Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

PubMed

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China.

PubMed

Zhao, Jian-Jun; Yan, Xi-Jun; Chai, Xiu-Li; Martella, Vito; Luo, Guo-Liang; Zhang, Hai-Ling; Gao, Han; Liu, Ying-Xue; Bai, Xue; Zhang, Lei; Chen, Tao; Xu, Lei; Zhao, Chun-Fei; Wang, Feng-Xue; Shao, Xi-Qun; Wu, Wei; Cheng, Shi-Peng

2010-01-06

Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. Genetic/antigenic heterogeneity has been observed among the various CDV strains, notably in the haemagglutinin (H) gene, that appears as a good target to gather epidemiological information. Based on sequence analysis of the H gene, wild-type CDV strains cluster into distinct geographic lineages (genotypes), irrespective of the species of isolation. The sequence of the H gene of 28 CDV strains detected from both vaccinated and non-vaccinated breeding foxes, raccoon dogs and minks from different geographical areas of China during the years 2004-2008 was determined. All the CDV strains but two (strains HL and HLJ2) were characterized as Asia-1 genotype and were highly similar to each other (96.2-99.7% at the amino acid [aa] level) and to other Asia-1 strains (96.1-99.5% aa) previously detected in China. The CDV strains HL and HLJ2 were both collected from foxes in Heilongjiang province in 2005. Strain HL resembled CDVs of the Arctic genotype (GR88-like) and displayed high aa identity (98.0%) to the Chinese canine strain Liu. By converse, strain HLJ2 was barely related to CDVs of the Asia-2 genotype (88.7-90.3% aa identity), and could represent a novel CDV genotype, tentatively proposed as Asia-3. These results suggest that at least three different CDV genotypes, distantly related (81.8-91.6% aa identity) to the vaccine strains, Onderstepoort-like (America-1 genotype), are currently circulating in breeding foxes, raccoon dogs and minks in China, and that the genotype Asia-1 is predominant. Whether the diversity between wild-type CDVs and the vaccine strains may affect, to some extent, the efficacy of the vaccines deserves further investigations.

Comparative Genomic Analysis of Phylogenetically Closely Related Hydrogenobaculum sp. Isolates from Yellowstone National Park

PubMed Central

Romano, Christine; D'Imperio, Seth; Woyke, Tanja; Mavromatis, Konstantinos; Lasken, Roger; Shock, Everett L.

2013-01-01

We describe the complete genome sequences of four closely related Hydrogenobaculum sp. isolates (≥99.7% 16S rRNA gene identity) that were isolated from the outflow channel of Dragon Spring (DS), Norris Geyser Basin, in Yellowstone National Park (YNP), WY. The genomes range in size from 1,552,607 to 1,552,931 bp, contain 1,667 to 1,676 predicted genes, and are highly syntenic. There are subtle differences among the DS isolates, which as a group are different from Hydrogenobaculum sp. strain Y04AAS1 that was previously isolated from a geographically distinct YNP geothermal feature. Genes unique to the DS genomes encode arsenite [As(III)] oxidation, NADH-ubiquinone-plastoquinone (complex I), NADH-ubiquinone oxidoreductase chain, a DNA photolyase, and elements of a type II secretion system. Functions unique to strain Y04AAS1 include thiosulfate metabolism, nitrate respiration, and mercury resistance determinants. DS genomes contain seven CRISPR loci that are almost identical but are different from the single CRISPR locus in strain Y04AAS1. Other differences between the DS and Y04AAS1 genomes include average nucleotide identity (94.764%) and percentage conserved DNA (80.552%). Approximately half of the genes unique to Y04AAS1 are predicted to have been acquired via horizontal gene transfer. Fragment recruitment analysis and marker gene searches demonstrated that the DS metagenome was more similar to the DS genomes than to the Y04AAS1 genome, but that the DS community is likely comprised of a continuum of Hydrogenobaculum genotypes that span from the DS genomes described here to an Y04AAS1-like organism, which appears to represent a distinct ecotype relative to the DS genomes characterized. PMID:23435891

Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio).

PubMed

Kongchum, Pawapol; Hallerman, Eric M; Hulata, Gideon; David, Lior; Palti, Yniv

2011-01-01

Induction of innate immune pathways is critical for early host defense, but there is limited understanding of how teleost fishes recognize pathogen molecules and activate these pathways. In mammals, cells of the innate immune system detect pathogenic molecular structures using pattern recognition receptors (PRRs). TLR9 functions as a PRR that recognizes CpG motifs in bacterial and viral DNA and requires adaptor molecules MyD88 and TRAF6 for signal transduction. Here we report full-length cDNA isolation, structural characterization and tissue mRNA expression analysis of the common carp (cc) TLR9, MyD88 and TRAF6 gene orthologs. The ccTLR9 open-reading frame (ORF) is predicted to encode a 1064-amino acid (aa) protein. We found that MyD88 and TRAF6 genes are duplicated in common carp. This is the first report of TRAF6 duplication in a vertebrate genome and stronger evidence in support of MyD88 duplication is provided. The ccMyD88a and b ORFs are predicted to encode 288-aa and 284-aa peptides, respectively. They share 91% aa sequence identity between paralogs. The ccTRAF6a and b ORFs are both predicted to encode 543-aa peptides sharing 95% aa sequence identity between paralogs. The ccTLR9 gene is contained in a single large exon. The ccMyD88a and ccMyD88b coding sequences span five exons. The TRAF6b gene spans six exons. PCR amplification to obtain the entire coding sequence of ccTRAF6a gene was not successful. The 2104-bp fragment amplified covers the 3' end of the gene and it contains a partial sequence of one exon and three complete exons. The predicated protein domains of the ccTLR9, ccMyD88 and ccTRAF6 are conserved and resemble orthologs from other vertebrates. Real-time quantitative PCR assays of the ccTLR9, MyD88a and b, and TRAF6a and b gene transcripts in healthy common carp indicated that mRNA expression varied between tissues. Differential expression of duplicate copies were found for ccMyD88 and ccTRAF6 in white and red muscle tissues, suggesting that paralogs may have evolved and attained a new function. The genomic information we describe in this paper provides evidence of sequence and structural conservation of immune response genes in common carp. Published by Elsevier Ltd.

Cloning and expression of chitinases of Entamoebae.

PubMed

de la Vega, H; Specht, C A; Semino, C E; Robbins, P W; Eichinger, D; Caplivski, D; Ghosh, S; Samuelson, J

1997-04-01

Entamoeba histolytica (Eh) and Entamoeba dispar (Ed) are protozoan parasites that infect hundreds of millions of persons. In the colonic lumen, amebae form chitin-walled cysts, the infectious stage of the parasite. Entamoeba invadens (Ei), which infects reptiles and is a model for amebic encystation, produces chitin synthase and chitinase during encystation. Ei cysts formation is blocked by the chitinase-inhibitor allosamidin. Here molecular cloning techniques were used to identify homologous genes of Eh, Ed, and Ei that encode chitinases (EC 3.2.1.14). The Eh gene (Eh cht1) predicts a 507-amino acid (aa) enzyme, which has 93 and 74% positional identities with Ed and Ei chitinases, respectively. The Entamoeba chitinases have signal sequences, followed by acidic and hydrophilic sequences composed of multiple tandemly arranged 7-aa repeats (Eh and Ed) or repeats varying in length (Ei). The aa compositions of the chitinase repeats are similar to those of the repeats of the Eh and Ed Ser-rich proteins. The COOH-terminus of each chitinase has a catalytic domain, which resembles those of Brugia malayi (33% positional identity) and Manduca sexta (29%). Recombinant entamoeba chitinases are precipitated by chitin and show chitinase activity with chitooligosacharide substrates. Consistent with previous biochemical data, chitinase mRNAs are absent in Ei trophozoites and accumulate to maximal levels in Ei encysting for 48 h.

Molecular analyses of the agouti allele in the Japanese house mouse identify a novel variant of the agouti gene.

PubMed

Iwasa, Masahiro A; Kawamura, Sayaka; Myoshu, Hikari; Suzuki, Taichi A

2018-03-01

It has been thought that the Japanese house mouse carries the A w allele at the agouti locus causing light-colored bellies, but they do not always show this coloration. Thus, the presence of the A w allele seems to be doubtful in them. To ascertain whether the A w allele is present, a two-pronged approach was used. First, we compared lengths of DNA fragments obtained from three PCRs conducted on them to the known fragment sizes generated from mouse strains exhibiting homozygosities of either a/a, A/A, or A w /A w . PCR I, PCR II, and PCR III amplify only in the A and A w alleles, the a and A w alleles, and the a allele, respectively, and we detected amplifications in strains with A/A and A w /A w by PCR I, in those with a/a and the Japanese house mouse by PCR II, and in those with a/a by PCR III. Second, we sequenced the exon 1A region of the agouti gene and obtained sequences corresponding to the above strains and the Japanese house mouse, but their sequences were similar to those of the a allele. We concluded that their agouti allele is not identical to the A w allele and seems to be a novel type similar to the a allele.

Two missense mutations in melanocortin 1 receptor (MC1R) are strongly associated with dark ventral coat color in reindeer (Rangifer tarandus).

PubMed

Våge, D I; Nieminen, M; Anderson, D G; Røed, K H

2014-10-01

The protein-coding region of melanocortin 1 receptor (MC1R) was sequenced to identify potential variation affecting coat color in reindeer (Rangifer tarandus). A T→C sequence variation at nucleotide position 218 (c.218T>C) causing an amino acid (aa) change from methionine to threonine at aa position 73 (p.Met73Thr) was identified. In addition, a T→G sequence variation was found at nucleotide position 839 (c.839T>G), causing phenylalanine to be exchanged by cysteine at aa position 280 (p.Phe280Cys). The two sequence variants (c.218C and c.839G) were found to be closely associated with a darker belly coat compared with animals not having any of these two variants. The aa acid change p.Met73Thr affects the same position as p.Met73Lys previously reported to give constitutive activation of MC1R in black sheep (Ovis aries), whereas p.Phe280Cys is identical to one of two variants previously reported to be associated with dark coat color in Arctic fox (Alopex lagopus), supporting that the two variants found in reindeer are functional. The complete absence of Thr73 and Cys280 among the 51 wild reindeer analyzed provides some evidence that these variants are more common in the domestic herds. © 2014 Stichting International Foundation for Animal Genetics.

Highly Efficient Synthesis of Fructooligosaccharides by Extracellular Fructooligosaccharide-Producing Enzymes and Immobilized Cells of Aspergillus aculeatus M105 and Purification and Biochemical Characterization of a Fructosyltransferase from the Fungus.

PubMed

Huang, Mei-Ping; Wu, Min; Xu, Qiang-Sheng; Mo, De-Jiao; Feng, Jia-Xun

2016-08-24

In this work, Aspergillus aculeatus M105 was obtained to produce high extracellular fructooligosaccharide-producing enzyme activity. The maximum yields of fructooligosaccharides produced by its extracellular enzymes and immobilized cells were 67.54 and 65.47% (w/w), respectively. A fructosyltransferase (FTase), AaFT32A, was purified from M105. The optimal pH and temperature of AaFT32A were pH 5.0-6.0 and 65 °C, respectively. The Km, Vmax, and kcat values for the transfructosylating activity of AaFT32A were 2267 mM, 1347 μmol/min/mg protein, and 1550.2 s(-1), respectively, and those values for the hydrolytic activity of AaFT32A were 6.10 mM, 32.44 μmol/min/mg protein, and 37.3 s(-1), respectively. The sequence of AaFT32A deduced from the cloned gene shared 99.4% identity with a FTase from Aspergillus japonicus CB05 and a fructofuranosidase from Aspergillus niger and 96.5% identity with a FTase (Aspacl_37092) from A. aculeatus ATCC 16872. The fungal strain and its FTase may have potential applications in the prebiotics industry.

Echinococcus P29 antigen: molecular characterization and implication on post-surgery follow-up of CE patients infected with different species of the Echinococcus granulosus complex.

PubMed

Boubaker, Ghalia; Gottstein, Bruno; Hemphill, Andrew; Babba, Hamouda; Spiliotis, Markus

2014-01-01

The protein P29 is a potential serological marker for post-treatment monitoring of cystic echinococcosis (CE) especially in young patients. We now have demonstrated that P29 is encoded in the Echinococcus genus by a single gene consisting of 7 exons spanning 1.2 kb of DNA. Variability of the p29 gene at inter- and intra-species level was assessed with 50 cDNA and 280 genomic DNA clones isolated from different E. granulosus s.l. isolates (E. granulosus sensu stricto (G1), E. equinus (G4), E. ortleppi (G5), E. canadensis (G6), E. canadensis (G7) and E. canadensis (G10)) as well as four E. multilocularis isolates. Scarce interspecies polymorphism at the p29 locus was observed and affected predominantly E. granulosus s.s. (G1), where we identified two alleles (A1 and A2) coding for identical P29 proteins and yielding in three genotypes (A1/A1, A2/A2 and A1/A2). Genotypic frequencies expected under Hardy-Weinberg equilibrium revealed a high rate of heterozygosity (47%) that strongly supports the hypothesis that E. granulosus s.s. (G1) is predominantly outbreeding. Comparative sequence analyses of the complete p29 gene showed that phylogenetic relationships within the genus Echinococcus were in agreement with those of previous nuclear gene studies. At the protein level, the deduced P29 amino acid (AA) sequences exhibited a high level of conservation, ranging from 97.9% AA sequence identity among the whole E. granulosus s.l. group to 99.58% identity among E. multilocularis isolates. We showed that P29 proteins of these two species differ by three AA substitutions without implication for antigenicity. In Western-blot analyses, serum antibodies from a human CE patient infected with E. canadensis (G6) strongly reacted with recombinant P29 from E. granulosus s.s. (G1) (recEg(G1)P29). In the same line, human anti-Eg(G1)P29 antibodies bound to recEcnd(G6)P29. Thus, minor AA sequence variations appear not to impair the prognostic serological use of P29.

Echinococcus P29 Antigen: Molecular Characterization and Implication on Post-Surgery Follow-Up of CE Patients Infected with Different Species of the Echinococcus granulosus Complex

PubMed Central

Boubaker, Ghalia; Gottstein, Bruno; Hemphill, Andrew; Babba, Hamouda; Spiliotis, Markus

2014-01-01

The protein P29 is a potential serological marker for post-treatment monitoring of cystic echinococcosis (CE) especially in young patients. We now have demonstrated that P29 is encoded in the Echinococcus genus by a single gene consisting of 7 exons spanning 1.2 kb of DNA. Variability of the p29 gene at inter- and intra-species level was assessed with 50 cDNA and 280 genomic DNA clones isolated from different E. granulosus s.l. isolates (E. granulosus sensu stricto (G1), E. equinus (G4), E. ortleppi (G5), E. canadensis (G6), E. canadensis (G7) and E. canadensis (G10)) as well as four E. multilocularis isolates. Scarce interspecies polymorphism at the p29 locus was observed and affected predominantly E. granulosus s.s. (G1), where we identified two alleles (A1 and A2) coding for identical P29 proteins and yielding in three genotypes (A1/A1, A2/A2 and A1/A2). Genotypic frequencies expected under Hardy-Weinberg equilibrium revealed a high rate of heterozygosity (47%) that strongly supports the hypothesis that E. granulosus s.s. (G1) is predominantly outbreeding. Comparative sequence analyses of the complete p29 gene showed that phylogenetic relationships within the genus Echinococcus were in agreement with those of previous nuclear gene studies. At the protein level, the deduced P29 amino acid (AA) sequences exhibited a high level of conservation, ranging from 97.9% AA sequence identity among the whole E. granulosus s.l. group to 99.58% identity among E. multilocularis isolates. We showed that P29 proteins of these two species differ by three AA substitutions without implication for antigenicity. In Western-blot analyses, serum antibodies from a human CE patient infected with E. canadensis (G6) strongly reacted with recombinant P29 from E. granulosus s.s. (G1) (recEg(G1)P29). In the same line, human anti-Eg(G1)P29 antibodies bound to recEcnd(G6)P29. Thus, minor AA sequence variations appear not to impair the prognostic serological use of P29. PMID:24851904

Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

PubMed

Biedler, James K; Tu, Zhijian

2010-07-08

The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

Discovery of a novel Parvovirinae virus, porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs.

PubMed

Palinski, Rachel M; Mitra, Namita; Hause, Ben M

2016-08-01

Parvoviruses are a diverse group of viruses containing some of the smallest known species that are capable of infecting a wide range of animals. Metagenomic sequencing of pooled rectal swabs from adult pigs identified a 4103-bp contig consisting of two major open reading frames encoding proteins of 672 and 469 amino acids (aa) in length. BLASTP analysis of the 672-aa protein found 42.4 % identity to fruit bat (Eidolon helvum) parvovirus 2 (EhPV2) and 37.9 % to turkey parvovirus (TuPV) TP1-2012/HUN NS1 proteins. The 469-aa protein had no significant similarity to known proteins. Genetic and phylogenetic analyses suggest that PPV7, EhPV2, and TuPV represent a novel genus in the family Parvoviridae. Quantitative PCR screening of 182 porcine diagnostic samples found a total of 16 positives (8.6 %). Together, these data suggest that PPV7 is a highly divergent novel parvovirus prevalent within the US swine.

Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Darai, G

1993-10-01

The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

Dopamine receptor antagonists as new mode-of-action insecticide leads for control of Aedes and Culex mosquito vectors.

PubMed

Nuss, Andrew B; Ejendal, Karin F K; Doyle, Trevor B; Meyer, Jason M; Lang, Emma G; Watts, Val J; Hill, Catherine A

2015-03-01

New mode-of-action insecticides are sought to provide continued control of pesticide resistant arthropod vectors of neglected tropical diseases (NTDs). We previously identified antagonists of the AaDOP2 D1-like dopamine receptor (DAR) from the yellow fever mosquito, Aedes aegypti, with toxicity to Ae. aegypti larvae as leads for novel insecticides. To extend DAR-based insecticide discovery, we evaluated the molecular and pharmacological characteristics of an orthologous DAR target, CqDOP2, from Culex quinquefasciatus, the vector of lymphatic filariasis and West Nile virus. CqDOP2 has 94.7% amino acid identity to AaDOP2 and 28.3% identity to the human D1-like DAR, hD1. CqDOP2 and AaDOP2 exhibited similar pharmacological responses to biogenic amines and DAR antagonists in cell-based assays. The antagonists amitriptyline, amperozide, asenapine, chlorpromazine and doxepin were between 35 to 227-fold more selective at inhibiting the response of CqDOP2 and AaDOP2 in comparison to hD1. Antagonists were toxic to both C. quinquefasciatus and Ae. aegypti larvae, with LC50 values ranging from 41 to 208 μM 72 h post-exposure. Orthologous DOP2 receptors identified from the African malaria mosquito, Anopheles gambiae, the sand fly, Phlebotomus papatasi and the tsetse fly, Glossina morsitans, had high sequence similarity to CqDOP2 and AaDOP2. DAR antagonists represent a putative new insecticide class with activity against C. quinquefasciatus and Ae. aegypti, the two most important mosquito vectors of NTDs. There has been limited change in the sequence and pharmacological properties of the DOP2 DARs of these species since divergence of the tribes Culicini and Aedini. We identified antagonists selective for mosquito versus human DARs and observed a correlation between DAR pharmacology and the in vivo larval toxicity of antagonists. These data demonstrate that sequence similarity can be predictive of target potential. On this basis, we propose expanded insecticide discovery around orthologous DOP2 targets from additional dipteran vectors.

Genetic Characterization of H1N1 and H1N2 Influenza A Viruses Circulating in Ontario Pigs in 2012.

PubMed

Grgić, Helena; Costa, Marcio; Friendship, Robert M; Carman, Susy; Nagy, Éva; Poljak, Zvonimir

2015-01-01

The objective of this study was to characterize H1N1 and H1N2 influenza A virus isolates detected during outbreaks of respiratory disease in pig herds in Ontario (Canada) in 2012. Six influenza viruses were included in analysis using full genome sequencing based on the 454 platform. In five H1N1 isolates, all eight segments were genetically related to 2009 pandemic virus (A(H1N1)pdm09). One H1N2 isolate had hemagglutinin (HA), polymerase A (PA) and non-structural (NS) genes closely related to A(H1N1)pdm09, and neuraminidase (NA), matrix (M), polymerase B1 (PB1), polymerase B2 (PB2), and nucleoprotein (NP) genes originating from a triple-reassortant H3N2 virus (tr H3N2). The HA gene of five Ontario H1 isolates exhibited high identity of 99% with the human A(H1N1)pdm09 [A/Mexico/InDRE4487/09] from Mexico, while one Ontario H1N1 isolate had only 96.9% identity with this Mexican virus. Each of the five Ontario H1N1 viruses had between one and four amino acid (aa) changes within five antigenic sites, while one Ontario H1N2 virus had two aa changes within two antigenic sites. Such aa changes in antigenic sites could have an effect on antibody recognition and ultimately have implications for immunization practices. According to aa sequence analysis of the M2 protein, Ontario H1N1 and H1N2 viruses can be expected to offer resistance to adamantane derivatives, but not to neuraminidase inhibitors.

Genetic Characterization of H1N1 and H1N2 Influenza A Viruses Circulating in Ontario Pigs in 2012

PubMed Central

Grgić, Helena; Costa, Marcio; Friendship, Robert M.; Carman, Susy; Nagy, Éva; Poljak, Zvonimir

2015-01-01

The objective of this study was to characterize H1N1 and H1N2 influenza A virus isolates detected during outbreaks of respiratory disease in pig herds in Ontario (Canada) in 2012. Six influenza viruses were included in analysis using full genome sequencing based on the 454 platform. In five H1N1 isolates, all eight segments were genetically related to 2009 pandemic virus (A(H1N1)pdm09). One H1N2 isolate had hemagglutinin (HA), polymerase A (PA) and non-structural (NS) genes closely related to A(H1N1)pdm09, and neuraminidase (NA), matrix (M), polymerase B1 (PB1), polymerase B2 (PB2), and nucleoprotein (NP) genes originating from a triple-reassortant H3N2 virus (tr H3N2). The HA gene of five Ontario H1 isolates exhibited high identity of 99% with the human A(H1N1)pdm09 [A/Mexico/InDRE4487/09] from Mexico, while one Ontario H1N1 isolate had only 96.9% identity with this Mexican virus. Each of the five Ontario H1N1 viruses had between one and four amino acid (aa) changes within five antigenic sites, while one Ontario H1N2 virus had two aa changes within two antigenic sites. Such aa changes in antigenic sites could have an effect on antibody recognition and ultimately have implications for immunization practices. According to aa sequence analysis of the M2 protein, Ontario H1N1 and H1N2 viruses can be expected to offer resistance to adamantane derivatives, but not to neuraminidase inhibitors. PMID:26030614

Novel Haloperoxidase from the Agaric Basidiomycete Agrocybe aegerita Oxidizes Aryl Alcohols and Aldehydes

PubMed Central

Ullrich, René; Nüske, Jörg; Scheibner, Katrin; Spantzel, Jörg; Hofrichter, Martin

2004-01-01

Agrocybe aegerita, a bark mulch- and wood-colonizing basidiomycete, was found to produce a peroxidase (AaP) that oxidizes aryl alcohols, such as veratryl and benzyl alcohols, into the corresponding aldehydes and then into benzoic acids. The enzyme also catalyzed the oxidation of typical peroxidase substrates, such as 2,6-dimethoxyphenol (DMP) or 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS). A. aegerita peroxidase production depended on the concentration of organic nitrogen in the medium, and highest enzyme levels were detected in the presence of soybean meal. Two fractions of the enzyme, AaP I and AaP II, which had identical molecular masses (46 kDa) and isoelectric points of 4.6 to 5.4 and 4.9 to 5.6, respectively (corresponding to six different isoforms), were identified after several steps of purification, including anion- and cation-exchange chromatography. The optimum pH for the oxidation of aryl alcohols was found to be around 7, and the enzyme required relatively high concentrations of H2O2 (2 mM) for optimum activity. The apparent Km values for ABTS, DMP, benzyl alcohol, veratryl alcohol, and H2O2 were 37, 298, 1,001, 2,367 and 1,313 μM, respectively. The N-terminal amino acid sequences of the main AaP II spots blotted after two-dimensional gel electrophoresis were almost identical and exhibited almost no homology to the sequences of other peroxidases from basidiomycetes, but they shared the first three amino acids, as well as two additional amino acids, with the heme chloroperoxidase (CPO) from the ascomycete Caldariomyces fumago. This finding is consistent with the fact that AaP halogenates monochlorodimedone, the specific substrate of CPO. The existence of haloperoxidases in basidiomycetous fungi may be of general significance for the natural formation of chlorinated organic compounds in forest soils. PMID:15294788

Genetic Characterization of the Tick-Borne Orbiviruses

PubMed Central

Belaganahalli, Manjunatha N.; Maan, Sushila; Maan, Narender S.; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P. C.

2015-01-01

The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in ‘conserved’ Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome. PMID:25928203

Genetic characterization of the tick-borne orbiviruses.

PubMed

Belaganahalli, Manjunatha N; Maan, Sushila; Maan, Narender S; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P C

2015-04-28

The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in 'conserved' Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome.

Isolation and functional characterization of an ammonium transporter gene, PyAMT1, related to nitrogen assimilation in the marine macroalga Pyropia yezoensis (Rhodophyta).

PubMed

Kakinuma, Makoto; Nakamoto, Chika; Kishi, Kazuki; Coury, Daniel A; Amano, Hideomi

2017-07-01

Ammonium and nitrate are the primary nitrogen sources in natural environments, and are essential for growth and development in photosynthetic eukaryotes. In this study, we report on the isolation and characterization of an ammonium transporter gene (PyAMT1) which performs a key function in nitrogen (N) metabolism of Pyropia yezoensis thalli. The predicted length of PyAMT1 was 483 amino acids (AAs). The AA sequence included 11 putative transmembrane domains and showed approximately 33-44% identity to algal and plant AMT1 AA sequences. Functional complementation in an AMT-defective yeast mutant indicated that PyAMT1 mediated ammonium transport across the plasma membrane. Expression analysis showed that the PyAMT1 mRNA level was strongly induced by N-deficiency, and was more highly suppressed by resupply of inorganic-N than organic-N. These results suggest that PyAMT1 plays important roles in the ammonium transport system, and is highly regulated in response to external/internal N-status. Copyright © 2016 Elsevier Ltd. All rights reserved.

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

Short communication: Conservation of Streptococcus uberis adhesion molecule and the sua gene in strains of Streptococcus uberis isolated from geographically diverse areas.

PubMed

Yuan, Ying; Dego, Oudessa Kerro; Chen, Xueyan; Abadin, Eurife; Chan, Shangfeng; Jory, Lauren; Kovacevic, Steven; Almeida, Raul A; Oliver, Stephen P

2014-12-01

The objective was to identify and sequence the sua gene (GenBank no. DQ232760; http://www.ncbi.nlm.nih.gov/genbank/) and detect Streptococcus uberis adhesion molecule (SUAM) expression by Western blot using serum from naturally S. uberis-infected cows in strains of S. uberis isolated in milk from cows with mastitis from geographically diverse areas of the world. All strains evaluated yielded a 4.4-kb sua-containing PCR fragment that was subsequently sequenced. Deduced SUAM AA sequences from those S. uberis strains evaluated shared >97% identity. The pepSUAM sequence located at the N terminus of SUAM was >99% identical among strains of S. uberis. Streptococcus uberis adhesion molecule expression was detected in all strains of S. uberis tested. These results suggest that sua is ubiquitous among strains of S. uberis isolated from diverse geographic locations and that SUAM is immunogenic. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Genetic characterization of Betacoronavirus lineage C viruses in bats reveals marked sequence divergence in the spike protein of pipistrellus bat coronavirus HKU5 in Japanese pipistrelle: implications for the origin of the novel Middle East respiratory syndrome coronavirus.

PubMed

Lau, Susanna K P; Li, Kenneth S M; Tsang, Alan K L; Lam, Carol S F; Ahmed, Shakeel; Chen, Honglin; Chan, Kwok-Hung; Woo, Patrick C Y; Yuen, Kwok-Yung

2013-08-01

While the novel Middle East respiratory syndrome coronavirus (MERS-CoV) is closely related to Tylonycteris bat CoV HKU4 (Ty-BatCoV HKU4) and Pipistrellus bat CoV HKU5 (Pi-BatCoV HKU5) in bats from Hong Kong, and other potential lineage C betacoronaviruses in bats from Africa, Europe, and America, its animal origin remains obscure. To better understand the role of bats in its origin, we examined the molecular epidemiology and evolution of lineage C betacoronaviruses among bats. Ty-BatCoV HKU4 and Pi-BatCoV HKU5 were detected in 29% and 25% of alimentary samples from lesser bamboo bat (Tylonycteris pachypus) and Japanese pipistrelle (Pipistrellus abramus), respectively. Sequencing of their RNA polymerase (RdRp), spike (S), and nucleocapsid (N) genes revealed that MERS-CoV is more closely related to Pi-BatCoV HKU5 in RdRp (92.1% to 92.3% amino acid [aa] identity) but is more closely related to Ty-BatCoV HKU4 in S (66.8% to 67.4% aa identity) and N (71.9% to 72.3% aa identity). Although both viruses were under purifying selection, the S of Pi-BatCoV HKU5 displayed marked sequence polymorphisms and more positively selected sites than that of Ty-BatCoV HKU4, suggesting that Pi-BatCoV HKU5 may generate variants to occupy new ecological niches along with its host in diverse habitats. Molecular clock analysis showed that they diverged from a common ancestor with MERS-CoV at least several centuries ago. Although MERS-CoV may have diverged from potential lineage C betacoronaviruses in European bats more recently, these bat viruses were unlikely to be the direct ancestor of MERS-CoV. Intensive surveillance for lineage C betaCoVs in Pipistrellus and related bats with diverse habitats and other animals in the Middle East may fill the evolutionary gap.

Genetic Characterization of Betacoronavirus Lineage C Viruses in Bats Reveals Marked Sequence Divergence in the Spike Protein of Pipistrellus Bat Coronavirus HKU5 in Japanese Pipistrelle: Implications for the Origin of the Novel Middle East Respiratory Syndrome Coronavirus

PubMed Central

Lau, Susanna K. P.; Li, Kenneth S. M.; Tsang, Alan K. L.; Lam, Carol S. F.; Ahmed, Shakeel; Chen, Honglin; Chan, Kwok-Hung

2013-01-01

While the novel Middle East respiratory syndrome coronavirus (MERS-CoV) is closely related to Tylonycteris bat CoV HKU4 (Ty-BatCoV HKU4) and Pipistrellus bat CoV HKU5 (Pi-BatCoV HKU5) in bats from Hong Kong, and other potential lineage C betacoronaviruses in bats from Africa, Europe, and America, its animal origin remains obscure. To better understand the role of bats in its origin, we examined the molecular epidemiology and evolution of lineage C betacoronaviruses among bats. Ty-BatCoV HKU4 and Pi-BatCoV HKU5 were detected in 29% and 25% of alimentary samples from lesser bamboo bat (Tylonycteris pachypus) and Japanese pipistrelle (Pipistrellus abramus), respectively. Sequencing of their RNA polymerase (RdRp), spike (S), and nucleocapsid (N) genes revealed that MERS-CoV is more closely related to Pi-BatCoV HKU5 in RdRp (92.1% to 92.3% amino acid [aa] identity) but is more closely related to Ty-BatCoV HKU4 in S (66.8% to 67.4% aa identity) and N (71.9% to 72.3% aa identity). Although both viruses were under purifying selection, the S of Pi-BatCoV HKU5 displayed marked sequence polymorphisms and more positively selected sites than that of Ty-BatCoV HKU4, suggesting that Pi-BatCoV HKU5 may generate variants to occupy new ecological niches along with its host in diverse habitats. Molecular clock analysis showed that they diverged from a common ancestor with MERS-CoV at least several centuries ago. Although MERS-CoV may have diverged from potential lineage C betacoronaviruses in European bats more recently, these bat viruses were unlikely to be the direct ancestor of MERS-CoV. Intensive surveillance for lineage C betaCoVs in Pipistrellus and related bats with diverse habitats and other animals in the Middle East may fill the evolutionary gap. PMID:23720729

Bifunctional CYP81AA proteins catalyse identical hydroxylations but alternative regioselective phenol couplings in plant xanthone biosynthesis

PubMed Central

El-Awaad, Islam; Bocola, Marco; Beuerle, Till; Liu, Benye; Beerhues, Ludger

2016-01-01

Xanthones are natural products present in plants and microorganisms. In plants, their biosynthesis starts with regioselective cyclization of 2,3′,4,6-tetrahydroxybenzophenone to either 1,3,5- or 1,3,7-trihydroxyxanthones, catalysed by cytochrome P450 (CYP) enzymes. Here we isolate and express CYP81AA-coding sequences from Hypericum calycinum and H. perforatum in yeast. Microsomes catalyse two consecutive reactions, that is, 3′-hydroxylation of 2,4,6-trihydroxybenzophenone and C–O phenol coupling of the resulting 2,3′,4,6-tetrahydroxybenzophenone. Relative to the inserted 3′-hydroxyl, the orthologues Hc/HpCYP81AA1 cyclize via the para position to form 1,3,7-trihydroxyxanthone, whereas the paralogue HpCYP81AA2 directs cyclization to the ortho position, yielding the isomeric 1,3,5-trihydroxyxanthone. Homology modelling and reciprocal mutagenesis reveal the impact of S375, L378 and A483 on controlling the regioselectivity of HpCYP81AA2, which is converted into HpCYP81AA1 by sextuple mutation. However, the reciprocal mutations in HpCYP81AA1 barely affect its regiospecificity. Product docking rationalizes the alternative C–O phenol coupling reactions. Our results help understand the machinery of bifunctional CYPs. PMID:27145837

Bifunctional CYP81AA proteins catalyse identical hydroxylations but alternative regioselective phenol couplings in plant xanthone biosynthesis.

PubMed

El-Awaad, Islam; Bocola, Marco; Beuerle, Till; Liu, Benye; Beerhues, Ludger

2016-05-05

Xanthones are natural products present in plants and microorganisms. In plants, their biosynthesis starts with regioselective cyclization of 2,3',4,6-tetrahydroxybenzophenone to either 1,3,5- or 1,3,7-trihydroxyxanthones, catalysed by cytochrome P450 (CYP) enzymes. Here we isolate and express CYP81AA-coding sequences from Hypericum calycinum and H. perforatum in yeast. Microsomes catalyse two consecutive reactions, that is, 3'-hydroxylation of 2,4,6-trihydroxybenzophenone and C-O phenol coupling of the resulting 2,3',4,6-tetrahydroxybenzophenone. Relative to the inserted 3'-hydroxyl, the orthologues Hc/HpCYP81AA1 cyclize via the para position to form 1,3,7-trihydroxyxanthone, whereas the paralogue HpCYP81AA2 directs cyclization to the ortho position, yielding the isomeric 1,3,5-trihydroxyxanthone. Homology modelling and reciprocal mutagenesis reveal the impact of S375, L378 and A483 on controlling the regioselectivity of HpCYP81AA2, which is converted into HpCYP81AA1 by sextuple mutation. However, the reciprocal mutations in HpCYP81AA1 barely affect its regiospecificity. Product docking rationalizes the alternative C-O phenol coupling reactions. Our results help understand the machinery of bifunctional CYPs.

Cell Surface Expression of Biologically Active Influenza C Virus HEF Glycoprotein Expressed from cDNA

PubMed Central

Pekosz, Andrew; Lamb, Robert A.

1999-01-01

The hemagglutinin, esterase, and fusion (HEF) glycoprotein of influenza C virus possesses receptor binding, receptor destroying, and membrane fusion activities. The HEF cDNAs from influenza C/Ann Arbor/1/50 (HEF-AA) and influenza C/Taylor/1223/47 (HEF-Tay) viruses were cloned and expressed, and transport of HEF to the cell surface was monitored by susceptibility to cleavage by exogenous trypsin, indirect immunofluorescence microscopy, and flow cytometry. Previously it has been found in studies with the C/Johannesburg/1/66 strain of influenza C virus (HEF-JHB) that transport of HEF to the cell surface is severely inhibited, and it is thought that the short cytoplasmic tail, Arg-Thr-Lys, is involved in blocking HEF cell surface expression (F. Oeffner, H.-D. Klenk, and G. Herrler, J. Gen. Virol. 80:363–369, 1999). As the cytoplasmic tail amino acid sequences of HEF-AA and HEF-Tay are identical to that of HEF-JHB, the data indicate that cell surface expression of HEF-AA and HEF-Tay is not inhibited by this amino acid sequence. Furthermore, the abundant cell surface transport of HEF-AA and HEF-Tay indicates that their cell surface expression does not require coexpression of another viral protein. The HEF-AA and HEF-Tay HEF glycoproteins bound human erythrocytes, promoted membrane fusion in a low-pH and trypsin-dependent manner, and displayed esterase activity, indicating that the HEF glycoprotein alone mediates all three known functions at the cell surface. PMID:10482635

Unique Strain of Rickettsia parkeri Associated with the Hard Tick Dermacentor parumapertus Neumann in the Western United States

PubMed Central

Allerdice, Michelle E. J.; Karpathy, Sandor E.; Nicholson, William L.; Levin, Michael L.; Smith, Travis C.; Becker, Tom; Delph, Robert J.; Knight, Robert N.; Ritter, Jana M.; Sanders, Jeanine H.; Goddard, Jerome

2017-01-01

ABSTRACT In 1953, investigators at the Rocky Mountain Laboratories in Hamilton, MT, described the isolation of a spotted fever group Rickettsia (SFGR) species from Dermacentor parumapertus ticks collected from black-tailed jackrabbits (Lepus californicus) in northern Nevada. Several decades later, investigators characterized this SFGR (designated the parumapertus agent) by using mouse serotyping methods and determined that it represented a distinct rickettsial serotype closely related to Rickettsia parkeri; nonetheless, the parumapertus agent was not further characterized or studied. To our knowledge, no isolates of the parumapertus agent remain in any rickettsial culture collection, which precludes contemporary phylogenetic placement of this enigmatic SFGR. To rediscover the parumapertus agent, adult-stage D. parumapertus ticks were collected from black-tailed jackrabbits shot or encountered as roadkills in Arizona, Utah, or Texas from 2011 to 2016. A total of 339 ticks were collected and evaluated for infection with Rickettsia species. Of 112 D. parumapertus ticks collected in south Texas, 16 (14.3%) contained partial ompA sequences with the closest identity (99.6%) to Rickettsia sp. strain Atlantic rainforest Aa46, an SFGR that is closely related or identical to an SFGR species that causes a mild rickettsiosis in several states of Brazil. A pure isolate, designated strain Black Gap, was cultivated in Vero E6 cells, and sequence analysis of the rrs, gltA, sca0, sca5, and sca4 genes also revealed the closest genetic identity to Rickettsia sp. Atlantic rainforest Aa46. Phylogenetic analysis of the five concatenated rickettsial genes place Rickettsia sp. strain Black Gap and Rickettsia sp. Atlantic rainforest Aa46 with R. parkeri in a distinct and well-supported clade. IMPORTANCE We suggest that Rickettsia sp. Black Gap and Rickettsia sp. Atlantic rainforest Aa46 represent nearly identical strains of R. parkeri and that Rickettsia sp. Black Gap or a very similar strain of R. parkeri represents the parumapertus agent. The close genetic relatedness among these taxa, as well as the response of guinea pigs infected with the Black Gap strain, suggests that R. parkeri Black Gap could cause disease in humans. The identification of this organism could also account, at least in part, for the remarkable differences in severity ascribed to Rocky Mountain spotted fever (RMSF) among various regions of the American West during the early 20th century. We suggest that the wide variation in case fatality rates attributed to RMSF could have occurred by the inadvertent inclusion of cases of milder disease caused by R. parkeri Black Gap. PMID:28213544

Unique Strain of Rickettsia parkeri Associated with the Hard Tick Dermacentor parumapertus Neumann in the Western United States.

PubMed

Paddock, Christopher D; Allerdice, Michelle E J; Karpathy, Sandor E; Nicholson, William L; Levin, Michael L; Smith, Travis C; Becker, Tom; Delph, Robert J; Knight, Robert N; Ritter, Jana M; Sanders, Jeanine H; Goddard, Jerome

2017-05-01

In 1953, investigators at the Rocky Mountain Laboratories in Hamilton, MT, described the isolation of a spotted fever group Rickettsia (SFGR) species from Dermacentor parumapertus ticks collected from black-tailed jackrabbits ( Lepus californicus ) in northern Nevada. Several decades later, investigators characterized this SFGR (designated the parumapertus agent) by using mouse serotyping methods and determined that it represented a distinct rickettsial serotype closely related to Rickettsia parkeri ; nonetheless, the parumapertus agent was not further characterized or studied. To our knowledge, no isolates of the parumapertus agent remain in any rickettsial culture collection, which precludes contemporary phylogenetic placement of this enigmatic SFGR. To rediscover the parumapertus agent, adult-stage D. parumapertus ticks were collected from black-tailed jackrabbits shot or encountered as roadkills in Arizona, Utah, or Texas from 2011 to 2016. A total of 339 ticks were collected and evaluated for infection with Rickettsia species. Of 112 D. parumapertus ticks collected in south Texas, 16 (14.3%) contained partial ompA sequences with the closest identity (99.6%) to Rickettsia sp. strain Atlantic rainforest Aa46, an SFGR that is closely related or identical to an SFGR species that causes a mild rickettsiosis in several states of Brazil. A pure isolate, designated strain Black Gap, was cultivated in Vero E6 cells, and sequence analysis of the rrs , gltA , sca0 , sca5 , and sca4 genes also revealed the closest genetic identity to Rickettsia sp. Atlantic rainforest Aa46. Phylogenetic analysis of the five concatenated rickettsial genes place Rickettsia sp. strain Black Gap and Rickettsia sp. Atlantic rainforest Aa46 with R. parkeri in a distinct and well-supported clade. IMPORTANCE We suggest that Rickettsia sp. Black Gap and Rickettsia sp. Atlantic rainforest Aa46 represent nearly identical strains of R. parkeri and that Rickettsia sp. Black Gap or a very similar strain of R. parkeri represents the parumapertus agent. The close genetic relatedness among these taxa, as well as the response of guinea pigs infected with the Black Gap strain, suggests that R. parkeri Black Gap could cause disease in humans. The identification of this organism could also account, at least in part, for the remarkable differences in severity ascribed to Rocky Mountain spotted fever (RMSF) among various regions of the American West during the early 20th century. We suggest that the wide variation in case fatality rates attributed to RMSF could have occurred by the inadvertent inclusion of cases of milder disease caused by R. parkeri Black Gap. Copyright © 2017 American Society for Microbiology.

Primary structure and cellular localization of chicken brain myosin-V (p190), an unconventional myosin with calmodulin light chains

PubMed Central

1992-01-01

Recent biochemical studies of p190, a calmodulin (CM)-binding protein purified from vertebrate brain, have demonstrated that this protein, purified as a complex with bound CM, shares a number of properties with myosins (Espindola, F. S., E. M. Espreafico, M. V. Coelho, A. R. Martins, F. R. C. Costa, M. S. Mooseker, and R. E. Larson. 1992. J. Cell Biol. 118:359-368). To determine whether or not p190 was a member of the myosin family of proteins, a set of overlapping cDNAs encoding the full-length protein sequence of chicken brain p190 was isolated and sequenced. Verification that the deduced primary structure was that of p190 was demonstrated through microsequence analysis of a cyanogen bromide peptide generated from chick brain p190. The deduced primary structure of chicken brain p190 revealed that this 1,830-amino acid (aa) 212,509-D) protein is a member of a novel structural class of unconventional myosins that includes the gene products encoded by the dilute locus of mouse and the MYO2 gene of Saccharomyces cerevisiae. We have named the p190-CM complex "myosin-V" based on the results of a detailed sequence comparison of the head domains of 29 myosin heavy chains (hc), which has revealed that this myosin, based on head structure, is the fifth of six distinct structural classes of myosin to be described thus far. Like the presumed products of the mouse dilute and yeast MYO2 genes, the head domain of chicken myosin-V hc (aa 1-764) is linked to a "neck" domain (aa 765-909) consisting of six tandem repeats of an approximately 23-aa "IQ-motif." All known myosins contain at least one such motif at their head-tail junctions; these IQ-motifs may function as calmodulin or light chain binding sites. The tail domain of chicken myosin-V consists of an initial 511 aa predicted to form several segments of coiled-coil alpha helix followed by a terminal 410-aa globular domain (aa, 1,421-1,830). Interestingly, a portion of the tail domain (aa, 1,094-1,830) shares 58% amino acid sequence identity with a 723-aa protein from mouse brain reported to be a glutamic acid decarboxylase. The neck region of chicken myosin-V, which contains the IQ-motifs, was demonstrated to contain the binding sites for CM by analyzing CM binding to bacterially expressed fusion proteins containing the head, neck, and tail domains. Immunolocalization of myosin-V in brain and in cultured cells revealed an unusual distribution for this myosin in both neurons and nonneuronal cells.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:1469047

Homology-based Modeling of Rhodopsin-like Family Members in the Inactive State: Structural Analysis and Deduction of Tips for Modeling and Optimization.

PubMed

Pappalardo, Matteo; Rayan, Mahmoud; Abu-Lafi, Saleh; Leonardi, Martha E; Milardi, Danilo; Guccione, Salvatore; Rayan, Anwar

2017-08-01

Modeling G-Protein Coupled Receptors (GPCRs) is an emergent field of research, since utility of high-quality models in receptor structure-based strategies might facilitate the discovery of interesting drug candidates. The findings from a quantitative analysis of eighteen resolved structures of rhodopsin family "A" receptors crystallized with antagonists and 153 pairs of structures are described. A strategy termed endeca-amino acids fragmentation was used to analyze the structures models aiming to detect the relationship between sequence identity and Root Mean Square Deviation (RMSD) at each trans-membrane-domain. Moreover, we have applied the leave-one-out strategy to study the shiftiness likelihood of the helices. The type of correlation between sequence identity and RMSD was studied using the aforementioned set receptors as representatives of membrane proteins and 98 serine proteases with 4753 pairs of structures as representatives of globular proteins. Data analysis using fragmentation strategy revealed that there is some extent of correlation between sequence identity and global RMSD of 11AA width windows. However, spatial conservation is not always close to the endoplasmic side as was reported before. A comparative study with globular proteins shows that GPCRs have higher standard deviation and higher slope in the graph with correlation between sequence identity and RMSD. The extracted information disclosed in this paper could be incorporated in the modeling protocols while using technique for model optimization and refinement. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Molecular Characterization and Expression of a Phytase Gene from the Thermophilic Fungus Thermomyces lanuginosus

PubMed Central

Berka, Randy M.; Rey, Michael W.; Brown, Kimberly M.; Byun, Tony; Klotz, Alan V.

1998-01-01

The phyA gene encoding an extracellular phytase from the thermophilic fungus Thermomyces lanuginosus was cloned and heterologously expressed, and the recombinant gene product was biochemically characterized. The phyA gene encodes a primary translation product (PhyA) of 475 amino acids (aa) which includes a putative signal peptide (23 aa) and propeptide (10 aa). The deduced amino acid sequence of PhyA has limited sequence identity (ca. 47%) with Aspergillus niger phytase. The phyA gene was inserted into an expression vector under transcriptional control of the Fusarium oxysporum trypsin gene promoter and used to transform a Fusarium venenatum recipient strain. The secreted recombinant phytase protein was enzymatically active between pHs 3 and 7.5, with a specific activity of 110 μmol of inorganic phosphate released per min per mg of protein at pH 6 and 37°C. The Thermomyces phytase retained activity at assay temperatures up to 75°C and demonstrated superior catalytic efficiency to any known fungal phytase at 65°C (the temperature optimum). Comparison of this new Thermomyces catalyst with the well-known Aspergillus niger phytase reveals other favorable properties for the enzyme derived from the thermophilic gene donor, including catalytic activity over an expanded pH range. PMID:9797301

Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand.

PubMed

Temeeyasen, Gun; Srijangwad, Anchalee; Tripipat, Thitima; Tipsombatboon, Pavita; Piriyapongsa, Jittima; Phoolcharoen, Waranyoo; Chuanasa, Taksina; Tantituvanont, Angkana; Nilubol, Dachrit

2014-01-01

Porcine epidemic diarrhea virus (PEDV) has become endemic in the Thai swine industry, causing economic losses and repeated outbreaks since its first emergence in 2007. In the present study, 69 Thai PEDV isolates were obtained from 50 swine herds across Thailand during the period 2008-2012. Both partial and complete nucleotide sequences of the spike (S) glycoprotein and the nucleotide sequences of ORF3 genes were determined to investigate the genetic diversity and molecular epidemiology of Thai PEDV. Based on the analysis of the partial S glycoprotein genes, the Thai PEDV isolates were clustered into 2 groups related to Korean and Chinese field isolates. The results for the complete spike genes, however, demonstrated that both groups were grouped in the same cluster. Interestingly, both groups of Thai PEDV isolates had a 4-aa (GENQ) insertion between positions 55 and 56, a 1-aa insertion between positions 135 and 136, and a 2-aa deletion between positions 155 and 156, making them identical to the Korean KNU series and isolates responsible for outbreaks in China in recent years. In addition to the complete S sequences, the ORF3 gene analyses suggested that the isolates responsible for outbreaks in Thailand are not vaccine related. The results of this study suggest that the PEDV isolates responsible for outbreaks in Thailand since its emergence represent a variant of PEDV that was previously reported in China and Korea. Copyright © 2013 Elsevier B.V. All rights reserved.

Cloning of Russian sturgeon (Acipenser gueldenstaedtii) growth hormone and insulin-like growth factor I and their expression in male and female fish during the first period of growth.

PubMed

Yom Din, S; Hurvitz, A; Goldberg, D; Jackson, K; Levavi-Sivan, B; Degani, G

2008-03-01

In this study, the GH and IGF-I of the Russian sturgeon (rs), Acipenser gueldenstaedtii, were cloned and sequenced, and their mRNA gene expression determined. In addition, to improve our understanding of the GH function, the expression of this hormone was assessed in young males and females. Moreover, IGF-I expression was quantified in young males and compared to that in older ones. The nucleotide sequence of the rsGH cDNA was 980 bp long and had an open reading frame of 642 bp, beginning with the first ATG codon at position 39 and ending with the stop codon at position 683. A putative polyadenylation signal, AATAAA, was recognized 42 bp upstream of the poly (A) tail. The position of the signal- peptide cleavage site was predicted to be at position 111, yielding a signal peptide of 24 amino-acids (aa) and a mature peptide of 190 aa. When the rsGH aa sequence was compared with other species, the highest degree of identity was found to be with mammalians (66-70% identity), followed by anguilliformes and amphibia (61%) and other fish (39-47%). The level of rsGH mRNA was discovered to be similar in pituitaries of females and males of 5 age groups (1, 2, 3, 4, and 5- yr-old). In females and males, the levels did not change dramatically during the first 5 yr of growth. The partial nucleotide sequence of the rsIGF-I was 445 bp long and had an open reading frame of 396 bp, beginning with the ATG codon at position 50. The position of the signal-peptide cleavage site was predicted to be at position 187, yielding a signal peptide of 44 aa. The highest level of IGF-I mRNA expression was recorded in the kidney of adult sturgeons. The IGF-I mRNA expression levels in the intestine, pituitary gland, and liver were not significantly different. Low levels of expression were found in the brain, heart, and muscle. In most tissues, there was no significant difference between mRNA levels of one and 5-yr-old fish. In conclusion, based on the GH-sequence analysis, A. gueldenstaedtii is genetically distant from other teleosts. The expression of the GH mRNA was similar in males and females, and its level remained constant during the first 5 yr of growth. While the IGF-I mRNA expression differed amongst various tissues, the level in each tissue was similar in 1 and 5-yr-old fish.

Draft Genome Sequences of Two Bacillus thuringiensis Strains and Characterization of a Putative 41.9-kDa Insecticidal Toxin

PubMed Central

Palma, Leopoldo; Muñoz, Delia; Berry, Colin; Murillo, Jesús; Caballero, Primitivo

2014-01-01

In this work, we report the genome sequencing of two Bacillus thuringiensis strains using Illumina next-generation sequencing technology (NGS). Strain Hu4-2, toxic to many lepidopteran pest species and to some mosquitoes, encoded genes for two insecticidal crystal (Cry) proteins, cry1Ia and cry9Ea, and a vegetative insecticidal protein (Vip) gene, vip3Ca2. Strain Leapi01 contained genes coding for seven Cry proteins (cry1Aa, cry1Ca, cry1Da, cry2Ab, cry9Ea and two cry1Ia gene variants) and a vip3 gene (vip3Aa10). A putative novel insecticidal protein gene 1143 bp long was found in both strains, whose sequences exhibited 100% nucleotide identity. The predicted protein showed 57 and 100% pairwise identity to protein sequence 72 from a patented Bt strain (US8318900) and to a putative 41.9-kDa insecticidal toxin from Bacillus cereus, respectively. The 41.9-kDa protein, containing a C-terminal 6× HisTag fusion, was expressed in Escherichia coli and tested for the first time against four lepidopteran species (Mamestra brassicae, Ostrinia nubilalis, Spodoptera frugiperda and S. littoralis) and the green-peach aphid Myzus persicae at doses as high as 4.8 µg/cm2 and 1.5 mg/mL, respectively. At these protein concentrations, the recombinant 41.9-kDa protein caused no mortality or symptoms of impaired growth against any of the insects tested, suggesting that these species are outside the protein’s target range or that the protein may not, in fact, be toxic. While the use of the polymerase chain reaction has allowed a significant increase in the number of Bt insecticidal genes characterized to date, novel NGS technologies promise a much faster, cheaper and efficient screening of Bt pesticidal proteins. PMID:24784323

EBNA-2 of herpesvirus papio diverges significantly from the type A and type B EBNA-2 proteins of Epstein-Barr virus but retains an efficient transactivation domain with a conserved hydrophobic motif.

PubMed Central

Ling, P D; Ryon, J J; Hayward, S D

1993-01-01

EBNA-2 contributes to the establishment of Epstein-Barr virus (EBV) latency in B cells and to the resultant alterations in B-cell growth pattern by up-regulating expression from specific viral and cellular promoters. We have taken a comparative approach toward characterizing functional domains within EBNA-2. To this end, we have cloned and sequenced the EBNA-2 gene from the closely related baboon virus herpesvirus papio (HVP). All human EBV isolates have either a type A or type B EBNA-2 gene. However, the HVP EBNA-2 gene falls into neither the type A category nor the type B category, suggesting that the separation into these two subtypes may have been a recent evolutionary event. Comparison of the predicted amino acid sequences indicates 37% amino acid identity with EBV type A EBNA-2 and 35% amino acid identity with type B EBNA-2. To define the domains of EBNA-2 required for transcriptional activation, the DNA binding domain of the GAL4 protein was fused to overlapping segments of EBV EBNA-2. This approach identified a 40-amino-acid (40-aa) EBNA-2 activation domain located between aa 437 and 477. Transactivation ability was completely lost when the amino-terminal boundary of this domain was moved to aa 441, indicating that the motif at aa 437 to 440, Pro-Ile-Leu-Phe, contains residues critical for function. The aa 437 boundary identified in these experiments coincides precisely with a block of conserved sequences in HVP EBNA-2, and the comparable carboxy-terminal region of HVP EBNA-2 also functioned as a strong transcriptional activation domain when fused to the Gal4(1-147) protein. The EBV and HVP EBNA-2 activation domains share a mixed proline-rich, negatively charged character with a striking conservation of positionally equivalent hydrophobic residues. The importance of the individual amino acids making up the Pro-Ile-Leu-Phe motif was examined by mutagenesis. Any alteration of these residues was found to reduce transactivation efficiency, with changes at the Pro-437 and Phe-440 positions producing the most deleterious effects. Activation of the EBV latency C promoter by EBNA-2 was shown to be dependent on the presence of the carboxy-terminal activation domain. However, this requirement was generic, rather than specific, since the EBNA-2 activation domain could be replaced with those from the herpes simplex virus (HSV) VP16 protein or the EBV Rta protein. Potential karyophilic signals within EBNA-2 were examined by introducing oligonucleotides encoding positively charged amino acid groupings that might serve in this capacity into a cytoplasmic test protein, HSV delta IE175, and by examining the intracellular localization of the resulting proteins. This assay identified a strong nuclear localization signal between EBV amino acids (aa) 478 to 485, which was conserved in HVP, and a weaker noncanonical signal between EBV aa 341 to 355, which was not conserved in HVP. Images PMID:8388484

EBNA-2 of herpesvirus papio diverges significantly from the type A and type B EBNA-2 proteins of Epstein-Barr virus but retains an efficient transactivation domain with a conserved hydrophobic motif.

PubMed

Ling, P D; Ryon, J J; Hayward, S D

1993-06-01

EBNA-2 contributes to the establishment of Epstein-Barr virus (EBV) latency in B cells and to the resultant alterations in B-cell growth pattern by up-regulating expression from specific viral and cellular promoters. We have taken a comparative approach toward characterizing functional domains within EBNA-2. To this end, we have cloned and sequenced the EBNA-2 gene from the closely related baboon virus herpesvirus papio (HVP). All human EBV isolates have either a type A or type B EBNA-2 gene. However, the HVP EBNA-2 gene falls into neither the type A category nor the type B category, suggesting that the separation into these two subtypes may have been a recent evolutionary event. Comparison of the predicted amino acid sequences indicates 37% amino acid identity with EBV type A EBNA-2 and 35% amino acid identity with type B EBNA-2. To define the domains of EBNA-2 required for transcriptional activation, the DNA binding domain of the GAL4 protein was fused to overlapping segments of EBV EBNA-2. This approach identified a 40-amino-acid (40-aa) EBNA-2 activation domain located between aa 437 and 477. Transactivation ability was completely lost when the amino-terminal boundary of this domain was moved to aa 441, indicating that the motif at aa 437 to 440, Pro-Ile-Leu-Phe, contains residues critical for function. The aa 437 boundary identified in these experiments coincides precisely with a block of conserved sequences in HVP EBNA-2, and the comparable carboxy-terminal region of HVP EBNA-2 also functioned as a strong transcriptional activation domain when fused to the Gal4(1-147) protein. The EBV and HVP EBNA-2 activation domains share a mixed proline-rich, negatively charged character with a striking conservation of positionally equivalent hydrophobic residues. The importance of the individual amino acids making up the Pro-Ile-Leu-Phe motif was examined by mutagenesis. Any alteration of these residues was found to reduce transactivation efficiency, with changes at the Pro-437 and Phe-440 positions producing the most deleterious effects. Activation of the EBV latency C promoter by EBNA-2 was shown to be dependent on the presence of the carboxy-terminal activation domain. However, this requirement was generic, rather than specific, since the EBNA-2 activation domain could be replaced with those from the herpes simplex virus (HSV) VP16 protein or the EBV Rta protein. Potential karyophilic signals within EBNA-2 were examined by introducing oligonucleotides encoding positively charged amino acid groupings that might serve in this capacity into a cytoplasmic test protein, HSV delta IE175, and by examining the intracellular localization of the resulting proteins. This assay identified a strong nuclear localization signal between EBV amino acids (aa) 478 to 485, which was conserved in HVP, and a weaker noncanonical signal between EBV aa 341 to 355, which was not conserved in HVP.

Identification of a Unique Amyloid Sequence in AA Amyloidosis of a Pig Associated With Streptococcus Suis Infection.

PubMed

Kamiie, J; Sugahara, G; Yoshimoto, S; Aihara, N; Mineshige, T; Uetsuka, K; Shirota, K

2017-01-01

Here we report a pig with amyloid A (AA) amyloidosis associated with Streptococcus suis infection and identification of a unique amyloid sequence in the amyloid deposits in the tissue. Tissues from the 180-day-old underdeveloped pig contained foci of necrosis and suppurative inflammation associated with S. suis infection. Congo red stain, immunohistochemistry, and electron microscopy revealed intense AA deposition in the spleen and renal glomeruli. Mass spectrometric analysis of amyloid material extracted from the spleen showed serum AA 2 (SAA2) peptide as well as a unique peptide sequence previously reported in a pig with AA amyloidosis. The common detection of the unique amyloid sequence in the current and past cases of AA amyloidosis in pigs suggests that this amyloid sequence might play a key role in the development of porcine AA amyloidosis. An in vitro fibrillation assay demonstrated that the unique AA peptide formed typically rigid, long amyloid fibrils (10 nm wide) and the N-terminus peptide of SAA2 formed zigzagged, short fibers (7 nm wide). Moreover, the SAA2 peptide formed long, rigid amyloid fibrils in the presence of sonicated amyloid fibrils formed by the unique AA peptide. These findings indicate that the N-terminus of SAA2 as well as the AA peptide mediate the development of AA amyloidosis in pigs via cross-seeding polymerization.

Personal Construct Theory and the Transformation of Identity in Alcoholics Anonymous

ERIC Educational Resources Information Center

Young, Lance Brendan

2011-01-01

The dominant theoretical approach to alcoholism research presumes linear, causal relationships between individual cognitions and behavioral outcomes. This approach has largely failed to account for the recovery some alcoholics achieve in Alcoholics Anonymous (AA) because AA emphasizes the transformation of identity, framed in terms of…

Cowpox virus encodes a fifth member of the tumor necrosis factor receptor family: A soluble, secreted CD30 homologue

PubMed Central

Panus, Joanne Fanelli; Smith, Craig A.; Ray, Caroline A.; Smith, Terri Davis; Patel, Dhavalkumar D.; Pickup, David J.

2002-01-01

Cowpox virus (Brighton Red strain) possesses one of the largest genomes in the Orthopoxvirus genus. Sequence analysis of a region of the genome that is type-specific for cowpox virus identified a gene, vCD30, encoding a soluble, secreted protein that is the fifth member of the tumor necrosis factor receptor family known to be encoded by cowpox virus. The vCD30 protein contains 110 aa, including a 21-residue signal peptide, a potential O-linked glycosylation site, and a 58-aa sequence sharing 51–59% identity with highly conserved extracellular segments of both mouse and human CD30. A vCD30Fc fusion protein binds CD153 (CD30 ligand) specifically, and it completely inhibits CD153/CD30 interactions. Although the functions of CD30 are not well understood, the existence of vCD30 suggests that the cellular receptor plays a significant role in normal immune responses. Viral inhibition of CD30 also lends support to the potential therapeutic value of targeting CD30 in human inflammatory and autoimmune diseases. PMID:12034885

Cloning of the Gene Encoding a 22-Kilodalton Cell Surface Antigen of Mycobacterium bovis BCG and Analysis of Its Potential for DNA Vaccination against Tuberculosis

PubMed Central

Lefèvre, Philippe; Denis, Olivier; De Wit, Lucas; Tanghe, Audrey; Vandenbussche, Paul; Content, Jean; Huygen, Kris

2000-01-01

Using spleen cells from mice vaccinated with live Mycobacterium bovis BCG, we previously generated three monoclonal antibodies reactive against a 22-kDa protein present in mycobacterial culture filtrate (CF) (K. Huygen et al., Infect. Immun. 61:2687–2693, 1993). These monoclonal antibodies were used to screen an M. bovis BCG genomic library made in phage λgt11. The gene encoding a 233-amino-acid (aa) protein, including a putative 26-aa signal sequence, was isolated, and sequence analysis indicated that the protein was 98% identical with the M. tuberculosis Lppx protein and that it contained a sequence 94% identical with the M. leprae 38-mer polypeptide 13B3 recognized by T cells from killed M. leprae-immunized subjects. Flow cytometry and cell fractionation demonstrated that the 22-kDa CF protein is also highly expressed in the bacterial cell wall and membrane compartment but not in the cytosol. C57BL/6, C3H, and BALB/c mice were vaccinated with plasmid DNA encoding the 22-kDa protein and analyzed for immune response and protection against intravenous M. tuberculosis challenge. Whereas DNA vaccination induced elevated antibody responses in C57BL/6 and particularly in C3H mice, Th1-type cytokine response, as measured by interleukin-2 and gamma interferon secretion, was only modest, and no protection against intravenous M. tuberculosis challenge was observed in any of the three mouse strains tested. Therefore, the 22-kDa antigen seems to have little potential for a DNA vaccine against tuberculosis, but it may be a good candidate for a mycobacterial antigen detection test. PMID:10678905

Biochemical and molecular characterization of a detergent-stable serine alkaline protease from Bacillus pumilus CBS with high catalytic efficiency.

PubMed

Jaouadi, Bassem; Ellouz-Chaabouni, Semia; Rhimi, Moez; Bejar, Samir

2008-09-01

We have described previously the potential use of an alkaline protease from Bacillus pumilus CBS as an effective additive in laundry detergent formulations [B. Jaouadi, S. Ellouz-Chaabouni, M. Ben Ali, E. Ben Messaoud, B. Naili, A. Dhouib, S. Bejar, A novel alkaline protease from Bacillus pumilus CBS having a high compatibility with laundry detergent and a high feather-degrading activity, Process Biochem, submitted for publication]. Here, we purified this enzyme (named SAPB) and we cloned, sequenced and over-expressed the corresponding gene. The enzyme was purified to homogeneity using salt precipitation and gel filtration HPLC. The pure protease was found to be monomeric protein with a molecular mass of 34598.19Da as determined by MALDI-TOF mass spectrometry. The NH2-terminal sequence of first 21 amino acids (aa) of the purified SAPB was AQTVPYGIPQIKAPAVHAQGY and was completely identical to proteases from other Bacillus pumilus species. This protease is strongly inhibited by PMSF and DFP, showing that it belongs to the serine proteases superfamily. Interestingly, the optimum pH is 10.6 while the optimum temperature was determined to be 65 degrees C. The enzyme was completely stable within a wide range of pH (7.0-10.6) and temperature (30-55 degrees C). One of the distinguishing properties is its catalytic efficiency (kcat/Km) calculated to be 45,265min(-1)mM(-1) and 147,000min(-1)mM(-1) using casein and AAPF as substrates, respectively, which is higher than that of Subtilisin Carlsberg, Subtilisin BPN' and Subtilisin 309 determined under the same conditions. In addition, SAPB showed remarkable stability, for 24h at 40 degrees C, in the presence of 5% Tween-80, 1% SDS, 15% urea and 10% H2O2, which comprise the common bleach-based detergent formulation. The sapB gene encoding SAPB was cloned, sequenced and over-expressed in Escherichia coli. The purified recombinant enzyme (rSAPB) has the same physicochemical and kinetic properties as the native one. SapB gene had an ORF of 1149bp encoding a protein of 383 aa organized into a signal peptide (29 aa), a pro-protein (79 aa) and a mature enzyme (275 aa). The deduced amino acid sequence inspection displays an important homology with other bacterial proteases. The highest homology of 98.1% was found with BPP-A protease from Bacillus pumilus MS-1, with only 8 aa of difference.

Comparison of ZP3 protein sequences among vertebrate species: to obtain a consensus sequence for immunocontraception.

PubMed

Zhu, X; Naz, R K

1999-03-01

The deduced ZP3 amino acid (aa) sequences of 13 vertebrate species namely mouse, hamster, rabbit, pig, porcine, cow, dog, cat, human, bonnet, marmoset, carp, and frog were compared using the PILEUP and PRETTY alignment programs (GCG, Wisconsin, USA). The published aa sequences obtained from 13 vertebrate species indicated the overall evolutionarily conservation in the N-terminus, central region, and C-terminus of the ZP3 polypeptide. More variations of ZP3 polypeptide sequences were seen in the alignments of carp and frog from the 11 mammalian species making the leader sequence more prominent. The canonical furin proteolytic processing signal at the C-terminus was found in all the ZP3 polypeptide sequences except of carp and frog. In the central region, the ZP3 deduced aa sequences of all the 13 vertebrate species aligned well, and six relatively conserved sequences were found. There are 11 conserved cysteine residues in the central region across all species including carp and frog, indicating that these residues have longer evolutionary history. The ZP3 aa sequence similarities were examined using the GAP program (GCG). The highest aa similarities are observed between the members of the same order within the class mammalia, and also (95.4%) between pig (ungulata) and rabbit (lagomorpha). The deduced ZP3 aa sequences per se may not be enough to build a phylogenetic tree.

Effects of a Non-Conservative Sequence on the Properties of β-glucuronidase from Aspergillus terreus Li-20

PubMed Central

Liu, Yanli; Huangfu, Jie; Qi, Feng; Kaleem, Imdad; E, Wenwen; Li, Chun

2012-01-01

We cloned the β-glucuronidase gene (AtGUS) from Aspergillus terreus Li-20 encoding 657 amino acids (aa), which can transform glycyrrhizin into glycyrrhetinic acid monoglucuronide (GAMG) and glycyrrhetinic acid (GA). Based on sequence alignment, the C-terminal non-conservative sequence showed low identity with those of other species; thus, the partial sequence AtGUS(-3t) (1–592 aa) was amplified to determine the effects of the non-conservative sequence on the enzymatic properties. AtGUS and AtGUS(-3t) were expressed in E. coli BL21, producing AtGUS-E and AtGUS(-3t)-E, respectively. At the similar optimum temperature (55°C) and pH (AtGUS-E, 6.6; AtGUS(-3t)-E, 7.0) conditions, the thermal stability of AtGUS(-3t)-E was enhanced at 65°C, and the metal ions Co2+, Ca2+ and Ni2+ showed opposite effects on AtGUS-E and AtGUS(-3t)-E, respectively. Furthermore, Km of AtGUS(-3t)-E (1.95 mM) was just nearly one-seventh that of AtGUS-E (12.9 mM), whereas the catalytic efficiency of AtGUS(-3t)-E was 3.2 fold higher than that of AtGUS-E (7.16 vs. 2.24 mM s−1), revealing that the truncation of non-conservative sequence can significantly improve the catalytic efficiency of AtGUS. Conformational analysis illustrated significant difference in the secondary structure between AtGUS-E and AtGUS(-3t)-E by circular dichroism (CD). The results showed that the truncation of the non-conservative sequence could preferably alter and influence the stability and catalytic efficiency of enzyme. PMID:22347419

Variation of amino acid sequences of serum amyloid a (SAA) and immunohistochemical analysis of amyloid a (AA) in Japanese domestic cats.

PubMed

Tei, Meina; Uchida, Kazuyuki; Chambers, James K; Watanabe, Ken-Ichi; Tamamoto, Takashi; Ohno, Koichi; Nakayama, Hiroyuki

2018-02-02

Amyloid A (AA) amyloidosis, a fatal systemic amyloid disease, occurs secondary to chronic inflammatory conditions in humans. Although persistently elevated serum amyloid A (SAA) levels are required for its pathogenesis, not all individuals with chronic inflammation necessarily develop AA amyloidosis. Furthermore, many diseases in cats are associated with the elevated production of SAA, whereas only a small number actually develop AA amyloidosis. We hypothesized that a genetic mutation in the SAA gene may strongly contribute to the pathogenesis of feline AA amyloidosis. In the present study, genomic DNA from four Japanese domestic cats (JDCs) with AA amyloidosis and from five without amyloidosis was analyzed using polymerase chain reaction (PCR) amplification and direct sequencing. We identified the novel variation combination of 45R-51A in the deduced amino acid sequences of four JDCs with amyloidosis and five without. However, there was no relationship between amino acid variations and the distribution of AA amyloid deposits, indicating that differences in SAA sequences do not contribute to the pathogenesis of AA amyloidosis. Immunohistochemical analysis using antisera against the three different parts of the feline SAA protein-i.e., the N-terminal, central, and C-terminal regions-revealed that feline AA contained the C-terminus, unlike human AA. These results indicate that the cleavage and degradation of the C-terminus are not essential for amyloid fibril formation in JDCs.

Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup.

PubMed

Chen, Tsung-Chi; Huang, Ching-Wen; Kuo, Yan-Wen; Liu, Fang-Lin; Yuan, Chao-Hsiu Hsuan; Hsu, Hei-Ti; Yeh, Shyi-Dong

2006-12-01

ABSTRACT The NSs protein of Watermelon silver mottle virus (WSMoV) was expressed by a Zucchini yellow mosaic virus (ZYMV) vector in squash. The expressed NSs protein with a histidine tag and an additional NIa protease cleavage sequence was isolated by Ni(2+)-NTA resins as a free-form protein and further eluted after sodium dodecyl sulfate-polyacrylamide gel electrophoresis for production of rabbit antiserum and mouse monoclonal antibodies (MAbs). The rabbit antiserum strongly reacted with the NSs crude antigen of WSMoV and weakly reacted with that of a high-temperature-recovered gloxinia isolate (HT-1) of Capsicum chlorosis virus (CaCV), but not with that of Calla lily chlorotic spot virus (CCSV). In contrast, the MAbs reacted strongly with all crude NSs antigens of WSMoV, CaCV, and CCSV. Various deletions of the NSs open reading frame were constructed and expressed by ZYMV vector. Results indicate that all three MAbs target the 89- to 125-amino-acid (aa) region of WSMoV NSs protein. Two indispensable residues of cysteine and lysine were essential for MAbs recognition. Sequence comparison of the deduced MAbs-recognized region with the reported tospoviral NSs proteins revealed the presence of a consensus sequence VRKPGVKNTGCKFTMHNQIFNPN (denoted WNSscon), at the 98- to 120-aa position of NSs proteins, sharing 86 to 100% identities among those of WSMoV, CaCV, CCSV, and Peanut bud necrosis virus. A synthetic WNSscon peptide reacted with the MAbs and verified that the epitopes are present in the 98- to 120-aa region of WSMoV NSs protein. The WSMoV sero-group-specific NSs MAbs provide a means for reliable identification of tospoviruses in this large serogroup.

Characterization of Am IT, an anti-insect β-toxin isolated from the venom of scorpion Androctonus mauretanicus.

PubMed

Oukkache, Naoual; ElJaoudi, Rachid; Chgoury, Fatima; Rocha, Marisa Teixeira; Sabatier, Jean-Marc

2015-06-25

In the present study, a 'novel' toxin, called Am IT from the venom of scorpion Androctonus mauretanicus is isolated and characterized. A detailed analysis of the action of Am IT on insect axonal sodium currents is reported. Am IT was purified through gel filtration followed by C18 reversed-phase HPLC. Toxicity of Am IT in vivo was assessed on male German cockroach (Blattella germanica) larvae and C57/BL6 mice. Cross-reactivity of Am IT with two β-toxins was evidenced using (125)I-iodinated toxin-based radioimmunoassays with synaptosomal preparations from rat brain. The complete amino acid sequence of Am IT was finally determined by Edman sequencing. Am IT was observed to compete with AaH IT4 purified from the venom of scorpion Androctonus australis in binding assays. It was recognized by an antibody raised against a β-type toxin, which indicated some structural similarity with β-toxins (or related toxin family). The 'novel' toxin exhibited dual activity since it competed with anti-mammal toxins in binding assays as well as showed contracting activity to insect. The toxin competed with radio-labeled β-toxin Css IV by binding to Na(+) channels of rat brain synaptosomes. Analysis of toxin amino acid sequences showed that Am IT shares high structural identity (92%) with AaH IT4. In conclusion, Am IT not only reveals an anti-insect compound properties secreted by 'Old World' scorpions, paralyzing insect larvae by binding to Na(+) channels on larvae's nerve-cell membranes, but also exerts toxic activity in mice, which is similar to anti-mammal toxins from 'New World' scorpions (North and South Americas). Therefore, Am IT appears to be structurally and functionally similar to AaH IT4.

Detection and genetic characterization of porcine group A rotaviruses in asymptomatic pigs in smallholder farms in East Africa: predominance of P[8] genotype resembling human strains.

PubMed

Amimo, J O; Junga, J O; Ogara, W O; Vlasova, A N; Njahira, M N; Maina, S; Okoth, E A; Bishop, R P; Saif, L J; Djikeng, A

2015-02-25

Viral enteritis is a serious problem accounting for deaths in neonatal animals and humans worldwide. The absence of surveillance programs and diagnostic laboratory facilities have resulted in a lack of data on rotavirus associated diarrheas in pigs in East Africa. Here we describe the incidence of group A rotavirus (RVA) infections in asymptomatic young pigs in East Africa. Of the 446 samples examined, 26.2% (117/446) were positive for RVA. More nursing piglets (78.7%) shed RVA than weaned (32.9%) and grower (5.8%) pigs. RVA incidence was higher in pigs that were either housed_free-range (77.8%) or tethered_free-range (29.0%) than those that were free-range or housed or housed-tethered pigs. The farms with larger herd size (>10 pigs) had higher RVA prevalence (56.5%) than farms with smaller herd size (24.1-29.7%). This study revealed that age, management system and pig density significantly (p<0.01) influenced the incidence of RVA infections, with housed_free-range management system and larger herd size showing higher risks for RVA infection. Partial (811-1604nt region) sequence of the VP4 gene of selected positive samples revealed that different genotypes (P[6], P[8] and P[13]) are circulating in the study area with P[8] being predominant. The P[6] strain shared nucleotide (nt) and amino acid (aa) sequence identity of 84.4-91.3% and 95.1-96.9%, respectively, with known porcine and human P[6] strains. The P[8] strains shared high nt and aa sequence identity with known human P[8] strains ranging from 95.6-100% to 92-100%, respectively. The P[13] strains shared nt and aa sequence identity of 83.6-91.7% and 89.3-96.4%, respectively, only with known porcine P[13] strains. No P[8] strains yielded RNA of sufficient quality/quantity for full genome sequencing. However analysis of the full genome constellation of the P[6], two P[13] and one untypeable strains revealed that the P[6] strain (Ke-003-5) genome constellation was G26-P[6]-I5-R1-C1-M1-A8-N1-T1-E1-H1, P[13] strains (Ug-049 and Ug-453) had G5-P[13]-I5-R1-C1-M1-A8-N1-T7-E1-H1 while the untypeable strain (Ug-218) had G5-P[?]-I5-R1-C1-M1-A8-N1-T1-E1-H? In conclusion, P[6] and P[8] genotypes detected were genetically closely related to human strains suggesting the possibility of interspecies transmission. Further studies are required to determine the role of RVA in swine enteric disease burden and to determine the genetic/antigenic heterogeneity of the circulating strains for development of accurate diagnostic tools and to implement appropriate prophylaxis programs. Copyright © 2014 Elsevier B.V. All rights reserved.

Hydropathic self-organized criticality: a magic wand for protein physics.

PubMed

Phillips, J C

2012-10-01

Self-organized criticality (SOC) is a popular concept that has been the subject of more than 3000 articles in the last 25 years. The characteristic signature of SOC is the appearance of self-similarity (power-law scaling) in observable properties. A characteristic observable protein property that describes protein-water interactions is the water-accessible (hydropathic) interfacial area of compacted globular protein networks. Here we show that hydropathic power-law (size- or length-scale-dependent) exponents derived from SOC enable theory to connect standard Web-based (BLAST) short-range amino acid (aa) sequence similarities to long-range aa sequence hydropathic roughening form factors that hierarchically describe evolutionary trends in water - membrane protein interactions. Our method utilizes hydropathic aa exponents that define a non-Euclidean metric realistically rooted in the atomic coordinates of 5526 protein segments. These hydropathic aa exponents thereby encapsulate universal (but previously only implicit) non-Euclidean long-range differential geometrical features of the Protein Data Bank. These hydropathic aa exponents easily organize small mutated aa sequence differences between human and proximate species proteins. For rhodopsin, the most studied transmembrane signaling protein associated with night vision, analysis shows that this approach separates Euclidean short- and non-Euclidean long-range aa sequence properties, and shows that they correlate with 96% success for humans, monkeys, cats, mice and rabbits. Proper application of SOC using hydropathic aa exponents promises unprecedented simplifications of exponentially complex protein sequence-structure-function problems, both conceptual and practical.

Immunoglobulin from Antarctic fish species of Rajidae family.

PubMed

Coscia, Maria Rosaria; Cocca, Ennio; Giacomelli, Stefano; Cuccaro, Fausta; Oreste, Umberto

2012-03-01

Immunoglobulins (Ig) of Chondroichthyes have been extensively studied in sharks; in contrast, in skates investigations on Ig remain scarce and fragmentary despite the high occurrence of skates in all of the major oceans of the world. To focus on Rajidae Igμ, the most abundant heavy chain isotype, we have chosen the Antarctic species Bathyraja eatonii, Bathyraja albomaculata, Bathyraja brachyurops, and Amblyraja georgiana which live at high latitudes in the Southern Ocean, and at very low temperatures. We prepared mRNA from the spleen of individuals of each species and performed RT-PCR experiments using two oligonucleotides designed on the alignment of various elasmobranch Igμ heavy chain sequences available in GenBank. The PCR products, about 1400-nt long, were cloned and sequenced. Nucleotide sequence identities calculated for the constant region domains ranged from 88.5% to 97.5% between species, and from 91.1% to 99.7% within species. In a distance tree, including also Raja erinacea sequences, two major branches were obtained, one containing Arhynchobatinae sequences, the other one Rajinae sequences. Four presumptive D gene segments were identified in the region of the VH/D/JH recombination; two different D segments were often found in the same sequence. Moreover, 5-15 genomic fragments of different lengths, carrying the gene locus encoding Igμ chain were revealed by Southern blotting analysis. B. eatonii amino acid sequences were analyzed for the positional diversity by Shannon entropy analysis, showing CH4 as the most conserved domain, and CH3 as the most variable one. B. eatonii CDR3 region length varied between 11 and 15 amino acid residues; the mean length (13.4 aa) was greater than that of Leucoraja eglanteria sequences (7.7 aa). An alignment of representative sequences of Antarctic species and R. erinacea showed that more cysteine residues not involved in the intradomain disulfide bridges were present in Antarctic species. Copyright © 2011 Elsevier B.V. All rights reserved.

VWF mutations and new sequence variations identified in healthy controls are more frequent in the African-American population.

PubMed

Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R

2012-03-01

Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.

The gender identity/gender dysphoria questionnaire for adolescents and adults.

PubMed

Deogracias, Joseph J; Johnson, Laurel L; Meyer-Bahlburg, Heino F L; Kessler, Suzanne J; Schober, Justine M; Zucker, Kenneth J

2007-11-01

The present study reports on the construction of a dimensional measure of gender identity (gender dysphoria) for adolescents and adults. The 27-item gender identity/gender dysphoria questionnaire for adolescents and adults (GIDYQ-AA) was administered to 389 university students (heterosexual and nonheterosexual) and 73 clinic-referred patients with gender identity disorder. Principal axis factor analysis indicated that a one-factor solution, accounting for 61.3% of the total variance, best fits the data. Factor loadings were all >or= .30 (median, .82; range, .34-.96). A mean total score (Cronbach's alpha, .97) was computed, which showed strong evidence for discriminant validity in that the gender identity patients had significantly more gender dysphoria than both the heterosexual and nonheterosexual university students. Using a cut-point of 3.00, we found the sensitivity was 90.4% for the gender identity patients and specificity was 99.7% for the controls. The utility of the GIDYQ-AA is discussed.

Hymenobacter roseosalivarius gen. nov., sp. nov. from continental Antartica soils and sandstone: bacteria of the Cytophaga/Flavobacterium/Bacteroides line of phylogenetic descent.

PubMed

Hirsch, P; Ludwig, W; Hethke, C; Sittig, M; Hoffmann, B; Gallikowski, C A

1998-08-01

Aseptically collected sandstone and soil samples from the antarctic Dry Valleys were inoculated into oligotrophic media and incubated under low light intensities. A total of 41 Gram-negative isolates were obtained with reddish colonies spreading on agar. A sandstone isolate and four soil strains were characterized further. They were nearly identical in morphological, physiological, biochemical and chemotaxonomic properties. They produced large amounts of extracellular polymer and utilized for growth: glucose, saccharose, mannitol, sorbitol, L-aspartate, malate and acetate, but not D-ribose, adonitol, DL-alanine, glutamate, glycolate, lactate or succinate. All strains hydrolyzed gelatin, starch, casein, xylan, Tweens 80 or 60 and dead or living yeast cells, but not cellulose or pectin. Nitrate was not reduced, ethanol was not oxidized and acid was not produced from maltose, mannitol or dulcitol. Ammonia was not produced from peptone. They were strictly aerobic. Major fatty acids were n 16:1 d 9, n 16:1 d 11, n 17:1 d 11, and i 15:0. The strains contained the quinone MK-7 and phosphatidylethanolamine as the main phospholipid. The base ratio ranged from 55 to 61 mol% G+C. A 16S rRNA sequence analysis of strains AA-688 and AA-718 showed these to be identical and to represent a special phylogenetic group within the Cytophaga/Flavobacterium/Bacteroides major line of descent. Three soil strains labeled "Taxeobacter" Txc1, Txg1, and Txo1 (Reichenbach, 1992) belonged to the same group but had lower sequence similarities (<95%). Some of their characteristics were different from those of the antarctic strains: the utilization of C-compounds, hydrolysis of polymers, temperature tolerances, major fatty acids and base ratios. Txc1 and Txg1 may later have to be considered as members of this group, possibly on the species level, while Txo1 could represent a different related genus. It is concluded that the five antarctic strains represent a new genus and species for which the name of Hymenobacter roseosalivarius is proposed. The type strain is AA-718T (DSM 11622T).

Bioinformatic Analysis Reveals Archaeal tRNATyr and tRNATrp Identities in Bacteria

PubMed Central

Mukai, Takahito; Reynolds, Noah M.; Crnković, Ana; Söll, Dieter

2017-01-01

The tRNA identity elements for some amino acids are distinct between the bacterial and archaeal domains. Searching in recent genomic and metagenomic sequence data, we found some candidate phyla radiation (CPR) bacteria with archaeal tRNA identity for Tyr-tRNA and Trp-tRNA synthesis. These bacteria possess genes for tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase (TrpRS) predicted to be derived from DPANN superphylum archaea, while the cognate tRNATyr and tRNATrp genes reveal bacterial or archaeal origins. We identified a trace of domain fusion and swapping in the archaeal-type TyrRS gene of a bacterial lineage, suggesting that CPR bacteria may have used this mechanism to create diverse proteins. Archaeal-type TrpRS of bacteria and a few TrpRS species of DPANN archaea represent a new phylogenetic clade (named TrpRS-A). The TrpRS-A open reading frames (ORFs) are always associated with another ORF (named ORF1) encoding an unknown protein without global sequence identity to any known protein. However, our protein structure prediction identified a putative HIGH-motif and KMSKS-motif as well as many α-helices that are characteristic of class I aminoacyl-tRNA synthetase (aaRS) homologs. These results provide another example of the diversity of molecular components that implement the genetic code and provide a clue to the early evolution of life and the genetic code. PMID:28230768

IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

PubMed

Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

2016-01-01

Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

Classification of Lactococcus lactis cell envelope proteinase based on gene sequencing, peptides formed after hydrolysis of milk, and computer modeling.

PubMed

Børsting, M W; Qvist, K B; Brockmann, E; Vindeløv, J; Pedersen, T L; Vogensen, F K; Ardö, Y

2015-01-01

Lactococcus lactis strains depend on a proteolytic system for growth in milk to release essential AA from casein. The cleavage specificities of the cell envelope proteinase (CEP) can vary between strains and environments and whether the enzyme is released or bound to the cell wall. Thirty-eight Lc. lactis strains were grouped according to their CEP AA sequences and according to identified peptides after hydrolysis of milk. Finally, AA positions in the substrate binding region were suggested by the use of a new CEP template based on Streptococcus C5a CEP. Aligning the CEP AA sequences of 38 strains of Lc. lactis showed that 21 strains, which were previously classified as group d, could be subdivided into 3 groups. Independently, similar subgroupings were found based on comparison of the Lc. lactis CEP AA sequences and based on normalized quantity of identified peptides released from αS1-casein and β-casein. A model structure of Lc. lactis CEP based on the crystal structure of Streptococcus C5a CEP was used to investigate the AA positions in the substrate-binding region. New AA positions were suggested, which could be relevant for the cleavage specificity of CEP; however, these could only explain 2 out of 3 found subgroups. The third subgroup could be explained by 1 to 5 AA positions located opposite the substrate binding region. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Full Genome Characterisation of Bluetongue Virus Serotype 6 from the Netherlands 2008 and Comparison to Other Field and Vaccine Strains

PubMed Central

Maan, Sushila; Maan, Narender S.; van Rijn, Piet A.; van Gennip, René G. P.; Sanders, Anna; Wright, Isabel M.; Batten, Carrie; Hoffmann, Bernd; Eschbaumer, Michael; Oura, Chris A. L.; Potgieter, Abraham C.; Nomikou, Kyriaki; Mertens, Peter P.C.

2010-01-01

In mid September 2008, clinical signs of bluetongue (particularly coronitis) were observed in cows on three different farms in eastern Netherlands (Luttenberg, Heeten, and Barchem), two of which had been vaccinated with an inactivated BTV-8 vaccine (during May-June 2008). Bluetongue virus (BTV) infection was also detected on a fourth farm (Oldenzaal) in the same area while testing for export. BTV RNA was subsequently identified by real time RT-PCR targeting genome-segment (Seg-) 10, in blood samples from each farm. The virus was isolated from the Heeten sample (IAH “dsRNA virus reference collection” [dsRNA-VRC] isolate number NET2008/05) and typed as BTV-6 by RT-PCR targeting Seg-2. Sequencing confirmed the virus type, showing an identical Seg-2 sequence to that of the South African BTV-6 live-vaccine-strain. Although most of the other genome segments also showed very high levels of identity to the BTV-6 vaccine (99.7 to 100%), Seg-10 showed greatest identity (98.4%) to the BTV-2 vaccine (RSAvvv2/02), indicating that NET2008/05 had acquired a different Seg-10 by reassortment. Although Seg-7 from NET2008/05 was also most closely related to the BTV-6 vaccine (99.7/100% nt/aa identity), the Seg-7 sequence derived from the blood sample of the same animal (NET2008/06) was identical to that of the Netherlands BTV-8 (NET2006/04 and NET2007/01). This indicates that the blood contained two different Seg-7 sequences, one of which (from the BTV-6 vaccine) was selected during virus isolation in cell-culture. The predominance of the BTV-8 Seg-7 in the blood sample suggests that the virus was in the process of reassorting with the northern field strain of BTV-8. Two genome segments of the virus showed significant differences from the BTV-6 vaccine, indicating that they had been acquired by reassortment event with BTV-8, and another unknown parental-strain. However, the route by which BTV-6 and BTV-8 entered northern Europe was not established. PMID:20428242

Isolation, cloning, and characterization of the 2S albumin: a new allergen from hazelnut.

PubMed

Garino, Cristiano; Zuidmeer, Laurian; Marsh, Justin; Lovegrove, Alison; Morati, Maria; Versteeg, Serge; Schilte, Piet; Shewry, Peter; Arlorio, Marco; van Ree, Ronald

2010-09-01

2S albumins are the major allergens involved in severe food allergy to nuts, seeds, and legumes. We aimed to isolate, clone, and express 2S albumin from hazelnut and determine its allergenicity. 2S albumin from hazelnut extract was purified using size exclusion chromatography and RP-HPLC. After N-terminal sequencing, degenerated and poly-d(T) primers were used to clone the 2S albumin sequence from hazelnut cDNA. After expression in Escherichia coli and affinity purification, IgE reactivity was evaluated by Immunoblot/ImmunoCAP (inhibition) analyses using sera of nut-allergic patients. N-terminal sequencing of a approximately 10 kDa peak from size exclusion chromatography/RP-HPLC gave two sequences highly homologous to pecan 2S albumin, an 11 amino acid (aa) N-terminal and a 10 aa internal peptide. The obtained clone (441 bp) encoded a 147 aa hazelnut 2S albumin consisting of a putative signal peptide (22 aa), a linker peptide (20 aa), and the mature protein sequence (105 aa). The latter was successfully expressed in E. coli. Both recombinant and natural 2S albumin demonstrated similar IgE reactivity in Immunoblot/ImmunoCAP (inhibition) analyses. We confirmed the postulated role of hazelnut 2S albumin as an allergen. The availability of recombinant molecules will allow establishing the importance of hazelnut 2S albumin for hazelnut allergy.

In silico cloning and B/T cell epitope prediction of triosephosphate isomerase from Echinococcus granulosus.

PubMed

Wang, Fen; Ye, Bin

2016-10-01

Cystic echinococcosis is a worldwide zoonosis caused by Echinococcus granulosus. Because the methods of diagnosis and treatment for cystic echinococcosis were limited, it is still necessary to screen target proteins for the development of new anti-hydatidosis vaccine. In this study, the triosephosphate isomerase gene of E. granulosus was in silico cloned. The B cell and T cell epitopes were predicted by bioinformatics methods. The cDNA sequence of EgTIM was composition of 1094 base pairs, with an open reading frame of 753 base pairs. The deduced amino acid sequences were composed of 250 amino acids. Five cross-reactive epitopes, locating on 21aa-35aa, 43aa-57aa, 94aa-107aa, 115-129aa, and 164aa-183aa, could be expected to serve as candidate epitopes in the development of vaccine against E. granulosus. These results could provide bases for gene cloning, recombinant expression, and the designation of anti-hydatidosis vaccine.

Typing of Intimin Genes in Human and Animal Enterohemorrhagic and Enteropathogenic Escherichia coli: Characterization of a New Intimin Variant

PubMed Central

Oswald, E.; Schmidt, H.; Morabito, S.; Karch, H.; Marchès, O.; Caprioli, A.

2000-01-01

Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) produce the characteristic “attaching and effacing” (A/E) lesion of the brush border. Intimin, an outer membrane protein encoded by eae, is responsible for the tight association of both pathogens with the host cell. Several eae have been cloned from different EPEC and EHEC strains isolated from humans and animals. These sequences are conserved in the N-terminal region but highly variable in the last C-terminal 280 amino acids (aa), where the cell binding activity is localized. Based on these considerations, we developed a panel of specific primers to investigate the eae heterogeneity of the variable 3′ region by using PCR amplification. We then investigated the distribution of the known intimin types in a large collection of EPEC and EHEC strains isolated from humans and different animal species. The existence of a yet-unknown family of intimin was suspected because several EHEC strains, isolated from human and cattle, did not react with any of the specific primer pairs, although these strains were eae positive when primers amplifying the conserved 5′ end were used. We then cloned and sequenced the eae present in one of these strains (EHEC of serotype O103:H2) and subsequently designed a PCR primer that recognizes in a specific manner the variable 3′ region of this new intimin type. This intimin, referred to as “ɛ,” was present in human and bovine EHEC strains of serogroups O8, O11, O45, O103, O121, and O165. Intimin ɛ is the largest intimin cloned to date (948 aa) and shares the greatest overall sequence identity with intimin β, although analysis of the last C-terminal 280 aa suggests a greater similarity with intimins α and γ. PMID:10603369

Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001: comparison with the South African strain SAAR-1776 and other flaviviruses.

PubMed

Bakonyi, Tamás; Gould, Ernest A; Kolodziejek, Jolanta; Weissenböck, Herbert; Nowotny, Norbert

2004-10-25

Here we describe the complete genome sequences of two strains of Usutu virus (USUV), a mosquito-borne member of the genus Flavivirus in the Japanese encephalitis virus (JEV) serogroup. USUV was detected in Austria in 2001 causing a high mortality rate in blackbirds; the reference strain (SAAR-1776) was isolated in 1958 from mosquitoes in South Africa and has never been associated with avian mortality. The Austrian and South African isolates exhibited 97% nucleotide and 99% amino acid identity. Phylogenetic trees were constructed displaying the genetic relationships of USUV with other members of the genus Flavivirus. When comparing USUV with other JEV serogroup viruses, the closest lineage was Murray Valley encephalitis virus (nt: 73%, aa: 82%) followed by JEV (nt: 71%, aa: 81%) and West Nile virus (nt: 68%, aa: 75%). Comparison of the genomes showed that the conserved structural elements and putative enzyme motifs were homologous in the two USUV strains and the JEV serogroup. The factors that determine the severe clinical symptoms caused by the Austrian USUV strain in Eurasian blackbirds are discussed. We also offer a possible explanation for the origins and dispersal of USUV, JEV, and MVEV out of Africa.

Bioinformatic flowchart and database to investigate the origins and diversity of Clan AA peptidases

PubMed Central

Llorens, Carlos; Futami, Ricardo; Renaud, Gabriel; Moya, Andrés

2009-01-01

Background Clan AA of aspartic peptidases relates the family of pepsin monomers evolutionarily with all dimeric peptidases encoded by eukaryotic LTR retroelements. Recent findings describing various pools of single-domain nonviral host peptidases, in prokaryotes and eukaryotes, indicate that the diversity of clan AA is larger than previously thought. The ensuing approach to investigate this enzyme group is by studying its phylogeny. However, clan AA is a difficult case to study due to the low similarity and different rates of evolution. This work is an ongoing attempt to investigate the different clan AA families to understand the cause of their diversity. Results In this paper, we describe in-progress database and bioinformatic flowchart designed to characterize the clan AA protein domain based on all possible protein families through ancestral reconstructions, sequence logos, and hidden markov models (HMMs). The flowchart includes the characterization of a major consensus sequence based on 6 amino acid patterns with correspondence with Andreeva's model, the structural template describing the clan AA peptidase fold. The set of tools is work in progress we have organized in a database within the GyDB project, referred to as Clan AA Reference Database . Conclusion The pre-existing classification combined with the evolutionary history of LTR retroelements permits a consistent taxonomical collection of sequence logos and HMMs. This set is useful for gene annotation but also a reference to evaluate the diversity of, and the relationships among, the different families. Comparisons among HMMs suggest a common ancestor for all dimeric clan AA peptidases that is halfway between single-domain nonviral peptidases and those coded by Ty3/Gypsy LTR retroelements. Sequence logos reveal how all clan AA families follow similar protein domain architecture related to the peptidase fold. In particular, each family nucleates a particular consensus motif in the sequence position related to the flap. The different motifs constitute a network where an alanine-asparagine-like variable motif predominates, instead of the canonical flap of the HIV-1 peptidase and closer relatives. Reviewers This article was reviewed by Daniel H. Haft, Vladimir Kapitonov (nominated by Jerry Jurka), and Ben M. Dunn (nominated by Claus Wilke). PMID:19173708

An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion protein.

PubMed

Butler-Cole, Christine; Wagner, Mary J; Da Silva, Melissa; Brown, Gordon D; Burke, Robert D; Upton, Chris

2007-07-24

Profilins are critical to cytoskeletal dynamics in eukaryotes; however, little is known about their viral counterparts. In this study, a poxviral profilin homolog, ectromelia virus strain Moscow gene 141 (ECTV-PH), was investigated by a variety of experimental and bioinformatics techniques to characterize its interactions with cellular and viral proteins. Profilin-like proteins are encoded by all orthopoxviruses sequenced to date, and share over 90% amino acid (aa) identity. Sequence comparisons show highest similarity to mammalian type 1 profilins; however, a conserved 3 aa deletion in mammalian type 3 and poxviral profilins suggests that these homologs may be more closely related. Structural analysis shows that ECTV-PH can be successfully modelled onto both the profilin 1 crystal structure and profilin 3 homology model, though few of the surface residues thought to be required for binding actin, poly(L-proline), and PIP2 are conserved. Immunoprecipitation and mass spectrometry identified two proteins that interact with ECTV-PH within infected cells: alpha-tropomyosin, a 38 kDa cellular actin-binding protein, and the 84 kDa product of vaccinia virus strain Western Reserve (VACV-WR) 148, which is the truncated VACV counterpart of the orthopoxvirus A-type inclusion (ATI) protein. Western and far-western blots demonstrated that the interaction with alpha-tropomyosin is direct, and immunofluorescence experiments suggest that ECTV-PH and alpha-tropomyosin may colocalize to structures that resemble actin tails and cellular protrusions. Sequence comparisons of the poxviral ATI proteins show that although full-length orthologs are only present in cowpox and ectromelia viruses, an ~ 700 aa truncated ATI protein is conserved in over 90% of sequenced orthopoxviruses. Immunofluorescence studies indicate that ECTV-PH localizes to cytoplasmic inclusion bodies formed by both truncated and full-length versions of the viral ATI protein. Furthermore, colocalization of ECTV-PH and truncated ATI protein to protrusions from the cell surface was observed. These results suggest a role for ECTV-PH in intracellular transport of viral proteins or intercellular spread of the virus. Broader implications include better understanding of the virus-host relationship and mechanisms by which cells organize and control the actin cytoskeleton.

Cancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2

DTIC Science & Technology

2017-05-01

TERMS Ovarian cancer, drug resistance, rucaparib, phase 2, DNA repair, homologous recombination, nonhomologous end-joining (NHEJ), poly(ADP-ribose...tissues from AA patients with OC. This should add 50 AA OC patients. We are also requesting anonymized DNA from AA OC patients who participated on...extracts DNA and creates library pretps for DNA sequencing. He performs Sanger sequencing validations. Funding Support: Has there been a change

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

A Novel Glucosylation Reaction on Anthocyanins Catalyzed by Acyl-Glucose–Dependent Glucosyltransferase in the Petals of Carnation and Delphinium[C][W

PubMed Central

Matsuba, Yuki; Sasaki, Nobuhiro; Tera, Masayuki; Okamura, Masachika; Abe, Yutaka; Okamoto, Emi; Nakamura, Haruka; Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki; Nagasawa, Kazuo; Ozeki, Yoshihiro

2010-01-01

Glucosylation of anthocyanin in carnations (Dianthus caryophyllus) and delphiniums (Delphinium grandiflorum) involves novel sugar donors, aromatic acyl-glucoses, in a reaction catalyzed by the enzymes acyl-glucose–dependent anthocyanin 5(7)-O-glucosyltransferase (AA5GT and AA7GT). The AA5GT enzyme was purified from carnation petals, and cDNAs encoding carnation Dc AA5GT and the delphinium homolog Dg AA7GT were isolated. Recombinant Dc AA5GT and Dg AA7GT proteins showed AA5GT and AA7GT activities in vitro. Although expression of Dc AA5GT in developing carnation petals was highest at early stages, AA5GT activity and anthocyanin accumulation continued to increase during later stages. Neither Dc AA5GT expression nor AA5GT activity was observed in the petals of mutant carnations; these petals accumulated anthocyanin lacking the glucosyl moiety at the 5 position. Transient expression of Dc AA5GT in petal cells of mutant carnations is expected to result in the transfer of a glucose moiety to the 5 position of anthocyanin. The amino acid sequences of Dc AA5GT and Dg AA7GT showed high similarity to glycoside hydrolase family 1 proteins, which typically act as β-glycosidases. A phylogenetic analysis of the amino acid sequences suggested that other plant species are likely to have similar acyl-glucose–dependent glucosyltransferases. PMID:20971893

TAILORING A FRUIT AND VEGETABLE INTERVENTION ON ETHNIC IDENTITY: RESULTS OF A RANDOMIZED STUDY

PubMed Central

Resnicow, Ken; Davis, Rachel; Zhang, Nanhua; Saunders, Ed; Strecher, Victor; Tolsma, Dennis; Calvi, Josephine; Alexander, Gwen; Anderson, Julia; Wiese, Cheryl; Cross, William

2009-01-01

Objective Many targeted health interventions have been developed and tested with African American (AA) populations; however, AAs are a highly heterogeneous group. One characteristic that varies across AAs is Ethnic Identity (EI). Despite the recognition that AAs are heterogeneous with regard to EI, little research has been conducted on how to incorporate EI into the design of health messages and programs. Design This randomized trial tested whether tailoring a print-based fruit and vegetable (F & V) intervention based on individual EI would enhance program impact beyond that of social cognitive tailoring alone. AA adults were recruited from two integrated healthcare delivery systems, one based in the Detroit Metro area and the other in the Atlanta Metro area, and then randomized to receive three newsletters focused on F & V behavior change over three months. One set of newsletters was tailored only on demographic, behavioral, and social cognitive variables (control condition) whereas the other (experimental condition) was additionally tailored on EI. Main Outcome Measures The primary outcome for the study was F & V intake, which was assessed at baseline and three months later using the composite of two brief self-report frequency measures. Results A total of 560 eligible participants were enrolled, of which 468 provided complete 3-month follow-up data. The experimental group increased their daily mean F & V intake by 1.1 servings compared to .8 servings in the control group (p = .13). Several variables were found to interact with intervention group. For instance, Afrocentric experimental group participants showed a 1.4 increase in F & V servings per day compared to a .43 servings per day increase among Afrocentric controls (p < .05). Conclusions Although the overall between-group effects were not significant, this study confirms that AAs are a highly diverse population and that tailoring dietary messages on ethnic identity may improve intervention impact for some AA subgroups. PMID:19594262

Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

PubMed

Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

1999-09-03

In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

Prediction protein structural classes with pseudo-amino acid composition: approximate entropy and hydrophobicity pattern.

PubMed

Zhang, Tong-Liang; Ding, Yong-Sheng; Chou, Kuo-Chen

2008-01-07

Compared with the conventional amino acid (AA) composition, the pseudo-amino acid (PseAA) composition as originally introduced for protein subcellular location prediction can incorporate much more information of a protein sequence, so as to remarkably enhance the power of using a discrete model to predict various attributes of a protein. In this study, based on the concept of PseAA composition, the approximate entropy and hydrophobicity pattern of a protein sequence are used to characterize the PseAA components. Also, the immune genetic algorithm (IGA) is applied to search the optimal weight factors in generating the PseAA composition. Thus, for a given protein sequence sample, a 27-D (dimensional) PseAA composition is generated as its descriptor. The fuzzy K nearest neighbors (FKNN) classifier is adopted as the prediction engine. The results thus obtained in predicting protein structural classification are quite encouraging, indicating that the current approach may also be used to improve the prediction quality of other protein attributes, or at least can play a complimentary role to the existing methods in the relevant areas. Our algorithm is written in Matlab that is available by contacting the corresponding author.

Gene-Based Sequencing Identifies Lipid-Influencing Variants with Ethnicity-Specific Effects in African Americans

PubMed Central

Bentley, Amy R.; Chen, Guanjie; Shriner, Daniel; Doumatey, Ayo P.; Zhou, Jie; Huang, Hanxia; Mullikin, James C.; Blakesley, Robert W.; Hansen, Nancy F.; Bouffard, Gerard G.; Cherukuri, Praveen F.; Maskeri, Baishali; Young, Alice C.; Adeyemo, Adebowale; Rotimi, Charles N.

2014-01-01

Although a considerable proportion of serum lipids loci identified in European ancestry individuals (EA) replicate in African Americans (AA), interethnic differences in the distribution of serum lipids suggest that some genetic determinants differ by ethnicity. We conducted a comprehensive evaluation of five lipid candidate genes to identify variants with ethnicity-specific effects. We sequenced ABCA1, LCAT, LPL, PON1, and SERPINE1 in 48 AA individuals with extreme serum lipid concentrations (high HDLC/low TG or low HDLC/high TG). Identified variants were genotyped in the full population-based sample of AA (n = 1694) and tested for an association with serum lipids. rs328 (LPL) and correlated variants were associated with higher HDLC and lower TG. Interestingly, a stronger effect was observed on a “European” vs. “African” genetic background at this locus. To investigate this effect, we evaluated the region among West Africans (WA). For TG, the effect size among WA was the same in AA with only African local ancestry (2–3% lower TG), while the larger association among AA with local European ancestry matched previous reports in EA (10%). For HDLC, there was no association with rs328 in AA with only African local ancestry or in WA, while the association among AA with European local ancestry was much greater than what has been observed for EA (15 vs. ∼5 mg/dl), suggesting an interaction with an environmental or genetic factor that differs by ethnicity. Beyond this ancestry effect, the importance of African ancestry-focused, sequence-based work was also highlighted by serum lipid associations of variants that were in higher frequency (or present only) among those of African ancestry. By beginning our study with the sequence variation present in AA individuals, investigating local ancestry effects, and seeking replication in WA, we were able to comprehensively evaluate the role of a set of candidate genes in serum lipids in AA. PMID:24603370

Draft Genome Sequence of the Putrescine-Producing Strain Lactococcus lactis subsp. lactis 1AA59

PubMed Central

del Rio, Beatriz; Linares, Daniel M.; Fernandez, María; Mayo, Baltasar; Martín, M. Cruz

2015-01-01

We report here the 2,576,542-bp genome annotated draft assembly sequence of Lactococcus lactis subsp. lactis 1AA59. This strain—isolated from a traditional cheese—produces putrescine, one of the most frequently biogenic amines found in dairy products. PMID:26089428

Identifying binding modes of two synthetic derivatives of adrenalin to the α2C-adrenoceptor by using molecular modeling; insights into the α2C-adrenoceptor activation.

PubMed

Gholami, Samira; Bordbar, A Khalegh; Lohrasebi, Amir

2017-04-01

Although, α2C adrenergic receptor (AR) mediates a number of physiological functions in vivo and has great therapeutic potential, the absence of its crystal structure is a major difficulty in the activation mechanism studies and drug design endeavors. Here, a homology model of α2C AR has been presented by means of multiple sequence alignment. The used templates were the latest crystal structures of the other ARs (Protein Data Bank IDs: 2R4R, 2RH1, 4GPO, 3P0G, 4BVN and 4LDO) that have 38.4% identity with the query. We then conducted docking simulations to understand and analyze the binding of noradrenaline (NOR), and its derivatives, namely arachidonoyl adrenalin (AA-AD) and arachidonoyl noradrenalin (AA-NOR) to the receptor. The existence of H-bonds between the ligands and SER218 residue implies the same binding site of derivatives with respect to the NOR. AA-AD and AA-NOR bind to the receptor with the larger binding affinities. The presence of salt bridge between ARG149 and GLU377 in the free receptor, obtained from molecular dynamics studies proved that the receptor still is in its basal state before binding process take places. The activation process is characterized by increasing in the RMSD values of the backbone receptor in the bound state, increasing the RMSF of the transmembrane involved in the activation process and the disappearance of the ARG149-GLU377 salt bridge. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of a "glycine-loop"-like coiled structure in the 34 AA Pro,Gly,Met repeat domain of the biomineral-associated protein, PM27.

PubMed

Wustman, Brandon A; Santos, Rudolpho; Zhang, Bo; Evans, John Spencer

2002-12-05

Fracture resistance in biomineralized structures has been linked to the presence of proteins, some of which possess sequences that are associated with elastic behavior. One such protein superfamily, the Pro,Gly-rich sea urchin intracrystalline spicule matrix proteins, form protein-protein supramolecular assemblies that modify the microstructure and fracture-resistant properties of the calcium carbonate mineral phase within embryonic sea urchin spicules and adult sea urchin spines. In this report, we detail the identification of a repetitive keratin-like "glycine-loop"- or coil-like structure within the 34-AA (AA: amino acid) N-terminal domain, (PGMG)(8)PG, of the spicule matrix protein, PM27. The identification of this repetitive structural motif was accomplished using two capped model peptides: a 9-AA sequence, GPGMGPGMG, and a 34-AA peptide representing the entire motif. Using CD, NMR spectrometry, and molecular dynamics simulated annealing/minimization simulations, we have determined that the 9-AA model peptide adopts a loop-like structure at pH 7.4. The structure of the 34-AA polypeptide resembles a coil structure consisting of repeating loop motifs that do not exhibit long-range ordering. Given that loop structures have been associated with protein elastic behavior and protein motion, it is plausible that the 34-AA Pro,Gly,Met repeat sequence motif in PM27 represents a putative elastic or mobile domain. Copyright 2002 Wiley Periodicals, Inc.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Homologs of CD83 from elasmobranch and teleost fish.

PubMed

Ohta, Yuko; Landis, Eric; Boulay, Thomas; Phillips, Ruth B; Collet, Bertrand; Secombes, Chris J; Flajnik, Martin F; Hansen, John D

2004-10-01

Dendritic cells are one of the most important cell types connecting innate and adaptive immunity, but very little is known about their evolutionary origins. To begin to study dendritic cells from lower vertebrates, we isolated and characterized CD83 from the nurse shark (Ginglymostoma cirratum (Gici)) and rainbow trout (Oncorhynchus mykiss (Onmy)). The open reading frames for Gici-CD83 (194 aa) and Onmy-CD83 (218 aa) display approximately 28-32% identity to mammalian CD83 with the presence of two conserved N-linked glycosylation sites. Identical with mammalian CD83 genes, Gici-CD83 is composed of five exons including conservation of phase for the splice sites. Mammalian CD83 genes contain a split Ig superfamily V domain that represents a unique sequence feature for CD83 genes, a feature conserved in both Gici- and Onmy-CD83. Gici-CD83 and Onmy-CD83 are not linked to the MHC, an attribute shared with mouse but not human CD83. Gici-CD83 is expressed rather ubiquitously with highest levels in the epigonal tissue, a primary site for lymphopoiesis in the nurse shark, whereas Onmy-CD83 mRNA expression largely paralleled that of MHC class II but at lower levels. Finally, Onmy-CD83 gene expression is up-regulated in virus-infected trout, and the promoter is responsive to trout IFN regulatory factor-1. These results suggest that the role of CD83, an adhesion molecule for cell-mediated immunity, has been conserved over 450 million years of vertebrate evolution.

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Molecular and Insecticidal Characterization of a Novel Cry-Related Protein from Bacillus Thuringiensis Toxic against Myzus persicae

PubMed Central

Palma, Leopoldo; Muñoz, Delia; Berry, Colin; Murillo, Jesús; Ruiz de Escudero, Iñigo; Caballero, Primitivo

2014-01-01

This study describes the insecticidal activity of a novel Bacillus thuringiensis Cry-related protein with a deduced 799 amino acid sequence (~89 kDa) and ~19% pairwise identity to the 95-kDa-aphidicidal protein (sequence number 204) from patent US 8318900 and ~40% pairwise identity to the cancer cell killing Cry proteins (parasporins Cry41Ab1 and Cry41Aa1), respectively. This novel Cry-related protein contained the five conserved amino acid blocks and the three conserved domains commonly found in 3-domain Cry proteins. The protein exhibited toxic activity against the green peach aphid, Myzus persicae (Sulzer) (Homoptera: Aphididae) with the lowest mean lethal concentration (LC50 = 32.7 μg/mL) reported to date for a given Cry protein and this insect species, whereas it had no lethal toxicity against the Lepidoptera of the family Noctuidae Helicoverpa armigera (Hübner), Mamestra brassicae (L.), Spodoptera exigua (Hübner), S. frugiperda (J.E. Smith) and S. littoralis (Boisduval), at concentrations as high as ~3.5 μg/cm2. This novel Cry-related protein may become a promising environmentally friendly tool for the biological control of M. persicae and possibly also for other sap sucking insect pests. PMID:25384108

Single molecule real-time sequencing of Xanthomonas oryzae genomes reveals a dynamic structure and complex TAL (transcription activator-like) effector gene relationships

PubMed Central

Booher, Nicholas J.; Carpenter, Sara C. D.; Sebra, Robert P.; Wang, Li; Salzberg, Steven L.; Leach, Jan E.

2015-01-01

Pathogen-injected, direct transcriptional activators of host genes, TAL (transcription activator-like) effectors play determinative roles in plant diseases caused by Xanthomonas spp. A large domain of nearly identical, 33–35 aa repeats in each protein mediates DNA recognition. This modularity makes TAL effectors customizable and thus important also in biotechnology. However, the repeats render TAL effector (tal) genes nearly impossible to assemble using next-generation, short reads. Here, we demonstrate that long-read, single molecule real-time (SMRT) sequencing solves this problem. Taking an ensemble approach to first generate local, tal gene contigs, we correctly assembled de novo the genomes of two strains of the rice pathogen X. oryzae completed previously using the Sanger method and even identified errors in those references. Sequencing two more strains revealed a dynamic genome structure and a striking plasticity in tal gene content. Our results pave the way for population-level studies to inform resistance breeding, improve biotechnology and probe TAL effector evolution. PMID:27148456

On the cellular metabolism of the click chemistry probe 19-alkyne arachidonic acid[S

PubMed Central

Robichaud, Philippe Pierre; Poirier, Samuel J.; Boudreau, Luc H.; Doiron, Jérémie A.; Barnett, David A.; Boilard, Eric; Surette, Marc E.

2016-01-01

Alkyne and azide analogs of natural compounds that can be coupled to sensitive tags by click chemistry are powerful tools to study biological processes. Arachidonic acid (AA) is a FA precursor to biologically active compounds. 19-Alkyne-AA (AA-alk) is a sensitive clickable AA analog; however, its use as a surrogate to study AA metabolism requires further evaluation. In this study, AA-alk metabolism was compared with that of AA in human cells. Jurkat cell uptake of AA was 2-fold greater than that of AA-alk, but significantly more AA-Alk was elongated to 22:4. AA and AA-alk incorporation into and remodeling between phospholipid (PL) classes was identical indicating equivalent CoA-independent AA-PL remodeling. Platelets stimulated in the pre­sence of AA-alk synthesized significantly less 12-lipoxygenase (12-LOX) and cyclooxygenase products than in the presence of AA. Ionophore-stimulated neutrophils produced significantly more 5-LOX products in the presence of AA-alk than AA. Neutrophils stimulated with only exogenous AA-alk produced significantly less 5-LOX products compared with AA, and leukotriene B4 (LTB4)-alk was 12-fold less potent at stimulating neutrophil migration than LTB4, collectively indicative of weaker leukotriene B4 receptor 1 agonist activity of LTB4-alk. Overall, these results suggest that the use of AA-alk as a surrogate for the study of AA metabolism should be carried out with caution. PMID:27538823

Activity of vegetative insecticidal proteins Vip3Aa58 and Vip3Aa59 of Bacillus thuringiensis against lepidopteran pests.

PubMed

Baranek, Jakub; Kaznowski, Adam; Konecka, Edyta; Naimov, Samir

2015-09-01

Vegetative insecticidal proteins (Vips) secreted by some isolates of Bacillus thuringiensis show activity against insects and are regarded as insecticides against pests. A number of B. thuringiensis strains harbouring vip3A genes were isolated from different sources and identified by using a PCR based approach. The isolates with the highest insecticidal activity were indicated in screening tests, and their vip genes were cloned and sequenced. The analysis revealed two polymorphic Vip protein forms, which were classified as Vip3Aa58 and Vip3Aa59. After expression of the vip genes, the proteins were isolated and characterized. The activity of both toxins was estimated against economically important lepidopteran pests of woodlands (Dendrolimus pini), orchards (Cydia pomonella) and field crops (Spodoptera exigua). Vip3Aa58 and Vip3Aa59 were highly toxic and their potency surpassed those of many Cry proteins used in commercial bioinsecticides. Vip3Aa59 revealed similar larvicidal activity as Vip3Aa58 against S. exigua and C. pomonella. Despite 98% similarity of amino acid sequences of both proteins, Vip3Aa59 was significantly more active against D. pini. Additionally the effect of proteolytic activation of Vip58Aa and Vip3Aa59 on toxicity of D. pini and S. exigua was studied. Both Vip3Aa proteins did not show any activity against Tenebrio molitor (Coleoptera) larvae. The results suggest that the Vip3Aa58 and Vip3Aa59 toxins might be useful for controlling populations of insect pests of crops and forests. Copyright © 2015 Elsevier Inc. All rights reserved.

The gender identity/gender dysphoria questionnaire for adolescents and adults: further validity evidence.

PubMed

Singh, Devita; Deogracias, Joseph J; Johnson, Laurel L; Bradley, Susan J; Kibblewhite, Sarah J; Owen-Anderson, Allison; Peterson-Badali, Michele; Meyer-Bahlburg, Heino F L; Zucker, Kenneth J

2010-01-01

This study aimed to provide further validity evidence for the dimensional measurement of gender identity and gender dysphoria in both adolescents and adults. Adolescents and adults with gender identity disorder (GID) were compared to clinical control (CC) adolescents and adults on the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults (GIDYQ-AA), a 27-item scale originally developed by Deogracias et al. (2007). In Study 1, adolescents with GID (n = 44) were compared to CC adolescents (n = 98); and in Study 2, adults with GID (n = 41) were compared to CC adults (n = 94). In both studies, clients with GID self-reported significantly more gender dysphoria than did the CCs, with excellent sensitivity and specificity rates. In both studies, degree of self-reported gender dysphoria was significantly correlated with recall of cross-gender behavior in childhood-a test of convergent validity. The research and clinical utility of the GIDYQ-AA is discussed, including directions for further research in distinct clinical populations.

Identification, Characterization, and Developmental Expression Pattern of Type III Interferon Receptor Gene in the Chinese Goose

PubMed Central

Zhou, Qin; Chen, Shun; Qi, Yulin; Zhou, Hao; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Zhou, Xue; Cheng, Anchun

2015-01-01

Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-λ) was a newly identified member of IFN family, which plays IFN-like antiviral activity. Towards a better understanding of the type III interferon system in birds, type III interferon lambda receptor (IFNLR1) was first identified in the Chinese goose. In this paper, we had cloned 1952 bp for goose IFNLR1 (goIFNLR1), including an ORF of 1539 bp, encoding a 512-amino acid protein with a 20 aa predict signal peptide at its N terminal and a 23 aa transmembrane region. The predicted amino acid sequence of goIFNLR1 has 90%, 73%, and 34% identity with duck IFNLR1 (predicted sequence), chicken IFNLR1, and human IFNLR1, respectively. And the age-related tissue distribution of goIFNLR1 was identified by Real Time quantitative PCR (RT-qPCR), we found that the goIFNLR1 has a mainly expression in epithelium-rich tissues similar to other species', such as small intestinal, lung, liver, and stomach. Moreover, a relatively high expression of goIFNLR1 was also observed in the secondary immune tissues (harderian gland and cecal tonsil). The identification and tissue distribution of goIFNLR1 will facilitate further study of the role of IFN-λ in goose antiviral defense. PMID:26064884

Koi herpesvirus encodes and expresses a functional interleukin-10.

PubMed

Sunarto, Agus; Liongue, Clifford; McColl, Kenneth A; Adams, Mathew M; Bulach, Dieter; Crane, Mark St J; Schat, Karel A; Slobedman, Barry; Barnes, Andrew C; Ward, Alister C; Walker, Peter J

2012-11-01

Koi herpesvirus (KHV) (species Cyprinid herpesvirus 3) ORF134 was shown to transcribe a spliced transcript encoding a 179-amino-acid (aa) interleukin-10 (IL-10) homolog (khvIL-10) in koi fin (KF-1) cells. Pairwise sequence alignment indicated that the expressed product shares 25% identity with carp IL-10, 22 to 24% identity with mammalian (including primate) IL-10s, and 19.1% identity with European eel herpesvirus IL-10 (ahvIL-10). In phylogenetic analyses, khvIL-10 fell in a divergent position from all host IL-10 sequences, indicating extensive structural divergence following capture from the host. In KHV-infected fish, khvIL-10 transcripts were observed to be highly expressed during the acute and reactivation phases but to be expressed at very low levels during low-temperature-induced persistence. Similarly, KHV early (helicase [Hel] and DNA polymerase [DNAP]) and late (intercapsomeric triplex protein [ITP] and major capsid protein [MCP]) genes were also expressed at high levels during the acute and reactivation phases, but only low-level expression of the ITP gene was detected during the persistent phase. Injection of khvIL-10 mRNA into zebrafish (Danio rerio) embryos increased the number of lysozyme-positive cells to a similar degree as zebrafish IL-10. Downregulation of the IL-10 receptor long chain (IL-10R1) using a specific morpholino abrogated the response to both khvIL-10 and zebrafish IL-10 transcripts, indicating that, despite the structural divergence, khvIL-10 functions via this receptor. This is the first report describing the characteristics of a functional viral IL-10 gene in the Alloherpesviridae.

Pathogenic Serum Amyloid A 1.1 Shows a Long Oligomer-rich Fibrillation Lag Phase Contrary to the Highly Amyloidogenic Non-pathogenic SAA2.2*

PubMed Central

Srinivasan, Saipraveen; Patke, Sanket; Wang, Yun; Ye, Zhuqiu; Litt, Jeffrey; Srivastava, Sunit K.; Lopez, Maria M.; Kurouski, Dmitry; Lednev, Igor K.; Kane, Ravi S.; Colón, Wilfredo

2013-01-01

Serum amyloid A (SAA) is best known for being the main component of amyloid in the inflammation-related disease amyloid A (AA) amyloidosis. Despite the high sequence identity among different SAA isoforms, not all SAA proteins are pathogenic. In most mouse strains, the AA deposits mostly consist of SAA1.1. Conversely, the CE/J type mouse expresses a single non-pathogenic SAA2.2 protein that is 94% identical to SAA1.1. Here we show that SAA1.1 and SAA2.2 differ in their quaternary structure, fibrillation kinetics, prefibrillar oligomers, and fibril morphology. At 37 °C and inflammation-related SAA concentrations, SAA1.1 exhibits an oligomer-rich fibrillation lag phase of a few days, whereas SAA2.2 shows virtually no lag phase and forms small fibrils within a few hours. Deep UV resonance Raman, far UV-circular dichroism, atomic force microscopy, and fibrillation cross-seeding experiments suggest that SAA1.1 and SAA2.2 fibrils possess different morphology. Both the long-lived oligomers of pathogenic SAA1.1 and the fleeting prefibrillar oligomers of non-pathogenic SAA2.2, but not their respective amyloid fibrils, permeabilized synthetic bilayer membranes in vitro. This study represents the first comprehensive comparison between the biophysical properties of SAA isoforms with distinct pathogenicities, and the results suggest that structural and kinetic differences in the oligomerization-fibrillation of SAA1.1 and SAA2.2, more than their intrinsic amyloidogenicity, may contribute to their diverse pathogenicity. PMID:23223242

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

PubMed

Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

2017-10-01

Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic cycle of domestic rabies in Cameroon.

Characterization and virulence of Beauveria spp. recovered from emerald ash borer in southwestern Ontario, Canada.

PubMed

Johny, Shajahan; Kyei-Poku, George; Gauthier, Debbie; Frankenhuyzen, Kees van; Krell, Peter J

2012-09-15

The emerald ash borer (EAB), Agrilus planipennis (Coleoptera: Buprestidae), is an invasive wood boring beetle that is decimating North America's ash trees (Fraxinus spp.). To find effective and safe indigenous biocontrol agents to manage EAB, we conducted a survey in 2008-2009 of entomopathogenic fungi (EPF) infecting EAB in five outbreak sites in southwestern Ontario, Canada. A total of 78 Beauveria spp. isolates were retrieved from dead and mycosed EAB cadavers residing in the phloem tissues of dead ash barks, larval frass extracted from feeding galleries under the bark of dead trees. Molecular characterization using sequences of the ITS, 5' end of EF1-α and intergenic Bloc region fragments revealed that Beauveria bassiana and Beauveria pseudobassiana were commonly associated with EAB in the sampled sites. Based on phylogenetic analysis inferred from ITS sequences, 17 of these isolates clustered with B. bassiana, which further grouped into three different sub-clades. However, the combined EF1-α and Bloc sequences detected five genotypes among the three sub-clades. The remaining 61 isolates clustered with B. pseudobassiana, which had identical ITS sequences but were further subdivided into two genotypes by variation in the EF1-α and Bloc regions. Initial virulence screening against EAB adults of 23 isolates representing the different clades yielded 8 that produced more than 90% mortality in a single concentration assay. These isolates differed in virulence based on LC(50) values estimated from multiple concentration bioassay and based on mean survival times at a conidia concentration of 2×10(6) conidia/ml. B. bassiana isolate L49-1AA was significantly more virulent and produced more conidia on EAB cadavers compared to the other indigenous isolates and the commercial strain B. bassiana GHA suggesting that L49-1AA may have potential as a microbiological control agent against EAB. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016

PubMed Central

Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

2017-01-01

Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5–100% nucleotide (nt) and 98.3–100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4–99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic cycle of domestic rabies in Cameroon. PMID:29084223

Clonal evolution and clinical significance of copy number neutral loss of heterozygosity of chromosome arm 6p in acquired aplastic anemia.

PubMed

Betensky, Marisol; Babushok, Daria; Roth, Jacquelyn J; Mason, Philip J; Biegel, Jaclyn A; Busse, Tracy M; Li, Yimei; Lind, Curt; Papazoglou, Anna; Monos, Dimitri; Podsakoff, Gregory; Bessler, Monica; Olson, Timothy S

2016-01-01

Acquired aplastic anemia (aAA) results from the T cell-mediated autoimmune destruction of hematopoietic stem cells. Factors predicting response to immune suppression therapy (IST) or development of myelodysplastic syndrome (MDS) are beginning to be elucidated. Our recent data suggest most patients with aAA treated with IST develop clonal somatic genetic alterations in hematopoietic cells. One frequent acquired abnormality is copy-number neutral loss of heterozygosity on chromosome 6p (6p CN-LOH) involving the human leukocyte antigen (HLA) locus. We hypothesized that because 6p CN-LOH clones may arise from selective pressure to escape immune surveillance through deletion of HLA alleles, the development of 6p CN-LOH may affect response to IST. We used single nucleotide polymorphism array genotyping and targeted next-generation sequencing of HLA alleles to assess frequency of 6p CN-LOH, identity of HLA alleles lost through 6p CN-LOH, and impact of 6p CN-LOH on response to IST. 6p CN-LOH clones were present in 11.3% of patients, remained stable over time, and were not associated with development of MDS-defining cytogenetic abnormalities. Notably, no patient with 6p CN-LOH treated with IST achieved a complete response. In summary, clonal 6p CN-LOH in aAA defines a unique subgroup of patients that may provide insights into hematopoietic clonal evolution. Copyright © 2016 Elsevier Inc. All rights reserved.

Clonal Evolution and Clinical Significance of Copy Number Neutral Loss of Heterozygosity of Chromosome Arm 6p in Acquired Aplastic Anemia

PubMed Central

Betensky, Marisol; Babushok, Daria; Roth, Jacquelyn J.; Mason, Philip J; Biegel, Jaclyn A.; Busse, Tracy M; Li, Yimei; Lind, Curt; Papazoglou, Anna; Monos, Dimitri; Podsakoff, Gregory; Bessler, Monica; Olson, Timothy S.

2015-01-01

Acquired aplastic anemia (aAA) results from the T cell-mediated autoimmune destruction of hematopoietic stem cells. Factors predicting response to immune suppression therapy (IST) or development of myelodysplastic syndrome (MDS) are beginning to be elucidated. Our recent data suggest most patients with aAA treated with IST develop clonal somatic genetic alterations in hematopoietic cells. One frequent acquired abnormality is copy-number neutral loss of heterozygosity on chromosome 6p (6p CN-LOH) involving the human leukocyte antigen (HLA) locus. We hypothesized that because 6p CN-LOH clones may arise from selective pressure to escape immune surveillance through deletion of HLA alleles, the development of 6p CN-LOH may affect response to IST. We used single nucleotide polymorphism array genotyping and targeted next-generation sequencing of HLA alleles to assess frequency of 6p CN-LOH, identity of HLA alleles lost through 6p CN-LOH, and impact of 6p CN-LOH on response to IST. 6p CN-LOH clones were present in 11.3% of patients, remained stable over time, and were not associated with development of MDS-defining cytogenetic abnormalities. Notably, no patient with 6p CN-LOH treated with IST achieved a complete response. In summary, clonal 6p CN-LOH in aAA defines a unique subgroup of patients that may provide insights into hematopoietic clonal evolution. PMID:26702937

Some distinguishable properties between acid-stable and neutral types of alpha-amylases from acid-producing koji.

PubMed

Suganuma, Toshihiko; Fujita, Kiyotaka; Kitahara, Kanefumi

2007-11-01

The highly humid climate of Japan facilitates the growth of various molds. Among these molds, Aspergillus oryzae is the most important and popular in Japan, and has been used as yellow-koji in producing many traditional fermented beverages and foods, such as Japanese sake, and soy sauce. Taka-amylase A (TAA), a major enzyme produced by the mold, is well known worldwide to be a leading enzyme for industrial utilization and academic study, since many extensive studies have been carried out with TAA. In southern Kyushu, the other koji's of citric acid-producing molds have often been used, such as in the production of a traditional distilled liquor of shochu. The koji molds black-koji and white-koji produce two types of alpha-amylase, namely, acid-stable (AA) and common neutral (NA). The latter enzyme is enzymatically and genetically similar to TAA. In this review, we investigate AA from three molds, Aspergillus niger, A. kawachii and A. awamori, and the yeast Cryptococcus sp. regarding the distinguishable properties between AA and NA. (i) The N-terminus amino acid sequences of AA determined by molecular cloning started with the sequence of L-S-A-, whereas those of NA started with A-T-P-. (ii) Most of the full sequences of AA were composed of, besides a core catalytic domain, an extra domain of a hinge region and a carbohydrate binding domain, which could be responsible for raw-starch-digestibility. The AA from A. niger has no exceptionally extra domain, similarly to NA. (iii) Simple methods for distinguishing AA from NA using CNP-alpha-G3 and G5 as substrates were developed by our group. (iv) The number of subsite in AA on the basis of its cleavage pattern of maltooligosaccharides was estimated to be five, which differs from that of TAA, 7-9. AA has many advantages in industrial applications, such as its acid-stability, thermostability, and raw-starch digesting properties.

Perceptions of Insulin Treatment Among African Americans With Uncontrolled Type 2 Diabetes.

PubMed

Bockwoldt, Denise; Staffileno, Beth A; Coke, Lola; Quinn, Lauretta

2016-03-01

Little is known regarding perception of insulin treatment among midlife and older African American (AA) adults with type 2 diabetes, or how perception affects self-management behaviors. Using the Roy adaptation model, this qualitative descriptive study explored the perception of insulin treatment in midlife and older AAs living with uncontrolled type 2 diabetes. Three 1-hour focus groups were conducted with a total of 13 participants. Thematic analysis of transcribed audio recordings used the constant comparative method. Themes identified include (a) insulin as instigator of negative emotions, (b) adapting to a lifestyle with insulin, and (c) becoming an insulin user: a new identity. Adapting to insulin is a psychosocial process that commonly results in negative emotions, identity conflict, and new roles. Further research is needed to understand how AA adults perceive insulin treatment, understand the role of perception in self-management behaviors, and determine whether interventions to change perceptions may be effective in improving adaptation to diabetes. © The Author(s) 2014.

The retinal rod Na(+)/Ca(2+),K(+) exchanger contains a noncleaved signal sequence required for translocation of the N terminus.

PubMed

McKiernan, C J; Friedlander, M

1999-12-31

The retinal rod Na(+)/Ca(2+),K(+) exchanger (RodX) is a polytopic membrane protein found in photoreceptor outer segments where it is the principal extruder of Ca(2+) ions during light adaptation. We have examined the role of the N-terminal 65 amino acids in targeting, translocation, and integration of the RodX using an in vitro translation/translocation system. cDNAs encoding human RodX and bovine RodX through the first transmembrane domain were correctly targeted and integrated into microsomal membranes; deletion of the N-terminal 65 amino acids (aa) resulted in a translation product that was not targeted or integrated. Deletion of the first 65 aa had no effect on membrane targeting of full-length RodX, but the N-terminal hydrophilic domain no longer translocated. Chimeric constructs encoding the first 65 aa of bovine RodX fused to globin were translocated across microsomal membranes, demonstrating that the sequence could function heterologously. Studies of fresh bovine retinal extracts demonstrated that the first 65 aa are present in the native protein. These data demonstrate that the first 65 aa of RodX constitute an uncleaved signal sequence required for the efficient membrane targeting and proper membrane integration of RodX.

The potential influence of masculine identity on health-improving behavior in midlife and older African American men.

PubMed

Hooker, Steven P; Wilcox, Sara; Burroughs, Ericka L; Rheaume, Carol E; Courtenay, Will

2012-06-01

To gain a greater understanding of masculinity and its potential influence on health-improving behavior in midlife and older African American (AA) men. Forty-nine AA men aged 45-88 years completed in-depth interviews to ascertain their perspectives on masculinity, how masculine identity in this population might be influenced by age and physical activity level, or how it might impact health. Taped interviews were transcribed and organized for analysis with common themes identified by multiple researchers. Most often cited attributes of someone considered "manly" included a leader of a family/household, provider, strong work ethic, and masculine physique. Terms such as responsible, principled, and man of character also described the typical man. Potential negative and positive influences of manhood on health included avoiding health care appointments and being a good example to children/others, respectively. Themes associated with age-related changes in manhood were acceptance and being more health conscious. Elements associated with how manhood was influenced by AA race included stress and perseverance. Midlife and older AA men in this study primarily expressed views of masculinity that fit the traditional perception of manhood. However, the attributes revealed, such as family provider, responsibility, self-reliance, and perseverance, were viewed as having potential for both negative and positive impacts on health and health-improving behaviors. It will be essential to integrate these prevalent attributes of masculine identity into health promotion interventions such that they facilitate positive behavior change while not competing with gender role norms among this vulnerable group of men.

'It Was about Claiming Space': Exposure to Asian American Studies, Ethnic Organization Participation, and the Negotiation of Self among Southeast Asian Americans

ERIC Educational Resources Information Center

Trieu, Monica M.

2018-01-01

Despite the growing number of Asian American Studies (AAS) programs and Asian ethnic organizations across colleges and universities since the 1970s, surprisingly little empirical research examines the role of these aspects of higher education on Asian American identity. How do the roles of AAS curriculum and Asian American student organizations…

An Evaluative Review of Hemispheric Learning Potential

DTIC Science & Technology

1985-10-01

suggests that the name response (Aa) involves different mechanisms than the physically identical match (AA) (Posner & Mitchell, 1967). Furthermore, the...probably not Important In tasks employing suprathreshold stimulation . Benton and his colleagues used an electromechanical device to stimulate the...back of the hand. Three points lying In a straight line were stimulated In quick succession, and the subject’s task was to indicate from among four

Trichohyalin is a potential major autoantigen in human alopecia areata.

PubMed

Leung, Man Ching; Sutton, Chris W; Fenton, David A; Tobin, Desmond J

2010-10-01

Several lines of evidence support an autoimmune basis for alopecia areata (AA), a common putative autoimmune hair loss disorder. However, definitive support is lacking largely because the identity of hair follicle (HF) autoantigen(s) involved in its pathogenesis remains unknown. Here, we isolated AA-reactive HF-specific antigens from normal human scalp anagen HF extracts by immunoprecipitation using serum antibodies from 10 AA patients. Samples were analyzed by LC-MALDI-TOF/TOF mass spectrometry, which indicated strong reactivity to the hair growth phase-specific structural protein trichohyalin in all AA sera. Keratin 16 (K16) was also identified as another potential AA-relevant target HF antigen. Double immunofluorescence studies using AA (and control sera) together with a monoclonal antibody to trichohyalin revealed that AA sera contained immunoreactivity that colocalized with trichohyalin in the growth phase-specific inner root sheath of HF. Furthermore, a partial colocalization of AA serum reactivity with anti-K16 antibody was observed in the outer root sheath of the HF. In summary, this study supports the involvement of an immune response to anagen-specific HFs antigens in AA and specifically suggests that an immune response to trichohyalin and K16 may have a role in the pathogenesis of the enigmatic disorder.

Aristolochic Acid in the Etiology of Renal Cell Carcinoma

PubMed Central

Hoang, Margaret L.; Chen, Chung-Hsin; Chen, Pau-Chung; Roberts, Nicholas J.; Dickman, Kathleen G.; Yun, Byeong Hwa; Turesky, Robert J.; Pu, Yeong-Shiau; Vogelstein, Bert; Papadopoulos, Nickolas; Grollman, Arthur P.; Kinzler, Kenneth W.; Rosenquist, Thomas A.

2017-01-01

Background Aristolochia species used in the practice of traditional herbal medicine contains aristolochic acid (AA), an established human carcinogen contributing to urothelial carcinomas of the upper urinary tract. AA binds covalently to genomic DNA, forming aristolactam (AL)–DNA adducts. Here we investigated whether AA is also an etiologic factor in clear cell renal cell carcinoma (ccRCC). Methods We conducted a population-based case–control study to investigate the linkage between Aristolochia prescription history, cumulative AA consumption, and ccRCC incidence in Taiwan (5,709 cases and 22,836 matched controls). The presence and level of mutagenic dA-AL-I adducts were determined in the kidney DNA of 51 Taiwanese ccRCC patients. The whole-exome sequences of ccRCC tumors from 10 Taiwanese ccRCC patients with prior exposure to AA were determined. Results Cumulative ingestion of more than 250 mg of AA increased risk of ccRCC (OR, 1.25), and we detected dA-AL-I adducts in 76% of Taiwanese ccRCC patients. Furthermore, the distinctive AA mutational signature was evident in six of 10 sequenced ccRCC exomes from Taiwanese patients. Conclusions This study strongly suggests that AA contributes to the etiology of certain RCCs. Impact The current study offers compelling evidence implicating AA in a significant fraction of the RCC arising in Taiwan and illustrates the power of integrating epidemiologic, molecular, and genetic data in the investigation of cancer etiology. PMID:27555084

Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

PubMed

Oppert, Brenda; Dowd, Scot E; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

2012-01-01

Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor to date. Furthermore, the methods in this study are useful for comparative analyses in organisms lacking a sequenced genome.

Transcriptome Profiling of the Intoxication Response of Tenebrio molitor Larvae to Bacillus thuringiensis Cry3Aa Protoxin

PubMed Central

Oppert, Brenda; Dowd, Scot E.; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D.; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L.; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

2012-01-01

Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor to date. Furthermore, the methods in this study are useful for comparative analyses in organisms lacking a sequenced genome. PMID:22558093

A report on the outbreak of Zika virus on Easter Island, South Pacific, 2014.

PubMed

Tognarelli, J; Ulloa, S; Villagra, E; Lagos, J; Aguayo, C; Fasce, R; Parra, B; Mora, J; Becerra, N; Lagos, N; Vera, L; Olivares, B; Vilches, M; Fernández, J

2016-03-01

Zika virus (ZIKV) is an emerging mosquito-borne flavivirus circulating in Asia and Africa. In 2013, a large outbreak was reported on the archipelago of French Polynesia. In this study, we report the detection and molecular characterization of Zika virus for the first time in Chile from an outbreak among the inhabitants of Easter Island. A total of 89 samples from patients suspected of having ZIKV infection were collected between the period from January to May, 2014. Molecular diagnosis of the virus was performed by RT-PCR followed by the sequencing of the region containing the NS5 gene. A comparison of the viral nucleic acid sequence with those of other strains of ZIKA virus was performed using the MEGA software. Fifty-one samples were found positive for ZIKV by RT-PCR analysis. Further analysis of the NS5 gene revealed that the ZIKV strains identified in Easter Island were most closely related to those found in French Polynesia (99.8 to 99.9% nt and 100% aa sequence identity). These results strongly suggest that the transmission pathway leading to the introduction of Zika virus on Easter Island has its origin in French Polynesia.

Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain.

PubMed

Martella, V; Blixenkrone-Møller, M; Elia, G; Lucente, M S; Cirone, F; Decaro, N; Nielsen, L; Bányai, K; Carmichael, L E; Buonavoglia, C

2011-02-01

Both egg- and cell-adapted canine distemper virus (CDV) vaccines are suspected to retain residual virulence, especially if administered to immuno-suppressed animals, very young pups or to highly susceptible animal species. In the early 1980s, post-vaccine encephalitis was reported in dogs from various parts of Britain after administration of a particular batch of combined CDV Rockborn strain/canine adenovirus type-1 vaccine, although incrimination of the Rockborn strain was subsequently retracted. Notwithstanding, this, and other reports, led to the view that the Rockborn strain is less attenuated and less safe than other CDV vaccines, and the Rockborn strain was officially withdrawn from the markets in the mid 1990s. By sequencing the H gene of the strain Rockborn from the 46th laboratory passage, and a commercial vaccine (Candur(®) SH+P, Hoechst Rousell Vet GmbH), the virus was found to differ from the commonly used vaccine strain, Onderstepoort (93.0% nt and 91.7% aa), and to resemble more closely (99.6% nt and 99.3% aa) a CDV strain detected in China from a Lesser Panda (Ailurus fulgens). An additional four CDV strains matching (>99% nt identity) the Rockborn virus were identified in the sequence databases. Also, Rockborn-like strains were identified in two vaccines currently in the market. These findings indicate that Rockborn-like viruses may be recovered from dogs or other carnivores with distemper, suggesting cases of residual virulence of vaccines, or circulation of vaccine-derived Rockborn-like viruses in the field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Measuring Gender Dysphoria: A Multicenter Examination and Comparison of the Utrecht Gender Dysphoria Scale and the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults.

PubMed

Schneider, Catharina; Cerwenka, Susanne; Nieder, Timo O; Briken, Peer; Cohen-Kettenis, Peggy T; De Cuypere, Griet; Haraldsen, Ira R; Kreukels, Baudewijntje P C; Richter-Appelt, Hertha

2016-04-01

This study examined two instruments measuring gender dysphoria within the multicenter study of the European Network for the Investigation of Gender Incongruence (ENIGI). The Utrecht Gender Dysphoria Scale (UGDS) and the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults (GIDYQ-AA) were examined for their definitions of gender dysphoria and their psychometric properties, and evaluated for their congruence in assessing the construct. The sample of 318 participants consisted of 178 male-to-females (MtF) and 140 female-to-males (FtM) who were recruited from the four ENIGI gender clinics. Both instruments were significantly correlated in the group of MtFs. For the FtM group, there was a trend in the same direction but smaller. Gender dysphoria was found to be defined differently in the two instruments, which led to slightly different findings regarding the subgroups. The UGDS detected a difference between the subgroups of early and late onset of gender identity disorder in the group of MtFs, whereas the GIDYQ-AA did not. For the FtM group, no significant effect of age of onset was found. Therefore, both instruments seem to capture not only similar but also different aspects of gender dysphoria. The UGDS focusses on bodily aspects, gender identity, and gender role, while the GIDYQ-AA addresses subjective, somatic, social, and sociolegal aspects. For future research, consistency in theory and definition of gender dysphoria is needed and should be in line with the DSM-5 diagnosis of gender dysphoria in adolescents and adults.

Race-dependent association of sulfidogenic bacteria with colorectal cancer.

PubMed

Yazici, Cemal; Wolf, Patricia G; Kim, Hajwa; Cross, Tzu-Wen L; Vermillion, Karin; Carroll, Timothy; Augustus, Gaius J; Mutlu, Ece; Tussing-Humphreys, Lisa; Braunschweig, Carol; Xicola, Rosa M; Jung, Barbara; Llor, Xavier; Ellis, Nathan A; Gaskins, H Rex

2017-11-01

Colorectal cancer (CRC) incidence is higher in African Americans (AAs) compared with non-Hispanic whites (NHWs). A diet high in animal protein and fat is an environmental risk factor for CRC development. The intestinal microbiota is postulated to modulate the effects of diet in promoting or preventing CRC. Hydrogen sulfide, produced by autochthonous sulfidogenic bacteria, triggers proinflammatory pathways and hyperproliferation, and is genotoxic. We hypothesised that sulfidogenic bacterial abundance in colonic mucosa may be an environmental CRC risk factor that distinguishes AA and NHW. Colonic biopsies from uninvolved or healthy mucosa from CRC cases and tumour-free controls were collected prospectively from five medical centres in Chicago for association studies. Sulfidogenic bacterial abundance in uninvolved colonic mucosa of AA and NHW CRC cases was compared with normal mucosa of AA and NHW controls. In addition, 16S rDNA sequencing was performed in AA cases and controls. Correlations were examined among bacterial targets, race, disease status and dietary intake. AAs harboured a greater abundance of sulfidogenic bacteria compared with NHWs regardless of disease status. Bilophila wadsworthia -specific dsrA was more abundant in AA cases than controls. Linear discriminant analysis of 16S rRNA gene sequences revealed five sulfidogenic genera that were more abundant in AA cases. Fat and protein intake and daily servings of meat were significantly higher in AAs compared with NHWs, and multiple dietary components correlated with a higher abundance of sulfidogenic bacteria. These results implicate sulfidogenic bacteria as a potential environmental risk factor contributing to CRC development in AAs. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.

PubMed

Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia

2007-10-01

Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence-selective formation of other tobacco carcinogen-DNA adducts along K-ras- and p53-derived duplexes and the preferential modification of endogenously methylated CG dinucleotides by benzo[a]pyrene diol epoxide and acrolein.

Transfer RNA: a dancer between charging and mis-charging for protein biosynthesis.

PubMed

Zhou, Xiaolong; Wang, Enduo

2013-10-01

Transfer RNA plays a fundamental role in the protein biosynthesis as an adaptor molecule by functioning as a biological link between the genetic nucleotide sequence in the mRNA and the amino acid sequence in the protein. To perform its role in protein biosynthesis, it has to be accurately recognized by aminoacyl-tRNA synthetases (aaRSs) to generate aminoacyl-tRNAs (aa-tRNAs). The correct pairing between an amino acid with its cognate tRNA is crucial for translational quality control. Production and utilization of mis-charged tRNAs are usually detrimental for all the species, resulting in cellular dysfunctions. Correct aa-tRNAs formation is collectively controlled by aaRSs with distinct mechanisms and/or other trans-factors. However, in very limited instances, mis-charged tRNAs are intermediate for specific pathways or essential components for the translational machinery. Here, from the point of accuracy in tRNA charging, we review our understanding about the mechanism ensuring correct aa-tRNA generation. In addition, some unique mis-charged tRNA species necessary for the organism are also briefly described.

Systemic AA amyloidosis in the red fox (Vulpes vulpes).

PubMed

Rising, Anna; Cederlund, Ella; Palmberg, Carina; Uhlhorn, Henrik; Gaunitz, Stefan; Nordling, Kerstin; Ågren, Erik; Ihse, Elisabet; Westermark, Gunilla T; Tjernberg, Lars; Jörnvall, Hans; Johansson, Jan; Westermark, Per

2017-11-01

Amyloid A (AA) amyloidosis occurs spontaneously in many mammals and birds, but the prevalence varies considerably among different species, and even among subgroups of the same species. The Blue fox and the Gray fox seem to be resistant to the development of AA amyloidosis, while Island foxes have a high prevalence of the disease. Herein, we report on the identification of AA amyloidosis in the Red fox (Vulpes vulpes). Edman degradation and tandem MS analysis of proteolyzed amyloid protein revealed that the amyloid partly was composed of full-length SAA. Its amino acid sequence was determined and found to consist of 111 amino acid residues. Based on inter-species sequence comparisons we found four residue exchanges (Ser31, Lys63, Leu71, Lys72) between the Red and Blue fox SAAs. Lys63 seems unique to the Red fox SAA. We found no obvious explanation to how these exchanges might correlate with the reported differences in SAA amyloidogenicity. Furthermore, in contrast to fibrils from many other mammalian species, the isolated amyloid fibrils from Red fox did not seed AA amyloidosis in a mouse model. © 2017 The Protein Society.

Spectroscopic signatures of AA' and AB stacking of chemical vapor deposited bilayer MoS 2

DOE PAGES

Xia, Ming; Li, Bo; Yin, Kuibo; ...

2015-11-04

We discuss prominent resonance Raman and photoluminescence spectroscopic differences between AA'and AB stacked bilayer molybdenum disulfide (MoS 2) grown by chemical vapor deposition are reported. Bilayer MoS 2 islands consisting of the two stacking orders were obtained under identical growth conditions. Also, resonance Raman and photoluminescence spectra of AA' and AB stacked bilayer MoS 2 were obtained on Au nanopyramid surfaces under strong plasmon resonance. Both resonance Raman and photoluminescence spectra show distinct features indicating clear differences in interlayer interaction between these two phases. The implication of these findings on device applications based on spin and valley degrees of freedom.

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

Inadequate Reference Datasets Biased toward Short Non-epitopes Confound B-cell Epitope Prediction*

PubMed Central

Rahman, Kh. Shamsur; Chowdhury, Erfan Ullah; Sachse, Konrad; Kaltenboeck, Bernhard

2016-01-01

X-ray crystallography has shown that an antibody paratope typically binds 15–22 amino acids (aa) of an epitope, of which 2–5 randomly distributed amino acids contribute most of the binding energy. In contrast, researchers typically choose for B-cell epitope mapping short peptide antigens in antibody binding assays. Furthermore, short 6–11-aa epitopes, and in particular non-epitopes, are over-represented in published B-cell epitope datasets that are commonly used for development of B-cell epitope prediction approaches from protein antigen sequences. We hypothesized that such suboptimal length peptides result in weak antibody binding and cause false-negative results. We tested the influence of peptide antigen length on antibody binding by analyzing data on more than 900 peptides used for B-cell epitope mapping of immunodominant proteins of Chlamydia spp. We demonstrate that short 7–12-aa peptides of B-cell epitopes bind antibodies poorly; thus, epitope mapping with short peptide antigens falsely classifies many B-cell epitopes as non-epitopes. We also show in published datasets of confirmed epitopes and non-epitopes a direct correlation between length of peptide antigens and antibody binding. Elimination of short, ≤11-aa epitope/non-epitope sequences improved datasets for evaluation of in silico B-cell epitope prediction. Achieving up to 86% accuracy, protein disorder tendency is the best indicator of B-cell epitope regions for chlamydial and published datasets. For B-cell epitope prediction, the most effective approach is plotting disorder of protein sequences with the IUPred-L scale, followed by antibody reactivity testing of 16–30-aa peptides from peak regions. This strategy overcomes the well known inaccuracy of in silico B-cell epitope prediction from primary protein sequences. PMID:27189949

Molecular cloning of trypsin cDNAs and trypsin gene expression in the salmon louse Lepeophtheirus salmonis (Copepoda: Caligidae).

PubMed

Johnson, S C; Ewart, K V; Osborne, J A; Delage, D; Ross, N W; Murray, H M

2002-09-01

The salmon louse, Lepeophtheirus salmonis, is a marine ectoparasitic copepod that infects salmonid fishes. We are studying the interactions between this parasite and its salmonid hosts, as it is a common cause of disease in both wild and farmed stocks of salmon. In this paper, we report on the cloning and sequencing of seven trypsin-like enzymes from a cDNA library prepared from whole body preadult female and male L. salmonis. The predicted trypsin activation peptides are 23 or 24 residues in length, considerably longer than previously reported activation peptides of other animals. Differences in the putative signal and activation peptide sequences of the trypsin isoforms suggest that these forms differ in their regulation and function. The calculated molecular weights of the trypsins range from 23.6 to 23.7 kDa. There are eight cysteine residues, which suggest the presence of four disulfide bridges. These trypsins are very similar (>or=46% aa identity) to other crustacean trypsins and insect hypodermins. Using in situ hybridization techniques trypsinogen expression could be identified in all three cell types of the midgut.

Biochemical properties and atomic resolution structure of a proteolytically processed β-mannanase from cellulolytic Streptomyces sp. SirexAA-E.

PubMed

Takasuka, Taichi E; Acheson, Justin F; Bianchetti, Christopher M; Prom, Ben M; Bergeman, Lai F; Book, Adam J; Currie, Cameron R; Fox, Brian G

2014-01-01

β-Mannanase SACTE_2347 from cellulolytic Streptomyces sp. SirexAA-E is abundantly secreted into the culture medium during growth on cellulosic materials. The enzyme is composed of domains from the glycoside hydrolase family 5 (GH5), fibronectin type-III (Fn3), and carbohydrate binding module family 2 (CBM2). After secretion, the enzyme is proteolyzed into three different, catalytically active variants with masses of 53, 42 and 34 kDa corresponding to the intact protein, loss of the CBM2 domain, or loss of both the Fn3 and CBM2 domains. The three variants had identical N-termini starting with Ala51, and the positions of specific proteolytic reactions in the linker sequences separating the three domains were identified. To conduct biochemical and structural characterizations, the natural proteolytic variants were reproduced by cloning and heterologously expressed in Escherichia coli. Each SACTE_2347 variant hydrolyzed only β-1,4 mannosidic linkages, and also reacted with pure mannans containing partial galactosyl- and/or glucosyl substitutions. Examination of the X-ray crystal structure of the GH5 domain of SACTE_2347 suggests that two loops adjacent to the active site channel, which have differences in position and length relative to other closely related mannanases, play a role in producing the observed substrate selectivity.

Zooanthroponotic transmission of rotavirus in Haryana State of Northern India.

PubMed

Choudhary, P; Minakshi, P; Ranjan, K; Basanti, B

Rotaviruses are the major cause of severe gastroenteritis and mortality in young children and animals. Due to segmented nature of dsRNA genome and wide host range, vast genetic and antigenic diversity exists amongst different isolates of rotaviruses. A total of 230 fecal ovine and caprine samples collected from organized farms and villages in Haryana were screened for rotavirus detection. Samples were screened by latex agglutination test and RNA-PAGE followed by RT-PCR and nucleic acid sequencing. The latex agglutination test showed 25 newborn lamb and 4 kid fecal samples positive for rotavirus. However, RNA-PAGE showed only 9 lamb fecal samples positive for rotavirus. All the samples were subjected to RT-PCR employing vp4 and vp7 gene specific primers of group A rotavirus of ovine, bovine and human origin. Only two samples from lamb (Sheep18/Hisar/2013 and Sheep22/Hisar/2013) showed vp4 and vp7 gene specific amplification with human group A rotavirus (GAR) specific primer. However, they did not show any amplification with ovine and bovine rotavirus specific primers. The nucleotide as well as deduced amino acid sequence analysis of vp4 gene of these isolates showed >98/97% and vp7 gene >95/94% nt/aa identity with human GAR from different regions of the world. Based on nucleotide similarity search, Sheep18/Hisar/2013 and Sheep22/Hisar/2013 isolates were genotyped as G1P[8] and G1P[4]. Phylogenetic analysis also confirmed that these isolates were clustered closely with human rotaviruses from different regions of the world. Earlier, higher prevalence of human rotaviruses was reported from the sample collecting area. The amplification of ovine samples with human rotavirus gene specific primers, sequence identity and phylogenetic analysis strongly suggests the zoonotic transmission of human GAR to sheep.

The human serotonin N-acetyltransferase (EC 2.3.1.87) gene (AANAT): Structure, chromosomal localization, and tissue expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coon, S.L.; Bernard, M.; Roseboom, P.H.

Serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, AA-NAT, HGMW-approved symbol AANAT;EC 2.3.1.87) is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. We have found that the human AA-NAT gene spans {approx}2.5 kb, contains four exons, and is located at chromosome 17q25. The open reading frame encodes a 23.2-kDa protein that is {approx}80% identical to sheep and rat AA-NAT. The AA-NAT transcript ({approx}1 kb) is highly abundant in the pineal gland and is expressed at lower levels in the retina and in the Y79 retinoblastoma cell line. AA-NAT mRNA is also detectable atmore » low levels in several brain regions and the pituitary gland, but not in several peripheral tissues examined. Brain and pituitary AA-NAT could modulate serotonin-dependent aspects of human behavior and pituitary function. 31 refs., 5 figs.« less

Activation of T cells recognizing self 60-kD heat shock protein can protect against experimental arthritis

PubMed Central

1995-01-01

Lewis rats are susceptible to several forms of experimental arthritis- induced using heat-killed Mycobacterium tuberculosis (adjuvant arthritis, or AA), streptococcal cell walls, collagen type II, and the lipoidal amine CP20961. Prior immunization with the mycobacterial 65-kD heat shock protein (hsp65) was reported to protect against AA, and other athritis models not using M. tuberculosis, via a T cell-mediated mechanism. Hsp65 shares 48% amino acid identity with mammalian hsp60, which is expressed at elevated levels in inflamed synovia. Several studies have reported cross-reactive T cell recognition of mycobacterial hsp65 and self hsp60 in arthritic and normal individuals. We previously described nine major histocompatibility complex class II- restricted epitopes in mycobacterial hsp65 recognized by Lewis rat T cells. Of these only one, covering the 256-270 sequence, primed for cross-reactive T cell responses to the corresponding region of rat hsp60. Here we have tested each hsp65 epitope for protective activity by immunizing rats with synthetic peptides. A peptide containing the 256-270 epitope, which induced cross-reactive T cells, was the only one able to confer protection against AA. Similarly, administration of a T cell line specific for this epitope protected against AA. Preimmunization with the 256-270 epitope induced T cells that responded to heat-shocked syngeneic antigen-presenting cells, and also protected against CP20961-induced arthritis, indicating that activation of T cells, recognizing an epitope in self hsp60 can protect against arthritis induced without mycobacteria. Therefore, in contrast to the accepted concept that cross-reactive T cell recognition of foreign and self antigens might induce aggressive autoimmune disease, we propose that cross-reactivity between bacterial and self hsp60 might also be used to maintain a protective self-reactive T cell population. This discovery might have important implications for understanding T cell- mediated regulation of inflammation. PMID:7869052

Evaluation of the use of non-pathogenic porcine circovirus type 1 as a vaccine delivery virus vector to express antigenic epitopes of porcine reproductive and respiratory syndrome virus.

PubMed

Piñeyro, Pablo E; Kenney, Scott P; Giménez-Lirola, Luis G; Opriessnig, Tanja; Tian, Debin; Heffron, C Lynn; Meng, Xiang-Jin

2016-02-02

We previously demonstrated that the C-terminus of the capsid gene of porcine circovirus type 2 (PCV2) is an immune reactive epitope displayed on the surface of virions. Insertion of foreign epitope tags in the C-terminus produced infectious virions that elicited humoral immune responses against both PCV2 capsid and the inserted epitope tags, whereas mutation in the N terminus impaired viral replication. Since the non-pathogenic porcine circovirus type 1 (PCV1) shares similar genomic organization and significant sequence identity with pathogenic PCV2, in this study we evaluated whether PCV1 can serve as a vaccine delivery virus vector. Four different antigenic determinants of porcine reproductive and respiratory syndrome virus (PRRSV) were inserted in the C-terminus of the PCV1 capsid gene, the infectivity and immunogenicity of the resulting viruses are determined. We showed that an insertion of 12 (PRRSV-GP2 epitope II, PRRSV-GP3 epitope I, and PRRSV-GP5 epitope I), and 14 (PRRSV-GP5 epitope IV) amino acid residues did not affect PCV1 replication. We successfully rescued and characterized four chimeric PCV1 viruses expressing PRRSV linear antigenic determinants (GP2 epitope II: aa 40-51, ASPSHVGWWSFA; GP3 epitope I: aa 61-72, QAAAEAYEPGRS; GP5 epitope I: aa 35-46, SSSNLQLIYNLT; and GP5 epitope IV: aa 187-200, TPVTRVSAEQWGRP). We demonstrated that all chimeric viruses were stable and infectious in vitro and three chimeric viruses were infectious in vivo. An immunogenicity study in pigs revealed that PCV1-VR2385EPI chimeric viruses elicited neutralizing antibodies against PRRSV-VR2385. The results have important implications for further evaluating PCV1 as a potential vaccine delivery vector. Copyright © 2015 Elsevier B.V. All rights reserved.

Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

PubMed Central

Jenkins, Jeremy L; Dean, Donald H

2001-01-01

Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori) midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm) aminopeptidase N (APN) and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM), and unusually tight binding to the cadherin-like receptor (2.6 nM), which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac) was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research. PMID:11722800

ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

PubMed Central

Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

2016-01-01

Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

Making meaning of Alcoholics Anonymous for social workers: myths, metaphors, and realities.

PubMed

Davis, D R; Jansen, G G

1998-03-01

Alcoholics Anonymous (AA), the increasingly popular mutual-help program for alcoholics, is often criticized for being just another substitute addiction, emphasizing "powerlessness" to already disenfranchised groups, being a religion or cult, adhering to a medical model of disease instead of a strengths perspective, and other such areas of concern to social workers. Many of these interpretations are based on viewing AA as an alternative treatment model or a rational service delivery model. This article addresses common critiques of AA by offering a way of understanding it as a "normative narrative community," where identity transformation takes place through the use of metaphor and storytelling. The article suggests alternative meanings of key metaphors, such as "powerlessness," describes areas of program strength and potential barriers for social workers, and reviews current research on AA effectiveness.

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

[Genetic characterisation of Powassan virus (POWV) isolated from Haemophysalis longicornis ticks in Primorye and two strains of Tick-borne encephalitis virus (TBEV) (Flaviviridae, Flavivirus): Alma-Arasan virus (AAV) isolated from Ixodes persulcatus ticks in Kazakhstan and Malyshevo virus isolated from Aedes vexans nipponii mosquitoes in Khabarovsk kray].

PubMed

L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Deriabin, P G; Gitel'man, A K; Botikov, A G; Aristova, V A

2014-01-01

The complete genomes of the three tick-borne flaviviruses (genus Flavivirus, fam. Bunyaviridae) were sequenced: Povassan virus (POWV, strain LEIV-3070Prm, isolated from Haemophysalis logicornis in Primorsky Krai, Russia in 1977), Alma-Arasan virus (AAV, strain LEIV-1380Kaz, isolated from Ixodes persulcatus ticks in Kazakhstan in 1977) and Malyshevo virus (isolated from a pool of Aedes vexans nipponii mosquitoes, in the Khabarovsk Krai, Russia in 1978). It is shown that AAV and Malyshevo virus are the strains of Tick-borne encephalitis virus (TBEV) and belong to Sibirian and Far-Eastern genotypes, respectively (GenBank ID: AAV KJ744033; strain Malyshevo KJ744034). Phylogenetically AAV is closest related (94,6% nt and 98,3% aa identity) to TBEV strains, isolated in Sibiria (Vasilchenko, Aino, Chita-653, Irkutsk-12). Malyshevo virus is closest related (96,4% nt and 98,3% nt identity) to strains of TBEV, isolated in Far Eastern part of Russia (1230, Spassk-72, Primorye-89). POWV LEIV-3070Prm has 99.7% identity with the prototype strain POWV LB, isolated in Canada and 99.5% of isolates with Far-Eastern strains of POWV (Spassk-9 and Nadezdinsk-1991).

Rare coding variation in paraoxonase-1 is associated with ischemic stroke in the NHLBI Exome Sequencing Project.

PubMed

Kim, Daniel Seung; Crosslin, David R; Auer, Paul L; Suzuki, Stephanie M; Marsillach, Judit; Burt, Amber A; Gordon, Adam S; Meschia, James F; Nalls, Mike A; Worrall, Bradford B; Longstreth, W T; Gottesman, Rebecca F; Furlong, Clement E; Peters, Ulrike; Rich, Stephen S; Nickerson, Deborah A; Jarvik, Gail P

2014-06-01

HDL-associated paraoxonase-1 (PON1) is an enzyme whose activity is associated with cerebrovascular disease. Common PON1 genetic variants have not been consistently associated with cerebrovascular disease. Rare coding variation that likely alters PON1 enzyme function may be more strongly associated with stroke. The National Heart, Lung, and Blood Institute Exome Sequencing Project sequenced the coding regions (exomes) of the genome for heart, lung, and blood-related phenotypes (including ischemic stroke). In this sample of 4,204 unrelated participants, 496 had verified, noncardioembolic ischemic stroke. After filtering, 28 nonsynonymous PON1 variants were identified. Analysis with the sequence kernel association test, adjusted for covariates, identified significant associations between PON1 variants and ischemic stroke (P = 3.01 × 10(-3)). Stratified analyses demonstrated a stronger association of PON1 variants with ischemic stroke in African ancestry (AA) participants (P = 5.03 × 10(-3)). Ethnic differences in the association between PON1 variants with stroke could be due to the effects of PON1Val109Ile (overall P = 7.88 × 10(-3); AA P = 6.52 × 10(-4)), found at higher frequency in AA participants (1.16% vs. 0.02%) and whose protein is less stable than the common allele. In summary, rare genetic variation in PON1 was associated with ischemic stroke, with stronger associations identified in those of AA. Increased focus on PON1 enzyme function and its role in cerebrovascular disease is warranted.

Chloroplast Phylogenomics Indicates that Ginkgo biloba Is Sister to Cycads

PubMed Central

Wu, Chung-Shien; Chaw, Shu-Miaw; Huang, Ya-Yi

2013-01-01

Molecular phylogenetic studies have not yet reached a consensus on the placement of Ginkgoales, which is represented by the only living species, Ginkgo biloba (common name: ginkgo). At least six discrepant placements of ginkgo have been proposed. This study aimed to use the chloroplast phylogenomic approach to examine possible factors that lead to such disagreeing placements. We found the sequence types used in the analyses as the most critical factor in the conflicting placements of ginkgo. In addition, the placement of ginkgo varied in the trees inferred from nucleotide (NU) sequences, which notably depended on breadth of taxon sampling, tree-building methods, codon positions, positions of Gnetopsida (common name: gnetophytes), and including or excluding gnetophytes in data sets. In contrast, the trees inferred from amino acid (AA) sequences congruently supported the monophyly of a ginkgo and Cycadales (common name: cycads) clade, regardless of which factors were examined. Our site-stripping analysis further revealed that the high substitution saturation of NU sequences mainly derived from the third codon positions and contributed to the variable placements of ginkgo. In summary, the factors we surveyed did not affect results inferred from analyses of AA sequences. Congruent topologies in our AA trees give more confidence in supporting the ginkgo–cycad sister-group hypothesis. PMID:23315384

77 FR 8002 - Unified Agenda of Federal Regulatory and Deregulatory Actions

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-13

... Identifier No. 431 Americans With 3014-AA11 Disabilities Act (ADA) Accessibility Guidelines for... Actions Regulation Sequence No. Title Identifier No. 432 Americans With 3014-AA26 Disabilities Act (ADA... BARRIERS COMPLIANCE BOARD (ATBCB) Proposed Rule Stage 431. Americans With Disabilities Act (ADA...

Antimicrobial Peptides Produced by Selective Pressure Incorporation of Non-canonical Amino Acids.

PubMed

Nickling, Jessica H; Baumann, Tobias; Schmitt, Franz-Josef; Bartholomae, Maike; Kuipers, Oscar P; Friedrich, Thomas; Budisa, Nediljko

2018-05-04

Nature has a variety of possibilities to create new protein functions by modifying the sequence of the individual amino acid building blocks. However, all variations are based on the 20 canonical amino acids (cAAs). As a way to introduce additional physicochemical properties into polypeptides, the incorporation of non-canonical amino acids (ncAAs) is increasingly used in protein engineering. Due to their relatively short length, the modification of ribosomally synthesized and post-translationally modified peptides by ncAAs is particularly attractive. New functionalities and chemical handles can be generated by specific modifications of individual residues. The selective pressure incorporation (SPI) method utilizes auxotrophic host strains that are deprived of an essential amino acid in chemically defined growth media. Several structurally and chemically similar amino acid analogs can then be activated by the corresponding aminoacyl-tRNA synthetase and provide residue-specific cAA(s) → ncAA(s) substitutions in the target peptide or protein sequence. Although, in the context of the SPI method, ncAAs are also incorporated into the host proteome during the phase of recombinant gene expression, the majority of the cell's resources are assigned to the expression of the target gene. This enables efficient residue-specific incorporation of ncAAs often accompanied with high amounts of modified target. The presented work describes the in vivo incorporation of six proline analogs into the antimicrobial peptide nisin, a lantibiotic naturally produced by Lactococcus lactis. Antimicrobial properties of nisin can be changed and further expanded during its fermentation and expression in auxotrophic Escherichia coli strains in defined growth media. Thereby, the effects of residue-specific replacement of cAAs with ncAAs can deliver changes in antimicrobial activity and specificity. Antimicrobial activity assays and fluorescence microscopy are used to test the new nisin variants for growth inhibition of a Gram-positive Lactococcus lactis indicator strain. Mass spectroscopy is used to confirm ncAA incorporation in bioactive nisin variants.

Gene organization and primary structure of human hormone-sensitive lipase: possible significance of a sequence homology with a lipase of Moraxella TA144, an antarctic bacterium.

PubMed Central

Langin, D; Laurell, H; Holst, L S; Belfrage, P; Holm, C

1993-01-01

The human hormone-sensitive lipase (HSL) gene encodes a 786-aa polypeptide (85.5 kDa). It is composed of nine exons spanning approximately 11 kb, with exons 2-5 clustered in a 1.1-kb region. The putative catalytic site (Ser423) and a possible lipid-binding region in the C-terminal part are encoded by exons 6 and 9, respectively. Exon 8 encodes the phosphorylation site (Ser551) that controls cAMP-mediated activity and a second site (Ser553) that is phosphorylated by 5'-AMP-activated protein kinase. Human HSL showed 83% identity with the rat enzyme and contained a 12-aa deletion immediately upstream of the phosphorylation sites with an unknown effect on the activity control. Besides the catalytic site motif (Gly-Xaa-Ser-Xaa-Gly) found in most lipases, HSL shows no homology with other known lipases or proteins, except for a recently reported unexpected homology between the region surrounding its catalytic site and that of the lipase 2 of Moraxella TA144, an antarctic psychrotrophic bacterium. The gene of lipase 2, which catalyses lipolysis below 4 degrees C, was absent in the genomic DNA of five other Moraxella strains living at 37 degrees C. The lipase 2-like sequence in HSL may reflect an evolutionarily conserved cold adaptability that might be of critical survival value when low-temperature-mobilized endogenous lipids are the primary energy source (e.g., in poikilotherms or hibernators). The finding that HSL at 10 degrees C retained 3- to 5-fold more of its 37 degrees C catalytic activity than lipoprotein lipase or carboxyl ester lipase is consistent with this hypothesis. Images Fig. 5 PMID:8506334

Preceding immunosuppressive therapy with antithymocyte globulin and ciclosporin increases the incidence of graft rejection in children with aplastic anaemia who underwent allogeneic bone marrow transplantation from HLA-identical siblings.

PubMed

Kobayashi, Ryoji; Yabe, Hiromasa; Hara, Junichi; Morimoto, Akira; Tsuchida, Masahiro; Mugishima, Hideo; Ohara, Akira; Tsukimoto, Ichiro; Kato, Koji; Kigasawa, Hisato; Tabuchi, Ken; Nakahata, Tatsutoshi; Ohga, Shoichi; Kojima, Seiji

2006-12-01

The incidence of graft rejection was determined in 66 children with acquired aplastic anaemia (AA) following bone marrow transplantation (BMT) from a related donor. Eleven of 65 evaluable patients experienced either early or late rejection. Multivariate analysis identified previous immunosuppressive therapy with antithymocyte-globulin (ATG) and ciclosporin (CsA) as a risk factor for graft rejection (relative risk: 16.6, P = 0.001). Patients who received ATG and CsA had a significantly lower probability of failure-free survival than those who did not (69.7 +/- 6.2% vs. 87.9 +/- 8.0%, P = 0.044). These results suggest that BMT should be instituted immediately in children with severe AA who have human leucocyte antigen-identical siblings.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

PubMed

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Somatic HLA Mutations Expose the Role of Class I-Mediated Autoimmunity in Aplastic Anemia and its Clonal Complications.

PubMed

Babushok, Daria V; Duke, Jamie L; Xie, Hongbo M; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J D; Kearns, Jane; Porter, David L; Podsakoff, Gregory M; Eisenlohr, Laurence C; Biegel, Jaclyn A; Chou, Stella T; Monos, Dimitrios S; Bessler, Monica; Olson, Timothy S

2017-10-10

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by Human Leukocyte Antigen (HLA)-restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole exome sequencing (WES), we recently identified two aAA patients with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the Major Histocompatibility Complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping we screened 66 aAA patients for somatic HLA class I loss. We found somatic HLA loss in eleven patients (17%), with thirteen loss-of-function mutations in HLA-A *33:03, HLA-A *68:01, HLA-B *14:02 and HLA-B *40:02 alleles. Three patients had more than one mutation targeting the same HLA allele. Interestingly, HLA-B *14:02 and HLA-B *40:02 were significantly overrepresented in aAA patients, compared to ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA, and establishes a novel link between aAA patients' immunogenetics and clonal evolution.

Somatic HLA mutations expose the role of class I–mediated autoimmunity in aplastic anemia and its clonal complications

PubMed Central

Duke, Jamie L.; Xie, Hongbo M.; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J. D.; Kearns, Jane; Porter, David L.; Podsakoff, Gregory M.; Eisenlohr, Laurence C.; Biegel, Jaclyn A.; Chou, Stella T.; Monos, Dimitrios S.; Bessler, Monica; Olson, Timothy S.

2017-01-01

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by human leukocyte antigen (HLA)–restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole-exome sequencing (WES), we recently identified 2 patients with aAA with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the major histocompatibility complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping, we screened 66 patients with aAA for somatic HLA class I loss. We found somatic HLA loss in 11 patients (17%), with 13 loss-of-function mutations in HLA-A*33:03, HLA-A*68:01, HLA-B*14:02, and HLA-B*40:02 alleles. Three patients had more than 1 mutation targeting the same HLA allele. Interestingly, HLA-B*14:02 and HLA-B*40:02 were significantly overrepresented in patients with aAA compared with ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA and establishes a novel link between immunogenetics and clonal evolution of patients with aAA. PMID:28971166

Evolution of insect arylalkylamine N-acetyltransferases: Structural evidence from the yellow fever mosquito, Aedes aegypti

PubMed Central

Han, Qian; Robinson, Howard; Ding, Haizhen; Christensen, Bruce M.; Li, Jianyong

2012-01-01

Arylalkylamine N-acetyltransferase (aaNAT) catalyzes the transacetylation from acetyl-CoA to arylalkylamines. aaNATs are involved in sclerotization and neurotransmitter inactivation in insects. Phyletic distribution analysis confirms three clusters of aaNAT-like sequences in insects: typical insect aaNAT, polyamine NAT-like aaNAT, and mosquito unique putative aaNAT (paaNAT). Here we studied three proteins: aaNAT2, aaNAT5b, and paaNAT7, each from a different cluster. aaNAT2, a protein from the typical insect aaNAT cluster, uses histamine as a substrate as well as the previously identified arylalkylamines. aaNAT5b, a protein from polyamine NAT -like aaNAT cluster, uses hydrazine and histamine as substrates. The crystal structure of aaNAT2 was determined using single-wavelength anomalous dispersion methods, and that of native aaNAT2, aaNAT5b and paaNAT7 was detected using molecular replacement techniques. All three aaNAT structures have a common fold core of GCN5-related N-acetyltransferase superfamily proteins, along with a unique structural feature: helix/helices between β3 and β4 strands. Our data provide a start toward a more comprehensive understanding of the structure–function relationship and physiology of aaNATs from the mosquito Aedes aegypti and serve as a reference for studying the aaNAT family of proteins from other insect species. The structures of three different types of aaNATs may provide targets for designing insecticides for use in mosquito control. PMID:22753468

Automated sequence analysis and editing software for HIV drug resistance testing.

PubMed

Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle

2012-05-01

Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.

The Complete Genome Phylogeny of Geographically Distinct Dengue Virus Serotype 2 Isolates (1944-2013) Supports Further Groupings within the Cosmopolitan Genotype

PubMed Central

Ali, Akhtar; Ali, Ijaz

2015-01-01

Dengue virus serotype 2 (DENV-2) isolates have been implicated in deadly outbreaks of dengue fever (DF) and dengue hemorrhagic fever (DHF) in several regions of the world. Phylogenetic analysis of DENV-2 isolates collected from particular countries has been performed using partial or individual genes but only a few studies have examined complete whole-genome sequences collected worldwide. Herein, 50 complete genome sequences of DENV-2 isolates, reported over the past 70 years from 19 different countries, were downloaded from GenBank. Phylogenetic analysis was conducted and evolutionary distances of the 50 DENV-2 isolates were determined using maximum likelihood (ML) trees or Bayesian phylogenetic analysis created from complete genome nucleotide (nt) and amino acid (aa) sequences or individual gene sequences. The results showed that all DENV-2 isolates fell into seven main groups containing five previously defined genotypes. A Cosmopolitan genotype showed further division into three groups (C-I, C-II, and C-III) with the C-I group containing two subgroups (C-IA and C-IB). Comparison of the aa sequences showed specific mutations among the various groups of DENV-2 isolates. A maximum number of aa mutations was observed in the NS5 gene, followed by the NS2A, NS3 and NS1 genes, while the smallest number of aa substitutions was recorded in the capsid gene, followed by the PrM/M, NS4A, and NS4B genes. Maximum evolutionary distances were found in the NS2A gene, followed by the NS4A and NS4B genes. Based on these results, we propose that genotyping of DENV-2 isolates in future studies should be performed on entire genome sequences in order to gain a complete understanding of the evolution of various isolates reported from different geographical locations around the world. PMID:26414178

Ethnic Identity and Major Depression in Asian American Subgroups Nationwide: Differential Findings in Relation to Subcultural Contexts.

PubMed

Ai, Amy L; Nicdao, Ethel G; Appel, Hoa B; Lee, Daniel Hyung Jik

2015-12-01

Asian Americans (AA) are the fastest growing minority population in the United States. Leading AA scholars have highlighted the unmet service needs and the necessity to investigate subgroup variations in the mental health of AAs. This study addressed a research gap of whether racial and ethnic identity (REI) in three AA subgroups (Chinese, Filipino, and Vietnamese) consistently protects against major depressive disorder (MDD), counteracting the deleterious role of discrimination. Using the National Latino and Asian American Study (NLAAS), we explored the varying and incremental predictive values of REI, above and beyond the effects of known demographic and acculturation predictors, alongside other potentially protective factors. In three sets of two-step logistic regressions, REI had an inverse relationship with MDD in the Filipino subgroup only but a positive association in the Chinese subgroup. The damaging role of negative REI moderated the effect of discrimination. The longest stay in the United States and discrimination predicted a higher likelihood of a MDD diagnosis in the Filipino subgroup. Social support contributed to the lower odds of MDD in Chinese and Vietnamese subgroups, had lower odds of having MDD, and religious attendance may act as a protective factor in the Vietnamese subgroup. Our findings do not reinforce uniform protection of REI but lend partial support for two underlying rationales. Based on cultural psychologists' framework, inconsistent findings are interpreted within the sociocultural contexts of the 3 subgroups. © 2015 Wiley Periodicals, Inc.

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

PubMed

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Rare coding variation in paraoxonase-1 is associated with ischemic stroke in the NHLBI Exome Sequencing Project[S

PubMed Central

Kim, Daniel Seung; Crosslin, David R.; Auer, Paul L.; Suzuki, Stephanie M.; Marsillach, Judit; Burt, Amber A.; Gordon, Adam S.; Meschia, James F.; Nalls, Mike A.; Worrall, Bradford B.; Longstreth, W. T.; Gottesman, Rebecca F.; Furlong, Clement E.; Peters, Ulrike; Rich, Stephen S.; Nickerson, Deborah A.; Jarvik, Gail P.

2014-01-01

HDL-associated paraoxonase-1 (PON1) is an enzyme whose activity is associated with cerebrovascular disease. Common PON1 genetic variants have not been consistently associated with cerebrovascular disease. Rare coding variation that likely alters PON1 enzyme function may be more strongly associated with stroke. The National Heart, Lung, and Blood Institute Exome Sequencing Project sequenced the coding regions (exomes) of the genome for heart, lung, and blood-related phenotypes (including ischemic stroke). In this sample of 4,204 unrelated participants, 496 had verified, noncardioembolic ischemic stroke. After filtering, 28 nonsynonymous PON1 variants were identified. Analysis with the sequence kernel association test, adjusted for covariates, identified significant associations between PON1 variants and ischemic stroke (P = 3.01 × 10−3). Stratified analyses demonstrated a stronger association of PON1 variants with ischemic stroke in African ancestry (AA) participants (P = 5.03 × 10−3). Ethnic differences in the association between PON1 variants with stroke could be due to the effects of PON1Val109Ile (overall P = 7.88 × 10−3; AA P = 6.52 × 10−4), found at higher frequency in AA participants (1.16% vs. 0.02%) and whose protein is less stable than the common allele. In summary, rare genetic variation in PON1 was associated with ischemic stroke, with stronger associations identified in those of AA. Increased focus on PON1 enzyme function and its role in cerebrovascular disease is warranted. PMID:24711634

Wear behaviors of pure aluminum and extruded aluminum alloy (AA2024-T4) under variable vertical loads and linear speeds

NASA Astrophysics Data System (ADS)

Jung, Jeki; Oak, Jeong-Jung; Kim, Yong-Hwan; Cho, Yi Je; Park, Yong Ho

2017-11-01

The aim of this study was to investigate the transition of wear behavior for pure aluminum and extruded aluminum alloy 2024-T4 (AA2024-T4). The wear test was carried using a ball-on-disc wear testing machine at various vertical loads and linear speeds. The transition of wear behaviors was analyzed based on the microstructure, wear tracks, wear cross-section, and wear debris. The critical wear rates for each material are occurred at lower linear speed for each vertical load. The transition of wear behavior was observed in which abrasion wears with the generation of an oxide layer, fracture of oxide layer, adhesion wear, severe adhesion wear, and the generation of seizure occurred in sequence. In case of the pure aluminum, the change of wear debris occurred in the order of blocky, flake, and needle-like debris. Cutting chip, flake-like, and coarse flake-like debris was occurred in sequence for the extruded AA2024-T4. The transition in the wear behavior of extruded AA2024-T4 occurred slower than in pure aluminum.

Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia.

PubMed

Shpilman, Michal; Hollander-Cohen, Lian; Ventura, Tomer; Gertler, Arieh; Levavi-Sivan, Berta

2014-10-01

Full-length cDNA encoding two leptin sequences (tLepA and tLepB) and one leptin receptor sequence (tLepR) were identified in tilapia (Oreochromis niloticus). The full-length cDNA of tLepR was 3423bp, encoding a protein of 1140 amino acid (aa) which contained all functionally important domains conserved among vertebrate leptin receptors. The cDNAs of tLepA and tLepB were 486bp and 459bp in length, encoding proteins of 161 aa and 152 aa, respectively. Modeling the three-dimensional structures of tLepA and tLepB predicted strong conservation of tertiary structure with that of human leptin, comprised of four helixes. Using synteny, the tLeps were found near common genes, such as IMPDH1 and LLRC4. The cDNA for tLepA and tLepB was cloned and synthetic cDNA optimized for expression in Escherichia coli was prepared according to the cloned sequence. The tLepA- and tLepB-expressing plasmids were transformed into E. coli and expressed as recombinant proteins upon induction with nalidixic acid, found almost entirely in insoluble inclusion bodies (IBs). The proteins were solubilized, refolded and purified to homogeneity by anion-exchange chromatography. In the case of tLepA, the fraction eluted contained a mixture of monomers and dimers. The purified tLepA and tLepB monomers and tLepA dimer showed a single band of ∼15kDa on an SDS-polyacrylamide gel in the presence of reducing agent, whereas the tLepA dimer showed one band of ∼30kDa in the absence of reducing agent, indicating its formation by S-S bonds. The three tLeps were biologically active in promoting proliferation of BAF/3 cells stably transfected with the long form of human leptin receptor (hLepR), but their activity was four orders of magnitude lower than that of mammalian leptin. Furthermore, the three tLeps were biologically active in promoting STAT-LUC activation in COS7 cells transfected with the identified tLepR but not in cells transfected with hLepR. tLepA was more active than tLepB. Low or no activity likely resulted from low identity (9-22%) to mammalian leptins. In an in vivo experiment in which tilapia were fed ad libitum or fasted, there was no significant difference in the expressions of tLepA, tLepB or tLepR in the brain between the two groups examined both by real-time PCR and RNA next generation sequencing. In conclusion, in the present report we show novel, previously unknown sequences of tilapia leptin receptor and two leptins and prepare two biologically active recombinant leptin proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

Isolation and characterization of a new enterovirus F in yak feces in the Qinghai-Tibetan Plateau.

PubMed

He, Huan; Tang, Cheng; Chen, Xinnuo; Yue, Hua; Ren, Yupeng; Liu, Yan; Zhang, Bin

2017-02-01

An enterovirus (EV) strain, designated as SWUN-AB001, was isolated in the Qinghai-Tibetan Plateau from a yak with severe diarrheal disease. The complete genome of strain SWUN-AB001 was 7,382 bp in length and shared 35.1-68.5% nt identities with bovine EVs belonging to a candidate new type EV-F7. Using the sequence difference values in the VP1 gene as a criterion for demarcating a new serotype/genotype in the Enterovirus genus, strain SWUN-AB001 had only a 71.1% nt and a 79.2% aa identity, in the VP1 region, with the most closely matched EV, further indicating that a new type of EV had been identified. Phylogenetic analysis of the nt sequence of the viral polyprotein and of VP1 genes demonstrated that the virus fell within the EV-F cluster, but was located in a unique lineage. Furthermore, a large-scale surveillance study indicated that the prevalence of this EV in yaks was 31.05% (95% CI = 25.5-37.6%) in 235 animals with diarrhea and 24.13% (95% CI = 17.4-32.4%) in 116 healthy yaks. However, there was no significant difference in virus prevalence between diarrheal and healthy samples. Interestingly, in the Tibet region, diarrheal feces had a higher incidence of EVs than feces of healthy yaks (odd ratios = 6.03, 95% CI = 1.93-18.86), indicating that the incidence of EV was potentially correlated with the clinical symptom of diarrhea in yaks.

Gene expression profiles of prohibitin in testes of Octopus tankahkeei (ot-phb) revealing its possible role during spermiogenesis.

PubMed

Mao, Hai-Tao; Wang, Da-Hui; Lan, Zhou; Zhou, Hong; Yang, Wan-Xi

2012-05-01

Prohibitin is essential for intracellular homeostasis and stabilization of mitochondrial respiratory chain complexes. To explore its functions during spermiogenesis of Octopus tankahkeei (O. tankahkeei), we have cloned and sequenced the cDNA of this mammalian PHB homologue (termed ot-PHB) from the testes of O. tankahkeei. The 1165 bp ot-phb cDNA contains a 100 bp 5' UTR, a 882 bp open reading frame and a 183 bp 3' UTR. The putative ot-PHB protein owns a transmembrane domain from 6 to 31 amino acid (aa) and a putative PHB domain from 26 to 178 aa. Protein alignment demonstrated that ot-PHB had 73.3, 73.6, 74.0, 75.1, and 45.4% identity with its homologues in Homo sapiens, Mus muculus, Danio rerio, Xenopus tropicalis and Trypanosoma brucei, respectively. Tissue distribution profile analysis revealed its presence in all the tissues examined. In situ hybridization in spermiogenic cells demonstrated that ot-phb was expressed moderately at the beginning of the spermiogenesis. The abundance of transcripts increased in intermediate spermatids and in drastically remodeling final spermatids. In mature spermatozoa, the residuary transcripts concentrated around the chondriosomal mantle where mitochondria assemble around. In summary, the expression of ot-phb during spermiogenesis implicates a potential function of this protein during mitochondrial ubiquitination. It is the first time to implicate the role of prohibitin in cephalopod spermiogenesis.

Biochemical Properties and Atomic Resolution Structure of a Proteolytically Processed β-Mannanase from Cellulolytic Streptomyces sp. SirexAA-E

PubMed Central

Takasuka, Taichi E.; Acheson, Justin F.; Bianchetti, Christopher M.; Prom, Ben M.; Bergeman, Lai F.; Book, Adam J.; Currie, Cameron R.; Fox, Brian G.

2014-01-01

β-mannanase SACTE_2347 from cellulolytic Streptomyces sp. SirexAA-E is abundantly secreted into the culture medium during growth on cellulosic materials. The enzyme is composed of domains from the glycoside hydrolase family 5 (GH5), fibronectin type-III (Fn3), and carbohydrate binding module family 2 (CBM2). After secretion, the enzyme is proteolyzed into three different, catalytically active variants with masses of 53, 42 and 34 kDa corresponding to the intact protein, loss of the CBM2 domain, or loss of both the Fn3 and CBM2 domains. The three variants had identical N-termini starting with Ala51, and the positions of specific proteolytic reactions in the linker sequences separating the three domains were identified. To conduct biochemical and structural characterizations, the natural proteolytic variants were reproduced by cloning and heterologously expressed in Escherichia coli. Each SACTE_2347 variant hydrolyzed only β-1,4 mannosidic linkages, and also reacted with pure mannans containing partial galactosyl- and/or glucosyl substitutions. Examination of the X-ray crystal structure of the GH5 domain of SACTE_2347 suggests that two loops adjacent to the active site channel, which have differences in position and length relative to other closely related mannanases, play a role in producing the observed substrate selectivity. PMID:24710170

Characterization of receptor of activated C kinase 1 (RACK1) and functional analysis during larval metamorphosis of the oyster Crassostrea angulata.

PubMed

Yang, Bingye; Pu, Fei; Qin, Ji; You, Weiwei; Ke, Caihuan

2014-03-10

During a large-scale screen of the larval transcriptome library of the Portuguese oyster, Crassostrea angulata, the oyster gene RACK, which encodes a receptor of activated protein kinase C protein was isolated and characterized. The cDNA is 1,148 bp long and has a predicted open reading frame encoding 317 aa. The predicted protein shows high sequence identity to many RACK proteins of different organisms including molluscs, fish, amphibians and mammals, suggesting that it is conserved during evolution. The structural analysis of the Ca-RACK1 genomic sequence implies that the Ca-RACK1 gene has seven exons and six introns, extending approximately 6.5 kb in length. It is expressed ubiquitously in many oyster tissues as detected by RT-PCR analysis. The Ca-RACK1 mRNA expression pattern was markedly increased at larval metamorphosis; and was further increased along with Ca-RACK1 protein synthesis during epinephrine-induced metamorphosis. These results indicate that the Ca-RACK1 plays an important role in tissue differentiation and/or in cell growth during larval metamorphosis in the oyster, C. angulata. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization of Cyt2Bc Toxin from Bacillus thuringiensis subsp. medellin

PubMed Central

Juárez-Pérez, Victor; Guerchicoff, Alejandra; Rubinstein, Clara; Delécluse, Armelle

2002-01-01

We cloned and sequenced a new cytolysin gene from Bacillus thuringiensis subsp. medellin. Three IS240-like insertion sequence elements and the previously cloned cyt1Ab and p21 genes were found in the vicinity of the cytolysin gene. The cytolysin gene encodes a protein 29.7 kDa in size that is 91.5% identical to Cyt2Ba from Bacillus thuringiensis subsp. israelensis and has been designated Cyt2Bc. Inclusions containing Cyt2Bc were purified from the crystal-negative strain SPL407 of B. thuringiensis. Cyt2Bc reacted weakly with antibodies directed against Cyt2Ba and was not recognized by an antiserum directed against the reference cytolysin Cyt1Aa. Cyt2Bc was hemolytic only upon activation with trypsin and had only one-third to one-fifth of the activity of Cyt2Ba, depending on the activation time. Cyt2Bc was also mosquitocidal against Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus, including strains resistant to the Bacillus sphaericus binary toxin. Its toxicity was half of that of Cyt2Ba on all mosquito species except resistant C. quinquefasciatus. PMID:11872472

Development of clinical paroxysmal nocturnal haemoglobinuria in children with aplastic anaemia.

PubMed

Narita, Atsushi; Muramatsu, Hideki; Okuno, Yusuke; Sekiya, Yuko; Suzuki, Kyogo; Hamada, Motoharu; Kataoka, Shinsuke; Ichikawa, Daisuke; Taniguchi, Rieko; Murakami, Norihiro; Kojima, Daiei; Nishikawa, Eri; Kawashima, Nozomu; Nishio, Nobuhiro; Hama, Asahito; Takahashi, Yoshiyuki; Kojima, Seiji

2017-09-01

The clinical significance of paroxysmal nocturnal haemoglobinuria (PNH) in children with aplastic anaemia (AA) remains unclear. We retrospectively studied 57 children with AA between 1992 and 2010. During the follow-up, five patients developed clinical PNH, in whom somatic PIGA mutations were detected by targeted sequencing. The 10-year probability of clinical PNH development was 10·2% (95% confidence interval, 3·6-20·7%). Furthermore, the detection of minor PNH clones by flow cytometry at AA diagnosis was a risk factor for the subsequent development of clinical PNH. These patients with PNH clones at AA diagnosis should undergo periodic monitoring for potential clinical PNH development. © 2017 John Wiley & Sons Ltd.

Sequence Analysis of Different Domains of Plasmodium vivax Apical Membrane Antigen (PvAMA-1 gene) Locus in Iran.

PubMed

Motevalli Haghi, A; Nateghpour, M; Edrissian, Ghh; Sepehrizadeh, Z; Mohebali, M; Khoramizade, Mr; Shahrbabak, S Sabouri; Moghimi, H

2012-01-01

Plasmodium vivax is responsible for approximately 80 million malaria cases in the world. Apical membrane antigen1 (AMA-1) is a type I integral membrane protein present in all Plasmodium species. AMA-1 interferes in critical steps of invasion of human hepatocytes by sporozoites and red blood cells by merozoites and is one of the most immunodominant antigens for eliciting a protective immune response in human. It is considered as a promising antigen for inclusion in a vaccine against P. vivax. Since more knowledge is needed to lighten the scope of such antigen we compared genetic variation in P. vivax AMA-1from an Iranian isolate with those reported from some of the other malarious countries so far. P. vivax genomic DNA was extracted from the whole blood of an Iranian patient with patent P. vivax infection. The nucleotide sequence for 446 amino acid (AA) residues (42-488 of PvAMA-1) was amplified by PCR and cloned in pUC19 vector for sequencing. Sequence analysis of the antigen showed a high degree of identity (99%) with strong homology to the PvAMA-1 gene of P. vivax S3 and SKO814 isolates from India and Korea (Asian isolates) respectively, and 96% similarity with P. vivax Sal-1 AMA-1 gene from El Salvador. We cloned and characterized three domains of PvAMA-1 gene from an Iranian patient. Predicted protein sequence of this gene showed some discrepancies in corresponding protein in comparing with similar genes reported from other malarious countries.

Identification of AaCASPS7, an effector caspase in Aedes albopictus.

PubMed

Feng, Lingyan; Liu, Hao; Li, Xiaomei; Qiao, Jialu; Wang, Shengya; Guo, Deyin; Liu, Qingzhen

2016-11-15

Aedes albopictus mosquito is a vector of various arboviruses and is becoming a significant threat to public health due to its rapid global expansion. Several reports suggest that apoptosis could be a factor limiting arbovirus infection in mosquitoes. Thus, it is significant to identify apoptosis pathway and study the correlation between apoptosis and virus infection in mosquitoes. Apoptosis is a type of programmed cell death that plays a vital role in immunity, development, and tissue homeostasis. Caspases are a family of conserved proteases playing important roles in apoptosis. In this study, we identified Aedes albopictus AaCASPS7, a caspase shared high identity with dipteran insect drICE orthologs. Phylogenetic analysis showed the closest relative of AaCASPS7 was Aedes aegypti AeCASPS7. AaCASPS7 displayed several features that were typical of an effector caspase and showed significant activity to effector caspase substrates. Aacasps7 transcripts were expressed ubiquitously in developmental and adult stages in Aedes albopictus mosquitoes. Transient expression of AaCASPS7 induced caspase-dependent apoptosis in C6/36 cells. Taken together the above data, this study identified a novel caspase, AaCASPS7, which might function as an apoptotic caspase. Further study the function of AaCASPS7 would facilitate better understanding the apoptotic mechanism in Aedes albopictus mosquito. Copyright © 2016 Elsevier B.V. All rights reserved.

Hydrogen isotopes in individual amino acids reflect differentiated pools of hydrogen from food and water in Escherichia coli.

PubMed

Fogel, Marilyn L; Griffin, Patrick L; Newsome, Seth D

2016-08-09

Hydrogen isotope (δ(2)H) analysis is widely used in animal ecology to study continental-scale movement because δ(2)H can trace precipitation and climate. To understand the biochemical underpinnings of how hydrogen is incorporated into biomolecules, we measured the δ(2)H of individual amino acids (AAs) in Escherichia coli cultured in glucose-based or complex tryptone-based media in waters with δ(2)H values ranging from -55‰ to +1,070‰. The δ(2)H values of AAs in tryptone spanned a range of ∼250‰. In E. coli grown on glucose, the range of δ(2)H among AAs was nearly 200‰. The relative distributions of δ(2)H of AAs were upheld in cultures grown in enriched waters. In E. coli grown on tryptone, the δ(2)H of nonessential AAs varied linearly with the δ(2)H of media water, whereas δ(2)H of essential AAs was nearly identical to δ(2)H in diet. Model calculations determined that as much as 46% of hydrogen in some nonessential AAs originated from water, whereas no more than 12% of hydrogen in essential AAs originated from water. These findings demonstrate that δ(2)H can route directly at the molecular level. We conclude that the patterns and distributions in δ(2)H of AAs are determined through biosynthetic reactions, suggesting that δ(2)H could become a new biosignature for studying novel microbial pathways. Our results also show that δ(2)H of AAs in an organism's tissues provides a dual tracer for food and environmental (e.g., drinking) water.

Hydrogen isotopes in individual amino acids reflect differentiated pools of hydrogen from food and water in Escherichia coli

PubMed Central

Fogel, Marilyn L.; Griffin, Patrick L.; Newsome, Seth D.

2016-01-01

Hydrogen isotope (δ2H) analysis is widely used in animal ecology to study continental-scale movement because δ2H can trace precipitation and climate. To understand the biochemical underpinnings of how hydrogen is incorporated into biomolecules, we measured the δ2H of individual amino acids (AAs) in Escherichia coli cultured in glucose-based or complex tryptone-based media in waters with δ2H values ranging from −55‰ to +1,070‰. The δ2H values of AAs in tryptone spanned a range of ∼250‰. In E. coli grown on glucose, the range of δ2H among AAs was nearly 200‰. The relative distributions of δ2H of AAs were upheld in cultures grown in enriched waters. In E. coli grown on tryptone, the δ2H of nonessential AAs varied linearly with the δ2H of media water, whereas δ2H of essential AAs was nearly identical to δ2H in diet. Model calculations determined that as much as 46% of hydrogen in some nonessential AAs originated from water, whereas no more than 12% of hydrogen in essential AAs originated from water. These findings demonstrate that δ2H can route directly at the molecular level. We conclude that the patterns and distributions in δ2H of AAs are determined through biosynthetic reactions, suggesting that δ2H could become a new biosignature for studying novel microbial pathways. Our results also show that δ2H of AAs in an organism’s tissues provides a dual tracer for food and environmental (e.g., drinking) water. PMID:27444017

Interdependence, Reflexivity, Fidelity, Impedance Matching, and the Evolution of Genetic Coding

PubMed Central

Carter, Charles W; Wills, Peter R

2018-01-01

Abstract Genetic coding is generally thought to have required ribozymes whose functions were taken over by polypeptide aminoacyl-tRNA synthetases (aaRS). Two discoveries about aaRS and their interactions with tRNA substrates now furnish a unifying rationale for the opposite conclusion: that the key processes of the Central Dogma of molecular biology emerged simultaneously and naturally from simple origins in a peptide•RNA partnership, eliminating the epistemological utility of a prior RNA world. First, the two aaRS classes likely arose from opposite strands of the same ancestral gene, implying a simple genetic alphabet. The resulting inversion symmetries in aaRS structural biology would have stabilized the initial and subsequent differentiation of coding specificities, rapidly promoting diversity in the proteome. Second, amino acid physical chemistry maps onto tRNA identity elements, establishing reflexive, nanoenvironmental sensing in protein aaRS. Bootstrapping of increasingly detailed coding is thus intrinsic to polypeptide aaRS, but impossible in an RNA world. These notions underline the following concepts that contradict gradual replacement of ribozymal aaRS by polypeptide aaRS: 1) aaRS enzymes must be interdependent; 2) reflexivity intrinsic to polypeptide aaRS production dynamics promotes bootstrapping; 3) takeover of RNA-catalyzed aminoacylation by enzymes will necessarily degrade specificity; and 4) the Central Dogma’s emergence is most probable when replication and translation error rates remain comparable. These characteristics are necessary and sufficient for the essentially de novo emergence of a coupled gene–replicase–translatase system of genetic coding that would have continuously preserved the functional meaning of genetically encoded protein genes whose phylogenetic relationships match those observed today. PMID:29077934

Development and Evaluation of New Methods for Estimating Albedo-area for Stable GEOs

NASA Astrophysics Data System (ADS)

Payne, T. E.; Gregory, S. A.; Dentamaro, A.; Ernst, M.; Hollon, J.; Kruchten, A.; Chaudhary, A. B.; Dao, P. D.

Although direct measurements of the projected areas of various Geosynchronous Earth Orbit (GEO) satellite facets are impossible without high-resolution imaging, estimates of the albedo-Area (aA) product lead to the possibility of inferring the area. Such size estimates are an integral part of its identity. We are engaged in parallel development of two methods for calculating aA for the body/communication antennae structures and one method for the solar panels. We have previously reported on the Two Facet Model (2FM) method for body aA, and here we discuss a method based on differences between new observations and a baseline catalog that has been constructed from the GEO Observations with Longitudinal Diversity Simultaneously (GOLDS) data. We report on evaluations of the 2FM and differential method (DM) algorithm results. We also discuss a new method of estimating solar panel aA by fitting new data that include specular glints. All of these measurement methods are compared to models and simulations that serve as a proxy for ground truth. Because of the partially directional nature of the composite Bi-directional Reflectivity Distribution Function (BRDF) of all bus-mounted appendages, variance of body aA results is expected to be significant. Short-term and long-term variance of the derived aAs will also be discussed.

Cloning of a neonatal calcium atpase isoform (SERCA 1B) from extraocular muscle of adult blue marlin (Makaira nigricans).

PubMed

Londraville, R L; Cramer, T D; Franck, J P; Tullis, A; Block, B A

2000-10-01

Complete cDNAs for the fast-twitch Ca2+ -ATPase isoform (SERCA 1) were cloned and sequenced from blue marlin (Makaira nigricans) extraocular muscle (EOM). Complete cDNAs for SERCA 1 were also cloned from fast-twitch skeletal muscle of the same species. The two sequences are identical over the coding region except for the last five codons on the carboxyl end; EOM SERCA 1 cDNA codes for 996 amino acids and the fast-twitch cDNAs code for 991 aa. Phylogenetic analysis revealed that EOM SERCA 1 clusters with an isoform of Ca2+ -ATPase normally expressed in early development of mammals (SERCA 1B). This is the first report of SERCA 1B in an adult vertebrate. RNA hybridization assays indicate that 1B expression is limited to extraocular muscles. Because EOM gives rise to the thermogenic heater organ in marlin, we investigated whether SERCA 1B may play a role in heat generation, or if 1B expression is common in EOM among vertebrates. Chicken also expresses SERCA 1B in EOM, but rat expresses SERCA 1A; because SERCA 1B is not specific to heater tissue we conclude it is unlikely that it plays a specific role in intracellular heat production. Comparative sequence analysis does reveal, however, several sites that may be the source of functional differences between fish and mammalian SERCAs.

Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

PubMed

Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

2015-02-01

Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

75 FR 79763 - Regulatory Agenda

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-20

... Current Food Good Manufacturing Practices Regulation 0910-AG36 Food and Drug Administration--Completed... Sequence Title Identifier Number Number 310 Quality Assurance Requirements for Respirators 0920-AA04 Food and Drug Administration--Prerule Stage Regulation Sequence Title Identifier Number Number 311 Food...

Molecular Evolution of Aminoacyl tRNA Synthetase Proteins in the Early History of Life

NASA Astrophysics Data System (ADS)

Fournier, Gregory P.; Andam, Cheryl P.; Alm, Eric J.; Gogarten, J. Peter

2011-12-01

Aminoacyl-tRNA synthetases (aaRS) consist of several families of functionally conserved proteins essential for translation and protein synthesis. Like nearly all components of the translation machinery, most aaRS families are universally distributed across cellular life, being inherited from the time of the Last Universal Common Ancestor (LUCA). However, unlike the rest of the translation machinery, aaRS have undergone numerous ancient horizontal gene transfers, with several independent events detected between domains, and some possibly involving lineages diverging before the time of LUCA. These transfers reveal the complexity of molecular evolution at this early time, and the chimeric nature of genomes within cells that gave rise to the major domains. Additionally, given the role of these protein families in defining the amino acids used for protein synthesis, sequence reconstruction of their pre-LUCA ancestors can reveal the evolutionary processes at work in the origin of the genetic code. In particular, sequence reconstructions of the paralog ancestors of isoleucyl- and valyl- RS provide strong empirical evidence that at least for this divergence, the genetic code did not co-evolve with the aaRSs; rather, both amino acids were already part of the genetic code before their cognate aaRSs diverged from their common ancestor. The implications of this observation for the early evolution of RNA-directed protein biosynthesis are discussed.

Deinococcus frigens sp. nov., Deinococcus saxicola sp. nov., and Deinococcus marmoris sp. nov., low temperature and draught-tolerating, UV-resistant bacteria from continental Antarctica.

PubMed

Hirsch, Peter; Gallikowski, Claudia A; Siebert, Jörg; Peissl, Klaus; Kroppenstedt, Reiner; Schumann, Peter; Stackebrandt, Erko; Anderson, Robert

2004-11-01

Six Gram-positive, non-motile, UV- and draught-tolerant bacteria were isolated from antarctic soil and rock samples. The pink to orange cocci grew well on oligotrophic medium PYGV (pH 7.5) at 9-18 degrees C. They tolerated 0-10% NaCl, were aerobic to facultatively anaerobic and contained ornithine in their cell wall (type A3beta, Orn-Gly2). The lipid profiles of four strains were found to be typical for those of D. radiodurans. Major fatty acids were 16:1cis9, 15:1cis9, 17:1cis9 and i17:1cis9, the respiratory quinone of three strains was MK-8. Comparative 16S rDNA gene sequencing revealed phylogenetic relationships to the Deinococcus clade, especially to D. radiopugnans. The levels of 16S rRNA gene sequence similarity and DNA-DNA hybridisation data showed the six isolates represented new taxa. Phenotypic properties supported the description of three new species which were different from the eight known Deinococcus species and particularly from D. radiopugnans. Soil isolate AA-692T (DSM 12807T) is the type strain of Deinococcus frigens sp. nov., with AA-752 (DSM 15993) and AA-829 (DSM 15994) as additional strains from soil. The endolithic isolate AA-1444T, Deinococcus saxicola sp. nov., (DSM 15974T) came from antarctic sandstone, and Deinococcus marmoris sp. nov. (isolate AA-63T [DSM 12784T]) as well as AA-69 (DSM 15951) were isolated from antarctic marble.

Identification of the cleavage sites of the RNA2-encoded polyproteins for two members of the genus Torradovirus by N-terminal sequencing of the virion capsid proteins.

PubMed

Ferriol, I; Silva Junior, D M; Nigg, J C; Zamora-Macorra, E J; Falk, B W

2016-11-01

Torradoviruses, family Secoviridae, are emergent bipartite RNA plant viruses. RNA1 is ca. 7kb and has one open reading frame (ORF) encoding for the protease, helicase and RNA-dependent RNA polymerase (RdRp). RNA2 is ca. 5kb and has two ORFs. RNA2-ORF1 encodes for a putative protein with unknown function(s). RNA2-ORF2 encodes for a putative movement protein and three capsid proteins. Little is known about the replication and polyprotein processing strategies of torradoviruses. Here, the cleavage sites in the RNA2-ORF2-encoded polyproteins of two torradoviruses, Tomato marchitez virus isolate M (ToMarV-M) and tomato chocolate spot virus, were determined by N-terminal sequencing, revealing that the amino acid (aa) at the -1 position of the cleavage sites is a glutamine. Multiple aa sequence comparison confirmed that this glutamine is conserved among other torradoviruses. Finally, site-directed mutagenesis of conserved aas in the ToMarV-M RdRp and protease prevented substantial accumulation of viral coat proteins or RNAs. Copyright © 2016 Elsevier Inc. All rights reserved.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

Evolution of aminoacyl-tRNA synthetases--analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events.

PubMed

Wolf, Y I; Aravind, L; Grishin, N V; Koonin, E V

1999-08-01

Phylogenetic analysis of aminoacyl-tRNA synthetases (aaRSs) of all 20 specificities from completely sequenced bacterial, archaeal, and eukaryotic genomes reveals a complex evolutionary picture. Detailed examination of the domain architecture of aaRSs using sequence profile searches delineated a network of partially conserved domains that is even more elaborate than previously suspected. Several unexpected evolutionary connections were identified, including the apparent origin of the beta-subunit of bacterial GlyRS from the HD superfamily of hydrolases, a domain shared by bacterial AspRS and the B subunit of archaeal glutamyl-tRNA amidotransferases, and another previously undetected domain that is conserved in a subset of ThrRS, guanosine polyphosphate hydrolases and synthetases, and a family of GTPases. Comparison of domain architectures and multiple alignments resulted in the delineation of synapomorphies-shared derived characters, such as extra domains or inserts-for most of the aaRSs specificities. These synapomorphies partition sets of aaRSs with the same specificity into two or more distinct and apparently monophyletic groups. In conjunction with cluster analysis and a modification of the midpoint-rooting procedure, this partitioning was used to infer the likely root position in phylogenetic trees. The topologies of the resulting rooted trees for most of the aaRSs specificities are compatible with the evolutionary "standard model" whereby the earliest radiation event separated bacteria from the common ancestor of archaea and eukaryotes as opposed to the two other possible evolutionary scenarios for the three major divisions of life. For almost all aaRSs specificities, however, this simple scheme is confounded by displacement of some of the bacterial aaRSs by their eukaryotic or, less frequently, archaeal counterparts. Displacement of ancestral eukaryotic aaRS genes by bacterial ones, presumably of mitochondrial origin, was observed for three aaRSs. In contrast, there was no convincing evidence of displacement of archaeal aaRSs by bacterial ones. Displacement of aaRS genes by eukaryotic counterparts is most common among parasitic and symbiotic bacteria, particularly the spirochaetes, in which 10 of the 19 aaRSs seem to have been displaced by the respective eukaryotic genes and two by the archaeal counterpart. Unlike the primary radiation events between the three main divisions of life, that were readily traceable through the phylogenetic analysis of aaRSs, no consistent large-scale bacterial phylogeny could be established. In part, this may be due to additional gene displacement events among bacterial lineages. Argument is presented that, although lineage-specific gene loss might have contributed to the evolution of some of the aaRSs, this is not a viable alternative to horizontal gene transfer as the principal evolutionary phenomenon in this gene class.

Analysis of amyloid fibrils in the cheetah (Acinonyx jubatus).

PubMed

Bergström, Joakim; Ueda, Mitsuharu; Une, Yumi; Sun, Xuguo; Misumi, Shogo; Shoji, Shozo; Ando, Yukio

2006-06-01

Recently, a high prevalence of amyloid A (AA) amyloidosis has been documented among captive cheetahs worldwide. Biochemical analysis of amyloid fibrils extracted from the liver of a Japanese captive cheetah unequivocally showed that protein AA was the main fibril constituent. Further characterization of the AA fibril components by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis revealed three main protein AA bands with approximate molecular weights of 8, 10 and 12 kDa. Mass spectrometry analysis of the 12-kDa component observed in SDS-PAGE and Western blotting confirmed the molecular weight of a 12,381-Da peak. Our finding of a 12-kDa protein AA component provides evidence that the cheetah SAA sequence is longer than the previously reported 90 amino acid residues (approximately 10 kDa), and hence SAA is part of the amyloid fibril.

Molecular evolution of the HoxA cluster in the three major gnathostome lineages

PubMed Central

Chiu, Chi-hua; Amemiya, Chris; Dewar, Ken; Kim, Chang-Bae; Ruddle, Frank H.; Wagner, Günter P.

2002-01-01

The duplication of Hox clusters and their maintenance in a lineage has a prominent but little understood role in chordate evolution. Here we examined how Hox cluster duplication may influence changes in cluster architecture and patterns of noncoding sequence evolution. We sequenced the entire duplicated HoxAa and HoxAb clusters of zebrafish (Danio rerio) and extended the 5′ (posterior) part of the HoxM (HoxA-like) cluster of horn shark (Heterodontus francisci) containing the hoxa11 and hoxa13 orthologs as well as intergenic and flanking noncoding sequences. The duplicated HoxA clusters in zebrafish each house considerably fewer genes and are dramatically shorter than the single HoxA clusters of human and horn shark. We compared the intergenic sequences of the HoxA clusters of human, horn shark, zebrafish (Aa, Ab), and striped bass and found extensive conservation of noncoding sequence motifs, i.e., phylogenetic footprints, between the human and horn shark, representing two of the three gnathostome lineages. These are putative cis-regulatory elements that may play a role in the regulation of the ancestral HoxA cluster. In contrast, homologous regions of the duplicated HoxAa and HoxAb clusters of zebrafish and the HoxA cluster of striped bass revealed a striking loss of conservation of these putative cis-regulatory sequences in the 3′ (anterior) segment of the cluster, where zebrafish only retains single representatives of group 1, 3, 4, and 5 (HoxAa) and group 2 (HoxAb) genes and in the 5′ part of the clusters, where zebrafish retains two copies of the group 13, 11, and 9 genes, i.e., AbdB-like genes. In analyzing patterns of cis-sequence evolution in the 5′ part of the clusters, we explicitly looked for evidence of complementary loss of conserved noncoding sequences, as predicted by the duplication-degeneration-complementation model in which genetic redundancy after gene duplication is resolved because of the fixation of complementary degenerative mutations. Our data did not yield evidence supporting this prediction. We conclude that changes in the pattern of cis-sequence conservation after Hox cluster duplication are more consistent with being the outcome of adaptive modification rather than passive mechanisms that erode redundancy created by the duplication event. These results support the view that genome duplications may provide a mechanism whereby master control genes undergo radical modifications conducive to major alterations in body plan. Such genomic revolutions may contribute significantly to the evolutionary process. PMID:11943847

A new putative deltapartitivirus recovered from Dianthus amurensis.

PubMed

An, Hongliu; Tan, Guanlin; Xiong, Guihong; Li, Meirong; Fang, Shouguo; Islam, Saif Ul; Zhang, Songbai; Li, Fan

2017-09-01

Two double stranded RNAs (dsRNA), likely representing the genome of a novel deltapartitivirus, provisionally named carnation cryptic virus 3 (CCV3), were recovered from Dianthus amurensis. The two dsRNAs were 1,573 (dsRNA1) and 1,561 (dsRNA2) bp in size, each containing a single open reading frame (ORF) encoding a 475- and 411-aa protein, respectively. The 475-aa protein contains a conserved RNA dependent RNA polymerase (RdRp) domain which shows significant homology to RdRps of established or putative partitiviruses, particularly those belonging to the genus Deltapartitivirus. However, it shares an amino acid identity of 75% with its closest relative, the RdRp of the deltapartitivirus beet cryptic virus 2 (BCV2), and is <62% identical to the RdRps of other partitiviruses. In a phylogenetic tree constructed with RdRps of selected partitiviruses, CCV3 clustered with BCV2 and formed a well-supported monophyletic clade with known or putative deltapartitiviruses.

The existence of fertile hybrids of closely related model earthworm species, Eisenia andrei and E. fetida.

PubMed

Plytycz, Barbara; Bigaj, Janusz; Osikowski, Artur; Hofman, Sebastian; Falniowski, Andrzej; Panz, Tomasz; Grzmil, Pawel; Vandenbulcke, Franck

2018-01-01

Lumbricid earthworms Eisenia andrei (Ea) and E. fetida (Ef) are simultaneous hermaphrodites with reciprocal insemination capable of self-fertilization while the existence of hybridization of these two species was still debatable. During the present investigation fertile hybrids of Ea and Ef were detected. Virgin specimens of Ea and Ef were laboratory crossed (Ea+Ef) and their progeny was doubly identified. 1 -identified by species-specific maternally derived haploid mitochondrial DNA sequences of the COI gene being either 'a' for worms hatched from Ea ova or 'f' for worms hatched from Ef ova. 2 -identified by the diploid maternal/paternal nuclear DNA sequences of 28s rRNA gene being either 'AA' for Ea, 'FF' for Ef, or AF/FA for their hybrids derived either from the 'aA' or 'fF' ova, respectively. Among offspring of Ea+Ef pairs in F1 generation there were mainly aAA and fFF earthworms resulted from the facilitated self-fertilization and some aAF hybrids from aA ova but none fFA hybrids from fF ova. In F2 generation resulting from aAF hybrids mated with aAA a new generations of aAA and aAF hybrids were noticed, while aAF hybrids mated with fFF gave fFF and both aAF and fFA hybrids. Hybrids intercrossed together produced plenty of cocoons but no hatchlings independently whether aAF+aAF or aAF+fFA were mated. These results indicated that Ea and Ef species, easy to maintain in laboratory and commonly used as convenient models in biomedicine and ecotoxicology, may also serve in studies on molecular basis of interspecific barriers and mechanisms of introgression and speciation. Hypothetically, their asymmetrical hybridization can be modified by some external factors.

Association of DGAT2 gene polymorphisms with carcass and meat quality traits in domestic pigeons (Columba livia).

PubMed

Mao, H G; Dong, X Y; Cao, H Y; Xu, N Y; Yin, Z Z

2018-04-01

1. Diacylglycerol acyltransferase (DGAT) plays an important role in the synthesis of triacylglycerol, but its effects on meat quality and carcass composition in pigeons are unclear. In this study, single-nucleotide polymorphisms (SNPs) in the exons of the DGAT2 gene were identified and analysed by using DNA sequencing methods in 200 domestic pigeons (Columba livia). The associations between DGAT2 polymorphisms and carcass and meat quality traits were also analysed. 2. Sequencing results showed that 5 nucleotide mutations were detected in exons 3, 4, 5 and 6 of the DGAT2 gene. The analysis revealed three genotypes (AA, AB and BB) in G18398T and G22484C, in which the AA genotype and A allele had the highest frequency. 3. In the SNP of G18398T located in exon 5, individuals with genotype BB had significantly higher meat quality and lower abdominal fat content than those with AA or AB genotype. In the SNP of G22484C located in exon 6, the genotype AA showed highest carcass trait values, while the genotype BB represented better meat quality, compared to AA and AB genotypes. 4. The results imply that DGAT2 gene has a close relationship with carcass and meat quality traits in pigeons, and the SNPs of G18398T and G22484C can be used as genetic markers for marker-assisted breeding in pigeon.

Complete chloroplast and ribosomal sequences for 30 accessions elucidate evolution of Oryza AA genome species

PubMed Central

Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Yu, Yeisoo; Yang, Kiwoung; Choi, Beom-Soon; Koh, Hee-Jong; Waminal, Nomar Espinosa; Choi, Hong-Il; Kim, Nam-Hoon; Jang, Woojong; Park, Hyun-Seung; Lee, Jonghoon; Lee, Hyun Oh; Joh, Ho Jun; Lee, Hyeon Ju; Park, Jee Young; Perumal, Sampath; Jayakodi, Murukarthick; Lee, Yun Sun; Kim, Backki; Copetti, Dario; Kim, Soonok; Kim, Sunggil; Lim, Ki-Byung; Kim, Young-Dong; Lee, Jungho; Cho, Kwang-Su; Park, Beom-Seok; Wing, Rod A.; Yang, Tae-Jin

2015-01-01

Cytoplasmic chloroplast (cp) genomes and nuclear ribosomal DNA (nR) are the primary sequences used to understand plant diversity and evolution. We introduce a high-throughput method to simultaneously obtain complete cp and nR sequences using Illumina platform whole-genome sequence. We applied the method to 30 rice specimens belonging to nine Oryza species. Concurrent phylogenomic analysis using cp and nR of several of specimens of the same Oryza AA genome species provides insight into the evolution and domestication of cultivated rice, clarifying three ambiguous but important issues in the evolution of wild Oryza species. First, cp-based trees clearly classify each lineage but can be biased by inter-subspecies cross-hybridization events during speciation. Second, O. glumaepatula, a South American wild rice, includes two cytoplasm types, one of which is derived from a recent interspecies hybridization with O. longistminata. Third, the Australian O. rufipogan-type rice is a perennial form of O. meridionalis. PMID:26506948

Voltage-gated sodium channel polymorphism and metabolic resistance in pyrethroid-resistant Aedes aegypti from Brazil.

PubMed

Martins, Ademir Jesus; Lins, Rachel Mazzei Moura de Andrade; Linss, Jutta Gerlinde Birgitt; Peixoto, Alexandre Afranio; Valle, Denise

2009-07-01

The nature of pyrethroid resistance in Aedes aegypti Brazilian populations was investigated. Quantification of enzymes related to metabolic resistance in two distinct populations, located in the Northeast and Southeast regions, revealed increases in Glutathione-S-transferase (GST) and Esterase levels. Additionally, polymorphism was found in the IIS6 region of Ae. aegypti voltage-gated sodium channel (AaNa(V)), the pyrethroid target site. Sequences were classified in two haplotype groups, A and B, according to the size of the intron in that region. Rockefeller, a susceptible control lineage, contains only B sequences. In field populations, some A sequences present a substitution in the 1011 site (Ile/Met). When resistant and susceptible individuals were compared, the frequency of both A (with the Met mutation) and B sequences were slightly increased in resistant specimens. The involvement of the AaNa(V) polymorphism in pyrethroid resistance and the metabolic mechanisms that lead to potential cross-resistance between organophosphate and pyrethroids are discussed.

Nonenzymatic template-directed synthesis on hairpin oligonucleotides. 3. Incorporation of adenosine and uridine residues

NASA Technical Reports Server (NTRS)

Wu, T.; Orgel, L. E.

1992-01-01

We have used [32P]-labeled hairpin oligonucleotides to study template-directed synthesis on templates containing one or more A or T residues within a run of C residues. When nucleoside-5'-phosphoro(2-methyl)imidazolides are used as substrates, isolated A and T residues function efficiently in facilitating the incorporation of U and A, respectively. The reactions are regiospecific, producing mainly 3'-5'-phosphodiester bonds. Pairs of consecutive non-C residues are copied much less efficiently. Limited synthesis of CA and AC sequences on templates containing TG and GT sequences was observed along with some synthesis of the AA sequences on templates containing TT sequences. The other dimer sequences investigated, AA, AG, GA, TA, and AT, could not be copied. If A is absent from the reaction mixture, misincorporation of G residues is a significant reaction on templates containing an isolated T residue or two consecutive T residues. However, if both A and G are present, A is incorporated to a much greater extent than G. We believe that wobble-pairing between T and G is responsible for misincorporation when only G is present.

Characterization of potential antiviral resistance mutations in hepatitis B virus reverse transcriptase sequences in treatment-naïve Chinese patients.

PubMed

Liu, Bao-Ming; Li, Tong; Xu, Jie; Li, Xiao-Guang; Dong, Jian-Ping; Yan, Ping; Yang, Jing-Xian; Yan, Ling; Gao, Zhi-Yong; Li, Wen-Peng; Sun, Xie-Wen; Wang, Yu-Hua; Jiao, Xiu-Juan; Hou, Chun-Sheng; Zhuang, Hui

2010-03-01

Full-length hepatitis B virus (HBV) reverse transcriptase (RT) sequences were amplified and sequenced among 192 nucleos(t)ide analogue (NA)-naïve Chinese patients with chronic hepatitis B. Deduced amino acids (AAs) at 42 previously reported potential NA resistance (NAr) mutation positions in RT region were analyzed. Patients were found with either B-genotype (28.65%) or C-genotype (71.35%) infections. Rt53, rt91, rt124, rt134, rt221, rt224, rt238 and rt256 were identified as B- and C-genotype-dependent polymorphic AA positions. AA substitutions at 11 classical NAr mutation positions, i.e. rt80, rt169, rt173, rt180, rt181, rt184, rt194, rt202, rt204, rt236 and rt250, were not detected. However, potential NAr mutations were found in 30.73% (59/192) isolates, which involved 18 positions including rt53, rt207, rt229, rt238 and rt256, etc. The concomitant AA changes of HBsAg occurred in 16.67% (32/192) isolates including sG145R mutation. One-third of mutation positions were located in functional RT domains (e.g. rt207 and rt233), A-B interdomains (overlapping HBsAg 'a' determinant and showing most concomitant immune-associated mutations) and non-A-B interdomains (e.g. rt191 and rt213), respectively. Genotypes B and C each showed several preferred positions to mutate. These results might provide insights into understanding the evolution and selection basis of NAr HBV strains under antiviral therapy.

Using the concept of Chou's pseudo amino acid composition to predict apoptosis proteins subcellular location: an approach by approximate entropy.

PubMed

Jiang, Xiaoying; Wei, Rong; Zhang, Tongliang; Gu, Quan

2008-01-01

The function of protein is closely correlated with it subcellular location. Prediction of subcellular location of apoptosis proteins is an important research area in post-genetic era because the knowledge of apoptosis proteins is useful to understand the mechanism of programmed cell death. Compared with the conventional amino acid composition (AAC), the Pseudo Amino Acid composition (PseAA) as originally introduced by Chou can incorporate much more information of a protein sequence so as to remarkably enhance the power of using a discrete model to predict various attributes of a protein. In this study, a novel approach is presented to predict apoptosis protein solely from sequence based on the concept of Chou's PseAA composition. The concept of approximate entropy (ApEn), which is a parameter denoting complexity of time series, is used to construct PseAA composition as additional features. Fuzzy K-nearest neighbor (FKNN) classifier is selected as prediction engine. Particle swarm optimization (PSO) algorithm is adopted for optimizing the weight factors which are important in PseAA composition. Two datasets are used to validate the performance of the proposed approach, which incorporate six subcellular location and four subcellular locations, respectively. The results obtained by jackknife test are quite encouraging. It indicates that the ApEn of protein sequence could represent effectively the information of apoptosis proteins subcellular locations. It can at least play a complimentary role to many of the existing methods, and might become potentially useful tool for protein function prediction. The software in Matlab is available freely by contacting the corresponding author.

Clinical characteristics and HLA alleles of a family with simultaneously occurring alopecia areata.

PubMed

Emre, Selma; Metin, Ahmet; Caykoylu, Ali; Akoglu, Gulsen; Ceylan, Gülay G; Oztekin, Aynure; Col, Esra S

2016-06-01

Alopecia areata (AA) is a T-cell-mediated autoimmune disease resulting in partial or total noncicatricial hair loss. HLA class II antigens are the most important markers that constitute genetic predisposition to AA. Various life events and intense psychological stress may play an important role in triggering AA attacks. We report an unusual case series of 4 family members who had simultaneously occurring active AA lesions. Our aim was to evaluate the clinical and psychiatric features of 4 cases of active AA lesions occurring simultaneously in a family and determine HLA alleles. The clinical and psychological features of all patients were examined. HLA antigen DNA typing was performed by polymerase chain reaction with sequence-specific primers. All patients had typical AA lesions over the scalp and/or beard area. Psychological examinations revealed obsessive-compulsive personality disorder in the proband's parents as well as anxiety and lack of self-confidence in both the proband and his sister. HLA antigen types were not commonly shared with family members. These findings suggest that AA presenting concurrently in members of the same family was not associated with genetic predisposition. Shared psychological disorders and stressful life events might be the major key points in the concurrent presentation of these familial AA cases and development of resistance against treatments.

Cloning and sequencing the genes encoding goldfish and carp ependymin.

PubMed

Adams, D S; Shashoua, V E

1994-04-20

Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

Comparative study of immunological and structural properties of two recombinant vaccine candidates against botulinum neurotoxin type E.

PubMed

Rostamian, Mosayeb; Mousavy, Seyed Jafar; Ebrahimi, Firouz; Ghadami, Seyyed Abolghasem; Sheibani, Nader; Minaei, Mohammad Ebrahim; Arefpour Torabi, Mohammad Ali

2012-01-01

Recently, botulinum neurotoxin (BoNT)-derived recombinant proteins have been suggested as potential botulism vaccines. Here, with concentrating on BoNT type E (BoNT/E), we studied two of these binding domain-based recombinant proteins: a multivalent chimer protein, which is composed of BoNT serotypes A, B and E binding subdomains, and a monovalent recombinant protein, which contains 93 amino acid residues from recombinant C-terminal heavy chain of BoNT/E (rBoNT/E-HCC). Both proteins have an identical region (48 aa) that contains one of the most important BoNT/E epitopes (YLTHMRD sequence). The recombinant protein efficiency in antibody production, their structural differences, and their BoNT/E-epitope location were compared by using ELISA, circular dichroism, computational modeling, and hydrophobicity predictions. Immunological studies indicated that the antibody yield against rBoNT/E-HCC was higher than chimer protein. Cross ELISA confirmed that the antibodies against the chimer protein recognized rBoNT/E-HCC more efficiently. However, both antibody groups (anti-chimer and anti-rBoNT/E-HCC antibodies) were able to recognize other proteins. Structural studies with circular dichroism showed that chimer proteins have slightly more secondary structures than rBoNT/E-HCC. The immunological results suggested that the above-mentioned identical region in rBoNT/E-HCC is more exposed. Circular dichroism, computational protein modeling and hydrophobicity predictions indicated a more exposed location for the identical region in rBoNT/E-HCC than the chimer protein, which is strongly in agreement with immunological results.

Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

PubMed

Zhou, Yuchan; Underhill, Steven J R

2016-01-01

Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Molecular characterization, transcriptional profiling, and antibacterial potential of G-type lysozyme from seahorse (Hippocampus abdominalis).

PubMed

Ko, Jiyeon; Wan, Qiang; Bathige, S D N K; Lee, Jehee

2016-11-01

Lysozymes are a family of enzymes that catalyze the hydrolysis of bacterial cell wall, acting as antimicrobial effectors of the innate immune system. In the present study, an ortholog of goose-type lysozyme (ShLysG) from the big-belly seahorse (Hippocampus abdominalis) was identified and characterized structurally and functionally. The full-length cDNA sequence (1213 bp) of ShLysG is comprised of an open reading frame made up of 552 bp, encoding a polypeptide of 184 amino acid (aa) with a predicted molecular mass of 20 kDa. In silico analysis of ShLysG revealed the absence of signal peptide and the presence of a characteristic bacterial soluble lytic transglycosylase (SLT) domain bearing three catalytic residues (Glu 71 , Asp 84 , and Asp 95 ) and seven N-acetyl-d-glucosamine binding sites (Glu 71 , Asp 95 , Tyr 98 , His 99 , Ile 117 , Tyr 145 , and Asn 146 ). Homology analysis demonstrated that the aa sequence of ShLysG shared 60.7-67.4% identity and 72.6-79.3% similarity with the orthologs of other teleosts. Phylogenetic analysis of ShLysG indicated a closest relationship with the ortholog from Gadus morhua. In healthy seahorse, ShLysG mRNA showed a constitutive expression in all the tissues examined, with the highest expression in kidney and the least expression in liver. The ShLysG mRNA levels were also shown significant elevation upon the bacterial and pathogen-associated molecular pattern (PAMPs) challenges. Furthermore, lytic activities of ShLysG recombinant protein were detected against several Gram-negative and Gram-positive bacterial species. Taken together, these results suggest that ShLysG might possess a potential immune defensive role against invading microbial pathogens in seahorse. Copyright © 2016 Elsevier Ltd. All rights reserved.

An integrated system for identifying the hidden assassins in traditional medicines containing aristolochic acids

NASA Astrophysics Data System (ADS)

Wu, Lan; Sun, Wei; Wang, Bo; Zhao, Haiyu; Li, Yaoli; Cai, Shaoqing; Xiang, Li; Zhu, Yingjie; Yao, Hui; Song, Jingyuan; Cheng, Yung-Chi; Chen, Shilin

2015-08-01

Traditional herbal medicines adulterated and contaminated with plant materials from the Aristolochiaceae family, which contain aristolochic acids (AAs), cause aristolochic acid nephropathy. Approximately 256 traditional Chinese patent medicines, containing Aristolochiaceous materials, are still being sold in Chinese markets today. In order to protect consumers from health risks due to AAs, the hidden assassins, efficient methods to differentiate Aristolochiaceous herbs from their putative substitutes need to be established. In this study, 158 Aristolochiaceous samples representing 46 species and four genera as well as 131 non-Aristolochiaceous samples representing 33 species, 20 genera and 12 families were analyzed using DNA barcodes based on the ITS2 and psbA-trnH sequences. Aristolochiaceous materials and their non-Aristolochiaceous substitutes were successfully identified using BLAST1, the nearest distance method and the neighbor-joining (NJ) tree. In addition, based on sequence information of ITS2, we developed a Real-Time PCR assay which successfully identified herbal material from the Aristolochiaceae family. Using Ultra High Performance Liquid Chromatography-Mass Spectrometer (UHPLC-HR-MS), we demonstrated that most representatives from the Aristolochiaceae family contain toxic AAs. Therefore, integrated DNA barcodes, Real-Time PCR assays using TaqMan probes and UHPLC-HR-MS system provides an efficient and reliable authentication system to protect consumers from health risks due to the hidden assassins (AAs).

Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

PubMed

Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

2012-09-01

FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular cloning and expression of a chloride channel-associated protein pICln in human young red blood cells: association with actin.

PubMed

Schwartz, R S; Rybicki, A C; Nagel, R L

1997-10-15

We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.

Genetic analysis of interleukin 18 gene polymorphisms in alopecia areata.

PubMed

Celik, Sumeyya Deniz; Ates, Omer

2018-06-01

Alopecia areata (AA), which appears as nonscarring hair shedding on any hair-bearing area, is a common organ-specific autoimmune condition. Cytokines have important roles in the development of AA. Interleukin (IL) 18 is a significant proinflammatory cytokine that was found higher in the patients with AA. We aimed to investigate whether the IL-18 (rs187238 and rs1946518) single nucleotide polymorphisms (SNPs) may be associated with AA and/or clinical outcome of patients with AA in Turkish population. Genotyping of rs187238 and rs1946518 SNPs were detected using sequence-specific primer-polymerase chain reaction (SSP-PCR) method in 200 patients with AA and 200 control subjects. The genotype distribution of rs1946518 (-607C>A) SNP was found to be statistically significantly different among patients with AA and controls (P = .0008). Distribution of CC+CA genotypes and frequency of -607/allele C of rs1946518 SNP were higher in patients with AA (P = .001, P = .001, respectively). The genotype distribution of rs187238 (-137G>C) SNP was found to be statistically significantly different among patients with AA and control subjects (P = .0014). Distribution of GG genotype and frequency of -137/allele G of rs187238 SNP were higher in patients with AA (P = .0003, P = .001, respectively). The rs1946518 (-607C>A) and rs187238 (-137G>C) polymorphisms were found associated with alopecia areata disease. The study suggests that IL-18 rs187238 and rs1946518 SNPs may be the cause of the AA susceptibility. © 2018 Wiley Periodicals, Inc.

Molecular characterization of the Salmonella typhi StpA protein that is related to both Yersinia YopE cytotoxin and YopH tyrosine phosphatase.

PubMed

Arricau, N; Hermant, D; Waxin, H; Popoff, M Y

1997-01-01

Analysis of the nucleotide sequence of a 4-kb DNA fragment located between the sip and iag loci on Salmonella typhi chromosome revealed three open reading frames, termed sipF, ctpA and stpA. The 82-amino-acid (aa) sipF product showed extensive similarity to the lacP protein from S. typhimurium. The StpA protein (535 aa) exhibited significant similarity to both Yersinia enterocolitica YopE cytotoxin and YopH tyrosine phosphatase. The CtpA polypeptide (130 aa) might be the molecular chaperone of the StpA protein.

The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubota, Akira; Bainy, Afonso C.D.; Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900

2013-10-01

The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs.more » On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with any CYP2 subfamily in mammals. • Induction of CYP2AA1 and CYP2AA2 indicates a phenobarbital-type response in fish.« less

Food Service Follow-up Study.

ERIC Educational Resources Information Center

Scott, David C.

Bakersfield City College reports on a followup study done to evaluate their Food Service Management Program. The program offers courses in three areas: certification and skill updating for those already employed in school cafeteria work, an A.A. degree program, and avocational courses for extended day students. Identical questionnaires were sent…

Sesavirus: prototype of a new parvovirus genus in feces of a sea lion.

PubMed

Phan, Tung Gia; Gulland, Frances; Simeone, Claire; Deng, Xutao; Delwart, Eric

2015-02-01

We describe the nearly complete genome of a highly divergent parvovirus, we tentatively name Sesavirus, from the feces of a California sea lion pup (Zalophus californianus) suffering from malnutrition and pneumonia. The 5,049-base-long genome contained two major ORFs encoding a 553-aa nonstructural protein and a 965-aa structural protein which shared closest amino acid identities of 25 and 28 %, respectively, with members of the copiparvovirus genus known to infect pigs and cows. Given the low degree of similarity, Sesavirus might be considered as prototype for a new genus with a proposed name of Marinoparvovirus in the subfamily Parvovirinae.

Racial Disparities in the Molecular Landscape of Cancer.

PubMed

Heath, Elisabeth I; Lynce, Filipa; Xiu, Joanne; Ellerbrock, Angela; Reddy, Sandeep K; Obeid, Elias; Liu, Stephen V; Bollig-Fischer, Aliccia; Separovic, Duska; Vanderwalde, Ari

2018-04-01

African Americans (AA) have the highest incidence and mortality of any racial/ethnic group in the US for most cancer types. Heterogeneity in the molecular biology of cancer, as a contributing factor to this disparity, is poorly understood. To address this gap in knowledge, we explored the molecular landscape of colorectal cancer (CRC), non-small cell lung cancer (NSCLC) and high-grade glioma (HGG) from 271 AA and 636 Caucasian (CC) cases. DNA from formalin-fixed paraffin-embedded tumors was sequenced using next-generation sequencing. Additionally, we evaluated protein expression using immunohistochemistry. The Exome Aggregation Consortium Database was evaluated for known ethnicity associations. Considering only pathogenic or presumed pathogenic mutations, as determined by the American College of Medical Genetics and Genomics guidelines, and using Bonferroni and Benjamini-Hochberg corrections for multiple comparisons, we found that CRC tumors from AA patients harbored significantly more mutations of phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA) than those from CC patients. CRC tumors in AA patients also appeared to harbor more mutations of mitogen-activated protein kinase kinase 1 (MAP2K1/MEK1), MPL proto-oncogene (MPL), thrombo-poietin receptor, and neurofibromin 1 (NF1) than those from CC patients. In contrast, CRCs from AA patients were likely to carry fewer mutations of ataxia-telangiectasia mutated (ATM), as well as of proto-oncogene B-Raf (BRAF), including the V600E variant, than those from CC patients. Rates of immunohistochemical positivity for epidermal growth factor receptor (EGFR) and DNA topoisomerase 2-alpha (TOP2A) tended to be higher in CRCs from AA patients than in CC patients. In NSCLC adenocarcinoma, BRAF variants appeared to be more frequent in the AA than in the CC cohort, whereas in squamous cell lung carcinoma, programmed death-ligand 1 (PD-L1) expression tended to be lower in the AA than in CC group. Moreover, HGG tumors from AA patients showed a trend toward harboring more mutations of protein tyrosine phosphatase non-receptor 11 (PTPN11), than HGG tumors from the CC cohort. In contrast, mutations of phosphatase and tensin homolog (PTEN) and tumor protein 53 (TP53) appeared to be higher in HGG tumors in CC patients than in their AA counterparts. Our data revealed significant differences and trends in molecular signatures of the three cancer types in AA and CC cohorts. These findings imply that there may be differences in carcinogenesis between AA and CC patients and that race may be a factor that should be considered regarding cancer incidence and outcome. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Mad men, women and steroid cocktails: a review of the impact of sex and other factors on anabolic androgenic steroids effects on affective behaviors.

PubMed

Onakomaiya, Marie M; Henderson, Leslie P

2016-02-01

For several decades, elite athletes and a growing number of recreational consumers have used anabolic androgenic steroids (AAS) as performance enhancing drugs. Despite mounting evidence that illicit use of these synthetic steroids has detrimental effects on affective states, information available on sex-specific actions of these drugs is lacking. The focus of this review is to assess information to date on the importance of sex and its interaction with other environmental factors on affective behaviors, with an emphasis on data derived from non-human studies. The PubMed database was searched for relevant studies in both sexes. Studies examining AAS use in females are limited, reflecting the lower prevalence of use in this sex. Data, however, indicate significant sex-specific differences in AAS effects on anxiety-like and aggressive behaviors, interactions with other drugs of abuse, and the interplay of AAS with other environmental factors such as diet and exercise. Current methods for assessing AAS use have limitations that suggest biases of both under- and over-reporting, which may be amplified for females who are poorly represented in self-report studies of human subjects and are rarely used in animal studies. Data from animal literature suggest that there are significant sex-specific differences in the impact of AAS on aggression, anxiety, and concomitant use of other abused substances. These results have relevance for human females who take these drugs as performance-enhancing substances and for transgender XX individuals who may illicitly self-administer AAS as they transition to a male gender identity.

Dividing to unveil protein microheterogeneities: A Traveling Wave Ion Mobility study

PubMed Central

Halgand, F.; Habchi, Johnny; Cravello, Laetitia; Martinho, Marlène; Guigliarelli, Bruno; Longhi, Sonia

2011-01-01

Over-expression of a protein in a foreign host is often the only route toward an exhaustive characterization especially when purification from the natural source(s) is hardly achievable. The key issue in these studies relies on quality control of the purified recombinant protein to precisely determining its identity as well as any undesirable micro-heterogeneities. While standard proteomics approaches preclude unbiased search for modifications, the optional technique of top down MSMS requires the use of highly accurate and highly resolved experiments to reveal subtle sequence modifications. In the present study, the top down MSMS approach combined with Traveling Wave Ion Mobility (TWIM) separation was evaluated for its ability to achieve high sequence coverage and to reveal subtle micro-heterogeneities that were hitherto only accessible with FTICR-MS instruments. The power of this approach is herein illustrated in an in-depth analysis of both wt and K496C variant of the recombinant X domain (XD, aa 459-507) of the measles virus phosphoprotein expressed in E. coli. Using top down MSMS combined to TWIM, we show that XD samples occasionally exhibit a micro-heterogeneity that could not be anticipated from the nucleotide sequence of the encoding constructs and that likely reflects a genetic drift, neutral or not, occurring during expression. In addition, an MTSL nitroxide probe that was grafted on the K496C XD variant was shown to undergo oxidation and/or protonation in the ESI source leading to artifactual mass increases. PMID:21800924

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Vip3Aa induces apoptosis in cultured Spodoptera frugiperda (Sf9) cells.

PubMed

Jiang, Kun; Mei, Si-Qi; Wang, Ting-Ting; Pan, Jin-Hua; Chen, Yue-Hua; Cai, Jun

2016-09-15

The vegetative insecticidal proteins (Vip) secreted by many Bacillus thuringiensis strains during their vegetative growth stage are regarded as second generation insecticidal proteins, as they share no sequence or structural homology with known crystal insecticidal proteins (Cry) and have a broad insecticidal spectrum. Compared with insecticidal crystal proteins (ICPs), the insecticidal mechanisms of Vips have been little studied. Here we investigated the mechanism responsible for Vip3Aa toxicity in cultured insect cells. Using, flow cytometry analyzes, TUNEL staining and DNA fragmentation assays, we show that Vip3Aa can induce apoptosis in Spodoptera frugiperda (Sf9) cells and cause cells to arrest at the G2/M phase. We also show that Vip3Aa can disrupt mitochondrial membrane potential (ΔΨm), leading to the activation of Sf-caspase-1, suggesting that a mitochondrial mediated and caspase dependent pathway may be involved in Vip3Aa-induced apoptosis in Sf9 cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence variability of the respiratory syncytial virus (RSV) fusion gene among contemporary and historical genotypes of RSV/A and RSV/B

PubMed Central

Hause, Anne M.; Henke, David M.; Avadhanula, Vasanthi; Shaw, Chad A.; Tapia, Lorena I.

2017-01-01

Background The fusion (F) protein of RSV is the major vaccine target. This protein undergoes a conformational change from pre-fusion to post-fusion. Both conformations share antigenic sites II and IV. Pre-fusion F has unique antigenic sites p27, ø, α2α3β3β4, and MPE8; whereas, post-fusion F has unique antigenic site I. Our objective was to determine the antigenic variability for RSV/A and RSV/B isolates from contemporary and historical genotypes compared to a historical RSV/A strain. Methods The F sequences of isolates from GenBank, Houston, and Chile (N = 1,090) were used for this analysis. Sequences were compared pair-wise to a reference sequence, a historical RSV/A Long strain. Variability (calculated as %) was defined as changes at each amino acid (aa) position when compared to the reference sequence. Only aa at antigenic sites with variability ≥5% were reported. Results A total of 1,090 sequences (822 RSV/A and 268 RSV/B) were analyzed. When compared to the reference F, those domains with the greatest number of non-synonymous changes included the signal peptide, p27, heptad repeat domain 2, antigenic site ø, and the transmembrane domain. RSV/A subgroup had 7 aa changes in the antigenic sites: site I (N = 1), II (N = 1), p27 (N = 4), α2α3β3β4(AM14) (N = 1), ranging in frequency from 7–91%. In comparison, RSV/B had 19 aa changes in antigenic sites: I (N = 3), II (N = 1), p27 (N = 9), ø (N = 4), α2α3β3β4(AM14) (N = 1), and MPE8 (N = 1), ranging in frequency from 79–100%. Discussion Although antigenic sites of RSV F are generally well conserved, differences are observed when comparing the two subgroups to the reference RSV/A Long strain. Further, these discrepancies are accented in the antigenic sites in pre-fusion F of RSV/B isolates, often occurring with a frequency of 100%. This could be of importance if a monovalent F protein from the historical GA1 genotype of RSV/A is used for vaccine development. PMID:28414749

Sequence variability of the respiratory syncytial virus (RSV) fusion gene among contemporary and historical genotypes of RSV/A and RSV/B.

PubMed

Hause, Anne M; Henke, David M; Avadhanula, Vasanthi; Shaw, Chad A; Tapia, Lorena I; Piedra, Pedro A

2017-01-01

The fusion (F) protein of RSV is the major vaccine target. This protein undergoes a conformational change from pre-fusion to post-fusion. Both conformations share antigenic sites II and IV. Pre-fusion F has unique antigenic sites p27, ø, α2α3β3β4, and MPE8; whereas, post-fusion F has unique antigenic site I. Our objective was to determine the antigenic variability for RSV/A and RSV/B isolates from contemporary and historical genotypes compared to a historical RSV/A strain. The F sequences of isolates from GenBank, Houston, and Chile (N = 1,090) were used for this analysis. Sequences were compared pair-wise to a reference sequence, a historical RSV/A Long strain. Variability (calculated as %) was defined as changes at each amino acid (aa) position when compared to the reference sequence. Only aa at antigenic sites with variability ≥5% were reported. A total of 1,090 sequences (822 RSV/A and 268 RSV/B) were analyzed. When compared to the reference F, those domains with the greatest number of non-synonymous changes included the signal peptide, p27, heptad repeat domain 2, antigenic site ø, and the transmembrane domain. RSV/A subgroup had 7 aa changes in the antigenic sites: site I (N = 1), II (N = 1), p27 (N = 4), α2α3β3β4(AM14) (N = 1), ranging in frequency from 7-91%. In comparison, RSV/B had 19 aa changes in antigenic sites: I (N = 3), II (N = 1), p27 (N = 9), ø (N = 4), α2α3β3β4(AM14) (N = 1), and MPE8 (N = 1), ranging in frequency from 79-100%. Although antigenic sites of RSV F are generally well conserved, differences are observed when comparing the two subgroups to the reference RSV/A Long strain. Further, these discrepancies are accented in the antigenic sites in pre-fusion F of RSV/B isolates, often occurring with a frequency of 100%. This could be of importance if a monovalent F protein from the historical GA1 genotype of RSV/A is used for vaccine development.

Microsolvation of the acetanilide cation (AA(+)) in a nonpolar solvent: IR spectra of AA(+)-L(n) clusters (L = He, Ar, N2; n ≤ 10).

PubMed

Schmies, Matthias; Patzer, Alexander; Schütz, Markus; Miyazaki, Mitsuhiko; Fujii, Masaaki; Dopfer, Otto

2014-05-07

Infrared photodissociation (IRPD) spectra of mass-selected cluster ions of acetanilide (N-phenylacetamide), AA(+)-Ln, with the ligands L = He (n = 1-2), Ar (n = 1-7), and N2 (n = 1-10) are recorded in the hydride stretch (amide A, νNH, νCH) and fingerprint (amide I-III) ranges of AA(+) in its (2)A'' ground electronic state. Cold AA(+)-Ln clusters are generated in an electron impact ion source, which predominantly produces the most stable isomer of a given cluster ion. Systematic vibrational frequency shifts of the N-H stretch fundamentals (νNH) provide detailed information about the sequential microsolvation process of AA(+) in a nonpolar (L = He and Ar) and quadrupolar (L = N2) solvent. In the most stable AA(+)-Ln clusters, the first ligand forms a hydrogen bond (H-bond) with the N-H proton of trans-AA(+) (t-AA(+)), whereas further ligands bind weakly to the aromatic ring (π-stacking). There is no experimental evidence for complexes with the less stable cis-AA(+) isomer. Quantum chemical calculations at the M06-2X/aug-cc-pVTZ level confirm the cluster growth sequence derived from the IR spectra. The calculated binding energies of De(H) = 720 and 1227 cm(-1) for H-bonded and De(π) = 585 and 715 cm(-1) for π-bonded Ar and N2 ligands in t-AA(+)-L are consistent with the observed photofragmentation branching ratios of AA(+)-Ln. Comparison between charged and neutral AA((+))-L dimers indicates that ionization switches the preferred ion-ligand binding motif from π-stacking to H-bonding. Electron removal from the HOMO of AA(+) delocalized over both the aromatic ring and the amide group significantly strengthens the C[double bond, length as m-dash]O bond and weakens the N-H bond of the amide group.

Molecular cloning, gene expression analysis, and recombinant protein expression of novel silk proteins from larvae of a retreat-maker caddisfly, Stenopsyche marmorata.

PubMed

Bai, Xue; Sakaguchi, Mayo; Yamaguchi, Yuko; Ishihara, Shiori; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku; Nomura, Takaomi; Arai, Ryoichi

2015-08-28

Retreat-maker larvae of Stenopsyche marmorata, one of the major caddisfly species in Japan, produce silk threads and adhesives to build food capture nets and protective nests in water. Research on these underwater adhesive silk proteins potentially leads to the development of new functional biofiber materials. Recently, we identified four major S. marmorata silk proteins (Smsps), Smsp-1, Smsp-2, Smsp-3, and Smsp-4 from silk glands of S. marmorata larvae. In this study, we cloned full-length cDNAs of Smsp-2, Smsp-3, and Smsp-4 from the cDNA library of the S. marmorata silk glands to reveal the primary sequences of Smsps. Homology search results of the deduced amino acid sequences indicate that Smsp-2 and Smsp-4 are novel proteins. The Smsp-2 sequence [167 amino acids (aa)] has an array of GYD-rich repeat motifs and two (SX)4E motifs. The Smsp-4 sequence (132 aa) contains a number of GW-rich repeat motifs and three (SX)4E motifs. The Smsp-3 sequence (248 aa) exhibits high homology with fibroin light chain of other caddisflies. Gene expression analysis of Smsps by real-time PCR suggested that the gene expression of Smsp-1 and Smsp-3 was relatively stable throughout the year, whereas that of Smsp-2 and Smsp-4 varied seasonally. Furthermore, Smsps recombinant protein expression was successfully performed in Escherichia coli. The study provides new molecular insights into caddisfly aquatic silk and its potential for future applications. Copyright © 2015 Elsevier Inc. All rights reserved.

Aminobacter aminovorans NADH:flavin oxidoreductase His140: a highly conserved residue critical for NADH binding and utilization.

PubMed

Russell, Thomas R; Tu, Shiao-Chun

2004-10-12

Homodimeric FRD(Aa) Class I is an NADH:flavin oxidoreductase from Aminobacter aminovorans. It is unusual because it contains an FMN cofactor but utilizes a sequential-ordered kinetic mechanism. Because little is known about NADH-specific flavin reductases in general and FRD(Aa) in particular, this study aimed to further explore FRD(Aa) by identifying the functionalities of a key residue. A sequence alignment of FRD(Aa) with several known and hypothetical flavoproteins in the same subfamily reveals within the flavin reductase active-site domain a conserved GDH motif, which is believed to be responsible for the enzyme and NADH interaction. Mutation of the His140 in this GDH motif to alanine reduced FRD(Aa) activity to <3%. An ultrafiltration assay and fluorescence quenching demonstrated that H140A FRD(Aa) binds FMN in the same 1:1 stoichiometric ratio as the wild-type enzyme, but with slightly weakened affinity (K(d) = 0.9 microM). Anaerobic stopped-flow studies were carried out using both the native and mutated FRD(Aa). Similar to the native enzyme, H140A FRD(Aa) was also able to reduce the FMN cofactor by NADH although much less efficiently. Kinetic analysis of anaerobic reduction measurements indicated that the His140 residue of FRD(Aa) was essential to NADH binding, as well as important for the reduction of the FMN cofactor. For the native enzyme, the cofactor reduction was followed by at least one slower step in the catalytic pathway.

The unfolding mechanism of monomeric mutant SOD1 by simulated force spectroscopy.

PubMed

Habibi, Mona; Rottler, Jörg; Plotkin, Steven S

2017-11-01

Mechanical unfolding of mutated apo, disulfide-reduced, monomeric superoxide dismutase 1 protein (SOD1) has been simulated via force spectroscopy techniques, using both an all-atom (AA), explicit solvent model and a coarse-grained heavy-atom Gō (HA-Gō) model. The HA-Gō model was implemented at two different pulling speeds for comparison. The most-common sequence of unfolding in the AA model agrees well with the most-common unfolding sequence of the HA-Gō model, when the same normalized pulling rate was used. Clustering of partially-native structures as the protein unfolds shows that the AA and HA-Gō models both exhibit a dominant pathway for early unfolding, which eventually bifurcates repeatedly to multiple branches after the protein is about half-unfolded. The force-extension curve exhibits multiple force drops, which are concomitant with jumps in the local interaction potential energy between specific β-strands in the protein. These sudden jumps in the potential energy coincide with the dissociation of specific pairs of β-strands, and thus intermediate unfolding events. The most common sequence of β-strand dissociation in the unfolding pathway of the AA model is β-strands 5, 4, 8, 7, 1, 2, then finally β-strands 3 and 6. The observation that β-strand 5 is among the first to unfold here, but the last to unfold in simulations of loop-truncated SOD1, could imply the existence of an evolutionary compensation mechanism, which would stabilize β-strands flanking long loops against their entropic penalty by strengthening intramolecular interactions. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

Evolution of simeprevir-resistant variants over time by ultra-deep sequencing in HCV genotype 1b.

PubMed

Akuta, Norio; Suzuki, Fumitaka; Sezaki, Hitomi; Suzuki, Yoshiyuki; Hosaka, Tetsuya; Kobayashi, Masahiro; Kobayashi, Mariko; Saitoh, Satoshi; Ikeda, Kenji; Kumada, Hiromitsu

2014-08-01

Using ultra-deep sequencing technology, the present study was designed to investigate the evolution of simeprevir-resistant variants (amino acid substitutions of aa80, aa155, aa156, and aa168 positions in HCV NS3 region) over time. In Toranomon Hospital, 18 Japanese patients infected with HCV genotype 1b, received triple therapy of simeprevir/PEG-IFN/ribavirin (DRAGON or CONCERT study). Sustained virological response rate was 67%, and that was significantly higher in patients with IL28B rs8099917 TT than in those with non-TT. Six patients, who did not achieve sustained virological response, were tested for resistant variants by ultra-deep sequencing, at the baseline, at the time of re-elevation of viral loads, and at 96 weeks after the completion of treatment. Twelve of 18 resistant variants, detected at re-elevation of viral load, were de novo resistant variants. Ten of 12 de novo resistant variants become undetectable over time, and that five of seven resistant variants, detected at baseline, persisted over time. In one patient, variants of Q80R at baseline (0.3%) increased at 96-week after the cessation of treatment (10.2%), and de novo resistant variants of D168E (0.3%) also increased at 96-week after the cessation of treatment (9.7%). In conclusion, the present study indicates that the emergence of simeprevir-resistant variants after the start of treatment could not be predicted at baseline, and the majority of de novo resistant variants become undetectable over time. Further large-scale prospective studies should be performed to investigate the clinical utility in detecting simeprevir-resistant variants. © 2014 Wiley Periodicals, Inc.

Improvement and efficient display of Bacillus thuringiensis toxins on M13 phages and ribosomes.

PubMed

Pacheco, Sabino; Cantón, Emiliano; Zuñiga-Navarrete, Fernando; Pecorari, Frédéric; Bravo, Alejandra; Soberón, Mario

2015-12-01

Bacillus thuringiensis (Bt) produces insecticidal proteins that have been used worldwide in the control of insect-pests in crops and vectors of human diseases. However, different insect species are poorly controlled by the available Bt toxins or have evolved resistance to these toxins. Evolution of Bt toxicity could provide novel toxins to control insect pests. To this aim, efficient display systems to select toxins with increased binding to insect membranes or midgut proteins involved in toxicity are likely to be helpful. Here we describe two display systems, phage display and ribosome display, that allow the efficient display of two non-structurally related Bt toxins, Cry1Ac and Cyt1Aa. Improved display of Cry1Ac and Cyt1Aa on M13 phages was achieved by changing the commonly used peptide leader sequence of the coat pIII-fusion protein, that relies on the Sec translocation pathway, for a peptide leader sequence that relies on the signal recognition particle pathway (SRP) and by using a modified M13 helper phage (Phaberge) that has an amber mutation in its pIII genomic sequence and preferentially assembles using the pIII-fusion protein. Also, both Cry1Ac and Cyt1Aa were efficiently displayed on ribosomes, which could allow the construction of large libraries of variants. Furthermore, Cry1Ac or Cyt1Aa displayed on M13 phages or ribosomes were specifically selected from a mixture of both toxins depending on which antigen was immobilized for binding selection. These improved systems may allow the selection of Cry toxin variants with improved insecticidal activities that could counter insect resistances.

Isolation of an invertebrate-type lysozyme from the nephridia of the echiura, Urechis unicinctus, and its recombinant production and activities.

PubMed

Oh, Hye Young; Kim, Chan-Hee; Go, Hye-Jin; Park, Nam Gyu

2018-05-09

Invertebrates, unlike vertebrates which have adaptive immune system, rely heavily on the innate immune system for the defense against pathogenic bacteria. Lysozymes, along with other immune effectors, are regarded as an important group in this defense. An invertebrate-type (i-type) lysozyme, designated Urechis unicinctus invertebrate-type lysozyme, Uu-ilys, has been isolated from nephridia of Urechis unicinctus using a series of high performance liquid chromatography (HPLC), and ultrasensitive radial diffusion assay (URDA) as a bioassay system. Analyses of the primary structure and cDNA cloning revealed that Uu-ilys was approximately 14 kDa and composed of 122 amino acids (AAs) of which the precursor had a total of 160 AAs containing a signal peptide of 18 AAs and a pro-sequence of 20 AAs encoded by the nucleotide sequence of 714 bp that comprises a 5' untranslated region (UTR) of 42 bp, an open reading frame (ORF) of 483 bp, and a 3' UTR of 189 bp. Multiple sequence alignment showed Uu-ilys has high homology to i-type lysozymes from several annelids. Relatively high transcriptional expression levels of Uu-ilys was detected in nephridia, anal vesicle, and intestine. The native Uu-ilys exhibited comparable lysozyme enzymatic and antibacterial activities to hen egg white lysozyme. Collectively, these data suggest that Uu-ilys, the isolated antibacterial protein, plays a role in the immune defense mechanism of U. unicinctus. Recombinant Uu-ilys (rUu-ilys) produced in a bacterial expression system showed significantly decreased lysozyme lytic activity from that of the native while its potency on radial diffusion assay detecting antibacterial activity was retained, which may indicate the non-enzymatic antibacterial capacity of Uu-ilys. Copyright © 2018. Published by Elsevier Ltd.

Strain of ascending aorta on cardiac magnetic resonance in 1027 patients: Relation with age, gender, and cardiovascular disease.

PubMed

Scarabello, Marco; Codari, Marina; Secchi, Francesco; Cannaò, Paola M; Alì, Marco; Di Leo, Giovanni; Sardanelli, Francesco

2018-02-01

To evaluate ascending aortic strain (AAS) with cardiac magnetic resonance (CMR) in a large consecutive series of patients with different types of cardiovascular disease (CVD). Two-dimensional phase-contrast gradient-echo sequences of the ascending aorta were retrospectively reviewed in 1027 patients (726 males, 301 females). Aortic lumen area was segmented using a semi-automatic approach to calculate AAS values. Subgroup analysis was performed for patients with normal CMR, tetralogy of Fallot (ToF), and ischemic heart disease (IHD). Multivariate and post-hoc analyses were performed to evaluate the effect of age, gender, and CVD on AAS values. Shapiro-Wilk, three- and two-way ANOVA, Mann-Whitney U, and Spearman correlation statistics were used. Multivariate analysis showed significant differences in AAS among decades of age (p<0.001), genders (p=0.006) and CVD subgroups (p<0.001) without interaction among these factors. A gender-related difference (higher AAS in females) was significant in ToF (p=0.008), while an AAS reduction during aging was observed in all CVD subgroups. Post-hoc analysis showed a significantly lower AAS in ToF and IHD patients compared to subjects with normal CMR (p<0.001). Differences in age, gender, and CVD independently affect AAS. The lower AAS observed in ToF fosters its assessment during follow-up in adulthood. Future studies on causes and clinical implications of a higher AAS in females affected by ToF are warranted. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

PubMed

Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

2012-12-01

The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

Bacillus thuringiensis Crystal Protein Cry6Aa Triggers Caenorhabditis elegans Necrosis Pathway Mediated by Aspartic Protease (ASP-1)

PubMed Central

Zhang, Fengjuan; Peng, Donghai; Cheng, Chunsheng; Zhou, Wei; Ju, Shouyong; Wan, Danfeng; Yu, Ziquan; Shi, Jianwei; Deng, Yaoyao; Wang, Fenshan; Ye, Xiaobo; Hu, Zhenfei; Lin, Jian; Ruan, Lifang; Sun, Ming

2016-01-01

Cell death plays an important role in host-pathogen interactions. Crystal proteins (toxins) are essential components of Bacillus thuringiensis (Bt) biological pesticides because of their specific toxicity against insects and nematodes. However, the mode of action by which crystal toxins to induce cell death is not completely understood. Here we show that crystal toxin triggers cell death by necrosis signaling pathway using crystal toxin Cry6Aa-Caenorhabditis elegans toxin-host interaction system, which involves an increase in concentrations of cytoplasmic calcium, lysosomal lyses, uptake of propidium iodide, and burst of death fluorescence. We find that a deficiency in the necrosis pathway confers tolerance to Cry6Aa toxin. Intriguingly, the necrosis pathway is specifically triggered by Cry6Aa, not by Cry5Ba, whose amino acid sequence is different from that of Cry6Aa. Furthermore, Cry6Aa-induced necrosis pathway requires aspartic protease (ASP-1). In addition, ASP-1 protects Cry6Aa from over-degradation in C. elegans. This is the first demonstration that deficiency in necrosis pathway confers tolerance to Bt crystal protein, and that Cry6A triggers necrosis represents a newly added necrosis paradigm in the C. elegans. Understanding this model could lead to new strategies for nematode control. PMID:26795495

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Language Helps Children Succeed on a Classic Analogy Task

ERIC Educational Resources Information Center

Christie, Stella; Gentner, Dedre

2014-01-01

Adult humans show exceptional relational ability relative to other species. In this research, we trace the development of this ability in young children. We used a task widely used in comparative research--the relational match-to-sample task, which requires participants to notice and match the identity relation: for example, AA should match BB…

Late Miocene volcanic sequences in northern Victoria Land, Antarctica: products of glaciovolcanic eruptions under different thermal regimes

NASA Astrophysics Data System (ADS)

Smellie, J. L.; Rocchi, S.; Armienti, P.

2011-01-01

Late Miocene (c. 13-5 Ma) volcanic sequences of the Hallett Volcanic Province (HVP) crop out along >250 km of western Ross Sea coast in northern Victoria Land. Eight primary volcanic and six sedimentary lithofacies have been identified, and they are organised into at least five different sequence architectures as a consequence of different combinations of eruptive and/or depositional conditions. The volcanoes were erupted in association with a Miocene glacial cover and the sequences are overwhelmingly glaciovolcanic. The commonest and most representative are products of mafic aa lava-fed deltas, a type of glaciovolcanic sequence that has not been described before. It is distinguished by (1) a subaerially emplaced relatively thin caprock of aa lavas lying on and passing down-dip into (2) a thicker association of chaotic to crudely bedded hyaloclastite breccias, water-chilled lava sheets and irregular lava masses, collectively called lobe-hyaloclastite. A second distinctive sequence type present is characterised by water-cooled lavas and associated sedimentary lithofacies (diamictite (probably glacigenic) and fluvial sands and gravels) similar to some mafic glaciovolcanic sheet-like sequences (see Smellie, Earth-Science Reviews, 74, 241-268, 2008), but including (for the first time) examples of likely sheet-like sequences with felsic compositions. Other sequence types in the HVP are minor and include tuff cones, cinder cones and a single ice-marginal lacustrine sequence. The glacial thermal regime varied from polar, characterised by sequences lacking glacial erosion, glacigenic sediments or evidence for free water, to temperate or sub-polar for sequences in which all of these features are conspicuously developed.

Genome sequence of the cultivated cotton Gossypium arboreum

USDA-ARS?s Scientific Manuscript database

Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...

Analysis and prediction of presynaptic and postsynaptic neurotoxins by Chou's general pseudo amino acid composition and motif features.

PubMed

Mei, Juan; Zhao, Ji

2018-06-14

Presynaptic neurotoxins and postsynaptic neurotoxins are two important neurotoxins isolated from venoms of venomous animals and have been proven to be potential effective in neurosciences and pharmacology. With the number of toxin sequences appeared in the public databases, there was a need for developing a computational method for fast and accurate identification and classification of the novel presynaptic neurotoxins and postsynaptic neurotoxins in the large databases. In this study, the Multinomial Naive Bayes Classifier (MNBC) had been developed to discriminate the presynaptic neurotoxins and postsynaptic neurotoxins based on the different kinds of features. The Minimum Redundancy Maximum Relevance (MRMR) feature selection method was used for ranking 400 pseudo amino acid (PseAA) compositions and 50 top ranked PseAA compositions were selected for improving the prediction results. The motif features, 400 PseAA compositions and 50 PseAA compositions were combined together, and selected as the input parameters of MNBC. The best correlation coefficient (CC) value of 0.8213 was obtained when the prediction quality was evaluated by the jackknife test. It was anticipated that the algorithm presented in this study may become a useful tool for identification of presynaptic neurotoxin and postsynaptic neurotoxin sequences and may provide some useful help for in-depth investigation into the biological mechanism of presynaptic neurotoxins and postsynaptic neurotoxins. Copyright © 2018 Elsevier Ltd. All rights reserved.

Backbone Brackets and Arginine Tweezers delineate Class I and Class II aminoacyl tRNA synthetases

PubMed Central

Haupt, V. Joachim; Schroeder, Michael; Labudde, Dirk

2018-01-01

The origin of the machinery that realizes protein biosynthesis in all organisms is still unclear. One key component of this machinery are aminoacyl tRNA synthetases (aaRS), which ligate tRNAs to amino acids while consuming ATP. Sequence analyses revealed that these enzymes can be divided into two complementary classes. Both classes differ significantly on a sequence and structural level, feature different reaction mechanisms, and occur in diverse oligomerization states. The one unifying aspect of both classes is their function of binding ATP. We identified Backbone Brackets and Arginine Tweezers as most compact ATP binding motifs characteristic for each Class. Geometric analysis shows a structural rearrangement of the Backbone Brackets upon ATP binding, indicating a general mechanism of all Class I structures. Regarding the origin of aaRS, the Rodin-Ohno hypothesis states that the peculiar nature of the two aaRS classes is the result of their primordial forms, called Protozymes, being encoded on opposite strands of the same gene. Backbone Brackets and Arginine Tweezers were traced back to the proposed Protozymes and their more efficient successors, the Urzymes. Both structural motifs can be observed as pairs of residues in contemporary structures and it seems that the time of their addition, indicated by their placement in the ancient aaRS, coincides with the evolutionary trace of Proto- and Urzymes. PMID:29659563

Identification of novel mutations in Mexican patients with Aarskog-Scott syndrome.

PubMed

Pérez-Coria, Mariana; Lugo-Trampe, José J; Zamudio-Osuna, Michell; Rodríguez-Sánchez, Iram P; Lugo-Trampe, Angel; de la Fuente-Cortez, Beatriz; Campos-Acevedo, Luis D; Martínez-de-Villarreal, Laura E

2015-05-01

Aarskog-Scott syndrome (AAS), also known as faciogenital dysplasia (FGD, OMIM # 305400), is an X-linked disorder of recessive inheritance, characterized by short stature and facial, skeletal, and urogenital abnormalities. AAS is caused by mutations in the FGD1 gene (Xp11.22), with over 56 different mutations identified to date. We present the clinical and molecular analysis of four unrelated families of Mexican origin with an AAS phenotype, in whom FGD1 sequencing was performed. This analysis identified two stop mutations not previously reported in the literature: p.Gln664* and p.Glu380*. Phenotypically, every male patient met the clinical criteria of the syndrome, whereas discrepancies were found between phenotypes in female patients. Our results identify two novel mutations in FGD1, broadening the spectrum of reported mutations; and provide further delineation of the phenotypic variability previously described in AAS.

Identification of novel mutations in Mexican patients with Aarskog–Scott syndrome

PubMed Central

Pérez-Coria, Mariana; Lugo-Trampe, José J; Zamudio-Osuna, Michell; Rodríguez-Sánchez, Iram P; Lugo-Trampe, Angel; de la Fuente-Cortez, Beatriz; Campos-Acevedo, Luis D; Martínez-de-Villarreal, Laura E

2015-01-01

Aarskog–Scott syndrome (AAS), also known as faciogenital dysplasia (FGD, OMIM # 305400), is an X-linked disorder of recessive inheritance, characterized by short stature and facial, skeletal, and urogenital abnormalities. AAS is caused by mutations in the FGD1 gene (Xp11.22), with over 56 different mutations identified to date. We present the clinical and molecular analysis of four unrelated families of Mexican origin with an AAS phenotype, in whom FGD1 sequencing was performed. This analysis identified two stop mutations not previously reported in the literature: p.Gln664* and p.Glu380*. Phenotypically, every male patient met the clinical criteria of the syndrome, whereas discrepancies were found between phenotypes in female patients. Our results identify two novel mutations in FGD1, broadening the spectrum of reported mutations; and provide further delineation of the phenotypic variability previously described in AAS. PMID:26029706

Yeast mitochondrial threonyl-tRNA synthetase recognizes tRNA isoacceptors by distinct mechanisms and promotes CUN codon reassignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ling, Jiqiang; Peterson, Kaitlyn M.; Simonovic, Ivana

2014-03-12

Aminoacyl-tRNA synthetases (aaRSs) ensure faithful translation of mRNA into protein by coupling an amino acid to a set of tRNAs with conserved anticodon sequences. Here, we show that in mitochondria of Saccharomyces cerevisiae, a single aaRS (MST1) recognizes and aminoacylates two natural tRNAs that contain anticodon loops of different size and sequence. Besides a regular ?? with a threonine (Thr) anticodon, MST1 also recognizes an unusual ??, which contains an enlarged anticodon loop and an anticodon triplet that reassigns the CUN codons from leucine to threonine. Our data show that MST1 recognizes the anticodon loop in both tRNAs, but employsmore » distinct recognition mechanisms. The size but not the sequence of the anticodon loop is critical for ?? recognition, whereas the anticodon sequence is essential for aminoacylation of ??. The crystal structure of MST1 reveals that, while lacking the N-terminal editing domain, the enzyme closely resembles the bacterial threonyl-tRNA synthetase (ThrRS). A detailed structural comparison with Escherichia coli ThrRS, which is unable to aminoacylate ??, reveals differences in the anticodon-binding domain that probably allow recognition of the distinct anticodon loops. Finally, our mutational and modeling analyses identify the structural elements in MST1 (e.g., helix {alpha}11) that define tRNA selectivity. Thus, MTS1 exemplifies that a single aaRS can recognize completely divergent anticodon loops of natural isoacceptor tRNAs and that in doing so it facilitates the reassignment of the genetic code in yeast mitochondria.« less

Mad men, women and steroid cocktails: A review of the impact of sex and other factors on anabolic androgenic steroids effects on affective behaviors

PubMed Central

Henderson, Leslie P.

2016-01-01

Rationale For several decades, elite athletes and a growing number of recreational consumers have used anabolic androgenic steroids (AAS) as performance enhancing drugs. Despite mounting evidence that illicit use of these synthetic steroids has detrimental effects on affective states, information available on sex-specific actions of these drugs is lacking. Objectives The focus of this review is to assess information to date on the importance of sex and its interaction with other environmental factors on affective behaviors, with an emphasis on data derived from non-human studies. Methods The PubMed database was searched for relevant studies in both sexes. Results Studies examining AAS use in females are limited, reflecting the lower prevalence of use in this sex. Data, however, indicate significant sex-specific differences in AAS effects on anxiety-like and aggressive behaviors, interactions with other drugs of abuse, and the interplay of AAS with other environmental factors such as diet and exercise. Conclusions Current methods for assessing AAS use have limitations that suggest biases of both under- and over-reporting, which may be amplified for females who are poorly represented in self-report studies of human subjects and are rarely used in animal studies. Data from animal literature suggest that there are significant sex-specific differences in the impact of AAS on aggression, anxiety, and concomitant use of other abused substances. These results have relevance for human females who take these drugs as performance enhancing substances and for transgender XX individuals who may illicitly self-administer AAS as they transition to a male gender identity. PMID:26758282

Resistance Phenotypes Mediated by Aminoacyl-Phosphatidylglycerol Synthases

PubMed Central

Arendt, Wiebke; Hebecker, Stefanie; Jäger, Sonja; Nimtz, Manfred

2012-01-01

The specific aminoacylation of the phospholipid phosphatidylglycerol (PG) with alanine or with lysine catalyzed by aminoacyl-phosphatidylglycerol synthases (aaPGS) was shown to render various organisms less susceptible to antibacterial agents. This study makes use of Pseudomonas aeruginosa chimeric mutant strains producing lysyl-phosphatidylglycerol (L-PG) instead of the naturally occurring alanyl-phosphatidylglycerol (A-PG) to study the resulting impact on bacterial resistance. Consequences of such artificial phospholipid composition were studied in the presence of an overall of seven antimicrobials (β-lactams, a lipopeptide antibiotic, cationic antimicrobial peptides [CAMPs]) to quantitatively assess the effect of A-PG substitution (with L-PG, L-PG and A-PG, increased A-PG levels). For the employed Gram-negative P. aeruginosa model system, an exclusive charge repulsion mechanism does not explain the attenuated antimicrobial susceptibility due to PG modification. Additionally, the specificity of nine orthologous aaPGS enzymes was experimentally determined. The newly characterized protein sequences allowed for the establishment of a significant group of A-PG synthase sequences which were bioinformatically compared to the related group of L-PG synthesizing enzymes. The analysis revealed a diverse origin for the evolution of A-PG and L-PG synthases, as the specificity of an individual enzyme is not reflected in terms of a characteristic sequence motif. This finding is relevant for future development of potential aaPGS inhibitors. PMID:22267511

Sequence and expression variation in SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1): homeolog evolution in Indian Brassicas.

PubMed

Sri, Tanu; Mayee, Pratiksha; Singh, Anandita

2015-09-01

Whole genome sequence analyses allow unravelling such evolutionary consequences of meso-triplication event in Brassicaceae (∼14-20 million years ago (MYA)) as differential gene fractionation and diversification in homeologous sub-genomes. This study presents a simple gene-centric approach involving microsynteny and natural genetic variation analysis for understanding SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1) homeolog evolution in Brassica. Analysis of microsynteny in Brassica rapa homeologous regions containing SOC1 revealed differential gene fractionation correlating to reported fractionation status of sub-genomes of origin, viz. least fractionated (LF), moderately fractionated 1 (MF1) and most fractionated (MF2), respectively. Screening 18 cultivars of 6 Brassica species led to the identification of 8 genomic and 27 transcript variants of SOC1, including splice-forms. Co-occurrence of both interrupted and intronless SOC1 genes was detected in few Brassica species. In silico analysis characterised Brassica SOC1 as MADS intervening, K-box, C-terminal (MIKC(C)) transcription factor, with highly conserved MADS and I domains relative to K-box and C-terminal domain. Phylogenetic analyses and multiple sequence alignments depicting shared pattern of silent/non-silent mutations assigned Brassica SOC1 homologs into groups based on shared diploid base genome. In addition, a sub-genome structure in uncharacterised Brassica genomes was inferred. Expression analysis of putative MF2 and LF (Brassica diploid base genome A (AA)) sub-genome-specific SOC1 homeologs of Brassica juncea revealed near identical expression pattern. However, MF2-specific homeolog exhibited significantly higher expression implying regulatory diversification. In conclusion, evidence for polyploidy-induced sequence and regulatory evolution in Brassica SOC1 is being presented wherein differential homeolog expression is implied in functional diversification.

On Mass Polarization Effect in Three-Body Nuclear Systems

NASA Astrophysics Data System (ADS)

Filikhin, I.; Kezerashvili, R. Ya.; Suslov, V. M.; Vlahovic, B.

2018-05-01

The mass polarization effect is considered for different three-body nuclear AAB systems having a strongly bound AB and unbound AA subsystems. We employ the Faddeev equations for calculations and the Schrödinger equation for analysis of the contribution of the mass polarization term of the kinetic-energy operator. For a three-boson system the mass polarization effect is determined by the difference of the doubled binding energy of the AB subsystem 2E2 and the three-body binding energy E3(V_{AA}=0) when the interaction between the identical particles is omitted. In this case: | E3(V_{AA}=0)| >2| E2| . In the case of a system complicated by isospins(spins), such as the kaonic clusters K-K-p and ppK-, a similar evaluation is impossible. For these systems it is found that | E3(V_{AA}=0)| <2| E2| . A model with an AB potential averaged over spin(isospin) variables transforms the latter case to the first one. The mass polarization effect calculated within this model is essential for the kaonic clusters. In addition we have obtained the relation |E_3|≤|2E_2| for the binding energy of the kaonic clusters.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

D-Dimer in African Americans: Whole Genome Sequence Analysis and Relationship to Cardiovascular Disease Risk in the Jackson Heart Study.

PubMed

Raffield, Laura M; Zakai, Neil A; Duan, Qing; Laurie, Cecelia; Smith, Joshua D; Irvin, Marguerite R; Doyle, Margaret F; Naik, Rakhi P; Song, Ci; Manichaikul, Ani W; Liu, Yongmei; Durda, Peter; Rotter, Jerome I; Jenny, Nancy S; Rich, Stephen S; Wilson, James G; Johnson, Andrew D; Correa, Adolfo; Li, Yun; Nickerson, Deborah A; Rice, Kenneth; Lange, Ethan M; Cushman, Mary; Lange, Leslie A; Reiner, Alex P

2017-11-01

Plasma levels of the fibrinogen degradation product D-dimer are higher among African Americans (AAs) compared with those of European ancestry and higher among women compared with men. Among AAs, little is known of the genetic architecture of D-dimer or the relationship of D-dimer to incident cardiovascular disease. We measured baseline D-dimer in 4163 AAs aged 21 to 93 years from the prospective JHS (Jackson Heart Study) cohort and assessed association with incident cardiovascular disease events. In participants with whole genome sequencing data (n=2980), we evaluated common and rare genetic variants for association with D-dimer. Each standard deviation higher baseline D-dimer was associated with a 20% to 30% increased hazard for incident coronary heart disease, stroke, and all-cause mortality. Genetic variation near F3 was associated with higher D-dimer (rs2022030, β=0.284, P =3.24×10 -11 ). The rs2022030 effect size was nearly 3× larger among women (β=0.373, P =9.06×10 -13 ) than among men (β=0.135, P =0.06; P interaction =0.009). The sex by rs2022030 interaction was replicated in an independent sample of 10 808 multiethnic men and women ( P interaction =0.001). Finally, the African ancestral sickle cell variant ( HBB rs334) was significantly associated with higher D-dimer in JHS (β=0.507, P =1.41×10 -14 ), and this association was successfully replicated in 1933 AAs ( P =2.3×10 -5 ). These results highlight D-dimer as an important predictor of cardiovascular disease risk in AAs and suggest that sex-specific and African ancestral genetic effects of the F3 and HBB loci contribute to the higher levels of D-dimer among women and AAs. © 2017 American Heart Association, Inc.

Cloning of stanniocalcin (STC) cDNAs of divergent teleost species: Monomeric STC supports monophyly of the ancient teleosts, the osteoglossomorphs.

PubMed

Amemiya, Yutaka; Irwin, David M; Youson, John H

2006-10-01

Molecular cloning of teleost stanniocalcin (STC) cDNAs was undertaken in two species of order Osteoglossiformes of subdivision Osteoglossomorpha and one species of each of orders Cypriniformes and Perciformes within the subdivision Euteleostei. The elephantnose (Gnathonemus petersii) and the butterflyfish (Pantadon buchholzi) are basal teleosts in different osteoglossiforme suborders yet their 218 amino acid (aa) mature hormones, from prehormones of 249 and 251aa, respectively, have only 10 cysteine residues. A substitution for cysteine at the intermonomeric disulfide linkage site, implies that their STCs exist as monomeric peptides, as is the case with STC from another osteoglossormorph, arawana [Amemiya, Y., Marra, L.E., Reyhani, N., Youson, J.H., 2002. Stanniocalcin from an ancient teleost: a monomeric form of the hormone and a possible extracorpuscular distribution. Mol. Cell. Endocrinol. 188, 141-150]. The STC cDNA of the generalized teleost and cyprinid, the white sucker (Catostomus commersoni), encodes a prehormone of 249aa with a signal peptide of 31aa and a mature protein of 218aa that possesses 11 cysteine residues. The latter feature is consistent with a previous analysis that white sucker mature STC is a glycosylated, homodimeric peptide [Amemiya, Y., Marra, L.E., Reyhani, N., Youson, J.H., 2002. Stanniocalcin from an ancient teleost: a monomeric form of the hormone and a possible extracorpuscular distribution. Mol. Cell. Endocrinol. 188, 141-150]. An open reading frame of the STC cDNA of the derived teleost and perciforme, the smallmouth bass (Micropterus dolomieui), encodes a prehormone of 255aa with a signal peptide of 33aa and a mature protein of 222aa. The position of the 11 cysteines in smallmouth bass STC suggests that it exists as a homodimeric peptide. A phylogenetic analysis, using the new STC-1 amino acid sequences and those in the gene data base provided strong support for monophyly of the Osteoglossomorpha and indicated, with positioning of white sucker and smallmouth bass, that this molecule has some utility as a taxonomic marker. This analysis also suggested that two STC-1 gene sequences exist in multiple fish genomes, and that they may be a product of the fish-specific genome duplication. The mutation in the osteoglossomorph STC likely occurred after the appearance of the first teleosts and before movement of the tectonic plates.

Cloning of oligopeptide transport carrier PepT1 and comparative analysis of PepT1 messenger ribonucleic acid expression in response to dietary nitrogen levels in yak () and indigenous cattle () on the Qinghai-Tibetan plateau.

PubMed

Wang, H C; Shi, F Y; Hou, M J; Fu, X Y; Long, R J

2016-08-01

The gastrointestinal lumen can directly absorb all di- and tripeptide protein degradation products, and oligopeptide absorption depends on the specific peptide transport carriers, which are located in gastrointestinal epithelial cells on the brush border membrane. Yak () use N more efficiently than cattle do, which implies that yak have a specific mechanism of nonprotein utilization including a peptide absorption mechanism. However, this mechanism has not been clarified. Our objective was to explore whether yak possess any adaptive mechanisms of peptide absorption to survive in the harsh foraging environment of the Qinghai-Tibetan plateau. Twelve castrated males of each of 2 genotypes, yak () and indigenous cattle (), were fed diets of various N levels. The yak PepT1 (yPepT1) cDNA was cloned in omasum epithelial tissue. Our results showed that the full-length yPepT1 cDNA contains 2,805 bp, and a 2,121-bp open reading frame encodes a putative protein of 707 AA residues. The yPepT1 AA sequence identified 5 putative extracellular N-glycosylation sites (Asn, Asn, Asn, Asn, and Asn), 2 putative intracellular protein kinase A sites (Ser and Thr), and 3 intracellular putative protein kinase C sites (Ser, Ser, and Ser). The yPepT1 AA sequence was 99, 95, 86, and 83% identical to PepT1 from cattle (), sheep (), pigs (), and humans (), respectively. The relative PepT1 mRNA expression for indigenous cattle was greater than yak in the rumen, omasum, duodenum, ileum, and liver ( < 0.001); however, it was lower in jejunum tissue ( < 0.01). The relative PepT1 mRNA expression in response to increasing dietary N for both genotypes were linear in the rumen and jejunum ( < 0.10); quadratic or cubic in the reticulum ( < 0.01); linear or quadratic in the duodenum, ileum, and liver ( ≤ 0.01); and linear, quadratic, or cubic in the omasum ( < 0.001). Moreover, there were significant interactions between genotype and dietary N in rumen, reticulum, omasum, duodenum, jejunum, ileum, and liver tissues. In conclusion, the PepT1 profile and expression in gastrointestinal epithelial cells of yak varied from those of cattle, implying that yak have evolved a peptide transport mechanism to adapt the environment of the Qinghai-Tibetan plateau.

Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

PubMed

Hong, Jungeui; Gresham, David

2017-11-01

Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

Patterns of DNA variation among three centromere satellite families in Arabidopsis halleri and A. lyrata.

PubMed

Kawabe, Akira; Charlesworth, Deborah

2007-02-01

We describe patterns of DNA variation among the three centromeric satellite families in Arabidopsis halleri and lyrata. The newly studied subspecies (A. halleri ssp. halleri and A. lyrata ssp. lyrata and petraea), like the previously studied A. halleri ssp. gemmifera and A. lyrata ssp. kawasakiana, have three different centromeric satellite families, the older pAa family (also present in A. arenosa) and two families, pAge1 and pAge2, that probably evolved more recently. Sequence variability is high in all three satellite families, and the pAa sequences do not cluster by their species of origin. Diversity in the pAge2 family is complex, and different from variation among copies of the other two families, showing clear evidence for exchange events among family members, especially in A. halleri ssp. halleri. In A. lyrata ssp. lyrata there is some evidence for recent rapid spread of pAge2 variants, suggesting selection favoring these sequences.

Production and characterization of genetically modified human IL-11 variants.

PubMed

Sano, Emiko; Takei, Toshiaki; Ueda, Takuya; Tsumoto, Kouhei

2017-02-01

Interleukin-11 (IL-11) has been expected as a drug on severe thrombocytopenia caused by myelo-suppressive chemotherapy. Whereas, development of IL-11 inhibitor is also expected for a treatment against IL-11 related cancer progression. Here, we will demonstrate the creation of various kinds of genetically modified hIL-11s. Modified vectors were constructed by introducing N- or O-glycosylation site on the region of hIL-11 that does not belong to the core α-helical motif based on the predicted secondary structure. N-terminal (N: between 22 to 23 aa), the first loop (M1:70 to 71 aa), the second loop (M2:114-115 aa), the third loop (M3:160-161 aa) and C-terminal (C: 200- aa) were selected for modification. A large scale production system was established and the characteristics of modified hIL-11s were evaluated. The structure was analyzed by amino acid sequence and composition analysis and CD-spectra. Glycan was assessed by monosaccharide composition analysis. Growth promoting activity and biological stability were analyzed by proliferation of T1165 cells. N-terminal modified proteins were well glycosylated and produced. Growth activity of 3NN with NASNASNAS sequence on N-terminal was about tenfold higher than wild type (WT). Structural and biological stabilities of 3NN were also better than WT and residence time in mouse blood was longer than WT. M1 variants lacked growth activity though they are well glycosylated and secondary structure is very stable. Both of 3NN and OM1 with AAATPAPG on M1 associated with hIL-11R strongly. These results indicate N-terminal and M1 variants will be expected for practical use as potent agonists or antagonists of hIL-11. Copyright © 2016 Elsevier B.V. All rights reserved.

The nop gene from Phanerochaete chrysosporium encodes a peroxidase with novel structural features

Treesearch

Luis F. Larrondo; Angel Gonzalez; Tomas Perez-Acle; Dan Cullen; Rafael Vicuna

2005-01-01

Inspection of the genome of the ligninolytic basidiomycete Phanerochaete chrysosporium revealed an unusual peroxidase-like sequence. The corresponding full length cDNA was sequenced and an archetypal secretion signal predicted. The deduced mature protein (NoP, novel peroxidase) contains 295 aa residues and is therefore considerably shorter than other Class II (fungal)...

Analysis of the complete genome of peach chlorotic mottle virus: identification of non-AUG start codons, in vitro coat protein expression, and elucidation of serological cross-reactions.

PubMed

James, D; Varga, A; Croft, H

2007-01-01

The entire genome of peach chlorotic mottle virus (PCMV), originally identified as Prunus persica cv. Agua virus (4N6), was sequenced and analysed. PCMV cross-reacts with antisera to diverse viruses, such as plum pox virus (PPV), genus Potyvirus, family Potyviridae; and apple stem pitting virus (ASPV), genus Foveavirus, family Flexiviridae. The PCMV genome consists of 9005 nucleotides (nts), excluding a poly(A) tail at the 3' end of the genome. Five open reading frames (ORFs) were identified with four untranslated regions (UTR) including a 5', a 3', and two intergenic UTRs. The genome organisation of PCMV is similar to that of ASPV and the two genomes share a nucleotide (nt) sequence identity of 58%. PCMV ORF1 encodes the replication-associated protein complex (Mr 241,503), ORF2-ORF4 code for the triple gene block proteins (TGBp; Mr 24,802, 12,370, and 7320, respectively), and ORF5 encodes the coat protein (CP) (Mr 42,505). Two non-AUG start codons participate in the initiation of translation: 35AUC and 7676AUA initiate translation of ORF1 and ORF5. In vitro expression with subsequent Western blot analysis confirmed ORF5 as the CP-encoding gene and confirmed that the codon AUA is able to initiate translation of the CP. Expression of a truncated CP fragment (Mr 39, 689) was demonstrated, and both proteins are expressed in vivo, since both were observed in Western blot analysis of PCMV-infected peach and Nicotiana occidentalis. The expressed proteins cross-reacted with an antiserum against ASPV. The amino acid sequences of the CPs of PCMV and ASPV CP share only 37% identity, but there are 11 shared peptides 4-8 aa residues long. These may constitute linear epitopes responsible for ASPV antiserum cross reactions. No significant common linear epitopes were associated with PPV. Extensive phylogenetic analysis indicates that PCMV is closely related to ASPV and is a new and distinct member of the genus Foveavirus.

HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus.

PubMed

Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe

2006-01-01

Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.

The effect of suffering on generativity: accounts of elderly African American men.

PubMed

Black, Helen K; Rubinstein, Robert L

2009-03-01

This article focuses on attitudes to and behaviors of generativity in 6 older African American (AA) men. Data on generativity emerged from in-depth qualitative research that explored experiences of suffering in community-dwelling persons aged 80 years and over. For these AA men, experiences of racism were salient in stories of suffering, and suffering was intricately related to attitudes and behaviors of generativity. We placed men's narratives, showing the link between suffering and generativity, in 3 categories: Generativity is rooted in (a) suffering and in empathy for suffering others, (b) experiences of redemption from suffering, and (c) religious belief that assuages suffering. These AA men's generative behaviors were shaped by unique life experiences, including experiences of suffering. Bequeathing a legacy to succeeding generations was tied to suffering experiences, to the personal and communal identities that emerged from suffering, to the importance of inter- and intragenerational community, and to what men believed others needed from them.

Hookah and Cigarette Smoking Among African American College Students: Implications for Campus Risk Reduction and Health Promotion Efforts

PubMed Central

Jones, Brittni D.; Cunningham-Williams, Renee M.

2016-01-01

Objective To identify individual and institutional risks and protections for hookah and cigarette smoking among African American (AA) college students. Participants AA college students (n=1,402; mean age=20, range=18–24 years; 75% female) who completed the Fall 2012 American College Health Association–National College Health Assessment II. Methods Respondents were stratified into four mutually exclusive groups by last 30-day smoking status: cigarette-only use (5.1%), hookah-only use (5.9%), dual use (2.4%), and non-use (86.6%). Multinomial logistic regression models identified the relative odds of exclusive and dual hookah and cigarette smoking. Results Current hookah and cigarette smoking rates were comparably low. Age, gender identity, current substance use, interest in tobacco use information, and student population prevailed as risks and protections for hookah and cigarette smoking. Conclusions Campus health promotion campaigns may need to tailor messages to AA students, particularly those who use substances, to underscore the health risks of hookah and cigarette smoking. PMID:26829515

The Effect of Suffering on Generativity: Accounts of Elderly African American Men

PubMed Central

Rubinstein, Robert L.

2009-01-01

Background This article focuses on attitudes to and behaviors of generativity in 6 older African American (AA) men. Methods Data on generativity emerged from in-depth qualitative research that explored experiences of suffering in community-dwelling persons aged 80 years and over. Results For these AA men, experiences of racism were salient in stories of suffering, and suffering was intricately related to attitudes and behaviors of generativity. We placed men's narratives, showing the link between suffering and generativity, in 3 categories: Generativity is rooted in (a) suffering and in empathy for suffering others, (b) experiences of redemption from suffering, and (c) religious belief that assuages suffering. Conclusions These AA men's generative behaviors were shaped by unique life experiences, including experiences of suffering. Bequeathing a legacy to succeeding generations was tied to suffering experiences, to the personal and communal identities that emerged from suffering, to the importance of inter- and intragenerational community, and to what men believed others needed from them. PMID:19182225

Branched-Chain Amino Acids and Arginine Improve Performance in Two Consecutive Days of Simulated Handball Games in Male and Female Athletes: A Randomized Trial

PubMed Central

Chang, Chen-Kang; Chang Chien, Kun-Ming; Chang, Jung-Hsien; Huang, Mei-Hsuan; Liang, Ya-Chuan; Liu, Tsung-Han

2015-01-01

The central nervous system plays a crucial role in the development of physical fatigue. The purpose of this study is to investigate the effect of combined supplementation of branched-chain amino acids (BCAA) and arginine on intermittent sprint performance in simulated handball games on 2 consecutive days. Methods: Fifteen male and seven female handball players consumed 0.17 g/kg BCAA and 0.04 g/kg arginine together (AA trial), or placebo (PB trial) before exercise. Each trial contained two 60-min simulated handball games on consecutive days. The game was consisted of 30 identical 2-min blocks and a 20 m all-out sprint was performed at the end of each block. The performance, measured by percentage changes of sprint time between day 1 and 2, was significantly better in the AA trial (first half: AA trial: -1.34±0.60%, PB trial: -0.21±0.69%; second half: AA trial: -1.68±0.58%, PB trial: 0.49±0.42%). The average ratings of perceive exertion throughout the 2-day trial was significantly lower in the AA trial (14.2±0.3) than the PB trial (15.1±0.4). Concurrently, post-exercise tryptophan/BCAA ratio on both days in the AA trial was significantly lower than the baseline. This study showed that BCAA and arginine supplementation could improve performance in intermittent sprints on the second consecutive day of simulated handball games in well-trained athletes by potentially alleviating central fatigue. PMID:25803783

A Replication and Extension of the Antisymmetry Effect in Pigeons

ERIC Educational Resources Information Center

Urcuioli, Peter J.; Swisher, Melissa

2012-01-01

Pigeons trained on successive AB symbolic matching show emergent BA antisymmetry if they are also trained on successive AA oddity and BB identity (Urcuioli, 2008, Experiment 4). In other words, when tested on BA probe trials following training, they respond more to the comparisons on the reverse of the nonreinforced AB baseline trials than on the…

Facilitated sequence counting and assembly by template mutagenesis

PubMed Central

Levy, Dan; Wigler, Michael

2014-01-01

Presently, inferring the long-range structure of the DNA templates is limited by short read lengths. Accurate template counts suffer from distortions occurring during PCR amplification. We explore the utility of introducing random mutations in identical or nearly identical templates to create distinguishable patterns that are inherited during subsequent copying. We simulate the applications of this process under assumptions of error-free sequencing and perfect mapping, using cytosine deamination as a model for mutation. The simulations demonstrate that within readily achievable conditions of nucleotide conversion and sequence coverage, we can accurately count the number of otherwise identical molecules as well as connect variants separated by long spans of identical sequence. We discuss many potential applications, such as transcript profiling, isoform assembly, haplotype phasing, and de novo genome assembly. PMID:25313059

The molecular relationship between antigenic domains and epitopes on hCG.

PubMed

Berger, Peter; Lapthorn, Adrian J

2016-08-01

Antigenic domains are defined to contain a limited number of neighboring epitopes recognized by antibodies (Abs) but their molecular relationship remains rather elusive. We thoroughly analyzed the antigenic surface of the important pregnancy and tumor marker human chorionic gonadotropin (hCG), a cystine knot (ck) growth factor, and set antigenic domains and epitopes in molecular relationships to each other. Antigenic domains on hCG, its free hCGα and hCGβ subunits are dependent on appropriate inherent molecular features such as molecular accessibility and protrusion indices that determine bulging structures accessible to Abs. The banana-shaped intact hCG comprises ∼7500Å(2) of antigenic surface with minimally five antigenic domains that encompass a continuum of overlapping non-linear composite epitopes, not taking into account the C-terminal peptide extension of hCGβ (hCGβCTP). Epitopes within an antigenic domain are defined by specific Abs, that bury nearly 1000Å(2) of surface accessible area on the antigen and recognize a few up to 15 amino acid (aa) residues, whereby between 2 and 5 of these provide the essential binding energy. Variability in Ab binding modes to the contact aa residues are responsible for the variation in affinity and intra- and inter-species specificity, e.g. cross-reactions with luteinizing hormone (LH). Each genetically distinct fragment antigen binding (Fab) defines its own epitope. Consequently, recognition of the same epitope by different Abs is only possible in cases of genetically identical sequences of its binding sites. Due to combinatorial V(D)J gene segment variability of heavy and light chains, Abs defining numerous epitopes within an antigenic domain can be generated by different individuals and species. Far more than hundred Abs against the immuno-dominant antigenic domains of either subunit at both ends of the hCG-molecule, the tips of peptide loops one and three (Ł1+3) protruding from the central ck, encompassing hCGβŁ1+3 (aa 20-25+64+68-81) and hCGαŁ1 (aa 13-22; Pro16, Phe17, Phe18) plus hCGαŁ3 (Met71, Phe74), respectively, have been identified in the two "ISOBM Tissue Differentiation-7 Workshops on hCG and Related Molecules" and in other studies. These Abs recognize distinct but overlapping epitopes with slightly different specificity profiles and affinities. Heterodimeric-specific epitopes involve neighboring αŁ1 plus βŁ2 (hCGβ44/45 and 47/48). Diagnostically important Abs recognize the middle of the molecule, the ck (aa Arg10, Arg60 and possibly Gln89) and the linear hCGβCTP "tail" (aa 135-145; Asp139, Pro144, Gln145), respectively. Identification of antigenic domains and of specific epitopes is essential for harmonization of Abs in methods that are used for reliable and robust hCG measurements for the management of pregnancy, pregnancy-related disease and tumors. Copyright © 2016. Published by Elsevier Ltd.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

An Enhancer Near ISL1 and an Ultraconserved Exon of PCBP2 areDerived from a Retroposon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bejerano, Gill; Lowe, Craig; Ahituv, Nadav

2005-11-27

Hundreds of highly conserved distal cis-regulatory elementshave been characterized to date in vertebrate genomes1. Many thousandsmore are predicted based on comparative genomics2,3. Yet, in starkcontrast to the genes they regulate, virtually none of these regions canbe traced using sequence similarity in invertebrates, leaving theirevolutionary origin obscure. Here we show that a class of conserved,primarily non-coding regions in tetrapods originated from a novel shortinterspersed repetitive element (SINE) retroposon family that was activein Sarcopterygii (lobe-finned fishes and terrestrial vertebrates) in theSilurian at least 410 Mya4, and, remarkably, appears to be recentlyactive in the "living fossil" Indonesian coelacanth, Latimeriamenadoensis. We show that onemore » copy is a distal enhancer, located 500kbfrom the neuro-developmental gene ISL1. Several others represent new,possibly regulatory, alternatively spliced exons in the middle ofpre-existing Sarcopterygian genes. One of these is the>200bpultraconserved region5, 100 percent identical in mammals, and 80 percentidentical to the coelacanth SINE, that contains a 31aa alternativelyspliced exon of the mRNA processing gene PCBP26. These add to a growinglist of examples7 in which relics of transposable elements have acquireda function that serves their host, a process termed "exaptation"8, andprovide an origin for at least some of the highly-conservedvertebrate-specific genomic sequences recently discovered usingcomparative genomics.« less

Functional analysis of guinea pig β1-adrenoceptor.

PubMed

Tanaka, Yoshio; Takahashi, Hiromi; Shibata, Sayuri; Namiki, Kana; Kimura, Sadao; Koike, Katsuo; Kasuya, Yoshitoshi

2011-12-01

Although similarity of pharmacological responses to certain stimuli between guinea pigs and humans has been reported, this has been poorly defined by a molecular biological approach. In this study, we cloned the gene of guinea pig ?1-adrenoceptor (ADRB1). The deduced amino acid sequence of guinea pig ADRB1 (467-aa) showed 91% and 92% identity with the human and rat ADRB1 sequences, respectively. Using HEK293T cells expressing guinea pig, human and rat ADRB1s independently, we elucidated the functional characteristics of each ADRB1. The ligand-binding profiles and the concentration-response relationships for isoprenaline-induced cyclic adenosine monophosphate (cAMP) production were similar among the three ADRB1s. Isoprenaline also induced phosphorylation of extracellular-signal related kinases (ERK) through ADRB1s in a concentration-dependent manner. The minimum effective concentration of isoprenaline for phosphorylation of ERK, through guinea pig ADRB1 was the same as through human ADRB1, but markedly lower than that of through rat ADRB1. ERK phosphorylation through guinea pig ADRB1 was sensitive to pertussis toxin, a dominant-negative ras and PD98059, indicating that a G(i)-mediated pathway is involved in the ADRB1/ERK signaling loop. These results suggest that the G(i)-coupling efficacy of guinea pig and human ADRB1s may be higher than that of rat ADRB1.

Molecular cloning and expression of rat liver bile acid CoA ligase.

PubMed

Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

2002-12-01

Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

A network biology approach to understanding the importance of chameleon proteins in human physiology and pathology.

PubMed

Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Marashi, Sayed-Amir

2017-02-01

Chameleon proteins are proteins which include sequences that can adopt α-helix-β-strand (HE-chameleon) or α-helix-coil (HC-chameleon) or β-strand-coil (CE-chameleon) structures to operate their crucial biological functions. In this study, using a network-based approach, we examined the chameleon proteins to give a better knowledge on these proteins. We focused on proteins with identical chameleon sequences with more than or equal to seven residues long in different PDB entries, which adopt HE-chameleon, HC-chameleon, and CE-chameleon structures in the same protein. One hundred and ninety-one human chameleon proteins were identified via our in-house program. Then, protein-protein interaction (PPI) networks, Gene ontology (GO) enrichment, disease network, and pathway enrichment analyses were performed for our derived data set. We discovered that there are chameleon sequences which reside in protein-protein interaction regions between two proteins critical for their dual function. Analysis of the PPI networks for chameleon proteins introduced five hub proteins, namely TP53, EGFR, HSP90AA1, PPARA, and HIF1A, which were presented in four PPI clusters. The outcomes demonstrate that the chameleon regions are in critical domains of these proteins and are important in the development and treatment of human cancers. The present report is the first network-based functional study of chameleon proteins using computational approaches and might provide a new perspective for understanding the mechanisms of diseases helping us in developing new medical therapies along with discovering new proteins with chameleon properties which are highly important in cancer.

Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

PubMed

Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

2015-01-25

Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel bocavirus in canine liver

PubMed Central

2013-01-01

Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC), associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV), associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3). The three major ORFs of CnBoV3 (NS1, NP1 and VP1) shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined. PMID:23402347

Theoretical investigation of structural and optical properties of semi-fluorinated bilayer graphene

NASA Astrophysics Data System (ADS)

Xiao-Jiao, San; Bai, Han; Jing-Geng, Zhao

2016-03-01

We have studied the structural and optical properties of semi-fluorinated bilayer graphene using density functional theory. When the interlayer distance is 1.62 Å, the two graphene layers in AA stacking can form strong chemical bonds. Under an in-plane stress of 6.8 GPa, this semi-fluorinated bilayer graphene becomes the energy minimum. Our calculations indicate that the semi-fluorinated bilayer graphene with the AA stacking sequence and rectangular fluorinated configuration is a nonmagnetic semiconductor (direct gap of 3.46 eV). The electronic behavior at the vicinity of the Fermi level is mainly contributed by the p electrons of carbon atoms forming C=C double bonds. We compare the optical properties of the semi-fluorinated bilayer graphene with those of bilayer graphene stacked in the AA sequence and find that the semi-fluorinated bilayer graphene is anisotropic for the polarization vector on the basal plane of graphene and a red shift occurs in the [010] polarization, which makes the peak at the low-frequency region located within visible light. This investigation is useful to design polarization-dependence optoelectronic devices. Project supported by the Program of Educational Commission of Heilongjiang Province, China (Grant No. 12541131).

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Arachidonate-Regulated Ca2+ Influx in Human Airway Smooth Muscle

PubMed Central

Thompson, Michael A.; Prakash, Y. S.

2014-01-01

Plasma membrane Ca2+ influx, especially store-operated Ca2+ entry triggered by sarcoplasmic reticulum (SR) Ca2+ release, is a key component of intracellular calcium concentration ([Ca2+]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca2+ oscillations in ASM that involve both influx and SR mechanisms have been previously demonstrated. In nonexcitable cells, [Ca2+]i oscillations involve Ca2+ influx via arachidonic acid (AA) –stimulated channels, which show similarities to store-operated Ca2+ entry, although their molecular identity remains undetermined. Little is known about AA-regulated Ca2+ channels or their regulation in ASM. In enzymatically dissociated human ASM cells loaded with the Ca2+ indicator, fura-2, AA (1–10 μM) triggered [Ca2+]i oscillations that were inhibited by removal of extracellular Ca2+. Other fatty acids, such as the diacylglycerol analog, 1-oleoyl-2-acetyl-SN-glycerol, oleic acid, and palmitic acid (10 μM each), failed to elicit similar [Ca2+]i responses. Preincubation with LaCl3 (1 μM or 1 mM) inhibited AA-induced oscillations. Inhibition of receptor-operated channels (SKF96,365 [10 μM]), lipoxygenase (zileuton [10 μM]), or cyclooxygenase (indomethacin [10 μM]) did not affect oscillation parameters. Inhibition of SR Ca2+ release (ryanodine [10 μM] or inositol 1,4,5-trisphosphate receptor inhibitor, xestospongin C [1 μM]) decreased [Ca2+]i oscillation frequency and amplitude. Small interfering RNA against caveolin-1, stromal interaction molecule 1, or Orai3 (20 nM each) reduced the frequency and amplitude of AA-induced [Ca2+]i oscillations. In ASM cells derived from individuals with asthma, AA increased oscillation amplitude, but not frequency. These results are highly suggestive of a novel AA-mediated Ca2+–regulatory mechanism in human ASM, reminiscent of agonist-induced oscillations. Given the role of AA in ASM intracellular signaling, especially with inflammation, AA-regulated Ca2+ channels could potentially contribute to increased [Ca2+]i in diseases such asthma. PMID:24471656

Detailed molecular analyses of the hexon loop-1 and fibers of fowl aviadenoviruses reveal new insights into the antigenic relationship and confirm that specific genotypes are involved in field outbreaks of inclusion body hepatitis.

PubMed

Schachner, Anna; Marek, Ana; Grafl, Beatrice; Hess, Michael

2016-04-15

Forty-eight fowl aviadenoviruses (FAdVs) isolated from recent IBH outbreaks across Europe were investigated, by utilizing for the first time the two major adenoviral antigenic domains, hexon loop-1 and fiber, for compound molecular characterization of IBH-associated FAdVs. Successful target gene amplification, following virus isolation in cell culture or from FTA-card samples, demonstrated presence of FAdVs in all cases indicative for IBH. Based on hexon loop-1 analysis, 31 European field isolates exhibited highest nucleotide identity (>97.2%) to reference strains FAdV-2 or -11 representing FAdV-D, while 16 and one European isolates shared >96.0% nucleotide identity with FAdV-8a and -8b, or FAdV-7, the prototype strains representing FAdV-E. These results extend recognition of specific FAdV-D and FAdV-E affiliate genotypes as causative agents of IBH to the European continent. In all isolates, species specificity determined by fiber gene analysis correlated with hexon-based typing. A threshold of 72.0% intraspecies nucleotide identity between fibers from investigated prototype and field strains corresponded with demarcation criteria proposed for hexon, suggesting fiber-based analysis as a complementary tool for molecular FAdV typing. A limited number of strains exhibited inconsistencies between hexon and fiber subclustering, indicating potential constraints for single-gene based typing of those FAdVs. Within FAdV-D, field isolate fibers shared a high degree of nucleotide (>96.7%) and aa (>95.8%) identity, while FAdV-E field isolate fibers displayed greater nucleotide divergence of up to 22.6%, resulting in lower aa identities of >81.7%. Furthermore, comparison with FAdVs from IBH outbreaks outside Europe revealed close genetic relationship in the fiber, independent of the strains' geographic origin. Copyright © 2016 Elsevier B.V. All rights reserved.

Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

PubMed

Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

2009-07-01

The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Insights from the genome of a high alkaline cellulase producing Aspergillus fumigatus strain obtained from Peruvian Amazon rainforest.

PubMed

Paul, Sujay; Zhang, Angel; Ludeña, Yvette; Villena, Gretty K; Yu, Fengan; Sherman, David H; Gutiérrez-Correa, Marcel

2017-06-10

Here, we report the complete genome sequence of a high alkaline cellulase producing Aspergillus fumigatus strain LMB-35Aa isolated from soil of Peruvian Amazon rainforest. The genome is ∼27.5mb in size, comprises of 228 scaffolds with an average GC content of 50%, and is predicted to contain a total of 8660 protein-coding genes. Of which, 6156 are with known function; it codes for 607 putative CAZymes families potentially involved in carbohydrate metabolism. Several important cellulose degrading genes, such as endoglucanase A, endoglucanase B, endoglucanase D and beta-glucosidase, are also identified. The genome of A. fumigatus strain LMB-35Aa represents the first whole sequenced genome of non-clinical, high cellulase producing A. fumigatus strain isolated from forest soil. Copyright © 2017 Elsevier B.V. All rights reserved.

Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

PubMed

Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

1991-09-15

We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

Bioinformatics analysis for structure and function of CPR of Plasmodium falciparum.

PubMed

Fan, Zhigang; Zhang, Lingmin; Yan, Guogang; Wu, Qiang; Gan, Xiufeng; Zhong, Saifeng; Lin, Guifen

2011-02-01

To analyse the structure and function of NADPH-cytochrome p450 reductase (CYPOR or CPR) from Plasmodium falciparum (Pf), and to predict its' drug target and vaccine target. The structure, function, drug target and vaccine target of CPR from Plasmodium falciparum were analyzed and predicted by bioinformatics methods. PfCPR, which was older CPR, had close relationship with the CPR from other Plasmodium species, but it was distant from its hosts, such as Homo sapiens and Anopheles. PfCPR was located in the cellular nucleus of Plasmodium falciparum. 335aa-352aa and 591aa - 608aa were inserted the interior side of the nuclear membrane, while 151aa-265aa was located in the nucleolus organizer regions. PfCPR had 40 function sites and 44 protein-protein binding sites in amino acid sequence. The teriary structure of 1aa-700aa was forcep-shaped with wings. 15 segments of PfCPR had no homology with Homo sapien CPR and most were exposed on the surface of the protein. These segments had 25 protein-protein binding sites. While 13 other segments all possessed function sites. The evolution or genesis of Plasmodium falciparum is earlier than those of Homo sapiens. PfCPR is a possible resistance site of antimalarial drug and may involve immune evasion, which is associated with parasite of sporozoite in hepatocytes. PfCPR is unsuitable as vaccine target, but it has at least 13 ideal drug targets. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

MetaSeq: privacy preserving meta-analysis of sequencing-based association studies.

PubMed

Singh, Angad Pal; Zafer, Samreen; Pe'er, Itsik

2013-01-01

Human genetics recently transitioned from GWAS to studies based on NGS data. For GWAS, small effects dictated large sample sizes, typically made possible through meta-analysis by exchanging summary statistics across consortia. NGS studies groupwise-test for association of multiple potentially-causal alleles along each gene. They are subject to similar power constraints and therefore likely to resort to meta-analysis as well. The problem arises when considering privacy of the genetic information during the data-exchange process. Many scoring schemes for NGS association rely on the frequency of each variant thus requiring the exchange of identity of the sequenced variant. As such variants are often rare, potentially revealing the identity of their carriers and jeopardizing privacy. We have thus developed MetaSeq, a protocol for meta-analysis of genome-wide sequencing data by multiple collaborating parties, scoring association for rare variants pooled per gene across all parties. We tackle the challenge of tallying frequency counts of rare, sequenced alleles, for metaanalysis of sequencing data without disclosing the allele identity and counts, thereby protecting sample identity. This apparent paradoxical exchange of information is achieved through cryptographic means. The key idea is that parties encrypt identity of genes and variants. When they transfer information about frequency counts in cases and controls, the exchanged data does not convey the identity of a mutation and therefore does not expose carrier identity. The exchange relies on a 3rd party, trusted to follow the protocol although not trusted to learn about the raw data. We show applicability of this method to publicly available exome-sequencing data from multiple studies, simulating phenotypic information for powerful meta-analysis. The MetaSeq software is publicly available as open source.

Virulence-Associated Genome Mutations of Murine Rotavirus Identified by Alternating Serial Passages in Mice and Cell Cultures

PubMed Central

Tatsumi, Masatoshi; Tsutsumi, Hiroyuki

2014-01-01

ABSTRACT Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3′ consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. IMPORTANCE Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. PMID:24599996

Virulence-associated genome mutations of murine rotavirus identified by alternating serial passages in mice and cell cultures.

PubMed

Tsugawa, Takeshi; Tatsumi, Masatoshi; Tsutsumi, Hiroyuki

2014-05-01

Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired four kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3' consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa 37 site as important for its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence. Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in an animal host. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly and sequenced the eleven genes of the passaged viruses to identify mutations associated with the emergence or disappearance of virulence. Sequence analysis revealed that changes in three genes (VP4, NSP1, and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheagenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence.

Two rare AKAP9 variants are associated with Alzheimer disease in African Americans

PubMed Central

Logue, Mark W.; Schu, Matthew; Vardarajan, Badri N.; Farrell, John; Bennett, David A.; Buxbaum, Joseph D.; Byrd, Goldie S.; Ertekin-Taner, Nilufer; Evans, Denis; Foroud, Tatiana; Goate, Alison; Graff-Radford, Neill R.; Kamboh, M. Ilyas; Kukull, Walter A.; Manly, Jennifer J.; Haines, Jonathan L.; Mayeux, Richard; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Lunetta, Kathryn L.; Baldwin, Clinton T.; Fallin, M. Daniele; Farrer, Lindsay A.

2014-01-01

Background Less is known about the genetic basis of Alzheimer disease (AD) in African Americans (AAs) than in non-Hispanic whites. Methods Whole exome sequencing (WES) was performed on seven AA AD cases. Disease association with potentially AD-related variants from WES was assessed in an AA discovery cohort of 422 cases and 394 controls. Replication was sought in an AA sample of 1,037 cases and 1,869 controls from the Alzheimer Disease Genetics Consortium (ADGC). Results Forty-four SNPs from WES passed filtering criteria and were successfully genotyped, Nominally significant (p<0.05) association to AD was observed with two African-descent specific AKAP9 SNPs in tight linkage disequilibrium: rs144662445 (p=0.014) and rs149979685 (p=0.037). These associations were replicated in the ADGC sample (rs144662445: p=0.0022, odds ratio [OR]=2.75; rs149979685: p=0.0022, OR=3.61). Conclusions Because AKAP9 was not previously linked to AD risk, this study indicates a potential new disease mechanism. PMID:25172201

Cloning and characterization of a cAMP-specific phosphodiesterase (TbPDE2B) from Trypanosoma brucei

PubMed Central

Rascón, Ana; Soderling, Scott H.; Schaefer, Jonathan B.; Beavo, Joseph A.

2002-01-01

Here we report the cloning, expression, and characterization of a cAMP-specific phosphodiesterase (PDE) from Trypanosoma brucei (TbPDE2B). Using a bioinformatic approach, two different expressed sequence tag clones were identified and used to isolate the complete sequence of two identical PDE genes arranged in tandem. Each gene consists of 2,793 bases that predict a protein of 930 aa with a molecular mass of 103.2 kDa. Two GAF (for cGMP binding and stimulated PDEs, Anabaena adenylyl cyclases, and Escherichia coli FhlA) domains, similar to those contained in many signaling molecules including mammalian PDE2, PDE5, PDE6, PDE10, and PDE11, were located N-terminal to a consensus PDE catalytic domain. The catalytic domain is homologous to the catalytic domain of all 11 mammalian PDEs, the Dictyostelium discoideum RegA, and a probable PDE from Caenorhabditis elegans. It is most similar to the T. brucei PDE2A (89% identity). TbPDE2B has substrate specificity for cAMP with a Km of 2.4 μM. cGMP is not hydrolyzed by TbPDE2B nor does this cyclic nucleotide modulate cAMP PDE activity. The nonselective PDE inhibitors 3-isobutyl-1-methylxanthine, papaverine and pentoxifyline are poor inhibitors of TbPDE2B. Similarly, PDE inhibitors selective for the mammalian PDE families 2, 3, 5, and 6 (erythro-9-[3-(2-hydroxynonyl)]-adenine, enoximone, zaprinast, and sildenafil) were also unable to inhibit this enzyme. However, dipyridamole was a reasonably good inhibitor of this enzyme with an IC50 of 27 μM. cAMP plays key roles in cell growth and differentiation in this parasite, and PDEs are responsible for the hydrolysis of this important second messenger. Therefore, parasite PDEs, including this one, have the potential to be attractive targets for selective drug design. PMID:11930017

Effect of Interfacial Reaction on the Mechanical Performance of Steel to Aluminum Dissimilar Ultrasonic Spot Welds

NASA Astrophysics Data System (ADS)

Xu, Lei; Wang, Li; Chen, Ying-Chun; Robson, Joe D.; Prangnell, Philip B.

2016-01-01

The early stages of formation of intermetallic compounds (IMC) have been investigated in dissimilar aluminum to steel welds, manufactured by high power (2.5 kW) ultrasonic spot welding (USW). To better understand the influence of alloy composition, welds were produced between a low-carbon steel (DC04) and two different aluminum alloys (6111 and 7055). The joint strengths were measured in lap shear tests and the formation and growth behavior of IMCs at the weld interface were characterized by electron microscopy, for welding times from 0.2 to 2.4 seconds. With the material combinations studied, the η (Fe2Al5) intermetallic phase was found to form first, very rapidly in the initial stage of welding, with a discontinuous island morphology. Continuous layers of η and then θ (FeAl3) phase were subsequently seen to develop on extending the welding time to greater than 0.7 second. The IMC layer formed in the DC04-AA7055 combination grew thicker than for the DC04-AA6111 welds, despite both weld sets having near identical thermal histories. Zinc was also found to be dissolved in the IMC phases when welding with the AA7055 alloy. After post-weld aging of the aluminum alloy, fracture in the lap shear tests always occurred along the joint interface; however, the DC04-AA6111 welds had higher fracture energy than the DC04-AA7055 combination.

Molecular characterisation of Sarcocystis lutrae n. sp. and Toxoplasma gondii from the musculature of two Eurasian otters (Lutra lutra) in Norway.

PubMed

Gjerde, Bjørn; Josefsen, Terje D

2015-03-01

Sarcocysts were detected in routinely processed histological sections of skeletal muscle, but not cardiac muscle, of two adult male otters (Lutra lutra; Mustelidae) from northern Norway following their post-mortem examination in 1999 and 2000. The sarcocysts were slender, spindle-shaped, up to 970 μm long and 35-70 μm in greatest diameter. The sarcocyst wall was thin (∼ 0.5 μm) and smooth with no visible protrusions. Portions of unfixed diaphragm of both animals were collected at the autopsies and kept frozen for about 14 years pending further examination. When the study was resumed in 2013, the thawed muscle samples were examined for sarcocysts under a stereo microscope, but none could be found. Genomic DNA was therefore extracted from a total of 36 small pieces of the diaphragm from both otters, and samples found to contain Sarcocystidae DNA were used selectively for PCR amplification and sequencing of the nuclear 18S and 28S ribosomal (r) RNA genes and internal transcribed spacer 1 (ITS1) region, as well as the mitochondrial cytochrome b (cytb) and cytochrome c oxidase subunit 1 (cox1) genes. Sequence comparisons revealed that both otters were infected by the same Sarcocystis sp. and that there was no genetic variation (100 % identity) among sequenced isolates at the 18S and 28S rRNA genes (six identical isolates at both loci) or at cox1 (13 identical isolates). PCR products comprising the ITS1 region, on the other hand, had to be cloned before sequencing due to intraspecific sequence variation. A total of 33 clones were sequenced, and the identities between them were 97.9-99.9 %. These sequences were most similar (93.7-96.0 % identity) to a sequence of Sarcocystis kalvikus from the wolverine in Canada, but the phylogenetic analyses placed all of them as a monophyletic sister group to S. kalvikus. Hence, they were considered to represent a novel species, which was named Sarcocystis lutrae. Sequence comparisons and phylogenetic analyses based on sequences of the 18S and 28S rRNA genes and cox1, for which little or no sequence data were available for S. kalvikus, revealed that S. lutrae otherwise was most closely related to various Sarcocystis spp. using birds or carnivores as intermediate hosts. The cox1 sequences of S. lutrae from the otters were identical to two sequences from an arctic fox, which in a previous study had been assigned to Sarcocystis arctica due to a high identity (99.4 %) with the latter species at this gene and a complete identity with S. arctica at three other loci when using the same DNA samples as templates for PCR reactions. Additional PCR amplifications and sequencing of cox1 (ten sequences) and the ITS1 region (four sequences) using four DNA samples from this fox as templates again generated cox1 sequences exclusively of S. lutrae, but ITS1 sequences of S. arctica, and thus confirmed that this arctic fox had acted as intermediate host for both S. arctica and S. lutrae. Based on the phylogenetic placement of S. lutrae, the geographical location of infected animals (otters, arctic fox) and the distribution of carnivores/raptors which may have interacted with them, the white-tailed eagle (Haliaeetus albicilla) seems to be a possible definitive host of S. lutrae. Some of the muscle samples from both otters were shown to harbour stages of Toxoplasma gondii through PCR amplification and sequencing of the entire ITS1 region (five isolates) and/or the partial cytb (eight isolates) and cox1 (one isolate). These sequences were identical to several previous sequences of T. gondii in GenBank. Thus, both otters had a dual infection with S. lutrae and T. gondii.

Comparison of 4D flow and 2D velocity-encoded phase contrast MRI sequences for the evaluation of aortic hemodynamics

PubMed Central

Bollache, Emilie; van Ooij, Pim; Powell, Alex; Carr, James; Markl, Michael; Barker, Alex J.

2016-01-01

The purpose of this study was to compare aortic flow and velocity quantification using 4D flow MRI and 2D CINE phase-contrast (PC)-MRI with either one-directional (2D-1dir) or three-directional (2D-3dir) velocity encoding. 15 healthy volunteers (51 ± 19 years) underwent MRI including (1) breath-holding 2D-1dir and (2) free breathing 2D-3dir PC-MRI in planes orthogonal to the ascending (AA) and descending (DA) aorta, as well as (3) free breathing 4D flow MRI with full thoracic aorta coverage. Flow quantification included the co-registration of the 2D PC acquisition planes with 4D flow MRI data, AA and DA segmentation, and calculation of AA and DA peak systolic velocity, peak flow and net flow volume for all sequences. Additionally, the 2D-3dir velocity taking into account the through-plane component only was used to obtain results analogous to a free breathing 2D-1dir acquisition. Good agreement was found between 4D flow and 2D-3dir peak velocity (differences = −3 to 6 %), peak flow (−7 %) and net volume (−14 to −9 %). In contrast, breath-holding 2D-1dir measurements exhibited indices significantly lower than free breathing 2D-3dir and 2D-1dir (differences = −35 to −7 %, p < 0.05). Finally, high correlations (r ≥ 0.97) were obtained for indices estimated with or without eddy current correction, with the lowest correlation observed for net volume. 4D flow and 2D-3dir aortic hemodynamic indices were in concordance. However, differences between respiration state and 2D-1dir and 2D-3dir measurements indicate that reference values should be established according to the PC-MRI sequence, especially for the widely used net flow (e.g. stroke volume in the AA). PMID:27435230

Whole-Exome Sequencing to Identify Rare Variants and Gene Networks that Increase Susceptibility to Scleroderma in African Americans.

PubMed

Gourh, Pravitt; Remmers, Elaine F; Boyden, Steven E; Alexander, Theresa; Morgan, Nadia D; Shah, Ami A; Mayes, Maureen D; Doumatey, Ayo; Bentley, Amy R; Shriner, Daniel; Domsic, Robyn T; Medsger, Thomas A; Steen, Virginia D; Ramos, Paula S; Silver, Richard M; Korman, Benjamin; Varga, John; Schiopu, Elena; Khanna, Dinesh; Hsu, Vivien; Gordon, Jessica K; Saketkoo, Lesley Ann; Gladue, Heather; Kron, Brynn; Criswell, Lindsey A; Derk, Chris T; Bridges, S Louis; Shanmugam, Victoria K; Kolstad, Kathleen D; Chung, Lorinda; Jan, Reem; Bernstein, Elana J; Goldberg, Avram; Trojanowski, Marcin; Kafaja, Suzanne; Maksimowicz-McKinnon, Kathleen M; Mullikin, James C; Adeyemo, Adebowale; Rotimi, Charles; Boin, Francesco; Kastner, Daniel L; Wigley, Fredrick M

2018-05-06

Whole-exome sequencing (WES) studies in systemic sclerosis (SSc) patients of European American (EA) ancestry have identified variants in the ATP8B4 gene and enrichment of variants in genes in the extracellular matrix (ECM)-related pathway increasing SSc susceptibility. Our goal was to evaluate the association of the ATP8B4 gene and the ECM-related pathway with SSc in a cohort of African Americans (AA). SSc patients of AA ancestry were enrolled from 23 academic centers across the United States under the Genome Research in African American Scleroderma Patients (GRASP) consortium. Unrelated AA individuals without serological evidence of autoimmunity enrolled in the Howard University Family Study were used as unaffected controls. Functional variants in genes reported in the two WES studies in EA SSc were selected for gene association testing using the optimized sequence kernel association test (SKAT-O) and pathway analysis by Ingenuity pathway analysis in 379 patients and 411 controls. Principal components analysis demonstrated that the patients and controls had similar ancestral backgrounds with about equal proportions of mean European admixture. Using SKAT-O, we examined the association of individual genes that were previously reported in EAs, and none remained significant including ATP8B4 (P U nCorr =0.98). However, we confirm the previously reported association of the ECM-related pathway with enrichment of variants within the COL13A1, COL18A1, COL22A1, COL4A3, COL4A4, COL5A2, PROK1, and SERPINE1 genes (P C orr =1.95×10 -4 ). This is the largest genetic study in AAs with SSc to date, corroborating the role of functional variants aggregating in a fibrotic pathway and increasing SSc susceptibility. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Characterisation of Potential Antimicrobial Targets in Bacillus spp. I. Aminotransferases and Methionine Regeneration in Bacillus subtilis

DTIC Science & Technology

2002-07-01

DAAT and 45% identical to the Staphylococcus haemolyticus DAAT. The ybgE and ywaA sequences were found in the Illa subfamily, and were 59% identical to...halodurans BH1060 gene product. The two sequences also had a respective 40% and 37% identity to the Staphylococcus aureuts SAV2560 gene product. The 6

Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

PubMed

Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

2004-01-30

Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

Acquired aplastic anemia.

PubMed

Keohane, Elaine M

2004-01-01

Acquired aplastic anemia (AA) is a disorder characterized by a profound deficit of hematopoietic stem and progenitor cells, bone marrow hypocellularity, and peripheral blood pancytopenia. It primarily affects children, young adults, and those over 60 years of age. The majority of cases are idiopathic; however, idiosyncratic reactions to some drugs, chemicals, and viruses have been implicated in its etiology. An autoimmune T-cell reaction likely causes the stem cell depletion, but the precise mechanism, as well as the eliciting and target antigens, is unknown. Symptoms vary from severe life-threatening cytopenias to moderate or non-severe disease that does not require transfusion support. The peripheral blood typically exhibits pancytopenia, reticulocytopenia, and normocytic or macrocytic erythrocytes. The bone marrow is hypocellular and may exhibit dysplasia of the erythrocyte precursors. First line treatment for severe AA consists of hematopoietic stem cell transplantation in young patients with HLA identical siblings, while immunosuppression therapy is used for older patients and for those of any age who lack a HLA matched donor. Patients with AA have an increased risk of developing paroxysmal nocturnal hemoglobinuria (PNH), myelodysplastic syndrome (MDS), or acute leukemia. Further elucidation of the pathophysiology of this disease will result in a better understanding of the interrelationship among AA, PNH, and MDS, and may lead to novel targeted therapies.

Differential Metabolic Impact of Gastric Bypass Surgery Versus Dietary Intervention in Obese Diabetic Subjects Despite Identical Weight Loss

PubMed Central

Laferrère, Blandine; Reilly, David; Arias, Sara; Swerdlow, Nicholas; Gorroochurn, Prakash; Bawa, Baani; Bose, Mousumi; Teixeira, Julio; Stevens, Robert D.; Wenner, Brett R.; Bain, James R.; Muehlbauer, Michael J.; Haqq, Andrea; Lien, Lillian; Shah, Svati H.; Svetkey, Laura P.; Newgard, Christopher B.

2013-01-01

Glycemic control is improved more after gastric bypass surgery (GBP) than after equivalent diet-induced weight loss in patients with morbid obesity and type 2 diabetes mellitus. We applied metabolomic profiling to understand the mechanisms of this better metabolic response after GBP. Circulating amino acids (AAs) and acylcarnitines (ACs) were measured in plasma from fasted subjects by targeted tandem mass spectrometry before and after a matched 10-kilogram weight loss induced by GBP or diet. Total AAs and branched-chain AAs (BCAAs) decreased after GBP, but not after dietary intervention. Metabolites derived from BCAA oxidation also decreased only after GBP. Principal components (PC) analysis identified two major PCs, one composed almost exclusively of ACs (PC1) and another with BCAAs and their metabolites as major contributors (PC2). PC1 and PC2 were inversely correlated with pro-insulin concentrations, the C-peptide response to oral glucose, and the insulin sensitivity index after weight loss, whereas PC2 was uniquely correlated with levels of insulin resistance (HOMA-IR). These data suggest that the enhanced decrease in circulating AAs after GBP occurs by mechanisms other than weight loss and may contribute to the better improvement in glucose homeostasis observed with the surgical intervention. PMID:21525399

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

ExprAlign - the identification of ESTs in non-model species by alignment of cDNA microarray expression profiles

PubMed Central

2009-01-01

Background Sequence identification of ESTs from non-model species offers distinct challenges particularly when these species have duplicated genomes and when they are phylogenetically distant from sequenced model organisms. For the common carp, an environmental model of aquacultural interest, large numbers of ESTs remained unidentified using BLAST sequence alignment. We have used the expression profiles from large-scale microarray experiments to suggest gene identities. Results Expression profiles from ~700 cDNA microarrays describing responses of 7 major tissues to multiple environmental stressors were used to define a co-expression landscape. This was based on the Pearsons correlation coefficient relating each gene with all other genes, from which a network description provided clusters of highly correlated genes as 'mountains'. We show that these contain genes with known identities and genes with unknown identities, and that the correlation constitutes evidence of identity in the latter. This procedure has suggested identities to 522 of 2701 unknown carp ESTs sequences. We also discriminate several common carp genes and gene isoforms that were not discriminated by BLAST sequence alignment alone. Precision in identification was substantially improved by use of data from multiple tissues and treatments. Conclusion The detailed analysis of co-expression landscapes is a sensitive technique for suggesting an identity for the large number of BLAST unidentified cDNAs generated in EST projects. It is capable of detecting even subtle changes in expression profiles, and thereby of distinguishing genes with a common BLAST identity into different identities. It benefits from the use of multiple treatments or contrasts, and from the large-scale microarray data. PMID:19939286

[A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

PubMed

Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

2013-08-04

Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to NaCl and alkali stresses.

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

PubMed

Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

2018-04-11

Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.

Genetic polymorphisms within exon 3 of heat shock protein 90AA1 gene and its association with heat tolerance traits in Sahiwal cows

PubMed Central

Kumar, Rakesh; Gupta, I. D.; Verma, Archana; Verma, Nishant; Vineeth, M. R.

2015-01-01

Aim: The present study was undertaken to identify novel single nucleotide polymorphism (SNP) in Exon 3 of HSP90AA1 gene and to analyze their association with respiration rate (RR) and rectal temperature (RT) in Sahiwal cows. Materials and Methods: The present study was carried out in Sahiwal cows (n=100) with the objectives to identify novel SNP in exon 3 of HSP90AA1 gene and to explore the association with heat tolerance traits. CLUSTAL-W multiple sequence analysis was used to identify novel SNPs in exon 3 of HSP90AA1 gene in Sahiwal cows. Gene and genotype frequencies of different genotypes were estimated by standard procedure POPGENE version 1.32 (University of Alberta, Canada). The significant effect of SNP variants on physiological parameters, e.g. RR and RT were analyzed using the General Linear model procedure of SAS Version 9.2. Results: The polymerase chain reaction product with the amplicon size of 450 bp was successfully amplified, covering exon 3 region of HSP90AA1 gene in Sahiwal cows. On the basis of comparative sequence analysis of Sahiwal samples (n=100), transitional mutations were detected at locus A1209G as compared to Bos taurus (NCBI GenBank AC_000178.1). After chromatogram analysis, three genotypes AA, AG, and GG with respective frequencies of 0.23, 0.50, and 0.27 ascertained. RR and RT were recorded once during probable extreme hours in winter, spring, and summer seasons. It was revealed that significant difference (p<0.01) among genetic variants of HSP90AA1 gene with heat tolerance trait was found in Sahiwal cattle. The homozygotic animals with AA genotype had lower heat tolerance coefficient (HTC) (1.78±0.04a), as compared to both AG and GG genotypes (1.85±0.03b and 1.91±0.02c), respectively. The gene and genotype frequencies for the locus A1209G were ascertained. Conclusions: Novel SNP was found at the A1209G position showed all possible three genotypes (homozygous and heterozygous). Temperature humidity index has a highly significant association with RR, RT, and HTC in all the seasons. Perusal of results across different seasons showed the significant (p<0.01) difference in RR, RT, and HTC among winter, spring, and summer seasons. Genetic association with heat tolerance traits reveals their importance as a potential genetic marker for heat tolerance traits in Sahiwal cows. PMID:27047179

Identification of three genotypes of sugarcane yellow leaf virus causing yellow leaf disease from India and their molecular characterization.

PubMed

Viswanathan, R; Balamuralikrishnan, M; Karuppaiah, R

2008-12-01

Sugarcane yellow leaf virus (SCYLV) that causes yellow leaf disease (YLD) in sugarcane (recently reported in India) belongs to Polerovirus. Detailed studies were conducted to characterize the virus based on partial open reading frames (ORFs) 1 and 2 and complete ORFs 3 and 4 sequences in their genome. Reverse-transcriptase polymerase chain reaction (RT-PCR) was performed on 48 sugarcane leaf samples to detect the virus using a specific set of primers. Of the 48 samples, 36 samples (field samples with and without foliar symptoms) including 10 meristem culture derived plants were found to be positive to SCYLV infection. Additionally, an aphid colony collected from symptomatic sugarcane in the field was also found to be SCYLV positive. The amplicons from 22 samples were cloned, sequenced and acronymed as SCYLV-CB isolates. The nucleotide (nt) and amino acid (aa) sequence comparison showed a significant variation between SCYLV-CB and the database sequences at nt (3.7-5.1%) and aa (3.2-5.3%) sequence level in the CP coding region. However, the database sequences comprising isolates of three reported genotypes, viz., BRA, PER and REU, were observed with least nt and aa sequence dissimilarities (0.0-1.6%). The phylogenetic analyses of the overlapping ORFs (ORF 3 and ORF 4) of SCYLV encoding CP and MP determined in this study and additional sequences of 26 other isolates including an Indian isolate (SCYLV-IND) available from GenBank were distributed in four phylogenetic clusters. The SCYLV-CB isolates from this study lineated in two clusters (C1 and C2) and all the other isolates from the worldwide locations into another two clusters (C3 and C4). The sequence variation of the isolates in this study with the database isolates, even in the least variable region of the SCYLV genome, showed that the population existing in India is significantly different from rest of the world. Further, comparison of partial sequences encoding for ORFs 1 and 2 revealed that YLD in sugarcane in India is caused by at least three genotypes, viz., CUB, IND and BRA-PER, of which a majority of the samples were found infected with Cuban genotype (CUB) and lesser by IND and BRA-PER genotypes. The genotype IND was identified as a new genotype from this study, and this was found to have significant variation with the reported genotypes.

Terminal region sequence variations in variola virus DNA.

PubMed

Massung, R F; Loparev, V N; Knight, J C; Totmenin, A V; Chizhikov, V E; Parsons, J M; Safronov, P F; Gutorov, V V; Shchelkunov, S N; Esposito, J J

1996-07-15

Genome DNA terminal region sequences were determined for a Brazilian alastrim variola minor virus strain Garcia-1966 that was associated with an 0.8% case-fatality rate and African smallpox strains Congo-1970 and Somalia-1977 associated with variola major (9.6%) and minor (0.4%) mortality rates, respectively. A base sequence identity of > or = 98.8% was determined after aligning 30 kb of the left- or right-end region sequences with cognate sequences previously determined for Asian variola major strains India-1967 (31% death rate) and Bangladesh-1975 (18.5% death rate). The deduced amino acid sequences of putative proteins of > or = 65 amino acids also showed relatively high identity, although the Asian and African viruses were clearly more related to each other than to alastrim virus. Alastrim virus contained only 10 of 70 proteins that were 100% identical to homologs in Asian strains, and 7 alastrim-specific proteins were noted.

Effects of learning with explicit elaboration on implicit transfer of visuomotor sequence learning.

PubMed

Tanaka, Kanji; Watanabe, Katsumi

2013-08-01

Intervals between stimuli and/or responses have significant influences on sequential learning. In the present study, we investigated whether transfer would occur even when the intervals and the visual configurations in a sequence were drastically changed so that participants did not notice that the required sequences of responses were identical. In the experiment, two (or three) sequential button presses comprised a "set," and nine (or six) consecutive sets comprised a "hyperset." In the first session, participants learned either a 2 × 9 or 3 × 6 hyperset by trial and error until they completed it 20 times without error. In the second block, the 2 × 9 (3 × 6) hyperset was changed into the 3 × 6 (2 × 9) hyperset, resulting in different visual configurations and intervals between stimuli and responses. Participants were assigned into two groups: the Identical and Random groups. In the Identical group, the sequence (i.e., the buttons to be pressed) in the second block was identical to that in the first block. In the Random group, a new hyperset was learned. Even in the Identical group, no participants noticed that the sequences were identical. Nevertheless, a significant transfer of performance occurred. However, in the subsequent experiment that did not require explicit trial-and-error learning in the first session, implicit transfer in the second session did not occur. These results indicate that learning with explicit elaboration strengthens the implicit representation of the sequence order as a whole; this might occur independently of the intervals between elements and enable implicit transfer.

Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1993-01-01

Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

Multiple vitellogenins and product yolk proteins in European sea bass (Dicentrarchus labrax): Molecular characterization, quantification in plasma, liver and ovary, and maturational proteolysis.

PubMed

Yilmaz, Ozlem; Prat, Francisco; Ibáñez, A Jose; Köksoy, Sadi; Amano, Haruna; Sullivan, Craig V

2016-01-01

Three complete vitellogenin (Vtg) polypeptides of European sea bass (Dicentrarchus labrax), an acanthomorph teleost spawning pelagic eggs in seawater, were deduced from cDNA and identified as VtgAa, VtgAb and VtgC based on current Vtg nomenclature and phylogeny. Label free quantitative mass spectrometry verified the presence of the three sea bass Vtgs or their product yolk proteins (YPs) in liver, plasma and ovary of postvitellogenic females. As evidenced by normalized spectral counts, VtgAb-derived protein was 2- to 5-fold more abundant, depending on sample type, than for VtgAa, while VtgC-derived protein was less abundant, albeit only 3-fold lower than for VtgAb in the ovary. Western blotting with Vtg type-specific antisera raised against corresponding gray mullet (Mugil cephalus) lipovitellins (Lvs) detected all three types of sea bass Vtg in the blood plasma of gravid females and/or estrogenized males and showed that all three forms of sea bass Lv undergo limited partial degradation during oocyte maturation. The comparatively high levels of VtgC-derived YPs in fully-grown oocytes and the maturational proteolysis of all three types of Lv differ from what has been reported for other teleosts spawning pelagic eggs in seawater but are similar to recent findings for two species of North American Moronidae, the striped bass (Morone saxatilis) and white perch (Morone americana), which spawn pelagic and demersal eggs, respectively in fresh water. Together with the high Vtg sequence homologies and virtually identical structural features of each type of Vtg between species, these findings indicate that the moronid multiple Vtg systems do not substantially vary with reproductive environment. Copyright © 2015 Elsevier Inc. All rights reserved.

Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

PubMed

Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

2014-08-01

Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

Cloning of a growth hormone from a primitive bony fish and its phylogenetic relationships.

PubMed

Rubin, D A; Dores, R M

1994-07-01

Growth hormone (GH), prolactin, and their relatives constitute a multigene family which is considered to have evolved from a common ancestor. The structural and functional domains of GH appear to be highly conserved among vertebrates. In order to investigate the phylogenetic relationships among GHs in the Actinopterygii and Sarcopterygii, we have cloned and sequenced GH from the pituitary of the primitive bony fish, Amia calva. Bony fishes (teleosts) and Amia (Halecomorphi) are purported sister-groups within the Neoptergii, hence studies on this perspective group of fish can provide insights into the evolution of GH. The deduced amino acid (aa) sequence from A. calva GH (amGH) cDNA revealed that the mature GH consists of 190 residues. Phylogenetic comparisons with GH aa sequences from blue shark, sturgeon, four teleosts (eel, carp, porgy, flounder), and two sarcopterygians (African lungfish and bullfrog) indicated, in the most parsimonious cladogram, that amGH clusters as the sister-group to the teleosts, that sturgeon is the sister-group to the Neopterygii, and that the African lungfish and bullfrog are in the same clade.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

PubMed

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

PubMed

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

Emergence of Clonal Hematopoiesis in the Majority of Patients with Acquired Aplastic Anemia

PubMed Central

Babushok, Daria V.; Perdigones, Nieves; Perin, Juan C.; Olson, Timothy S.; Ye, Wenda; Roth, Jacquelyn J.; Lind, Curt; Cattier, Carine; Li, Yimei; Hartung, Helge; Paessler, Michele E.; Frank, Dale M.; Xie, Hongbo M.; Cross, Shanna; Cockroft, Joshua D.; Podsakoff, Gregory M.; Monos, Dimitrios; Biegel, Jaclyn A.; Mason, Philip J.; Bessler, Monica

2015-01-01

Acquired aplastic anemia (aAA) is a non-malignant disease caused by autoimmune destruction of early hematopoietic cells. Clonal hematopoiesis is a late complication, seen in 20–25% of older patients. We hypothesized that clonal hematopoiesis in aAA is a more general phenomenon, which can arise early in disease even in younger patients. To evaluate clonal hematopoiesis in aAA, we used comparative whole exome sequencing of paired bone marrow and skin in 22 patients. We found somatic mutations in sixteen patients (72.7%) with a median disease duration of 1 year; twelve (66.7%) were patients with pediatriconset aAA. Fifty-eight mutations in 51 unique genes were primarily in pathways of immunity and transcriptional regulation. Most frequently mutated was PIGA, with 7 mutations. Only two mutations were in genes recurrently-mutated in MDS. Two patients had oligoclonal loss of HLA alleles, linking immune escape to clone emergence. Two patients had activating mutations in key signaling pathways (STAT5B(p.N642H), CAMK2G(p.T306M)). Our results suggest that clonal hematopoiesis in aAA is common, with two mechanisms emerging― immune escape and increased proliferation. Our findings expand conceptual understanding of this non-neoplastic blood disorder. Future prospective studies of clonal hematopoiesis in aAA will be critical for understanding outcomes, and for designing personalized treatment strategies. PMID:25800665

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Large-scale oscillation of structure-related DNA sequence features in human chromosome 21

NASA Astrophysics Data System (ADS)

Li, Wentian; Miramontes, Pedro

2006-08-01

Human chromosome 21 is the only chromosome in the human genome that exhibits oscillation of the (G+C) content of a cycle length of hundreds kilobases (kb) ( 500kb near the right telomere). We aim at establishing the existence of a similar periodicity in structure-related sequence features in order to relate this (G+C)% oscillation to other biological phenomena. The following quantities are shown to oscillate with the same 500kb periodicity in human chromosome 21: binding energy calculated by two sets of dinucleotide-based thermodynamic parameters, AA/TT and AAA/TTT bi- and tri-nucleotide density, 5'-TA-3' dinucleotide density, and signal for 10- or 11-base periodicity of AA/TT or AAA/TTT. These intrinsic quantities are related to structural features of the double helix of DNA molecules, such as base-pair binding, untwisting or unwinding, stiffness, and a putative tendency for nucleosome formation.

Mosaic Graphs and Comparative Genomics in Phage Communities

PubMed Central

Belcaid, Mahdi; Bergeron, Anne

2010-01-01

Abstract Comparing the genomes of two closely related viruses often produces mosaics where nearly identical sequences alternate with sequences that are unique to each genome. When several closely related genomes are compared, the unique sequences are likely to be shared with third genomes, leading to virus mosaic communities. Here we present comparative analysis of sets of Staphylococcus aureus phages that share large identical sequences with up to three other genomes, and with different partners along their genomes. We introduce mosaic graphs to represent these complex recombination events, and use them to illustrate the breath and depth of sequence sharing: some genomes are almost completely made up of shared sequences, while genomes that share very large identical sequences can adopt alternate functional modules. Mosaic graphs also allow us to identify breakpoints that could eventually be used for the construction of recombination networks. These findings have several implications on phage metagenomics assembly, on the horizontal gene transfer paradigm, and more generally on the understanding of the composition and evolutionary dynamics of virus communities. PMID:20874413

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Identification and characterization of microRNAs in oilseed rape (Brassica napus) responsive to infection with the pathogenic fungus Verticillium longisporum using Brassica AA (Brassica rapa) and CC (Brassica oleracea) as reference genomes.

PubMed

Shen, Dan; Suhrkamp, Ina; Wang, Yu; Liu, Shenyi; Menkhaus, Jan; Verreet, Joseph-Alexander; Fan, Longjiang; Cai, Daguang

2014-11-01

Verticillium longisporum, a soil-borne pathogenic fungus, causes vascular disease in oilseed rape (Brassica napus). We proposed that plant microRNAs (miRNAs) are involved in the plant-V. longisporum interaction. To identify oilseed rape miRNAs, we deep-sequenced two small RNA libraries made from V. longisporum infected/noninfected roots and employed Brassica rapa and Brassica oleracea genomes as references for miRNA prediction and characterization. We identified 893 B. napus miRNAs representing 360 conserved and 533 novel miRNAs, and mapped 429 and 464 miRNAs to the AA and CC genomes, respectively. Microsynteny analysis with the conserved miRNAs and their flanking protein coding sequences revealed 137 AA-CC genome syntenic miRNA pairs and 61 AA and 42 CC genome-unique miRNAs. Sixty-two miRNAs were responsive to the V. longisporum infection. We present data for specific interactions and simultaneously reciprocal changes in the expression levels of the miRNAs and their targets in the infected roots. We demonstrate that miRNAs are involved in the plant-fungus interaction and that miRNA168-Argonaute 1 (AGO1) expression modulation might act as a key regulatory module in a compatible plant-V. longisporum interaction. Our results suggest that V. longisporum may have evolved a virulence mechanism by interference with plant miRNAs to reprogram plant gene expression and achieve infection. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

The AAS Working Group on Accessibility and Disability (WGAD): Year 1 Highlights

NASA Astrophysics Data System (ADS)

Aarnio, Alicia; Monkiewicz, Jacqueline; Murphy, Nicholas Arnold; Nordhaus, Jason; Tuttle, Sarah E.

2017-01-01

The AAS Working Group on Accessibility and Disability (WGAD) was formed in January of 2016 with the express purpose of seeking equity of opportunity and building inclusive practices for disabled astronomers at all career stages. In our first year, the WGAD has been actively developing resources and the online infrastructure for the dissemination of information and engagement with the astronomy community. Our official WGAD website has gone live, and we have used both the access: astronomy google group and blog to discuss specific issues of disability justice and to raise awareness for less-discussed barriers to access. The WGAD has developed relationships and collaboration with AAS inclusion committees (SGMA, CSMA, CSWA) so our work can recognize and address the intersections of identity astronomers occupy. In this presentation, we summarize our year one activities, focusing on our recently developed set of recommendations for journal accessibility to ensure everyone can engage with journal content and navigate the submission process. We will also discuss ongoing and future endeavors: a best practices guide for accessibility to be available via our website, and a site visit program.

Analysis of aldehydes in beer by gas-diffusion microextraction: characterization by high-performance liquid chromatography-diode-array detection-atmospheric pressure chemical ionization-mass spectrometry.

PubMed

Gonçalves, Luís Moreira; Magalhães, Paulo Jorge; Valente, Inês Maria; Pacheco, João Grosso; Dostálek, Pavel; Sýkora, David; Rodrigues, José António; Barros, Aquiles Araújo

2010-06-11

In this work, a recently developed extraction technique for sample preparation aiming the analysis of volatile and semi-volatile compounds named gas-diffusion microextraction (GDME) is applied in the chromatographic analysis of aldehydes in beer. Aldehydes-namely acetaldehyde (AA), methylpropanal (MA) and furfural (FA)-were simultaneously extracted and derivatized with 2,4-dinitrophenylhydrazine (DNPH), then the derivatives were separated and analyzed by high-performance liquid chromatography with spectrophotometric detection (HPLC-UV). The identity of the eluted compounds was confirmed by high-performance liquid chromatography-atmospheric pressure chemical ionization-mass-spectrometry detection in the negative ion mode (HPLC-APCI-MS). The developed methodology showed good repeatability (ca. 5%) and linearity as well as good limits of detection (AA-12.3, FA-1.5 and MA 5.4microgL(-1)) and quantification (AA-41, FA-4.9 and MA 18microgL(-1)); it also appears to be competitive in terms of speed and cost of analysis. Copyright 2010 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berkowitz, L.R.; Orringer, E.P.

Swelling hemoglobin CC erythrocytes stimulates a ouabain-insensitive K flux that restores original cell volume. Studies were performed with the K analog, /sup 86/Rb. This volume regulatory pathway was characterized for its anion dependence, sensitivity to loop diuretics, and requirement for Na. The swelling-induced K flux was eliminated if intracellular chloride was replaced by nitrate and both swelling-activated K influx and efflux were partially inhibited by 1 mM furosemide or bumetanide. K influx in swollen hemoglobin CC cells was not diminished when Na in the incubation medium was replaced with choline, indicating Na independence of the swelling-induced flux. Identical experiments withmore » hemoglobin AA cells also demonstrated a swelling-induced increase in K flux, but the magnitude and duration of this increase were considerably less than that seen with hemoglobin CC cells. The increased K flux in hemoglobin AA cells was likewise sensitive to anion replacement and to loop diuretics and did not require the presence of Na. These data indicate that a volume-activated K pathway with similar transport characteristics exists in both hemoglobin CC and AA red cells.« less

A New Bat-HKU2–like Coronavirus in Swine, China, 2017

PubMed Central

Gong, Lang; Li, Jie; Zhou, Qingfeng; Xu, Zhichao; Chen, Li; Zhang, Yun; Xue, Chunyi

2017-01-01

We identified from suckling piglets with diarrhea in China a new bat-HKU2–like porcine coronavirus (porcine enteric alphacoronavirus). The GDS04 strain of this coronavirus shares high aa identities (>90%) with the reported bat-HKU2 strains in Coronaviridae-wide conserved domains, suggesting that the GDS04 strain belongs to the same species as HKU2. PMID:28654418

A highly conserved N-terminal sequence for teleost vitellogenin with potential value to the biochemistry, molecular biology and pathology of vitellogenesis

USGS Publications Warehouse

Folmar, L.D.; Denslow, N.D.; Wallace, R.A.; LaFleur, G.; Gross, T.S.; Bonomelli, S.; Sullivan, C.V.

1995-01-01

N-terminal amino acid sequences for vitellogenin (Vtg) from six species of teleost fish (striped bass, mummichog, pinfish, brown bullhead, medaka, yellow perch and the sturgeon) are compared with published N-terminal Vtg sequences for the lamprey, clawed frog and domestic chicken. Striped bass and mummichog had 100% identical amino acids between positions 7 and 21, while pinfish, brown bullhead, sturgeon, lamprey, Xenopus and chicken had 87%, 93%, 60%, 47%, 47-60%) for four transcripts and had 40% identical, respectively, with striped bass for the same positions. Partial sequences obtained for medaka and yellow perch were 100% identical between positions 5 to 10. The potential utility of this conserved sequence for studies on the biochemistry, molecular biology and pathology of vitellogenesis is discussed.

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

A novel amino acid substitution in a voltage-gated sodium channel is associated with knockdown resistance to permethrin in Aedes aegypti.

PubMed

Chang, Cheng; Shen, Wen-Kai; Wang, Tzu-Ting; Lin, Ying-Hsi; Hsu, Err-Lieh; Dai, Shu-Mei

2009-04-01

To identify pertinent mutations associated with knockdown resistance to permethrin, the entire coding sequence of the voltage-gated sodium channel gene Aa-para was sequenced and analyzed from a Per-R strain with 190-fold resistance to permethrin and two susceptible strains of Aedes aegypti. The longest transcript, a 6441bp open reading frame, encodes 2147 amino acid residues with an estimated molecular mass of 241kDa. A total of 33 exons were found in the Aa-para gene over 293kb of genomic DNA. Three previously unreported optional exons were identified. The first two exons, m and n, were located within the intracellular domain I/II, and the third, f', was found within the II/III linkers. The two mutually exclusive exons, d and l, were the only alternative exons in all the cDNA clones sequenced in this study. The most distinct finding was a novel amino acid substitution mutation, D1794Y, located within the extracellular linker between IVS5 and IVS6, which is concurrent with the known V1023G mutation in Aa-para of the Per-R strain. The high frequency and coexistence of the two mutations in the Per-R strain suggest that they might exert a synergistic effect to provide the knockdown resistance to permethrin. Furthermore, both cDNA and genomic DNA data from the same individual mosquitoes have demonstrated that RNA editing was not involved in amino acid substitutions of the Per-R strain.

Electronic coupling through natural amino acids.

PubMed

Berstis, Laura; Beckham, Gregg T; Crowley, Michael F

2015-12-14

Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For both motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green's function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.

APOBEC3H haplotypes and HIV-1 pro-viral vif DNA sequence diversity in early untreated human immunodeficiency virus-1 infection.

PubMed

Gourraud, P A; Karaouni, A; Woo, J M; Schmidt, T; Oksenberg, J R; Hecht, F M; Liegler, T J; Barbour, J D

2011-03-01

We examined single nucleotide polymorphisms (SNP) in the APOBEC3 locus on chromosome 22, paired with population sequences of pro-viral human immunodeficiency virus-1 (HIV-1) vif from peripheral blood mononuclear cells, from 96 recently HIV-1-infected treatment-naive adults. We found evidence for the existence of an APOBEC3H linkage disequilibrium (LD) block associated with variation in GA → AA, or APOBEC3F/H signature, sequence changes in pro-viral HIV-1 vif sequence (top 10 significant SNPs with a significant p = 4.8 × 10(-3)). We identified a common five position risk haplotype distal to APOBEC3H (A3Hrh). These markers were in high LD (D' = 1; r(2) = 0.98) to a previously described A3H "RED" haplotype containing a variant (E121) with enhanced susceptibility to HIV-1 Vif. This association was confirmed by a haplotype analysis. Homozygote carriers of the A3Hrh had lower GA->AA (A3F/H) sequence editing upon pro-viral HIV-1 vif sequence (p = 0.01), and lower HIV-1 RNA levels over time during early, untreated HIV-1 infection, (p = 0.015 mixed effects model). This effect may be due to enhanced susceptibility of A3H forms to HIV-1 Vif mediated viral suppression of sequence editing activity, slowing viral diversification and escape from immune responses. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Efficient analysis of mouse genome sequences reveal many nonsense variants

PubMed Central

Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude

2016-01-01

Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605

High-resolution motion compensated MRA in patients with congenital heart disease using extracellular contrast agent at 3 Tesla.

PubMed

Dabir, Darius; Naehle, Claas Philip; Clauberg, Ralf; Gieseke, Juergen; Schild, Hans H; Thomas, Daniel

2012-10-29

Using first-pass MRA (FP-MRA) spatial resolution is limited by breath-hold duration. In addition, image quality may be hampered by respiratory and cardiac motion artefacts. In order to overcome these limitations an ECG- and navigator-gated high-resolution-MRA sequence (HR-MRA) with slow infusion of extracellular contrast agent was implemented at 3 Tesla for the assessment of congenital heart disease and compared to standard first-pass-MRA (FP-MRA). 34 patients (median age: 13 years) with congenital heart disease (CHD) were prospectively examined on a 3 Tesla system. The CMR-protocol comprised functional imaging, FP- and HR-MRA, and viability imaging. After the acquisition of the FP-MRA sequence using a single dose of extracellular contrast agent the motion compensated HR-MRA sequence with isotropic resolution was acquired while injecting the second single dose, utilizing the timeframe before viability imaging. Qualitative scores for image quality (two independent reviewers) as well as quantitative measurements of vessel sharpness and relative contrast were compared using the Wilcoxon signed-rank test. Quantitative measurements of vessel diameters were compared using the Bland-Altman test. The mean image quality score revealed significantly better image quality of the HR-MRA sequence compared to the FP-MRA sequence in all vessels of interest (ascending aorta (AA), left pulmonary artery (LPA), left superior pulmonary vein (LSPV), coronary sinus (CS), and coronary ostia (CO); all p < 0.0001). In comparison to FP-MRA, HR-MRA revealed significantly better vessel sharpness for all considered vessels (AA, LSPV and LPA; all p < 0.0001). The relative contrast of the HR-MRA sequence was less compared to the FP-MRA sequence (AA: p <0.028, main pulmonary artery: p <0.004, LSPV: p <0.005). Both, the results of the intra- and interobserver measurements of the vessel diameters revealed closer correlation and closer 95 % limits of agreement for the HR-MRA. HR-MRA revealed one additional clinical finding, missed by FP-MRA. An ECG- and navigator-gated HR-MRA-protocol with infusion of extracellular contrast agent at 3 Tesla is feasible. HR-MRA delivers significantly better image quality and vessel sharpness compared to FP-MRA. It may be integrated into a standard CMR-protocol for patients with CHD without the need for additional contrast agent injection and without any additional examination time.

Analysis of hepatitis B virus preS1 variability and prevalence of the rs2296651 polymorphism in a Spanish population

PubMed Central

Casillas, Rosario; Tabernero, David; Gregori, Josep; Belmonte, Irene; Cortese, Maria Francesca; González, Carolina; Riveiro-Barciela, Mar; López, Rosa Maria; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-01-01

AIM To determine the variability/conservation of the domain of hepatitis B virus (HBV) preS1 region that interacts with sodium-taurocholate cotransporting polypeptide (hereafter, NTCP-interacting domain) and the prevalence of the rs2296651 polymorphism (S267F, NTCP variant) in a Spanish population. METHODS Serum samples from 246 individuals were included and divided into 3 groups: patients with chronic HBV infection (CHB) (n = 41, 73% Caucasians), patients with resolved HBV infection (n = 100, 100% Caucasians) and an HBV-uninfected control group (n = 105, 100% Caucasians). Variability/conservation of the amino acid (aa) sequences of the NTCP-interacting domain, (aa 2-48 in viral genotype D) and a highly conserved preS1 domain associated with virion morphogenesis (aa 92-103 in viral genotype D) were analyzed by next-generation sequencing and compared in 18 CHB patients with viremia > 4 log IU/mL. The rs2296651 polymorphism was determined in all individuals in all 3 groups using an in-house real-time PCR melting curve analysis. RESULTS The HBV preS1 NTCP-interacting domain showed a high degree of conservation among the examined viral genomes especially between aa 9 and 21 (in the genotype D consensus sequence). As compared with the virion morphogenesis domain, the NTCP-interacting domain had a smaller proportion of HBV genotype-unrelated changes comprising > 1% of the quasispecies (25.5% vs 31.8%), but a larger proportion of genotype-associated viral polymorphisms (34% vs 27.3%), according to consensus sequences from GenBank patterns of HBV genotypes A to H. Variation/conservation in both domains depended on viral genotype, with genotype C being the most highly conserved and genotype E the most variable (limited finding, only 2 genotype E included). Of note, proline residues were highly conserved in both domains, and serine residues showed changes only to threonine or tyrosine in the virion morphogenesis domain. The rs2296651 polymorphism was not detected in any participant. CONCLUSION In our CHB population, the NTCP-interacting domain was highly conserved, particularly the proline residues and essential amino acids related with the NTCP interaction, and the prevalence of rs2296651 was low/null. PMID:29456407

Genome Sequencing of Ralstonia solanacearum CQPS-1, a Phylotype I Strain Collected from a Highland Area with Continuous Cropping of Tobacco

PubMed Central

Liu, Ying; Tang, Yuanman; Qin, Xiyun; Yang, Liang; Jiang, Gaofei; Li, Shili; Ding, Wei

2017-01-01

Ralstonia solanacearum, an agent of bacterial wilt, is a highly variable species with a broad host range and wide geographic distribution. As a species complex, it has extensive genetic diversity and its living environment is polymorphic like the lowland and the highland area, so more genomes are needed for studying population evolution and environment adaptation. In this paper, we reported the genome sequencing of R. solanacearum strain CQPS-1 isolated from wilted tobacco in Pengshui, Chongqing, China, a highland area with severely acidified soil and continuous cropping of tobacco more than 20 years. The comparative genomic analysis among different R. solanacearum strains was also performed. The completed genome size of CQPS-1 was 5.89 Mb and contained the chromosome (3.83 Mb) and the megaplasmid (2.06 Mb). A total of 5229 coding sequences were predicted (the chromosome and megaplasmid encoded 3573 and 1656 genes, respectively). A comparative analysis with eight strains from four phylotypes showed that there was some variation among the species, e.g., a large set of specific genes in CQPS-1. Type III secretion system gene cluster (hrp gene cluster) was conserved in CQPS-1 compared with the reference strain GMI1000. In addition, most genes coding core type III effectors were also conserved with GMI1000, but significant gene variation was found in the gene ripAA: the identity compared with strain GMI1000 was 75% and the hrpII box promoter in the upstream had significantly mutated. This study provided a potential resource for further understanding of the relationship between variation of pathogenicity factors and adaptation to the host environment. PMID:28620361

Reduced amino acids in the bovine uterine lumen of cloned versus in vitro fertilized pregnancies prior to implantation.

PubMed

Groebner, Anna E; Zakhartchenko, Valeri; Bauersachs, Stefan; Rubio-Aliaga, Isabel; Daniel, Hannelore; Büttner, Mathias; Reichenbach, Horst D; Meyer, Heinrich H D; Wolf, Eckhard; Ulbrich, Susanne E

2011-10-01

Fetal overgrowth and placental abnormalities frequently occur in pregnancies following somatic cell nuclear transfer (SCNT). An optimal intrauterine supply of amino acids (AA) is of specific importance for the development of the bovine preimplantation embryo, and a defective regulation of AA supply might contribute to pregnancy failures. Thus, we analyzed 41 AA and derivatives by liquid chromatography-tandem mass spectrometry in uterine flushings of day 18 pregnant heifers carrying in vitro fertilized (IVF) or SCNT embryos, which were cultured under identical conditions until transfer to recipients. The concentrations of several AA were reduced in samples from SCNT pregnancies: L-leucine (1.8-fold), L-valine (1.6-fold), L-isoleucine (1.9-fold), L-phenylalanine (1.5-fold), L-glutamic acid (3.9-fold), L-aspartic acid (4.0-fold), L-proline (2.6-fold), L-alanine (2.0-fold), L-arginine (2.5-fold), and L-lysine (1.9-fold). The endometrial transcript abundance for the AA transporter solute carrier family 7 (amino acid transporter, L-type), member 8 (SLC7A8) was also 2.4-fold lower in SCNT pregnancies. O-phosphoethanolamine (PetN) was 11-fold (p=0.0001) reduced in the uterine fluid of animals carrying an SCNT conceptus, pointing toward changes of the phospholipid metabolism. We provide evidence for disturbed embryo-maternal interactions in the preimplantation period after transfer of SCNT embryos, which may contribute to developmental abnormalities. These are unlikely related to the major embryonic pregnancy recognition signal interferon-tau, because similar activities were detected in uterine flushings of the SCNT and IVF groups.

Conservation and diversification of Msx protein in metazoan evolution.

PubMed

Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun

2008-01-01

Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family proteins contributed to the diversification of animal body organization.

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Identification of a new Apscaviroid from Japanese persimmon.

PubMed

Nakaune, Ryoji; Nakano, Masaaki

2008-01-01

Three viroid-like sequences were detected from Japanese persimmon (Diospyrus kaki Thunb.) by RT-PCR using primers specific for members of the genus Apscaviroid. Based on the sequences, we determined the complete genomic sequences. Two had 92.1-94.3% sequence identity with citrus viroid OS (CVd-OS) and 91.4-96.3% identity with apple fruit crinkle viroid (AFCVd), respectively. Another one, tentatively named persimmon viroid (PVd), had 396 nucleotides and less than 70% sequence identity with known viroids. The secondary structure of PVd is proposed to be rod-like with extensive base pairing and contains the terminal conserved region and the central conserved region characteristic of the genus Apscaviroid. Moreover, we confirmed that the viroids, including PVd, are graft transmissible from persimmon to persimmon and that persimmon is a natural host of these viroids. According to its molecular and biological properties, PVd should be considered a member of a new species in the genus Apscaviroid.

Biochemical evaluation of a parsley tyrosine decarboxylase results in a novel 4-hydroxyphenylacetaldehyde synthase enzyme.

PubMed

Torrens-Spence, Michael P; Gillaspy, Glenda; Zhao, Bingyu; Harich, Kim; White, Robert H; Li, Jianyong

2012-02-10

Plant aromatic amino acid decarboxylases (AAADs) are effectively indistinguishable from plant aromatic acetaldehyde syntheses (AASs) through primary sequence comparison. Spectroscopic analyses of several characterized AASs and AAADs were performed to look for absorbance spectral identifiers. Although this limited survey proved inconclusive, the resulting work enabled the reevaluation of several characterized plant AAS and AAAD enzymes. Upon completion, a previously reported parsley AAAD protein was demonstrated to have AAS activity. Substrate specificity tests demonstrate that this novel AAS enzyme has a unique substrate specificity towards tyrosine (km 0.46mM) and dopa (km 1.40mM). Metabolite analysis established the abundance of tyrosine and absence of dopa in parsley extracts. Such analysis indicates that tyrosine is likely to be the sole physiological substrate. The resulting information suggests that this gene is responsible for the in vivo production of 4-hydroxyphenylacetaldehyde (4-HPAA). This is the first reported case of an AAS enzyme utilizing tyrosine as a primary substrate and the first report of a single enzyme capable of producing 4-HPAA from tyrosine. Copyright © 2012 Elsevier Inc. All rights reserved.

Association of a novel SNP in exon 10 of the IGF2 gene with growth traits in Egyptian water buffalo (Bubalus bubalis).

PubMed

Abo-Al-Ela, Haitham G; El-Magd, Mohammed Abu; El-Nahas, Abeer F; Mansour, Ali A

2014-08-01

Insulin-like growth factor 2 (IGF2) plays an important role in muscle growth and it might be used as a marker for the growth traits selection strategies in farm animals. The objectives of this study were to detect polymorphisms in exon 10 of IGF2 and to determine associations between these polymorphisms and growth traits in Egyptian water buffalo. PCR-single-strand conformation polymorphism (SSCP) and DNA sequencing methods were used to detect any prospective polymorphism. A novel single nucleotide polymorphism (SNP), C287A, was detected. It was a non-synonymous mutation and led to replacement of glutamine (Q) amino acid (aa) by histidine (H) aa. Three different SSCP patterns were observed: AA, AC, and CC, with frequencies of 0.540, 0.325, and 0.135, respectively. Association analyses revealed that the AA individuals had a higher average daily gain (ADG) than other individuals (CC and AC) from birth to 9 months of age. We conclude that the AA genotype in C287A SNP in the exon 10 of the IGF2 gene is associated with the ADG during the age from birth to 9 months and could be used as a potential genetic marker for selection of growth traits in Egyptian buffalo.

Abiraterone acetate in the treatment of prostate cancer.

PubMed

Thakur, Abhimanyu; Roy, Aishwarya; Ghosh, Arijit; Chhabra, Mohit; Banerjee, Sugato

2018-05-01

Among all cancer-related death, prostate cancer accounts for the second prominent reason for cancer-associated death in men. Despite the castration mediated reduction in testosterone synthesis, adrenal glands, as well as tissues of prostate cancer, continue to produce androgens, which ultimately lead to the growth of prostate cancer. This phase is referred as metastatic castration-resistant prostate cancer, which throws an obstacle to treatment. Androgen antagonists, in addition to deprivation of hormone, is being used for reducing the level of prostate-specific antigen but has not successfully come in front as a choice for prolonging the life of patients suffering from prostate cancer. In this prevailing scenario, abiraterone acetate (AA) has proved to be a boon for patients suffering from prostate cancer. AA selectively inhibits the actions of enzymes C17, 20-lyase and 17α-hydroxylase on cytochrome P450 (CYP) 17 when administered orally. The signaling of androgen receptor, being important for primary to metastatic phases of prostate cancer, CYP17 is essential for the synthesis of androgen. Herein, the in-detail pharmacological profile of AA, including androgen signaling, mechanism of action of AA, mechanism of AA resistance, pharmacokinetics, latest clinical findings, predictive markers, optimal treatment sequence, toxicity, and food interaction profiles have been reviewed. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

A targeted mass spectrometry-based approach for the identification and characterization of proteins containing α-aminoadipic and γ-glutamic semialdehyde residues

PubMed Central

Chavez, Juan D.; Bisson, William H.

2011-01-01

The site-specific identification of α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) residues in proteins is reported. Semialdehydic protein modifications result from the metal-catalyzed oxidation of Lys or Arg and Pro residues, respectively. Most of the analytical methods for the analysis of protein carbonylation measure change to the global level of carbonylation and fail to provide details regarding protein identity, site, and chemical nature of the carbonylation. In this work, we used a targeted approach, which combines chemical labeling, enrichment, and tandem mass spectrometric analysis, for the site-specific identification of AAS and GGS sites in proteins. The approach is applied to in vitro oxidized glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and an untreated biological sample, namely cardiac mitochondrial proteins. The analysis of GAPDH resulted in the site-specific identification of two AAA and four GGS residues. Computational evaluation of the identified AAS and GGS sites in GAPDH indicated that these sites are located in flexible regions, show high solvent accessibility values, and are in proximity with possible metal ion binding sites. The targeted proteomic analysis of semialdehydic modifications in cardiac mitochondria yielded nine AAS modification sites which were unambiguously assigned to distinct lysine residues in the following proteins: ATP/ATP translocase isoforms 1 and 2, ubiquinol cytochrome-c reductase core protein 2, and ATP synthase α-subunit. PMID:20957471

Mutations in the C-terminal region affect subcellular localization of crucian carp herpesvirus (CaHV) GPCR.

PubMed

Wang, Jun; Gui, Lang; Chen, Zong-Yan; Zhang, Qi-Ya

2016-08-01

G protein-coupled receptors (GPCRs) are known as seven transmembrane domain receptors and consequently can mediate diverse biological functions via regulation of their subcellular localization. Crucian carp herpesvirus (CaHV) was recently isolated from infected fish with acute gill hemorrhage. CaHV GPCR of 349 amino acids (aa) was identified based on amino acid identity. A series of variants with truncation/deletion/substitution mutation in the C-terminal (aa 315-349) were constructed and expressed in fathead minnow (FHM) cells. The roles of three key C-terminal regions in subcellular localization of CaHV GPCR were determined. Lysine-315 (K-315) directed the aggregation of the protein preferentially at the nuclear side. Predicted N-myristoylation site (GGGWTR, aa 335-340) was responsible for punctate distribution in periplasm or throughout the cytoplasm. Predicted phosphorylation site (SSR, aa 327-329) and GGGWTR together determined the punctate distribution in cytoplasm. Detection of organelles localization by specific markers showed that the protein retaining K-315 colocalized with the Golgi apparatus. These experiments provided first evidence that different mutations of CaHV GPCR C-terminals have different affects on the subcellular localization of fish herpesvirus-encoded GPCRs. The study provided valuable information and new insights into the precise interactions between herpesvirus and fish cells, and could also provide useful targets for antiviral agents in aquaculture.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Remarkable sequence conservation of the last intron in the PKD1 gene.

PubMed

Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P

2003-10-01

The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

Emergence of clonal hematopoiesis in the majority of patients with acquired aplastic anemia.

PubMed

Babushok, Daria V; Perdigones, Nieves; Perin, Juan C; Olson, Timothy S; Ye, Wenda; Roth, Jacquelyn J; Lind, Curt; Cattier, Carine; Li, Yimei; Hartung, Helge; Paessler, Michele E; Frank, Dale M; Xie, Hongbo M; Cross, Shanna; Cockroft, Joshua D; Podsakoff, Gregory M; Monos, Dimitrios; Biegel, Jaclyn A; Mason, Philip J; Bessler, Monica

2015-04-01

Acquired aplastic anemia (aAA) is a nonmalignant disease caused by autoimmune destruction of early hematopoietic cells. Clonal hematopoiesis is a late complication, seen in 20-25% of older patients. We hypothesized that clonal hematopoiesis in aAA is a more general phenomenon, which can arise early in disease, even in younger patients. To evaluate clonal hematopoiesis in aAA, we used comparative whole exome sequencing of paired bone marrow and skin samples in 22 patients. We found somatic mutations in 16 patients (72.7%) with a median disease duration of 1 year; of these, 12 (66.7%) were patients with pediatric-onset aAA. Fifty-eight mutations in 51 unique genes were found primarily in pathways of immunity and transcriptional regulation. Most frequently mutated was PIGA, with seven mutations. Only two mutations were in genes recurrently mutated in myelodysplastic syndrome. Two patients had oligoclonal loss of the HLA alleles, linking immune escape to clone emergence. Two patients had activating mutations in key signaling pathways (STAT5B (p.N642H) and CAMK2G (p.T306M)). Our results suggest that clonal hematopoiesis in aAA is common, with two mechanisms emerging-immune escape and increased proliferation. Our findings expand conceptual understanding of this nonneoplastic blood disorder. Future prospective studies of clonal hematopoiesis in aAA will be critical for understanding outcomes and for designing personalized treatment strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular characterization of a distinct monopartite begomovirus associated with betasatellites and alphasatellites infecting Pisum sativum in Nepal.

PubMed

Shahid, M S; Pudashini, B J; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2017-04-01

Pea (Pisum sativum) plants exhibiting leaf distortion, yellowing, stunted growth and reduction in leaf size from Rampur, Nepal were shown to be infected by a begomovirus in association with betasatellites and alphasatellites. The begomovirus associated with the disease showed only low levels of nucleotide sequence identity (<91%) to previously characterized begomoviruses. This finding indicates that the pea samples were infected with an as yet undescribed begomovirus for which the name Pea leaf distortion virus (PLDV) is proposed. Two species of betasatellite were identified in association with PLDV. One group of sequences had high (>78%) nucleotide sequence identity to isolates of Ludwigia leaf distortion betasatellite (LuLDB), and the second group had less than 78% to all other betasatellite sequences. This showed PLDV to be associated with either LuLDB or a previously undescribed betasatellite for which the name Pea leaf distortion betasatellite is proposed. Two types of alphasatellites were identified in the PLDV-infected pea plants. The first type showed high levels of sequence identity to Ageratum yellow vein alphasatellite, and the second type showed high levels of identity to isolates of Sida yellow vein China alphasatellite. These are the first begomovirus, betasatellites and alphasatellites isolated from pea.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Discovery and characterization of a new family of lytic polysaccharide monooxygenases.

PubMed

Hemsworth, Glyn R; Henrissat, Bernard; Davies, Gideon J; Walton, Paul H

2014-02-01

Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They are attracting considerable attention owing to their potential use in biomass conversion, notably in the production of biofuels. Previous studies have identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here, we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the three-dimensional structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active center featuring the 'histidine brace' active site, but is distinct in terms of its active site details and its EPR spectroscopy. The newly characterized AA11 family expands the LPMO clan, potentially broadening both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs.

Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

PubMed Central

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

Cadmium contamination in cereal-based diets and diet ingredients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siitonen, P.H.; Thompson, H.C. Jr.

1990-11-01

Cereal-based diet and/or diet ingredient cadmium levels were determined by graphite furnace AAS. Cadmium contamination was 88.3 and 447 ppb in two cereal-based diets, 44.6 and 48.9 ppb in two purified diets, and ranged from less than 1.1 to 22,900 ppb in the ingredients of one cereal-based diet. The major source of cadmium contamination was attributed to the calcium supplement used for diet formulation. Comparative analyses of two purified diet samples and one cereal-based diet by the National Institute of Standards and Technology (NIST, formerly the National Bureau of Standards) and the National Center for Toxicological Research (NCTR) gave virtuallymore » identical results for Cd. A comparative study of Cd levels determined by flame and furnace AAS was also made by the NCTR and the NIST.« less

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

Chemokine Ligand 5 (CCL5) and chemokine receptor (CCR5) genetic variants and prostate cancer risk among men of African Descent: a case-control study

PubMed Central

2012-01-01

Background Chemokine and chemokine receptors play an essential role in tumorigenesis. Although chemokine-associated single nucleotide polymorphisms (SNPs) are associated with various cancers, their impact on prostate cancer (PCA) among men of African descent is unknown. Consequently, this study evaluated 43 chemokine-associated SNPs in relation to PCA risk. We hypothesized inheritance of variant chemokine-associated alleles may lead to alterations in PCA susceptibility, presumably due to variations in antitumor immune responses. Methods Sequence variants were evaluated in germ-line DNA samples from 814 African-American and Jamaican men (279 PCA cases and 535 controls) using Illumina’s Goldengate genotyping system. Results Inheritance of CCL5 rs2107538 (AA, GA+AA) and rs3817655 (AA, AG, AG+AA) genotypes were linked with a 34-48% reduction in PCA risk. Additionally, the recessive and dominant models for CCR5 rs1799988 and CCR7 rs3136685 were associated with a 1.52-1.73 fold increase in PCA risk. Upon stratification, only CCL5 rs3817655 and CCR7 rs3136685 remained significant for the Jamaican and U.S. subgroups, respectively. Conclusions In summary, CCL5 (rs2107538, rs3817655) and CCR5 (rs1799988) sequence variants significantly modified PCA susceptibility among men of African descent, even after adjusting for age and multiple comparisons. Our findings are only suggestive and require further evaluation and validation in relation to prostate cancer risk and ultimately disease progression, biochemical/disease recurrence and mortality in larger high-risk subgroups. Such efforts will help to identify genetic markers capable of explaining disproportionately high prostate cancer incidence, mortality, and morbidity rates among men of African descent. PMID:23168091

Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

PubMed

Kim, Myeong Hee; Kang, So Young; Lee, Woo In

2017-05-01

The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

Activation of the EBV/C3d receptor (CR2, CD21) on human B lymphocyte surface triggers tyrosine phosphorylation of the 95-kDa nucleolin and its interaction with phosphatidylinositol 3 kinase.

PubMed

Barel, M; Le Romancer, M; Frade, R

2001-03-01

We previously demonstrated that CR2 activation on human B lymphocyte surface triggered tyrosine phosphorylation of a p95 component and its interaction with p85 subunit of phosphatidylinositol 3' (PI 3) kinase. Despite identical molecular mass of 95 kDa, this tyrosine phosphorylated p95 molecule was not CD19, the proto-oncogene Vav, or the adaptator Gab1. To identify this tyrosine phosphorylated p95 component, we first purified it by affinity chromatography on anti-phosphotyrosine mAb covalently linked to Sepharose 4B, followed by polyacrylamide gel electrophoresis. Then, the isolated 95-kDa tyrosine phosphorylated band was submitted to amino acid analysis by mass spectrometry; the two different isolated peptides were characterized by amino acid sequences 100% identical with two different domains of nucleolin, localized between aa 411--420 and 611--624. Anti-nucleolin mAb was used to confirm the antigenic properties of this p95 component. Functional studies demonstrated that CR2 activation induced, within a brief span of 2 min, tyrosine phosphorylation of nucleolin and its interaction with Src homology 2 domains of the p85 subunit of PI 3 kinase and of 3BP2 and Grb2, but not with Src homology 2 domains of Fyn and Gap. These properties of nucleolin were identical with those of the p95 previously described and induced by CR2 activation. Furthermore, tyrosine phosphorylation of nucleolin was also induced in normal B lymphocytes by CR2 activation but neither by CD19 nor BCR activation. These data support that tyrosine phosphorylation of nucleolin and its interaction with PI 3 kinase p85 subunit constitute one of the earlier steps in the specific intracellular signaling pathway of CR2.

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

Elevated immunoglobulin G antibodies to the proline-rich amino-terminal region of Epstein-Barr virus nuclear antigen-2 in sera from patients with systemic connective tissue diseases and from a subgroup of Sjögren's syndrome patients with pulmonary involvements.

PubMed

Yamazaki, M; Kitamura, R; Kusano, S; Eda, H; Sato, S; Okawa-Takatsuji, M; Aotsuka, S; Yanagi, K

2005-03-01

Associations of Epstein-Barr virus (EBV) and autoimmune diseases have been hypothesized. We have analysed IgG antibodies to EBV nuclear antigen (EBNA)-2 in sera from Japanese patients with autoimmune systemic connective tissue diseases (CTD), exemplified by systemic lupus erythematosus (SLE), primary Sjogren's syndrome (SS), rheumatoid arthritis (RA), systemic sclerosis (SSc) and secondary SS (classical CTDs complicated with SS). An enzyme-linked immunosorbent assay (ELISA) which uses glutathione-S-transferase polypeptides fused to EBV nuclear antigen (EBNA)-2 and EBNA-1 was developed. Ratios of IgG antibody reactivity to whole IgG concentrations of sera were calculated to normalize EBNA-2 and EBNA-1 antibody levels to the hypergammaglobulinaemia that occurs in CTD. The ELISA optical density OD(450) readings of IgG antibodies to both the amino-terminal aa 1-116 of EBNA-2 and carboxyl-terminal aa 451-641 of EBNA-1 were elevated significantly in patients with SLE, primary SS, RA, SSc and secondary SS when compared to EBNA-1. The OD readings were divided by serum IgG concentrations to normalize for the hypergammaglobulinaemia. The specific levels of IgG antibodies to the amino-terminal region of EBNA-2 were elevated in patients with SLE, primary SS or RA, as well as those with secondary SS complicated with SLE or RA. The EBNA-2 amino-terminal region contains a polyproline tract and a proline-rich sequence and has considerable amino acid sequence homology with many cellular proline-rich proteins. High ratios of EBNA-2 aa 1-116 to EBNA-1 aa 451-641 IgG antibody levels which probably suggest reactivation of EBV latent infection were associated significantly with pulmonary involvement in SS patients. These results are consistent with the hypothesis that the sequence similarity between the amino-terminal region of EBNA-2 and proline-rich cellular proteins is associated with pathogenesis in a subpopulation of CTD patients, possibly by the molecular mimicry-epitope shift mechanism.

DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

PubMed

Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

2014-04-01

The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

NASA Technical Reports Server (NTRS)

Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

1996-01-01

A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

Intravascular enhancement with identical iodine delivery rate using different iodine contrast media in a circulation phantom.

PubMed

Mihl, Casper; Wildberger, Joachim E; Jurencak, Tomas; Yanniello, Michael J; Nijssen, Estelle C; Kalafut, John F; Nalbantov, Georgi; Mühlenbruch, Georg; Behrendt, Florian F; Das, Marco

2013-11-01

Both iodine delivery rate (IDR) and iodine concentration are decisive factors for vascular enhancement in computed tomographic angiography. It is unclear, however, whether the use of high-iodine concentration contrast media is beneficial to lower iodine concentrations when IDR is kept identical. This study evaluates the effect of using different iodine concentrations on intravascular attenuation in a circulation phantom while maintaining a constant IDR. A circulation phantom with a low-pressure venous compartment and a high-pressure arterial compartment simulating physiological circulation parameters was used (heart rate, 60 beats per minute; stroke volume, 60 mL; blood pressure, 120/80 mm Hg). Maintaining a constant IDR (2.0 g/s) and a constant total iodine load (20 g), prewarmed (37°C) contrast media with differing iodine concentrations (240-400 mg/mL) were injected into the phantom using a double-headed power injector. Serial computed tomographic scans at the level of the ascending aorta (AA), the descending aorta (DA), and the left main coronary artery (LM) were obtained. Total amount of contrast volume (milliliters), iodine delivery (grams of iodine), peak flow rate (milliliter per second), and intravascular pressure (pounds per square inch) were monitored using a dedicated data acquisition program. Attenuation values in the AA, the DA, and the LM were constantly measured (Hounsfield unit [HU]). In addition, time-enhancement curves, aortic peak enhancement, and time to peak were determined. All contrast injection protocols resulted in similar attenuation values: the AA (516 [11] to 531 [37] HU), the DA (514 [17] to 531 [32] HU), and the LM (490 [10] to 507 [17] HU). No significant differences were found between the AA, the DA, and the LM for either peak enhancement (all P > 0.05) or mean time to peak (AA, 19.4 [0.58] to 20.1 [1.05] seconds; DA, 21.1 [1.0] to 21.4 [1.15] seconds; LM, 19.8 [0.58] to 20.1 [1.05] seconds). This phantom study demonstrates that constant injection parameters (IDR, overall iodine load) lead to robust enhancement patterns, regardless of the contrast material used. Higher iodine concentration itself does not lead to higher attenuation levels. These results may stimulate a shift in paradigm toward clinical usage of contrast media with lower iodine concentrations (eg, 240 mg iodine/mL) in individual tailored contrast protocols. The use of low-iodine concentration contrast media is desirable because of the lower viscosity and the resulting lower injection pressure.

Sequence conservation, HLA-E-Restricted peptide, and best-defined CTL/CD8+ epitopes in gag P24 (capsid) of HIV-1 subtype B

NASA Astrophysics Data System (ADS)

Prasetyo, Afiono Agung; Dharmawan, Ruben; Sari, Yulia; Sariyatun, Ratna

2017-02-01

Human immunodeficiency virus type 1 (HIV-1) remains a cause of global health problem. Continuous studies of HIV-1 genetic and immunological profiles are important to find strategies against the virus. This study aimed to conduct analysis of sequence conservation, HLA-E-restricted peptide, and best-defined CTL/CD8+ epitopes in p24 (capsid) of HIV-1 subtype B worldwide. The p24-coding sequences from 3,557 HIV subtype B isolates were aligned using MUSCLE and analysed. Some highly conserved regions (sequence conservation ≥95%) were observed. Two considerably long series of sequences with conservation of 100% was observed at base 349-356 and 550-557 of p24 (HXB2 numbering). The consensus from all aligned isolates was precisely the same as consensus B in the Los Alamos HIV Database. The HLA-E-restricted peptide in amino acid (aa) 14-22 of HIV-1 p24 (AISPRTLNA) was found in 55.9% (1,987/3,557) of HIV-1 subtype B worldwide. Forty-four best-defined CTL/CD8+ epitopes were observed, in which VKNWMTETL epitope (aa 181-189 of p24) restricted by B*4801 was the most frequent, as found in 94.9% of isolates. The results of this study would contribute information about HIV-1 subtype B and benefits for further works willing to develop diagnostic and therapeutic strategies against the virus.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

β-Cell lipotoxicity after an overnight intravenous lipid challenge and free fatty acid elevation in African American versus American white overweight/obese adolescents.

PubMed

Hughan, Kara S; Bonadonna, Riccardo C; Lee, SoJung; Michaliszyn, Sara F; Arslanian, Silva A

2013-05-01

Overweight/obese (OW/OB) African American (AA) adolescents have a more diabetogenic insulin secretion/sensitivity pattern compared with their American white (AW) peers. The present study investigated β-cell lipotoxicity to test whether increased free fatty acid (FFA) levels result in greater β-cell dysfunction in AA vs AW OW/OB adolescents. Glucose-stimulated insulin secretion was modeled, from glucose and C-peptide concentrations during a 2-hour hyperglycemic (225 mg/dL) clamp in 22 AA and 24 AW OW/OB adolescents, on 2 occasions after a 12-hour overnight infusion of either normal saline or intralipid (IL) in a random sequence. β-Cell function relative to insulin sensitivity, the disposition index (DI), was examined during normal saline and IL conditions. Substrate oxidation was evaluated with indirect calorimetry and body composition and abdominal adiposity with dual-energy X-ray absorptiometry and magnetic resonance imaging at L4-L5, respectively. Age, sex, body mass index, total and sc adiposity were similar between racial groups, but visceral adiposity was significantly lower in AAs. During IL infusion, FFAs and fat oxidation increased and insulin sensitivity decreased similarly in AAs and AWs. β-Cell glucose sensitivity of first- and second-phase insulin secretion did not change significantly during IL infusion in either group, but DI in each phase decreased significantly and similarly in AAs and AWs. Overweight/obese AA and AW adolescents respond to an overnight fat infusion with significant declines in insulin sensitivity, DI, and β-cell function relative to insulin sensitivity, suggestive of β-cell lipotoxicity. However, contrary to our hypothesis, there does not seem to be a race differential in β-cell lipotoxicity. Longer durations of FFA elevation may unravel such race-related contrasts.

Blunt Snout Bream (Megalobrama amblycephala) MyD88 and TRAF6: Characterisation, Comparative Homology Modelling and Expression

PubMed Central

Tran, Ngoc Tuan; Liu, Han; Jakovlić, Ivan; Wang, Wei-Min

2015-01-01

MyD88 and TRAF6 play an essential role in the innate immune response in most animals. This study reports the full-length MaMyD88 and MaTRAF6 genes identified from the blunt snout bream (Megalobrama amblycephala) transcriptome profile. MaMyD88 is 2501 base pairs (bp) long, encoding a putative protein of 284 amino acids (aa), including the N-terminal DEATH domain of 78 aa and the C-terminal TIR domain of 138 aa. MaTRAF6 is 2252 bp long, encoding a putative protein of 542 aa, including the N-terminal low-complexity region, RING domain (40 aa), a coiled-coil region (64 aa) and C-terminal MATH domain (147 aa). Coding regions of MaMyD88 and MaTRAF6 genomic sequences consisted of five and six exons, respectively. Physicochemical and functional characteristics of the proteins were analysed. Alpha helices were dominant in the secondary structure of the proteins. Homology models of the MaMyD88 and MaTRAF6 domains were constructed applying the comparative modelling method. RT-qPCR was used to analyse the expression of MaMyD88 and MaTRAF6 mRNA transcripts in response to Aeromonas hydrophila challenge. Both genes were highly upregulated in the liver, spleen and kidney during the first 24 h after the challenge. While MyD88 and TRAF6 have been reported in various aquatic species, this is the first report and characterisation of these genes in blunt snout bream. This research also provides evidence of the important roles of these two genes in the blunt snout bream innate immune system. PMID:25830478

Detection and genetic characterization of bovine kobuvirus from calves in Egypt.

PubMed

Mohamed, Fakry F; Mansour, Shimaa M G; Orabi, Ahmed; El-Araby, Iman E; Ng, Terry Fei Fan; Mor, Sunil K; Goyal, Sagar M

2018-06-01

Kobuviruses are small non-enveloped RNA viruses that probably cause diarrhea in cattle and swine. Since its discovery in 2003, few studies have addressed bovine kobuvirus (BKoV; a species of Aichivirus B) infections. BKoV has been reported in Europe, Asia, and South America, suggesting a worldwide distribution. To investigate the presence of BKoV in Egypt, 36 fecal specimens from diarrheic calves in two different Egyptian provinces (Cairo and Sharkia) were screened by RT-PCR and 24 (66.7%) were found positive for BKoV. RNA from one of the positive samples (BKoV/Egy-1/KY407744) was subjected to next-generation sequencing to determine the complete BKoV genome sequence. When compared to the only recorded BKoV genome sequence (BKoV/U-1/AB084788), the studied strain showed 94 amino acid (aa) substitutions through its entire polyprotein (2463 aa), one nucleotide (nt) insertion and one nt deletion in the 2B gene and 4-nt deletions in the UTRs (2 each). Additionally, five VP1 and seven 3D sequences were obtained from other samples by using RT-PCR and Sanger sequencing. A discrepancy in the phylogenetic topography of VP1 and 3D was observed, where the Egyptian VP1 sequences were classified as a distinct cluster within the proposed lineage 1 (genotype A), which also contained strains from the UK, Brazil, and Japan. While, the 3D sequences from Cairo were related to those of Chinese strains unlike Sharkia ones that were more closer to Korean  strains. To the best of our knowledge, this is the first detection and genomic characterization of BKoV in Egypt or indeed Africa.

The alpha-fetoprotein (AFP) third domain: a search for AFP interaction sites of cell cycle proteins.

PubMed

Mizejewski, G J

2016-09-01

The carboxy-terminal third domain of alpha-fetoprotein (AFP-3D) is known to harbor binding and/or interaction sites for hydrophobic ligands, receptors, and binding proteins. Such reports have established that AFP-3D consists of amino acid (AA) sequence stretches on the AFP polypeptide that engages in protein-to-protein interactions with various ligands and receptors. Using a computer software program specifically designed for such interactions, the present report identified AA sequence fragments on AFP-3D that could potentially interact with a variety of cell cycle proteins. The cell cycle proteins identified were (1) cyclins, (2) cyclin-dependent kinases, (3) cell cycle-associated proteins (inhibitors, checkpoints, initiators), and (4) ubiquitin ligases. Following detection of the AFP-3D to cell cycle protein interaction sites, the computer-derived AFP localization AA sequences were compared and aligned with previously reported hydrophobic ligand and receptor interaction sites on AFP-3D. A literature survey of the association of cell cycle proteins with AFP showed both positive relationships and correlations. Previous reports of experimental AFP-derived peptides effects on various cell cycle proteins served to confirm and verify the present computer cell cycle protein identifications. Cell cycle protein interactions with AFP-CD peptides have been reported in cultured MCF-7 breast cancer cells subjected to mRNA microarray analysis. After 7 days in culture with MCF-7 cells, the AFP-derived peptides were shown to downregulate cyclin E, SKP2, checkpoint suppressors, cyclin-dependent kinases, and ubiquitin ligases that modulate cyclin E/CdK2 transition from the G1 to the S-phase of the cell cycle. Thus, the experimental data on AFP-CD interaction with cell cycle proteins were consistent with the "in silico" findings.

High-sensitive electrochemical detection of point mutation based on polymerization-induced enzymatic amplification.

PubMed

Feng, Kejun; Zhao, Jingjin; Wu, Zai-Sheng; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2011-03-15

Here a highly sensitive electrochemical method is described for the detection of point mutation in DNA. Polymerization extension reaction is applied to specifically initiate enzymatic electrochemical amplification to improve the sensitivity and enhance the performance of point mutation detection. In this work, 5'-thiolated DNA probe sequences complementary to the wild target DNA are assembled on the gold electrode. In the presence of wild target DNA, the probe is extended by DNA polymerase over the free segment of target as the template. After washing with NaOH solution, the target DNA is removed while the elongated probe sequence remains on the sensing surface. Via hybridizing to the designed biotin-labeled detection probe, the extended sequence is capable of capturing detection probe. After introducing streptavidin-conjugated alkaline phosphatase (SA-ALP), the specific binding between streptavidin and biotin mediates a catalytic reaction of ascorbic acid 2-phosphate (AA-P) substrate to produce a reducing agent ascorbic acid (AA). Then the silver ions in solution are reduced by AA, leading to the deposition of silver metal onto the electrode surface. The amount of deposited silver which is determined by the amount of wild target can be quantified by the linear sweep voltammetry (LSV). The present approach proved to be capable of detecting the wild target DNA down to a detection limit of 1.0×10(-14) M in a wide target concentration range and identifying -28 site (A to G) of the β-thalassemia gene, demonstrating that this scheme offers a highly sensitive and specific approach for point mutation detection. Copyright © 2010 Elsevier B.V. All rights reserved.

Voltage-Gated Na+ Channel Isoforms and Their mRNA Expression Levels and Protein Abundance in Three Electric Organs and the Skeletal Muscle of the Electric Eel Electrophorus electricus

PubMed Central

Hiong, Kum C.; Boo, Mel V.; Wong, Wai P.; Chew, Shit F.

2016-01-01

This study aimed to obtain the coding cDNA sequences of voltage-gated Na+ channel (scn) α-subunit (scna) and β-subunit (scnb) isoforms from, and to quantify their transcript levels in, the main electric organ (EO), Hunter’s EO, Sach’s EO and the skeletal muscle (SM) of the electric eel, Electrophorus electricus, which can generate both high and low voltage electric organ discharges (EODs). The full coding sequences of two scna (scn4aa and scn4ab) and three scnb (scn1b, scn2b and scn4b) were identified for the first time (except scn4aa) in E. electricus. In adult fish, the scn4aa transcript level was the highest in the main EO and the lowest in the Sach’s EO, indicating that it might play an important role in generating high voltage EODs. For scn4ab/Scn4ab, the transcript and protein levels were unexpectedly high in the EOs, with expression levels in the main EO and the Hunter’s EO comparable to those of scn4aa. As the key domains affecting the properties of the channel were mostly conserved between Scn4aa and Scn4ab, Scn4ab might play a role in electrogenesis. Concerning scnb, the transcript level of scn4b was much higher than those of scn1b and scn2b in the EOs and the SM. While the transcript level of scn4b was the highest in the main EO, protein abundance of Scn4b was the highest in the SM. Taken together, it is unlikely that Scna could function independently to generate EODs in the EOs as previously suggested. It is probable that different combinations of Scn4aa/Scn4ab and various Scnb isoforms in the three EOs account for the differences in EODs produced in E. electricus. In general, the transcript levels of various scn isoforms in the EOs and the SM were much higher in adult than in juvenile, and the three EOs of the juvenile fish could be functionally indistinct. PMID:27907137

Hawaiian lava flows in the third dimension: Identification and interpretation of pahoehoe and 'a'a distribution in the KP-1 and SOH-4 cores

NASA Astrophysics Data System (ADS)

Katz, Melissa G.; Cashman, Katharine V.

2003-02-01

Hawaiian lava flows are classified as pahoehoe or 'a'a by their surface morphology. As surface morphology reflects flow emplacement conditions, the surface distribution of morphologic flow types has been used to study the evolution and eruptive history of basaltic volcanoes. We extend this analysis to the third dimension by determining the distribution of flow types in two deep drill cores, the Scientific Observation Hole-4 (SOH-4) core, drilled near Kilauea's East Rift Zone (ERZ), and the pilot hole (Kahi Puka-1 (KP-1)) for the Hawaiian Scientific Drilling Project (HSDP), drilled through distal flows from Mauna Loa and Mauna Kea. Flows are classified using both internal structures and groundmass textures, with the latter useful when identification based on mesoscopic flow features (e.g., surface morphology and vesicle content and distribution) is ambiguous. We then examine the temporal distribution of pahoehoe and 'a'a flows in proximal (SOH-4) and distal (KP-1) settings. Sequence analysis shows that the two flow types are not randomly distributed in either core but instead are strongly clustered. The proximal SOH-4 core is dominated by thin pahoehoe flows (˜60% by volume), consistent with the common occurrence of surface-fed pahoehoe flows in near-vent settings. The distal KP-1 core has a high proportion of 'a'a (˜58% by volume), although the proportion of pahoehoe and 'a'a varies dramatically throughout the Mauna Kea sequence. Thick inflated pahoehoe flows dominate when the drill site was near sea level, consistent with the numerous inflated pahoehoe fields on the current coastal plains of Kilauea and Mauna Loa. 'A'a flows are abundant when the site was far above sea level. As slope increases from the coastal plains to Mauna Kea's flank, this correlation may reflect the combined effect of long transport distances and increased slopes on flow emplacement. These results demonstrate that flow type and thickness variations in cores provide valuable information about both vent location and local site environment. Observed variations in flow type within the KP-1 core raise interesting questions about feedback between volcano evolution and flow morphology and suggest that flow type is an important variable in models of volcano growth and related models for lava flow hazard assessment.

Implication of the cause of differences in 3D structures of proteins with high sequence identity based on analyses of amino acid sequences and 3D structures.

PubMed

Matsuoka, Masanari; Sugita, Masatake; Kikuchi, Takeshi

2014-09-18

Proteins that share a high sequence homology while exhibiting drastically different 3D structures are investigated in this study. Recently, artificial proteins related to the sequences of the GA and IgG binding GB domains of human serum albumin have been designed. These artificial proteins, referred to as GA and GB, share 98% amino acid sequence identity but exhibit different 3D structures, namely, a 3α bundle versus a 4β + α structure. Discriminating between their 3D structures based on their amino acid sequences is a very difficult problem. In the present work, in addition to using bioinformatics techniques, an analysis based on inter-residue average distance statistics is used to address this problem. It was hard to distinguish which structure a given sequence would take only with the results of ordinary analyses like BLAST and conservation analyses. However, in addition to these analyses, with the analysis based on the inter-residue average distance statistics and our sequence tendency analysis, we could infer which part would play an important role in its structural formation. The results suggest possible determinants of the different 3D structures for sequences with high sequence identity. The possibility of discriminating between the 3D structures based on the given sequences is also discussed.

Electronic coupling through natural amino acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berstis, Laura; Beckham, Gregg T., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov; Crowley, Michael F., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov

2015-12-14

Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For bothmore » motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green’s function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.« less

Common and rare von Willebrand factor (VWF) coding variants, VWF levels, and factor VIII levels in African Americans: the NHLBI Exome Sequencing Project.

PubMed

Johnsen, Jill M; Auer, Paul L; Morrison, Alanna C; Jiao, Shuo; Wei, Peng; Haessler, Jeffrey; Fox, Keolu; McGee, Sean R; Smith, Joshua D; Carlson, Christopher S; Smith, Nicholas; Boerwinkle, Eric; Kooperberg, Charles; Nickerson, Deborah A; Rich, Stephen S; Green, David; Peters, Ulrike; Cushman, Mary; Reiner, Alex P

2013-07-25

Several rare European von Willebrand disease missense variants of VWF (including p.Arg2185Gln and p.His817Gln) were recently reported to be common in apparently healthy African Americans (AAs). Using data from the NHLBI Exome Sequencing Project, we assessed the association of these and other VWF coding variants with von Willebrand factor (VWF) and factor VIII (FVIII) levels in 4468 AAs. Of 30 nonsynonymous VWF variants, 6 were significantly and independently associated (P < .001) with levels of VWF and/or FVIII. Each additional copy of the common VWF variants encoding p.Thr789Ala or p.Asp1472His was associated with 6 to 8 IU/dL higher VWF levels. The VWF variant encoding p.Arg2185Gln was associated with 7 to 13 IU/dL lower VWF and FVIII levels. The type 2N-related VWF variant encoding p.His817Gln was associated with 17 IU/dL lower FVIII level but normal VWF level. A novel, rare missense VWF variant that predicts disruption of an O-glycosylation site (p.Ser1486Leu) and a rare variant encoding p.Arg2287Trp were each associated with 30 to 40 IU/dL lower VWF level (P < .001). In summary, several common and rare VWF missense variants contribute to phenotypic differences in VWF and FVIII among AAs.

Molecular identification of a new begomovirus infecting yellow passion fruit (Passiflora edulis) in Colombia.

PubMed

Vaca-Vaca, Juan Carlos; Carrasco-Lozano, Emerson Clovis; López-López, Karina

2017-02-01

The complete genome sequence of a bipartite begomovirus (genus Begomovirus, family Geminiviridae) infecting yellow passion fruit (Passiflora edulis) in the state of Valle del Cauca (Colombia) has been determined. The complete DNA-A and DNA-B components were determined to be 2600 and 2572 nt in length, respectively. The DNA-A showed the highest nucleotide sequence identity (87.2 %) to bean dwarf mosaic virus (M88179), a begomovirus found in common bean crops in Colombia, and only 77.4 % identity to passion fruit severe leaf distortion virus (FJ972767), a begomovirus identified infecting passion fruit in Brazil. Based on its sequence identity to all other begomoviruses known to date and in accordance with the ICTV species demarcation criterion for the genus Begomovirus (≥91 % sequence identity for the complete DNA-A), the name passion fruit leaf distortion virus is proposed for this new begomovirus. To our knowledge, this is the first report of a bipartite begomovirus affecting passion fruit in Colombia and the second report of a geminivirus affecting this crop worldwide.

Sequence identity and antigenic cross-reactivity of white face hornet venom allergen, also a hyaluronidase, with other proteins.

PubMed

Lu, G; Kochoumian, L; King, T P

1995-03-03

White face hornet (Dolichovespula maculata) venom has three known protein allergens which induce IgE response in susceptible people. They are antigen 5, phospholipase A1, and hyaluronidase, also known as Dol m 5, 1, and 2, respectively. We have cloned Dol m 2, a protein of 331 residues. When expressed in bacteria, a mixture of recombinant Dol m 2 and its fragments was obtained. The fragments were apparently generated by proteolysis of a Met-Met bond at residue 122, as they were not observed for a Dol m 2 mutant with a Leu-Met bond. Dol m 2 has 56% sequence identity with the honey bee venom allergen hyaluronidase and 27% identity with PH-20, a human sperm protein with hyaluronidase activity. A common feature of hornet venom allergens is their sequence identity with other proteins in our environment. We showed previously the sequence identity of Dol m 5 with a plant protein and a mammalian testis protein and of Dol m 1 with mammalian lipases. In BALB/c mice, Dol m 2 and bee hyaluronidase showed cross-reactivity at both antibody and T cell levels. These findings are relevant to some patients' multiple sensitivity to hornet and bee stings.

Optimization of identity operation in NMR spectroscopy via genetic algorithm: Application to the TEDOR experiment

NASA Astrophysics Data System (ADS)

Manu, V. S.; Veglia, Gianluigi

2016-12-01

Identity operation in the form of π pulses is widely used in NMR spectroscopy. For an isolated single spin system, a sequence of even number of π pulses performs an identity operation, leaving the spin state essentially unaltered. For multi-spin systems, trains of π pulses with appropriate phases and time delays modulate the spin Hamiltonian to perform operations such as decoupling and recoupling. However, experimental imperfections often jeopardize the outcome, leading to severe losses in sensitivity. Here, we demonstrate that a newly designed Genetic Algorithm (GA) is able to optimize a train of π pulses, resulting in a robust identity operation. As proof-of-concept, we optimized the recoupling sequence in the transferred-echo double-resonance (TEDOR) pulse sequence, a key experiment in biological magic angle spinning (MAS) solid-state NMR for measuring multiple carbon-nitrogen distances. The GA modified TEDOR (GMO-TEDOR) experiment with improved recoupling efficiency results in a net gain of sensitivity up to 28% as tested on a uniformly 13C, 15N labeled microcrystalline ubiquitin sample. The robust identity operation achieved via GA paves the way for the optimization of several other pulse sequences used for both solid- and liquid-state NMR used for decoupling, recoupling, and relaxation experiments.

Recovery of Hafnia alvei from diseased brown trout, Salmo trutta L., and healthy noble crayfish, Astacus astacus (L.), in Bulgaria.

PubMed

Orozova, P; Sirakov, I; Chikova, V; Popova, R; Al-Harbi, A H; Crumlish, M; Austin, B

2014-10-01

Hafnia alvei was isolated in Bulgaria from healthy noble crayfish, Astacus astacus (L.), and then from farmed diseased brown trout, Salmo trutta L., with signs of haemorrhagic septicaemia. The isolates were identified initially with conventional phenotyping and commercial Merlin Micronaut and API 20E rapid identification systems, followed by sequencing of the 16S rRNA gene. Hafnia alvei Bt1, Bt2 and Aa4 were of low virulence to rainbow trout and brown trout, although cytotoxicity was demonstrated by Bt1 and Bt2, but not by Aa4. © 2014 John Wiley & Sons Ltd.

Current siRNA Targets in Atherosclerosis and Aortic Aneurysm

PubMed Central

Pradhan-Nabzdyk, Leena; Huang, Chenyu; Logerfo, Frank W.; Nabzdyk, Christoph S.

2014-01-01

Atherosclerosis (ATH) and aortic aneurysms (AA) remain challenging chronic diseases that confer high morbidity and mortality despite advances in medical, interventional, and surgical care. RNA interference represents a promising technology that may be utilized to silence genes contributing to ATH and AA. Despite positive results in preclinical and some clinical feasibility studies, challenges such as target/sequence validation, tissue specificity, transfection efficiency, and mitigation of unwanted off-target effects remain to be addressed. In this review the most current targets and some novel approaches in siRNA delivery are being discussed. Due to the plethora of investigated targets, only studies published between 2010 and 2014 were included. PMID:24882715

Polymorphism of follicle stimulating hormone beta (FSHβ) subunit gene and its association with litter traits in giant panda.

PubMed

Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming

2013-11-01

The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiriyama, Takao; Hirano, Makito; Asai, Hirohide

Triple A syndrome is an autosomal recessive neurological disease, mimicking motor neuron disease, and is caused by mutant ALADIN, a nuclear-pore complex component. We recently discovered that the pathogenesis involved impaired nuclear import of DNA repair proteins, including DNA ligase I and the cerebellar ataxia causative protein aprataxin. Such impairment was overcome by fusing classical nuclear localization signal (NLS) and 137-aa downstream sequence of XRCC1, designated stretched NLS (stNLS). We report here that the minimum essential sequence of stNLS (mstNLS) is residues 239-276, downsized by more than 100 aa. mstNLS enabled efficient nuclear import of DNA repair proteins in patientmore » fibroblasts, functioned under oxidative stress, and reduced oxidative-stress-induced cell death, more effectively than stNLS. The stress-tolerability of mstNLS was also exerted in control fibroblasts and neuroblastoma cells. These findings may help develop treatments for currently intractable triple A syndrome and other oxidative-stress-related neurological diseases, and contribute to nuclear compartmentalization study.« less

Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2016-02-16

The invention relates to a polypeptide which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well asmore » the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.« less

Polypeptide having swollenin activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elizabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica D; Damveld, Robbertus Antonius

2015-11-04

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel; Damveld, Robbertus Antonius

2015-09-01

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having cellobiohydrolase activity and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-09-15

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having acetyl xylan esterase activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having carbohydrate degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica Diana; Damveld, Robbertus Antonius

2015-08-18

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Influence of autoantibodies against AT1 receptor and AGTR1 polymorphisms on candesartan-based antihypertensive regimen: results from the study of optimal treatment in hypertensive patients with anti-AT1-receptor autoantibodies trial.

PubMed

Sun, Yanxiang; Liao, Yuhua; Yuan, Yong; Feng, Li; Ma, Shihui; Wei, Feng; Wang, Min; Zhu, Feng

2014-01-01

The autoantibodies against angiotensin AT1 receptors (AT1-AAs) in patients with essential hypertension exhibited an agonistic action like angiotensin II and maintained high blood pressure (BP). Angiotensin II receptor gene (AGTR1) polymorphisms were associated with BP response to RAS inhibition in the hypertensive population. Furthermore, the BP response to AT1 receptor blockers varied significantly among individuals with hypertension. We hypothesized that the polymorphisms of the AGTR1 and AT1-AAs might affect antihypertensive response to AT1 receptor blockers based in patients with primary hypertension. Patients who received a candesartan-based regimen came from the SOT-AT1 study (Study of Optimal Treatment in Hypertensive Patients with Anti-AT1-Receptor Autoantibodies). The established enzyme-labeled immunosorbent assay was used to detect AT1-AAs in the sera of the patients. Genotype 3 single nucleotide polymorphisms in AGTR1 gene was used by DNA sequencing. The correlations among AT1-AAs, AGTR1 gene polymorphisms or haplotypes, and the antihypertensive effect candesartan-based were analyzed using SPSS. The percentage of systolic BP reduction that was candesartan-based was greater in AT1-AA positive groups than in AT1-AA negative ones (21 ± 8 vs. 18 ± 9; P = .001). Meanwhile, systolic BP reduction that was candesartan-based was more significant in the group of rs5186 AC genotypes than AA homozygotes after adjusting for other confounding factors (37.55 ± 13.7 vs. 32.47 ± 17.27 mm Hg; adjusted P = .028). Furthermore, haplotypes (GCC) and (AAC) had impacts on the antihypertensive effect of candesartan therapy. The AT1-AAs, AGTR1 gene polymorphisms and haplotypes solely or jointly have influences on candesartan-based antihypertensive response in patients with primary hypertension. Copyright © 2014 American Society of Hypertension. Published by Elsevier Inc. All rights reserved.

Molecular characterization of subgenotype A1 (subgroup Aa) of hepatitis B virus.

PubMed

Kramvis, Anna; Kew, Michael C

2007-07-01

Subgenotypes of hepatitis B virus (HBV) were first recognized after a unique segment of genotype A was identified when sequencing the preS2/S region of southern African HBV isolates. Originally named subgroup A', subsequently called subgroup Aa (for Africa) or subgenotype A1, this subgenotype is found in South Africa, Malawi, Uganda, Tanzania, Somalia, Yemen, India, Nepal, the Philippines and Brazil. The relatively higher mean nucleotide divergence of subgenotype A1 suggests that it has been endemic and has a long evolutionary history in the populations where it prevails. Distinctive sequence characteristics could account for the high hepatitis B e-antigen (HBeAg) negativity and low HBV DNA levels in carriers of this subgenotype. Substitutions or mutations can reduce HBeAg expression at three levels: (i) 1762T1764A atthe transcriptional level; (ii) substitutions at nt 1809-1812 at the translational level; and (iii) 1862T at the post-translational level. Co-existence of 1762T1764A and nt 1809-1812 mutations reduces HBeAg expression in an additive manner. In addition, subgenotype A1 has unique sequence alterations in the transcriptional regulatory elements and the polymerase coding region. The distinct sequence characteristics of subgenotype A1 may contribute to the 4.5-fold increased risk of heptocellular carcinoma in HBV carriers infected with genotype A, which is entirely attributable to subgenotype A1.

Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

PubMed

Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

2013-06-01

Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

On the Role of Aggregation Prone Regions in Protein Evolution, Stability, and Enzymatic Catalysis: Insights from Diverse Analyses

PubMed Central

Buck, Patrick M.; Kumar, Sandeep; Singh, Satish K.

2013-01-01

The various roles that aggregation prone regions (APRs) are capable of playing in proteins are investigated here via comprehensive analyses of multiple non-redundant datasets containing randomly generated amino acid sequences, monomeric proteins, intrinsically disordered proteins (IDPs) and catalytic residues. Results from this study indicate that the aggregation propensities of monomeric protein sequences have been minimized compared to random sequences with uniform and natural amino acid compositions, as observed by a lower average aggregation propensity and fewer APRs that are shorter in length and more often punctuated by gate-keeper residues. However, evidence for evolutionary selective pressure to disrupt these sequence regions among homologous proteins is inconsistent. APRs are less conserved than average sequence identity among closely related homologues (≥80% sequence identity with a parent) but APRs are more conserved than average sequence identity among homologues that have at least 50% sequence identity with a parent. Structural analyses of APRs indicate that APRs are three times more likely to contain ordered versus disordered residues and that APRs frequently contribute more towards stabilizing proteins than equal length segments from the same protein. Catalytic residues and APRs were also found to be in structural contact significantly more often than expected by random chance. Our findings suggest that proteins have evolved by optimizing their risk of aggregation for cellular environments by both minimizing aggregation prone regions and by conserving those that are important for folding and function. In many cases, these sequence optimizations are insufficient to develop recombinant proteins into commercial products. Rational design strategies aimed at improving protein solubility for biotechnological purposes should carefully evaluate the contributions made by candidate APRs, targeted for disruption, towards protein structure and activity. PMID:24146608

Sequence Similarity Presenter: a tool for the graphic display of similarities of long sequences for use in presentations.

PubMed

Fröhlich, K U

1994-04-01

A new method for the presentation of alignments of long sequences is described. The degree of identity for the aligned sequences is averaged for sections of a fixed number of residues. The resulting values are converted to shades of gray, with white corresponding to lack of identity and black corresponding to perfect identity. A sequence alignment is represented as a bar filled with varying shades of gray. The display is compact and allows for a fast and intuitive recognition of the distribution of regions with a high similarity. It is well suited for the presentation of alignments of long sequences, e.g. of protein superfamilies, in plenary lectures. The method is implemented as a HyperCard stack for Apple Macintosh computers. Several options for the modification of the output are available (e.g. background reduction, size of the summation window, consideration of amino acid similarity, inclusion of graphic markers to indicate specific domains). The output is a PostScript file which can be printed, imported as EPS or processed further with Adobe Illustrator.

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

Isolation of prolactin and growth hormone from the pituitary of the holostean fish Amia calva.

PubMed

Dores, R M; Noso, T; Rand-Weaver, M; Kawauchi, H

1993-06-01

Pituitaries from adult male and female Amia calva (Order Holostei) were acid extracted and fractionated by gel filtration column chromatography and reversed-phase high performance liquid chromatography. This two-step isolation procedure yielded homogeneous pools of Amia prolaction (PRL) and growth hormone (GH). The amino acid composition of both purified polypeptides was determined. Primary sequence analysis of the first 22 positions at the N-terminal of Amia PRL revealed that this region has 63% sequence identity with eel PRL-1. The N-terminal region of Amia PRL lacks the disulfide bridge which is characteristic of tetrapod PRLs. Primary sequence analysis of the first 24 positions at the N-terminal of Amia GH revealed that this region has 62% sequence identity with eel GH and 54% sequence identity with both blue shark GH and sea turtle GH. Based on N-terminal analysis, it appears that Amia PRL and GH are more closely related to teleost PRLs and GHs than they are to tetrapod PRLs and GHs.

Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

PubMed

Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

2013-12-01

The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

Dynamics and viscosity of `a'a and pahoehoe lava flows of the 2012-2013 eruption of Tolbachik volcano, Kamchatka (Russia)

NASA Astrophysics Data System (ADS)

Belousov, Alexander; Belousova, Marina

2018-01-01

The 2012-2013 flank eruption of Tolbachik volcano (Kamchatka) lasted 9 months and produced 0.54 km3 of basaltic trachyandesite lava, thus becoming one of the most voluminous historical lava effusions of basic composition in subduction-related environments globally. From March to July 2013, the volcano monotonously erupted lava of constant composition (SiO2 = 52 wt%) with a nearly stable effusion rate of 18 m3/s. Despite the uniform eruptive and emplacement conditions, the dominant style of lava propagation throughout that time gradually changed from `a'a to pahoehoe. We report results of instrumental field measurements of the `a'a and pahoehoe flow dynamics (documented with time-lapse cameras) as well as the lava viscosity determined by flow rate and shear stress (using penetrometer) methods. Maximal propagation velocities of the `a'a fronts ranged from 2 to 25 mm/s, and those of the pahoehoe from 0.5 to 6 mm/s. The flow front velocities of both lava types experienced short-period fluctuations that were caused by complex flow mechanics of the advancing flow lobes. Minimal viscosities of lava of the `a'a lobes ranged from 1.3 × 105 to 3.3 × 107 Pa s (flow rate method), and those of the pahoehoe from to 5 × 103 to 5 × 104 Pa s (shear stress method). Our data include the first ever measured profiles of viscosity through the entire thickness of actively advancing pahoehoe lava lobes. We have found that both the `a'a and pahoehoe flows were fed by identical parental lava, which then developed contrasting rheological properties, owing to differences in the process of lava transport over the ground surface. The observed transition from the dominant `a'a to the dominant pahoehoe propagation styles occurred due to gradual elongation and branching of the lava tube system throughout the course of the eruption. Such evolution became possible because the growing lava field, composed of semisolidified flows, provided an environment for shallow subsurface intrusions and internal migrations of lava that, with time, developed into branches of the lava tube system. Based on our data, we propose phenomenological models of the `a'a and pahoehoe flow mechanics.

ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams and Rogers, 1984 (Acanthocephala: Palaeacanthocephala).

PubMed

Král'ová-Hromadová, Iva; Tietz, David F; Shinn, Andrew P; Spakulová, Marta

2003-10-01

The internal transcribed spacers (ITS-1 and ITS-2) of the ribosomal RNA gene of Pomphorhynchus laevis (Zoega in Müller, 1776) (Acanthocephala) isolated from various fish species across Central and Southern Europe were compared with those of P. lucyi Williams and Rogers, 1984 collected from the largemouth bass Micropterus salmonoides Boulenger from the USA. The nucleotide sequences of ITS regions of P. laevis from minnows Phoxinus phoxinus (L.) and chub Leuciscus cephalus (L.) from two distant localities in the Slovak Republic were found to be 100% identical. The ITS-1 and ITS-2 of P. laevis from chub from the Czech Republic and Italy were also mutually identical, but significantly different from Slovak worms (88.7% identity for ITS-1, 91.3% identity for ITS-2). A fifth sample collected from Barbus tyberinus Bonaparte from Italy was very similar to the sympatric Italian isolate from chub, possessing four nucleotide substitutions in ITS-1 (98.4% identity). The ITS rDNA sequences of P. lucyi differed significantly from those of P. laevis; the values of identity were 51.8-56.1% for ITS-1 and 63.1-65.3% for ITS-2, and were significantly higher than the range of P. laevis within-species variability. The results based on the ITS sequences confirmed the occurrence of strains in P. laevis from Continental Europe which are well defined by molecules but reveal only slight differences in their morphology.

Characterization of biocarbon-source recovery and microbial community shifts from waste activated sludge by conditioning with cornstover: Assessment of cellulosic compositions

NASA Astrophysics Data System (ADS)

Wen, Kaili; Zhou, Aijuan; Zhang, Jiaguang; Liu, Zhihong; Wang, Guoying; Liu, Wenzong; Wang, Aijie; Yue, Xiuping

2017-02-01

Most studies on the production of volatile fatty acids (VFAs) from waste activated sludge (WAS) digestion have focused on operating conditions, pretreatments and characteristic adjustments. Conditioning by extra carbon sources (ECS), normally added in a solid form, has been reported to be an efficient approach. However, this has caused considerable waste of monomeric sugars in the hydrolysate. In this study, the effects of two added forms (pretreated straw (S) and hydrolyzed liquid (L)) of cornstover (CS) on WAS acidification were investigated. To obtain different cellulosic compositions of CS, low-thermal or autoclaved assisted alkaline (TA or AA) pretreatments were conducted. The results showed that AA-L test achieved the highest VFAs value (653 mg COD/g VSS), followed by AA-S (613 mg COD/g VSS). These values were 12% and 28% higher, respectively, than that obtained in the TA-L and TA-S tests. Meanwhile, higher percentages of acetic acid were observed after AA pretreatment (~62% versus ~53% in TA). The added forms of CS played an important role in structuring the innate microbial community in the WAS, as shown by high-throughput sequencing and canonical correspondence analysis. The findings obtained in this work may provide a scientific basis for the potential implementation of co-digesting WAS with ECS simultaneously obtaining energy and high value-added products.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

First description of Grapevine leafroll-associated virus 5 in Argentina and partial genome sequence.

PubMed

Gómez Talquenca, Sebastián; Muñoz, Claudio; Grau, Oscar; Gracia, Olga

2009-02-01

An accession of Vitis vinifera cv. Red Globe from Argentina, was found to be infected with Grapevine leafroll-associated virus-5 by ELISA. It was partially sequenced, and three ORFs, corresponding to HSP70h, HSP90h, and CP, were found. This isolate shares a high aminoacid identity with the previously reported sequence of the virus, and identities between 80% and 90% with previously reported GLRaV-9 and GLRaV-4 isolates. The analysis of the sequence supports the clustering together with GLRaV-4 and GLRV-9 inside the Ampelovirus genus.

Structures of two Arabidopsis thaliana major latex proteins represent novel helix-grip folds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lytle, Betsy L.; Song, Jikui; de la Cruz, Norberto B.

2009-06-02

Here we report the first structures of two major latex proteins (MLPs) which display unique structural differences from the canonical Bet v 1 fold described earlier. MLP28 (SwissProt/TrEMBL ID Q9SSK9), the product of gene At1g70830.1, and the At1g24000.1 gene product (Swiss- Prot/TrEMBL ID P0C0B0), proteins which share 32% sequence identity, were independently selected as foldspace targets by the Center for Eukaryotic Structural Genomics. The structure of a single domain (residues 17-173) of MLP28 was solved by NMR spectroscopy, while the full-length At1g24000.1 structure was determined by X-ray crystallography. MLP28 displays greater than 30% sequence identity to at least eight MLPsmore » from other species. For example, the MLP28 sequence shares 64% identity to peach Pp-MLP119 and 55% identity to cucumber Csf2.20 In contrast, the At1g24000.1 sequence is highly divergent (see Fig. 1), containing a gap of 33 amino acids when compared with all other known MLPs. Even when the gap is excluded, the sequence identity with MLPs from other species is less than 30%. Unlike some of the MLPs from other species, none of the A. thaliana MLPs have been characterized biochemically. We show by NMR chemical shift mapping that At1g24000.1 binds progesterone, demonstrating that despite its sequence dissimilarity, the hydrophobic binding pocket is conserved and, therefore, may play a role in its biological function and that of the MLP family in general.« less

First isolation of Rickettsia monacensis from a patient in South Korea.

PubMed

Kim, Yeon-Sook; Choi, Yeon-Joo; Lee, Kyung-Min; Ahn, Kyu-Joong; Kim, Heung-Chul; Klein, Terry; Jiang, Ju; Richards, Allen; Park, Kyung-Hee; Jang, Won-Jong

2017-07-01

A Rickettsia sp. was isolated from the blood of a patient with an acute febrile illness using the shell vial technique; the isolate was named CN45Kr and was identified by molecular assay as Rickettsia monacensis, which was first recognized as a pathogen in Spain. Sequencing analysis showed that the gltA sequence of the isolate was identical to that of Rickettsia sp. IRS3. The ompA-5mp fragment sequence showed 100% identity to those of R. monacensis and Rickettsia sp. In56 and ompA-3pA In56 and 100% identity to that of Rickettsia sp. IRS3. The ompB sequence was found to have 99.9% similarity to that of R. monacensis IrR/Munich. This study confirms the pathogenicity of this agent and provides additional information about its geographic distribution. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

High-resolution motion compensated MRA in patients with congenital heart disease using extracellular contrast agent at 3 Tesla

PubMed Central

2012-01-01

Background Using first-pass MRA (FP-MRA) spatial resolution is limited by breath-hold duration. In addition, image quality may be hampered by respiratory and cardiac motion artefacts. In order to overcome these limitations an ECG- and navigator-gated high-resolution-MRA sequence (HR-MRA) with slow infusion of extracellular contrast agent was implemented at 3 Tesla for the assessment of congenital heart disease and compared to standard first-pass-MRA (FP-MRA). Methods 34 patients (median age: 13 years) with congenital heart disease (CHD) were prospectively examined on a 3 Tesla system. The CMR-protocol comprised functional imaging, FP- and HR-MRA, and viability imaging. After the acquisition of the FP-MRA sequence using a single dose of extracellular contrast agent the motion compensated HR-MRA sequence with isotropic resolution was acquired while injecting the second single dose, utilizing the timeframe before viability imaging. Qualitative scores for image quality (two independent reviewers) as well as quantitative measurements of vessel sharpness and relative contrast were compared using the Wilcoxon signed-rank test. Quantitative measurements of vessel diameters were compared using the Bland-Altman test. Results The mean image quality score revealed significantly better image quality of the HR-MRA sequence compared to the FP-MRA sequence in all vessels of interest (ascending aorta (AA), left pulmonary artery (LPA), left superior pulmonary vein (LSPV), coronary sinus (CS), and coronary ostia (CO); all p < 0.0001). In comparison to FP-MRA, HR-MRA revealed significantly better vessel sharpness for all considered vessels (AA, LSPV and LPA; all p < 0.0001). The relative contrast of the HR-MRA sequence was less compared to the FP-MRA sequence (AA: p <0.028, main pulmonary artery: p <0.004, LSPV: p <0.005). Both, the results of the intra- and interobserver measurements of the vessel diameters revealed closer correlation and closer 95 % limits of agreement for the HR-MRA. HR-MRA revealed one additional clinical finding, missed by FP-MRA. Conclusions An ECG- and navigator-gated HR-MRA-protocol with infusion of extracellular contrast agent at 3 Tesla is feasible. HR-MRA delivers significantly better image quality and vessel sharpness compared to FP-MRA. It may be integrated into a standard CMR-protocol for patients with CHD without the need for additional contrast agent injection and without any additional examination time. PMID:23107424

Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

PubMed Central

Scheler, Ott; Glynn, Barry; Parkel, Sven; Palta, Priit; Toome, Kadri; Kaplinski, Lauris; Remm, Maido; Maher, Majella; Kurg, Ants

2009-01-01

Background Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA) with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP) molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Results Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. Conclusion We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology. PMID:19445684

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

[Levels of autoantibodies against AT1-receptor in hypertensive patients with acute coronary syndromes and its role in coronary artery vasoconstriction].

PubMed

Wang, Jingping; Zhang, Yuean; Wang, Huixian; Zeng, Xiaoxia; Yang, Jinjing; Dong, Jin; Wang, Jianling; Yang, Yan; Wang, Rijun; Zhang, Xiaojuan; Chai, Xiaohong; Zhang, Haozhou; Li, Bao

2015-02-17

To explore the levels of autoantibodies against AT1-receptor (AT1-AA) in hypertensive patients with acute coronary syndrome (ACS) and observe the in vitro effects of AT1-AA on resting tension of isolated anterior descending artery of vascular ring in male Wistar rats. All patients were recruited from June 2007 to August 2008. There were hypertensive patients with ACS (n = 120), those with simple hypertension (n = 253) and those with simple ACS (n = 115). And the outpatients for health examination during the same period were selected as healthy control group (n = 188). The second extracellular loop amino acid sequences of peptides of ATI receptor was synthesized and used as antigen (AT1-Ag) and sialic acid-enzyme-linked immunosorbent assay (SA-ELISA) for detect the serum levels of AT1-AA. Microvascular ring tension technology was used to test the vascular loop resting tension of anterior descending coronary artery from rats induced by a high-fat diet. The positive rates of AT1-AA in patients with simple hypertension (35.2%) and those with simple ACS (30.4%) were significantly higher than those in healthy control group (7.2%, P < 0.01). And the positive rate of AT1-AA in hypertensive patients with ACS (43.3%) was significantly higher than that in those with simple hypertension (35.2%, P < 0.05) and that in healthy control group (7.2%, P < 0.05).Furthermore, AT1-AA increased the vascular loop resting tension of anterior descending coronary artery rings in rats induced by a high-fat diet in a dose-dependant manner. And the vasoconstrictive action of AT1-AA was equal to 46.4% of AngII's action. And such an action was blocked by losartan and antigens. The level of AT1-AA increases markedly in hypertensive patients with ACS. And AT1-AA induces vasoconstrictive effects on anterior descending artery rings in rats induced by a high-fat diet.

NGSCheckMate: software for validating sample identity in next-generation sequencing studies within and across data types.

PubMed

Lee, Sejoon; Lee, Soohyun; Ouellette, Scott; Park, Woong-Yang; Lee, Eunjung A; Park, Peter J

2017-06-20

In many next-generation sequencing (NGS) studies, multiple samples or data types are profiled for each individual. An important quality control (QC) step in these studies is to ensure that datasets from the same subject are properly paired. Given the heterogeneity of data types, file types and sequencing depths in a multi-dimensional study, a robust program that provides a standardized metric for genotype comparisons would be useful. Here, we describe NGSCheckMate, a user-friendly software package for verifying sample identities from FASTQ, BAM or VCF files. This tool uses a model-based method to compare allele read fractions at known single-nucleotide polymorphisms, considering depth-dependent behavior of similarity metrics for identical and unrelated samples. Our evaluation shows that NGSCheckMate is effective for a variety of data types, including exome sequencing, whole-genome sequencing, RNA-seq, ChIP-seq, targeted sequencing and single-cell whole-genome sequencing, with a minimal requirement for sequencing depth (>0.5X). An alignment-free module can be run directly on FASTQ files for a quick initial check. We recommend using this software as a QC step in NGS studies. https://github.com/parklab/NGSCheckMate. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Discovery of 4-((3'R,4'S,5'R)-6″-Chloro-4'-(3-chloro-2-fluorophenyl)-1'-ethyl-2″-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3″-indoline]-5'-carboxamido)bicyclo[2.2.2]octane-1-carboxylic Acid (AA-115/APG-115): A Potent and Orally Active Murine Double Minute 2 (MDM2) Inhibitor in Clinical Development.

PubMed

Aguilar, Angelo; Lu, Jianfeng; Liu, Liu; Du, Ding; Bernard, Denzil; McEachern, Donna; Przybranowski, Sally; Li, Xiaoqin; Luo, Ruijuan; Wen, Bo; Sun, Duxin; Wang, Hengbang; Wen, Jianfeng; Wang, Guangfeng; Zhai, Yifan; Guo, Ming; Yang, Dajun; Wang, Shaomeng

2017-04-13

We previously reported the design of spirooxindoles with two identical substituents at the carbon-2 of the pyrrolidine core as potent MDM2 inhibitors. In this paper we describe an extensive structure-activity relationship study of this class of MDM2 inhibitors, which led to the discovery of 60 (AA-115/APG-115). Compound 60 has a very high affinity to MDM2 (K i < 1 nM), potent cellular activity, and an excellent oral pharmacokinetic profile. Compound 60 is capable of achieving complete and long-lasting tumor regression in vivo and is currently in phase I clinical trials for cancer treatment.

Residual stress analysis on AA6061+22% Al2O3p simple shape demonstrators of a wheel hub

NASA Astrophysics Data System (ADS)

Giuliani, Alessandra; Albertini, Gianni; Fiori, Fabrizio; Girardin, Emmanuelle

2004-07-01

The effects of thermal treatments in a component for automotive industry are considered: the induced residual stresses in wheel hubs were investigated. Measurements have been carried out on two identical simple shape demonstrators made of AA6061+22% Al2O3p in order to evaluate the stress conditions after forging and T6 treatment and without taking into account the final design of the wheel hub. One sample was analysed in as-forged conditions while the second after forging and T6 treatment (560°C for 2h, 20°C water quenching, artificial aging at 177°C for 10h). Particular attention was given to the stresses in the radial and hoop directions, as the main consequences of the in-service fatigue are expected to be related to stresses along these two directions.

GRIL: genome rearrangement and inversion locator.

PubMed

Darling, Aaron E; Mau, Bob; Blattner, Frederick R; Perna, Nicole T

2004-01-01

GRIL is a tool to automatically identify collinear regions in a set of bacterial-size genome sequences. GRIL uses three basic steps. First, regions of high sequence identity are located. Second, some of these regions are filtered based on user-specified criteria. Finally, the remaining regions of sequence identity are used to define significant collinear regions among the sequences. By locating collinear regions of sequence, GRIL provides a basis for multiple genome alignment using current alignment systems. GRIL also provides a basis for using current inversion distance tools to infer phylogeny. GRIL is implemented in C++ and runs on any x86-based Linux or Windows platform. It is available from http://asap.ahabs.wisc.edu/gril

[Study on the pathological and molecular characteristics of viral meningitis outbreaks in Linhai county, Zhejiang province, 2004].

PubMed

Yan, Ju-ying; Lu, Yi-yu; Xu, Chang-ping; Gong, Li-ming; Chen, Yin; Zhang, Yan-jun; Zhu, Jian-sheng

2011-12-01

In order to confirm the causes of viral meningitis outbreaks in Linhai county, Zhejiang province in 2004, and to analyze the relationship between hereditary variation and evolution of the pathogen. 60 cerebrospinal fluid (CSF) specimens were collected from the suspected patients. Virus strains from the specimens were isolated with RD and Hep-2 cell lines, and identified through neutralization test. VP1 and VP4/VP2 genes of the isolated viruses were sequenced. Both phylogenetic and homological trees were also constructed. 19 Echovirus type 30 (E30) strains were isolated from 60 CSFs, in which E30 accounted for 31.7%. All of the complete VP1 genes in 4 sequenced virus isolates of E30 were composed of 876 nt, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 82.4% - 84.1% and 93.5% - 94.2% between the 4 Linhai strains and the prototype strain Bastianni of E30, were 87.1% - 99.9% and 97.9% - 100.0% among the 4 virus strains of E30 from Linhai, respectively. The 4 Linhai strains could be classified into two classes. The diversity of nt and aa was minimal in the same class but obvious between the two classes, with the range of diversities as 12.9% and 2.1%, respectively. The Linhai E30 strains had maximum similarity with the Zhejiang E30 strains in 2002 - 2003. The 4 Linhai strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. The G branch also included the E30 strains from Zhejiang, Jiangsu and Shangdong in 2003, while the H branch including E30 strains from Zhuji, Zhejiang in 2002. The phylogenetic tree of VP4/VP2 genes was similar to that of VP1 gene. The outbreak of viral meningitis in Linhai county in 2004 was caused by the two classes of E30 strains with G and H genotype existed simultaneously. The Linhai E30 strains had maximum genetic relations to the Zhejiang, Jiangsu and Shangdong strains of E30. The H genotype was inferred to be a new variant strain, which was first isolated in Zhejiang province in 2002.

Synonymous Mutations in the Core Gene Are Linked to Unusual Serological Profile in Hepatitis C Virus Infection

PubMed Central

Budkowska, Agata; Kakkanas, Athanassios; Nerrienet, Eric; Kalinina, Olga; Maillard, Patrick; Horm, Srey Viseth; Dalagiorgou, Geena; Vassilaki, Niki; Georgopoulou, Urania; Martinot, Michelle; Sall, Amadou Alpha; Mavromara, Penelope

2011-01-01

The biological role of the protein encoded by the alternative open reading frame (core+1/ARF) of the Hepatitis C virus (HCV) genome remains elusive, as does the significance of the production of corresponding antibodies in HCV infection. We investigated the prevalence of anti-core and anti-core+1/ARFP antibodies in HCV-positive blood donors from Cambodia, using peptide and recombinant protein-based ELISAs. We detected unusual serological profiles in 3 out of 58 HCV positive plasma of genotype 1a. These patients were negative for anti-core antibodies by commercial and peptide-based assays using C-terminal fragments of core but reacted by Western Blot with full-length core protein. All three patients had high levels of anti-core+1/ARFP antibodies. Cloning of the cDNA that corresponds to the core-coding region from these sera resulted in the expression of both core and core+1/ARFP in mammalian cells. The core protein exhibited high amino-acid homology with a consensus HCV1a sequence. However, 10 identical synonymous mutations were found, and 7 were located in the aa(99–124) region of core. All mutations concerned the third base of a codon, and 5/10 represented a T>C mutation. Prediction analyses of the RNA secondary structure revealed conformational changes within the stem-loop region that contains the core+1/ARFP internal AUG initiator at position 85/87. Using the luciferase tagging approach, we showed that core+1/ARFP expression is more efficient from such a sequence than from the prototype HCV1a RNA. We provide additional evidence of the existence of core+1/ARFP in vivo and new data concerning expression of HCV core protein. We show that HCV patients who do not produce normal anti-core antibodies have unusually high levels of antit-core+1/ARFP and harbour several identical synonymous mutations in the core and core+1/ARFP coding region that result in major changes in predicted RNA structure. Such HCV variants may favour core+1/ARFP production during HCV infection. PMID:21283512

Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosí City, Mexico

PubMed Central

López-Revilla, Rubén; Pineda, Marco A; Ortiz-Valdez, Julio; Sánchez-Garza, Mireya; Riego, Lina

2009-01-01

Background In San Luis Potosí City cervical infection by human papillomavirus type 16 (HPV16) associated to dysplastic lesions is more prevalent in younger women. In this work HPV16 subtypes and variants associated to low-grade intraepithelial lesions (LSIL), high-grade intraepithelial lesions (HSIL) and invasive cervical cancer (ICC) of 38 women residing in San Luis Potosí City were identified by comparing their E6 open reading frame sequences. Results Three European (E) variants (E-P, n = 27; E-T350G, n = 7; E-C188G, n = 2) and one AA-a variant (n = 2) were identified among the 38 HPV16 sequences analyzed. E-P variant sequences contained 23 single nucleotide changes, two of which (A334G, A404T) had not been described before and allowed the phylogenetic separation from the other variants. E-P A334G sequences were the most prevalent (22 cases, 57.9%), followed by the E-P Ref prototype (8 cases, 21.1%) and E-P A404T (1 case, 2.6%) sequences. The HSIL + ICC fraction was 0.21 for the E-P A334G variants and 0.00 for the E-P Ref variants. Conclusion We conclude that in the women included in this study the HPV16 E subtype is 19 times more frequent than the AA subtype; that the circulating E variants are E-P (71.1%) > E-T350G (18.4%) > E-C188G (5.3%); that 71.0% of the E-P sequences carry the A334G single nucleotide change and appear to correspond to a HPV16 variant characteristic of San Luis Potosi City more oncogenic than the E-P Ref prototype. PMID:19216802

Draft Genome Sequences of Acinetobacter and Bacillus Strains Isolated from Spacecraft-Associated Surfaces

PubMed Central

Seuylemezian, Arman; Vaishampayan, Parag; Cooper, Kerry

2018-01-01

ABSTRACT We report here the draft genome sequences of four strains isolated from spacecraft-associated surfaces exhibiting increased resistance to stressors such as UV radiation and exposure to H2O2. The draft genomes of strains 1P01SCT, FO-92T, 50v1, and 2P01AA had sizes of 5,500,894 bp, 4,699,376 bp, 3,174,402 bp, and 4,328,804 bp, respectively. PMID:29439046

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

Systematic comparison of jet energy-loss schemes in a realistic hydrodynamic medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bass, Steffen A.; Majumder, Abhijit; Gale, Charles

2009-02-15

We perform a systematic comparison of three different jet energy-loss approaches. These include the Armesto-Salgado-Wiedemann scheme based on the approach of Baier-Dokshitzer-Mueller-Peigne-Schiff and Zakharov (BDMPS-Z/ASW), the higher twist (HT) approach and a scheme based on the Arnold-Moore-Yaffe (AMY) approach. In this comparison, an identical medium evolution will be utilized for all three approaches: this entails not only the use of the same realistic three-dimensional relativistic fluid dynamics (RFD) simulation, but also the use of identical initial parton-distribution functions and final fragmentation functions. We are, thus, in a unique position to not only isolate fundamental differences between the various approaches butmore » also make rigorous calculations for different experimental measurements using state of the art components. All three approaches are reduced to versions containing only one free tunable parameter, this is then related to the well-known transport parameter q. We find that the parameters of all three calculations can be adjusted to provide a good description of inclusive data on R{sub AA} vs transverse momentum. However, we do observe slight differences in their predictions for the centrality and azimuthal angular dependence of R{sub AA} vs p{sub T}. We also note that the values of the transport coefficient q in the three approaches to describe the data differ significantly.« less

Asian-American variants of human papillomavirus 16 and risk for cervical cancer: a case-control study.

PubMed

Berumen, J; Ordoñez, R M; Lazcano, E; Salmeron, J; Galvan, S C; Estrada, R A; Yunes, E; Garcia-Carranca, A; Gonzalez-Lira, G; Madrigal-de la Campa, A

2001-09-05

Human papillomavirus 16 (HPV16) has a number of variants, each with a different geographic distribution and some that are associated more often with invasive neoplasias. We investigated whether the high incidence of cervical cancer in Mexico (50 cases per 100 000 women) may be associated with a high prevalence of oncogenic HPV16 variants. Cervical samples were collected from 181 case patients with cervical cancer and from 181 age-matched control subjects, all from Mexico City. HPV16 was detected with an E6/E7 gene-specific polymerase chain reaction, and variant HPV classes and subclasses were identified by sequencing regions of the E6 and L1/MY genes. Clinical data and data on tumor characteristics were also collected. All statistical tests were two-sided. HPV16 was detected in cervical scrapes from 50.8% (92 of 181) of case patients and from 11% (20 of 181) of control subjects. All HPV16-positive samples, except one, contained European (E) or Asian-American (AA) variants. AA and E variants were found statistically significantly more often in case patients (AA = 23.2% [42 of 181]; E = 27.1% [49 of 181]) than in control subjects (AA = 1.1% [two of 181]; E = 10% [18 of 181]) (P<.001 for case versus control subjects for either E or AA variants, chi2 test). However, the frequency of AA variants was 21 times higher in cancer patients than in control subjects, whereas that ratio for E variants was only 2.7 (P =.006, chi2 test). The odds ratio (OR) for cervical cancer associated with AA variants (OR = 27.0; 95% confidence interval [CI] = 6.4 to 113.7) was higher than that associated with E variants (OR = 3.4; 95% CI = 1.9 to 6.0). AA-positive case patients (46.2 +/- 12.5 years [mean +/- standard deviation]) were 7.7 years younger than E-positive case patients (53.9 +/- 12.2 years) (P =.004, Student's t test). AA variants were associated with squamous cell carcinomas and adenocarcinomas, but E variants were associated with only squamous cell carcinomas (P =.014, Fisher's exact test). The high frequency of HPV16 AA variants, which appear to be more oncogenic than E variants, might contribute to the high incidence of cervical cancer in Mexico.

Comparing Genomes in Terms of Protein Structure: Surveys of a Finite Parts List

DTIC Science & Technology

1998-01-01

539-547. 39. Fraser, C M, et al. (1997) Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi [see comments]. Nature 390, 580-586. 40...Methanobacterium thermoautotrophicum [202] BS Bacillus subtilis [203] AB Archaeoglobus fulgidus [204] BB Borrelia burgdorferi [39] AA Aquifex aeolicus

The LIM homeobox protein mLIM3/Lhx3 induces expression of the prolactin gene by a Pit-1/GHF-1-independent pathway in corticotroph AtT20 cells.

PubMed

Girardin, S E; Benjannet, S; Barale, J C; Chrétien, M; Seidah, N G

1998-07-24

mLIM3, a member of the LIM homeobox family, was recently demonstrated to be critical for proliferation and differentiation of the pituitary cell lineage. Using a pool of degenerate oligonucleotides we determined the DNA sequence ANNAGGAAA(T/C)GA(CIG)AA as the set preferentially recognized by mLIM3. A nearly identical sequence is found in the prolactin (PRL) promoter, within a 15-mer stretch from nucleotides (nts) -218 to -204 which is highly conserved between human, rat, and bovine. In order to test the hypothesis of a transcriptional effect of mLIM3 on the prolactin promoter, stable transfectants of mLIM3 cDNA in AtT20 tumor cells revealed that PRL mRNA expression was induced in 3 separate stable clones. Gel retardation experiments performed using nuclear extracts isolated from one of the AtT20/mLIM3 stable transfectants revealed affinity towards the 15-mer element of the PRL promoter. From these results, we propose that the PRL promoter element (nts -218 to -204) could be functional in vivo. Finally, we demonstrate that in AtT20 cells prolactin mRNA expression is not induced by the Pit-1/GHF-1 pathway and that growth hormone mRNA is not detected concomitantly with prolactin. We conclude that mLIM3 may play a key role in inducing PRL gene expression in lactotrophs by binding to a conserved motif close to a Pit-1/GHF-1 site within the proximal PRL promoter.

First isolation of a rhabdovirus from perch Perca fluviatilis in Switzerland.

PubMed

Wahli, Thomas; Bellec, Laure; von Siebenthal, Beat; Cabon, Joëlle; Schmidt-Posthaus, Heike; Morin, Thierry

2015-10-16

Perca fluviatilis is a fish species of increasing interest to the Swiss fish farming industry. In recent years, recirculation systems have been specifically set up to increase production. In one of these farms, abnormal spiral swimming associated with elevated mortalities occurred in repeated batches of imported perch shortly after stocking on several occasions. No bacterial or parasitic etiology was detected, but a virus grown in bluegill fry (BF-2) cells was identified as perch rhabdovirus. Subsequent investigations of other samples suggested a viral tropism for the central nervous system (CNS). Phylogenetic analysis of the partial N and entire G gene sequences positioned this isolate in genogroup C of the species Perch rhabdovirus, with high nucleotide and amino acid (aa) sequence identities with the DK5533 strain isolated in Denmark in 1989. Comparative studies using other closely related isolates allowed the distinction of 2 serological patterns among perch rhabdoviruses and the identification of a proline substitution by a serine in position 147 of the glycoprotein potentially involved in antigenic differentiation. Even if perch imported onto the farm tested negative by virus isolation prior to transport, they may have been the origin of this outbreak since CNS tissue was not included in the samples that were analyzed. Another possibility might be a sub-clinical infection with a viral load in resident fish too low to be detected. This study reports the first isolation of a perch rhabdovirus in Switzerland, and emphasizes the necessity of optimizing diagnostic tools that facilitate better control of the risks associated with fish translocation.

Comparative genomics on Norrie disease gene.

PubMed

Katoh, Masuko; Katoh, Masaru

2005-05-01

DAND1 (NBL1), DAND2 (CKTSF1B1 or GREM1 or GREMLIN), DAND3 (CKTSF1B2 or GREM2 or PRDC), DAND4 (CER1), DAND5 (CKTSF1B3 or GREM3 or DANTE), MUC2, MUC5AC, MUC5B, MUC6, MUC19, WISP1, WISP2, WISP3, VWF, NOV and Norrie disease (NDP or NORRIN) genes encode proteins with cysteine knot domain. Cysteine-knot superfamily proteins regulate ligand-receptor interactions for a variety of signaling pathways implicated in embryogenesis, homeostasis, and carcinogenesis. Although Ndp is unrelated to Wnt family members, Ndp is claimed to function as a ligand for Fzd4. Here, we identified and characterized rat Ndp, cow Ndp, chicken ndp and zebrafish ndp genes by using bioinformatics. Rat Ndp gene, consisting of three exons, was located within AC105563.4 genome sequence. Cow Ndp and chicken ndp complete CDS were derived from CB467544.1 EST and BX932859.2 cDNA, respectively. Zebrafish ndp gene was located within BX572627.5 genome sequence. Rat Ndp (131 aa) was a secreted protein with C-terminal cysteine knot-like (CTCK) domain. Rat Ndp showed 100, 96.9, 95.4, 87.8 and 66.4 total-amino-acid identity with mouse Ndp, cow Ndp, human NDP, chicken ndp and zebrafish ndp, respectively. Exon-intron structure of mammalian Ndp orthologs was well conserved. FOXA2, CUTL1 (CCAAT displacement protein), LMO2, CEBPA (C/EBPalpha)-binding sites and triple POU2F1 (OCT1)-binding sites were conserved among promoters of mammalian Ndp orthologs.

A scorpion venom neurotoxin paralytic to insects that affects sodium current inactivation: Purification, primary structure, and mode of action

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eitan, M.; Fowler, E.; Herrmann, R.

1990-06-26

A new toxin, Lqh alpha IT, which caused a unique mode of paralysis of blowfly larvae, was purified from the venom of the scorpion Leiurus quinquestriatus hebraeus, and its structural and pharmacological properties were compared to those of three other groups of neurotoxins found in Buthinae scorpion venoms. Like the excitatory and depressant insect-selective neurotoxins, Lqh alpha IT was highly toxic to insects, but it differed from these toxins in two important characteristics: (a) Lqh alpha IT lacked strict selectivity for insects; it was highly toxic to crustaceans and had a measurable but low toxicity to mice. (b) It didmore » not displace an excitatory insect toxin, 125I-AaIT, from its binding sites in the insect neuronal membrane; this indicates that the binding sites for Lqh alpha IT are different from those shared by the excitatory and depressant toxins. However, in its primary structure and its effect on excitable tissues, Lqh alpha IT strongly resembled the well-characterized alpha scorpion toxins, which affect mammals. The amino acid sequence was identical with alpha toxin sequences in 55%-75% of positions. This degree of similarity is comparable to that seen among the alpha toxins themselves. Voltage- and current-clamp studies showed that Lqh alpha IT caused an extreme prolongation of the action potential in both cockroach giant axon and rat skeletal muscle preparations as a result of the slowing and incomplete inactivation of the sodium currents. These observations indicate that Lqh alpha IT is an alpha toxin which acts on insect sodium channels.« less

The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

PubMed Central

2010-01-01

Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24). The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS) sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity) elsewhere in the genome, but only 23% have identical copies (99% identity). The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is a feasible goal. PMID:20609256

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Alignment-Annotator web server: rendering and annotating sequence alignments.

PubMed

Gille, Christoph; Fähling, Michael; Weyand, Birgit; Wieland, Thomas; Gille, Andreas

2014-07-01

Alignment-Annotator is a novel web service designed to generate interactive views of annotated nucleotide and amino acid sequence alignments (i) de novo and (ii) embedded in other software. All computations are performed at server side. Interactivity is implemented in HTML5, a language native to web browsers. The alignment is initially displayed using default settings and can be modified with the graphical user interfaces. For example, individual sequences can be reordered or deleted using drag and drop, amino acid color code schemes can be applied and annotations can be added. Annotations can be made manually or imported (BioDAS servers, the UniProt, the Catalytic Site Atlas and the PDB). Some edits take immediate effect while others require server interaction and may take a few seconds to execute. The final alignment document can be downloaded as a zip-archive containing the HTML files. Because of the use of HTML the resulting interactive alignment can be viewed on any platform including Windows, Mac OS X, Linux, Android and iOS in any standard web browser. Importantly, no plugins nor Java are required and therefore Alignment-Anotator represents the first interactive browser-based alignment visualization. http://www.bioinformatics.org/strap/aa/ and http://strap.charite.de/aa/. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Alignment-Annotator web server: rendering and annotating sequence alignments

PubMed Central

Gille, Christoph; Fähling, Michael; Weyand, Birgit; Wieland, Thomas; Gille, Andreas

2014-01-01

Alignment-Annotator is a novel web service designed to generate interactive views of annotated nucleotide and amino acid sequence alignments (i) de novo and (ii) embedded in other software. All computations are performed at server side. Interactivity is implemented in HTML5, a language native to web browsers. The alignment is initially displayed using default settings and can be modified with the graphical user interfaces. For example, individual sequences can be reordered or deleted using drag and drop, amino acid color code schemes can be applied and annotations can be added. Annotations can be made manually or imported (BioDAS servers, the UniProt, the Catalytic Site Atlas and the PDB). Some edits take immediate effect while others require server interaction and may take a few seconds to execute. The final alignment document can be downloaded as a zip-archive containing the HTML files. Because of the use of HTML the resulting interactive alignment can be viewed on any platform including Windows, Mac OS X, Linux, Android and iOS in any standard web browser. Importantly, no plugins nor Java are required and therefore Alignment-Anotator represents the first interactive browser-based alignment visualization. Availability: http://www.bioinformatics.org/strap/aa/ and http://strap.charite.de/aa/. PMID:24813445

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

Discovery and characterization of a new family of lytic polysaccharide mono-oxygenases

PubMed Central

Hemsworth, Glyn R.; Henrissat, Bernard; Davies, Gideon J.; Walton, Paul H.

2014-01-01

Lytic polysaccharide mono-oxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They currently attract much attention due to their potential use in biomass conversion, notably in the production of biofuels. Past work has identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the 3-D structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active centre featuring the histidine brace active site, but is distinct in terms of its active site details and its EPR spectroscopy. The new AA11 family expands the LPMO clan with the potential to broaden both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs. PMID:24362702

Complete mitochondrial genomes of Thai and Lao populations indicate an ancient origin of Austroasiatic groups and demic diffusion in the spread of Tai-Kadai languages.

PubMed

Kutanan, Wibhu; Kampuansai, Jatupol; Srikummool, Metawee; Kangwanpong, Daoroong; Ghirotto, Silvia; Brunelli, Andrea; Stoneking, Mark

2017-01-01

The Tai-Kadai (TK) language family is thought to have originated in southern China and spread to Thailand and Laos, but it is not clear if TK languages spread by demic diffusion (i.e., a migration of people from southern China) or by cultural diffusion, with native Austroasiatic (AA) speakers switching to TK languages. To address this and other questions, we obtained 1234 complete mtDNA genome sequences from 51 TK and AA groups from Thailand and Laos. We find high genetic heterogeneity across the region, with 212 different haplogroups, and significant genetic differentiation among different samples from the same ethnolinguistic group. TK groups are more genetically homogeneous than AA groups, with the latter exhibiting more ancient/basal mtDNA lineages, and showing more drift effects. Modeling of demic diffusion, cultural diffusion, and admixture scenarios consistently supports the spread of TK languages by demic diffusion.

Combinations of putative virulence markers in typical and variant enteroaggregative Escherichia coli strains from children with and without diarrhoea.

PubMed Central

Elias, W. P.; Uber, A. P.; Tomita, S. K.; Trabulsi, L. R.; Gomes, T. A. T.

2002-01-01

Enteroaggregative Escherichia coli (EAEC) is defined by the ability to produce aggregative adherence (AA) to cultured cells. We analysed 128 EAEC strains, isolated from children with and without diarrhoea, regarding the presence of 11 EAEC virulence genes. Seventy strains carried and 58 lacked the EAEC probe sequence; 17 probe positive and 31 probe negative strains showed variations in the AA pattern. All EAEC probe positive strains carried at least one EAEC marker; aspU (94.3%), irp2 (91.4%), and aggR (74.3%) were the most prevalent. Conversely, among the EAEC probe negative strains, 41.4% were devoid of any marker and astA predominated (44.8%). No significant statistical difference in the prevalence of any marker between cases and controls in both EAEC probe groups or AA variants was found. We suggest that the EAEC probe positive strains may have a higher pathogenic potential or alternatively, EAEC probe negative strains may harbour virulence factors as yet undescribed. PMID:12211596

PSS-3D1D: an improved 3D1D profile method of protein fold recognition for the annotation of twilight zone sequences.

PubMed

Ganesan, K; Parthasarathy, S

2011-12-01

Annotation of any newly determined protein sequence depends on the pairwise sequence identity with known sequences. However, for the twilight zone sequences which have only 15-25% identity, the pair-wise comparison methods are inadequate and the annotation becomes a challenging task. Such sequences can be annotated by using methods that recognize their fold. Bowie et al. described a 3D1D profile method in which the amino acid sequences that fold into a known 3D structure are identified by their compatibility to that known 3D structure. We have improved the above method by using the predicted secondary structure information and employ it for fold recognition from the twilight zone sequences. In our Protein Secondary Structure 3D1D (PSS-3D1D) method, a score (w) for the predicted secondary structure of the query sequence is included in finding the compatibility of the query sequence to the known fold 3D structures. In the benchmarks, the PSS-3D1D method shows a maximum of 21% improvement in predicting correctly the α + β class of folds from the sequences with twilight zone level of identity, when compared with the 3D1D profile method. Hence, the PSS-3D1D method could offer more clues than the 3D1D method for the annotation of twilight zone sequences. The web based PSS-3D1D method is freely available in the PredictFold server at http://bioinfo.bdu.ac.in/servers/ .

Differential inductions of phenylalanine ammonia-lyase and chalcone synthase during wounding, salicylic acid treatment, and salinity stress in safflower, Carthamus tinctorius

PubMed Central

Dehghan, Sara; Sadeghi, Mahnaz; Pöppel, Anne; Fischer, Rainer; Lakes-Harlan, Reinhard; Kavousi, Hamid Reza; Vilcinskas, Andreas; Rahnamaeian, Mohammad

2014-01-01

Safflower (Carthamus tinctorius L.) serves as a reference dicot for investigation of defence mechanisms in Asteraceae due to abundant secondary metabolites and high resistance/tolerance to environmental stresses. In plants, phenylpropanoid and flavonoid pathways are considered as two central defence signalling cascades in stress conditions. Here, we describe the isolation of two major genes in these pathways, CtPAL (phenylalanine ammonia-lyase) and CtCHS (chalcone synthase) in safflower along with monitoring their expression profiles in different stress circumstances. The aa (amino acid) sequence of isolated region of CtPAL possesses the maximum identity up to 96% to its orthologue in Cynara scolymus, while that of CtCHS retains the highest identity to its orthologue in Callistephus chinensis up to 96%. Experiments for gene expression profiling of CtPAL and CtCHS were performed after the treatment of seedlings with 0.1 and 1 mM SA (salicylic acid), wounding and salinity stress. The results of semi-quantitative RT–PCR revealed that both CtPAL and CtCHS genes are further responsive to higher concentration of SA with dissimilar patterns. Regarding wounding stress, CtPAL gets slightly induced upon injury at 3 hat (hours after treatment) (hat), whereas CtCHS gets greatly induced at 3 hat and levels off gradually afterward. Upon salinity stress, CtPAL displays a similar expression pattern by getting slightly induced at 3 hat, but CtCHS exhibits a biphasic expression profile with two prominent peaks at 3 and 24 hat. These results substantiate the involvement of phenylpropanoid and particularly flavonoid pathways in safflower during wounding and especially salinity stress. PMID:24865400

Carbohydrate degrading polypeptide and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide having carbohydrate material degrading activity which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Recovered, in recovery or recovering from substance abuse? A question of identity.

PubMed

Doukas, Nick; Cullen, Jim

2009-12-01

There has always been widespread debate on how people with past substance abuse problems choose to identify themselves with regards to their recovery and the terms used to associate with that identity. Most of the disagreement over these terms is rooted on whether recovery is seen as an ongoing process ("recovering" or "in recovery") or a life event that can be mastered ("recovered"). This article discusses these three controversial terms and attempts to make them available as terms that one can use or identify with by presenting different perspectives on the topic of recovery. Some of these perspectives may be unconventional when compared to traditional views of the recovery process, but they are the realities of many individuals who have had a past experience with substance abuse and may be confronted with prejudice when voicing their recovery in a past tense. The article makes comparisons between the DSM IV and the Big Book of AA and discusses identity vs labels and the influence of the medical community on this controversial topic.

Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

PubMed

Luo, M; Mao, X; Plummer, F A

2005-02-01

We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

PubMed

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

Association of HLA haplotype with alopecia areata in Chinese Hans.

PubMed

Xiao, F-L; Ye, D-Q; Yang, S; Zhou, F-S; Zhou, S-M; Zhu, Y-G; Liang, Y-H; Ren, Y-Q; Zhang, X-J

2006-11-01

Some studies have shown discrepancies in human leucocyte antigen (HLA) associated with alopecia areata (AA) between different ethnic populations. To investigate whether HLA-I, -DQA1 and -DQB1 alleles and the HLA haplotype are associated with AA, and the correlation between the HLA haplotype profile, age of onset and severity of AA in Chinese Hans. The polymerase chain reaction-sequence specific primer (PCR-SSP) method was used to analyse the frequencies of HLA class I, -DQA1 and -DQB1 alleles in 192 patients with AA and 252 controls in Chinese Hans. The linkage disequilibrium was calculated using the 2 x 2 table. The 24 two-locus haplotypes [including A*02-B*18, A*02-B*27, A*02-B*52, A*02-Cw*0704, A*02-DQA1*0104, A*02-DQB1*0604, A*02-DQB1*0606, B*18-Cw*0704, B*18-DQA1*0104, B*18-DQA1*0302, B*18-DQB1*0606, B*27-Cw*0704, B*27-DQA1*0104, B*27-DQA1*0302, B*52-Cw*0704, B*52-DQA1*0104, B*52-DQA1*0302, B52-DQB1*0606, Cw*0704-DQA1*0104, Cw*0704-DQA1*0302, Cw*0704-DQB1*0606, DQA1*0104-DQB1*0604, DQA1*0104-DQB1*0606, DQA1*0302-DQB1*0606 (P<0.05)] were associated with AA, while eight extended haplotypes (A*02-B*18-DQA1*0104, A*02-B*27-DQA1*0104, A*02-B*52-DQA1*0104, A*02-B*52-DQA1*0302, A*02-B*52-DQB1*0606, B*52-Cw*0704-DQA1*0104, B*52-Cw*0704-DQA1*0302, A*02-B*52-DQA1*0302-DQB1*0606) were found to be related to AA in Chinese Hans. Through stratified analysis, we found that the extended haplotype B*52-Cw*0704-DQA1*0302 was related to early onset of AA, and no haplotype was only associated with severe AA. This is the first detailed report to elucidate HLA haplotypes associated with AA and that demonstrates the significant HLA haplotypes in Chinese Hans AA. The haplotype B*52-Cw*0704-DQA1*0302 was identified to be related to early onset of AA. Our results provide some information for future research on predisposing genes in HLA regions in Chinese Hans.

Association of HLA class I alleles with aloplecia areata in Chinese Hans.

PubMed

Xiao, Feng-Li; Yang, Sen; Yan, Kai-lin; Cui, Yong; Liang, Yan-Hua; Zhou, Fu-Sheng; Du, Wen-Hui; Gao, Min; Sun, Liang-Dan; Fan, Xing; Chen, Jian-Jun; Wang, Pei-Guang; Zhu, Ya-Gang; Zhou, Shun-Ming; Zhang, Xue-Jun

2006-02-01

Some studies suggested that human HLA status may potentiate development of the AA phenotype and exists ethic differences. No report has been published about HLA class I alleles associated with AA in Chinese Hans. To study the distribution of HLA class I alleles and haplotypes in Chinese Hans AA patients and the relation of HLA class I profile with age of onset, severity, duration of current attack, past history and family history. The polymerase chain reaction-sequence-specific primer (PCR-SSP) method was used to analyze the distribution of HLA class I alleles in 192 patients with AA and 252 healthy controls in Chinese Hans. The frequencies of HLA-A*02, -A*03, -B*18, -B*27, -B*52 and -Cw*0704 were significantly higher in patients than in controls. The A*2-B*18, A*2-B*27, A*2-B*52, A*2-Cw*0704, B*18-Cw*0704, B*27-Cw*0704, B*52-Cw*0704 were found as high-risk haplotypes in developing AA in this study. The HLA-A*02 and -A*03 were observed increased frequencies in patients less than 50% hair loss, and HLA-B*27 equally in patients of 50-99% hair loss, alopecia totalis and alopecia universalis. The frequencies of HLA-A*02 and -B*27 were significantly raised in recurrent patients, and ones of HLA-A*02, -A*03 and -B*27 similarly in patients without a positive family history. This study demonstrated the positive association of HLA class I alleles and haplotypes with AA. There may be differences in genetic background in patients with different age of onset, grade of scalp hair loss, duration of current attack, a past history and a family history.

Characterization of hepatitis B virus surface antigen variability and impact on HBs antigen clearance under nucleos(t)ide analogue therapy.

PubMed

Velay, A; Jeulin, H; Eschlimann, M; Malvé, B; Goehringer, F; Bensenane, M; Frippiat, J-P; Abraham, P; Ismail, A M; Murray, J M; Combet, C; Zoulim, F; Bronowicki, J-P; Schvoerer, E

2016-05-01

For hepatitis B virus (HBV)-related chronic infection under treatment by nucleos(t)ide analogues (NUCs), HBsAg clearance is the ultimate therapeutic goal but very infrequent. We investigated how HBV envelope protein variability could lead to differential HBsAg clearance on NUCs. For 12 HBV genotype D patients receiving NUCs, six resolvers (HBsAg clearance) were compared to six matched nonresolvers (HBsAg persistence). PreS/S amino acid (aa) sequences were analysed with bioinformatics to predict HBV envelope antigenicity and aa covariance. To enrich our analyses on very rare resolvers, these were compared with other HBV genotype D strains in three characterized clinical cohorts including common chronically infected patients. The sT125M+sP127T combination was observed in four nonresolvers of six, corroborated by aa covariance analysis, associated with a lower predicted antigenicity than sT125T+sP127P. Concordant features within this HBV key functional domain, at positions 125 and 127, were reported from two of the three comparative cohorts. In our hands, a lower ELISA reactivity of HBV-vaccinated mice sera was observed against the sT125M mutant. In the S gene, 56 aa changes in minor variants were detected in non-resolvers, mainly in the major hydrophilic region, vs 28 aa changes in resolvers. Molecular features in patients showing HBsAg persistence on NUCs argue in favour of a different aa pattern in the HBV S gene compared to those showing HBsAg clearance. In nonresolvers, a decrease in HBs 'a' determinant antigenicity and more frequent mutations in the S gene suggest a role for the HBV envelope characteristics in HBsAg persistence. © 2016 John Wiley & Sons Ltd.

Construction and characterization of 3A-epitope-tagged foot-and-mouth disease virus.

PubMed

Ma, Xueqing; Li, Pinghua; Sun, Pu; Bai, Xingwen; Bao, Huifang; Lu, Zengjun; Fu, Yuanfang; Cao, Yimei; Li, Dong; Chen, Yingli; Qiao, Zilin; Liu, Zaixin

2015-04-01

Nonstructural protein 3A of foot-and-mouth disease virus (FMDV) is a partially conserved protein of 153 amino acids (aa) in most FMDVs examined to date. Specific deletion in the FMDV 3A protein has been associated with the inability of FMDV to grow in primary bovine cells and cause disease in cattle. However, the aa residues playing key roles in these processes are poorly understood. In this study, we constructed epitope-tagged FMDVs containing an 8 aa FLAG epitope, a 9 aa haemagglutinin (HA) epitope, and a 10 aa c-Myc epitope to substitute residues 94-101, 93-101, and 93-102 of 3A protein, respectively, using a recently developed O/SEA/Mya-98 FMDV infectious cDNA clone. Immunofluorescence assay (IFA), Western blot and sequence analysis showed that the epitope-tagged viruses stably maintained and expressed the foreign epitopes even after 10 serial passages in BHK-21 cells. The epitope-tagged viruses displayed growth properties and plaque phenotypes similar to those of the parental virus in BHK-21 cells. However, the epitope-tagged viruses exhibited lower growth rates and smaller plaque size phenotypes than those of the parental virus in primary fetal bovine kidney (FBK) cells, but similar growth properties and plaque phenotypes to those of the recombinant viruses harboring 93-102 deletion in 3A. These results demonstrate that the decreased ability of FMDV to replicate in primary bovine cells was not associated with the length of 3A, and the genetic determinant thought to play key role in decreased ability to replicate in primary bovine cells could be reduced from 93-102 residues to 8 aa residues at positions 94-101 in 3A protein. Copyright © 2015 Elsevier B.V. All rights reserved.

The effects of Bacillus thuringiensis Cry6A on the survival, growth, reproduction, locomotion, and behavioral response of Caenorhabditis elegans.

PubMed

Luo, Hui; Xiong, Jing; Zhou, Qiaoni; Xia, Liqiu; Yu, Ziquan

2013-12-01

Several families of crystal proteins from Bacillus thuringiensis exhibit nematicidal activity. Cry5B protein, a pore-forming toxin, has been intensively studied yielding many insights into the mode of action of crystal protein at molecular level and pathogenesis of pore-forming toxins. However, little attention was paid to Cry6A, another representative nematicidal crystal protein. Cry6A shares very low homology with Cry5B at amino acid sequence and probably acts in a distinct pathway from Cry5B and even the other main commercial crystal proteins. In the current study, we comprehensively investigated the nematicidal properties of Cry6Aa2 against the free-living soil nematode Caenorhabditis elegans and examined the physical response of C. elegans to Cry6Aa2 attack. Our results indicate that Cry6Aa2 exhibits high lethal activity to C. elegans and could cause detrimental effects on C. elegans, including obviously suppressed growth, decreased brood size, and even abnormal motility. Meanwhile, our study additionally shows that C. elegans could defend against the Cry6Aa2 toxin harmful threat through behavioral defense responses, such as reduced oral uptake and physical avoidance. In general, this study suggests that Cry6Aa2 possesses diverse nematicidal properties, which strongly indicates that Cry6Aa2 is a promising potential candidate of nematicidal agent. Moreover, this study highlights the importance of behavioral responses in defense of C. elegans for survival and demonstrates the key role of crystal protein in the interaction of B. thuringiensis-C. elegans. These findings could shed light on understanding the interaction of C. elegans with B. thuringiensis and provide a perfect model to study the role of pathogenic factor in the interaction of pathogen-host.

Changing epidemiology of AA amyloidosis: clinical observations over 25 years at a single national referral centre.

PubMed

Lane, Thirusha; Pinney, Jennifer H; Gilbertson, Janet A; Hutt, David F; Rowczenio, Dorota M; Mahmood, Shameem; Sachchithanantham, Sajitha; Fontana, Marianna; Youngstein, Taryn; Quarta, Candida C; Wechalekar, Ashutosh D; Gillmore, Julian D; Hawkins, Philip N; Lachmann, Helen J

2017-09-01

Systemic AA amyloidosis is a serious complication of chronic inflammation; however, there are relatively few published data on its incidence. We investigated the changing epidemiology of AA amyloidosis over a 25-year period at a single national referral centre. We conducted a retrospective study of all patients diagnosed with AA amyloidosis who had attended the centre between 1990 and 2014 inclusive. Six hundred and twenty-five patients were studied in three cohorts: C1: 1990-1997; C2: 1998-2006; C3: 2007-2014. Mean age at presentation increased from 46 in C1 to 56 in C3 (p < .0001). The proportion of South Asian patients increased from 4% in C1 to 17% in C3 (p = .0006). Comparison of underlying diseases between C1 and C3 revealed a reduction in patients with juvenile idiopathic arthritis from 25% to 2% (p < .0001), but an increase in patients with chronic infection due to intravenous recreational drug use from 1% to 13% (p < .0001), and uncharacterized inflammatory disorders from 10% to 27% (p <.0001). More patients were in end-stage renal failure at presentation in C3 (29%) than C1 (15%) (p = .0028). Median age at death was later in C3 (62 years) than C1 (54 years) (p = .0012). These data suggest both falling incidence and better outcome in AA amyloidosis over a quarter of a century, reflecting advances in therapeutics and overall management of complex chronic disease in an ageing population. AA amyloidosis of uncertain aetiology presents an emerging major problem. Newer techniques such as next-generation sequencing may aid diagnosis and effective treatment, thereby improving overall survival.

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

Infection of Taenia asiatica in a Bai Person in Dali, China.

PubMed

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-02-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica.

Infection of Taenia asiatica in a Bai Person in Dali, China

PubMed Central

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-01-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica. PMID:26951981

Precursors of vertebrate peptide antibiotics dermaseptin b and adenoregulin have extensive sequence identities with precursors of opioid peptides dermorphin, dermenkephalin, and deltorphins.

PubMed

Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P

1994-07-08

The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family despite the fact that they encode end products having very different biological activities. These genes might contain a homologous export exon comprising the 5'-untranslated region, the 22-residue signal peptide, the 20-24-residue acidic spacer, and the basic pair Lys-Arg.

β-Cell Lipotoxicity After an Overnight Intravenous Lipid Challenge and Free Fatty Acid Elevation in African American Versus American White Overweight/Obese Adolescents

PubMed Central

Hughan, Kara S.; Bonadonna, Riccardo C.; Lee, SoJung; Michaliszyn, Sara F.

2013-01-01

Objective: Overweight/obese (OW/OB) African American (AA) adolescents have a more diabetogenic insulin secretion/sensitivity pattern compared with their American white (AW) peers. The present study investigated β-cell lipotoxicity to test whether increased free fatty acid (FFA) levels result in greater β-cell dysfunction in AA vs AW OW/OB adolescents. Research Design and Methods: Glucose-stimulated insulin secretion was modeled, from glucose and C-peptide concentrations during a 2-hour hyperglycemic (225 mg/dL) clamp in 22 AA and 24 AW OW/OB adolescents, on 2 occasions after a 12-hour overnight infusion of either normal saline or intralipid (IL) in a random sequence. β-Cell function relative to insulin sensitivity, the disposition index (DI), was examined during normal saline and IL conditions. Substrate oxidation was evaluated with indirect calorimetry and body composition and abdominal adiposity with dual-energy X-ray absorptiometry and magnetic resonance imaging at L4-L5, respectively. Results: Age, sex, body mass index, total and sc adiposity were similar between racial groups, but visceral adiposity was significantly lower in AAs. During IL infusion, FFAs and fat oxidation increased and insulin sensitivity decreased similarly in AAs and AWs. β-Cell glucose sensitivity of first- and second-phase insulin secretion did not change significantly during IL infusion in either group, but DI in each phase decreased significantly and similarly in AAs and AWs. Conclusions: Overweight/obese AA and AW adolescents respond to an overnight fat infusion with significant declines in insulin sensitivity, DI, and β-cell function relative to insulin sensitivity, suggestive of β-cell lipotoxicity. However, contrary to our hypothesis, there does not seem to be a race differential in β-cell lipotoxicity. Longer durations of FFA elevation may unravel such race-related contrasts. PMID:23526462

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

PubMed

Pessôa, Rodrigo; Watanabe, Jaqueline Tomoko; Nukui, Youko; Pereira, Juliana; Casseb, Jorge; Kasseb, Jorge; de Oliveira, Augusto César Penalva; Segurado, Aluisio Cotrim; Sanabani, Sabri Saeed

2014-01-01

Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol. Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis. A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Wenhui; Chen, Xilei; Li, Tao

Fibroblast growth factor 8b (FGF8b) is the major isoform of FGF8 expressed in prostate cancer and it correlates with the stage and grade of the disease. FGF8b has been considered as a potential target for prostate cancer therapy. Here we isolated 12 specific FGF8b-binding phage clones by screening a phage display heptapeptide library with FGF8b. The peptide (HSQAAVP, named as P12) corresponding to one of these clones showed high homology to the immunoglobulin-like (Ig-like) domain II(D2) of high-affinity FGF8b receptor (FGFR3c), contained 3 identical amino acids (AVP) to the authentic FGFR3 D2 sequence aa 163–169 (LLAVPAA) directly participating in ligandmore » binding, carried the same charges as its corresponding motif (aa163–169) in FGFR3c, suggesting that P12 may have a greater potential to interrupt FGF8b binding to its receptors than other identified heptapeptides do. Functional analysis indicated that synthetic P12 peptides mediate significant inhibition of FGF8b-induced cell proliferation, arrest cell cycle at the G0/G1 phase via suppression of Cyclin D1 and PCNA, and blockade of the activations of Erk1/2 and Akt cascades in both prostate cancer cells and vascular endothelial cells. The results demonstrated that the P12 peptide acting as an FGF8b antagonist may have therapeutic potential in prostate cancer. - Highlights: ► A novel FGF8b-binding peptide P12 was isolated from a phage display library. ► The mechanisms for P12 peptide inhibiting cell proliferation were proposed. ► P12 caused cell cycle arrest at G0/G1 phase via suppression of Cyclin D1 and PCNA. ► P12 suppressed FGF8b-induced activations of Akt and MAP kinases. ► P12 acting as an FGF8b antagonist may have therapeutic potential in prostate cancer.« less

Application of Genotyping during an Extensive Outbreak of Waterborne Giardiasis in Bergen, Norway, during Autumn and Winter 2004†

PubMed Central

Robertson, L. J.; Hermansen, L.; Gjerde, B. K.; Strand, E.; Alvsvåg, J. O.; Langeland, N.

2006-01-01

During the autumn and winter of 2004 and 2005, an extensive outbreak of waterborne giardiasis occurred in Bergen, Norway. Over 1,500 patients were diagnosed with giardiasis. Analysis of water from the implicated source revealed low numbers of Giardia cysts, but the initial contamination event probably occurred up to 10 weeks previously. While sewage leakage from a residential area is now considered to be the probable source of contamination, during the episode waste from one particular septic tank was thought to be a possible source. Genotyping of cysts from the septic tank demonstrated that they were assemblage A cysts, although the sequences were not identical to any previously published sequences. For the β-giardin gene, the closest published subgenotype was subgenotype A3; for the gdh gene, the closest published subgenotype was subgenotype A2. Genotyping of cysts from 21 patient samples revealed that they were assemblage B cysts; thus, the septic tank was unlikely to be the contamination source. Sequencing of the β-giardin and gdh genes from patient samples and a comparison of the sequences gave complex results. For the β-giardin gene, three isolates had sequences identical to subgenotype B3 sequences. However, other isolates had between one and four single-nucleotide polymorphisms (SNPs). For the gdh gene, none of the sequences were identical to the sequence published for subgenotype B3, and the sequences had between one and three SNPs. One isolate, which was identical to subgenotype B3 at the β-giardin gene, was more similar to subgenotype B2 at the gdh gene. Grouping the isolates on the basis of SNPs resulted in different groups for the two genes. The results are discussed in relation to giardiasis in Norway and to other Giardia genotyping studies. PMID:16517674

Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

PubMed

Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

2005-05-01

Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

Microbial genomic taxonomy

PubMed Central

2013-01-01

A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132

Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

PubMed Central

Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

2012-01-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

PubMed Central

Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

1991-01-01

The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

High Fragmentation Steel Production Process

DTIC Science & Technology

1981-08-01

Hsv j , —U -I* : -’ 1 . ’ ; - * - 1 "^Sv i ! :.:.; 1 HEBUCTIOK AHU.,, .../y?.;-’" • jttoireAnoi..|..r!.5^«. ::^;;;i:^l^~!’in...on rmrerae aide 11 neceaaary and Identity by block number) HF- 1 Steel Metallurgical Evaluation MMT-Process improvement 20. ABSTRACT ("ContfBu...ao reraram attba tt n*c*aaMey and. IderUlty by block numbat) Two heats of B0F HF- 1 steel were purchased, one from Republic Steel and one from

A General Model of Production: Theory and Application

DTIC Science & Technology

1984-01-01

It may be verified that X2 , - (o.1) and y2a, -,O and thus dearly the nets {x2,), LA ,,) satisfy the conditions of Proposition (3.4.6) but violate the...and (4-1d) are identical. This example shows thai, two See ,ao La a a oWBO Y=1921. >........................... *’*** . . . 89 /00- aa b (a) Detailed...intensities. 4.3.1. Constructing the Domain of the Aggregate Operating Intensity L_., A represent an aggregate activity. As notation, let EA min El, LA

Identification and analysis of cytochrome P450IID6 antigenic sites recognized by anti-liver-kidney microsome type-1 antibodies (LKM1).

PubMed

Yamamoto, A M; Cresteil, D; Boniface, O; Clerc, F F; Alvarez, F

1993-05-01

Anti-liver-kidney microsome type-1 antibodies (LKM1), present in sera from a group of patients with autoimmune hepatitis, are directed against P450IID6. Previous work, using cDNA constructions spanning most of the P450IID6 protein defined the main immunogenic site between the amino acids (aa), 254-271 and predicted the presence of other putative immunogenic sites in the molecule. Fusion proteins from new cDNA constructions, spanning so-far-untested regions between aa 1-125 and 431-522, were not recognized by LKM1-positive sera. Synthetic peptides, representing sequences from putative immunogenic regions or previously untested regions, allowed a precise definition of four antigenic sites located between peptides 257-269, 321-351, 373-389 and 410-429, which were recognized, respectively, by 14, 8, 1 and 2 out of 15 LKM1-positive sera tested. The minimal sequence of the main antigenic site (peptide 257-269) recognized by the autoantibody was established to be WDPAQPPRD (peptide 262-270). In addition, deletion and replacement experiments showed that aa 263 (Asp) was essential for the binding of the autoantibody to peptide 262-270. Analysis of the second most frequently recognized peptide between aa 321-351, was performed using peptides 321-339 and 340-351 in competitive inhibition studies. Complete elimination of antibody binding to peptide 321-351 obtained by absorption of both shorter peptides indicated that peptide 321-351 is a discontinuous antigenic site. LKM1-positive sera reacting against peptide 321-351 recognized either both the shorter peptides or just one of them preferentially. Results of the present study suggest that the production of LKM1 antibodies is an antigen-driven, poly- or oligoclonal B cell response. The identification of antigenic sites will allow: (i) the development of specific diagnostic tests and (ii) further studies on the pathogenic value of LKM1 antibodies in autoimmune hepatitis.

The existence of fertile hybrids of closely related model earthworm species, Eisenia andrei and E. fetida

PubMed Central

Bigaj, Janusz; Osikowski, Artur; Hofman, Sebastian; Falniowski, Andrzej; Panz, Tomasz; Grzmil, Pawel; Vandenbulcke, Franck

2018-01-01

Lumbricid earthworms Eisenia andrei (Ea) and E. fetida (Ef) are simultaneous hermaphrodites with reciprocal insemination capable of self-fertilization while the existence of hybridization of these two species was still debatable. During the present investigation fertile hybrids of Ea and Ef were detected. Virgin specimens of Ea and Ef were laboratory crossed (Ea+Ef) and their progeny was doubly identified. 1 –identified by species-specific maternally derived haploid mitochondrial DNA sequences of the COI gene being either ‘a’ for worms hatched from Ea ova or ‘f’ for worms hatched from Ef ova. 2 –identified by the diploid maternal/paternal nuclear DNA sequences of 28s rRNA gene being either ‘AA’ for Ea, ‘FF’ for Ef, or AF/FA for their hybrids derived either from the ‘aA’ or ‘fF’ ova, respectively. Among offspring of Ea+Ef pairs in F1 generation there were mainly aAA and fFF earthworms resulted from the facilitated self-fertilization and some aAF hybrids from aA ova but none fFA hybrids from fF ova. In F2 generation resulting from aAF hybrids mated with aAA a new generations of aAA and aAF hybrids were noticed, while aAF hybrids mated with fFF gave fFF and both aAF and fFA hybrids. Hybrids intercrossed together produced plenty of cocoons but no hatchlings independently whether aAF+aAF or aAF+fFA were mated. These results indicated that Ea and Ef species, easy to maintain in laboratory and commonly used as convenient models in biomedicine and ecotoxicology, may also serve in studies on molecular basis of interspecific barriers and mechanisms of introgression and speciation. Hypothetically, their asymmetrical hybridization can be modified by some external factors. PMID:29370238

Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

PubMed

El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

2013-07-01

Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

Association of aplastic anemia and FoxP3 gene polymorphisms in Koreans.

PubMed

In, Ji Won; Lee, Nuri; Roh, Eun Youn; Shin, Sue; Park, Kyoung Un; Song, Eun Young

2017-04-01

Aplastic anemia (AA) is characterized by pancytopenia and bone marrow failure, and most acquired AA is an immune-mediated disorder. Regulatory T cells (T regs ) suppressing autoreactive T cells were decreased in AA patients. FoxP3 is a major regulator for the development and function of T regs . Polymorphism in FoxP3 was shown to be associated with various autoimmune diseases, however, has not yet been studied in AA. In this study, we examined the association between FoxP3 polymorphisms and AA in Korean patients. The study population consisted of 94 patients diagnosed by bone marrow examination in Seoul National University Hospital (SNUH) during 1997-2012 and 195 healthy controls. FoxP3 polymorphisms (rs5902434 del/ATT, rs3761548 C/A, rs3761549 C/T, rs2232365 A/G) were analyzed by PCR-sequencing method. We analyzed differences of genotype and allele frequencies between patients and controls. We also compared differences of genotype and allele frequencies between responder and non-responder in patients treated with immunosuppressive therapy (IST). For the statistical analysis, the chi-square test and Fisher's exact test were used and P < 0.05 was regarded as statistically significant. There was no significant difference in the genotype frequencies of FoxP3 polymorphisms between patients and controls. With regards to the allele frequencies, rs3761548 C allele was significantly higher in AA patients than in controls (87.4% vs. 79.7%, P = 0.047). In patients treated with IST, rs3761549 C allele was significantly higher in non-responder patients than in responders (89.6% vs. 66.7%, P = 0.036) and female rs3761549 C/C genotype carriers were associated with greater risk for non-response to IST (84.2% vs. 16.7%, P = 0.006). Polymorphisms in rs3761548 and rs3761549 of FoxP3 in our population were associated with disease susceptibility and response for IST, respectively. This study suggests an association between FoxP3 polymorphisms and AA in Korean patients and will be useful in further understanding the genetic basis of disease susceptibility and response to IST in AA patients.

76 FR 40074 - Unified Agenda of Federal Regulatory and Deregulatory Actions

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-07

... barges found abandoned and help prevent future marine pollution. This rulemaking supports the Coast Guard... Sequence No. Title Identifier No. 214 Claims Procedures Under 1625-AA03 the Oil Pollution Act of 1990 (USCG... (USCG) Prerule Stage 214. Claims Procedures Under the Oil Pollution Act of 1990 (USCG-2004- 17697) Legal...

77 FR 8034 - Semiannual Regulatory Agenda and Fiscal Year 2011 Regulatory Plan

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-13

... ``no'' for such fields. Because the CFPB is at an early stage of its operations, it is still in the... Financial Protection Bureau--Prerule Stage Regulation Sequence No. Title Identifier No. 492 Business Lending Data 3170-AA09 (Regulation B). Consumer Financial Protection Bureau--Proposed Rule Stage Regulation...

High-level expression of human stem cell factor fused with erythropoietin mimetic peptide in Escherichia coli.

PubMed

Su, Lin; Chen, Song-Sen; Yang, Ke-Gong; Liu, Chang-Zheng; Zhang, Yan-Li; Liang, Zhi-Quan

2006-06-01

Stem cell factor (SCF) and erythropoietin are essential for normal erythropoiesis and induce proliferation and differentiation synergistically for erythroid progenitor cells. Here, we report our work on construction of SCF/erythropoietin mimetic peptide (EMP) fusion protein gene, in which human SCF cDNA (1-165aa) and EMP sequence (20aa) were connected using a short (GGGGS) or long (GGGGSGGGGGS) linker sequence. The SCF/EMP gene was cloned into the pBV220 vector and expressed in the Escherichia coli DH5alpha strain. The expression level of the fusion protein was about 30% of total cell protein. The resulting inclusion bodies were solubilized with 8 M urea, followed by dilution refolding. The renatured protein was subsequently purified by Q-Sepharose FF column. The final product was >95% pure by SDS-PAGE and the yield of fusion protein was about 40 mg/L of culture. UT-7 cell proliferation and human cord blood cell colony-forming assays showed that the fusion proteins exhibited more potent activity than recombinant human SCF, suggesting a new strategy to enhance biological activities of growth factors.

Primary structure of the Aequorea victoria green-fluorescent protein.

PubMed

Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

1992-02-15

Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

Structure analysis of Si(111)-7 × 7 reconstructed surface by transmission electron diffraction

NASA Astrophysics Data System (ADS)

Takayanagi, Kunio; Tanishiro, Yasumasa; Takahashi, Shigeki; Takahashi, Masaetsu

1985-12-01

The atomic structure of the 7 × 7 reconstructed Si(111) surface has been analysed by ultra-high vacuum (UHV) transmission electron diffraction (TED). A possible projected structure of the surface is deduced from the intensity distribution in TED patterns of normal electron incidence and from Patterson and Fourier syntheses of the intensities. A new three-dimensional structure model, the DAS model, is proposed: The model consists of 12 adatoms arranged locally in the 2 × 2 structure, a stacking fault layer and a layer with a vacancy at the corner and 9 dimers on the sides of each of the two triangular subcells of the 7 × 7 unit cell. The silicon layers in one subcell are stacked with the normal sequence, CcAaB + adatoms, while those in the other subcell are stacked with a faulted sequence, CcAa/C + adatoms. The model has only 19 dangling bonds, the smallest number among models so far proposed. Previously proposed models are tested quantitatively by the TED intensity. Advantages and limits of the TED analysis are discussed.

Ketide Synthase (KS) Domain Prediction and Analysis of Iterative Type II PKS Gene in Marine Sponge-Associated Actinobacteria Producing Biosurfactants and Antimicrobial Agents

PubMed Central

Selvin, Joseph; Sathiyanarayanan, Ganesan; Lipton, Anuj N.; Al-Dhabi, Naif Abdullah; Valan Arasu, Mariadhas; Kiran, George S.

2016-01-01

The important biological macromolecules, such as lipopeptide and glycolipid biosurfactant producing marine actinobacteria were analyzed and their potential linkage between type II polyketide synthase (PKS) genes was explored. A unique feature of type II PKS genes is their high amino acid (AA) sequence homology and conserved gene organization. These enzymes mediate the biosynthesis of polyketide natural products with enormous structural complexity and chemical nature by combinatorial use of various domains. Therefore, deciphering the order of AA sequence encoded by PKS domains tailored the chemical structure of polyketide analogs still remains a great challenge. The present work deals with an in vitro and in silico analysis of PKS type II genes from five actinobacterial species to correlate KS domain architecture and structural features. Our present analysis reveals the unique protein domain organization of iterative type II PKS and KS domain of marine actinobacteria. The findings of this study would have implications in metabolic pathway reconstruction and design of semi-synthetic genomes to achieve rational design of novel natural products. PMID:26903957

STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

PubMed Central

Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

1994-01-01

We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

Perceptions of racism in healthcare among patients with systemic lupus erythematosus: a cross-sectional study

PubMed Central

Vina, Ernest R; Hausmann, Leslie R M; Utset, Tammy O; Masi, Christopher M; Liang, Kimberly P; Kwoh, C Kent

2015-01-01

Background Racial disparities in the clinical outcomes of systemic lupus erythematosus (SLE) exist. Perceived racial discrimination may contribute to disparities in health. Objectives To determine if perceived racism in healthcare differs by race among patients with SLE and to evaluate its contribution to racial disparities in SLE-related outcomes. Methods 163 African–American (AA) and 180 white (WH) patients with SLE were enrolled. Structured interviews and chart reviews were done to determine perceptions of racism, SLE-related outcomes (Systemic Lupus International Collaborating Clinics (SLICC) Damage Index, SLE Disease Activity, Center for Epidemiologic Studies-Depression (CES-D)), and other variables that may affect perceptions of racism. Serial hierarchical multivariable logistic regression models were conducted. Race-stratified analyses were also performed. Results 56.0% of AA patients compared with 32.8% of WH patients had high perceptions of discrimination in healthcare (p<0.001). This difference remained (OR 4.75 (95% CI 2.41 to 8.68)) after adjustment for background, identity and healthcare experiences. Female gender (p=0.012) and lower trust in physicians (p<0.001) were also associated with high perceived racism. The odds of having greater disease damage (SLICC damage index ≥2) were higher in AA patients than in WH patients (crude OR 1.55 (95% CI 1.01 to 2.38)). The odds of having moderate to severe depression (CES-D ≥17) were also higher in AA patients than in WH patients (crude OR 1.94 (95% CI 1.26 to 2.98)). When adjusted for sociodemographic and clinical characteristics, racial disparities in disease damage and depression were no longer significant. Among AA patients, higher perceived racism was associated with having moderate to severe depression (adjusted OR 1.23 (95% CI 1.05 to 1.43)) even after adjusting for sociodemographic and clinical variables. Conclusions Perceptions of racism in healthcare were more common in AA patients than in WH patients with SLE and were associated with depression. Interventions aimed at modifiable factors (eg, trust in providers) may reduce higher perceptions of race-based discrimination in SLE. PMID:26322238

The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).

PubMed

Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

2011-05-01

The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.

Complete genome analysis of jasmine virus T from Jasminum sambac in China.

PubMed

Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

2016-07-01

The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

New Ehrlichia Species Closely Related to Ehrlichia chaffeensis Isolated from Ixodes ovatus Ticks in Japan

PubMed Central

Shibata, Shin-ichiro; Kawahara, Makoto; Rikihisa, Yasuko; Fujita, Hiromi; Watanabe, Yuriko; Suto, Chiharu; Ito, Tadahiko

2000-01-01

Seven Ehrlichia strains (six HF strains and one Anan strain) that were obtained from laboratory mice by intraperitoneally inoculating homogenates of adult Ixodes ovatus collected in Japan were characterized. 16S rRNA sequences of all six HF strains were identical, and the sequences were 99.7, 98.2, and 97.7% identical to those of Anan strain, Ehrlichia chaffeensis (human monocytic ehrlichiosis agent), and E. muris, respectively. Partial GroEL amino acid sequencing also revealed that the six HF strains had identical sequences, which were 99.0, 98.5, and 97.3% identical to those of E. chaffeensis, the Anan strain, and E. canis, respectively. All HF strains were lethal to mice at higher dosages and intraperitoneal inoculation, whereas the Anan or E. muris strain induced only mild clinical signs. Light and electron microscopy of moribund mice inoculated with one of the HF strains revealed severe liver necrosis and the presence of numerous ehrlichial inclusions (morulae) in various organs. The study revealed that members of E. canis genogroup are naturally present in Ixodes ticks. HF strains that can cause severe illness in immunocompetent laboratory mice would be valuable in studying the pathogenesis and the roles of both cellular and humoral immune responses in ehrlichiosis caused by E. canis genogroup. PMID:10747103

Promoter Variant-Dependent mRNA Expression of the MEF2A in Longissimus Dorsi Muscle in Cattle

PubMed Central

Starzyński, Rafał Radosław; Wicińska, Krystyna; Flisikowski, Krzysztof

2012-01-01

The myocyte enhancer factor 2A (MEF2A) gene encodes a member of the myocyte enhancer factor 2 (MEF2) protein family that is involved in vertebrate skeletal, cardiac, and smooth muscle development and differentiation during myogenesis. According to recent studies, MEF2 genes might be major regulators of postnatal skeletal muscle growth; thus, they are considered to be important, novel candidates for muscle development and body growth in farm animals. The aim of the present study was to search for polymorphisms in the bovine MEF2A gene and analyze their effect on the MEF2A mRNA expression level in the longissimus dorsi muscle of Polish Holstein-Fresian cattle. In total, 4094 bp of the whole coding sequence and the promoter region of MEF2A were re-sequenced in 30 animals, resulting in the detection of 6 novel variants as well as one previously reported SNP. Three linked mutations in the promoter region (-780T/G, g.-768T/G, and g.-222A/G) and only two genotypes were identified in two Polish breeds (TTA/TTA and TTA/GGG). Three SNPs in the coding region [g.1599G/A (421aa), g.1626G/A (429aa), and g.1641G/A (434aa)] appeared to be silent substitutions and segregated as two intragene haplotypes: GGG and AAA. Expression analysis showed that the mutations in the promoter region are highly associated with the MEF2A mRNA level in the longissimus dorsi muscle of bulls carrying two different genotypes. The higher MEF2A mRNA level was estimated in the muscle of bulls carrying the TTA/TTA (p<0.01) genotype as compared with those with TTA/GGG. The results obtained suggest that the nucleotide sequence mutation in MEF2A might be useful marker for body growth traits in cattle. PMID:22320864

Amino acid similarities and divergences in the small surface proteins of genotype C hepatitis B viruses between nucleos(t)ide analogue-naïve and lamivudine-treated patients with chronic hepatitis B.

PubMed

Ding, Hai; Liu, Baoming; Zhao, Chengyu; Yang, Jingxian; Yan, Chunhui; Yan, Ling; Zhuang, Hui; Li, Tong

2014-02-01

Entire C-genotype small hepatitis B surface (SHBs) sequences were isolated from 139 nucleos(t)ide analogues (NA)-naïve and 74 lamivudine (LMV)-treated chronic hepatitis B (CHB) patients. The conservation and variability of total 226 amino acids (AAs) within the sequences were determined individually, revealing significant higher mutant isolate rate and mutation frequency in LMV-treated cohort than those in the NA-naïve one (P=0.009 and 0.0001, respectively). Three absolutely conserved fragments (s16-s19, s176-s181 and s185-s188) and seven moderately conserved regions (a few AA sites acquiring increased variability after LMV-treatment) were identified. The significant mutation rate increase after LMV-treatment occurred primarily in major hydrophilic region (except 'a' determinant) and transmembrane domain 3/4, but not in other upstream functional regions of SHBs. With little influence on immune escape-associated mutation frequencies within 'a' determinant, LMV-monotherapy significantly induced classical LMVr-associated mirror changes sE164D/rtV173L, sI195M/rtM204V and sW196L/S/rtM204I, as well as non-classical ones sG44E/rtS53N, sT47K/A/rtH55R/Q and sW182stop/rtV191I outside 'a' determinant. Interestingly, another newly-identified truncation mutation sC69stop/rtS78T decreased from 7.91% (11/139) in NA-naïve cohort to 2.70% (2/74) in LMV-treated one. Altogether, the altered AA conservation and diversity in SHBs sequences after LMV-treatment in genotype-C HBV infection might shed new insights into how LMV-therapy affects the SHBs variant evolution and its antigenicity. Copyright © 2013 Elsevier B.V. All rights reserved.

Indigenous and introduced potyviruses of legumes and Passiflora spp. from Australia: biological properties and comparison of coat protein sequences

USDA-ARS?s Scientific Manuscript database

Coat protein sequences of 33 Potyvirus isolates from legume and Passiflora spp. were sequenced to determine the identity of infecting viruses. Phylogenetic analysis of the sequences revealed the presence of seven distinct virus species....

Computer-assisted prediction of HLA-DR binding and experimental analysis for human promiscuous Th1-cell peptides in the 24 kDa secreted lipoprotein (LppX) of Mycobacterium tuberculosis.

PubMed

Al-Attiyah, R; Mustafa, A S

2004-01-01

The secreted 24 kDa lipoprotein (LppX) is an antigen that is specific for Mycobacterium tuberculosis complex and M. leprae. The present study was carried out to identify the promiscuous T helper 1 (Th1)-cell epitopes of the M. tuberculosis LppX (MT24, Rv2945c) antigen by using 15 overlapping synthetic peptides (25 mers overlapping by 10 residues) covering the sequence of the complete protein. The analysis of Rv2945c sequence for binding to 51 alleles of nine serologically defined HLA-DR molecules, by using a virtual matrix-based prediction program (propred), showed that eight of the 15 peptides of Rv2945c were predicted to bind promiscuously to >/=10 alleles from more than or equal to three serologically defined HLA-DR molecules. The Th1-cell reactivity of all the peptides was assessed in antigen-induced proliferation and interferon-gamma (IFN-gamma)-secretion assays with peripheral blood mononuclear cells (PBMCs) from 37 bacille Calmette-Guérin (BCG)-vaccinated healthy subjects. The results showed that 17 of the 37 donors, which represented an HLA-DR-heterogeneous group, responded to one or more peptides of Rv2945c in the Th1-cell assays. Although each peptide stimulated PBMCs from one or more donors in the above assays, the best positive responses (12/17 (71%) responders) were observed with the peptide p14 (aa 196-220). This suggested a highly promiscuous presentation of p14 to Th1 cells. In addition, the sequence of p14 is completely identical among the LppX of M. tuberculosis, M. bovis and M. leprae, which further supports the usefulness of Rv2945c and p14 in the subunit vaccine design against both tuberculosis and leprosy.

Endothelin Receptor B2 (EDNRB2) Gene Is Associated with Spot Plumage Pattern in Domestic Ducks (Anas platyrhynchos).

PubMed

Li, Ling; Li, Dan; Liu, Li; Li, Shijun; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

2015-01-01

Endothelin receptor B subtype 2 (EDNRB2) is a seven-transmembrane G-protein coupled receptor. In this study, we investigated EDNRB2 gene as a candidate gene for duck spot plumage pattern according to studies of chicken and Japanese quail. The entire coding region was cloned by the reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis showed that duck EDNRB2 cDNA contained a 1311 bp open reading frame and encoded a putative protein of 436 amino acids residues. The transcript shared 89%-90% identity with the counterparts in other avian species. A phylogenetic tree based on amino acid sequences showed that duck EDNRB2 was evolutionary conserved in avian clade. The entire coding region of EDNRB2 were sequenced in 20 spot and 20 non-spot ducks, and 13 SNPs were identified. Two of them (c.940G>A and c.995G>A) were non-synonymous substitutions, and were genotyped in 647 ducks representing non-spot and spot phenotypes. The c.995G>A mutation, which results in the amino acid substitution of Arg332His, was completely associated with the spot phenotype: all 152 spot ducks were carriers of the AA genotype and the other 495 individuals with non-spot phenotype were carriers of GA or GG genotype, respectively. Segregation in 17 GA×GG and 22 GA×GA testing combinations confirmed this association since the segregation ratios and genotypes of the offspring were in agreement with the hypothesis. In order to investigate the underlying mechanism of the spot phenotype, MITF gene was used as cell type marker of melanocyte progenitor cells while TYR and TYRP1 gene were used as cell type markers of mature melanocytes. Transcripts of MITF, TYR and TYRP1 gene with expected size were identified in all pigmented skin tissues while PCR products were not obtained from non-pigmented skin tissues. It was inferred that melanocytes are absent in non-pigmented skin tissues of spot ducks.

Isolation and Semi Quantitative PCR of Na+/H+ Antiporter (SOS1 and NHX) Genes under Salinity Stress in Kochia scoparia.

PubMed

Fahmideh, Leila; Fooladvand, Ziba

2018-01-01

Kochia scoparia is a dicotyledonous annual herb and belongs to the Amaranthaceae family. Genetic diversity and resistance to drought stress of this plant has made it widely scattered in different regions which contains highly genetic diversity and great potential as fodder and can grow on salty, drought affected areas. Since the soil salinity has become widely spread, environmental concern has sparked so many debates. An important limiting factor in agricultural production worldwide is the sensitivity of most of the crop to salinity caused by high concentration of salts soil. Plants use three different strategies to prevent and adapt to high Na + concentrations. Antiporters are important category of genes that play a pivotal role in ion homeostasis in plants. Na + /H + antiporters (NHX1 and SOS1) are located in tonoplasts and reduce cytosolic Na + concentration by pumping in the vacuole whereas SOS1 is localized at the plasma membrane and extrudes Na + in apoplasts. Coding sequence of plasma membrane Na + /H + antiporter (SOS1) and vacuole membrane Na + /H + antiporter (NHX) in Kochia scoparia were isolated using conserved sequences of SOS1 and NHX. Also, expression profile under salinity stress was studied in this study. The amino acid sequences (aa) of the isolated region of K.SSOS1 and K.SNHX showed the maximum identity up to 84% and 90% to its orthologous in salicornia brachiate and suede maritime, respectively. The results of semi-quantitative RT-PCR revealed that salinization has affected positively on SOS1 transcription level. The expression of K.SSOS1 and K.SNHX in leaves and roots of Kochia scoparia were progressively increased under all salinity levels compared to control. The results suggest that K.SSOS1 and K.SNHX play an essential role in salt tolerance of K.scoparia and they can be useful to improve salt tolerance in other crops.

Molecular identification of an androgen receptor and its changes in mRNA levels during 17α-methyltestosterone-induced sex reversal in the orange-spotted grouper Epinephelus coioides.

PubMed

Shi, Yu; Liu, Xiaochun; Zhang, Haifa; Zhang, Yong; Lu, Danqi; Lin, Haoran

2012-09-01

Androgens play a crucial role in sex differentiation, sexual maturation, and spermatogenesis in vertebrates. The action of androgens is mediated via androgen receptors (ARs). The present study reports the cloning of the cDNA sequence of the ar in the orange-spotted grouper, with high expression in testis and relatively low in subdivision of brain areas. The cDNA sequence of ar was 2358 bp, encoding a protein of 759 amino acids (aa). Phylogenetic analysis showed that the ar cDNA sequence was closely related to that of threespot wrasse (Halichoeres trimaculatus) and medaka (Oryzias latipes) arβ. As deduced from the phylogenetic tree and the high amino acid identity with the ARβ subtype of other teleosts, grouper ar seems to be more closely related to the beta than the alpha subtype cloned to date. In the first week after 17α-methyltestosterone (MT) implantation, the transcript levels of ar in the hypothalamus declined significantly, and consistently stayed at low level expression to the second week, but increased back to the control levels in the third and fourth week. In the gonad, the mRNA expression of ar was not changed in the first week compared with the control, but increased significantly in the second week, consistently reached the highest level in the third week, dropped slightly but still higher than that of the control in the fourth week. The expression pattern of ar in hypothalamus and gonad during MT-induced sex reversal suggests the involvement of ar in regulating this process in the orange-spotted grouper. The present study provides the data of the changes in the mRNA levels of ar during MT-induced sex reversal in detail to help understand the complicated signals under sex reversal. Copyright © 2012 Elsevier Inc. All rights reserved.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Visualizing bacterial tRNA identity determinants and antideterminants using function logos and inverse function logos

PubMed Central

Freyhult, Eva; Moulton, Vincent; Ardell, David H.

2006-01-01

Sequence logos are stacked bar graphs that generalize the notion of consensus sequence. They employ entropy statistics very effectively to display variation in a structural alignment of sequences of a common function, while emphasizing its over-represented features. Yet sequence logos cannot display features that distinguish functional subclasses within a structurally related superfamily nor do they display under-represented features. We introduce two extensions to address these needs: function logos and inverse logos. Function logos display subfunctions that are over-represented among sequences carrying a specific feature. Inverse logos generalize both sequence logos and function logos by displaying under-represented, rather than over-represented, features or functions in structural alignments. To make inverse logos, a compositional inverse is applied to the feature or function frequency distributions before logo construction, where a compositional inverse is a mathematical transform that makes common features or functions rare and vice versa. We applied these methods to a database of structurally aligned bacterial tDNAs to create highly condensed, birds-eye views of potentially all so-called identity determinants and antideterminants that confer specific amino acid charging or initiator function on tRNAs in bacteria. We recovered both known and a few potentially novel identity elements. Function logos and inverse logos are useful tools for exploratory bioinformatic analysis of structure–function relationships in sequence families and superfamilies. PMID:16473848

Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruzen, M.E.

1993-01-01

Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less

Structural characterization of the N-terminal mineral modification domains from the molluscan crystal-modulating biomineralization proteins, AP7 and AP24.

PubMed

Wustman, Brandon A; Morse, Daniel E; Evans, John Spencer

2004-08-05

The AP7 and AP24 proteins represent a class of mineral-interaction polypeptides that are found in the aragonite-containing nacre layer of mollusk shell (H. rufescens). These proteins have been shown to preferentially interfere with calcium carbonate mineral growth in vitro. It is believed that both proteins play an important role in aragonite polymorph selection in the mollusk shell. Previously, we demonstrated the 1-30 amino acid (AA) N-terminal sequences of AP7 and AP24 represent mineral interaction/modification domains in both proteins, as evidenced by their ability to frustrate calcium carbonate crystal growth at step edge regions. In this present report, using free N-terminal, C(alpha)-amide "capped" synthetic polypeptides representing the 1-30 AA regions of AP7 (AP7-1 polypeptide) and AP24 (AP24-1 polypeptide) and NMR spectroscopy, we confirm that both N-terminal sequences possess putative Ca (II) interaction polyanionic sequence regions (2 x -DD- in AP7-1, -DDDED- in AP24-1) that are random coil-like in structure. However, with regard to the remaining sequences regions, each polypeptide features unique structural differences. AP7-1 possesses an extended beta-strand or polyproline type II-like structure within the A11-M10, S12-V13, and S28-I27 sequence regions, with the remaining sequence regions adopting a random-coil-like structure, a trait common to other polyelectrolyte mineral-associated polypeptide sequences. Conversely, AP24-1 possesses random coil-like structure within A1-S9 and Q14-N16 sequence regions, and evidence for turn-like, bend, or loop conformation within the G10-N13, Q17-N24, and M29-F30 sequence regions, similar to the structures identified within the putative elastomeric proteins Lustrin A and sea urchin spicule matrix proteins. The similarities and differences in AP7 and AP24 N-terminal domain structure are discussed with regard to joint AP7-AP24 protein modification of calcium carbonate growth. Copyright 2004 Wiley Periodicals, Inc.

The unique self-assembly/disassembly property of Archaeoglobus fulgidus ferritin and its implications on molecular release from the protein cage.

PubMed

Sana, Barindra; Johnson, Eric; Lim, Sierin

2015-12-01

In conventional in vitro encapsulation of molecular cargo, the multi-subunit ferritin protein cages are disassembled in extremely acidic pH and re-assembled in the presence of highly concentrated cargo materials, which results in poor yields due to the low-pH treatment. In contrast, Archaeoglobus fulgidus open-pore ferritin (AfFtn) and its closed-pore mutant (AfFtn-AA) are present as dimeric species in neutral buffers that self-assemble into cage-like structure upon addition of metal ions. To understand the iron-mediated self-assembly and ascorbate-mediated disassembly properties, we studied the iron binding and release profile of the AfFtn and AfFtn-AA, and the corresponding oligomerization of their subunits. Fe(2+) binding and conversion to Fe(3+) triggered the self-assembly of cage-like structures from dimeric species of AfFtn and AfFtn-AA subunits, while disassembly was induced by dissolving the iron core with reducing agents. The closed-pore AfFtn-AA has identical iron binding kinetics but lower iron release rates when compared to AfFtn. While the iron binding rate is proportional to Fe(2+) concentration, the iron release rate can be controlled by varying ascorbate concentrations. The AfFtn and AfFtn-AA cages formed by iron mineralization could be disassembled by dissolving the iron core. The open-pores of AfFtn contribute to enhanced reductive iron release while the small channels located at the 3-fold symmetry axis (3-fold channels) are used for iron uptake. The iron-mediated self-assembly/disassembly property of AfFtn offers a new set of molecular trigger for formation and dissociation of the protein cage, which can potentially regulate uptake and release of molecular cargo from protein cages. Copyright © 2015 Elsevier B.V. All rights reserved.

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Radiolabeled Escherichia coli heat-stable enterotoxin analogs for in vivo imaging of colorectal cancer

NASA Astrophysics Data System (ADS)

Giblin, M. F.; Sieckman, G. L.; Owen, N. K.; Hoffman, T. J.; Forte, L. R.; Volkert, W. A.

2005-12-01

The human Escherichia coli heat-stable enterotoxin (STh, amino acid sequence N1SSNYCCELCCNPACTGCY19) binds specifically to the guanylate cyclase C (GC-C) receptor, which is present in high density on the apical surface of normal intestinal epithelial cells as well as on the surface of human colon cancer cells. In the current study, two STh analogs were synthesized and evaluated in vitro and in vivo. Both analogs shared identical 6-19 core sequences, and had N-terminal pendant DOTA moieties. The analogs differed in the identity of a 6 amino acid peptide sequence intervening between DOTA and the 6-19 core. In one analog, the peptide was an RGD-containing sequence found in human fibronectin (GRGDSP), while in the other this peptide sequence was randomly scrambled (GRDSGP). The results indicated that the presence of the human fibronectin sequence in the hybrid peptide did not affect tumor localization in vivo.

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

PubMed

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

PubMed Central

Minkiewicz, Piotr; Darewicz, Małgorzata; Iwaniak, Anna; Sokołowska, Jolanta; Starowicz, Piotr; Bucholska, Justyna; Hrynkiewicz, Monika

2015-01-01

A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept. PMID:26340620

Novel Detection of Coxiella spp., Theileria luwenshuni, and T. ovis Endosymbionts in Deer Keds (Lipoptena fortisetosa).

PubMed

Lee, Seung-Hun; Kim, Kyoo-Tae; Kwon, Oh-Deog; Ock, Younsung; Kim, Taeil; Choi, Donghag; Kwak, Dongmi

2016-01-01

We describe for the first time the detection of Coxiella-like bacteria (CLB), Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae) by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tü57.

PubMed Central

Gaisser, S; Trefzer, A; Stockert, S; Kirschning, A; Bechthold, A

1997-01-01

A 65-kb region of DNA from Streptomyces viridochromogenes Tü57, containing genes encoding proteins involved in the biosynthesis of avilamycins, was isolated. The DNA sequence of a 6.4-kb fragment from this region revealed four open reading frames (ORF1 to ORF4), three of which are fully contained within the sequenced fragment. The deduced amino acid sequence of AviM, encoded by ORF2, shows 37% identity to a 6-methylsalicylic acid synthase from Penicillium patulum. Cultures of S. lividans TK24 and S. coelicolor CH999 containing plasmids with ORF2 on a 5.5-kb PstI fragment were able to produce orsellinic acid, an unreduced version of 6-methylsalicylic acid. The amino acid sequence encoded by ORF3 (AviD) is 62% identical to that of StrD, a dTDP-glucose synthase from S. griseus. The deduced amino acid sequence of AviE, encoded by ORF4, shows 55% identity to a dTDP-glucose dehydratase (StrE) from S. griseus. Gene insertional inactivation experiments of aviE abolished avilamycin production, indicating the involvement of aviE in the biosynthesis of avilamycins. PMID:9335272

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.

PubMed

Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide

2017-06-01

To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Biochemical characterization of microbial type terpene synthases in two closely related species of hornworts, Anthoceros punctatus and Anthoceros agrestis.

PubMed

Xiong, Wangdan; Fu, Jianyu; Köllner, Tobias G; Chen, Xinlu; Jia, Qidong; Guo, Haobo; Qian, Ping; Guo, Hong; Wu, Guojiang; Chen, Feng

2018-05-01

Microbial terpene synthase-like (MTPSL) genes are a type of terpene synthase genes only recently identified in plants. In contrast to typical plant terpene synthase genes, which are ubiquitous in land plants, MTPSL genes appear to occur only in nonseed plants. Our knowledge of catalytic functions of MTPSLs is very limited. Here we report biochemical characterization of the enzymes encoded by MTPSL genes from two closely related species of hornworts, Anthoceros punctatus and Anthoceros agrestis. Seven full-length MTPSL genes were identified in A. punctatus (ApMTPSL1-7) based on the analysis of its genome sequence. Using homology-based cloning, the apparent orthologs for six of the ApMTPSL genes, except ApMTPSL2, were cloned from A. agrestis. They were designated AaMTPSL1, 3-7. The coding sequences for each of the 13 Anthoceros MTPSL genes were cloned into a protein expression vector. Escherichia coli-expressed recombinant MTPSLs from hornworts were assayed for terpene synthase activities. Six ApMTPSLs and five AaMTPSLs, except for ApMTPSL5 and AaMTPSL5, showed catalytic activities with one or more isoprenyl diphosphate substrates. All functional MTPSLs exhibited sesquiterpene synthase activities. In contrast, only ApMTPSL7 and AaMTPSL7 showed monoterpene synthase activity and only ApMTPSL2, ApMTPSL6 and AaMTPSL6 showed diterpene synthase activity. Most MTPSLs from Anthoceros contain uncanonical aspartate-rich motif in the form of either 'DDxxxD' or 'DDxxx'. Homology-based structural modeling analysis of ApMTPSL1 and ApMTPSL7, which contain 'DDxxxD' and 'DDxxx' motif, respectively, showed that 'DDxxxD' and 'DDxxx' motifs are localized in the similar positions as the canonical 'DDxxD' motif in known terpene synthases. To further understand the role of individual aspartate residues in the motifs, ApMTPSL1 and ApMTPSL7 were selected as two representatives for site-directed mutagenesis studies. No activities were detected when any of the conserved aspartic acid was mutated into alanine. This study provides new information about the catalytic functions of MTPSLs and the functionality of their uncanonical aspartate-rich motifs, and builds a knowledge base for studying the biological importance of MTPSL genes and their terpene products in nonseed plants. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effect of Bacillus subtilis and Bacillus licheniformis supplementation in diets with low- and high-protein content on ileal crude protein and amino acid digestibility and intestinal microbiota composition of growing pigs.

PubMed

Kaewtapee, Chanwit; Burbach, Katharina; Tomforde, Georgina; Hartinger, Thomas; Camarinha-Silva, Amélia; Heinritz, Sonja; Seifert, Jana; Wiltafsky, Markus; Mosenthin, Rainer; Rosenfelder-Kuon, Pia

2017-01-01

Bacillus spp. seem to be an alternative to antimicrobial growth promoters for improving animals' health and performance. However, there is little information on the effect of Bacillus spp. in combination with different dietary crude protein (CP) levels on the ileal digestibility and microbiota composition. Therefore, the objective of this study was to determine the effect of Bacillus spp. supplementation to low- (LP) and high-protein diets (HP) on ileal CP and amino acid (AA) digestibility and intestinal microbiota composition. Eight ileally cannulated pigs with an initial body weight of 28.5 kg were randomly allocated to a row-column design with 8 pigs and 3 periods of 16 d each. The assay diets were based on wheat-barley-soybean meal with two protein levels: LP (14% CP, as-fed) and HP diet (18% CP, as-fed). The LP and HP diets were supplemented with or without Bacillus spp. at a level of 0.04% (as-fed). The apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of CP and AA was determined. Bacterial community composition from ileal digesta was analyzed by Illumina amplicon sequencing and quantitative real-time PCR. Data were analyzed as a 2 × 2 factorial design using the GLIMMIX procedures of SAS. The supplementation with Bacillus spp. did not affect both AID and SID of CP and AA in growing pigs. Moreover, there was no difference in AID of CP and AA between HP and LP diets, but SID of cystine, glutamic acid, glycine, and proline was lower ( P  < 0.05) in pigs fed the HP diets. The HP diets increased abundance of Bifidobacterium spp. and Lactobacillus spp., ( P  < 0.05) and by amplicon sequencing the latter was identified as predominant genus in microbiota from HP with Bacillus spp., whereas dietary supplementation of Bacillus spp. increased ( P  < 0.05) abundance of Roseburia spp.. The HP diet increased abundance of Lactobacillus spp. and Bifidobacterium spp.. The supplementation of Bacillus spp. resulted in a higher abundance of healthy gut associated bacteria without affecting ileal CP and AA digestibility, whereas LP diet may reduce the flow of undigested protein to the large intestine of pigs.

Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

PubMed

Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

2002-06-01

Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

Molecular epidemiological and phylogenetic analyses of canine parvovirus in domestic dogs and cats in Beijing, 2010-2013.

PubMed

Wu, Jing; Gao, Xin-Tao; Hou, Shao-Hua; Guo, Xiao-Yu; Yang, Xue-Shong; Yuan, Wei-Feng; Xin, Ting; Zhu, Hong-Fei; Jia, Hong

2015-10-01

Fifty-five samples (15.62%) collected from dogs and cats were identified as canine parvovirus (CPV) infection in Beijing during 2010-2013. The nucleotide identities and aa similarities were 98.2-100% and 97.7-100%, respectively, when compared with the reference isolates. Also, several synonymous and non-synonymous mutations were also recorded for the first time. New CPV-2a was dominant, accounting for 90.90% of the samples. Two of the 16 samples collected from cats were identified as new CPV-2a (12.5%), showing nucleotide identities of 100% with those from dogs. Twelve samples (15.78%) collected from completely immunized dogs were found to be new CPV-2a, which means CPV-2 vaccines may not provide sufficient protection for the epidemic strains.

Deep Sequencing Analysis of Apple Infecting Viruses in Korea

PubMed Central

Cho, In-Sook; Igori, Davaajargal; Lim, Seungmo; Choi, Gug-Seoun; Hammond, John; Lim, Hyoun-Sub; Moon, Jae Sun

2016-01-01

Deep sequencing has generated 52 contigs derived from five viruses; Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), Apple green crinkle associated virus (AGCaV), and Apricot latent virus (ApLV) were identified from eight apple samples showing small leaves and/or growth retardation. Nucleotide (nt) sequence identity of the assembled contigs was from 68% to 99% compared to the reference sequences of the five respective viral genomes. Sequences of ASPV and ASGV were the most abundantly represented by the 52 contigs assembled. The presence of the five viruses in the samples was confirmed by RT-PCR using specific primers based on the sequences of each assembled contig. All five viruses were detected in three of the samples, whereas all samples had mixed infections with at least two viruses. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV which were withal found in mixed infections in the tested samples. AGCaV was identified in assembled contigs ID 1012480 and 93549, which showed 82% and 78% nt sequence identity with ORF1 of AGCaV isolate Aurora-1. ApLV was identified in three assembled contigs, ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV isolate LA2. Deep sequencing assay was shown to be a valuable and powerful tool for detection and identification of known and unknown virome in infected apple trees, here identifying ApLV and AGCaV in commercial orchards in Korea for the first time. PMID:27721694

Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

PubMed

Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

2014-02-01

Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Immunogenicity of a recombinant fusion protein of tandem repeat epitopes of foot-and-mouth disease virus type Asia 1 for guinea pigs.

PubMed

Zhang, Q; Yang, Y Q; Zhang, Z Y; Li, L; Yan, W Y; Jiang, W J; Xin, A G; Lei, C X; Zheng, Z X

2002-01-01

In this study, the sequences of capsid protein VPI regions of YNAs1.1 and YNAs1.2 isolates of foot-and-mouth disease virus (FMDV) were analyzed and a peptide containing amino acids (aa) 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia I was assumed to contain B and T cell epitopes, because it is hypervariable and includes a cell attachment site RGD located in the G-H loop. The DNA fragments encoding aa 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia 1 were chemically synthesized and ligated into a tandem repeat of aa 133-158-20 approximately 34-133-158. In order to enhance its immunogenicity, the tandem repeat was inserted downstream of the beta-galactosidase gene in the expression vector pWR590. This insertion yielded a recombinant expression vector pAS1 encoding the fusion protein. The latter reacted with sera from FMDV type Asia 1-infected animals in vitro and elicited high levels of neutralizing antibodies in guinea pigs. The T cell proliferation in immunized animals increased following stimulation with the fusion protein. It is reported for the first time that a recombinant fusion protein vaccine was produced using B and T cell epitopes of FMDV type Asia 1 and that this fusion protein was immunogenic. The fusion protein reported here can serve as a candidate of fusion epitopes for design of a vaccine against FMDV type Asia 1.

Investigation of decolorization of textile wastewater in an anaerobic/aerobic biological activated carbon system (A/A BAC).

PubMed

Pasukphun, N; Vinitnantharat, S; Gheewala, S

2010-04-01

The aim of this study is to investigate the decolorization in anaerobic/aerobic biological activated carbon (A/A BAC) system. The experiment was divided into 2 stages; stage I is batch test for preliminary study of dye removal equilibrium time. The preliminary experiment (stage I) provided the optimal data for experimental design of A/A BAC system in SBR (stage II). Stage II is A/A BAC system imitated Sequencing Batch Reactor (SBR) which consist of 5 main periods; fill, react, settle, draw and idle. React period include anaerobic phase followed by aerobic phase. The BAC main media; Granular Activated Carbon (GAC), Mixed Cultures (MC) and Biological Activated Carbon (BAC) were used for dye and organic substances removal in three different solutions; Desizing Agent Solution (DAS), dye Solution (DS) and Synthetic Textile Wastewater (STW). Results indicate that GAC adsorption plays role in dye removal followed by BAC and MC activities, respectively. In the presence desizing agent, decolorization by MC was improved because desizing agent acts as co-substrates for microorganisms. It was found that 50% of dye removal efficiency was achieved in Fill period by MC. GC/MS analysis was used to identify dye intermediate from decolorization. Dye intermediate containing amine group was found in the solution and on BAC surfaces. The results demonstrated that combination of MC and BAC in the system promotes decolorization and dye intermediate removal. In order to improve dye removal efficiency in an A/A BAC system, replacement of virgin GAC, sufficient co-substrates supply and the appropriate anaerobic: aerobic period should be considered.

Mitochondrial DNA analyses reveal low genetic diversity in Culex quinquefasciatus from residential areas in Malaysia.

PubMed

Low, V L; Lim, P E; Chen, C D; Lim, Y A L; Tan, T K; Norma-Rashid, Y; Lee, H L; Sofian-Azirun, M

2014-06-01

The present study explored the intraspecific genetic diversity, dispersal patterns and phylogeographic relationships of Culex quinquefasciatus Say (Diptera: Culicidae) in Malaysia using reference data available in GenBank in order to reveal this species' phylogenetic relationships. A statistical parsimony network of 70 taxa aligned as 624 characters of the cytochrome c oxidase subunit I (COI) gene and 685 characters of the cytochrome c oxidase subunit II (COII) gene revealed three haplotypes (A1-A3) and four haplotypes (B1-B4), respectively. The concatenated sequences of both COI and COII genes with a total of 1309 characters revealed seven haplotypes (AB1-AB7). Analysis using tcs indicated that haplotype AB1 was the common ancestor and the most widespread haplotype in Malaysia. The genetic distance based on concatenated sequences of both COI and COII genes ranged from 0.00076 to 0.00229. Sequence alignment of Cx. quinquefasciatus from Malaysia and other countries revealed four haplotypes (AA1-AA4) by the COI gene and nine haplotypes (BB1-BB9) by the COII gene. Phylogenetic analyses demonstrated that Malaysian Cx. quinquefasciatus share the same genetic lineage as East African and Asian Cx. quinquefasciatus. This study has inferred the genetic lineages, dispersal patterns and hypothetical ancestral genotypes of Cx. quinquefasciatus. © 2013 The Royal Entomological Society.

Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

PubMed

Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

1997-03-01

cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

Discovery of 4-((3′R,4′S,5′R)-6″-Chloro-4′-(3-chloro-2-fluorophenyl)-1′-ethyl-2″-oxodispiro[cyclohexane-1,2′-pyrrolidine-3′,3″-indoline]-5′-carboxamido)bicyclo[2.2.2]octane-1-carboxylic Acid (AA-115/APG-115): A Potent and Orally Active Murine Double Minute 2 (MDM2) Inhibitor in Clinical Development

PubMed Central

2017-01-01

We previously reported the design of spirooxindoles with two identical substituents at the carbon-2 of the pyrrolidine core as potent MDM2 inhibitors. In this paper we describe an extensive structure–activity relationship study of this class of MDM2 inhibitors, which led to the discovery of 60 (AA-115/APG-115). Compound 60 has a very high affinity to MDM2 (Ki < 1 nM), potent cellular activity, and an excellent oral pharmacokinetic profile. Compound 60 is capable of achieving complete and long-lasting tumor regression in vivo and is currently in phase I clinical trials for cancer treatment. PMID:28339198

Data for analysis of mannose-6-phosphate glycans labeled with fluorescent tags

PubMed Central

Kang, Ji-Yeon; Kwon, Ohsuk; Gil, Jin Young; Oh, Doo-Byoung

2016-01-01

Mannose-6-phosphate (M-6-P) glycan plays an important role in lysosomal targeting of most therapeutic enzymes for treatment of lysosomal storage diseases. This article provides data for the analysis of M-6-P glycans by high-performance liquid chromatography (HPLC) and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. The identities of M-6-P glycan peaks in HPLC profile were confirmed by measuring the masses of the collected peak eluates. The performances of three fluorescent tags (2-aminobenzoic acid [2-AA], 2-aminobenzamide [2-AB], and 3-(acetyl-amino)-6-aminoacridine [AA-Ac]) were compared focusing on the analysis of bi-phosphorylated glycan (containing two M-6-Ps). The bi-phosphorylated glycan analysis is highly affected by the attached fluorescent tag and the hydrophilicity of elution solvent used in HPLC. The data in this article is associated with the research article published in “Comparison of fluorescent tags for analysis of mannose-6-phosphate glycans” (Kang et al., 2016 [1]). PMID:27222848

Data for analysis of mannose-6-phosphate glycans labeled with fluorescent tags.

PubMed

Kang, Ji-Yeon; Kwon, Ohsuk; Gil, Jin Young; Oh, Doo-Byoung

2016-06-01

Mannose-6-phosphate (M-6-P) glycan plays an important role in lysosomal targeting of most therapeutic enzymes for treatment of lysosomal storage diseases. This article provides data for the analysis of M-6-P glycans by high-performance liquid chromatography (HPLC) and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. The identities of M-6-P glycan peaks in HPLC profile were confirmed by measuring the masses of the collected peak eluates. The performances of three fluorescent tags (2-aminobenzoic acid [2-AA], 2-aminobenzamide [2-AB], and 3-(acetyl-amino)-6-aminoacridine [AA-Ac]) were compared focusing on the analysis of bi-phosphorylated glycan (containing two M-6-Ps). The bi-phosphorylated glycan analysis is highly affected by the attached fluorescent tag and the hydrophilicity of elution solvent used in HPLC. The data in this article is associated with the research article published in "Comparison of fluorescent tags for analysis of mannose-6-phosphate glycans" (Kang et al., 2016 [1]).

Resistance of different stocks and transferrin genotypes of coho salmon, Oncorhynchus kisutch, and steelhead trout, Salmo gairdneri, to bacterial kidney disease and vibriosis

USGS Publications Warehouse

Winter , Gary W.; Schreck, Carl B.; McIntyre, John D.

1979-01-01

Juvenile coho salmon and steelhead trout ofdifferentstocks and three transferrin genotypes(AA, AC, and CCl, all reared in identical or similar environments, were experimentally infected with Corynebacterium sp., the causative agent ofbacterial kidney disease, or with Vibrio anguillarum, the causative agent of vibriosis. Mortality due to the pathogens was compared among stocks within a species and among transferrin genotypes within a stock to determine whetherthere was a geneticbasis for resistance to disease. Differences in resistance to bacterial kidney disease among coho salmon stocks had a genetic basis. Stock susceptibility to vibriosis was strongly influenced by environmental factors. Coho salmon orsteelhead trout of one stock may be resistant to one disease but susceptible to another. The importance of transferrin genotype of coho salmon in resistance to bacterial kidney disease was stock specific; in stocks that showed differential resistance of genotypes, the AA was the most susceptible. No differencesin resistance to vibriosis were observed among transferrin genotypes.

Measurement of cellular copper levels in Bacillus megaterium during exponential growth and sporulation.

PubMed

Krueger, W B; Kolodziej, B J

1976-01-01

Both atomic absorption spectrophotometry (AAS) and neutron activation analysis have been utilized to determine cellular Cu levels in Bacillus megaterium ATCC 19213. Both methods were selected for their sensitivity to detection of nanogram quantities of Cu. Data from both methods demonstrated identical patterms of Cu uptake during exponenetial growth and sporulation. Late exponential phase cells contained less Cu than postexponential t2 cells while t5 cells contained amounts equivalent to exponential cells. The t11 phase-bright forespore containing cells had a higher Cu content than those of earlier time periods, and the free spores had the highest Cu content. Analysis of the culture medium by AAS corroborated these data by showing concomitant Cu uptake during exponential growth and into t2 postexponential phase of sporulation. From t2 to t4, Cu egressed from the cells followed by a secondary uptake during the maturation of phase-dark forespores into phase-bright forespores (t6--t9).