Sample records for aapl spdr gold

  1. 78 FR 16895 - Self-Regulatory Organizations; Chicago Board Options Exchange, Incorporated; Notice of Filing and...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Immediate Effectiveness of a Proposed Rule Change Relating to Complex Orders and Mini-Options March 13, 2013... related to complex orders. The text of the proposed rule change is also available on the Exchange's Web... listing of mini- options on SPDR S&P 500 (``SPY''), Apple, Inc. (``AAPL''), SPDR Gold Trust...

  2. Now is the time for AAPL to demonstrate leadership by advocating positions of social importance.


    Halpern, Abraham L; Halpern, John H; Freedman, Alfred M


    The American Academy of Psychiatry and the Law (AAPL) and other medical organizations have not taken a position on the abolition of capital punishment because of a long-standing tradition of remaining neutral on "nonmedical" societal issues that are highly divisive. It is the authors' contention that taking a stand on vital social issues that are clearly in the public interest is wholly consistent with the stated purposes of AAPL and that the time has come for an open and frank discussion by the membership on the merits of altering its policy, with particular focus on eliminating the death penalty. The present article explains why capital punishment can no longer be considered a nonmedical societal issue and why AAPL must awaken to take on controversial matters such as this one. For AAPL to continue to avoid this debate and silence any attempt to organize opposition to the current status quo will only serve to embolden those who argue in favor of the death penalty. Such continued silence betrays any notion of neutrality and is an abdication of the canons of medical ethics we have all sworn to uphold.

  3. 78 FR 18660 - Self-Regulatory Organizations; NYSE MKT LLC; Notice of Filing and Immediate Effectiveness of...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Proposed Rule Change Amending the Definition of Complex Orders, Complex Trades and Stock/Options Orders To... definition of Complex Orders, Complex Trades and Stock/Options orders to accommodate the trading of option... S&P 500 (``SPY''), Apple, Inc. (``AAPL''), SPDR Gold Trust (``GLD''), Google Inc. (``GOOG'')...

  4. 78 FR 18649 - Self-Regulatory Organizations; NYSE Arca, Inc.; Notice of Filing and Immediate Effectiveness of...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Proposed Rule Change Amending the Definition of Complex Orders and Stock/Options Orders To Accommodate the... Complex Orders and Stock/Options orders to accommodate the trading of option contracts overlying 10 shares.... (``AAPL''), SPDR Gold Trust (``GLD''), Google Inc. (``GOOG'') and Inc. (``AMZN'').\\4\\...

  5. Gold

    USGS Publications Warehouse

    Kirkemo, Harold; Newman, William L.; Ashley, Roger P.


    Through the ages, men and women have cherished gold, and many have had a compelling desire to amass great quantities of it -- so compelling a desire, in fact, that the frantic need to seek and hoard gold has been aptly named "gold fever." Gold was among the first metals to be mined because it commonly occurs in its native form -- that is, not combined with other elements -- because it is beautiful and imperishable, and because exquisite objects can be made from it.

  6. Gold Rush!

    ERIC Educational Resources Information Center

    Brahier, Daniel J.


    Describes a mathematical investigation of gold--how it is weighed, stored, used, and valued. For grades 3-4, children estimate the value of treasure chests filled with gold coins and explore the size and weight of gold bars. Children in grades 5-6 explore how gold is mined and used, and how the value of gold changes over time. (PVD)

  7. Gold Coating

    NASA Technical Reports Server (NTRS)


    Epner Technology Inc. responded to a need from Goddard Space Flight Center for the ultimate in electroplated reflectivity needed for the Mars Global Surveyor Mars Orbiter Laser Altimeter (MOLA). Made of beryllium, the MOLA mirror was coated by Epner Technology Laser Gold process, specially improved for the project. Improved Laser Gold- coated reflectors have found use in an epitaxial reactor built for a large semiconductor manufacturer as well as the waveguide in Braun-Thermoscan tympanic thermometer and lasing cavities in various surgical instruments.

  8. Gold Nanoantennas

    SciTech Connect


    An array of gold nanoantennas laced into an artificial membrane enhances the fluorescence intensity of three different molecules when they pass through plasmonic hot spots in the array. Watch for the blue, green and red flashes. The photobleaching at the end of each fluorescence event (white flashes) is indicative of single molecule observations.

  9. Biomineralization of gold: biofilms on bacterioform gold.


    Reith, Frank; Rogers, Stephen L; McPhail, D C; Webb, Daryl


    Bacterial biofilms are associated with secondary gold grains from two sites in Australia. 16S ribosomal DNA clones of the genus Ralstonia that bear 99% similarity to the bacterium Ralstonia metallidurans-shown to precipitate gold from aqueous gold(III) tetrachloride-were present on all DNA-positive gold grains but were not detected in the surrounding soils. These results provide evidence for the bacterial contribution to the authigenic formation of secondary bacterioform gold grains and nuggets.

  10. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.


    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…



    Seegmiller, R.


    An improved bath is reported for plating gold on other metals. The composition of the plating bath is as follows: Gold cyanide from about 15 to about 50 grams, potassium cyanide from about 70 to about 125 grams, and sulfonated castor oil from about 0.1 to about 10 cc. The gold plate produced from this bath is smooth, semi-hard, and nonporous.

  12. Chalcogenide centred gold complexes.


    Gimeno, M Concepción; Laguna, Antonio


    Chalcogenide-centred gold complexes are an important class of compounds in which a central chalcogen is surrounded by several gold atoms or gold and other metals. They have special characteristics such as unusual geometries, electron deficiency and properties such as luminescence or non-linear optical properties. The best known species are the trinuclear [E(AuPR3)3]+, 'oxonium' type species, that have high synthetic applicability, not only in other chalcogen-centred species, but in many other organometallic derivatives. The aurophilic interactions play an important role in the stability, preference for a particular geometry and luminescence properties in this type of derivatives (critical review, 117 references).

  13. 77 FR 74043 - Self-Regulatory Organizations; The Options Clearing Corporation; Order Granting Approval of...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... rule changes that permitted the International Securities Exchange, LLC and NYSE Arca, Inc. to list and trade mini options (``Mini Options'') overlying 10 shares of SPDR S&P 500 ETF, Apple Inc., SPDR Gold Trust, Google Inc., and , Inc.\\4\\ Subsequently, NASDAQ OMX PHLX LLC filed a proposed...

  14. Gold nanoprobes for theranostics

    PubMed Central

    Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph


    Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586

  15. Gold-bearing skarns

    USGS Publications Warehouse

    Theodore, Ted G.; Orris, Greta J.; Hammerstrom, Jane M.; Bliss, James D.


    In recent years, a significant proportion of the mining industry's interest has been centered on discovery of gold deposits; this includes discovery of additional deposits where gold occurs in skarn, such as at Fortitude, Nevada, and at Red Dome, Australia. Under the classification of Au-bearing skarns, we have modeled these and similar gold-rich deposits that have a gold grade of at least 1 g/t and exhibit distinctive skarn mineralogy. Two subtypes, Au-skarns and byproduct Au-skarns, can be recognized on the basis of gold, silver, and base-metal grades, although many other geological factors apparently are still undistinguishable largely because of a lack of detailed studies of the Au-skarns. Median grades and tonnage for 40 Au-skarn deposits are 8.6 g/t Au, 5.0 g/t Ag, and 213,000 t. Median grades and tonnage for 50 byproduct and Au-skarn deposits are 3.7 g/t Au, 37 g/t Ag, and 330,000 t. Gold-bearing skarns are generally calcic exoskarns associated with intense retrograde hydrosilicate alteration. These skarns may contain economic amounts of numerous other commodities (Cu, Fe, Pb, Zn, As, Bi, W, Sb, Co, Cd, and S) as well as gold and silver. Most Au-bearing skarns are found in Paleozoic and Cenozoic orogenic-belt and island-arc settings and are associated with felsic to intermediate intrusive rocks of Paleozoic to Tertiary age. Native gold, electru, pyrite, pyrrhotite, chalcopyrite, arsenopyrite, sphalerite, galena, bismuth minerals, and magnetite or hematite are the most common opaque minerals. Gangue minerals typically include garnet (andradite-grossular), pyroxene (diopside-hedenbergite), wollastonite, chlorite, epidote, quartz, actinolite-tremolite, and (or) calcite.

  16. Getting the Gold Treatment

    NASA Technical Reports Server (NTRS)


    Epner Technology, Inc., worked with Goddard Space Center to apply gold coating to the Vegetation Canopy Lidar (VCL) mirror. This partnership resulted in new commercial applications for Epner's LaserGold(R) process in the automotive industry. Previously, the company did not have equipment large enough to handle the plating of the stainless steel panels cost effectively. Seeing a chance to renew this effort, Epner Technology and Goddard entered into an agreement by which NASA would fund the facility needed to do the gold-plating, and Epner Technology would cover all other costs as part of their internal research and development. The VCL mirror project proceeded successfully, fulfilling Goddard's needs and leaving Epner Technology with a new facility to provide LaserGold for the automotive industry. The new capability means increased power savings and improvements in both quality and production time for BMW Manufacturing Corporation of Spartanburg, South Carolina, and Cadillac of Detroit, Michigan, as well as other manufacturers who have implemented Epner Technology's LaserGold process. LaserGold(R) is a registered trademark of Epner Technology, Inc.

  17. Gold in minerals and the composition of native gold

    USGS Publications Warehouse

    Jones, Robert Sprague; Fleischer, Michael


    Gold occurs in nature mainly as the metal and as various alloys. It forms complete series of solid solutions with silver, copper, nickel, palladium, and platinum. In association with the platinum metals, gold occurs as free gold as well as in solid solution. The native elements contain the most gold, followed by the sulfide minerals. Several gold tellurides are known, but no gold selenides have been reported, and only one sulfide, the telluride-sulfide mineral nagyagite, is known. The nonmetallic minerals carry the least gold, and the light-colored minerals generally contain less gold than the dark minerals. Some conclusions in the literature are conflicting in regard to the relation of fineness of native gold to its position laterally and vertically within a lode, the nature of the country rocks, and the location and size of nuggets in a streambed, as well as to the variation of fineness within an individual nugget.

  18. In vivo liberation of gold ions from gold implants. Autometallographic tracing of gold in cells adjacent to metallic gold.


    Danscher, Gorm


    For some years, the implantation of small pieces of gold has been used as an unauthorised remedy for osteoarthritis and pain. The aim of the present study was to evaluate whether gold ions are released from gold implants. Pieces of pure gold were placed in the connective tissue of skin, bone and brains of anaesthetised animals. Ten days to several months later the animals were anaesthetised and killed by transcardial perfusion. Tissue blocks containing the gold pieces were cut, and the sections were silver-enhanced by autometallography. It was found that gold ions are released from the implanted gold and diffuse out into the surrounding tissue. The gold-containing cells in connective tissues were macrophages, mast cells and fibroblasts. In the brain, gold accumulated in astrocytes and neurons. Proton-induced X-ray emission spectroscopy analysis of the tissue surrounding gold implants confirmed that gold ions are liberated. The findings suggest that the gold implant technique, on a local scale, mimics systemic treatment with a gold-containing drug.

  19. Biorecovery of gold

    USGS Publications Warehouse

    Eisler, R.


    Recovery of ionic and metallic gold (Au) from a wide variety of solutions by selected species of bacteria, yeasts, fungi, algae, and higher plants is documented. Gold accumulations were up to 7.0 g/kg dry weight (DW) in various species of bacteria, 25.0 g/kg DW in freshwater algae, 84.0 g/kg DW in peat, and 100.0 g/kg DW in dried fungus mixed with keratinous material. Mechanisms of accumulation include oxidation, dissolution, reduction, leaching, and sorption. Uptake patterns are significantly modified by the physicochemical milieu. Crab exoskeletons accumulate up to 4.9 g Au/kg DW; however, gold accumulations in various tissues of living teleosts, decapod crustaceans, and bivalve molluscs are negligible.

  20. Gold-bismuth clusters.


    Martínez, Ana


    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  1. Chemistry for oncotheranostic gold nanoparticles.


    Trouiller, Anne Juliette; Hebié, Seydou; El Bahhaj, Fatima; Napporn, Teko W; Bertrand, Philippe


    This review presents in a comprehensive ways the chemical methods used to functionalize gold nanoparticles with focus on anti-cancer applications. The review covers the parameters required for the synthesis gold nanoparticles with defined shapes and sizes, method for targeted delivery in tumours, and selected examples of anti-cancers compounds delivered with gold nanoparticles. A short survey of bioassays for oncology based on gold nanoparticles is also presented.

  2. Derivatized gold clusters and antibody-gold cluster conjugates


    Hainfeld, James F.; Furuya, Frederic R.


    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  3. Derivatized gold clusters and antibody-gold cluster conjugates


    Hainfeld, J.F.; Furuya, F.R.


    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  4. Earth's continental crustal gold endowment

    NASA Astrophysics Data System (ADS)

    Frimmel, H. E.


    The analysis of the temporal distribution of gold deposits, combined with gold production data as well as reserve and resource estimates for different genetic types of gold deposit, revealed that the bulk of the gold known to be concentrated in ore bodies was added to the continental crust during a giant Mesoarchaean gold event at a time (3 Ga) when the mantle temperature reached a maximum and the dominant style of tectonic movement changed from vertical, plume-related to subhorizontal plate tectonic. A magmatic derivation of the first generation of crustal gold from a relatively hot mantle that was characterized by a high degree of partial melting is inferred from the gold chemistry, specifically high Os contents. While a large proportion of that gold is still present in only marginally modified palaeoplacer deposits of the Mesoarchaean Witwatersrand Basin in South Africa, accounting for about 40% of all known gold, the remainder has been recycled repeatedly on a lithospheric scale, predominantly by plate-tectonically induced magmatic and hydrothermal fluid circulation, to produce the current variety of gold deposit types. Post-Archaean juvenile gold addition to the continental crust has been limited, but a mantle contribution to some of the largest orogenic or intrusion-related gold deposits is indicated, notably for the Late Palaeozoic Tien Shan gold province. Magmatic fluids in active plate margins seem to be the most effective transport medium for gold mobilization, giving rise to a large proportion of volcanic-arc related gold deposits. Due to their generally shallow crustal level of formation, they have a low preservation potential. In contrast, those gold deposits that form at greater depth are more widespread also in older rocks. This explains the high proportion of orogenic (including intrusion-related) gold (32%) amongst all known gold deposits. The overall proportion of gold concentrated in known ore bodies is only 7 × 10- 7 of the estimated total

  5. Gold and gold working in Late Bronze Age Northern Greece.


    Vavelidis, M; Andreou, S


    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium B.C: . Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.



    Smith, A.E.


    An improved seal between the piston and die member of a piston-cylinder type pressure vessel is presented. A layer of gold, of sufficient thickness to provide an interference fit between the piston and die member, is plated on the contacting surface of at least one of the members. (AEC)

  7. Digging for Gold

    ERIC Educational Resources Information Center

    Waters, John K.


    In the case of higher education, the hills are more like mountains of data that "we're accumulating at a ferocious rate," according to Gerry McCartney, CIO of Purdue University (Indiana). "Every higher education institution has this data, but it just sits there like gold in the ground," complains McCartney. Big Data and the new tools people are…

  8. 'Cascade Gold' raspberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ‘Cascade Gold’ is a new gold fruited, floricane fruiting raspberry cultivar (Rubus idaeus L.) jointly released by Washington State University (WSU), Oregon State University (OSU) and the U.S. Department of Agriculture (USDA). It has been evaluated at Puyallup, Wash. in plantings from 1988 to 2008. ...

  9. Gold Nanoparticle Microwave Synthesis

    SciTech Connect

    Krantz, Kelsie E.; Christian, Jonathan H.; Coopersmith, Kaitlin; Washington, II, Aaron L.; Murph, Simona H.


    At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.

  10. Gold Nanoparticles Cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mironava, Tatsiana

    Over the last two decades gold nanoparticles (AuNPs) have been used for many scientific applications and have attracted attention due to the specific chemical, electronic and optical size dependent properties that make them very promising agents in many fields such as medicine, imagine techniques and electronics. More specifically, biocompatible gold nanoparticles have a huge potential for use as the contrast augmentation agent in X-ray Computed Tomography and Photo Acoustic Tomography for early tumor diagnostic as well these nanoparticles are extensively researched for enhancing the targeted cancer treatment effectiveness such as photo-thermal and radiotherapy. In most biomedical applications biocompatible gold nanoparticles are labeled with specific tumor or other pathology targeting antibodies and used for site specific drug delivery. However, even though gold nanoparticles poses very high level of anti cancer properties, the question of their cytotoxicity ones they are released in normal tissue has to be researched. Moreover, the huge amount of industrially produced gold nanoparticles raises the question of these particles being a health hazard, since the penetration is fairly easy for the "nano" size substances. This study focuses on the effect of AuNPs on a human skin tissue, since it is fall in both categories -- the side effects for biomedical applications and industrial workers and users' exposure during production and handling. Therefore, in the present project, gold nanoparticles stabilized with the biocompatible agent citric acid were generated and characterized by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM). The cytotoxic effect of AuNPs release to healthy skin tissue was modeled on 3 different cell types: human keratinocytes, human dermal fibroblasts, and human adipose derived stromal (ADS) cells. The AuNPs localization inside the cell was found to be cell type dependent. Overall cytotoxicity was found to be dependent

  11. Spiky gold nanoshells.


    Sanchez-Gaytan, Brenda L; Park, So-Jung


    We report a high-yield synthetic method for a new type of metal nanostructure, spiky gold nanoshells, which combine the morphological characteristics of hollow metal nanoshells and nanorods. Our method utilizes block copolymer assemblies and polymer beads as templates for the growth of spiky nanoshells. Various shapes of spiky metal nanoshells were prepared in addition to spherical nanoshells by using block copolymer assemblies such as rod-like micelles, vesicles, and bilayers as templates. Furthermore, spiky gold shells encapsulating magnetic nanoparticles or quantum dots were prepared based on the ability of block copolymers to self-assemble with various types of nanoparticles and molecules. The capability to encapsulate other materials in the core, the shape tunability, and the highly structured surface of spiky nanoshells should benefit a range of imaging, sensing, and medical applications of metal nanostructures.

  12. Radioactive gold ring dermatitis

    SciTech Connect

    Miller, R.A.; Aldrich, J.E. )


    A superficial squamous cell carcinoma developed in a woman who wore a radioactive gold ring for more than 30 years. Only part of the ring was radioactive. Radiation dose measurements indicated that the dose to basal skin layer was 2.4 Gy (240 rad) per week. If it is assumed that the woman continually wore her wedding ring for 37 years since purchase, she would have received a maximum dose of approximately 4600 Gy.

  13. 'Pot of Gold'

    NASA Technical Reports Server (NTRS)


    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. The rock's nodules and layered appearance have inspired rover team members to investigate the rock's detailed chemistry in coming sols. This picture was taken on sol 158 (June 13, 2004).

  14. Gold-gold junction electrodes:the disconnection method.


    Dale, Sara E C; Vuorema, Anne; Ashmore, Ellen M Y; Kasprzyk-Horden, Barbara; Sillanpää, Mika; Denuault, Guy; Marken, Frank


    The formation of gold-gold junction electrodes for application in electroanalysis is described here based on electro-deposition from a non-cyanide gold plating bath. Converging growth of two hemispherical gold deposits on two adjacent platinum microelectrodes (both 100 µm diameter in glass, ca. 45 µm gap) followed by careful etching in aqueous chloride solution was employed. During growth both gold hemispheres "connect" and during etching "disconnection" is evident in a drop in current. Gold-gold junctions with sub-micron gaps are formed and applied for the electroanalytical detection of sub-micromolar concentrations of hydroquinone in 0.1 M phosphate buffer pH 7 (E(rev) = 0.04 V vs. SCE) and sub-micromolar concentration of dopamine in 0.1 M phosphate buffer pH 7 (E(rev) = 0.14 V vs. SCE). The potential future uses in analysis and limitations of gold-gold junction electrodes are discussed.

  15. Industry Forum Navy Gold Coast

    DTIC Science & Technology


    NAVFAC Southwest Lora E. Morrow Deputy for Small Business NAVFAC Southwest NAVFAC Southwest Industry Forum Navy Gold Coast August...REPORT DATE 13 AUG 2014 2. REPORT TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Industry Forum Navy Gold Coast 5a...S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES NDIA 27th Navy Gold Coast

  16. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2011 CFR


    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  17. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2013 CFR


    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  18. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2010 CFR


    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Gold coin and gold certificates in... EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued before January 30, 1934, are exchangeable, as...

  19. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2014 CFR


    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  20. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2012 CFR


    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  1. Surface-stabilized gold nanocatalysts


    Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN


    A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.

  2. 75 FR 48400 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Listing and Trading of Options on the Sprott Physical Gold Trust August 4, 2010. Pursuant to Section 19(b... trading of options on the Sprott Physical Gold Trust. A copy of the proposed rule change is available from... SPDR Gold Trust,\\5\\ the iShares COMEX Gold Trust,\\6\\ the iShares Silver Trust,\\7\\ the ETFS Gold...

  3. Experimental abrasion of detrital gold

    USGS Publications Warehouse

    Yeend, Warren E.


    The physical breakdown and abrasion rates of gold were studied using a tumbler to simulate natural high-energy environments. The gold fragments were tumbled for periods ranging from 30 to 240 h with different combinations of sand, cobbles, and water at velocities of 0.5 and 2.0 mi/h (0.85 and 3.22 km/h). With sand and gravel, the common bedload of the rivers that deposited the gold-bearing Tertiary sedimentary rocks of the Sierra Nevada, gold is abraded at rates of 0.015 to 0.007 percent (by weight) per hour of travel (at 0.5 mi/h or 0.845 km/h). Cobbles, rather than sand, are responsible for most of the physical changes and abrasion of the gold. Ten gold fragments tumbled for 120 h with cobbles and water (no sand) were broken down to 68 recoverable fragments and lost about 25 percent of their weight to particles smaller than could be recovered using conventional panning techniques. Gold tumbled for 120 h with sand and water lost less than 1 percent of its weight. Gold was abraded faster by wet sand than by dry sand. Velocity appears to be more important as a factor in abrasion of gold than travel distance a fourfold increase in velocity produced a tenfold increase in hourly abrasion rates of gold. Scanning electron microscope examination of the gold fragments after the tumbling experiments revealed differences in surface texture between fragments tumbled with (1) sand, (2) sand and cobbles, and (3) cobbles only.

  4. When cyclopropenes meet gold catalysts

    PubMed Central

    Miege, Frédéric


    Summary Cyclopropenes as substrates entered the field of gold catalysis in 2008 and have proven to be valuable partners in a variety of gold-catalyzed reactions. The different contributions in this growing research area are summarized in this review. PMID:21804867

  5. Antibody-gold cluster conjugates


    Hainfeld, J.F.


    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  6. Synthesis of gold structures by gold-binding peptide governed by concentration of gold ion and peptide.


    Kim, Jungok; Kim, Dong-Hun; Lee, Sylvia J; Rheem, Youngwoo; Myung, Nosang V; Hur, Hor-Gil


    Although biological synthesis methods for the production of gold structures by microorganisms, plant extracts, proteins, and peptide have recently been introduced, there have been few reports pertaining to controlling their size and morphology. The gold ion and peptide concentrations affected on the size and uniformity of gold plates by a gold-binding peptide Midas-11. The higher concentration of gold ions produced a larger size of gold structures reached 125.5 μm, but an increased amount of Midas-11 produced a smaller size of gold platelets and increased the yield percentage of polygonal gold particles rather than platelets. The mechanisms governing factors controlling the production of gold structures were primarily related to nucleation and growth. These results indicate that the synthesis of gold architectures can be controlled by newly isolated and substituted peptides under different reaction conditions.

  7. 20th-Century Gold Rush.

    ERIC Educational Resources Information Center

    Wargo, Joseph G.


    Presents Nevada's gold rush activities spurred by technological advancements in search methods. Describes the events that led to the twentieth-century gold rush, the techniques for finding deposits and the geological formation process of disseminated gold deposits. Vignettes present the gold extraction process, cross-section, and profile of a…

  8. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2014 CFR


    ... 41 Public Contracts and Property Management 2 2014-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  9. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2013 CFR


    ... 41 Public Contracts and Property Management 2 2013-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  10. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2012 CFR


    ... 41 Public Contracts and Property Management 2 2012-07-01 2012-07-01 false Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  11. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2011 CFR


    ... 41 Public Contracts and Property Management 2 2011-07-01 2007-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  12. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2010 CFR


    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  13. Enhancement of gold recovery using bioleaching from gold concentrate

    NASA Astrophysics Data System (ADS)

    Choi, S. H.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.


    The gold in refractory ores is encapsulated as fine particles (sometimes at a molecular level) in the crystal structure of the sulfide (typically pyrite with or without arsenopyrite) matrix. This makes it impossible to extract a significant amount of refractory gold by cyanidation since the cyanide solution cannot penetrate the pyrite/arsenopyrite crystals and dissolve gold particles, even after fine grinding. To effectively extract gold from these ores, an oxidative pretreatment is necessary to break down the sulfide matrix. The most popular methods of pretreatment include nitric acid oxidation, roasting, pressure oxidation and biological oxidation by microorganisms. This study investigated the bioleaching efficiency of Au concentrate under batch experimental conditions (adaptation cycles and chemical composition adaptation) using the indigenous acidophilic bacteria collected from gold mine leachate in Sunsin gold mine, Korea. We conducted the batch experiments at two different chemical composition (CuSO4 and ZnSO4), two different adaptation cycles 1'st (3 weeks) and 2'nd (6 weeks). The results showed that the pH in the bacteria inoculating sample decreased than initial condition and Eh increased. In the chemical composition adaptation case, the leached accumulation content of Fe and Pb was exhibited in CuSO4 adaptation bacteria sample more than in ZnSO4 adaptation bacteria samples, possibly due to pre-adaptation effect on chalcopyrite (CuFeS2) in gold concentrate. And after 21 days on the CuSO4 adaptation cycles case, content of Fe and Pb was appeared at 1'st adaptation bacteria sample(Fe - 1.82 and Pb - 25.81 times per control sample) lower than at 2'nd adaptation bacteria sample(Fe - 2.87 and Pb - 62.05 times per control sample). This study indicates that adaptation chemical composition and adaptation cycles can play an important role in bioleaching of gold concentrate in eco-/economic metallurgy process.

  14. 75 FR 41247 - Self-Regulatory Organizations; International Securities Exchange, LLC; Notice of Filing and...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Immediate Effectiveness of Proposed Rule Change to List and Trade Options on the Sprott Physical Gold Trust... options on the Sprott Physical Gold Trust. The text of the proposed rule change is available on the... the SPDR Gold Trust,\\5\\ the iShares COMEX Gold Trust and the iShares Silver Trust,\\6\\ the ETFS...

  15. Colloidal Synthesis of Gold Semishells

    PubMed Central

    Rodríguez-Fernández, Denis; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel; Liz-Marzán, Luis M


    This work describes a novel and scalable colloid chemistry strategy to fabricate gold semishells based on the selective growth of gold on Janus silica particles (500 nm in diameter) partly functionalized with amino groups. The modulation of the geometry of the Janus silica particles allows us to tune the final morphology of the gold semishells. This method also provides a route to fabricating hollow gold semishells through etching of the silica cores with hydrofluoric acid. The optical properties were characterized by visible near-infrared (vis-NIR) spectroscopy and compared with simulations performed using the boundary element method (BEM). These revealed that the main optical features are located beyond the NIR region because of the large core size. PMID:24551496

  16. Gold, currencies and market efficiency

    NASA Astrophysics Data System (ADS)

    Kristoufek, Ladislav; Vosvrda, Miloslav


    Gold and currency markets form a unique pair with specific interactions and dynamics. We focus on the efficiency ranking of gold markets with respect to the currency of purchase. By utilizing the Efficiency Index (EI) based on fractal dimension, approximate entropy and long-term memory on a wide portfolio of 142 gold price series for different currencies, we construct the efficiency ranking based on the extended EI methodology we provide. Rather unexpected results are uncovered as the gold prices in major currencies lay among the least efficient ones whereas very minor currencies are among the most efficient ones. We argue that such counterintuitive results can be partly attributed to a unique period of examination (2011-2014) characteristic by quantitative easing and rather unorthodox monetary policies together with the investigated illegal collusion of major foreign exchange market participants, as well as some other factors discussed in some detail.

  17. GOLD: The Genomes Online Database

    DOE Data Explorer

    Kyrpides, Nikos; Liolios, Dinos; Chen, Amy; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor; Bernal, Alex

    Since its inception in 1997, GOLD has continuously monitored genome sequencing projects worldwide and has provided the community with a unique centralized resource that integrates diverse information related to Archaea, Bacteria, Eukaryotic and more recently Metagenomic sequencing projects. As of September 2007, GOLD recorded 639 completed genome projects. These projects have their complete sequence deposited into the public archival sequence databases such as GenBank EMBL,and DDBJ. From the total of 639 complete and published genome projects as of 9/2007, 527 were bacterial, 47 were archaeal and 65 were eukaryotic. In addition to the complete projects, there were 2158 ongoing sequencing projects. 1328 of those were bacterial, 59 archaeal and 771 eukaryotic projects. Two types of metadata are provided by GOLD: (i) project metadata and (ii) organism/environment metadata. GOLD CARD pages for every project are available from the link of every GOLD_STAMP ID. The information in every one of these pages is organized into three tables: (a) Organism information, (b) Genome project information and (c) External links. [The Genomes On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata, Konstantinos Liolios, Konstantinos Mavromatis, Nektarios Tavernarakis and Nikos C. Kyrpides, Nucleic Acids Research Advance Access published online on November 2, 2007, Nucleic Acids Research, doi:10.1093/nar/gkm884]

    The basic tables in the GOLD database that can be browsed or searched include the following information:

    • Gold Stamp ID
    • Organism name
    • Domain
    • Links to information sources
    • Size and link to a map, when available
    • Chromosome number, Plas number, and GC content
    • A link for downloading the actual genome data
    • Institution that did the sequencing
    • Funding source
    • Database where information resides
    • Publication status and information

    • Gold, coal and oil.


      Dani, Sergio U


      Jared Diamond has hypothesized that guns, germs and steel account for the fate of human societies. Here I propose an extension of Diamond's hypothesis and put it in other terms and dimensions: gold, coal and oil account not only for the fate of human societies but also for the fate of mankind through the bodily accumulation of anthropogenic arsenic, an invisible weapon of mass extinction and evolutionary change. The background is clear; arsenic species fulfill seven criteria for a weapon of mass extinction and evolutionary change: (i) bioavailability to all living organisms; (ii) imperceptibility; (iii) acute toxicity; (iv) bioaccumulation and chronic toxicity; (v) adverse impact on reproductive fitness and reproductive outcomes and early-age development and growth in a wide range of microbial, plant and animal species including man; (vi) widespread geographical distribution, mobility and ecological persistence on a centennial to millennial basis and (vii) availability in necessary and sufficient amounts to exert evolutionarily meaningful effects. The proof is becoming increasingly feasible as human exploitation of gold, coal and oil deposits cause sustainable rises of arsenic concentrations in the biosphere. Paradoxically, humans are among the least arsenic-resistant organisms because humans are long-lived, encephalized and complex social metazoans. An arsenic accumulation model is presented here to describe how arsenic accumulates in the human body with increasing age and at different provisionally safe exposure levels. Arsenic accumulates in the human body even at daily exposure levels which are within the lowest possible WHO provisional tolerance limits, yielding bodily arsenic concentrations which are above WHO provisional limits. Ongoing consequences of global scale arsenic poisoning of mankind include age-specific rises in morbidity and mortality followed by adaptive changes. The potential rise of successful forms of inborn resistance to arsenic in humans

    • Gold nanoparticle (AuNPs) and gold nanopore (AuNPore) catalysts in organic synthesis.


      Takale, Balaram S; Bao, Ming; Yamamoto, Yoshinori


      Organic synthesis using gold has gained tremendous attention in last few years, especially heterogeneous gold catalysis based on gold nanoparticles has made its place in almost all organic reactions, because of the robust and green nature of gold catalysts. In this context, gold nanopore (AuNPore) with a 3D metal framework is giving a new dimension to heterogeneous gold catalysts. Interestingly, AuNPore chemistry is proving better than gold nanoparticles based chemistry. In this review, along with recent advances, major discoveries in heterogeneous gold catalysis are discussed.

    • Modeling of gold production in Malaysia

      NASA Astrophysics Data System (ADS)

      Muda, Nora; Ainuddeen, Nasihah Rasyiqah; Ismail, Hamizun; Umor, Mohd Rozi


      This study was conducted to identify the main factors that contribute to the gold production and hence determine the factors that affect to the development of the mining industry in Malaysia. An econometric approach was used by performing the cointegration analysis among the factors to determine the existence of long term relationship between the gold prices, the number of gold mines, the number of workers in gold mines and the gold production. The study continued with the Granger analysis to determine the relationship between factors and gold production. Results have found that there are long term relationship between price, gold production and number of employees. Granger causality analysis shows that there is only one way relationship between the number of employees with gold production in Malaysia and the number of gold mines in Malaysia.

  1. Monoclonal antibody "gold rush".


    Maggon, Krishan


    The market, sales and regulatory approval of new human medicines, during the past few years, indicates increasing number and share of new biologics and emergence of new multibillion dollar molecules. The global sale of monoclonal antibodies in 2006 were $20.6 billion. Remicade had annual sales gain of $1 billion during the past 3 years and five brands had similar increase in 2006. Rituxan with 2006 sales of $4.7 billion was the best selling monoclonal antibody and biological product and the 6th among the top selling medicinal brand. It may be the first biologic and monoclonal antibody to reach $10 billion annual sales in the near future. The strong demand from cancer and arthritis patients has surpassed almost all commercial market research reports and sales forecast. Seven monoclonal antibody brands in 2006 had sales exceeding $1 billion. Humanized or fully human monoclonal antibodies with low immunogenicity, enhanced antigen binding and reduced cellular toxicity provide better clinical efficacy. The higher technical and clinical success rate, overcoming of technical hurdles in large scale manufacturing, low cost of market entry and IND filing, use of fully human and humanized monoclonal antibodies has attracted funds and resources towards R&D. Review of industry research pipeline and sales data during the past 3 years indicate a real paradigm shift in industrial R&D from pharmaceutical to biologics and monoclonal antibodies. The antibody bandwagon has been joined by 200 companies with hundreds of new projects and targets and has attracted billions of dollars in R&D investment, acquisitions and licensing deals leading to the current Monoclonal Antibody Gold Rush.

  2. Goldschlager allergy in a gold allergic patient.


    Guenthner, T; Stork, C M; Cantor, R M


    We describe the case of gold allergy after ingestion of GOLDSCHLAGER, a gold-containing liquor, in a patient with a previous allergy to gold jewelry. The patient was not aware that genuine gold particles were contained in the schnapps liquor and that ingestion could result in a reaction similar to that experienced by individuals sensitive to gold jewelry. Clinicians should be familiar with the presence of gold particles in GOLDSCHLAGER liquor and the potential for allergic reactions to occur in those so predisposed.

  3. Phage based green chemistry for gold ion reduction and gold retrieval.


    Setyawati, Magdiel I; Xie, Jianping; Leong, David T


    The gold mining industry has taken its toll on the environment, triggering the development of more environmentally benign processes to alleviate the waste load release. Here, we demonstrate the use of bacteriophages (phages) for biosorption and bioreduction of gold ions from aqueous solution, which potentially can be applied to remediate gold ions from gold mining waste effluent. Phage has shown a remarkably efficient sorption of gold ions with a maximum gold adsorption capacity of 571 mg gold/g dry weight phage. The product of this phage mediated process is gold nanocrystals with the size of 30-630 nm. Biosorption and bioreduction processes are mediated by the ionic and covalent interaction between gold ions and the reducing groups on the phage protein coat. The strategy offers a simple, ecofriendly and feasible option to recover of gold ions to form readily recoverable products of gold nanoparticles within 24 h.

  4. Gold nanoparticles for photoacoustic imaging

    PubMed Central

    Li, Wanwan; Chen, Xiaoyuan


    Photoacoustic (PA) imaging is a biomedical imaging modality that provides functional information regarding the cellular and molecular signatures of tissue by using endogenous and exogenous contrast agents. There has been tremendous effort devoted to the development of PA imaging agents, and gold nanoparticles as exogenous contrast agents have great potential for PA imaging due to their inherent and geometrically induced optical properties. The gold-based nanoparticles that are most commonly employed for PA imaging include spheres, rods, shells, prisms, cages, stars and vesicles. This article provides an overview of the current state of research in utilizing these gold nanomaterials for PA imaging of cancer, atherosclerotic plaques, brain function and image-guided therapy. PMID:25600972

  5. Economic geology: Gold buried by oxygen

    NASA Astrophysics Data System (ADS)

    Gaillard, Fabrice; Copard, Yoann


    The Witwatersrand Basin in South Africa contains extraordinary amounts of gold. Thermodynamic calculations suggest that the gold may have accumulated there in response to a perfect storm of conditions available only during the Archaean.

  6. Recent Developments in Australian Gold Extraction.

    ERIC Educational Resources Information Center

    Thiele, Rodney B.


    Describes new technologies that have greatly improved the extraction efficiency of gold ore, including: altering plant layout to promote efficiency, engaging Filiblast forced oxidation and bioxidation systems, and updating the electrowinning procedure at the gold recovery stage. (JRH)

  7. Formation, structure, and orientation of gold silicide on gold surfaces

    NASA Technical Reports Server (NTRS)

    Green, A. K.; Bauer, E.


    The formation of gold silicide on Au films evaporated onto Si(111) surfaces is studied by Auger electron spectroscopy (AES) and low-energy electron diffraction (LEED). Surface condition, film thickness, deposition temperature, annealing temperature, and heating rate during annealing are varied. Several oriented crystalline silicide layers are observed.

  8. Single-crystalline gold nanoplates from a commercial gold plating solution.


    Li, Zhonghao; Lapeyre, Véronique; Ravaine, Valérie; Ravaine, Serge; Kuhn, Alexander


    A novel route was proposed to synthesize gold nanoplates using a commercial gold plating solution as the reactant. Single-crystalline gold nanoplates can be successfully synthesized by reacting gold plating solution with HCl. The as-prepared nanoplates are from several micrometers to tens of micrometers in size. The effects of reactant concentration and temperature on the morphology of the gold products were investigated. The size of the gold nanoplate increases with the decrease of the amount of gold plating solution, while irregular gold nanoparticles are formed as the HCl concentration becomes low. When the reaction temperature is as low as room temperature, nanoplates with a concavity form. Specifically, it is found that the Cl- plays an important role for the formation of these gold nanoplates. The formation mechanism of the gold nanoplates is studied in detail.

  9. Structural change from doping the gold cluster.


    Tang, Yiji; Wang, Shu-Guang; Li, Jia


    Doping gold clusters with a transition metal (M@Au(n)) causes structural change. To determine the mechanism by which these changes occur, the central gold atom of Au(5) was doped with its same row transition metals Pt, Ir, Os, Re, and W. Based on theoretical calculations, a similar trend was found in other gold clusters.

  10. Highly active thermally stable nanoporous gold catalyst

    SciTech Connect

    Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern


    In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.

  11. Gold, Silver and Bronze Citations.

    ERIC Educational Resources Information Center

    American School & University, 2003


    Presents the gold, silver, and bronze winners of a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, focusing on concepts and ideas that made them exceptional. For each citation, the article offers information on the firm, client, total area, total…

  12. 75 FR 9981 - Self-Regulatory Organizations; The Options Clearing Corporation; Order Approving Proposed Rule...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... securities options or the clearing of such futures as security futures constitutes a violation of the CEA. \\3... same as the options and security futures on SPDR Gold Shares, iShares COMEX Gold Shares, and iShares... to help clarify that options and security futures on ETFS Physical Swiss Gold Shares and...

  13. 75 FR 31823 - Self-Regulatory Organizations; Chicago Board Options Exchange, Incorporated; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Proposed Rule Change To Enable the Listing and Trading of Options on the Sprott Physical Gold Trust May 28... rules to enable the listing and trading on the Exchange of options on the Sprott Physical Gold Trust... ``Commission'') authorized CBOE to list and trade options on the SPDR Gold Trust,\\3\\ the iShares COMEX...

  14. 75 FR 29597 - Self-Regulatory Organizations; Chicago Board Options Exchange, Incorporated; Order Approving...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Proposed Rule Change, as Modified by Amendment No. 1 Thereto, To List and Trade CBOE Gold ETF Volatility...,\\2\\ a proposed rule change to list and trade options on the CBOE Gold ETF Volatility Index (``GVZ... the VIX methodology applied to options on the SPDR Gold Trust (``GLD''). GVZ is an...

  15. Bimodal porous gold opals for molecular sensing

    NASA Astrophysics Data System (ADS)

    Chae, Weon-Sik; Yu, Hyunung; Ham, Sung-Kyoung; Lee, Myung-Jin; Jung, Jin-Seung; Robinson, David B.


    We have fabricated bimodal porous gold skeletons by double-templating routes using poly(styrene) colloidal opals as templates. The fabricated gold skeletons show a bimodal pore-size distribution, with small pores within spheres and large pores between spheres. The templated bimodal porous gold skeletons were applied in Raman scattering experiments to study sensing efficiency for probe molecules. We found that the bimodal porous gold skeletons showed obvious enhancement of Raman scattering signals versus that of the unimodal porous gold which only has interstitial pores of several hundred nanometers.

  16. Gold nephropathy in juvenile rheumatoid arthritis.


    Husserl, F E; Shuler, S E


    A 2-year-old girl was treated with gold salts for juvenile rheumatoid arthritis. Treatment had to be discontinued when persistent proteinuria was detected. As this case report indicates, close monitoring of the urine is mandatory during treatment with gold salts to detect early signs of toxicity: hematuria followed by casts and then proteinuria as therapy is continued. Histologic examination with electron microscopy will help to differentiate the different forms of gold toxicity. When the findings are consistent with gold-induced renal involvement, therapy should be discontinued. The gold nephropathy usually resolves in time, with no permanent renal damage.

  17. Gold recycling; a materials flow study

    USGS Publications Warehouse

    Amey, Earle B.


    This materials flow study includes a description of trends in consumption, loss, and recycling of gold-containing materials in the United States in 1998 in order to illustrate the extent to which gold is presently being recycled and to identify recycling trends. The quantity of gold recycled, as a percent of the apparent supply of gold, was estimated to be about 30 percent. Of the approximately 446 metric tons of gold refined in the United States in 1998, the fabricating and industrial use losses were 3 percent.

  18. AAPL Practice Guideline for the forensic psychiatric evaluation of competence to stand trial.


    Mossman, Douglas; Noffsinger, Stephen G; Ash, Peter; Frierson, Richard L; Gerbasi, Joan; Hackett, Maureen; Lewis, Catherine F; Pinals, Debra A; Scott, Charles L; Sieg, Karl G; Wall, Barry W; Zonana, Howard V


    Competence to stand trial is a legal construct used to identify those criminal defendants who have the requisite mental capacity to understand the nature and objective of the proceedings against them and to participate rationally in preparing their defense. This Practice Guideline has described how psychiatrists should evaluate individuals concerning their competence to stand trial. The Guideline describes acceptable forensic psychiatric practice for such evaluations. Where possible, it specifies standards of practice and principles of ethics and also emphasizes the importance of analyzing an individual defendant's case in the context of statutes and case law applicable in the jurisdiction where the evaluation takes place. The recommendations in the Guideline both reflect and are limited by evolving case law, statutory requirements, legal publications, and the current state of psychiatric knowledge. The authors have taken note of nationally applicable case law, federal constitutional standards, statutory language, and federal and state interpretations of the rights or statutes, recognizing that jurisdictions may differ in their specific interpretation or application of statutes or general constitutional standards. The review of cases concerning specific psychiatric diagnoses illustrates general U.S. trends, and psychiatrists must remain cognizant of their jurisdictions' interpretations of statutes or constitutional requirements. By surveying a variety of practices and approaches to data gathering and case analysis, the authors believe that this Guideline will stimulate additional collegial discussion about what is necessary and sufficient for adequate evaluations of adjudicative competence. The notion that psychiatrists should apply expertise to competence assessments stems from the principal that, before allowing a defendant to face criminal prosecution and possible punishment, courts need reasonable assurance--based, if necessary, on a careful, individualized evaluation--that the defendant has adequate mental capacity to make a defense. At a minimum, a psychiatrist's opinion about adjudicative competence should reflect an understanding of the jurisdictional standard and of how the defendant's mental condition affects competence as defined with the jurisdiction. The psychiatrist's report should clearly describe the opinion and the reasoning that leads to it. Psychiatrists who provide mental health expertise concerning adjudicative competence give trial courts information needed to assure that defendants can appropriately protect themselves and that criminal proceedings will be accurate, dignified,and just.

  19. Dating native gold by noble gas analyses

    NASA Technical Reports Server (NTRS)

    Niedermann, S.; Eugster, O.; Hofmann, B.; Thalmann, CH.; Reimold, W. U.


    Our recent work on He, Ne, and Ar in Alpine gold samples has demonstrated that gold is extremely retentive for He and could thus, in principle, be used for U/Th-He-4 dating. For vein-type gold from Brusson, Northern Italy, we derived a U/Th-He-4 age of 36 Ma, in agreement with the K-Ar formation age of associated muscovites and biotites. However, in placer gold from the Napf area, Central Switzerland, we observed large excesses of both He-4 and radiogenic Ar-40 (Ar-40 sub rad, defined as Ar-40-295.5-Ar-.36). The gas release systematics indicate two distinct noble gas components, one of which is released below about 800 C and the other one at the melting point of gold (1064 C). We now present results of He and Xe measurements in a 1 g placer gold sample from the river Kruempelgraben, as well as He and Ar data for Brusson vein-type gold and for gold from the Lily Gold Mine, South Africa. We calculate reasonable U/Th-He-4 as well as U-Xe ages based on those gases which are released at approximately 800 C. Probably the low-temperature components represent in-situ-produced radiogenic He and fission Xe, whereas the gases evolving when gold melts have been trapped during gold formation. Therefore, only the low-temperature components are relevant for dating purposes.

  20. Mammalian sensitivity to elemental gold (Au?)

    USGS Publications Warehouse

    Eisler, R.


    There is increasing documentation of allergic contact dermatitis and other effects from gold jewelry, gold dental restorations, and gold implants. These effects were especially pronounced among females wearing body-piercing gold objects. One estimate of the prevalence of gold allergy worldwide is 13%, as judged by patch tests with monovalent organogold salts. Eczema of the head and neck was the most common response of individuals hypersensitive to gold, and sensitivity can last for at least several years. Ingestion of beverages containing flake gold can result in allergic-type reactions similar to those seen in gold-allergic individuals exposed to gold through dermal contact and other routes. Studies with small laboratory mammals and injected doses of colloidal gold showed increased body temperatures, accumulations in reticular cells, and dose enhancement in tumor therapy; gold implants were associated with tissue injuries. It is proposed that Au? toxicity to mammals is associated, in part, with formation of the more reactive Au+ and Au3+ species.

  1. Bending Gold Nanorods with Light.


    Babynina, Anastasia; Fedoruk, Michael; Kühler, Paul; Meledin, Alexander; Döblinger, Markus; Lohmüller, Theobald


    V-shaped gold nanoantennas are the functional components of plasmonic metasurfaces, which are capable of manipulating light in unprecedented ways. Designing a metasurface requires the custom arrangement of individual antennas with controlled shape and orientation. Here, we show how highly crystalline gold nanorods in solution can be bent, one-by-one, into a V-shaped geometry and printed to the surface of a solid support through a combination of plasmonic heating and optical force. Significantly, we demonstrate that both the bending angle and the orientation of each rod-antenna can be adjusted independent from each other by tuning the laser intensity and polarization. This approach is applicable for the patterning of V-shaped plasmonic antennas on almost any substrate, which holds great potential for the fabrication of ultrathin optical components and devices.

  2. Biomolecular Assembly of Gold Nanocrystals

    SciTech Connect

    Micheel, Christine Marya


    Over the past ten years, methods have been developed to construct discrete nanostructures using nanocrystals and biomolecules. While these frequently consist of gold nanocrystals and DNA, semiconductor nanocrystals as well as antibodies and enzymes have also been used. One example of discrete nanostructures is dimers of gold nanocrystals linked together with complementary DNA. This type of nanostructure is also known as a nanocrystal molecule. Discrete nanostructures of this kind have a number of potential applications, from highly parallel self-assembly of electronics components and rapid read-out of DNA computations to biological imaging and a variety of bioassays. My research focused in three main areas. The first area, the refinement of electrophoresis as a purification and characterization method, included application of agarose gel electrophoresis to the purification of discrete gold nanocrystal/DNA conjugates and nanocrystal molecules, as well as development of a more detailed understanding of the hydrodynamic behavior of these materials in gels. The second area, the development of methods for quantitative analysis of transmission electron microscope data, used computer programs written to find pair correlations as well as higher order correlations. With these programs, it is possible to reliably locate and measure nanocrystal molecules in TEM images. The final area of research explored the use of DNA ligase in the formation of nanocrystal molecules. Synthesis of dimers of gold particles linked with a single strand of DNA possible through the use of DNA ligase opens the possibility for amplification of nanostructures in a manner similar to polymerase chain reaction. These three areas are discussed in the context of the work in the Alivisatos group, as well as the field as a whole.

  3. DNA-templated gold nanowires

    NASA Astrophysics Data System (ADS)

    Mohammadzadegan, Reza; Mohabatkar, Hassan; Sheikhi, Mohammad Hossein; Safavi, Afsaneh; Khajouee, Mahmood Barati


    We have developed simple methods of reproducibly creating deoxyribonucleic acid (DNA)-templated gold nanowires on silicon. First DNA nanowires were aligned on silicon surfaces. Briefly, modified silicon wafer was soaked in the DNA solution, and then the solution was removed using micropipettes; the surface tension at the moving air-solution interface is sufficient to align the DNA nanowires on the silicon wafer. In another attempt, an aqueous dispersion of sodium azide-stabilized gold nanoparticles was prepared. The nanoparticles aligned double-stranded λ-DNA to form a linear nanoparticle array. Continuous gold nanowires were obtained. The above nanowires were structurally characterized using scanning electron microscopy. The results of the characterizations show the wires to be 57-323 nm wide, to be continuous with a length of 2.8-9.5 μm. The use of DNA as a template for the self-assembly of conducting nanowires represents a potentially important approach in the fabrication of nanoscale interconnects.

  4. Distinguishing Between Legally and Illegally Produced Gold in South Africa.


    Roberts, Richard J; Dixon, Roger D; Merkle, Roland K W


    The identification of gold-bearing material is essential for combating the theft of gold in South Africa. Material seized in police operations is generally a mixture of gold from different mines, and as such cannot be traced back to a single location. ICP-OES analysis of material dissolved by acid dissolution provided a database of gold compositions comprising gold from South African mines, illegal gold stolen from the mines, and commercial gold alloys and jewelery. Discrimination between legal and illegal gold was possible due to the presence of Pb, As, Sb, Sn, Se, and Te in the stolen material, elements which are not present in legally produced gold. The presence of these elements is a quick and simple way to distinguish between gold alloys based on refined gold, such as in commercially manufactured jewelery, and gold alloys containing a proportion of unrefined and therefore illegally obtained gold.

  5. Physiological investigation of gold nanorods toward watermelon.


    Wan, Yujie; Li, Junli; Ren, Hongxuan; Huang, Jin; Yuan, Hong


    The objective of the present study was to evaluate the phytotoxicity and oxidant stress of the gold nanorods toward watermelon, and hence give a quantitative risk assessment of both seeds and plants phase. The seed germination, the activity of antioxidant enzymes, and the contents of soluble protein and malondialdehyde (MDA) have been measured while the plant roots were observed by transmission electron microscopy (TEM). It was found that the gold nanorods significantly promoted the root elongation. Furthermore, the results on the enzymes activities of plant indicated that oxidative stress happened in the plant treated with gold nanorods. However, the gold nanorods resulted in the phytotoxicity toward plant especially at high concentration. The TEM images of the plant roots with and without the treatment of gold nanorods showed the significant different size of starch granules. In conclusion, significant physiological changes of plant occurred after treatment with the gold nanorods.

  6. Template based synthesis of gold nanotubes using biologically synthesized gold nanoparticles.


    Ballabh, R; Nara, S


    Reliable experimental protocols using green technologies to synthesize metallic nanostructures widen their applications, both biological as well as biomedical. Here, we describe a method for synthesizing gold nanotubes using biologically synthesized gold nanoparticles in a template based approach. E. coli DH5α was used as bionanofactory to synthesize gold nanoparticles. These nanoparticles were then deposited on sodium sulfate (Na2SO4) nanowires which were employed as sacrificial template for gold nanotube (Au-NT) formation. The gold nanoparticles, sodium sulphate nanowires and gold nanotubes were appropriately characterized using transmission electron microscopy. The TEM results showed that the average diameter of gold nanotubes was 72 nm and length up to 4-7 μm. The method discussed herein is better than other reported conventional chemical synthesis approaches as it uses biologically synthesized gold nanoparticles, and does not employ any harsh conditions/solvents for template removal which makes it a clean and ecofriendly method.

  7. Electrochemical Assay of Gold-Plating Solutions

    NASA Technical Reports Server (NTRS)

    Chiodo, R.


    Gold content of plating solution is assayed by simple method that required only ordinary electrochemical laboratory equipment and materials. Technique involves electrodeposition of gold from solution onto electrode, the weight gain of which is measured. Suitable fast assay methods are economically and practically necessary in electronics and decorative-plating industries. If gold content in plating bath is too low, poor plating may result, with consequent economic loss to user.

  8. Formation of Gold(III) Alkyls from Gold Alkoxide Complexes

    PubMed Central


    The gold(III) methoxide complex (C∧N∧C)AuOMe (1) reacts with tris(p-tolyl)phosphine in benzene at room temperature under O abstraction to give the methylgold product (C∧N∧C)AuMe (2) together with O=P(p-tol)3 ((C∧N∧C) = [2,6-(C6H3tBu-4)2pyridine]2–). Calculations show that this reaction is energetically favorable (ΔG = −32.3 kcal mol–1). The side products in this reaction, the Au(II) complex [Au(C∧N∧C)]2 (3) and the phosphorane (p-tol)3P(OMe)2, suggest that at least two reaction pathways may operate, including one involving (C∧N∧C)Au• radicals. Attempts to model the reaction by DFT methods showed that PPh3 can approach 1 to give a near-linear Au–O–P arrangement, without phosphine coordination to gold. The analogous reaction of (C∧N∧C)AuOEt, on the other hand, gives exclusively a mixture of 3 and (p-tol)3P(OEt)2. Whereas the reaction of (C∧N∧C)AuOR (R = But, p-C6H4F) with P(p-tol)3 proceeds over a period of hours, compounds with R = CH2CF3, CH(CF3)2 react almost instantaneously, to give 3 and O=P(p-tol)3. In chlorinated solvents, treatment of the alkoxides (C∧N∧C)AuOR with phosphines generates [(C∧N∧C)Au(PR3)]Cl, via Cl abstraction from the solvent. Attempts to extend the synthesis of gold(III) alkoxides to allyl alcohols were unsuccessful; the reaction of (C∧N∧C)AuOH with an excess of CH2=CHCH2OH in toluene led instead to allyl alcohol isomerization to give a mixture of gold alkyls, (C∧N∧C)AuR′ (R′ = −CH2CH2CHO (10), −CH2CH(CH2OH)OCH2CH=CH2 (11)), while 2-methallyl alcohol affords R′ = CH2CH(Me)CHO (12). The crystal structure of 11 was determined. The formation of Au–C instead of the expected Au–O products is in line with the trend in metal–ligand bond dissociation energies for Au(III): M–H > M–C > M–O.

  9. Native gold in Hawaiian alkalic magma

    USGS Publications Warehouse

    Sisson, T.W.


    Native gold found in fresh basanite glass from the early submarine phase of Kilauea volcano, Hawaii, may be the first documented case of the transport of gold as a distinct precious metal phase in a mantle-derived magma. The gold-bearing glass is a grain in bedded volcanic glass sandstone (Japan Marine Science and Technology Center (JAMSTEC) sample S508-R3) collected by the submersible Shinkai 6500 at 3879 m depth off Kilauea's south flank. Extensive outcrops there expose debris-flow breccias and sandstones containing submarine-erupted alkalic rock fragments and glasses from early Kilauea. Precipitation of an immiscible gold liquid resulted from resorption of magmatic sulfides during crystallization-differentiation, with consequent liberation of sulfide-hosted gold. Elevated whole-rock gold concentrations (to 36 ppb) for fresh lavas and clasts from early Kilauea further show that some magmas erupted at the beginning stages of Hawaiian shield volcanoes were distinctly gold rich, most likely owing to limited residual sulfide in their mantle source. Alkalic magmas at other ocean islands may also be gold rich, and oceanic hot-spot provinces may contain underappreciated gold resources.

  10. Gold ink coating of thermocouple sheaths


    Ruhl, H. Kenneth


    A method is provided for applying a gold ink coating to a thermocouple sheath which includes the steps of electropolishing and oxidizing the surface of the thermocouple sheath, then dipping the sheath into liquid gold ink, and finally heat curing the coating. The gold coating applied in this manner is highly reflective and does not degrade when used for an extended period of time in an environment having a temperature over F. Depending on the application, a portion of the gold coating covering the tip of the thermocouple sheath is removed by abrasion.

  11. Gold Fever! Seattle Outfits the Klondike Gold Rush. Teaching with Historic Places.

    ERIC Educational Resources Information Center

    Blackburn, Marc K.

    This lesson is based on the National Register of Historic Places registration file, "Pioneer Square Historic District," and other sources about Seattle (Washington) and the Klondike Gold Rush. The lesson helps students understand how Seattle exemplified the prosperity of the Klondike Gold Rush after 1897 when news of a gold strike in…

  12. Gold nanorod plasmonic upconversion microlaser.


    Shi, Ce; Soltani, Soheil; Armani, Andrea M


    Plasmonic-photonic interactions have stimulated significant interdisciplinary interest, leading to rapid innovations in solar design and biosensors. However, the development of an optically pumped plasmonic laser has failed to keep pace due to the difficulty of integrating a plasmonic gain material with a suitable pump source. In the present work, we develop a method for coating high quality factor toroidal optical cavities with gold nanorods, forming a photonic-plasmonic laser. By leveraging the two-photon upconversion capability of the nanorods, lasing at 581 nm with a 20 μW threshold is demonstrated.

  13. Precision gold conductors for HMCs

    NASA Astrophysics Data System (ADS)

    Widmer, M. R.


    Ti/Pd/Au multiple code coded switch (MCCS) networks were built and compared to Cr/Au MCCS networks. The data showed no measurable difference between the two systems. Interface resistance of both types of networks was measured as a diagnostic aid to determine if hydrogen was affecting the Ti/Pd/Au MCCS networks. The data showed that although hydrogen does affect Ti/Pd/Au, the changes are not significant with respect to MCCS environments. An evaluation of several proprietary gold electroplating solutions for use in the production of Ti/Pd/Au conductors was performed. All the testing results were comparable to the current product requirements.

  14. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2010 CFR


    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  15. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2014 CFR


    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  16. A Placer-Gold Evaluation Exercise.

    ERIC Educational Resources Information Center

    Tunley, A. Tom


    A laboratory exercise allowing students to use drillhole data to simulate the process of locating a placer gold paystreak is presented. As part of the activity students arithmetically compute the value of their gold, mining costs, and personal profits or losses, and decide on development plans for the claim. (BC)

  17. RF Sputtering of Gold Contacts On Niobium

    NASA Technical Reports Server (NTRS)

    Barr, D. W.


    Reliable gold contacts are deposited on niobium by combination of RF sputtering and photolithography. Process results in structures having gold only where desired for electrical contact. Contacts are stable under repeated cycling from room temperature to 4.2 K and show room-temperature contact resistance as much as 40 percent below indium contacts made by thermalcompression bonding.

  18. Sesquicentennial: Gold Rush to Golden Statehood.

    ERIC Educational Resources Information Center

    Sabato, George


    Provides an annotated bibliography of educational resources that can be used to support instructional units on the Gold Rush or the sesquicentennial of California's statehood. The materials include workbooks, videos, teacher's guides, monographs, and magazines. Offers a brief history of the Gold Rush and a set of relevant discussion questions.…

  19. Gold-nickel-titanium brazing alloy


    Mizuhara, Howard


    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99% gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  20. The Gold Mining Camp: A Simulation Game.

    ERIC Educational Resources Information Center

    Stoltman, Joseph P.; Keach, Everett T., Jr.

    This economics simulation game complements the third grade Gold Mining Unit developed by Project Social Studies at the University of Minnesota. The simulation is designed for three purposes: 1) to reinforce the prior learning which occurs in the gold mining camp unit; 2) to involve eight-year-olds in the process of solving simulated economic…

  1. Gold-nickel-titanium brazing alloy


    Mizuhara, Howard


    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99 gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  2. Gold-Collar Workers. ERIC Digest.

    ERIC Educational Resources Information Center

    Wonacott, Michael E.

    The gold-collar worker has problem-solving abilities, creativity, talent, and intelligence; performs non-repetitive and complex work difficult to evaluate; and prefers self management. Gold-collar information technology workers learn continually from experience; recognize the synergy of teams; can demonstrate leadership; and are strategic thinkers…

  3. Gold of the Pharaohs 6000 years of gold mining in Egypt and Nubia

    NASA Astrophysics Data System (ADS)

    Klemm, Dietrich; Klemm, Rosemarie; Murr, Andreas


    The legendary wealth in gold of ancient Egypt seems to correspond with an unexpected high number of gold production sites in the Eastern Desert of Egypt and Nubia. This contribution introduces briefly the general geology of these vast regions and discusses the geology of the different varieties of the primary gold occurrences (always related to auriferous quartz mineralization in veins or shear zones) as well as the variable physico-chemical genesis of the gold concentrations. The development of gold mining over time, from Predynastic (ca. 3000 BC) until the end of Arab gold production times (about 1350 AD), including the spectacular Pharaonic periods is outlined, with examples of its remaining artefacts, settlements and mining sites in remote regions of the Eastern Desert of Egypt and Nubia. Finally, some estimates on the scale of gold production are presented.

  4. Preparation of conductive gold nanowires in confined environment of gold-filled polymer nanotubes.


    Mitschang, Fabian; Langner, Markus; Vieker, Henning; Beyer, André; Greiner, Andreas


    Continuous conductive gold nanofibers are prepared via the "tubes by fiber templates" process. First, poly(l-lactide) (PLLA)-stabilized gold nanoparticles (AuNP) with over 60 wt% gold are synthesized and characterized, including gel permeation chromatography coupled with a diode array detector. Subsequent electrospinning of these AuNP with template PLLA results in composite nanofibers featuring a high gold content of 57 wt%. Highly homogeneous gold nanowires are obtained after chemical vapor deposition of 345 nm of poly(p-xylylene) (PPX) onto the composite fibers followed by pyrolysis of the polymers at 1050 °C. The corresponding heat-induced transition from continuous gold-loaded polymer tubes to smooth gold nanofibers is studied by transmission electron microscopy and helium ion microscopy using both secondary electrons and Rutherford backscattered ions.

  5. Gold emissivities for hydrocode applications

    NASA Astrophysics Data System (ADS)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.


    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroès superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroès emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations.

  6. Switchable imbibition in nanoporous gold

    PubMed Central

    Xue, Yahui; Markmann, Jürgen; Duan, Huiling; Weissmüller, Jörg; Huber, Patrick


    Spontaneous imbibition enables the elegant propelling of nano-flows because of the dominance of capillarity at small length scales. The imbibition kinetics are, however, solely determined by the static host geometry, the capillarity, and the fluidity of the imbibed liquid. This makes active control particularly challenging. Here we show for aqueous electrolyte imbibition in nanoporous gold that the fluid flow can be reversibly switched on and off through electric potential control of the solid–liquid interfacial tension, that is, we can accelerate the imbibition front, stop it, and have it proceed at will. Simultaneous measurements of the mass flux and the electrical current allow us to document simple scaling laws for the imbibition kinetics, and to explore the charge transport in the metallic nanopores. Our findings demonstrate that the high electric conductivity along with the pathways for fluid/ionic transport render nanoporous gold a versatile, accurately controllable electrocapillary pump and flow sensor for minute amounts of liquids with exceptionally low operating voltages. PMID:24980062

  7. The interaction of gold with gallium arsenide

    NASA Technical Reports Server (NTRS)

    Weizer, Victor G.; Fatemi, Navid S.


    Gold and gold-based alloys, commonly used as solar-cell contact materials, are known to react readily with gallium arsenide. Experiments designed to identify the mechanisms involved in these GaAs-metal interactions have yielded several interesting results. It is shown that the reaction of GaAs with gold takes place via a dissociative diffusion process. It is shown further that the GaAs-metal reaction rate is controlled to a very great extent by the condition of the free surface of the contact metal, an interesting example of which is the previously unexplained increase in the reaction rate that has been observed for samples annealed in a vacuum environment as compared to those annealed in a gaseous ambient. A number of other hard-to-explain observations, such as the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface, are also explained by invoking this mechanism.

  8. Synthesis of camptothecin-loaded gold nanomaterials

    NASA Astrophysics Data System (ADS)

    Xing, Zhimin; Liu, Zhiguo; Zu, Yuangang; Fu, Yujie; Zhao, Chunjian; Zhao, Xiuhua; Meng, Ronghua; Tan, Shengnan


    Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.

  9. Ordering Gold Nanoparticles with DNA Origami Nanoflowers.


    Schreiber, Robert; Santiago, Ibon; Ardavan, Arzhang; Turberfield, Andrew J


    Nanostructured materials, including plasmonic metamaterials made from gold and silver nanoparticles, provide access to new materials properties. The assembly of nanoparticles into extended arrays can be controlled through surface functionalization and the use of increasingly sophisticated linkers. We present a versatile way to control the bonding symmetry of gold nanoparticles by wrapping them in flower-shaped DNA origami structures. These "nanoflowers" assemble into two-dimensonal gold nanoparticle lattices with symmetries that can be controlled through auxiliary DNA linker strands. Nanoflower lattices are true composites: interactions between the gold nanoparticles are mediated entirely by DNA, and the DNA origami will fold into its designed form only in the presence of the gold nanoparticles.

  10. Tailored nanoporous gold for ultrahigh fluorescence enhancement.


    Lang, X Y; Guan, P F; Fujita, T; Chen, M W


    We report molecular fluorescence enhancement of free-standing nanoporous gold in which the nanoporosity can be arbitrarily tailored by the combination of dealloying and electroless gold plating. The nanoporous gold fabricated by this facile method possesses unique porous structures with large gold ligaments and very small pores, and exhibits significant improvements in surface enhanced fluorescence as well as structure rigidity. It demonstrates that the confluence effect of improved quantum yield and excitation of fluorophores is responsible for the large fluorescence enhancement due to the near-field enhancement of nanoporous gold, which arises from the strong electromagnetic coupling between neighboring ligaments and the weakening of plasmon damping of the large ligaments because of the small pore size and large ligament size, respectively.

  11. Magnetically mediated vortexlike assembly of gold nanoshells.


    Sun, Jianfei; Dong, Jian; Sun, Dongke; Guo, Zhirui; Gu, Ning


    Gold nanoshells currently attract increasing research interests due to the important role in many subjects. For practical applications, random arrangement of the nanoparticles is often unfavored so that the assembly of gold nanoshells is becoming a central issue. We here proposed to utilize time-variant magnetic field to direct the assembly of gold nanoshells. It was discovered that the alternating magnetic field can mediate the vortex-like assembly of gold nanoshells. The mechanism was explored and thought to be relative with the electric field of induction which caused the thermal gradient on the substrate and the electric force. The vortexlike structure as well as the assembly mechanism will play an important role in research and application of gold nanomaterials.

  12. 75 FR 40005 - Self-Regulatory Organizations; Chicago Board Options Exchange, Incorporated; Order Granting...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Approval of Proposed Rule Change To Enable the Listing and Trading of Options on the Sprott Physical Gold... change to list and trade options on the Sprott Physical Gold Trust (``Sprott Options''). The proposed.... Description of Proposal Recently, the Commission authorized CBOE to list and trade options on the SPDR...

  13. 76 FR 20779 - Self-Regulatory Organizations; The Options Clearing Corporation; Notice of Filing and Immediate...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Effectiveness of Proposed Rule Change To Provide Legal Certainty for the Trading of Futures on the CBOE Gold ETF... futures on the CBOE Gold ETF Volatility Index (``GVZ Index''). II. Self-Regulatory Organization's... Exchange, LLC (``CFE'') as an up-to-the-minute market estimate of the expected volatility of SPDR...

  14. Molecular Beam Optical Study of Gold Sulfide and Gold Oxide

    NASA Astrophysics Data System (ADS)

    Zhang, Ruohan; Yu, Yuanqin; Steimle, Timothy


    Gold-sulfur and gold-oxygen bonds are key components to numerous established and emerging technologies that have applications as far ranging as medical imaging, catalysis, electronics, and material science. A major theoretical challenge for describing this bonding is correctly accounting for the large relativistic and electron correlation effects. Such effects are best studied in diatomic, AuX, molecules. Recently, the observed AuS electronic state energy ordering was measured and compared to a simple molecular orbital diagram prediction. Here we more thoroughly investigate the nature of the electronic states of both AuS and AuO from the analysis of high-resolution (FWHM\\cong35MHz) optical Zeeman spectroscopy of the (0,0){B}2Σ--{X}2Π3/2 bands. The determined fine and hyperfine parameters for the {B}2Σ- state of AuO differ from those extracted from the analysis of a hot, Doppler-limited, spectrum. It is demonstrated that the nature of the {B}2Σ- states of AuO and AuS are radically different. The magnetic tuning of AuO and AuS indicates that the {B}2Σ- states are heavily contaminated. Supported by the National Science Foundation under Grant No.1265885. D. L. Kokkin, R. Zhang, T. C. Steimle, I. A. Wyse, B. W. Pearlman and T. D. Varberg, J. Phys. Chem. A., 119(48), 4412, 2015. L. C. O'Brien, B. A. Borchert, A. Farquhar, S. Shaji, J. J. O'Brien and R. W. Field, J. Mol. Spectrosc., 252(2), 136, 2008

  15. Gold's future role in fuel cell systems

    NASA Astrophysics Data System (ADS)

    Cameron, Don; Holliday, Richard; Thompson, David

    Innovative recent research has suggested that gold-based catalysts are potentially capable of being effectively employed in fuel cells and related hydrogen fuel processing. The justification for developing the gold catalyst technologies described, is not only based on their promising technical performance, but also the relatively low stable price and greater availability of gold compared with the platinum group metals. The employment of gold catalysts could therefore produce a welcome reduction in the capital cost of fuel cell installations. The most likely first use for gold catalysts is for the removal of carbon monoxide impurities from the hydrogen feedstock streams used for fuel cells. Such hydrogen is usually obtained from reforming reactions (from hydrocarbons or methanol) either from free-standing plant or from an on-board reformer in a vehicle in the case of transport applications. Absence of carbon monoxide would enable fuel cells to run at lower temperatures and with improved efficiency. Effectiveness of gold catalysts in this application has already been demonstrated. Preferential oxidation (PROX) of carbon monoxide in hydrogen-rich reformer gas is best effected by a gold catalyst (Au/α-Fe 2O 3) which is significantly more active at lower temperatures than the commercial PROX catalyst, i.e. Pt/γ-Al 2O 3 currently used for this purpose. Supported gold catalysts are also very active in the water gas shift reaction used for producing hydrogen from carbon monoxide and water. Research has shown that gold supported on iron oxide (Au/α-Fe 2O 3) catalyst is more active at lower temperatures than both the α-Fe 2O 3 support and the mixed copper/zinc oxide (CuO/ZnO) catalyst currently used commercially. Preparation of gold on iron oxide and gold on titania (Au/Fe 2O 3 and Au/TiO 2) by deposition-precipitation produces more active catalysts than by conventional co-precipitation. Other applications for gold in fuel cells are described and include its use as a

  16. Coal-gold agglomeration: an alternative separation process in gold recovery

    SciTech Connect

    Akcil, A.; Wu, X.Q.; Aksay, E.K.


    Considering the increasing environmental concerns and the potential for small gold deposits to be exploited in the future, the uses of environmentally friendly processes are essential. Recent developments point to the potential for greatly increased plant performance through a separation process that combines the cyanide and flotation processes. In addition, this kind of alternative treatment processes to the traditional gold recovery processes may reduce the environmental risks of present small-scale gold mining. Gold recovery processes that applied to different types of gold bearing ore deposits show that the type of deposits plays an important role for the selection of mineral processing technologies in the production of gold and other precious metals. In the last 25 years, different alternative processes have been investigated on gold deposits located in areas where environmental issues are a great concern. In 1988, gold particles were first recovered by successful pilot trial of coal-gold agglomeration (CGA) process in Australia. The current paper reviews the importance of CGA in the production of gold ore and identifies areas for further development work.

  17. Exposure to metallic gold in patients with contact allergy to gold sodium thiosulfate.


    Ahnlide, I; Björkner, B; Bruze, M; Möller, H


    Gold allergy is common, with approximately 10% of patients patch tested because of eczematous disease being positive to gold sodium thiosulfate (GSTS). However, clinical relevance seems to be rare. The aim of this prospective double-blind study was to demonstrate the effects of exposure to metallic gold, in this case earrings, in gold-positive patients. 60 female patients with pierced earlobes test-positive to GSTS were included in the study. The patients were randomized into 2 groups, 30 patients receiving earrings with a surface layer consisting of 24-carat gold and 30 patients earrings with a surface layer of titanium nitride, virtually indistinguishable from gold. The patients wore the earrings for 8 weeks. During the study, any dermatitis on the earlobes, as well as on other body sites, was registered. The skin reactions observed were weak but, in total, 17 of the 60 patients had a skin reaction (local or remote) during the study, 12 of whom had received gold earrings and 5 titanium (p<0.05). 11 patients had a reaction on the earlobes, 7 of whom had received gold earrings and 4 titanium (NS). With these facts it is hard to exclude that exposure to gold jewelry can be clinically relevant in persons hypersensitive to gold.

  18. Gold-catalyzed naphthalene functionalization

    PubMed Central

    Rivilla, Iván


    Summary The complexes IPrMCl (IPr = 1,3-bis(diisopropylphenyl)imidazol-2-ylidene, M = Cu, 1a; M = Au, 1b), in the presence of one equiv of NaBAr'4 (Ar' = 3,5-bis(trifluoromethyl)phenyl), catalyze the transfer of carbene groups: C(R)CO2Et (R = H, Me) from N2C(R)CO2Et to afford products that depend on the nature of the metal center. The copper-based catalyst yields exclusively a cycloheptatriene derivative from the Buchner reaction, whereas the gold analog affords a mixture of products derived either from the formal insertion of the carbene unit into the aromatic C–H bond or from its addition to a double bond. In addition, no byproducts derived from carbene coupling were observed. PMID:21647320

  19. Gold nanoparticles in cardiovascular imaging.


    Varna, Mariana; Xuan, Hoa V; Fort, Emmanuel


    Although originally applied in the field of oncology, recent results have illustrated the considerable potential of gold nanoparticles (GNPs) in the imaging of cardiovascular diseases (CVDs). CVDs represent the leading cause of mortality and disability in the world. The principal cause underpinning CVDs is atherosclerosis, which develops into mid and large blood vessels, often leading to severe complications. Thanks to their unique physicochemical properties, GNPs have drawn much attention from the research community in cardiovascular imaging. Thus, the optical properties of GNPs have led to their utilization as contrast agents for optical or X-ray imaging modalities allowing the detection of atherosclerotic plaques, intravascular thrombus, or fibrotic tissue. In this study, we detail the most promising preclinical scientific progresses based on the use of GNPs for imaging in cardiovascular field and their improvements for a potential clinical application. For further resources related to this article, please visit the WIREs website.

  20. Cancer theranostics with gold nanoshells.


    Zhao, Jun; Wallace, Michael; Melancon, Marites P


    Gold nanoshells (AuNSs) present a vivid example of integrating nanoscience in order to solve a biomedical problem. AuNSs exhibit tunable surface plasmon resonance, which can be tuned to the near-infrared region in order to realize optimal tissue penetration. The highly efficient light-to-heat transformation by AuNSs during laser irradiation causes thermal damage to the tumor without damaging healthy organs. Transient nanobubbles can form around AuNSs during laser treatment and induce mechanical stress specifically in tumor cells. AuNSs also serve as a versatile platform for the delivery of various diagnostic and therapeutic agents. In this article, we describe the physicochemical properties of AuNSs in the context of their design, preparation and application in cancer theranostics. Ultimately, we look beyond the current research on AuNSs and discussed future challenges to their successful translation into clinical use.

  1. Annealing of gold nanostructures sputtered on polytetrafluoroethylene

    PubMed Central


    Gold nanolayers sputtered on polytetrafluoroethylene (PTFE) surface and their changes induced by post-deposition annealing at 100°C to 300°C are studied. Changes in surface morphology and roughness are examined by atomic force microscopy, electrical sheet resistance by two point technique, zeta potential by electrokinetic analysis and chemical composition by X-ray photoelectron spectroscopy (XPS) in dependence on the gold layer thickness. Transition from discontinuous to continuous gold coverage takes place at the layer thicknesses 10 to 15 nm and this threshold remains practically unchanged after the annealing at the temperatures below 200°C. The annealing at 300°C, however, leads to significant rearrangement of the gold layer and the transition threshold increases to 70 nm. Significant carbon contamination and the presence of oxidized structures on gold-coated samples are observed in XPS spectra. Gold coating leads to a decrease in the sample surface roughness. Annealing at 300°C of pristine PTFE and gold-coated PTFE results in significant increase of the sample surface roughness. PMID:22078024

  2. Functionalization of gold nanoparticles as antidiabetic nanomaterial

    NASA Astrophysics Data System (ADS)

    Venkatachalam, M.; Govindaraju, K.; Mohamed Sadiq, A.; Tamilselvan, S.; Ganesh Kumar, V.; Singaravelu, G.


    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS, FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0 mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p < 0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5 mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  3. Gold nano-particles fixed on glass

    NASA Astrophysics Data System (ADS)

    Worsch, Christian; Wisniewski, Wolfgang; Kracker, Michael; Rüssel, Christian


    A simple process for producing wear resistant gold nano-particle coatings on transparent substrates is proposed. Soda-lime-silica glasses were sputtered with gold and subsequently coated with SiO2 using a combustion chemical vapor deposition technique. Some samples were first coated with silica, sputtered with gold and then coated with a second layer of silica. The samples were annealed for 20 min at either 550 or 600 °C. This resulted in the formation of round, well separated gold nano-particles with sizes from 15 to 200 nm. The color of the coated glass was equivalent to that of gold-ruby glasses. Silica/gold/silica coatings annealed at 600 °C for 20 min were strongly adherent and scratch resistant. X-ray diffraction and electron backscatter diffraction (EBSD) were used to describe the crystal orientations of the embedded particles. The gold particles are preferably oriented with their (1 1 1) planes perpendicular to the surface.

  4. Gold metal liquid-like droplets.


    Smirnov, Evgeny; Scanlon, Micheál D; Momotenko, Dmitry; Vrubel, Heron; Méndez, Manuel A; Brevet, Pierre-Francois; Girault, Hubert H


    Simple methods to self-assemble coatings and films encompassing nanoparticles are highly desirable in many practical scenarios, yet scarcely any examples of simple, robust approaches to coat macroscopic droplets with continuous, thick (multilayer), reflective and stable liquid nanoparticle films exist. Here, we introduce a facile and rapid one-step route to form films of reflective liquid-like gold that encase macroscopic droplets, and we denote these as gold metal liquid-like droplets (MeLLDs). The present approach takes advantage of the inherent self-assembly of gold nanoparticles at liquid-liquid interfaces and the increase in rates of nanoparticle aggregate trapping at the interface during emulsification. The ease of displacement of the stabilizing citrate ligands by appropriate redox active molecules that act as a lubricating molecular glue is key. Specifically, the heterogeneous interaction of citrate stabilized aqueous gold nanoparticles with the lipophilic electron donor tetrathiafulvalene under emulsified conditions produces gold MeLLDs. This methodology relies exclusively on electrochemical reactions, i.e., the oxidation of tetrathiafulvalene to its radical cation by the gold nanoparticle, and electrostatic interactions between the radical cation and nanoparticles. The gold MeLLDs are reversibly deformable upon compression and decompression and kinetically stable for extended periods of time in excess of a year.

  5. Gold nanoparticles produced in a microalga

    NASA Astrophysics Data System (ADS)

    Luangpipat, Tiyaporn; Beattie, Isabel R.; Chisti, Yusuf; Haverkamp, Richard G.


    An efficient biological route to production of gold nanoparticles which allows the nanoparticles to be easily recovered remains elusive. Live cells of the green microalga Chlorella vulgaris were incubated with a solution of gold chloride and harvested by centrifugation. Nanoparticles inside intact cells were identified by transmission electron microscopy and confirmed to be metallic gold by synchrotron based X-ray powder diffraction and X-ray absorption spectroscopy. These intracellular gold nanoparticles were 40-60 nm in diameter. At a concentration of 1.4% Au in the alga, a better than 97% recovery of the gold from solution was achieved. A maximum of 4.2% Au in the alga was obtained. Exposure of C. vulgaris to solutions containing dissolved salts of palladium, ruthenium, and rhodium also resulted in the production of the corresponding nanoparticles within the cells. These were surmised to be also metallic, but were produced at a much lower intracellular concentration than achieved with gold. Iridium was apparently toxic to the alga. No nanoparticles were observed using platinum solutions. C. vulgaris provides a possible route to large scale production of gold nanoparticles.

  6. Functionalization of gold nanoparticles as antidiabetic nanomaterial.


    Venkatachalam, M; Govindaraju, K; Mohamed Sadiq, A; Tamilselvan, S; Ganesh Kumar, V; Singaravelu, G


    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS,FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p<0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  7. Nature vs. nurture: gold perpetuates "stemness".


    Paul, Willi; Sharma, Chandra P; Deb, Kaushik Dilip


    Adult tissues contain quiescent reservoirs of multipotent somatic stem cells and pluripotent embryonic-like stem cells (ELSCs). Credited with regenerative properties gold is used across both -contemporary and -ancient medicines. Here, we show that gold exerted these effects by enhancing the pool of pluripotent ELSC while improving their stemness. We used hESCs as an in-vitro model to understand if gold could enhance self-renewal and pluripotency. Swarna-bhasma (SB), an ancient Indian gold microparticulate (41.1 nm), preparation, reduced spontaneous-differentiation, improved self-renewal, pluripotency and proliferation of hESCs. Colloidal gold-nanoparticles (GNP) (15.59 nm) were tested to confirm that the observations were attributable to nanoparticulate-gold. SB and GNP exposure: maintained -stemness, -karyotypic stability, enhanced pluripotency till day-12, increased average colony-sizes, and reduced the number of autonomously-derived differentiated FGFR1 positive fibroblast-niche-cells/colony. Particulate-gold induced upregulation of FGFR1 and IGF2 expression, and decrease in IGF1 secretion indicates IGF1/2 mediated support for enhanced pluripotency and self-renewal in hESCs.

  8. Gel Electrophoresis of Gold-DNA Nanoconjugates


    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...


    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  9. Alkanetelluroxide-protected gold nanoparticles.


    Li, Ying; Silverton, Latoya C; Haasch, Richard; Tong, Yu Ye


    The synthesis and characterization of the first air-stable tellurium-containing ligand-protected gold nanoparticles (NPs) are reported. Although the synthesis largely followed the well-known Brust two-phase approach, the starting ligand was dioctyl ditelluride rather than alkanetellurol, which is an analogue of the widely used alkanethiol. Dioctyl ditelluride was used because alkanetellurol is unstable. The 1H and 13C NMR spectra, as well as infrared spectra (IR) of the formed Au NPs, indicated that the Te-Te bond in the starting ligand was broken but the octyl group was intact. This was further corroborated by the solid-state 125Te NMR spectrum that displayed a very broad and significantly downfield-shifted peak, indicating that tellurium was directly bound to the Au core. Furthermore, the O 1s and Te 3d XPS spectra of the Au NPs indicated that the capping ligands were octanetelluroxide. An average particle size of 2.7 nm diameter as measured by transmission electron microscopy (TEM) corresponded to an Au607 core. A two-step weight loss of approximately 22.2% in total was observed in the thermogravimetric analysis, which indicated about 53% ligand monolayer coverage (i.e., Au607(Te(=O)C8H17)133). Additionally, dioctyl ditelluride demonstrated an intriguing reductive power that led to a more sophisticated chemistry of forming the air-stable octanetelluroxide-protected gold NPs. It has been found that (1) when the ratio of Au to Te was about 1.5 a colorless intermediate state similar to Au(I)-SR (the intermediate state widely accepted in the synthesis of thiolate-protected Au NPs) could be obtained and (2) this kind of intermediate state played a key role in the formation of stable Au NPs.

  10. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2013 CFR


    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  11. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2014 CFR


    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  12. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2011 CFR


    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  13. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2012 CFR


    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  14. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2010 CFR


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  15. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2013 CFR


    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  16. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2012 CFR


    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  17. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2011 CFR


    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  18. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2010 CFR


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  19. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2014 CFR


    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  20. Colloidal-gold electrosensor measuring device


    Wegner, S.; Harpold, M.A.; McCaffrey, T.M.; Morris, S.E.; Wojciechowski, M.; Zhao, J.; Henkens, R.W.; Naser, N.; O`Daly, J.P.


    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 {micro}g/dL in blood samples as small as 10 {micro}L. 9 figs.

  1. Colloidal-gold electrosensor measuring device


    Wegner, Steven; Harpold, Michael A.; McCaffrey, Terence M.; Morris, Susan E.; Wojciechowski, Marek; Zhao, Junguo; Henkens, Robert W.; Naser, Najih; O'Daly, John P.


    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 .mu.g/dL in blood samples as small as 10 .mu.L.

  2. Designing hollow nano gold golf balls.


    Landon, Preston B; Mo, Alexander H; Zhang, Chen; Emerson, Chris D; Printz, Adam D; Gomez, Alan F; DeLaTorre, Christopher J; Colburn, David A M; Anzenberg, Paula; Eliceiri, Matthew; O'Connell, Connor; Lal, Ratnesh


    Hollow/porous nanoparticles, including nanocarriers, nanoshells, and mesoporous materials have applications in catalysis, photonics, biosensing, and delivery of theranostic agents. Using a hierarchical template synthesis scheme, we have synthesized a nanocarrier mimicking a golf ball, consisting of (i) solid silica core with a pitted gold surface and (ii) a hollow/porous gold shell without silica. The template consisted of 100 nm polystyrene beads attached to a larger silica core. Selective gold plating of the core followed by removal of the polystyrene beads produced a golf ball-like nanostructure with 100 nm pits. Dissolution of the silica core produced a hollow/porous golf ball-like nanostructure.

  3. Gold nanoparticles extraction from dielectric scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin


    The unique advantages such as brightness, non-photobleaching, good bio-compatibility make gold nanoparticles desirable labels and play important roles in biotech and related research and applications. Distinguishing gold nanoparticles from other dielectric scattering particles is of more importance, especially in bio-tracing and imaging. The enhancement image results from the localized surface plasmon resonance associated with gold nanopartilces makes themselves distinguishable from other dielectric particles, based on which, we propose a dual-wavelength detection method by employing a high sensitive cross-polarization microscopy.

  4. Electrochemical control of creep in nanoporous gold

    SciTech Connect

    Ye, Xing-Long; Jin, Hai-Jun


    We have investigated the mechanical stability of nanoporous gold (npg) in an electrochemical environment, using in situ dilatometry and compression experiments. It is demonstrated that the gold nano-ligaments creep under the action of surface stress which leads to spontaneous volume contractions in macroscopic npg samples. The creep of npg, under or without external forces, can be controlled electrochemically. The creep rate increases with increasing potential in double-layer potential region, and deceases to almost zero when the gold surface is adsorbed with oxygen. Surprisingly, we also noticed a correlation between creep and surface diffusivity, which links the deformation of nanocrystals to mobility of surface atoms.

  5. Electrically Conductive Polyimide Films Containing Gold Surface

    NASA Technical Reports Server (NTRS)

    Caplan, Maggie L.; Stoakley, Diane M.; St. Clair, Anne K.


    Polyimide films exhibiting high thermo-oxidative stability and including electrically conductive surface layers containing gold made by casting process. Many variations of basic process conditions, ingredients, and sequence of operations possible, and not all resulting versions of process yield electrically conductive films. Gold-containing layer formed on film surface during cure. These metallic gold-containing polyimides used in film and coating applications requiring electrical conductivity, high reflectivity, exceptional thermal stability, and/or mechanical integrity. They also find commercial potential in areas ranging from thin films for satellite antennas to decorative coatings and packaging.

  6. Gold deposit styles and placer gold characterisation in northern and east-central Madagascar

    USGS Publications Warehouse

    Pitfield, Peter E. J; Styles, Michael T.; Taylor, Cliff D.; Key, Roger M.; Bauer,; Ralison, A


    Microchemical characterisation of bedrock and placer gold grains from six gold districts within the Archaean domains and intervening Neoproterozoic Anaboriana-Manampotsy belt of northern and east-central Madagascar show few opaque inclusions (e.g pyrrhotite, Bi tellurides) but wide range of Ag contents (40wt%). Some districts exhibit multiple source populations of grains. The ‘greenstone belt’ terranes have an orogenic gold signature locally with an intrusion-related to epithermal overprint. Proterozoic metasediments with felsic to ultramafic bodies yield dominantly intrusion-related gold. A high proportion of secondary gold (<0.5wt% Ag) is related to recycling of paleoplacers and erosion of post-Gondwana planation surfaces and indicates that some mesothermal gold systems were already partially to wholly removed by erosion by the PermoTriassic.

  7. Gold nanodumbbell-seeded growth of silver nanobars and nanobipyramids

    NASA Astrophysics Data System (ADS)

    Deng, Jin-Pei; Chen, Chih-Wei; Hsieh, Wei-Chi; Wang, Chao-Hsien; Hsu, Cheng-Yung; Lin, Jyun-Hao


    Gold nanodumbbells (NDs) are prepared by the reduction of gold ions in the presence of gold nanorods. Gold NDs are then employed for the synthesis of gold-silver core-shell nanoparticles (Au@Ag NPs). The quasi-ellipsoidal NPs could be found at room temperature, but Au@Ag bar and triangular bipyramid (TBP) NPs were obtained at 75 °C. Our results show that the long ends of gold NDs are in the position of the bar center and closely paralleled the shorter edge of TBP. Mechanisms in the growth of silver on gold NDs are proposed for the formations of these Au@Ag NPs.

  8. Gold and gold-iron oxide magnetic glyconanoparticles: synthesis, characterization and magnetic properties.


    de la Fuente, Jesús M; Alcántara, David; Eaton, Peter; Crespo, Patricia; Rojas, Teresa C; Fernandez, Asunción; Hernando, Antonio; Penadés, Soledad


    The preparation, characterization and the magnetic properties of gold and gold-iron oxide glyconanoparticles (GNPs) are described. Glyconanoparticles were prepared in a single step procedure in the presence of aqueous solution of thiol functionalized neoglycoconjugates and either gold salts or both gold and iron salts. Neoglycoconjugates of lactose and maltose disaccharides with different linkers were used. Iron-free gold or gold-iron oxide GNPs with controlled gold-iron ratios were obtained. The average core-size diameters are in the range of 1.5-2.5 nm. The GNPs are fully characterized by (1)H NMR spectrometry, transmission electron microscopy (TEM), and UV-vis and X-ray absorption (XAS) spectroscopies. Inductive plasma-atomic emission spectrometry (ICP) and elemental analysis gave the average number of neoglycoconjugates per cluster. The magnetic properties were measured in a SQUID magnetometer. The most remarkable results was the observation of a permanent magnetism up to room temperature in the iron-free gold GNPs, that was not present in the corresponding gold-iron oxide GNPs.

  9. Structural controls on Carlin-type gold mineralization in the gold bar district, Eureka County, Nevada

    USGS Publications Warehouse

    Yigit, O.; Nelson, E.P.; Hitzman, M.W.; Hofstra, A.H.


    The Gold Bar district in the southern Roberts Mountains, 48 km northwest of Eureka, Nevada, contains one main deposit (Gold Bar), five satellite deposits, and other resources. Approximately 0.5 Moz of gold have been recovered from a resource of 1,639,000 oz of gold in Carlin-type gold deposits in lower plate, miogeoclinal carbonate rocks below the Roberts Mountains thrust. Host rocks are unit 2 of the Upper Member of the Devonian Denay Formation and the Bartine Member of the McColley Canyon Formation. Spatial and temporal relations between structures and gold mineralization indicate that both pre-Tertiary and Tertiary structures were important controls on gold mineralization. Gold mineralization occurs primarily along high-angle Tertiary normal faults, some of which are reactivated reverse faults of Paleozoic or Mesozoic age. Most deposits are localized at the intersection of northwest- and northeast-striking faults. Alteration includes decalcification, and to a lesser extent, silicification along high-angle faults. Jasperoid (pervasive silicification), which formed along most faults and in some strata-bound zones, accounts for a small portion of the ore in every deposit. In the Gold Canyon deposit, a high-grade jasperoid pipe formed along a Tertiary normal fault which was localized along a zone of overturned fault-propagation folds and thrust faults of Paleozoic or Mesozoic age.

  10. Emergency Response to Gold King Mine Release

    EPA Pesticide Factsheets

    Description of August 5, 2015 release of contaminated waters from the Gold King Mine into Cement Creek and the Animas River, and the resulting emergency response remediation efforts, including monitoring of affected waterways.

  11. Novel Catalysis by Gold: A Modern Alchemy

    NASA Astrophysics Data System (ADS)

    Haruta, Masatake

    Gold has long been neglected as a catalyst because of its chemical inertness. However, when gold is deposited as nanoparticles on carbon and polymer materials as well as on base metal oxides and hydroxides, it exhibits unique catalytic properties for many reactions such as CO oxidation at a temperature as low as 200 K, gas phase direct epoxidation of propylene, and aerobic oxidation of glucose to gluconic acid. The structure-catalytic activity correlations are discussed with emphasis on the contact structure, support selection, and the size control of gold particles. Gold clusters with diameters smaller than 2 nm are expected to exhibit novel properties in catalysis, optics, and electronics depending on the size (number of atoms), shape, and the electronic and chemical interaction with the support materials. The above achievements and attempts can be regarded as a modern alchemy that creates valuables by means of the noblest element with little practical use.

  12. Anatomy of gold catalysts: facts and myths

    PubMed Central

    Ranieri, Beatrice; Escofet, Imma


    This review article covers the main types of gold(i) complexes used as precatalysts under homogeneous conditions in organic synthesis and discusses the different ways of catalyst activation as well as ligand, silver, and anion effects. PMID:26055272

  13. Aqueous Black Colloids of Reticular Nanostructured Gold

    NASA Astrophysics Data System (ADS)

    Stanca, S. E.; Fritzsche, W.; Dellith, J.; Froehlich, F.; Undisz, A.; Deckert, V.; Krafft, C.; Popp, J.


    Since ancient times, noble gold has continuously contributed to several aspects of life from medicine to electronics. It perpetually reveals its new features. We report the finding of a unique form of gold, reticular nanostructured gold (RNG), as an aqueous black colloid, for which we present a one-step synthesis. The reticules consist of gold crystals that interconnect to form compact strands. RNG exhibits high conductivity and low reflection, and these features, coupled with the high specific surface area of the material, could prove valuable for applications in electronics and catalysis. Due to high absorption throughout the visible and infrared domain, RNG has the potential to be applied in the construction of sensitive solar cells or as a substrate for Raman spectroscopy.

  14. Radiochemical separation of gold by amalgam exchange

    USGS Publications Warehouse

    Ruch, R.R.


    A rapid and simple method for the radiochemical separation of gold after neutron activation. The technique is based on treatment with a dilute indium-gold amalgam, both chemical reduction and isotopic exchange being involved. The counting efficiency for 198Au in small volumes of the amalgam is good. Few interferences occur and the method is applicable to clays, rocks, salts and metals. The possibility of determining silver, platinum and palladium by a similar method is mentioned. ?? 1970.

  15. Silver and gold-catalyzed multicomponent reactions

    PubMed Central

    Abbiati, Giorgio


    Summary Silver and gold salts and complexes mainly act as soft and carbophilic Lewis acids even if their use as σ-activators has been rarely reported. Recently, transformations involving Au(I)/Au(III)-redox catalytic systems have been reported in the literature. In this review we highlight all these aspects of silver and gold-mediated processes and their application in multicomponent reactions. PMID:24605168


    USGS Publications Warehouse

    Antweiler, John C.; Cathrall, John; Tripp, Richard


    The United States Geological Survey has begun a state-wide study of Alaskan gold deposits. The immediate goals are to determine the relationship of gold in placer deposits to possible primary sources, to determine how nuggets form, to contribute to existing knowledge of principles for prospecting for placer deposits, and determine if minerals associated with placer deposits might suggest important deposits of other metals. The project started in 1982 with a study of placer mines in the Brooks Range.

  17. Orientations of polyoxometalate anions on gold nanoparticles.


    Sharet, Shelly; Sandars, Ella; Wang, Yifeng; Zeiri, Offer; Neyman, Alevtina; Meshi, Louisa; Weinstock, Ira A


    Cryogenic transmission electron microscopy of polyoxometalate-protected gold nanoparticles reveals that the Preyssler ion, [NaP(5)W(30)O(110)](14-), lies "face down" with its C(5) axis perpendicular to the gold surface, while the Finke-Droege ion, [P(4)W(30)Zn(4)(H(2)O)(2)O(112)](16-), is "tilted", with its long axis close to 60° from the normal to the surface.

  18. Effective PEGylation of gold nanorods

    NASA Astrophysics Data System (ADS)

    Schulz, F.; Friedrich, W.; Hoppe, K.; Vossmeyer, T.; Weller, H.; Lange, H.


    Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to dramatically improve the ligand exchange and to synthesize PEGylated AuNR with high chemical and colloidal stability and high PEG grafting densities. Such AuNR are especially interesting for applications in nanomedicine.Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to

  19. The gold rush 1925-35.


    Keers, R Y


    Although from the time of Koch onwards there had been desultory experiments with a variety of gold preparations in the management of pulmonary tuberculosis, gold as a recognised and accepted treatment did not emerge until 1925. In that year Holger Mollgaard of Copenhagen introduced sanocrysin, a double thiosulphate of gold and sodium, with which he had conducted an extensive series of animal experiments. The results of these were considered to justify its use in clinical practice and two physicians, Secher and Faber, undeterred by its toxicity, reported enthusiastically in its favour. Other Danish physicians followed but, alarmed by violent reactions, modified the dosage, an example followed by British workers. Encouraging results continued to be reported although each series contained a significant proportion of failures, and toxicity remained high. The first properly planned and fully controlled clinical trial took place in the United States and produced a report which was wholly adverse and which sounded the death knell of gold therapy throughout America. Until 1934-35 gold was used extensively in Europe but thereafter there was a sudden and largely universal cessation of interest and within a few years gold, introduced with such éclat and carrying so many high hopes, had vanished from the therapy of tuberculosis even though, at that point, no better alternative was available.

  20. Acoustic vibrations of single suspended gold nanostructures

    NASA Astrophysics Data System (ADS)

    Major, Todd A.

    The acoustic vibrations for single gold nanowires and gold plates were studied using time-resolved ultrafast transient absorption. The objective of this work was to remove the contribution of the supporting substrate from the damping of the acoustic vibrations of the metal nano-objects. This was achieved by suspending the nano-objects across trenches created by photolithography and reactive ion etching. Transient absorption measurements for single suspended gold nanowires were initially completed in air and water environments. The acoustic vibrations for gold nanowires over the trench in air last typically for several nanoseconds, whereas gold nanowires in water are damped more quickly. Continuum mechanics models suggest that the acoustic impedance mismatch between air and water dominates the damping rate. Later transient absorption studies on single suspended gold nanowires were completed in glycerol and ethylene glycol environments. However, our continuum mechanical model suggests nearly complete damping in glycerol due to its high viscosity, but similar damping rates are seen between the two liquids. The continuum mechanics model thus incorrectly addresses high viscosity effects on the lifetimes of the acoustic vibrations, and more complicated viscoelastic interactions occur for the higher viscosity liquids. (Abstract shortened by UMI.).

  1. Gold mobility during Palaeoarchaean submarine alteration

    NASA Astrophysics Data System (ADS)

    Hofmann, Axel; Pitcairn, Iain; Wilson, Allan


    Seafloor alteration provides large amounts of solutes to the hydrosphere. In order to investigate gold mobility during water-rock interaction prior to 3-billion-years ago, low detection limit analysis of Au concentrations was carried out on rocks from marine alteration zones. Stratiform zones recording low-temperature (≤150 °C) seafloor alteration are a characteristic feature of greenstone belts older than 3.0 Ga. Hydrothermal processes were operating on, and immediately below, the seafloor, giving rise to extensive silicification of sub-seafloor volcanic rocks and silicification of seafloor sediments. In order to investigate gold mobility during silicification, unaltered and variably silicified volcanic rocks and associated cherts from Palaeoarchaean greenstone successions (c. 3.4 Ga) of South Africa were analyzed. Results show mobility of gold during silicification of mafic/ultramafic rocks and transfer to the Archaean ocean. Some gold was incorporated into carbonaceous marine sediments overlying the alteration zones. A combination of pervasive silicification, rarity of black shales, and low gold content in komatiites can explain the low mineralization potential of Palaeoarchaean greenstone belts for orogenic gold deposits.

  2. [Sunrise gold foil jacket crown].


    Lecardonnel, A


    This technique permits the preparation of ceramic jacket crowns made on Sunrise laminated precious metal alloy. The Sunrise foil is gold-colored, made of 99% of precious metals and is 50 microns thick. The die is prepared in order to display a moderate and regular undercut beyond the cervical limit. The margin will be underlined with a red pencil. The Sunrise foil is cut according to predetermined templates. Then the foil is applied without burnishing, according to the technique of jacket crowns on platinum foil only by finger pressure. The double folding on closure is preferably done distally or mesially. Then, the metal base is disinserted, sandblasted with 100 microns aluminum oxide, replaced on its die, and placed in a rubber casing before being placed in the isostatic press, to be subjected to a pressure of 2,000 TSI (14 kg par cm2). Sunrise's orange color reinforces rather subtetly the overall color, making these reconstructions particularly esthetic. The color of the Sunrise metal does not require, therefore a too thick opaque. Any ceramic intended to be fired on a metal base, may be used in respecting its firing protocol. Sunrise, as any other technique of this type, require a careful preparation with a shoulder that has a rounded gingivoaxial line angle. Bridges may be built on the "thimbles" crowns, fitted on Sunrise cores, the pontics being made as a ceramo-metal framework.

  3. Gold Nanoparticle Mediated Cancer Immunotherapy

    PubMed Central

    Almeida, Joao Paulo Mattos; Figueroa, Elizabeth Raquel; Drezek, Rebekah Anna


    Significant progress has been made in the field of cancer immunotherapy, where the goal is to activate or modulate the body’s immune response against cancer. However, current immunotherapy approaches exhibit limitations of safety and efficacy due to systemic delivery. In this context, the use of nanotechnology for the delivery of cancer vaccines and immune adjuvants presents a number of advantages such as targeted delivery to immune cells, enhanced therapeutic effect, and reduced adverse outcomes. Recently, gold nanoparticles (AuNP) have been explored as immunotherapy carriers, creating new AuNP applications that merit a critical overview. This review highlights recent advances in the development of AuNP mediated immunotherapies that harness AuNP biodistribution, optical properties and their ability to deliver macromolecules such as peptides and oligonucleotides. It has been demonstrated that the use of AuNP carriers can improve the delivery and safety of immunotherapy agents, and that AuNP immunotherapies are well suited for synergistic combination therapy with existing cancer therapies like photothermal ablation. PMID:24103304

  4. Curcumin: the Indian solid gold.


    Aggarwal, Bharat B; Sundaram, Chitra; Malani, Nikita; Ichikawa, Haruyo


    Turmeric, derived from the plant Curcuma longa, is a gold-colored spice commonly used in the Indian subcontinent, not only for health care but also for the preservation of food and as a yellow dye for textiles. Curcumin, which gives the yellow color to turmeric, was first isolated almost two centuries ago, and its structure as diferuloylmethane was determined in 1910. Since the time of Ayurveda (1900 Bc) numerous therapeutic activities have been assigned to turmeric for a wide variety of diseases and conditions, including those of the skin, pulmonary, and gastrointestinal systems, aches, pains, wounds, sprains, and liver disorders. Extensive research within the last half century has proven that most of these activities, once associated with turmeric, are due to curcumin. Curcumin has been shown to exhibit antioxidant, anti-inflammatory, antiviral, antibacterial, antifungal, and anticancer activities and thus has a potential against various malignant diseases, diabetes, allergies, arthritis, Alzheimer's disease, and other chronic illnesses. These effects are mediated through the regulation of various transcription factors, growth factors, inflammatory cytokines, protein kinases, and other enzymes. Curcumin exhibits activities similar to recently discovered tumor necrosis factor blockers (e.g., HUMIRA, REMICADE, and ENBREL), a vascular endothelial cell growth factor blocker (e.g., AVASTIN), human epidermal growth factor receptor blockers (e.g., ERBITUX, ERLOTINIB, and GEFTINIB), and a HER2 blocker (e.g., HERCEPTIN). Considering the recent scientific bandwagon that multitargeted therapy is better than monotargeted therapy for most diseases, curcumin can be considered an ideal "Spice for Life".

  5. Tectonic setting of Late Cenozoic gold mineralization in the gold belt of Costa Rica

    SciTech Connect

    Deruyter, V.D.


    The Gold Belt of Costa Rica is a northwest-elongated zone 15 km wide by 120 km long containing numerous auriferous quartz veins and pyritic silicified patterns upon which abundant small mines are developed. Gold veins are related principally to northeast-southwest and north-south striking, steeply dipping faults. Higher grade ore and thicker veins invariably occur at intersections of these fracture orientations, indicating simultaneous opening at the time of gold introduction. Restriction of gold veins to the northwest-trending arc of Miocene Aguacate Group andesite volcanic rocks, a product of Cocos Plate subduction, suggested approximately coeval formation, but recognition by the writer of the important role played by 2-5 m.y. old altered, gold mineralized rhyolite dikes intruded along north-south gold vein structures and intimately involved with high grade ores at the Esperanza Mine and Rio Chiquito prospect, for example, suggest a much younger period of fracturing and gold introduction. The rhyolite intrusions are more brittle and stockwork mineralized than andesite host rocks and form bulk tonnage gold targets. Initiation of right-lateral movement along the north-south Panama Fracture Zone at 5 m.y.a. within the pattern of northeastward Cocos Plate subduction may have tapped rhyolites from subvolcanic magma chambers into new faults.

  6. Gold(I) Carbenoids: On-Demand Access to Gold(I) Carbenes in Solution.


    Sarria Toro, Juan M; García-Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S; Echavarren, Antonio M


    Chloromethylgold(I) complexes of phosphine, phosphite, and N-heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene.

  7. Gold(I) Carbenoids: On‐Demand Access to Gold(I) Carbenes in Solution

    PubMed Central

    Sarria Toro, Juan M.; García‐Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S.


    Abstract Chloromethylgold(I) complexes of phosphine, phosphite, and N‐heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene. PMID:28090747

  8. East asian gold: Deciphering the anomaly of phanerozoic gold in precambrian cratons

    USGS Publications Warehouse

    Goldfarb, R.J.; Hart, C.; Davis, G.; Groves, D.


    Early Cretaceous orogenic gold deposits in eastern Asia are globally unique in that large Phanerozoic lode gold deposits occur in Archean-Paleoproterozoic cratons. In the northern Pacific region, ca. 125 Ma orogenic gold deposits in the North China, Yangzte, and Siberian craton margins, as well as in young terranes in California, may ultimately relate to the giant Cretaceous mantle plume in the southern Pacific basin and the relatively rapid tectonic consequences along both continental margins from resulting Pacific plate reconfigurations. In eastern Asia, such consequences include reactivation of and fluid flow along major fault systems, with fluid focusing into simultaneously forming, isolated core complexes of uncertain genesis. Deposition of gold ores in previously devolatilized high-grade Precambrian metamorphic rocks requires an exotic source of ore fluid, most likely subducted Mesozoic oceanic crust and/or overlying sediment. An implication is that Phanerozoic metamorphic core complexes in other destabilized craton margins could host large gold resources. ?? 2007 by Economic Geology.

  9. Silver, gold, and alloyed silver-gold nanoparticles: characterization and comparative cell-biologic action

    NASA Astrophysics Data System (ADS)

    Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li, Zi-An; Farle, Michael; Köller, Manfred; Epple, Matthias


    Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly( N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 μg mL-1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.

  10. Oxidation state of gold and arsenic in gold-bearing arsenian pyrite

    SciTech Connect

    Simon, G.; Huang, H.; Penner-Hahn, J.E.; Kesler, S.E.; Kao, L.S.


    XANES measurements on gold-bearing arsenian pyrite from the Twin Creeks Carlin-type gold deposits show that gold is present as both Au{sup 0} and Au{sup 1+} and arsenic is present as As{sup 1{minus}}. Au{sup 0} is attributed to sub-micrometer size inclusions of free gold, whereas Au{sup 1+} is attributed to gold in the lattice of the arsenian pyrite. STEM observations suggest that As{sup 1{minus}} is probably concentrated in angstrom-scale, randomly distributed layers with a marcasite or arsenopyrite structure. Ionic gold (Au{sup 1+}) could be concentrated in these layers as well, and is present in both twofold- and fourfold-coordinated forms, with fourfold-coordinated Au{sup 1+} more abundant. Twofold-coordinated Au{sup 1+} is similar to gold in Au{sub 2}S in which it is linearly coordinated to two sulfur atoms. The nature of fourfold-coordinated Au{sup 1+} is not well understood, although it might be present as an Au-As-S compound where gold is bonded in fourfold coordination to sulfur and arsenic atoms, or in vacancy positions on a cation site in the arsenian pyrite. Au{sup 1+} was probably incorporated into arsenian pyrite by adsorption onto pyrite surfaces during crystal growth. The most likely compound in the case of twofold-coordinated Au{sup 1+} was probably a tri-atomic surface complex such as S{sub pyrite}-Au{sup 1+}-S{sub bi-sulfide}H or Au{sup 1+}-S-Au{sup 1+}. The correlation between gold and arsenic might be related to the role of arsenic in enhancing the adsorption of gold complexes of this type on pyrite surfaces, possibly through semiconductor effects.

  11. Precipitation of lamellar gold nanocrystals in molten polymers

    NASA Astrophysics Data System (ADS)

    Palomba, M.; Carotenuto, G.


    Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.

  12. Engineered Gold Nanoparticles and Plant Adaptation Potential

    NASA Astrophysics Data System (ADS)

    Siddiqi, Khwaja Salahuddin; Husen, Azamal


    Use of metal nanoparticles in biological system has recently been recognised although little is known about their possible effects on plant growth and development. Nanoparticles accumulation, translocation, growth response and stress modulation in plant system is not well understood. Plants exposed to gold and gold nanoparticles have been demonstrated to exhibit both positive and negative effects. Their growth and yield vary from species to species. Cytoxicity of engineered gold nanoparticles depends on the concentration, particle size and shape. They exhibit increase in vegetative growth and yield of fruit/seed at lower concentration and decrease them at higher concentration. Studies have shown that the gold nanoparticles exposure has improved free radical scavenging potential and antioxidant enzymatic activities and alter micro RNAs expression that regulate different morphological, physiological and metabolic processes in plants. These modulations lead to improved plant growth and yields. Prior to the use of gold nanoparticles, it has been suggested that its cost may be calculated to see if it is economically feasible.

  13. Radiofrequency Heating Pathways for Gold Nanoparticles

    PubMed Central

    Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.


    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry and physics, including the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell may all strongly influence to what extent a nanoparticle heats in an RF field. Aspects of RF include: power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields, and also influence the extent to which a gold nanoparticle heats in RF. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments. PMID:24962620

  14. Therapeutic gold, silver, and platinum nanoparticles.


    Yamada, Miko; Foote, Matthew; Prow, Tarl W


    There are an abundance of nanoparticle technologies being developed for use as part of therapeutic strategies. This review focuses on a narrow class of metal nanoparticles that have therapeutic potential that is a consequence of elemental composition and size. The most widely known of these are gold nanoshells that have been developed over the last two decades for photothermal ablation in superficial cancers. The therapeutic effect is the outcome of the thickness and diameter of the gold shell that enables fine tuning of the plasmon resonance. When these metal nanoparticles are exposed to the relevant wavelength of light, their temperature rapidly increases. This in turn induces a localized photothermal ablation that kills the surrounding tumor tissue. Similarly, gold nanoparticles have been developed to enhance radiotherapy. The high-Z nature of gold dramatically increases the photoelectric cross-section. Thus, the photoelectric effects are significantly increased. The outcome of these interactions is enhanced tumor killing with lower doses of radiation, all while sparing tissue without gold nanoparticles. Silver nanoparticles have been used for their wound healing properties in addition to enhancing the tumor-killing effects of anticancer drugs. Finally, platinum nanoparticles are thought to serve as a reservoir for platinum ions that can induce DNA damage in cancer cells. The future is bright with the path to clinical trials is largely cleared for some of the less complex therapeutic metal nanoparticle systems.

  15. Amplitude enhancement by a gold dimer

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin; Jin, Zheng


    The unique optical properties such as brightness, non-bleaching, good bio-compatibility make gold particles ideal label candidates for molecular probes. Due to the strongly enhanced field, aggregation of gold nanoparticles finds themselves plenty of applications in bio-imaging. But limited by its small cross-section associated with nanometer sized particle, it is a big challenge to employ it in a single molecular detection. The field enhancement results from the effect of plasmonic coupling between two closely attached gold nanoparticle under the right excitation condition. With the aim to apply the gold dimer probe to find the molecules in our recently established optical detection method, we compared of the amplitude enhancement by the dimer relative to a single particle. The amplitude distribution under a highly focused illumination objective was calculated, whose results suggest that at the optimized excitation condition, the local field can be enhanced 190 fold. In consequence, experimental detection was carried out. Gold dimers were linked together by the hybridization of two single chain DNAs. Dimer and single particle probes were mixed together in one detection. Overwhelming contrast between these two kinds of probes were clearly exhibited in the experimental detection image. This method can provide a way to a high specific detection in early diagnosis.

  16. Controlling Gold Nanoclusters by Diphospine Ligands

    SciTech Connect

    Chen, Jing; Zhang, Qianfan; Bonaccorso, Timary A.; Williard, Paul G.; Wang, Lai S.


    We report the synthesis and structure determination of a new Au22 nanocluster coordinated by six bidentate diphosphine ligands: 1,8-bis(diphenylphosphino) octane (L8 for short). Single crystal x-ray crystallography and electrospray ionization mass spectrometry show that the cluster assembly is neutral and can be formulated as Au22(L8)6. The Au22 core consists of two Au11 units clipped together by four L8 ligands, while the additional two ligands coordinate to each Au11 unit in a bidentate fashion. Eight gold atoms at the interface of the two Au11 units are not coordinated by any ligands. Four short gold-gold distances (2.64?2.65 Å) are observed at the interface of the two Au11 clusters as a result of the clamping force of the four clipping ligands and strong electronic interactions. The eight uncoordinated surface gold atoms in the Au22(L8)6 nanocluster are unprecedented in atom-precise gold nanoparticles and can be considered as potential in-situ active sites for catalysis.

  17. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    NASA Technical Reports Server (NTRS)

    Venkatasubbarao, Srivatsa


    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  18. Gold grade variation and particle microchemistry in exploration pits of the Batouri gold district, SE Cameroon

    NASA Astrophysics Data System (ADS)

    Vishiti, A.; Suh, C. E.; Lehmann, B.; Egbe, J. A.; Shemang, E. M.


    The Batouri area hosts lode-gold mineralization under several-m-thick lateritic cover. Pitting to bed rock on a geochemical Au anomaly defined from previous reconnaissance soil sampling identified five horizons ranging from saprock at the base to laterite at the top. Analysis of bulk samples from each horizon by fire assay shows that most of the horizons are barren although 119 ppb and 48 ppb Au values were obtained from one laterite horizon and one saprolite horizon, respectively, from two separate pits. All the horizons were panned and particulate gold was also recovered only from these two horizons. The gold grains from both horizons are morphologically and compositionally indistinguishable with rare quartz, pyrite and galena inclusions. The grains have irregular, sub-rounded, bean to elongated shapes and they show a remarkable core-rim zonation. Electron microprobe analysis of the grains recorded high gold content in the rims (86.3-100 wt%) and along fissures within the grains (95.1-100 wt%). The cores are relatively Ag rich (11.8-14 wt% Ag) while the rims (0.63-13.7 wt% Ag, most of the values fall within the lower limit of this range) and fissures (0.03-5.02 wt% Ag) are poor in Ag. The low Ag concentration in the rims and along fissures is attributed to preferential leaching of Ag; a process recognized in gold grains and platiniferous alloys from alluvia. The core composition of the grains is similar to that of primary gold composition in the bedrock. These results show that gold in the soil is relic particulate gold derived from the primary source with no evidence of secondary gold precipitation in the weathering cycle. In all the pits no horizon was systematically enriched in gold suggesting there has been no chemical remobilization of gold in this environment. Rather the dispersion of gold here is in the particulate form. Therefore combining particulate gold features with assay data is relevant to exploration in such tropical environments.

  19. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun


    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  20. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun


    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  1. Galvanic gold plating for fixed dental prosthesis.


    Ozcelik, Tuncer Burak; Yilmaz, Burak


    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique.

  2. Catalysis by unsupported skeletal gold catalysts.


    Wittstock, Arne; Bäumer, Marcus


    Catalysis is one of the key technologies for the 21st century for achieving the required sustainability of chemical processes. Critical improvements are based on the development of new catalysts and catalytic concepts. In this context, gold holds great promise because it is more active and selective than other precious metal catalysts at low temperatures. However, gold becomes only chemically and catalytically active when it is nanostructured. Since the 1970s and 1980s, the first type of gold catalysts that chemists studied were small nanoparticles on oxidic supports. With the later onset of nanotechnology, a variety of nanostructured materials not requiring a support or organic stabilizers became available within about the last 10 years. Among these are gold nanofoams generated by combustion of gold compounds, nanotube membranes prepared by electroless deposition of gold inside a template, and corrosion-derived nanoporous gold. Even though these materials are macroscopic in their geometric dimensions (e.g., disks, cubes, and membranes with dimensions of millimeters), they are comprised of gold nanostructures, for example, in the form of ligaments as small as 15 nm in diameter (nanoporous gold, npAu). The nanostructure brings about a high surface to volume ratio and a large fraction of low coordinated surface atoms. In this Account, we discuss how unsupported materials are active catalysts for aerobic oxidation reaction in gas phase (oxidation of CO and primary alcohols), as well as liquid phase oxidation and reduction reactions. It turns out that the bonding and activation of molecular oxygen for gas phase oxidations strongly profits from trace amounts of an ad-metal residue such as silver. It is noteworthy that these catalysts still exhibit the special gold type chemistry, characterized by activity at very low temperatures and high selectivity for partial oxidations. For example, we can oxidize CO over these unsupported catalysts (npAu, nanotubes, and powder) at

  3. Ultrasonic-aided fabrication of gold nanofluids.


    Chen, Hui-Jiuan; Wen, Dongsheng


    A novel ultrasonic-aided one-step method for the fabrication of gold nanofluids is proposed in this study. Both spherical- and plate-shaped gold nanoparticles (GNPs) in the size range of 10-300 nm are synthesized. Subsequent purification produces well-controlled nanofluids with known solid and liquid contents. The morphology and properties of the nanoparticle and nanofluids are characterized by transmission electron microscopy, scanning electron microscope, energy dispersive X-ray spectroscope, X-ray diffraction spectroscopy, and dynamic light scattering, as well as effective thermal conductivities. The ultrasonication technique is found to be a very powerful tool in engineering the size and shape of GNPs. Subsequent property measurement shows that both particle size and particle shape play significant roles in determining the effective thermal conductivity. A large increase in effective thermal conductivity can be achieved (approximately 65%) for gold nanofluids using plate-shaped particles under low particle concentrations (i.e.764 μM/L).

  4. Gold(III) complexes in medicinal chemistry.


    Maia, Pedro Ivo da Silva; Deflon, Victor M; Abram, Ulrich


    A number of gold(III) compounds has been designed with the objective of overcoming the disadvantages associated with the platinum-based drugs for cancer treatment. Compounds of a remarkable structural manifold show significant antiproliferative effects in vitro against a number of cancer cells, including cisplatin resistant ones. The target of most of them is, unlike that of cisplatin, not the DNA. Although the mechanisms of action displayed by the gold compounds in biological media are still under investigation, many studies show evidence that the cellular targets are mitochondria-based. Recent advances in gold(III) medicinal chemistry also recommend such compounds for other pharmacological applications such as the treatment of viral or parasitic diseases. The radioactive isotopes (198)Au and (199)Au present potential in radiotherapy.

  5. Layering-induced Superlubricity: Gold on Graphite

    NASA Astrophysics Data System (ADS)

    Vanossi, Andrea; Guerra, Roberto; Tosatti, Erio; Nanofriction Group Sissa Team


    By means of realistic MD simulations, we explore the static friction trend as a function of the true contact area and the model dimensionality for 2D gold nanoislands and 3D gold nanoclusters deposited on graphite, interesting tribological systems whose slow and fast dynamics have been previously investigated. For increasing island size, because of the relative gold-graphite lattice mismatch, the interface stress energy has the chance to pile up by forming frustrated unmatched (i.e., incommensurate) regions and to develop a continuous solitonic pathway, foreshadowing a possible condition for the occurrence of ultra-low friction regimes. The significant reduction of the depinning threshold, towards superlubricity, with the system dimensionality can be ascribed to a layering-induced effective stiffness of the interface contact, favoring the natural Au-C lattice incommensurability. Partly sponsored under SNSF Sinergia Grant CRSII2 136287/1, EU ERC Grant No. 320796 MODPHYSFRICT, EU COST Action MP1303.

  6. OCT imaging enhancement of ovarian cancer using gold and gold/silver nanorods

    NASA Astrophysics Data System (ADS)

    Shi, Yiwen; Fan, Shanhui; Chen, Shuohui; Jiang, Xia; Zhao, Qingliang; Ren, Qiushi; Cui, Daxiang; Zhou, Chuanqing


    For OCT imaging, enhancing contrast efficiency will lead to significant improvements in the detection limits in cancer. Recently, noble metal nanoparticles are considered to be better contrast agents than traditional ones, especially for gold and silver. Silver nanoparticles have more attractive optical properties than gold nanoparticles. But they are employed far less because of its poor chemical stability. In this paper, we introduced our recent progress on a new application of using gold/silver alloy nanoparticles as OCT contrast agents in the detection of ovarian cancer. The scattering properties and sensitivity of silver were investigated. By means of tuning LSPR wavelengths of the nanoparticles, they were able to match the central wavelength of light used in OCT. Before carrying out animal experiments, we evaluated the different performances of alloy nanoparticles and gold nanorods in vitro. It has been sufficiently demonstrated that the alloy nanoparticles revealed stronger OCT signals than gold nanorods because of the better scattering properties. Then in vivo study, we compared the contrast enhancement of gold/silver alloy nanoparticles and gold nanorods on the ovarian cancer model mice. This study contributes a new kind of contrast agent in OCT imaging, which has a profound effect on drug delivery and further therapeutic action.

  7. Luminescent gold nanoparticles for bioimaging

    NASA Astrophysics Data System (ADS)

    Zhou, Chen

    Inorganic nanoparticles (NPs) with tunable and diverse material properties hold great potential as contrast agents for better disease management. Over the past decades, luminescent gold nanoparticles (AuNPs) with intrinsic emissions ranging from the visible to the near infrared have been synthesized and emerge as a new class of fluorophores for bioimaging. This dissertation aims to fundamentally understand the structure-property relationships in luminescent AuNPs and apply them as contrast agents to address some critical challenges in bioimaging at both the in vitro and in vivo level. In Chapter 2, we described the synthesized ~20 nm polycrystalline AuNPs (pAuNPs), which successfully integrated and enhanced plasmonic and fluorescence properties into a single AuNP through the grain size effect. The combination of these properties in one NP enabled AuNPs to serve as a multimodal contrast agent for in vitro optical microscopic imaging, making it possible to develop correlative microscopic imaging techniques. In Chapters 3-5, we proposed a feasible approach to optimize the in vivo kinetics and clearance profile of nanoprobes for multimodality in vivo bioimaging applications by using straightforward surface chemistry with luminescent AuNPs as a model. Luminescent glutathione-coated AuNPs of ~2 nm were synthesized. Investigation of the biodistribution showed that these glutathione-coated AuNPs (GS-AuNPs) exhibit stealthiness to the reticuloendothelial system (RES) organs and efficient renal clearance, with only 3.7+/-1.9% and 0.3+/-0.1% accumulating in the liver and spleen, and over 65% of the injection dose cleared out via the urine within the first 72 hours. In addition, ~2.5 nm NIR-emitting radioactive glutathione-coated [198Au]AuNPs (GS-[198Au]AuNPs) were synthesized for further evaluation of the pharmacokinetic profile of GS-AuNPs and potential multimodal imaging. The results showed that the GS-[198Au]AuNPs behave like small-molecule contrast agents in

  8. Major brazilian gold deposits - 1982 to 1999

    USGS Publications Warehouse

    Thorman, C.H.; Dewitt, E.; Maron, M.A.; Ladeira, E.A.


    Brazil has been a major but intermittent producer of gold since its discovery in 1500. Brazil led the world in gold production during the 18th and early 19th centuries. From the late 19th century to the late 20th century, total mining company and garimpeiro production was small and relatively constant at about 5 to 8 t/year. The discovery of alluvial deposits in the Amazon by garimpeiros in the 1970s and the opening of eight mines by mining companies from 1983 to 1990 fueled a major boom in Brazil's gold production, exceeding 100 t/year in 1988 and 1989. However, garimpeiro alluvial production decreased 'rapidly in the 1990s, to about 10 t/year by 1999. Company production increased about tenfold from about 4 t/year in 1982 to 40 t in 1992. Production from 1992 to the present remained relatively stable, even though several mines were closed or were in the process of closing and no new major mines were put into production during that period. Based on their production history from 1982-1999, 17 gold mines are ranked as major (> 20 t) and minor (3-8 t) mines. From 1982-1999, deposits hosted in Archean rocks produced 66% of the gold in Brazil, whereas deposits in Paleoproterozoic and Neoproterozoic rocks accounted for 19% and 15%, respectively. Deposits in metamorphosed sedimentary rocks, especially carbonate-rich rocks and carbonate iron-formation, yielded the great bulk of the gold. Deposits in igneous rocks were of much less importance. The Archean and Paleoproterozoic terranes of Brazil largely lack base-metal-rich volcanogenic massive sulfide deposits, porphyry deposits, and polymetallic veins and sedimentary exhalative deposits. An exception to this is in the Caraja??s Mineral Province.

  9. Rheumatoid arthritis, gold therapy, contact allergy and blood cytokines

    PubMed Central

    Svensson, Åke; Möller, Halvor; Björkner, Bert; Bruze, Magnus; Leden, Ido; Theander, Jan; Ohlsson, Kjell; Linder, Carina


    Objective To study the clinical and biochemical effects of a low starting dose for gold therapy in rheumatoid arthritis patients with a contact allergy to gold. Methods Serum cytokines were assayed before and 24 h after the first injection of gold sodium thiomalate (GSTM). Results Contact allergy to gold was found in 4 of 19 patients. Compared to gold-negative patients (starting dose: 10 mg GSTM), there was a larger increase in serum TNFalpha (p < 0.05), sTNF-R1 (NS), and IL-1 ra (p < 0.05) in gold-allergic patients. Conclusions Cytokines are released in blood by GSTM in RA patients with gold allergy. To minimize the risk of acute adverse reactions the starting dose of GSTM should be lowered to 5 mg. Alternatively, patients should be patch-tested before gold therapy; in test-positive cases, 5 mg is recommended as the first dose. PMID:11860615


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, c. 1937. DATE BASED ON USE IN PUBLICATION. CREDIT WR. - Bald Mountain Gold Mill, Nevada Gulch at head of False Bottom Creek, Lead, Lawrence County, SD


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  12. Nanosecond laser ablation of gold nanoparticle films

    SciTech Connect

    Ko, Seung H.; Choi, Yeonho; Hwang, David J.; Grigoropoulos, Costas P.; Chung, Jaewon; Poulikakos, Dimos


    Ablation of self-assembled monolayer protected gold nanoparticle films on polyimide was explored using a nanosecond laser. When the nanoparticle film was ablated and subsequently thermally sintered to a continuous film, the elevated rim structure by the expulsion of molten pool could be avoided and the ablation threshold fluence was reduced to a value at least ten times lower than the reported threshold for the gold film. This could be explained by the unusual properties of nanoparticle film such as low melting temperature, weak bonding between nanoparticles, efficient laser energy deposition, and reduced heat loss. Finally, submicron lines were demonstrated.

  13. Plasmonics of Gold Nanorods. Considerations for Biosensing

    NASA Astrophysics Data System (ADS)

    Liz-Marzán, Luis M.; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel

    In this chapter, we explore the sensitivity of gold nanorods toward changes in the dielectric constant of the surrounding medium. Experimental data for pure and silica-coated nanorods with varying shell thickness are compared to calculations based on the boundary element method (BEM). They indicate that anisotropy and sharp tips make nanoparticles more environmentally sensitive. We also find that sensitivity decreases as silica shell thickness increases, as expected from a dielectric screening effect. Even when coated with thin shells, gold nanorods are found to be excellent candidates for biosensing applications.

  14. Current methods for synthesis of gold nanoparticles.


    Herizchi, Roya; Abbasi, Elham; Milani, Morteza; Akbarzadeh, Abolfazl


    Metal nanoparticles, such as nanoparticles synthesized using gold, have numerous uncommon chemical and physical properties due to the effects of their quantum size and their large surface area, in comparison with other metal atoms or bulk metal. Gold nanoparticles (GNPs), in particular, are very attractive because of their size and shape-dependent properties. Metal nanoparticles have gathered extensive attention due to their uncommon properties and promising applications in photonics, electronics, biochemical sensing, and imaging. This review covers recent advances in the synthesis of GNPs.

  15. Functionalized Gold Nanoparticles and Their Biomedical Applications

    PubMed Central

    Tiwari, Pooja M.; Vig, Komal; Dennis, Vida A.; Singh, Shree R.


    Metal nanoparticles are being extensively used in various biomedical applications due to their small size to volume ratio and extensive thermal stability. Gold nanoparticles (GNPs) are an obvious choice due to their amenability of synthesis and functionalization, less toxicity and ease of detection. The present review focuses on various methods of functionalization of GNPs and their applications in biomedical research. Functionalization facilitates targeted delivery of these nanoparticles to various cell types, bioimaging, gene delivery, drug delivery and other therapeutic and diagnostic applications. This review is an amalgamation of recent advances in the field of functionalization of gold nanoparticles and their potential applications in the field of medicine and biology.

  16. Crack injection in silver gold alloys

    NASA Astrophysics Data System (ADS)

    Chen, Xiying

    Stress corrosion cracking (SCC) is a materials degradation phenomena resulting from a combination of stress and a corrosive environment. Among the alphabet soup of proposed mechanism of SCC the most important are film-rupture, film-induced cleavage and hydrogen embrittlement. This work examines various aspects of film-induced cleavage in gold alloys for which the operation of hydrogen embrittlement processes can be strictly ruled out on thermodynamic grounds. This is so because in such alloys SCC occurs under electrochemical conditions within which water is stable to hydrogen gas evolution. The alloy system examined in this work is AgAu since the corrosion processes in this system occur by a dealloying mechanism that results in the formation of nanoporous gold. The physics behind the dealloying process as well as the resulting formation of nanoporous gold is today well understood. Two important aspects of the film-induced cleavage mechanism are examined in this work: dynamic fracture in monolithic nanoporous gold and crack injection. In crack injection there is a finite thickness dealloyed layer formed on a AgAu alloy sample and the question of whether or not a crack that nucleates within this layer can travel for some finite distance into the un-corroded parent phase alloy is addressed. Dynamic fracture tests were performed on single edge-notched monolithic nanoporous gold samples as well as "infinite strip" sample configurations for which the stress intensity remains constant over a significant portion of the crack length. High-speed photography was used to measure the crack velocity. In the dynamic fracture experiments cracks were observed to travel at speeds as large as 270 m/s corresponding to about 68% of the Raleigh wave velocity. Crack injection experiments were performed on single crystal Ag77Au23, polycrystalline Ag72Au28 and pure gold, all of which had thin nanoporous gold layers on the surface of samples. Through-thickness fracture was seen in both the

  17. Shape-controlled Synthesis of Gold Nanoparticles from Gold(III)-chelates of β-diketones

    NASA Astrophysics Data System (ADS)

    Kundu, Subrata; Pal, Anjali; Ghosh, Sujit Kumar; Nath, Sudip; Panigrahi, Sudipa; Praharaj, Snigdhamayee; Basu, Soumen; Pal, Tarasankar


    Chelating ligands with β-diketone skeleton have been employed for the first time as reductant to produce ligand stabilized gold nanoparticles of different shapes out of aqueous HAuCl4 solutions. Evolution of stable gold nanoparticles happens to be first order with respect to gold particles having rate constants ˜ ˜10-2 min-1 and subsequent chlorine insertion in the β-diketone skeleton is reported as a general feature. Spherical or triangular or hexagonal particle evolution goes selectively under the influence of different β-diketones in terms of capping and reducing capabilities of the reductants.

  18. Self-assembly of 4-ferrocene thiophenol capped electroactive gold nanoparticles onto gold electrode

    NASA Astrophysics Data System (ADS)

    Li, Di; Li, Jinghong


    Gold nanoparticles capped by 4-ferrocene thiophenol with an average core size of 2.5 nm and surface plasmon absorbance at 522 nm were place-exchanged with 1,8-octanedithiol, and then self-assembled onto the gold electrode via tail SH group. The self-assembly was characterized by X-ray photoelectron spectroscopy. Cyclic voltammograms examined the coverage fraction of the self-assembled monolayers of the electroactive gold nanoparticles and the formal potential of the indicated SAMs. Further experiments exhibited that the electrode process was controlled by surface confined faradic reactions.

  19. Fractionation of gold in a differentiated tholeiitic dolerite

    USGS Publications Warehouse

    Rowe, J.J.


    Gold content was determined, by neutron-activation analysis, in samples from a drill core through the Great Lake sheet, Tasmania, a differentiated tholeiitic dolerite. The gold content of parts of the core seems to be related to the mafic index. The variation of gold content with depth and mafic index is similar to that of copper, indicating that gold and copper may have been concomitantly crystallized from the magma. ?? 1969.

  20. Early Yellowstone hotspot magmatism and gold metallogeny

    NASA Astrophysics Data System (ADS)

    Hames, Willis; Unger, Derick; Saunders, James; Kamenov, George


    High-grade epithermal gold deposits in the Northern Great Basin have long been associated with regional Miocene basaltic to rhyolitic volcanism. Previous models for the low-sulfidation epithermal gold ores in this region have generally portrayed the bimodal magmas as a source of heat to drive large-scale convection of meteoritic water that leached gold from crustal sources and deposited it in hydrothermal vein systems, or required that the gold evolve from fractionated silicic magmas. New data of the present study indicate a more direct genetic link to the plume-related basaltic magmas of the region. Laser 40Ar/ 39Ar incremental heating plateau ages for single crystals of adularia from several of these low-sulfidation epithermal gold deposits range from 16.6 Ma to 15.5 Ma. Adularia from the Jumbo deposit yields three concordant plateau ages with a combined statistical result of 16.54 ± 0.04 Ma (95% confidence level, MSWD = 0.23). Plateau ages for adularia from other deposits in the region, and from gold-bearing veins in the Owyhee Mountains of southwestern Idaho, yield similar ages up to ~16.5 Ma, however some veins are as young as ca. 15.5 Ma and the grain-to-grain ages for a given sample can vary by up to ca. 0.5 Ma. Observed variations in age among the adularia crystals of a given rock sample indicate varying amounts of extraneous argon, and also loss of radiogenic 40Ar, among the population of grains for a particular sample. The single-crystal results are interpreted to indicate a 16.5-15.5 Ma interval for formation of gold-bearing adularia veins in the region. The initiation and duration of this gold-forming event appears contemporaneous (within uncertainties) with the basaltic volcanism at the Steens Mountain section and an ensuing one-million-year episode of basaltic volcanism from multiple centers in the region ( Brueseke et al., 2007). Trace amounts of lead are alloyed with gold in the deposits studied. The isotopic compositions of this lead are not

  1. Gold-coated nanoparticles for use in biotechnology applications


    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.


    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  2. Gold-coated nanoparticles for use in biotechnology applications


    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.


    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  3. Link between ridge subduction and gold mineralization in southern Alaska

    USGS Publications Warehouse

    Haeussler, Peter J.; Bradley, Dwight C.; Goldfarb, Richard; Snee, Lawrence W.; Taylor, Cliff D.


    40Ar/39Ar geochronology reveals that turbidite-hosted gold deposits in the southern Alaska accretionary prism are the same age as nearby near-trench plutons. These early Tertiary plutons and gold lodes formed above a slab window during subduction of an oceanic spreading center. Ridge subduction is a previously unrecognized tectonic process for the generation of lode gold.

  4. Gold nanoparticles: preparation, functionalisation and applications in biochemistry and immunochemistry

    NASA Astrophysics Data System (ADS)

    Dykman, Lev A.; Bogatyrev, Vladimir A.


    The review summarises data on the synthesis and functionalisation of gold nanoparticles and their applications in biological investigations. Particular attention is given to applications of colloidal gold in solid-phase assays, immunoassay and studies of biologically active compounds by vibrational spectroscopy. A special section deals with the use of gold nanoparticles as antigen carriers in immunisation.

  5. 77 FR 60279 - Gold Star Mother's and Family's Day, 2012

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Documents#0;#0; ] Proclamation 8872 of September 28, 2012 Gold Star Mother's and Family's Day, 2012 By the... upholding the sacred trust we share with our Gold Star families and the heroes we have laid to rest. Let us... designated the last Sunday in September as ``Gold Star Mother's Day.'' NOW, THEREFORE, I, BARACK...

  6. 76 FR 60355 - Gold Star Mother's and Family's Day, 2011

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Documents#0;#0; ] Proclamation 8722 of September 23, 2011 Gold Star Mother's and Family's Day, 2011 By the... never fully repay, and the enormity of the grief their families carry we can never fully know. Gold Star... heartbreaking loss, our Gold Star families continue to support one another, serve their communities, and...

  7. 75 FR 60283 - Gold Star Mother's and Families' Day, 2010

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Documents#0;#0; ] Proclamation 8569 of September 24, 2010 Gold Star Mother's and Families' Day, 2010 By the... those who share in that ultimate sacrifice: America's Gold Star Mothers and Families. For those in our... exceptional spirit of service dwells in the pride of Gold Star parents, who instilled the values that...

  8. 78 FR 60179 - Gold Star Mother's and Family's Day, 2013

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Documents#0;#0; ] Proclamation 9025 of September 26, 2013 Gold Star Mother's and Family's Day, 2013 By the... their example. On this day, we remember our commitment to the Gold Star mothers and families who carry... is over, we will continue to give our military and Gold Star families the care and support...

  9. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  10. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  11. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  12. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  13. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  14. Gold in meteorites and in the earth's crust

    USGS Publications Warehouse

    Jones, Robert Sprague


    The reported gold contents of meteorites range from 0.0003 to 8.74 parts per million. Gold is siderophilic, and the greatest amounts in meteorites are in the iron phases. Estimates ,of the gold content of the earth's crust are in the range of 0.001 to 0.006 parts per million.

  15. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR


    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  16. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR


    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  17. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR


    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  18. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  19. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR


    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  20. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR


    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  1. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR


    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  2. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  3. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  4. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  5. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR


    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  6. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  7. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR


    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  8. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  9. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  10. Noble gases, K, U, Th, and Pb in native gold

    NASA Astrophysics Data System (ADS)

    Engster, O.; Niedermann, S.; Thalmann, C.; Frei, R.; Kramers, J.; KräHenbühl, U.; Liu, Y. Z.; Hofmann, B.; Boer, R. H.; Reimold, W. U.; Bruno, L.


    We present determinations of the noble gas and Pb isotopic abundances and of K, Th, and U concentrations of native gold. Our results demonstrate that gold is an excellent carrier for crustal volatiles, but direct dating of gold using the U, Th-4He, 40K-40Ar, and U fission Xe methods was not successful for various reasons. The main significance of this work is the great sensitivity of gold for trapped gases as well as for gases that were produced in situ which gives the prospects of using gold and its fluid and solid inclusions for the study of paleogas composition. Numerous nuclear effects characterize the noble gas inventory of placer gold from Switzerland and Italy, vein gold from Italy, South Africa, and Venezuela, and lode gold from South Africa. The degassing patterns obtained by mass spectrometry show a low-temperature release of volatiles around 500°C from fluid inclusions mainly in vein gold and a high-temperature release from solid inclusions and the gold itself. The low-temperature volatiles represent species that were trapped when the gold crystallized. We investigated the following trapped species: the isotopes of He, Ne, Ar, Kr, Xe, and Pb, and the abundances of K, U, Th, H2O, and CO2. The crustal gases trapped by gold comprise 3He from 6Li(n,α)3H → β- → 3He, 4He and 40Ar from the U, Th, and K decay, and Xe from 238U fission. We observe 4He/40Ar = 3.9 for the radiogenic trapped gases of tertiary gold and a ratio of 1.4 for Archean gold. These ratios are consistent with the production ratios from U and K at the respective times and demonstrate that gold can be used as a sampler of ancient atmospheric gases. The concentrations of U and Th range from a few parts per billion to a few parts per million, and those of K and Pb range up to some tens of parts per million. The antiquity of trapped Pb is indicated by the Pb-Pb model age of about 3000 Ma for the lead extracted from vein gold and quartz of the Lily gold mine (South Africa). Gold also

  11. Demonstration of enhancement of x-ray flux with foam gold compared to solid gold

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Ding, Yongkun; Lin, Zhiwei; Li, Hang; Jing, Longfei; Yuan, Zheng; Yang, Zhiwen; Tan, Xiulan; Kuang, Longyu; Zhang, Wenhai; Li, Liling; Li, Ping; Yuan, Guanghui; Jiang, Shaoen; Zhang, Baohan


    Experiments have been conducted to compare the re-emission from foam gold with a 0.3 g cc-1 density and solid gold in a SGIII prototype laser facility. Measurements of the re-emission x-ray flux demonstrate that emission is enhanced by the low density foam gold compared to the solid gold under the same conditions. The emission fraction increases with time and is concentrated on soft x-ray flux between 0.1-1 keV. The simulation results with Multi 1D agree with the experimental results. There are potential advantages to using foam walls for improving the emission and soft x-ray flux in hohlraums.

  12. Near Infrared Resonant Gold / Gold Sulfide Nanoparticles as a Photothermal Cancer Therapeutic Agent

    PubMed Central

    Gobin, André M.; Watkins, Emily M.; Quevedo, Elizabeth; Colvin, Vicki L.; West, Jennifer L.


    The development and optimization of near-infrared (nIR) absorbing nanoparticles for use as photothermal cancer therapeutic agents has been ongoing. We have previously reported on larger layered gold / silica nanoshells (~140 nm) for combined therapy and imaging applications. This work exploits the properties of smaller gold / gold sulfide (GGS) nIR absorbing nanoparticles (~35–55 nm) that provide higher absorption (98% absorption & 2% scattering for GGS versus 70% absorption & 30% scattering for gold/silica nanoshells) as well as potentially better tumor penetration. In this work we demonstrate ability to ablate tumor cells in vitro, and efficacy for photothermal cancer therapy, where in an in vivo model we show significantly increased long-term, tumor-free survival. Further, enhanced circulation and bio-distribution is observed in vivo. This class of nIR absorbing nanoparticles has potential to improve upon photothermal tumor ablation for cancer therapy. PMID:20183810

  13. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates.


    Dorel, Ruth; Echavarren, Antonio M


    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes.

  14. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates

    PubMed Central


    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes. PMID:26061916

  15. Gold Nanoparticle Hyperthermia Reduces Radiotherapy Dose

    PubMed Central

    Lin, Lynn; Slatkin, Daniel N.; Dilmanian, F. Avraham; Vadas, Timothy M.; Smilowitz, Henry M.


    Gold nanoparticles can absorb near infrared light, resulting in heating and ablation of tumors. Gold nanoparticles have also been used for enhancing the dose of X-rays in tumors during radiotherapy. The combination of hyperthermia and radiotherapy is synergistic, importantly allowing a reduction in X-ray dose with improved therapeutic results. Here we intratumorally infused small 15 nm gold nanoparticles engineered to be transformed from infrared-transparent to infrared-absorptive by the tumor, which were then heated by infrared followed by X-ray treatment. Synergy was studied using a very radioresistant subcutaneous squamous cell carcinoma (SCCVII) in mice. It was found that the dose required to control 50% of the tumors, normally 55 Gy, could be reduced to <15 Gy (a factor of >3.7). Gold nanoparticles therefore provide a method to combine hyperthermia and radiotherapy to drastically reduce the X-ray radiation needed, thus sparing normal tissue, reducing the side effects, and making radiotherapy more effective. PMID:24990355

  16. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao


    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24198458

  17. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao


    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24163578

  18. Gold Creek: Preserving an Environmental Studies Center.

    ERIC Educational Resources Information Center

    Brooks, Suzanne

    In response to a Board of Trustees request for information and recommendations concerning the future use of the Gold Creek property owned by the Los Angeles Community College District, this report emphasizes that the use of this site for instructional field experiences enhances the quality of environmental education for the district's diverse…

  19. Crystalline and amorphous gold in chrysiasis.


    Benn, H P; von Gaudecker, B; Czank, M; Loeffler, H


    Skin biopsy specimens from five patients (three females and two males) treated parenterally with gold were investigated using transmission electron microscopy. X-ray microanalysis and electron diffraction were used to determine the dermal heavy metal content. Additional sections were stained for light microscopic examination. The amount of elemental gold administered to the patients over a period of years to alleviate rheumatoid arthritis lay between a minimum of 4.0 g and a maximum of 10.0 g. In one and the same patient dermal histiocytic gold aggregations in sun-exposed areas of skin displayed a different pattern and divergent physiochemical states from the gold deposits in non-UV-exposed skin, where aurosome-like amorphous formations are found in the cells of the upper dermis. Additional spherical particles are associated predominantly with phagolysosomes in melanophages beneath solar-irradiated epidermis. Convergent beam electron diffraction proves the crystalline nature of the spherical auriferous deposits. The occurrence of skin rash was not related to different physicochemical states of the precious metal.

  20. Applications of gold nanoparticles in cancer nanotechnology.


    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao


    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  1. Applications of gold nanoparticles in cancer nanotechnology.


    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao


    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  2. Functionalized gold nanorods for molecular optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Eghtedari, Mohammad; Oraevsky, Alexander; Conjusteau, Andre; Copland, John A.; Kotov, Nicholas A.; Motamedi, Massoud


    The development of gold nanoparticles for molecular optoacoustic imaging is a very promising area of research and development. Enhancement of optoacoustic imaging for molecular detection of tumors requires the engineering of nanoparticles with geometrical and molecular features that can enhance selective targeting of malignant cells while optimizing the sensitivity of optoacoustic detection. In this article, cylindrical gold nanoparticles (i.e. gold nanorods) were fabricated with a plasmon resonance frequency in the near infra-red region of the spectrum, where deep irradiation of tissue is possible using an Alexandrite laser. Gold nanorods (Au-NRs) were functionalized by covalent attachment of Poly(ethylene glycol) to enhance their biocompatibility. These particles were further functionalized with the aim of targeting breast cancer cells using monoclonal antibodies that binds to Her2/neu receptors, which are over expressed on the surface of breast cancer cells. A custom Laser Optoacoustic Imaging System (LOIS) was designed and employed to image nanoparticle-targeted cancer cells in a phantom and PEGylated Au-NRs that were injected subcutaneously into a nude mouse. The results of our experiments show that functionalized Au-NRs with a plasmon resonance frequency at near infra-red region of the spectrum can be detected and imaged in vivo using laser optoacoustic imaging system.

  3. The golden age: gold nanoparticles for biomedicine.


    Dreaden, Erik C; Alkilany, Alaaldin M; Huang, Xiaohua; Murphy, Catherine J; El-Sayed, Mostafa A


    Gold nanoparticles have been used in biomedical applications since their first colloidal syntheses more than three centuries ago. However, over the past two decades, their beautiful colors and unique electronic properties have also attracted tremendous attention due to their historical applications in art and ancient medicine and current applications in enhanced optoelectronics and photovoltaics. In spite of their modest alchemical beginnings, gold nanoparticles exhibit physical properties that are truly different from both small molecules and bulk materials, as well as from other nanoscale particles. Their unique combination of properties is just beginning to be fully realized in range of medical diagnostic and therapeutic applications. This critical review will provide insights into the design, synthesis, functionalization, and applications of these artificial molecules in biomedicine and discuss their tailored interactions with biological systems to achieve improved patient health. Further, we provide a survey of the rapidly expanding body of literature on this topic and argue that gold nanotechnology-enabled biomedicine is not simply an act of 'gilding the (nanomedicinal) lily', but that a new 'Golden Age' of biomedical nanotechnology is truly upon us. Moving forward, the most challenging nanoscience ahead of us will be to find new chemical and physical methods of functionalizing gold nanoparticles with compounds that can promote efficient binding, clearance, and biocompatibility and to assess their safety to other biological systems and their long-term term effects on human health and reproduction (472 references).

  4. Gold Creek: An Environmental Studies Center.

    ERIC Educational Resources Information Center

    Woodley, Laurel

    A description is provided of the Gold Creek Ecological Reserve, 240 acres of undisturbed land in Northeast Los Angeles County, which serves the Los Angeles Community College District (LACCD) as an outdoor laboratory for students and faculty in numerous disciplines. Section I provides introductory information on the reserve and its features, which…

  5. Gold(III)-Catalyzed Hydration of Phenylacetylene

    ERIC Educational Resources Information Center

    Leslie, J. Michelle; Tzeel, Benjamin A.


    A guided inquiry-based experiment exploring the regioselectivity of the hydration of phenylacetylene is described. The experiment uses an acidic gold(III) catalyst in a benign methanol/water solvent system to introduce students to alkyne chemistry and key principles of green chemistry. The experiment can be easily completed in approximately 2 h,…

  6. Hydroquinone Based Synthesis of Gold Nanorods.


    Picciolini, Silvia; Mehn, Dora; Ojea-Jiménez, Isaac; Gramatica, Furio; Morasso, Carlo


    Gold nanorods are an important kind of nanoparticles characterized by peculiar plasmonic properties. Despite their widespread use in nanotechnology, the synthetic methods for the preparation of gold nanorods are still not fully optimized. In this paper we describe a new, highly efficient, two-step protocol based on the use of hydroquinone as a mild reducing agent. Our approach allows the preparation of nanorods with a good control of size and aspect ratio (AR) simply by varying the amount of hexadecyl trimethylammonium bromide (CTAB) and silver ions (Ag(+)) present in the "growth solution". By using this method, it is possible to markedly reduce the amount of CTAB, an expensive and cytotoxic reagent, necessary to obtain the elongated shape. Gold nanorods with an aspect ratio of about 3 can be obtained in the presence of just 50 mM of CTAB (versus 100 mM used in the standard protocol based on the use of ascorbic acid), while shorter gold nanorods are obtained using a concentration as low as 10 mM.

  7. Shape-Controlled Gold Nanoparticle Synthesis

    DTIC Science & Technology


    shaped nanoparticles were produced. Liu and Guyot -Sionnest (9) showed through high-resolution transmission electron microscopy (TEM) that citrate-capped...14317. 9. Liu, M.; Guyot -Sionnest, P. Mechanism of Silver (I)-Assisted Growth of Gold Nanorods and Bipyramids. The Journal of Physical Chemistry B


    ERIC Educational Resources Information Center



  9. Understanding gold nanoisland formation using transport measurement

    NASA Astrophysics Data System (ADS)

    Joshi, Toyanath

    Novel metal nano-clusters are always being an interest of scientists and researchers because of their unique optical and chemical properties. This thesis studies the formation mechanism of gold nanoisland film by studying transport properties. We used layer-by-layer self-assembled multilayer gold samples and annealed them at the temperature ranging from room temperature to 625°C. Transport properties, particularly the resistance and capacitance, were measured in situ during annealing and compared with the surface morphology and UV-vis studies. Five films of the 8-layer gold and one film of the 5-layer silver and 5-layer gold nanoparticle sequentially self-assembled samples were measured. Temperature dependent resistance curves were plotted and analyzed. From the resistance curves, we were able to identify the actual temperature for polymer evaporation and nanoisland formation. These data were re-verified by comparing them with the temperature dependent studies of surface morphology and UV-vis spectroscopy. The effect of measuring condition, like heating rate and pre-annealing time factor, was also analyzed. Particularly, the slow heating and long pre-annealing time effected nanoisland growth mechanism.

  10. Atmospheric Turbulence Statistics from GOLD Experiments

    NASA Technical Reports Server (NTRS)

    Jeganathan, Muthu; Wilson, Keith; Lesh, Jim


    Ground-Orbiter Lasercomm Demonstration (GOLD) includes the following: (1) Optical communication experiments between Table Mountain Observatory (TMF) and Japanese Engineering Test Satellite (ETS-VI); (2) International cooperative effort between NASA, NASDA, CRL and JPL; and (3) Phase 1 transmissions from October 1995 to January 1996 and Phase 2 transmissions from March 1996 to May 1996.

  11. X-ray laser driven gold targets

    SciTech Connect

    Petrova, Tz. B. Whitney, K. G.; Davis, J.


    The femtosecond population dynamics of gold irradiated by a coherent high-intensity (>10{sup 17} W/cm{sup 2}) x-ray laser pulse is investigated theoretically. There are two aspects to the assembled model. One is the construction of a detailed model of platinum-like gold inclusive of all inner-shell states that are created by photoionization of atomic gold and decay either by radiative or Auger processes. Second is the computation of the population dynamics that ensues when an x-ray pulse is absorbed in gold. The hole state generation depends on the intensity and wavelength of the driving x-ray pulse. The excited state populations reached during a few femtosecond timescales are high enough to generate population inversions, whose gain coefficients are calculated. These amplified lines in the emitted x-ray spectrum provide important diagnostics of the radiation dynamics and also suggest a nonlinear way to increase the frequency of the coherent output x-ray pulses relative to the frequency of the driver input x-ray pulse.

  12. Catalysis of Gold and Gold-Silver Alloy Nanoparticles Supported on Mesoporous Silica

    DTIC Science & Technology


    catalysts greatly and an acidic silica support may solve this problem. Our purpose here is to develop stable gold-based nanocatalysts for the...Discussion: (1) Au system: We first demonstrate the use of pure gold nanocatalyst in catalysis of CO oxidation. While there are a large number of recent...studies of Au nanocatalysts supported on metal oxides, low-temperature CO oxidation under an acidic environment has not yet been accomplished. Over

  13. Analysis of gold(I/III)-complexes by HPLC-ICP-MS demonstrates gold(III) stability in surface waters.


    Ta, Christine; Reith, Frank; Brugger, Joël; Pring, Allan; Lenehan, Claire E


    Understanding the form in which gold is transported in surface- and groundwaters underpins our understanding of gold dispersion and (bio)geochemical cycling. Yet, to date, there are no direct techniques capable of identifying the oxidation state and complexation of gold in natural waters. We present a reversed phase ion-pairing HPLC-ICP-MS method for the separation and determination of aqueous gold(III)-chloro-hydroxyl, gold(III)-bromo-hydroxyl, gold(I)-thiosulfate, and gold(I)-cyanide complexes. Detection limits for the gold species range from 0.05 to 0.30 μg L(-1). The [Au(CN)2](-) gold cyanide complex was detected in five of six waters from tailings and adjacent monitoring bores of working gold mines. Contrary to thermodynamic predictions, evidence was obtained for the existence of Au(III)-complexes in circumneutral, hypersaline waters of a natural lake overlying a gold deposit in Western Australia. This first direct evidence for the existence and stability of Au(III)-complexes in natural surface waters suggests that Au(III)-complexes may be important for the transport and biogeochemical cycling of gold in surface environments. Overall, these results show that near-μg L(-1) enrichments of Au in environmental waters result from metastable ligands (e.g., CN(-)) as well as kinetically controlled redox processes leading to the stability of highly soluble Au(III)-complexes.

  14. Bioaccumulation of gold by sulfate-reducing bacteria cultured in the presence of gold(I)-thiosulfate complex

    NASA Astrophysics Data System (ADS)

    Lengke, Maggy; Southam, Gordon


    A sulfate-reducing bacterial (SRB) enrichment, from the Driefontein Consolidated Gold Mine, Witwatersrand Basin, Republic of South Africa, was able to destabilize gold(I)-thiosulfate complex (Au(SO)23-) and precipitate elemental gold. The precipitation of gold was observed in the presence of active (live) SRB due to the formation and release of hydrogen sulfide as an end-product of metabolism, and occurred by three possible mechanisms involving iron sulfide, localized reducing conditions, and metabolism. The presence of biogenic iron sulfide caused significant removal of gold from solutions by adsorption and reduction processes on the iron sulfide surfaces. The presence of gold nanoparticles within and immediately surrounding the bacterial cell envelope highlights the presence of localized reducing conditions produced by the bacterial electron transport chain via energy generating reactions within the cell. Specifically, the decrease in redox conditions caused by the release of hydrogen sulfide from the bacterial cells destabilized the Au(SO)23- solutions. The presence of gold as nanoparticles (<10 nm) inside a sub-population of SRB suggests that the reduction of gold was a part of metabolic process. In late stationary phase or death phase, gold nanoparticles that were initially precipitated inside the bacterial cells, were released from the cells and deposited in the bulk solution as addition of gold nanoparticles that already precipitated in the solution. Ultimately, the formation of micrometer-scale sub-octahedral and octahedral gold and spherical aggregates containing octahedral gold was observed.

  15. Gold-Catalyzed Rearrangements and Beyond

    PubMed Central


    Cycloisomerizations of enynes are probably the most representative carbon–carbon bond forming reactions catalyzed by electrophilic metal complexes. These transformations are synthetically useful because chemists can use them to build complex architectures under mild conditions from readily assembled starting materials. However, these transformations can have complex mechanisms. In general, gold(I) activates alkynes in the presence of any other unsaturated functional group by forming an (η2-alkyne)–gold complex. This species reacts readily with nucleophiles, including electron-rich alkenes. In this case, the reaction forms cyclopropyl gold(I) carbene-like intermediates. These can come from different pathways depending on the substitution pattern of the alkyne and the alkene. In the absence of external nucleophiles, 1,n-enynes can form products of skeletal rearrangement in fully intramolecular reactions, which are mechanistically very different from metathesis reactions initiated by the [2 + 2] cycloaddition of a Grubbs-type carbene or other related metal carbenes. In this Account, we discuss how cycloisomerization and addition reactions of substituted enynes, as well as intermolecular reactions between alkynes and alkenes, are best interpreted as proceeding through discrete cationic intermediates in which gold(I) plays a significant role in the stabilization of the positive charge. The most important intermediates are highly delocalized cationic species that some chemists describe as cyclopropyl gold(I) carbenes or gold(I)-stabilized cyclopropylmethyl/cyclobutyl/homoallyl carbocations. However, we prefer the cyclopropyl gold(I) carbene formulation for its simplicity and mnemonic value, highlighting the tendency of these intermediates to undergo cyclopropanation reactions with alkenes. We can add a variety of hetero- and carbonucleophiles to the enynes in the presence of gold(I) in intra- or intermolecular reactions, leading to the corresponding adducts with

  16. Gold surface with gold nitride-a surface enhanced Raman scattering active substrate

    NASA Astrophysics Data System (ADS)

    Brieva, A. C.; Alves, L.; Krishnamurthy, S.; Šiller, L.


    The nitration of gold surfaces is a nonpolluting method, which can lead to large scale production of substrates with remarkable properties and applications. We present a topographical study of the nanoscale structure of the gold nitride surfaces produced by radio frequency (rf) nitrogen plasma etching of thin gold films. Atomic force microscopy images taken after rf etching reveal the striking appearance of the cluster assembly with large clusters surrounded by small clusters (7.9±1.4 and 2.3±0.9 nm, respectively) appearing to exhibit an attractive interaction. We discuss the possible mechanism for this attraction based on a colloid model by Messina et al. [Phys. Rev. Lett. 85, 872 (2000)]. This surface exhibits a notable surface enhanced Raman scattering effect demonstrated with L-alanine and rhodamine-6G. The significance of this work is that we found that this SERS active gold nitride surface can be prepared in just one step: by nitrogen plasma etching a thin gold film. Until now most SERS active gold cluster covered surfaces have been prepared in several steps very often requiring complex lithography.

  17. A halogen-free synthesis of gold nanoparticles using gold(III) oxide

    NASA Astrophysics Data System (ADS)

    Sashuk, Volodymyr; Rogaczewski, Konrad


    Gold nanoparticles are one of the most used nanomaterials. They are usually synthesized by the reduction of gold(III) chloride. However, the presence of halide ions in the reaction mixture is not always welcome. In some cases, these ions have detrimental influence on the morphology and structure of resulting nanoparticles. Here, we present a simple and halogen-free procedure to prepare gold nanoparticles by reduction of gold(III) oxide in neat oleylamine. The method provides the particles with an average size below 10 nm and dispersity of tens of percent. The process of nanoparticle formation was monitored using UV-Vis spectroscopy. The structure and chemical composition of the nanoparticles was determined by SEM, XPS and EDX. We also proposed the mechanism of reduction of gold(III) oxide based on MS, IR and NMR data. Importantly, the synthetic protocol is general and applicable for the preparation of other coinage metal nanoparticles from the corresponding metal oxides. For instance, we demonstrated that the absence of halogen enables efficient alloying of metals when preparing gold-silver bimetallic nanoparticles.

  18. Magnetic resonance investigation of gold-doped and gold-hydrogen-doped silicon

    NASA Astrophysics Data System (ADS)

    Huy, P. T.; Ammerlaan, C. A.


    Three paramagnetic centers related to gold have been observed in gold-doped and gold-doped hydrogenated silicon by magnetic resonance. One spectrum, labeled Si-NL62, corresponding to a center with monoclinic-I symmetry, presents fourfold splitting due to the hyperfine interaction with one gold atom and further hyperfine interaction with two silicon nearest-neighbor atoms. After being diffused with hydrogen in a wet atmosphere of water vapor at 1300 °C for about 30 min, a second electron paramagnetic resonance spectrum, labeled Si-NL63, is detected, also of the monoclinic-I symmetry. The spectrum of the center is characterized by a complex hyperfine structure, in which, depending on magnetic field orientation, a sevenfold splitting with the intensities 1:2:3:4:3:2:1, a fourfold splitting 4:4:4:4, and other more arbitrary structures are observed. Extra small splitting is observed in the sample diffused with deuterium, indicating hydrogen involvement in the microscopic structure of the Si-NL63 center. Under band gap illumination the third center of a one-gold-two-hydrogen complex is observed. The center, labeled Si-NL64, has low triclinic symmetry and features the hyperfine interactions with one gold and two nearly equivalent hydrogen atoms. This results in a (1:2:1):(1:2:1):(1:2:1):(1:2:1) structure of each group of spectral lines. Spin-Hamiltonian parameters for the three spectra are determined and microscopic models are discussed.

  19. Detailed energy distributions in laser-produced plasmas of solid gold and foam gold planar targets

    SciTech Connect

    Dong, Yunsong; Zhang, Lu; Yang, Jiamin; Shang, Wanli


    Foam gold was proposed to increase the laser to x-ray conversion efficiency due to its important applications. To understand the mechanism of x-ray enhancement, the detailed energy distributions and plasma profiles for laser-irradiated solid gold and foam gold targets were studied comparatively by hydrodynamic simulations using the code Multi-1D. It is confirmed that the radiation heat wave is subsonic for the normal solid gold target, while supersonic for the foam gold target. The shock wave, which is behind the supersonic radiation heat wave for the foam gold target, generates a plasma temperature gradient with high temperature near the shock wave front to produce an additional net outward radiation for enhancement of the x-ray emission. Much larger inward plasma velocity is also driven by the shock wave as an initial plasma velocity for the laser deposition and electron thermal conduct zone, which decreases the expanding plasma kinetic energy loss and helps to increase the x-ray radiation.

  20. Polymer decorated gold nanoparticles in nanomedicine conjugates.


    Capek, Ignác


    Noble metal, especially gold nanoparticles and their conjugates with biopolymers have immense potential for disease diagnosis and therapy on account of their surface plasmon resonance (SPR) enhanced light scattering and absorption. Conjugation of noble metal nanoparticles to ligands specifically targeted to biomarkers on diseased cells allows molecular-specific imaging and detection of disease. The development of smart gold nanoparticles (AuNPs) that can deliver therapeutics at a sustained rate directly to cancer cells may provide better efficacy and lower toxicity for treating cancer tumors. We highlight some of the promising classes of targeting systems that are under development for the delivery of gold nanoparticles. Nanoparticles designed for biomedical applications are often coated with polymers containing reactive functional groups to conjugate targeting ligands, cell receptors or drugs. Using targeted nanoparticles to deliver chemotherapeutic agents in cancer therapy offers many advantages to improve drug/gene delivery and to overcome many problems associated with conventional radiotherapy and chemotherapy. The targeted nanoparticles were found to be effective in killing cancer cells which were studied using various anticancer assays. Cell morphological analysis shows the changes occurred in cancer cells during the treatment with AuNPs. The results determine the influence of particle size and concentration of AuNPs on their absorption, accumulation, and cytotoxicity in model normal and cancer cells. As the mean particle diameter of the AuNPs decreased, their rate of absorption by the intestinal epithelium cells increased. These results provide important insights into the relationship between the dimensions of AuNPs and their gastrointestinal uptake and potential cytotoxicity. Furthermore gold nanoparticles efficiently convert the absorbed light into localized heat, which can be exploited for the selective laser photothermal therapy of cancer. We also review

  1. RAPID COMMUNICATION: Surface vertical deposition for gold nanoparticle film

    NASA Astrophysics Data System (ADS)

    Diao, J. J.; Qiu, F. S.; Chen, G. D.; Reeves, M. E.


    In this rapid communication, we present the surface vertical deposition (SVD) method to synthesize the gold nanoparticle films. Under conditions where the surface of the gold nanoparticle suspension descends slowly by evaporation, the gold nanoparticles in the solid-liquid-gas junction of the suspension aggregate together on the substrate by the force of solid and liquid interface. When the surface properties of the substrate and colloidal nanoparticle suspension define for the SVD, the density of gold nanoparticles in the thin film made by SVD only depends on the descending velocity of the suspension surface and on the concentration of the gold nanoparticle suspension.

  2. Formation of gold mineralization in ultramafic alkalic magmatic complexes

    NASA Astrophysics Data System (ADS)

    Ryabchikov, I. D.; Kogarko, L. N.; Sazonov, A. M.; Kononkova, N. N.


    Study of mineral inclusions within alluvial gold particles of the Guli Complex (East Siberia) and findings of lode gold in rocks of the same intrusion have demonstrated that gold mineralization occurs in interstitions of both early high-magnesium rocks (dunite) and later alkalic and carbonatite rocks. In dunite the native gold occurs in association with Fe-Ni sulfides (monosulfide solid solution, pentlandite, and heazlewoodite). Formation of the gold-bearing alloys took place under a low oxygen potential over a broad range of temperatures: from those close to 600°C down to below 400°C.

  3. Synchrotron X-Ray Synthesized Gold Nanoparticles for Tumor Therapy

    SciTech Connect

    Chien, C. C.; Wang, C. H.; Tseng, P. Y.; Yang, T. Y.; Hua, T. E.; Hwu, Y.; Chen, Y. J.; Chung, K. H.; Je, J. H.; Margaritondo, G.


    Highly concentrated gold nanoparticles (20 {+-} 5 nm) were produced by an x-ray irradiation method. The particles were then examined for the interactions between gold and tumor cells under x-ray radiation conditions. The biological effects of gold nanoparticles were investigated in terms of the internalization, cytotoxicity and capability to enhance x-ray radiotherapy. The results of this investigation indicated that x-ray derived gold nanoparticles were nontoxic to CT-26 cell line and immobilized within cytoplasm. The irradiation experiments provided further evidence that gold nanoparticles were capable of enhancing the efficiency of radiotherapy.

  4. Radicals Are Required for Thiol Etching of Gold Particles.


    Dreier, Timothy A; Ackerson, Christopher J


    Etching of gold with an excess of thiol ligand is used in both synthesis and analysis of gold particles. Mechanistically, the process of etching gold with excess thiol is unclear. Previous studies have obliquely considered the role of oxygen in thiolate etching of gold. Herein, we show that oxygen or a radical initiator is a necessary component for efficient etching of gold by thiolates. Attenuation of the etching process by radical scavengers in the presence of oxygen, and the restoration of activity by radical initiators under inert atmosphere, strongly implicate the oxygen radical. These data led us to propose an atomistic mechanism in which the oxygen radical initiates the etching process.

  5. The gold-sulfur interface at the nanoscale.


    Häkkinen, Hannu


    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  6. In vitro cytotoxicity of gold nanorods in A549 cells.


    Tang, Ying; Shen, Yafeng; Huang, Libin; Lv, Gaojian; Lei, Changhai; Fan, Xiaoyan; Lin, Fangxing; Zhang, Yuxia; Wu, Lihui; Yang, Yongji


    Gold nanoparticles, which have unique physicochemical characteristics, are being used for an increasingly wide range of applications in biomedical research. In this study, gold nanorods (width of 25 nm, length of 52 nm) were found to be internalized by A549 cells and were primarily localized in the lysosomes and membranous vesicles. The integrity of the membranes of A549 cells exposed to gold nanorods for 4h was damaged, as indicated by laser scanning confocal microscopy (LSCM). Increased lactate dehydrogenase (LDH) leakage and decreased cell viability further indicated the concentration-dependent cytotoxicity of the gold nanorods to the A549 cells. Reactive oxygen species (ROS) production was induced in the A549 cells by the gold nanorods, and this effect was positively correlated with the concentration of the gold nanorods. The results of this study indicated that exposure to gold nanorods caused dose-dependent cytotoxicity in A549 cells and that oxidative stress may be the main factor causing cytotoxicity.

  7. Preparation and characterization of gold-decorated graphite nanosheet composites.


    Kim, Jungsoo; Nam, Dae Geun; Oh, Weon Tae


    Some composites of gold nanoparticles and graphite nanosheets were prepared by electrostatic interaction, and structurally and electrochemically characterized using X-ray diffraction, X-ray photoelectron spectroscopy, UVNis spectroscopy, transmission electron microscopy, and cyclic-voltammetry. Pristine graphite was chemically treated using aqueous acid solution, and dispersed inpoly(diallyldimethylammonium) chloride aqueous solution to prepare positively charged graphite nanosheets. The gold nanoparticles (GNPs) in this work were stabilized by sodium dodecyl sulfate, poly(sodium 4-styrene sulfonate), or poly(vinylpyrrolidone). Gold nanoparticles and graphite nanosheet composites with gold nanoparticles showed the characteristic surface plasmon band at -530 nm. The electrochemical properties of the graphite nanosheet composites with gold nanoparticles were studied by cyclic voltammetry, in which reduction potential and reduction current of gold nanoparticles were strongly dependent on the gold-wrapped stabilizer in the composites.

  8. The gold-sulfur interface at the nanoscale

    NASA Astrophysics Data System (ADS)

    Häkkinen, Hannu


    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  9. Chirality in thiolate-protected gold clusters.


    Knoppe, Stefan; Bürgi, Thomas


    Over recent years, research on thiolate-protected gold clusters Au(m)(SR)n has gained significant interest. Milestones were the successful determination of a series of crystal structures (Au102(SR)44, Au25(SR)18, Au38(SR)24, Au36(SR)24, and Au28(SR)20). For Au102(SR)44, Au38(SR)24, and Au28(SR)20, intrinsic chirality was found. Strong Cotton effects (circular dichroism, CD) of gold clusters protected by chiral ligands have been reported a long time ago, indicating the transfer of chiral information from the ligand into the cluster core. Our lab has done extensive studies on chiral thiolate-protected gold clusters, including those protected with chiral ligands. We demonstrated that vibrational circular dichroism can serve as a useful tool for the determination of conformation of the ligand on the surface of the cluster. The first reports on crystal structures of Au102(SR)44 and Au38(SR)24 revealed the intrinsic chirality of these clusters. Their chirality mainly arises from the arrangement of the ligands on the surface of the cluster cores. As achiral ligands are used to stabilize the clusters, racemic mixtures are obtained. However, the separation of the enantiomers by HPLC was demonstrated which enabled the measurement of their CD spectra. Thermally induced inversion allows determination of the activation parameters for their racemization. The inversion demonstrates that the gold-thiolate interface is anything but fixed; in contrast, it is rather flexible. This result is of fundamental interest and needs to be considered in future applications. A second line of our research is the selective introduction of chiral, bidentate ligands into the ligand layer of intrinsically chiral gold clusters. The ligand exchange reaction is highly diastereoselective. The bidentate ligand connects two of the protecting units on the cluster surface and thus effectively stabilizes the cluster against thermally induced inversion. A minor (but significant) influence of chiral ligands to

  10. Antifungal activity of gold nanoparticles prepared by solvothermal method

    SciTech Connect

    Ahmad, Tokeer; Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna; Manzoor, Nikhat; Ahmad, Aijaz; Ahmed, Jahangeer; Al-Shihri, Ayed S.


    Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m{sup 2}/g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m{sup 2/}g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl{sub 2} and NaBH{sub 4} as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl{sub 2}, however, NaBH{sub 4} produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m{sup 2}/g for 7 nm and 269 m{sup 2}/g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H{sup +} efflux of the Candida species than 15 nm sized gold nanoparticles.

  11. Ultraviolet imaging detectors for the GOLD mission

    NASA Astrophysics Data System (ADS)

    Siegmund, O. H. W.; McPhate, J.; Curtis, T.; Jelinsky, S.; Vallerga, J. V.; Hull, J.; Tedesco, J.


    The GOLD mission is a NASA Explorer class ultraviolet Earth observing spectroscopy instrument that will be flown on a telecommunications satellite in geostationary orbit in 2018. Microchannel plate detectors operating in the 132 nm to 162 nm FUV bandpass with 2D imaging cross delay line readouts and electronics have been built for each of the two spectrometer channels for GOLD. The detectors are "open face" with CsI photocathodes, providing 30% efficiency at 130.4 nm and 15% efficiency at 160.8 nm. These detectors with their position encoding electronics provide 600 x 500 FWHM resolution elements and are photon counting, with event handling rates of > 200 KHz. The operational details of the detectors and their performance are discussed.

  12. Tamper indicating gold nanocup plasmonic films

    NASA Astrophysics Data System (ADS)

    DeVetter, Brent M.; Bernacki, Bruce E.; Bennett, Wendy D.; Schemer-Kohrn, Alan; Alvine, Kyle J.


    The spectral signatures of nanoplasmonic films are both robust and tailorable with optical responses ranging from the visible to the near-infrared. We present the development of flexible, elastomeric nanoplasmonic films consisting of periodic arrays of gold nanocups as tamper indicating films. Gold nanocups have polarization-sensitive optical properties that may be manufactured into films that offer unique advantages for tamper indication. These flexible films can be made quickly and at low-cost using the commercially available monodisperse polystyrene nanospheres through self-assembly followed by plasma etching, metal deposition, and lift-off from a sacrificial substrate. The polarization- and angle-dependent optical spectroscopic measurements were performed to characterize the fabricated films. Using polarization-sensitive hyperspectral imaging, we demonstrate how these films can be applied to tamper indication and counterfeit resistance applications.

  13. Synthesis and spectroscopic characterization of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Philip, Daizy


    Photoluminescent nanoparticles of gold with size 3, 4, 6, and 9 nm are prepared by borohydride/citrate reduction in presence of polyethylene glycol (PEG)/tannic acid. The prepared nanomaterials are characterized by UV-vis spectroscopy and dynamic light scattering (DLS) technique. Intense photoluminescence (PL) is observed in nanoparticles prepared by fast reduction with borohydride in presence of PEG. A red shift of PL emission from 408 to 456 nm is observed for the change of size from 4 to 6 nm. Increase in PL intensity is observed for all the nanoparticles on the addition of KCl. Citrate reduced gold colloid which consists of large particles of size ˜35 nm with anisotropic shapes showing two plasmon peaks is also prepared. The anisotropy is confirmed by TEM measurement. SERS activity of this colloid is tested using glutamic acid as an adsorbate probe. Assignment of the observed bands is given.

  14. Gold nanodisk array surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Tian, Xueli

    Surface plasmon resonances in periodic metal nanostructures have been investigated for sensing applications over the last decade. The resonance wavelengths of the nanostructures are usually measured in the transmission or reflection spectrum for chemical and biological sensing. In this thesis, I introduce a nanoscale gap mediated surface plasmon resonance nanodisk array for displacement sensing and a super-period gold nanodisk grating enabled surface plasmon resonance spectrometer sensor. The super-period gold nanodisk grating has a small subwavelength period and a large diffraction grating period. Surface plasmon resonance spectra are measured in the first order diffraction spatial profiles captured by a charge-coupled device (CCD). A surface plasmon resonance sensor for the bovine serum albumin (BSA) protein nanolayer bonding is demonstrated by measuring the surface plasmon resonance shift in the first order diffraction spatial intensity profiles captured by the CCD.

  15. Interconnecting Gold Islands with DNA Origami Nanotubes

    PubMed Central

    Ding, Baoquan; Wu, Hao; Xu, Wei; Zhao, Zhao; Liu, Yan; Yu, Hongbin; Yan, Hao


    Scaffolded DNA origami has recently emerged as a versatile, programmable method to fold DNA into arbitrarily shaped nanostructures that are spatially addressable, with sub-10 nm resolution. Toward functional DNA nanotechnology, one of the key challenges is to integrate the bottom up self-assembly of DNA origami with the top-down lithographic methods used to generate surface patterning. In this report we demonstrate that fixed length DNA origami nanotubes, modified with multiple thiol groups near both ends, can be used to connect surface patterned gold islands (tens of nanometers in diameter) fabricated by electron beam lithography (EBL). Atomic force microscopic imaging verified that the DNA origami nanotubes can be efficiently aligned between gold islands with various inter-island distances and relative locations. This development represents progress toward the goal of bridging bottom up and top down assembly approaches. PMID:21070012

  16. Gold resource modeling using pod indicator kriging

    NASA Astrophysics Data System (ADS)

    Bargawa, Waterman Sulistyana; Rauf, Abdul; Amri, Nur Ali


    This paper describes an implementation of the pod indicator kriging method used to gold resource modeling. Method such as ordinary kriging estimate the mean grade of a block that is fairly large. The usual outcome is that large blocks rarely turn out to be all ore or all waste, thus making reserve estimates an incorrect estimate of what will be mined. Pod indicator kriging offers a solution to this problem by estimating the distribution of grade values within a large block, rather than just estimating the mean grade of the block. Knowing the distribution of grade value within the block, it is then easy to calculate the proportion of the block that is above cutoff grade and the grade of the ore above cutoff grade. This research shows that the pod indicator kriging model is quite applicable and reliable in gold resourcemodeling.

  17. Topological states on the gold surface.


    Yan, Binghai; Stadtmüller, Benjamin; Haag, Norman; Jakobs, Sebastian; Seidel, Johannes; Jungkenn, Dominik; Mathias, Stefan; Cinchetti, Mirko; Aeschlimann, Martin; Felser, Claudia


    Gold surfaces host special electronic states that have been understood as a prototype of Shockley surface states. These surface states are commonly employed to benchmark the capability of angle-resolved photoemission spectroscopy (ARPES) and scanning tunnelling spectroscopy. Here we show that these Shockley surface states can be reinterpreted as topologically derived surface states (TDSSs) of a topological insulator (TI), a recently discovered quantum state. Based on band structure calculations, the Z2-type invariants of gold can be well-defined to characterize a TI. Further, our ARPES measurement validates TDSSs by detecting the dispersion of unoccupied surface states. The same TDSSs are also recognized on surfaces of other well-known noble metals (for example, silver, copper, platinum and palladium), which shines a new light on these long-known surface states.

  18. Gold Nanoparticles for Neural Prosthetics Devices

    PubMed Central

    Zhang, Huanan; Shih, Jimmy; Zhu, Jian; Kotov, Nicholas A.


    Treatments of neurological diseases and the realization of brain-computer interfaces require ultrasmall electrodes which are “invisible” to resident immune cells. Functional electrodes smaller than 50μm are impossible to produce with traditional materials due to high interfacial impedance at the characteristic frequency of neural activity and insufficient charge storage capacity. The problem can be resolved by using gold nanoparticle nanocomposites. Careful comparison indicates that layer-by-layer assembled films from Au NPs provide more than threefold improvement in interfacial impedance and one order of magnitude increase in charge storage capacity. Prototypes of microelectrodes could be made using traditional photolithography. Integration of unique nanocomposite materials with microfabrication techniques opens the door for practical realization of the ultrasmall implantable electrodes. Further improvement of electrical properties is expected when using special shapes of gold nanoparticles. PMID:22734673

  19. Biological synthesis of triangular gold nanoprisms

    NASA Astrophysics Data System (ADS)

    Shankar, S. Shiv; Rai, Akhilesh; Ankamwar, Balaprasad; Singh, Amit; Ahmad, Absar; Sastry, Murali


    The optoelectronic and physicochemical properties of nanoscale matter are a strong function of particle size. Nanoparticle shape also contributes significantly to modulating their electronic properties. Several shapes ranging from rods to wires to plates to teardrop structures may be obtained by chemical methods; triangular nanoparticles have been synthesized by using a seeded growth process. Here, we report the discovery that the extract from the lemongrass plant, when reacted with aqueous chloroaurate ions, yields a high percentage of thin, flat, single-crystalline gold nanotriangles. The nanotriangles seem to grow by a process involving rapid reduction, assembly and room-temperature sintering of 'liquid-like' spherical gold nanoparticles. The anisotropy in nanoparticle shape results in large near-infrared absorption by the particles, and highly anisotropic electron transport in films of the nanotriangles.

  20. Prospecting for gold in the United States

    USGS Publications Warehouse



    Prospecting for gold is something that probably everyone dreams of trying at least once. To the person who is mainly concerned with this activity as a vacation diversion, prospecting offers a special excitement. There is a constant hope that the next pan of sediment may be "pay dirt," and no other thrill can compare with that experienced when one sees even a few tiny flecks of gold glittering in the black sand at the bottom of his pan. The search itself is its own reward for the efforts expended by the vacation prospector. The would-be prospector hoping for financial gain, however, should carefully consider all the facts of the situation before deciding to set out on a prospecting expedition.

  1. Superlubricity of graphene nanoribbons on gold surfaces.


    Kawai, Shigeki; Benassi, Andrea; Gnecco, Enrico; Söde, Hajo; Pawlak, Rémy; Feng, Xinliang; Müllen, Klaus; Passerone, Daniele; Pignedoli, Carlo A; Ruffieux, Pascal; Fasel, Roman; Meyer, Ernst


    The state of vanishing friction known as superlubricity has important applications for energy saving and increasing the lifetime of devices. Superlubricity, as detected with atomic force microscopy, appears when sliding large graphite flakes or gold nanoclusters across surfaces, for example. However, the origin of the behavior is poorly understood because of the lack of a controllable nanocontact. We demonstrated the superlubricity of graphene nanoribbons when sliding on gold with a joint experimental and computational approach. The atomically well-defined contact allows us to trace the origin of superlubricity, unraveling the role played by ribbon size and elasticity, as well as by surface reconstruction. Our results pave the way to the scale-up of superlubricity and thus to the realization of frictionless coatings.

  2. Atomic Diffusion within Individual Gold Nanocrystal

    PubMed Central

    Xiong, Gang; Clark, Jesse N.; Nicklin, Chris; Rawle, Jonathan; Robinson, Ian K.


    Due to their excess surface free energy and structural instabilities, nanoparticles exhibit interesting physical and chemical properties. There has been an ever-growing interest in investigating these properties, driven by the desire to further miniaturize electronic devices, develop new functional materials and catalysts. Here, the intriguing question of how diffusion evolves in a single nanoparticle is investigated by measuring the spatial and temporal variations of the diffracted coherent X-ray intensity during copper diffusion into a gold nanocrystal. Dislocation loops formed from the insertion of single layer of extra atoms between neighbouring gold host lattice planes are detected. Au-Cu alloy channels are found to penetrate the nanocrystal due to the differential diffusion rate along different directions. With the advent of higher brilliance sources and free-electron-lasers, Bragg Coherent X-ray Diffraction Imaging can play an important role in unveiling atomic behaviours in three dimensions for nanomaterials during various fundamental processes. PMID:25341377

  3. A 'Pot of Gold' Rich with Nuggets

    NASA Technical Reports Server (NTRS)


    This close-up image taken by the Mars Exploration Rover Spirit highlights the nodular nuggets that cover the rock dubbed 'Pot of Gold.' These nuggets appear to stand on the end of stalk-like features. The surface of the rock is dotted with fine-scale pits. Data from the rover's scientific instruments have shown that Pot of Gold contains the mineral hematite, which can be formed with or without water.

    Scientists are planning further observations of this rock, which they hope will yield more insight into the hematite's origins as well as how the enigmatic nuggets formed.

    This image was taken by Spirit's microscopic imager on sol 162 (June 17, 2004). The observed area is 3 centimeters by 3 centimeters (1.2 inches by 1.2 inches)

  4. Local density variation of gold nanoparticles in aquatic environments

    NASA Astrophysics Data System (ADS)

    Hosseinzadeh, F.; Shirazian, F.; Shahsavari, R.; Khoei, A. R.


    Gold (Au) nanoparticles are widely used in diagnosing cancer, imaging, and identification of therapeutic methods due to their particular quantum characteristics. This research presents different types of aqueous models and potentials used in TIP3P, to study the effect of the particle size and density of Au clusters in aquatic environments; so it can be useful to facilitate future investigation of the interaction of proteins with Au nanoparticles. The EAM potential is used to model the structure of gold clusters. It is observed that in the systems with identical gold/water density and different cluster radii, gold particles are distributed in aqueous environment almost identically. Thus, Au particles have identical local densities, and the root mean square displacement (RMSD) increases with a constant slope. However in systems with constant cluster radii and different gold/water densities, Au particle dispersion increases with density; as a result, the local density decreases and the RMSD increases with a larger slope. In such systems, the larger densities result in more blunted second peaks in gold-gold radial distribution functions, owing to more intermixing of the clusters and less FCC crystalline features at longer range, a mechanism that is mediated by the competing effects of gold-water and gold-gold interactions.

  5. Irradiation stability and cytotoxicity of gold nanoparticles for radiotherapy

    PubMed Central

    Zhang, Xiao-Dong; Guo, Mei-Li; Wu, Hong-Ying; Sun, Yuan-Ming; Ding, Yan-Qiu; Feng, Xin; Zhang, Liang-An


    Gold nanoparticles are promising as a kind of novel radiosensitizer in radiotherapy. If gold nanoparticles are shown to have good irradiation stability and biocompatibility, they would play an important role in radiotherapy. In this work, we investigated irradiation effects of gold nanoparticles under 2–10 kR gamma irradiation and cytotoxicity of gold nanoparticles with human K562 cells by using Cell Titre-Glo™ luminescent cell viability assay. The results revealed that gamma irradiation had not induced any obvious instability and size variations in gold nanoparticles. We found that gold nanoparticles showed excellent radiation hardness with an absorbed dose conversation factor of 9.491 rad/R. Meanwhile, the surface plasmon resonance of gold nanoparticles was enhanced obviously after 2–10 kR gamma irradiation. Subsequently, cytotoxicity tests indicated that the extremely high concentration of gold nanoparticles could cause a sharp decrease in K562 cell viability, while the low concentration of gold nanoparticles had no obvious influence on the cell viability. Our results revealed that gold nanoparticles were stable under high-energy ray irradiation and showed concentration-dependent cytotoxicity. PMID:19774115

  6. Role of CO2 in the formation of gold deposits.


    Phillips, G N; Evans, K A


    Much of global gold production has come from deposits with uneconomic concentrations of base metals, such as copper, lead and zinc. These 'gold-only' deposits are thought to have formed from hot, aqueous fluids rich in carbon dioxide, but only minor significance has been attached to the role of the CO2 in the process of gold transport. This is because chemical bonding between gold ions and CO2 species is not strong, and so it is unlikely that CO2 has a direct role in gold transport. An alternative indirect role for CO2 as a weak acid that buffers pH has also appeared unlikely, because previously inferred pH values for such gold-bearing fluids are variable. Here we show that such calculated pH values are unlikely to record conditions of gold transport, and propose that CO2 may play a critical role during gold transport by buffering the fluid in a pH range where elevated gold concentration can be maintained by complexation with reduced sulphur. Our conclusions, which are supported by geochemical modelling, may provide a platform for new gold exploration methods.

  7. Gold fingerprinting by laser ablation inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Watling, R. John; Herbert, Hugh K.; Delev, Dianne; Abell, Ian D.


    Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) has been applied to the characterization of the trace element composition "fingerprint" of selected gold samples from Western Australia and South Africa. By comparison of the elemental associations it is possible to relate gold to a specific mineralizing event, mine or bullion sample. This methodology facilitates identification of the provenance of stolen gold or gold used in salting activities. In this latter case, it is common for gold from a number of sources to be used in the salting process. Consequently, gold in the prospect being salted will not come from a single source and identification of multiple sources for this gold will establish that salting has occurred. Preliminary results also indicate that specific elemental associations could be used to identify the country of origin of gold. The technique has already been applied in 17 cases involving gold theft in Western Australia, where it is estimated that up to 2% of gold production is "relocated" each year as a result of criminal activities.

  8. Assembly of functional gold nanoparticle on silica microsphere.


    Wang, Hsuan-Lan; Lee, Fu-Cheng; Tang, Tse-Yu; Zhou, Chenguang; Tsai, De-Hao


    We demonstrate a controlled synthesis of silica microsphere with the surface-decorated functional gold nanoparticles. Surface of silica microsphere was modified by 3-aminopropypltriethoxysilane and 3-aminopropyldimethylethoxysilane to generate a positive electric field, by which the gold nanoparticles with the negative charges (unconjugated, thiolated polyethylene glycol functionalized with the traceable packing density and conformation) were able to be attracted to the silica microsphere. Results show that both the molecular conjugation on gold nanoparticle and the uniformity in the amino-silanization of silica microsphere influenced the loading and the homogeneity of gold nanoparticles on silica microsphere. The 3-aminopropyldimethylethoxysilane-functionalized silica microsphere provided an uniform field to attract gold nanoparticles. Increasing the ethanol content in aminosilane solution significantly improved the homogeneity and the loading of gold nanoparticles on the surface of silica microsphere. For the gold nanoparticle, increasing the molecular mass of polyethylene glycol yielded a greater homogeneity but a lower loading on silica microsphere. Bovine serum albumin induced the desorption of gold nanoparticles from silica microsphere, where the extent of desorption was suppressed by the presence of high-molecular mass polyethylene glycol on gold nanoparticles. This work provides the fundamental understanding for the synthesis of gold nanoparticle-silica microsphere constructs useful to the applications in chemo-radioactive therapeutics.

  9. A novel 'Gold on Gold' biosensing scheme for an on-fiber immunoassay

    NASA Astrophysics Data System (ADS)

    Punjabi, N.; Satija, J.; Mukherji, S.


    In this paper, we propose a novel „gold on gold‟ biosensing scheme for absorbance based fiber-optic biosensor. First, a self-assembled monolayer of gold nanoparticles is formed at the sensing region of the fiber-optic probe by incubating an amino-silanized probe in a colloidal gold solution. Thereafter, the receptor moieties, i.e. Human immunoglobulin G (HIgG) were immobilized by using standard alkanethiol and classic carbodiimide coupling chemistry. Finally, biosensing experiments were performed with different concentrations of gold nanoparticle-tagged analyte, i.e. Goat anti- Human immunoglobulin G (Nanogold-GaHIgG). The sensor response was observed to be more than five-fold compared to the control bioassay, in which the sensor matrix was devoid of gold nanoparticle film. Also, the response was found to be ~10 times higher compared to the FITC-tagged scheme and ~14.5 times better compared to untagged scheme. This novel scheme also demonstrated the potential in improving the limit of detection for the fiber-optic biosensors.

  10. Differential interferences with clinical chemistry assays by gold nanorods, and gold and silica nanospheres.


    Hinkley, Georgia K; Carpinone, Paul L; Munson, John W; Powers, Kevin W; Roberts, Stephen M


    Nanomaterials are known to cause interference with several standard toxicological assays. As part of an in vivo study of PEG-coated gold nanorods in mice, nanorods were added to reference serum, and results for standard clinical chemistry parameters were compared with serum analyzed without nanorods. PEG-coated gold nanorods produced several concentration-dependent interferences. Comparisons were then made with PEG-coated gold and silica nanospheres. Interferences were observed for both materials that differed from gold nanorods. Removal of the particles from serum by centrifugation prior to analysis resolved most, but not all of the interferences. Additional clinical chemistry analyzers were used to further investigate trends in assay interference. We conclude that PEG-coated gold and silica nanoparticles can interfere with standard clinical chemistry tests in ways that vary depending upon material, shape, and specific assay methodology employed. Assay interferences by nanomaterials cannot always be predicted, underscoring the need to verify that nanomaterials under study do not interfere with methods used to evaluate potential biological effects.

  11. Silver- and gold-mediated nucleobase bonding.


    Acioli, Paulo H; Srinivas, Sudha


    We report the results of a density functional theory investigation of the bonding of nucleobases mediated by silver and gold atoms in the gas phase. Our calculations use the Becke exchange and Perdew-Wang correlation functional (BPW91) combined with the Stuttgart effective core potentials to represent the valence electrons of gold, silver, and platinum, and the all-electron DGTZVP basis set for C, H, N, and O. This combination was chosen based on tests on the metal atoms and tautomers of adenine, cytosine, and guanine. To establish a benchmark to understand the metal-mediated bonding, we calculated the binding energy of each of the base pairs in their canonical forms. Our calculations show rather strong bonds between the Watson-Crick base pairs when compared with typical values for N-H-N and N-H-O hydrogen bonds. The neutral metal atoms tend to bond near the nitrogen atoms. The effect of the metal atoms on the bonding of nucleobases differs depending on whether or not the metal atoms bond to one of the hydrogen-bonding sites. When the silver or gold atoms bond to a non-hydrogen-bonding site, the effect is a slight enhancement of the cytosine-guanine bonding, but there is almost no effect on the adenine-thymine pairing. The metal atoms can block one of the hydrogen-bonding sites, thus preventing the normal cytosine-guanine and adenine-thymine pairings. We also find that both silver and gold can bond to consecutive guanines in a similar fashion to platinum, albeit with a significantly lower binding energy.

  12. Optical Limiting Materials Based on Gold Nanoparticles

    DTIC Science & Technology


    AFRL-OSR-VA-TR-2014-0104 OPTICAL LIMITING MATERIALS BASED ON GOLD NANOPARTICLES John Dawson SOUTH CAROLINA RESEARCH FOUNDATION Final Report 04/30...2009; therefore, the award was modified so that her former department chair, John Dawson, became the PI of the award, with Murphy as a subcontract at...Mediated Synthesis to Nanoscale Sculpting,” Curr. Opin. Colloid. Interfac. Sci. 2011, 16, 128-134. • Sivapalan, S. T.; Vella, J. H.; Yang, T. K.; Dalton

  13. 'Pot of Gold' Close-up

    NASA Technical Reports Server (NTRS)


    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows a close-up of the rock dubbed 'Pot of Gold' (left), which is located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

  14. Backhoe 3D "gold standard" image

    NASA Astrophysics Data System (ADS)

    Gorham, LeRoy; Naidu, Kiranmai D.; Majumder, Uttam; Minardi, Michael A.


    ViSUAl-D (VIsual Sar Using ALl Dimensions), a 2004 DARPA/IXO seedling effort, is developing a capability for reliable high confidence ID from standoff ranges. Recent conflicts have demonstrated that the warfighter would greatly benefit from the ability to ID targets beyond visual and electro-optical ranges[1]. Forming optical-quality SAR images while exploiting full polarization, wide angles, and large bandwidth would be key evidence such a capability is achievable. Using data generated by the Xpatch EM scattering code, ViSUAl-D investigates all degrees of freedom available to the radar designer, including 6 GHz bandwidth, full polarization and angle sampling over 2π steradians (upper hemisphere), in order to produce a "literal" image or representation of the target. This effort includes the generation of a "Gold Standard" image that can be produced at X-band utilizing all available target data. This "Gold Standard" image of the backhoe will serve as a test bed for future more relevant military targets and their image development. The seedling team produced a public release data which was released at the 2004 SPIE conference, as well as a 3D "Gold Standard" backhoe image using a 3D image formation algorithm. This paper describes the full backhoe data set, the image formation algorithm, the visualization process and the resulting image.

  15. Identification of Paracoccidioides brasiliensis by gold nanoprobes

    NASA Astrophysics Data System (ADS)

    Martins, Jaciara F. S.; Castilho, Maiara L.; Cardoso, Maria A. G.; Carreiro, Andrea P.; Martin, Airton A.; Raniero, Leandro


    Paracoccidioides brasiliensis (P. brasiliensis) is a thermal dimorphic fungus and causal agent of paracoccidioidomycosis. Epidemiological data shows that it is mainly concentrated in Central and South America countries, with most registered cases in Colombia, Brazil, and Venezuela. The histopathological similarity with others fungal infection makes the diagnosis of P. brasiliensis more complicated. Therefore, the aim of this work was to find a positive and negative test for P. brasiliensis using gold nanoprobes as a new tool for P. brasiliensis detection. Gold nanoparticles were synthesized by reduction of gold chloride with sodium citrate. The results of this procedure is a wine-red solution with a maximum absorption in the range of ~520-530nm. A specific P. brasiliensis sequence of oligonucleotide was bonded to the nanoparticles, which maintained the wine-red color. The color changes from red to blue for negative diagnostic and is unchanged for a positive test. The H-bond interaction of DNA with the complementary DNA keeps strands together and forms double helical structure, maintaining the colloid stability. However, for non-complimentary DNA sequence the nanoprobes merge into a cluster, changing the light absorption.

  16. Ion beam analysis of gold jewelry

    NASA Astrophysics Data System (ADS)

    Demortier, Guy


    PIXE milliprobe in a nonvacuum assembly has been proven to be a very rapid and accurate method for the elemental analysis of gold jewelry artefacts. Using protons whose energy is lower than 3 MeV, it is possible to obtain, in a few minutes, the actual composition (copper, iron, gold, silver, etc.) of narrow parts of artefacts, without any sampling, even at microscopic level. Most of the studies of our group in this field concern solders on these jewelry items. Narrow regions of gold artefacts have also been studied with a PIXE microprobe. They were then irradiated in vacuum. Nuclear reaction analyses induced by 2 MeV deuterons are also performed to identify the presence of light elements and, particularly O, N and S. Traces of these elements are of primary importance to characterize the origin of the ores used in various workmanships. Interferences of X-ray lines of Au with those of traces of Cu and Zn are solved using a method of selective excitation of X-rays of these elements. Analytical results have been interpreted in order to understand the workmanship of goldsmiths from the Antiquity. Fakes and repairs (or ornaments added to original artefacts) may also be identified. The ancient recipes are improved to give new soldering procedures at low temperature.

  17. Photoswitchable NIR-Emitting Gold Nanoparticles.


    Bonacchi, Sara; Cantelli, Andrea; Battistelli, Giulia; Guidetti, Gloria; Calvaresi, Matteo; Manzi, Jeannette; Gabrielli, Luca; Ramadori, Federico; Gambarin, Alessandro; Mancin, Fabrizio; Montalti, Marco


    Photo-switching of the NIR emission of gold nanoparticles (GNP) upon photo-isomerization of azobenzene ligands, bound to the surface, is demonstrated. Photophysical results confirm the occurrence of an excitation energy transfer process from the ligands to the GNP that produces sensitized NIR emission. Because of this process, the excitation efficiency of the gold core, upon excitation of the ligands, is much higher for the trans form than for the cis one, and t→c photo-isomerization causes a relevant decrease of the GNP NIR emission. As a consequence, photo-isomerization can be monitored by ratiometric detection of the NIR emission upon dual excitation. The photo-isomerization process was followed in real-time through the simultaneous detection of absorbance and luminescence changes using a dedicated setup. Surprisingly, the photo-isomerization rate of the ligands, bound to the GNP surface, was the same as measured for the chromophores in solution. This outcome demonstrated that excitation energy transfer to gold assists photo-isomerization, rather than competing with it. These results pave the road to the development of new, NIR-emitting, stimuli-responsive nanomaterials for theranostics.

  18. Biosynthesis of gold nanoparticles: A green approach.


    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima


    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed.

  19. Titration of gold nanoparticles in phase extraction.


    Cheng, Han-Wen; Schadt, Mark J; Zhong, Chuan-Jian


    In the organic-aqueous phase transfer process of gold nanoparticles, there are two types of distinctive interfaces involving hydrophilic and hydrophobic ligands, the understanding of which is important for the design of functional nanomaterials for analytical/bioanalytical applications and the control over the nanoparticles' nanoactivity and nanotoxicity in different phases. This report describes new findings of an investigation of the quantitative aspect of ligand ion pairing at the capping monolayer structure that drives the phase extraction of gold nanoparticles. Alkanethiolate-capped gold nanoparticles of 8 nm diameter with high size monodispersity (RSD ∼ 5%) were first derivatized by a ligand place exchange reaction with 11-mercaptoundecanoic acid to form a mixed monolayer shell consisting of both hydrophobic (-CH3) and hydrophilic (-COOH) groups. It was followed by quantitative titration of the resulting nanoparticles with a cationic species (-NR4(+)) in a toluene phase, yielding ion pairing of -NR4(+) and -COO(-) on part of the capping monolayer. Analysis of the phase extraction allowed a quantitative determination of the percentage of ion pairing and structural changes in the capping monolayer on the nanoparticles. The results, along with morphological characterization, are discussed in terms of the interfacial structural changes and their implications on the rational design of surface-functionalized nanoparticles and fine tuning of the interfacial reactivity.

  20. Gold nanorods: contrast agents for photoacoustic imaging?

    NASA Astrophysics Data System (ADS)

    Ungureanu, C.; Gopal, R. Raja; van Leeuwen, T. G.; Manohar, S.


    Gold nanorods are seen as possible contrast agents for photoacoustic imaging since they have strong absorption peaks at near-infrared wavelengths. Also they are easy to conjugate with various proteins. If these particles can be conjugated with cancer affinity proteins then these particles can accumulate specifically at a tumor site. By detecting the presence of accumulation of gold nanorods inside the tissue the indirect detection of tumor can be realized. When these particles are irradiated with light pulses of appropriate temporal properties and energy the temperature around these particles can be high enough to induce apoptosis or necrosis in the surrounding cells. In order to use these particles at their full potential we must determine precisely their optical properties. We simulated the optical properties of gold nanorods synthesized by us using the DDSCAT code. The simulated spectra agree qualitatively with the spectra determined using spectrometry and also determined using photoacoustic spectroscopy. Further the values of molar extinction coefficient derived from the simulations were similar to the data measured experimentally by other groups. These results validated qualitatively the model used in the simulations. During simulations we found that the choice of the dielectric function used in simulations plays an important role in the results.

  1. Determination of the concentration and the average number of gold atoms in a gold nanoparticle by osmotic pressure.


    Lu, Yan; Wang, Lixia; Chen, Dejun; Wang, Gongke


    For an ideal solution, an analytical expression for the macromolecule concentration, electrolyte concentration, and solution osmotic pressure is obtained on the basis of the van't Hoff equation and the Donnan equilibrium. The expression was further applied to a colloid solution of about 3 nm glutathione-stabilized gold nanoparticles. The concentration of the colloid solution and the average net ion charge number for each gold nanoparticle were determined with the measured osmotic pressure data. Meanwhile, the gold contents of the solutions were analyzed by means of atomic absorption spectrophotometry, and the results were combined with the determined concentration of gold nanoparticle colloids to determine that the average number of gold atoms per 3 nm gold nanoparticle is 479, which is 1/1.7 times the number of atoms in bulk metallic gold of the same size. The same proportion also occurred in the 2 nm 4-mercaptobenzoic acid monolayer-protected gold nanoparticles prepared by Ackerson et al., who utilized the quantitative high-angle annular dark-field scanning transmission electron microscope to determine the average number of gold atoms per nanoparticle (Ackerson, C. J.; Jadzinsky, P. D.; Sexton J. Z.; Bushnell, D. A.; Kornberg, R. D. Synthesis and Bioconjugation of 2 and 3 nm-Diameter Gold Nanoparticles. Bioconjugate Chem. 2010, 21, 214-218).

  2. Manganese oxides supported on gold nanoparticles: new findings and current controversies for the role of gold.


    Najafpour, Mohammad Mahdi; Hosseini, Seyedeh Maedeh; Hołyńska, Małgorzata; Tomo, Tatsuya; Allakhverdiev, Suleyman I


    We synthesized manganese oxides supported on gold nanoparticles (diameter <100 nm) by the reaction of KMnO4 with gold nanoparticles under hydrothermal conditions. In this green method Mn oxide is deposited on the gold nanoparticles. The compounds were characterized by scanning electron microscopy, energy-dispersive spectrometry, high-resolution transmission electron microscopy, X-ray diffraction, UV-Vis spectroscopy, Fourier transform infrared spectroscopy, and atomic absorption spectroscopy. In the next step, the water-oxidizing activities of these compounds in the presence of cerium(IV) ammonium nitrate as a non-oxo transfer oxidant were studied. The results show that these compounds are good catalysts toward water oxidation with a turnover frequency of 1.0 ± 0.1 (mmol O2/(mol Mn·s)). A comparison with other previously reported Mn oxides and important factors influencing the water-oxidizing activities of Mn oxides is also discussed.

  3. Plasmonic phototherapy using gold nanospheres and gold nanorods irradiated with light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Poorani, Gananathan; Rao, Aruna Prakasa; Singaravelu, Ganesan; Manickam, Elanchezhiyan


    Gold nanoparticles (GNPs) provide different modes of therapeutic responses in cells depending on their size and shape. We have studied two modifications of GNPs exhibiting surface plasmon resonances (SPRs) with phototherapeutic effects in nonmalignant Vero and malignant HeLa cell lines. The cells were treated with 30-nm-size gold nanospheres (GNSs) (having SPR at a wavelength of 530 nm) and with gold nanorods (GNRs) (having SPR at 630 nm). The plasmonic phototherapy effect in cells was provided by irradiating them with green and red light-emitting diodes (LEDs). The cytotoxicities of GNPs were determined by MTT assay. Both the GNSs and GNRs were found to be biocompatible and have efficient phototherapeutic activity with LEDs.

  4. Electron-Impurity Interactions in the Relaxation of Hot Electrons in Gold-Gold Sulfide Nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah; Wolfgang, John; Nordlander, Peter; Halas, Naomi


    Hot electron dynamics can be modified in metallic nanostructures compared to bulk metals. In this experiment, ultrafast pump-probe spectroscopy permits observation of the effects of the local environment on hot electron relaxation in gold nanoshell particles. These nanoparticles consist of spherical (40 nm diameter) gold sulfide cores surrounded by ultrathin (5 nm) gold shells and possess a structure-dependent plasmon resonance.^1 Following excitation by a pump pulse at the plasmon resonance, the relaxation of the hot electrons in the nanoparticle's shell layer was observed. When molecules were adsorbed onto the nanoshell surface, increased electronic relaxation rates were observed for those molecular species with the greatest induced dipole moments near the nanoparticle surface. The effect of impurity adsorbates on the nanoparticle's electron dynamics is attributed to a perturbation in the electronic potential in the metal by the presence of the nearby impurities. ^1 R. D. Averitt, D. Sarkar, and N. J. Halas, Phys. Rev. Lett. 78, 4217 (1997).

  5. Constraints of mineralogical characterization of gold ore: Implication for genesis, controls and evolution of gold from Kundarkocha gold deposit, eastern India

    NASA Astrophysics Data System (ADS)

    Sahoo, P. R.; Venkatesh, A. S.


    Gold mineralization in Kundarkocha gold deposit occurs in the eastern Indian Craton that is hosted by sheared quartz-carbonate-sulfide veins emplaced within the graphitic schist, carbonaceous phyllite and talc-chlorite-serpentine schist belongs to Gorumahisani-Badampahar schist belt of Iron Ore Group. Gold mineralization exhibits both lithological and structural controls in the study area, albeit the stratigraphic control is more ubiquitously observed. Detailed mineralogical characterization coupled with electron probe microanalysis of the sulfide phases reveal the occurrences of gold in three distinct forms (i) as lattice-bound form within sulfides especially enriched in arsenopyrite, loellingite, pyrite, pyrrhotite and chalcopyrite in decreasing order of abundance; (ii) as micro inclusions or nano-scale gold inclusions within pyrite and arsenopyrite especially along the growth zones and micro-fractures as substrates and (iii) as free milling nugget gold grains either along the grain boundaries of sulfides or within the host rocks. Three generations of pyrite (Py-I, Py-II and Py-III) and arsenopyrite (Asp-I, Asp-II, Asp-III) have been identified based on textural, morphological characteristics and mineral chemistry. The lattice-bound gold content in pyrite and arsenopyrite varies from 600 to 2700 ppm and 900 to 3600 ppm respectively and increase in concentration of such refractory gold is seen in the order of chalcopyrite > pyrrhotite > pyrite > loellingite/arsenopyrite. The evolutionary stages of different forms of gold include remobilization of the lattice-bound grains in pyrite and arsenopyrite (Py-I and Asp-I) and re-concentration along the zoned-pyrite and arsenopyrite (Py-II and Asp-II) and ultimately as native gold/nuggets surrounding the sulfides as well as within the main mineralized zone. Lattice-bound gold distribution could have resulted due to metamorphic devolatilization reactions which are further aided by the influx of hydrothermal fluids. These

  6. Lithologically controlled invisible gold, Yukon, Canada

    NASA Astrophysics Data System (ADS)

    MacKenzie, Doug; Craw, Dave; Finnigan, Craig


    The newly discovered Cretaceous Coffee orogenic gold deposit (>4 Moz resource) consists of an extensive oxidised zone developed on primary sulphidic rock. The primary mineralised rock is characterised by invisible gold in arsenian pyrite that has replaced biotite in selected host rocks. The deposit has a cryptic surface expression and is an example of an extremely subtle exploration target. Hydrothermal emplacement was controlled by extensional fractures, with breccias, but most mineralisation was focused on biotite-bearing granitic gneiss, metasedimentary gneisses, and younger biotite granite. Fine-grained (<0.1 mm) arsenian pyrite replaced biotite along mineral cleavage planes and followed biotite-rich metamorphic and post-metamorphic structural fabrics. Arsenian pyrite also formed overgrowths on earlier coarse-grained (up to 2 mm) barren hydrothermal pyrite. Arsenian pyrite is concentrically zoned on the 1-10-μm scale with respect to As, Sb, and Au contents and typically contains ˜5 wt% As, ˜500 mg/kg Sb, and ˜500 mg/kg Au, in solid solution. Biotite replacement was accompanied by sericitisation, silicification, and ankerite impregnation. Hydrothermal alteration involved dilution and localised depletion of K, Na, and Al in silicified host rocks, but most Ca, Mg, and Fe concentrations remained broadly constant. Magnesium-rich ultramafic host rocks were only weakly mineralised with auriferous arsenian pyrite and have fuchsite and magnesite alteration. Near-surface oxidation has liberated nanoparticulate and microparticulate supergene gold, which remains essentially invisible. Varying degrees of oxidation extend as deep as 250 m below the present subdued topographic surface, well beyond the present vadose zone, and this deep oxidation may have occurred during post-mineralisation uplift and erosion in the Cretaceous. Oxidation has leached some As from the surficial mineralised rocks, decreasing the geochemical signal, which is also obscured by the localised

  7. Ultrafast electron dynamics in gold nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah Linda


    In metallic nanostructures, the interaction of excited electrons with the nanostructure surface may result in electron relaxation dynamics that are significantly different than those predicted by electron-lattice coupling. These ultrafast electron dynamics were monitored by pump-probe measurements of the time-resolved change in transmission. Using femtosecond pulses from a cavity-dumped titanium-doped sapphire laser, two types of nanoparticles with a core-shell geometry were studied. Nanoshells are nanoparticles with a dielectric core surrounded by a continuous thin metal shell. For nanoshells, the plasmon resonance wavelength is tunable by changing the core and shell dimensions. For nanoshells with a gold sulfide core and a gold shell, two conditions were observed under which electron relaxation was different than predicted by electron-phonon coupling. First, electron relaxation occurred more rapidly for gold-gold sulfide nanoshells embedded in polymer films than for nanoshells dispersed in water, with lifetimes of 1.6 ps and 3 to 5 ps, respectively. Second, for nanoshells dispersed in water, the electron relaxation lifetime decreased with adsorption of p-aminobenzoic acid (to 1.7 ps) or aniline (to 1.9 ps) on the nanoshells. With adsorbed n-propylamine or p-mercaptobenzoic acid, electron relaxation transpired in 2.8 ps or 2.4 ps, respectively. Density functional theory calculations indicated that the molecules leading to the fastest electron relaxation possessed the largest induced dipole moments near a metal surface. Semicontinuous gold films grown around a silica nanoparticle core exhibited spectral and dynamical optical signatures of the percolation threshold. Compared to continuous shells, the electron dynamics in the semicontinuous shell layer were dramatically different as additional induced bleaching was observed in the first 500 fs. The observed dynamics are consistent with a rate equation model in which the electrons are initially excited in localized

  8. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2011 CFR


    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  9. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2010 CFR


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  10. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2012 CFR


    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  11. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2012 CFR


    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  12. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2012 CFR


    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  13. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2013 CFR


    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  14. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2013 CFR


    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  15. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2014 CFR


    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  16. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2010 CFR


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  17. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2011 CFR


    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  18. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  19. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2014 CFR


    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  20. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2013 CFR


    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  1. Stabilization of 4H hexagonal phase in gold nanoribbons

    PubMed Central

    Fan, Zhanxi; Bosman, Michel; Huang, Xiao; Huang, Ding; Yu, Yi; Ong, Khuong P.; Akimov, Yuriy A.; Wu, Lin; Li, Bing; Wu, Jumiati; Huang, Ying; Liu, Qing; Eng Png, Ching; Lip Gan, Chee; Yang, Peidong; Zhang, Hua


    Gold, silver, platinum and palladium typically crystallize with the face-centred cubic structure. Here we report the high-yield solution synthesis of gold nanoribbons in the 4H hexagonal polytype, a previously unreported metastable phase of gold. These gold nanoribbons undergo a phase transition from the original 4H hexagonal to face-centred cubic structure on ligand exchange under ambient conditions. Using monochromated electron energy-loss spectroscopy, the strong infrared plasmon absorption of single 4H gold nanoribbons is observed. Furthermore, the 4H hexagonal phases of silver, palladium and platinum can be readily stabilized through direct epitaxial growth of these metals on the 4H gold nanoribbon surface. Our findings may open up new strategies for the crystal phase-controlled synthesis of advanced noble metal nanomaterials. PMID:26216712

  2. Annealing of gold nanostructures sputtered on glass substrate

    NASA Astrophysics Data System (ADS)

    Švorčík, V.; Siegel, J.; Šutta, P.; Mistrík, J.; Janíček, P.; Worsch, P.; Kolská, Z.


    The effects of annealing at 300 °C on gold nanostructures sputtered onto glass substrate were studied using XRD, SAXSees, the Van der Pauw method and ellipsometry. As-sputtered and annealed samples exhibit a different dependence of the gold lattice parameter on the sputtering time. With increasing sputtering time the average thickness of the layer and the size of gold crystallites increased. Another rapid enlargement of the crystallites is observed after annealing. The volume resistivity decreases rapidly with the increasing sputtering time for both, as-deposited and annealed structures. With increasing sputtering time initially discontinuous gold coverage changes gradually in a continuous one. Electrically continuous gold coverage on the as-sputtered and annealed samples exhibits the same concentration of free charge carriers and Hall mobility. Optical constants of as-deposited and annealed gold films determined by ellipsometry support resistivity measurements and clearly manifest the presence of plasmons in discontinuous films.

  3. Synthesis of gold nanoparticles using various amino acids.


    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya


    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  4. Microbial synthesis of gold nanoparticles: current status and future prospects.


    Shedbalkar, Utkarsha; Singh, Richa; Wadhwani, Sweety; Gaidhani, Sharvari; Chopade, B A


    Gold nanoparticles have been employed in biomedicine since the last decade because of their unique optical, electrical and photothermal properties. Present review discusses the microbial synthesis, properties and biomedical applications of gold nanoparticles. Different microbial synthesis strategies used so far for obtaining better yield and stability have been described. It also includes different methods used for the characterization and analysis of gold nanoparticles, viz. UV-visible spectroscopy, Fourier transform infrared spectroscopy, X ray diffraction spectroscopy, scanning electron microscopy, ransmission electron microscopy, atomic force microscopy, electron dispersive X ray, X ray photoelectron spectroscopy and cyclic voltametry. The different mechanisms involved in microbial synthesis of gold nanoparticles have been discussed. The information related to applications of microbially synthesized gold nanoparticles and patents on microbial synthesis of gold nanoparticles has been summarized.

  5. Establishment of gold-quartz standard GQS-1

    USGS Publications Warehouse

    Millard, Hugh T.; Marinenko, John; McLane, John E.


    A homogeneous gold-quartz standard, GQS-1, was prepared from a heterogeneous gold-bearing quartz by chemical treatment. The concentration of gold in GQS-1 was determined by both instrumental neutron activation analysis and radioisotope dilution analysis to be 2.61?0.10 parts per million. Analysis of 10 samples of the standard by both instrumental neutron activation analysis and radioisotope dilution analysis failed to reveal heterogeneity within the standard. The precision of the analytical methods, expressed as standard error, was approximately 0.1 part per million. The analytical data were also used to estimate the average size of gold particles. The chemical treatment apparently reduced the average diameter of the gold particles by at least an order of magnitude and increased the concentration of gold grains by a factor of at least 4,000.

  6. Detection of squamous carcinoma cells using gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Dai, Wei-Yun; Lee, Sze-tsen; Hsu, Yih-Chih


    The goal of this study is to use gold nanoparticle as a diagnostic agent to detect human squamous carcinoma cells. Gold nanoparticles were synthesized and the gold nanoparticle size was 34.3 ± 6.2 nm. Based on the over-expression of epidermal growth factor receptor (EGFR) biomarkers in squamous carcinoma cells, we hypothesized that EGFR could be a feasible biomarker with a target moiety for detection. We further modified polyclonal antibodies of EGFR on the surface of gold nanoparticles. We found selected squamous carcinoma cells can be selectively detected using EGFR antibody-modified gold nanoparticles via receptor-mediated endocytosis. Cell death was also examined to determine the survival status of squamous carcinoma cells with respect to gold nanoparticle treatment and EGFR polyclonal antibody modification.

  7. SERS decoding of micro gold shells moving in microfluidic systems.


    Lee, Saram; Joo, Segyeong; Park, Sejin; Kim, Soyoun; Kim, Hee Chan; Chung, Taek Dong


    In this study, in situ surface-enhanced Raman scattering (SERS) decoding was demonstrated in microfluidic chips using novel thin micro gold shells modified with Raman tags. The micro gold shells were fabricated using electroless gold plating on PMMA beads with diameter of 15 microm. These shells were sophisticatedly optimized to produce the maximum SERS intensity, which minimized the exposure time for quick and safe decoding. The shell surfaces produced well-defined SERS spectra even at an extremely short exposure time, 1 ms, for a single micro gold shell combined with Raman tags such as 2-naphthalenethiol and benzenethiol. The consecutive SERS spectra from a variety of combinations of Raman tags were successfully acquired from the micro gold shells moving in 25 microm deep and 75 microm wide channels on a glass microfluidic chip. The proposed functionalized micro gold shells exhibited the potential of an on-chip microfluidic SERS decoding strategy for micro suspension array.

  8. Diffuse reflectivity of gold plating with high power laser irradiation

    NASA Astrophysics Data System (ADS)

    Wu, Yong; Zhang, Lei; Yang, Pengling; Wang, Zhenbao; Tao, Mengmeng; Liu, Fuhua; Feng, Guobin


    The discoloration and optical characteristics of the gold plating film under long-time high power laser irradiation are investigated. The fabrication process of gold plating on nickel underplate on rough surface of copper and aluminum alloy substrates is introduced. The measurement results of the diffuse reflectivity for the samples with different surface roughness indicate that roughness of the gold layer surface should be 4μm to obtain the maximum value of diffuse reflectivity. The discoloration and variation of diffuse reflectivity are experimentally studied under 2000W irradiation. The research results show that the discoloration and degrading of reflectivity are caused by the diffusion of Ni to the gold plating surface and forming NiO thin film due to the porosity of the gold film and high temperature treatment. A change of diffuse reflectivity related mechanism is described. Several plating solution recipes are used to eliminate the discoloration and mitigate the degrading of the reflectivity on gold surface.

  9. Gold over Branched Palladium Nanostructures for Photothermal Cancer Therapy.


    McGrath, Andrew J; Chien, Yi-Hsin; Cheong, Soshan; Herman, David A J; Watt, John; Henning, Anna M; Gloag, Lucy; Yeh, Chen-Sheng; Tilley, Richard D


    Bimetallic nanostructures show exciting potential as materials for effective photothermal hyperthermia therapy. We report the seed-mediated synthesis of palladium-gold (Pd-Au) nanostructures containing multiple gold nanocrystals on highly branched palladium seeds. The nanostructures were synthesized via the addition of a gold precursor to a palladium seed solution in the presence of oleylamine, which acts as both a reducing and a stabilizing agent. The interaction and the electronic coupling between gold nanocrystals and between palladium and gold broadened and red-shifted the localized surface plasmon resonance absorption maximum of the gold nanocrystals into the near-infrared region, to give enhanced suitability for photothermal hyperthermia therapy. Pd-Au heterostructures irradiated with an 808 nm laser light caused destruction of HeLa cancer cells in vitro, as well as complete destruction of tumor xenographs in mouse models in vivo for effective photothermal hyperthermia.

  10. Solution-based metal enhanced fluorescence with gold and gold/silver core-shell nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Zebin; Li, Xiaoyi; Guo, Jingxia; Wang, Ruibo; Wu, Yanni; Zhang, Mingdi; Li, Caixia; Han, Qingyan; Dong, Jun; Zheng, Hairong


    Metal enhanced fluorescence of Oxazine720 fluorophore with gold and gold/silver core-shell nanorods is investigated experimentally in aqueous solution system. Metallic nanorods are synthesized for providing proper localized surface plasmon resonance and necessary enhancement to the fluorophore molecule. The experimental observation shows that the fluorescence enhancement increases firstly and then decreases when the concentration of metallic nanorods increases, which is resulted by the competition between enhanced emission and inner-filtering effect. Further investigation with different amounts of metallic nanorods shows that the relationship between metal enhanced fluorescence and spectral correlation strongly depends on the concentration of metallic nanorods.

  11. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    SciTech Connect

    Pattabi, Manjunatha M, Krishnaprabha


    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl{sub 4}). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  12. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    NASA Astrophysics Data System (ADS)

    Pattabi, Manjunatha; M, Krishnaprabha


    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl4). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  13. Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods

    DTIC Science & Technology


    AFRL-OSR-VA-TR-2014-0334 NOVEL ORGANO-SOLUBLE OPTICALLY TUNABLE CHIRAL HYBRID GOLD NANORODS Quan Li KENT STATE UNIV OH Final Report 12/04/2014...Prescribed by ANSI Std. Z39.18 1 FINAL REPORT Title: Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods AFOSR...Now this project has accomplished all the proposed objectives and beyond. Organo-soluble chiral azo thiol monolayer-protected gold nanorods, the

  14. Gold Ion-Angiotensin Peptide Interaction by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Lee, Jenny; Jayathilaka, Lasanthi P.; Gupta, Shalini; Huang, Jin-Sheng; Lee, Bao-Shiang


    Stimulated by the interest in developing gold compounds for treating cancer, gold ion-angiotensin peptide interactions are investigated by mass spectrometry. Under the experimental conditions used, the majority of gold ion-angiotensin peptide complexes contain gold in the oxidation states I and III. Both ESI-MS and MALDI-TOF MS detect singly/multiply charged ions for mononuclear/multinuclear gold-attached peptides, which are represented as [peptide + a Au(I) + b Au(III) + (e - a -3b) H]e+, where a,b ≥ 0 and e is charge. ESI-MS data shows singly/multiply charged ions of Au(I)-peptide and Au(III)-peptide complexes. This study reveals that MALDI-TOF MS mainly detects singly charged Au(I)-peptide complexes, presumably due to the ionization process. The electrons in the MALDI plume seem to efficiently reduce Au(III) to Au(I). MALDI also tends to enhance the higher polymeric forms of gold-peptide complexes regardless of the laser power used. Collision-induced dissociation experiments of the mononuclear and dinuclear gold-attached peptide ions for angiotensin peptides show that the gold ion (a soft acid) binding sites are in the vicinity of Cys (a soft ligand), His (a major anchor of peptide for metal ion chelation), and the basic residue Arg. Data also suggests that the abundance of gold-attached peptides increases with higher gold concentration until saturation, after which an increase in gold ion concentration leads to the aggregation and/or precipitation of gold-bound peptides.

  15. Multiple gold-dimer detection from large scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Jin, Zheng


    Gold nanoparticles exhibit unique plasmonic optical properties in visible to near infrared band. Especially the coupling effect existing at the gap between a closely linked particle pair can make the local field strongly enhanced. These properties make gold particles more attractive to be employed as molecular probes in biomedical related fundamental and clinical researches. However in the bio-system exist many large molecules or groups, whose optical signals can strongly depress the gold particles without detectable. In this paper, we proposed a method to extract the targets which are labelled by gold dimer pairs from large scattering background.

  16. Preparation and characterization of graphene oxide encapsulated gold nanoparticles.


    Yun, Yong Ju; Song, Ki-Bong


    We present a simple approach for the fabrication of graphene oxide-encapsulated gold nanoparticles using graphene oxide sheet-wrapping via electrostatic self-assembly. By mixing bovine serum albumin molecule-functionalized gold nanoparticles with graphene oxide dispersion, positively charged bovine serum albumin/gold nanoparticles easily assembled with negatively charged graphene oxide sheets through electrostatic interaction. Transmittance electron microscopy, scanning electron microscopy, atomic force microscopy, and Raman spectroscopy were used to confirm the encapsulation of graphene oxide on gold nanoparticles. Interestingly, graphene oxide sheets wrapping mainly occurs along the main body of single or a few gold nanoparticles. Additionally, by measuring the ultraviolet-visible spectroscopy spectrum, we found that the surface plasmon resonances band of the graphene oxide-encapsulated gold nanoparticles was found to become red-shifted compared to that of pristine gold nanoparticles, whereas similar to that of bovine serum albumin-coated gold nanoparticles. These results indicating that most of graphene oxide-encapsulated gold nanoparticles have good monodispersity and spherical shape. These resulting materials may potentially serve as a platform for plasmon resonance electron transfer spectroscopy or a probe for low level biosensing.

  17. Accelerated atmospheric corrosion testing of electroplated gold mirror coatings

    NASA Astrophysics Data System (ADS)

    Chu, C.-T.; Alaan, D. R.; Taylor, D. P.


    Gold-coated mirrors are widely used in infrared optics for industrial, space, and military applications. These mirrors are often made of aluminum or beryllium substrates with polished nickel plating. Gold is deposited on the nickel layer by either electroplating or vacuum deposition processes. Atmospheric corrosion of gold-coated electrical connectors and contacts was a well-known problem in the electronic industry and studied extensively. However, there is limited literature data that correlates atmospheric corrosion to the optical properties of gold mirror coatings. In this paper, the atmospheric corrosion of different electroplated gold mirror coatings were investigated with an accelerated mixed flowing gas (MFG) test for up to 50 days. The MFG test utilizes a combination of low-level air pollutants, humidity, and temperatures to achieve a simulated indoor environment. Depending on the gold coating thickness, pore corrosion started to appear on samples after about 10 days of the MFG exposure. The corrosion behavior of the gold mirror coatings demonstrated the porous nature of the electroplated gold coatings as well as the variation of porosity to the coating thickness. The changes of optical properties of the gold mirrors were correlated to the morphology of corrosion features on the mirror surface.

  18. The graphene-gold interface and its implications for nanoelectronics.


    Sundaram, Ravi S; Steiner, Mathias; Chiu, Hsin-Ying; Engel, Michael; Bol, Ageeth A; Krupke, Ralph; Burghard, Marko; Kern, Klaus; Avouris, Phaedon


    We combine optical microspectroscopy and electronic measurements to study how gold deposition affects the physical properties of graphene. We find that the electronic structure, the electron-phonon coupling, and the doping level in gold-plated graphene are largely preserved. The transfer lengths for electrons and holes at the graphene-gold contact have values as high as 1.6 μm. However, the interfacial coupling of graphene and gold causes local temperature drops of up to 500 K in operating electronic devices.

  19. Methanobactin-mediated one-step synthesis of gold nanoparticles.


    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu


    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months.

  20. Methanobactin-Mediated One-Step Synthesis of Gold Nanoparticles

    PubMed Central

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu


    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months. PMID:24189217

  1. Reflectance spectroscopy of gold nanoshells: computational predictions and experimental measurements

    NASA Astrophysics Data System (ADS)

    Lin, Alex W. H.; Lewinski, Nastassja A.; Lee, Min-Ho; Drezek, Rebekah A.


    Gold nanoshells are concentric spherical constructs that possess highly desirable optical responses in the near infrared. Gold nanoshells consist of a thin outer gold shell and a silica core and can be used for both diagnostic and therapeutic purposes by tuning the optical response through changing the core-shell ratio as well as the overall size. Although optical properties of gold nanoshells have already been well documented, the reflectance characteristics are not well understood and have not yet been elucidated by experimental measurements. Yet, in order to use gold nanoshells as an optical contrast agent for scattering-based optical methods such as reflectance spectroscopy, it is critical to characterize the reflectance behavior. With this in mind, we used a fiber-optic-based spectrometer to measure diffuse reflectance of gold nanoshell suspensions from 500 nm to 900 nm. Experimental results show that gold nanoshells cause a significant increase in the measured reflectance. Spectral features associated with scattering from large angles ( 180°) were observed at low nanoshell concentrations. Monte Carlo modeling of gold nanoshells reflectance demonstrated the efficacy of using such methods to predict diffuse reflectance. Our studies suggest that gold nanoshells are an excellent candidate as optical contrast agents and that Monte Carlo methods are a useful tool for optimizing nanoshells best suited for scattering-based optical methods.

  2. Mercury contamination from historical gold mining in California

    USGS Publications Warehouse

    Alpers, Charles N.; Hunerlach, Michael P.; May, Jason T.; Hothem, Roger L.


    Mercury contamination from historical gold mines represents a potential risk to human health and the environment. This fact sheet provides background information on the use of mercury in historical gold mining and processing operations in California, with emphasis on historical hydraulic mining areas. It also describes results of recent USGS projects that address the potential risks associated with mercury contamination. Miners used mercury (quicksilver) to recover gold throughout the western United States. Gold deposits were either hardrock (lode, gold-quartz veins) or placer (alluvial, unconsolidated gravels). Underground methods (adits and shafts) were used to mine hardrock gold deposits. Hydraulic, drift, or dredging methods were used to mine the placer gold deposits. Mercury was used to enhance gold recovery in all the various types of mining operations; historical records indicate that more mercury was used and lost at hydraulic mines than at other types of mines. On the basis of USGS studies and other recent work, a better understanding is emerging of mercury distribution, ongoing transport, transformation processes, and the extent of biological uptake in areas affected by historical gold mining. This information has been used extensively by federal, state, and local agencies responsible for resource management and public health in California.

  3. Gold Carbene or Carbenoid: Is There a Difference?

    PubMed Central

    Wang, Yahui; Muratore, Michael E; Echavarren, Antonio M


    By reviewing the recent progress on the elucidation of the structure of gold carbenes and the definitions of metal carbenes and carbenoids, we recommend to use the term gold carbene to describe gold carbene-like intermediates, regardless of whether the carbene or carbocation extreme resonance dominates. Gold carbenes, because of the weak metal-to-carbene π-back-donation and their strongly electrophilic reactivity, could be classified into the broader family of Fischer carbenes, although their behavior and properties are very specific. PMID:25786384

  4. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection

    NASA Astrophysics Data System (ADS)

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo


    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  5. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection.


    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo


    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  6. Ligand-Assisted Gold-Catalyzed Cross-Coupling with Aryldiazonium Salts: Redox Gold Catalysis without an External Oxidant.


    Cai, Rong; Lu, Mei; Aguilera, Ellen Y; Xi, Yumeng; Akhmedov, Novruz G; Petersen, Jeffrey L; Chen, Hao; Shi, Xiaodong


    Gold-catalyzed C(sp)-C(sp(2)) and C(sp(2))-C(sp(2)) cross-coupling reactions are accomplished with aryldiazonium salts as the coupling partner. With the assistance of bpy ligand, gold(I) species were oxidized to gold(III) by diazonium without any external oxidants. Monitoring the reaction with NMR and ESI-MS provided strong evidence for the nitrogen extrusion followed by Au(III) reductive elimination as the key step.

  7. Nanomanufacturing of gold nanoparticle superstructures from the "bottom-up"

    NASA Astrophysics Data System (ADS)

    Rao, Tingling

    Gold nanoparticles that can generate surface plasmons under appropriate conditions have attracted significant interest for their potential in optics, photonics, data storage and biological sensors. Developing high fidelity fabrication methods that yield gold nanoparticles with well-defined size, shape, composition and self-assembly allows manipulation of surface plasmonic properties for novel applications as well as revealing new aspects of the underlying science. This dissertation demonstrates multiple techniques that describe cost-effective bottom-up" fabrication methods that yield gold nano-superstructures. In my initial work, I outline the solution conditions for fabricating Janus nanoparticles composed of one gold nanoparticle per micelle. Poly(ethylene oxide)-b-polystyrene (PEO-b-PS) was synthesized and processed into spherical micelles, which served as the template to induce gold nanoparticles growth within the PEO corona in situ. Organic-inorganic hybrid nanoparticle formation was controlled kinetically by manipulating the concentration of both the micelle and reducing agent (HEPES). We also found that under certain condition, PEO-b-PS yielded micelles with pearl-like morphology, which possessed concentrated PEO domains at the interface between two adjacent PS cores. Careful manipulation of reaction conditions afforded gold nanoparticles that grew from the core-shell interface to form 1-dimensional (1-D) periodical gold nanoparticle chains. Based on similar principles, gold-gold dimers were synthesized by growing a second gold nanoparticle from a gold nanoparticle template surface-functionalized with PEO ligands. Gold dimers fabricated with this method exhibited strong enhancement properties via surface-enhanced Raman scattering (SERS). Instead of kinetic control, the number of newly grown gold nanoparticles on each particle template heavily relied on the PEO density on the nanoparticle template. As the size of the particle template increased from 10 nm to

  8. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.


    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  9. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.


    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  10. Turning Plastic into Gold: An Analogy to Demonstrate The Rutherford Gold Foil Experiment

    ERIC Educational Resources Information Center

    Gregory, Robert B.


    The Rutherford-Geiger-Marsden gold foil experiment is demonstrated to give students a useful mental image of the concept or principle of chemistry. The experiment shows students that in a short time one unexpected result can change the way science looks at the world.

  11. Where Are the Facts? "Jason's Gold" Gives Meaning to the Yukon Gold Rush

    ERIC Educational Resources Information Center

    Wasta, Stephanie; Lott, Carolyn


    This article discusses how fictional works can give a purposeful context and an appropriate venue for developing essential social studies concepts in middle-school students. The author uses the example of a National Council for the Social Studies (NCSS) notable book, "Jason's Gold" that blends history with story to become historical…

  12. Modulation of Fano resonances in symmetry-broken gold-SiO2-gold nanotube dimers

    NASA Astrophysics Data System (ADS)

    Wu, DaJian; Yu, HaiQun; Jiang, ShuMin; Wu, XueWei; Liu, XiaoJun


    Fano resonances in the symmetry-broken gold-SiO2-gold (BGSG) nanotubes and the associated dimers have been investigated based on the finite element method. In the BGSG nanotube, the symmetry breaking induced the interactions of the inner gold core and outer gold nanoshell plasmons of all multipolar orders and hence the red-shifts of the plasmon resonance modes and the enhanced quadrupole mode peaks were observed. The interference of the quadrupole mode peak with the subradiant dipole mode caused a Fano-dip in the scattering spectrum. By increasing the core offset-value in the BGSG nanotube, the Fano dip with low energy showed a red-shift and became deeper. Unexpectedly the plasmon coupling between a GSG nanotube and a BGSG nanotube can lead to two strong Fano dips in the scattering spectra of the dimer. It was further noted that the thin side of the BGSG nanotube located at two sides of the dimer gap can lead to the strong near-field coupling between two BGSG nanotubes and hence a deeper and broader Fano dip.

  13. Electronic transport in arrays of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    We examine electronic transport through two-dimensional arrays of gold nanocrystals. Recently developed techniques of particle synthesis and array self-assembly provide ordered (and disordered) monolayers of six-nanometer diameter gold nanocrystals on substrates with in-plane electrodes. These well-characterized superlattices allow investigation of basic questions about electronic conduction in metal quantum dot assemblies, answers to which have previously remained elusive. We first address the relation between current and voltage. Central to transport is the Coulomb blockade, the energetic cost of adding a single electron to a nanocrystal. Theoretical studies suggest power-law scaling of current beyond a threshold voltage in Coulomb blockade dominated systems. In ordered arrays, our data follow a power-law form, but with a scaling exponent significantly higher than the theoretical prediction. In disordered arrays, power-law scaling is violated; we explain that disorder disturbs the branching of current-carrying paths responsible for power-law conduction. Second, we examine the effect of temperature on transport. We find a large low-temperature regime (up to about 100 K) in which thermal energy acts only to linearly suppress the threshold voltage, leaving the current scale unaffected. We provide a simple, analytic model of thermally assisted tunneling which quantitatively describes the data. Third, we develop a simple and novel technique to tune the interparticle electronic couplings of the arrays---deposition of small amounts of germanium on the monolayers. The germanium dopant lowers the voltage threshold, and also increases conductivity. It also increases the temperature dependence of transport, suggesting the introduction of trapped states between the gold nanocrystal cores.

  14. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.


    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  15. Gold in the oceans through time

    NASA Astrophysics Data System (ADS)

    Large, Ross R.; Gregory, Daniel D.; Steadman, Jeffrey A.; Tomkins, Andrew G.; Lounejeva, Elena; Danyushevsky, Leonid V.; Halpin, Jacqueline A.; Maslennikov, Valeriy; Sack, Patrick J.; Mukherjee, Indrani; Berry, Ron; Hickman, Arthur


    During sedimentation and diagenesis of carbonaceous shales in marine continental margin settings, Au is adsorbed from seawater and organic matter and becomes incorporated into sedimentary pyrite. LA-ICPMS analysis of over 4000 sedimentary pyrite grains in 308 samples from 33 locations around the world, grouped over 123 determined ages, has enabled us to track, in a first order sense, the Au content of the ocean over the last 3.5 billion years. Gold was enriched in the Meso- and Neoarchean oceans, several times above present values, then dropped by an order of magnitude from the first Great Oxidation Event (GOE1) through the Paleoproterozoic to reach a minimum value around 1600 Ma. Gold content of the oceans then rose, with perturbations, through the Meso- and Neoproterozoic, showing a steady rise at the end of the Proterozoic (800 to 520 Ma), which most likely represents the effects of the second Great Oxidation Event (GOE2). Gold in the oceans was at a maximum at 520 Ma, when oxygen in the oceans rose to match current maximum values. In the Archean and Proterozoic, the Au content of seawater correlates with the time distribution of high-Mg greenstone belts, black shales and banded iron formations, suggesting that increases in atmospheric oxygen and marine bio-productivity, combined with the higher background of Au in komatiitic and Mg-rich basalts were the first order causes of the pattern of Au enrichment in seawater. We suggest the lack of major Au deposits from 1800 to 800 Ma, is explained by the low levels of Au in the oceans during this period.

  16. Fugitive Mercury Emissions From Nevada Gold Mines

    NASA Astrophysics Data System (ADS)

    Miller, M. B.; Eckley, C. S.; Gustin, M.; Marsik, F.


    Mercury (Hg) can be released from point sources at gold mines (e.g. stacks associated with ore processing facilities) as well as from diffuse fugitive sources (e.g. waste rock dumps, heap leaches, etc). Fugitive Hg emissions have not been quantified for active gold mines and as such a large knowledge gap exists concerning the magnitude of total emissions from this source type. This study measured fugitive Hg emissions from two active gold mines in Northern Nevada. To contextualize the magnitude of the mine emissions with respect to those associated with natural surfaces, data were collected from undisturbed areas near the mines that are of similar geologic character. The initial results from this project have shown that there is a large range in surface Hg concentrations and associated emissions to the atmosphere from different surface types within a mine as well as between the two mines. At both mines, the lowest surface Hg concentrations and emissions were associated with the alluvium/overburden waste rock dumps. Surface Hg concentrations and emissions at nearby undisturbed sites were of similar magnitude. Surface concentrations and emissions were substantially higher from active heap leaches. In addition to the difference in fluxes for specific materials, measured emissions must be put within the context of material spatial extent and temporal variability. Here we compare Hg emission contributions from mining and undisturbed materials as a function of space and time (diel and seasonal), and illustrate the need for collection of these types of data in order to reduce uncertainties in understanding air-surface Hg exchange.

  17. Solidification of gold nanoparticles in carbon nanotubes.


    Arcidiacono, S; Walther, J H; Poulikakos, D; Passerone, D; Koumoutsakos, P


    The structure and the solidification of gold nanoparticles in a carbon nanotube are investigated using molecular dynamics simulations. The simulations indicate that the predicted solidification temperature of the enclosed particle is lower than its bulk counterpart, but higher than that observed for clusters placed in vacuum. A comparison with a phenomenological model indicates that, in the considered range of tube radii (R(CNT)) of 0.5 < R(CNT) < 1.6 nm, the solidification temperature depends mainly on the length of the particle with a minor dependence on R(CNT).

  18. Gold(I) Fluorohalides: Theory and Experiment.


    Baya, Miguel; Pérez-Bitrián, Alberto; Martínez-Salvador, Sonia; Casas, José M; Menjón, Babil; Orduna, Jesús


    The anionic trifluoromethylgold(I) derivatives [CF3 AuX](-) , which have been prepared and isolated as their [PPh4 ](+) salts in good yield, undergo thermally induced difluorocarbene extrusion in the gas phase, giving rise to the mixed gold(I) fluorohalide complexes [F-Au-X](-) (X=Cl, Br, I). These triatomic species have been detected by tandem mass spectrometry (MS2) experiments and their properties have been analyzed by DFT methods. The CF2 extrusion mechanism from the Au-CF3 moiety serves as a model for the CF2 insertion into the Au-F bond, since both reactivity channels are connected by the microreversibility principle.

  19. Structural and plasmonic properties of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Sivapalan, Sean T.

    The design of gold nanoparticles for surface-enhanced Raman scattering (SERS) and plasmonic enhanced fluorescence are more involved than simply maximizing the local field enhancement. The enhancement is a function of the excitation wavelength relative to the plasmon resonance as well as the distance of the reporter molecules from the nanoparticles' surface. For suspension based measurements, additional considerations must also be made regarding absorption and scattering effects as light propagates through the sample. These effects are in addition to the other more commonly observed effects such as nanocrystal shape. With such a wide number of variables in play, a series of studies breaking down each of these components and their contribution to the observed enhancement is warranted. In this thesis, a series of experiments were undertaken using a platform based on polyelectrolyte coating of gold nanoparticles by layer-by-layer deposition. The reporter molecules are bound onto the surface of polyelectrolyte coated nanoparticles before trap coating them with an additional oppositely charged polyelectrolyte layer. By etching away the gold nanoparticle using potassium cyanide, we are then able to quantify the number of reporter molecule per nanoparticle using mass spectrometry. With this quantitative approach, we can the directly compare the effects of the aforementioned enhancement mechanisms on the observed signal intensity. This method overcomes some of the disparities in literature between reported values of enhancement due to assumption in the number of reporter molecules contribution to the signal intensity. Using our group's expertise, we synthesized gold nanoparticle libraries of nanorods, cubes, trisoctahedra and spheres of different sizes. Each geometric configuration was characterized using a recently developed TEM technique---nano-beam coherent area diffraction. The as-synthesized were exposed to a coherent electron beam with probe size similar to that of

  20. Overgrowth of Rhodium on Gold Nanorods

    PubMed Central


    This study focuses on the deposition and growth mode of rhodium (Rh) on gold (Au) seed nanorods (NRs). Using a combination of scanning transmission electron microscopy imaging, energy-dispersive X-ray spectroscopy, and UV–visible absorption spectroscopy, we show that Rh deposition results in an uneven overlayer morphology on the Au NR seeds, with a tendency for Rh deposition to occur preferentially on the Au NR ends. The results suggest that complex and kinetically driven metal–metal interactions take place in this system. PMID:22582111

  1. Mortality of white South African gold miners.

    PubMed Central

    Reid, P J; Sluis-Cremer, G K


    OBJECTIVES--This two part study aimed to determine whether there was an excess mortality generally or for some diseases among middle aged white South African gold miners on the Witwatersrand and whether the underground dust exposure of these miners contributed to the development of lung cancer, chronic obstructive pulmonary disease (COPD), or ischaemic heart disease (IHD). METHODS--A cohort of 4925 white miners in South Africa, born between 1 January 1916 and 31 December 1930 who were alive and working in the vicinity of Johannesburg on 1 January 1970, then aged between 39 and 54, was followed up for 20 years by which time 2032 had died. Most were gold miners (about 87% had worked 85% or more of their shifts in gold mines). Standardised mortality ratios (SMRs) were calculated as percentages of the number of deaths observed in the cohort for a condition as stated on the death certificate divided by the number expected on the basis of concurrent mortality in the reference population (the total age specific white male population of South Africa). A case-control analysis was performed for three diseases (lung cancer, COPD, and IHD), the results of which are presented for those miners in the cohort who had spent at least 85% of their service on gold mines and had worked at least 15% of their shifts underground. RESULTS--The SMR for all causes of death was 129.6%, raised because of excess mortality due to the following causes: lung cancer (SMR = 139.8%), IHD (124.1%), COPD (189%) and cirrhosis of the liver (155.3%). Smoking was confirmed to be the main risk factor for lung cancer and COPD although cumulative dust exposure was found to increase the risk of COPD in conjunction with smoking. No significant risk of lung cancer resulted from exposure to dust. High blood pressure and smoking were found to increase the risk of IHD, but no association between IHD and the quetelet index (weight/height2) was found. CONCLUSIONS--The most significant and unexpected finding was the

  2. Monolayer coated gold nanoparticles for delivery applications

    PubMed Central

    Rana, Subinoy; Bajaj, Avinash; Mout, Rubul; Rotello, Vincent M.


    Gold nanoparticles (AuNPs) provide attractive vehicles for delivery of drugs, genetic materials, proteins, and small molecules. AuNPs feature low core toxicity coupled with the ability to parametrically control particle size and surface properties. In this review, we focus on engineering of the AuNP surface monolayer, highlighting recent advances in tuning monolayer structures for efficient delivery of drugs and biomolecules. This review covers two broad categories of particle functionalization, organic monolayers and biomolecule coatings, and discusses their applications in drug, DNA/RNA, protein and small molecule delivery. PMID:21925556

  3. Method for aqueous gold thiosulfate extraction using copper-cyanide pretreated carbon adsorption

    SciTech Connect

    Young, Courtney; Melashvili, Mariam; Gow, Nicholas V


    A gold thiosulfate leaching process uses carbon to remove gold from the leach liquor. The activated carbon is pretreated with copper cyanide. A copper (on the carbon) to gold (in solution) ratio of at least 1.5 optimizes gold recovery from solution. To recover the gold from the carbon, conventional elution technology works but is dependent on the copper to gold ratio on the carbon.

  4. Adsorption of cellulose derivatives on flat gold surfaces and on spherical gold particles.


    Amirkhani, Masoud; Volden, Sondre; Zhu, Kaizheng; Glomm, Wilhelm R; Nyström, Bo


    The adsorption of hydroxyethylcellulose (HEC), ethyl(hydroxyethyl)cellulose (EHEC), and their hydrophobically modified counterparts HM-HEC and HM-EHEC has been studied on planar gold and citrate-covered gold surfaces by means of quartz crystal microbalance with dissipation monitoring (QCM-D), and on citrate-covered gold particles with the aid of dynamic light scattering (DLS). The QCM-D results indicate that larger amounts of polymer are adsorbed from aqueous solutions of HM-HEC and HM-EHEC on both substrates than from solutions of their unmodified analogues. The adsorption affinity for all the polymers, except EHEC, is higher on the citrate-covered surfaces than on the bare gold substrate. This indicates that more adsorption sites are activated in the presence of the citrate layer. The experimental adsorption data for all the polymers can be described fairly well by the Langmuir adsorption isotherm. However, at very low polymer concentrations significant deviations from the model are observed. The value of the hydrodynamic thickness of the adsorbed polymer layer (delta h), determined from DLS, rises with increasing polymer concentration for all the cellulose derivatives; a Langmuir type of isotherm can be used to roughly describe the adsorption behavior. Because of good solvent conditions for HEC the chains extend far out in the bulk at higher concentrations and the value of delta h is much higher than that of HM-HEC. The adsorption of EHEC and HM-EHEC onto gold particles discloses that the values of delta h are considerably higher for the hydrophobically modified cellulose derivative, and this finding is compatible with the trend in layer thickness estimated from the QCM-D measurements.

  5. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars.


    Favi, Pelagie Marlene; Gao, Ming; Johana Sepúlveda Arango, Liuda; Ospina, Sandra Patricia; Morales, Mariana; Pavon, Juan Jose; Webster, Thomas Jay


    Gold nanoparticles are materials with unique optical properties that have made them very attractive for numerous biomedical applications. With the increasing discovery of techniques to synthesize novel nanoparticles such as star-shaped gold nanoparticles for biomedical applications, the safety and performance of these new nanomaterials must be systematically assessed before use. In this study, gold nanostars (AuNSTs) with multibranched surface structures were synthesized, and their influence on the cytotoxicity of human skin fibroblasts and rat fat pad endothelial cells (RFPECs) were assessed and compared with that of gold nanospheres (AuNSPs) with unbranched surfaces. Results showed that the AuNSPs with diameters of approximately 61.46 nm showed greater toxicity with fibroblast cells and RFPECs compared with the synthesized AuNSTs with diameters of approximately 33.69 nm. The AuNSPs were lethal at concentrations of 40 μg/mL for both cell lines, whereas the AuNSTs were less toxic at higher concentrations (400 μg/mL). The calculated IC50 (50% inhibitory concentration) values of the AuNSPs exposed to fibroblast cells were greater at 1 and 4 days of culture (26.4 and 27.7 μg/mL, respectively) compared with the RFPECs (13.6 and 13.8 μg/mL, respectively), indicating that the AuNSPs have a greater toxicity to endothelial cells. It was proposed that possible factors that could be promoting the reduced toxicity effects of the AuNSTs to fibroblast cells and RFPECs, compared with the AuNSPs may be size, surface chemistry, and shape of the gold nanoparticles. The reduced cell toxicity observed with the AuNSTs suggests that AuNSTs may be a promising material for use in biomedical applications.

  6. Synthesis of Barbaralones and Bullvalenes Made Easy by Gold Catalysis.


    Ferrer, Sofia; Echavarren, Antonio M


    The gold(I)-catalyzed oxidative cyclization of 7-ethynyl-1,3,5-cycloheptatrienes gives 1-substituted barbaralones in a general manner, which simplifies the access to other fluxional molecules. As an example, we report the shortest syntheses of bullvalene, phenylbullvalene, and disubstituted bullvalenes, and a readily accessible route to complex cage-type structures by further gold(I)-catalyzed reactions.

  7. Intriguing mechanistic labyrinths in gold(i) catalysis

    PubMed Central

    Obradors, Carla


    Many mechanistically intriguing reactions have been developed in the last decade using gold(i) as catalyst. Here we review the main mechanistic proposals in gold-catalysed activation of alkynes and allenes, in which this metal plays a central role by stabilising a variety of complex cationic intermediates. PMID:24176910

  8. Why Gold and Copper Are Colored but Silver Is Not.

    ERIC Educational Resources Information Center

    Guerrero, Ariel H.; Fasoli, Hector J.; Costa, Jose Luis


    Explains why silver, which has the same external electronic configuration as copper and gold, does not appear yellow: white light reflects on most metals without color absorption or change to the naked eye; however, copper and gold appear yellow because they absorb "blue" and "red" photons during electron transitions between…

  9. Gold Mining in Papua New Guinea: A Curricular Omission?

    ERIC Educational Resources Information Center

    Palmer, W. P.


    What criteria should be used to include or exclude particular topics within a country's science curriculum? It will be argued here that gold/gold mining is a suitable and relevant topic for inclusion in PNG's science curricula and suggestions towards achieving that end will be offered. The teaching of the mining of copper ore and the metal's…

  10. News from El Dorado: Newspapers and the California Gold Rush.

    ERIC Educational Resources Information Center

    Kurutz, Gary F.

    When James Wilson Marshall discovered gold at Sutter's Mill (California) in 1848, he not only touched off the greatest gold rush the world had ever seen, but also ignited one of the great writing frenzies in American history. Guidebooks, diaries, and letters all told of a new El Dorado where unimaginable riches could be found simply by picking…

  11. An electrochemical investigation of gold, tin and titanium compounds

    SciTech Connect

    Sawtelle, S.M.


    The determination of the electron transfer properties of gold, tin, and titanium compounds using electrochemical and spectroelectrochemical techniques is the focus of this dissertation. The investigations of the gold compounds include the determination of the properties of Au[PR[sub 3

  12. [Gold amulets of Ra: a step towards immortality].


    Janot, F


    In Ancient Egypt, the priest-embalmer laid the gold on the whole of the king's body. For simple citizens, he more modestly applied fine leaves or amulets of golden wax for certain parts. Possessing the same magical powers as gold, they participated in the complete preservation.

  13. The source of Witwatersrand gold: evidence from uraninite chemistry

    USGS Publications Warehouse

    Frimmel, Hartwig E.; Emsbo, Poul; Koenig, Alan E.


    An in-situ LA-ICP-MS study of different generations of uraninite from the Mesoarchaean Witwatersrand gold palaeoplacer deposits revealed unusually high Au concentrations in rounded, detrital uraninite grains but no detectable Au in secondary, hydrothermally mobilised uraninite. A Au-enriched uraninite-bearing magmatic host is suggested as a significant source for detrital gold in the Witwatersrand sediments.

  14. Gold-silica quantum rattles for multimodal imaging and therapy.


    Hembury, Mathew; Chiappini, Ciro; Bertazzo, Sergio; Kalber, Tammy L; Drisko, Glenna L; Ogunlade, Olumide; Walker-Samuel, Simon; Krishna, Katla Sai; Jumeaux, Coline; Beard, Paul; Kumar, Challa S S R; Porter, Alexandra E; Lythgoe, Mark F; Boissière, Cédric; Sanchez, Clément; Stevens, Molly M


    Gold quantum dots exhibit distinctive optical and magnetic behaviors compared with larger gold nanoparticles. However, their unfavorable interaction with living systems and lack of stability in aqueous solvents has so far prevented their adoption in biology and medicine. Here, a simple synthetic pathway integrates gold quantum dots within a mesoporous silica shell, alongside larger gold nanoparticles within the shell's central cavity. This "quantum rattle" structure is stable in aqueous solutions, does not elicit cell toxicity, preserves the attractive near-infrared photonics and paramagnetism of gold quantum dots, and enhances the drug-carrier performance of the silica shell. In vivo, the quantum rattles reduced tumor burden in a single course of photothermal therapy while coupling three complementary imaging modalities: near-infrared fluorescence, photoacoustic, and magnetic resonance imaging. The incorporation of gold within the quantum rattles significantly enhanced the drug-carrier performance of the silica shell. This innovative material design based on the mutually beneficial interaction of gold and silica introduces the use of gold quantum dots for imaging and therapeutic applications.

  15. Functionalized Gold Nanoparticles: Synthesis, Properties and Applications--A Review.


    Alex, Saji; Tiwari, Ashutosh


    The past few decades have witnessed significant advances in the development of functionalized gold nanoparticles for applications in various fields such as chemistry, biology, pharmacy and physics. Although it has been more than 150 years since they were first synthesized, extensive research has recently been undertaken to improve or modify gold nanoparticles, thereby opening up opportunities to enhance and optimize their potential and breadth of their applicability. Recently developed methods have allowed a precise control of gold nanoparticle size and the modification of gold nanoparticles with suitable protecting and functionalizing agents, facilitate their applications in different areas such as chemical and biological sensing, imaging and biomedical applications. This review focuses on the recent developments in various methods for the size and shape controlled synthesis of gold nanoparticles, understanding of different properties of gold nanoparticles and their applications in various fields. Particular attention is given to the chemical and biological sensing applications of gold nanoparticles and on the advances in the controlled ordering of gold nanoparticles for creating nanostructures for diverse applications.

  16. Ion-selective electrodes for gold and silver determination.


    Petrukhin, O M; Avdeeva, E N; Shavnya, Y V; Yankauskas, V P; Kazlauskas, R M; Bychkov, A S; Zolotov, Y A


    Some new ion-selective electrodes for silver and gold are described. They are based on the ion-associate species formed by the cyanide, chloride or thiourea complexes of the metals, with hydrophobic anions or cations, as appropriate. The electrodes have been applied to the determination of gold and silver in various technological process solutions in industry.

  17. Colloidal Gold Nanocups with Orientation-Dependent Plasmonic Properties.


    Jiang, Ruibin; Qin, Feng; Liu, Yejing; Ling, Xing Yi; Guo, Jun; Tang, Minghua; Cheng, Si; Wang, Jianfang


    Colloidal gold nanocups are synthesized through single-vertex-initiated gold deposition on PbS nanooctahedrons and subsequent selective dissolution of the PbS component. They possess strong magnetic plasmon resonance and exhibit remarkable orientation-dependent plasmonic properties when deposited on flat substrates. They can also effectively couple s-polarized light into the interfacial region between the nanocup and substrate.

  18. Synthesis of gold nanostructures using fruit extract of Garcinia Indica

    NASA Astrophysics Data System (ADS)

    Krishnaprabha, M.; Pattabi, Manjunatha


    Gold nanoparticles having different shapes are synthesized using extract of fresh fruit rinds of Garcinia Indica. The onset of growth and formation of gold nanostructures is confirmed from UV-Vis spectroscopy. Morphological studies are done using FESEM. Size dependent catalytic activity is evaluated with the model reduction reaction of 4-nitrophenol to 4-aminophenol.

  19. Polymer and biopolymer mediated self-assembly of gold nanoparticles.


    Ofir, Yuval; Samanta, Bappaditya; Rotello, Vincent M


    Gold nanoparticle-polymer composites are versatile and diverse functional materials, with applications in optical, electronic and sensing devices. This tutorial review focuses on the use of polymers to control the assembly of gold nanoparticles. Examples of synthetic polymers and biopolymers are provided, as well as applications of the composite materials in sensing and memory devices.

  20. Undergraduate Laboratory Experiment Modules for Probing Gold Nanoparticle Interfacial Phenomena

    ERIC Educational Resources Information Center

    Karunanayake, Akila G.; Gunatilake, Sameera R.; Ameer, Fathima S.; Gadogbe, Manuel; Smith, Laura; Mlsna, Deb; Zhang, Dongmao


    Three gold-nanoparticle (AuNP) undergraduate experiment modules that are focused on nanoparticles interfacial phenomena have been developed. Modules 1 and 2 explore the synthesis and characterization of AuNPs of different sizes but with the same total gold mass. These experiments enable students to determine how particle size affects the AuNP…

  1. The Late Start and Amazing Upswing in Gold Chemistry

    ERIC Educational Resources Information Center

    Raubenheimer, Helgard G.; Schmidbaur, Hubert


    Probably owing to the prejudice that gold is a metal too noble to be used much in chemistry, the chemistry of this element has developed much later than that of its congeners and neighbors in the periodic table. In fact, before and after the time of alchemists, and up to the 20th century, all chemistry of gold was mainly performed in attempts to…


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  6. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR


    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  7. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  8. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR


    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  9. Exhaust system having a gold-platinum group metal catalyst


    Ragle, Christie Susan [Havana, IL; Silver, Ronald G [Peoria, IL; Zemskova, Svetlana Mikhailovna [Edelstein, IL; Eckstein, Colleen J [Metamora, IL


    A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.

  10. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR


    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  11. Exhaust system having a gold-platinum group metal catalyst


    Ragle, Christie Susan; Silver, Ronald G.; Zemskova, Svetlana Mikhailovna; Eckstein, Colleen J.


    A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.

  12. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  13. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR


    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  14. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  15. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR


    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  16. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  17. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR


    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  18. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2014 CFR


    ... 47 Telecommunication 1 2014-10-01 2014-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  19. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2012 CFR


    ... 47 Telecommunication 1 2012-10-01 2012-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  20. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2013 CFR


    ... 47 Telecommunication 1 2013-10-01 2013-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  1. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR


    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  2. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR


    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  3. Advocacy: Making the Gold Standard School a Reality

    ERIC Educational Resources Information Center

    Roberts, Julia Link; Inman, Tracy Ford


    In their last column, the authors described a Gold Standard School--a place in which all children thrive including the gifted and talented. The Checklist for a Gold Standard School, which is included in this article, highlights the main characteristics of such a school including a focus on continuous progress, talent development, policies that…

  4. The halogen analogs of thiolated gold nanoclusters

    SciTech Connect

    Jiang, Deen; Walter, Michael


    Is it possible to replace all the thiolates in a thiolated gold nanocluster with halogens while still maintaining the geometry and the electronic structure? In this work, we show from density functional theory that such halogen analogs of thiolated gold nanoclusters are highly likely. Using Au{sub 25}X{sub 18}{sup -} as an example, where X = F, Cl, Br, or I replaces -SR, we find that Au{sub 25}Cl{sub 18}{sup -} demonstrates a high similarity to Au{sub 25}(SR){sub 18}{sup -} by showing Au-Cl distances, Cl-Au-Cl angles, band gap, and frontier orbitals similar to those in Au{sub 25}(SR){sub 18}{sup -}. DFT-based global minimization also indicates the energetic preference of staple formation for the Au{sub 25}Cl{sub 18}{sup -} cluster. The similarity between Au{sub m}(SR){sub n} and Au{sub m}X{sub n} could be exploited to make viable Au{sub m}X{sub n} clusters and to predict structures for Au{sub m}(SR){sub n}.

  5. Photoinduced spectral changes of photoluminescent gold nanoclusters.


    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas


    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au- MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex = 420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem = 430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem = 476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  6. Photoinduced spectral changes of photoluminescent gold nanoclusters

    NASA Astrophysics Data System (ADS)

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas


    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au-MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex=420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem=430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem=476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  7. Unidirectional molecular motor on a gold surface

    NASA Astrophysics Data System (ADS)

    van Delden, Richard A.; Ter Wiel, Matthijs K. J.; Pollard, Michael M.; Vicario, Javier; Koumura, Nagatoshi; Feringa, Ben L.


    Molecules capable of mimicking the function of a wide range of mechanical devices have been fabricated, with motors that can induce mechanical movement attracting particular attention. Such molecular motors convert light or chemical energy into directional rotary or linear motion, and are usually prepared and operated in solution. But if they are to be used as nanomachines that can do useful work, it seems essential to construct systems that can function on a surface, like a recently reported linear artificial muscle. Surface-mounted rotors have been realized and limited directionality in their motion predicted. Here we demonstrate that a light-driven molecular motor capable of repetitive unidirectional rotation can be mounted on the surface of gold nanoparticles. The motor design uses a chiral helical alkene with an upper half that serves as a propeller and is connected through a carbon-carbon double bond (the rotation axis) to a lower half that serves as a stator. The stator carries two thiol-functionalized `legs', which then bind the entire motor molecule to a gold surface. NMR spectroscopy reveals that two photo-induced cis-trans isomerizations of the central double bond, each followed by a thermal helix inversion to prevent reverse rotation, induce a full and unidirectional 360° rotation of the propeller with respect to the surface-mounted lower half of the system.

  8. Gold nanostructure materials in diabetes management

    NASA Astrophysics Data System (ADS)

    Si, Satyabrata; Pal, Arttatrana; Mohanta, Jagdeep; Sagar Satapathy, Smith


    Diabetes mellitus is a group of metabolic diseases characterized by hyperglycemia, and is now one of the most non-communicable diseases globally and can be lethal if not properly controlled. Prolonged exposure to chronic hyperglycemia, without proper management, can lead to various vascular complications and represents the main cause of morbidity and mortality in diabetes patients. Studies have indicated that major long-term complications of diabetes arise from persistent oxidative-nitrosative stress and dysregulation in multiple metabolic pathways. Presently, the main focus for diabetes management is to optimize the available techniques to ensure adequate blood sugar level, blood pressure and lipid profile, thereby minimizing the diabetes complications. In this regard, nanomedicine utilizing gold nanostructures has great potential and seems to be a promising option. The present review highlights the basic concepts and up-to-date literature survey of gold nanostructure materials in management of diabetes in several ways, which include sensing, imaging, drug delivery and therapy. The work can be of interest to various researchers working on basic and applied sciences including nanosciences.

  9. Radiotracer investigation in gold leaching tanks.


    Dagadu, C P K; Akaho, E H K; Danso, K A; Stegowski, Z; Furman, L


    Measurement and analysis of residence time distribution (RTD) is a classical method to investigate performance of chemical reactors. In the present investigation, the radioactive tracer technique was used to measure the RTD of aqueous phase in a series of gold leaching tanks at the Damang gold processing plant in Ghana. The objective of the investigation was to measure the effective volume of each tank and validate the design data after recent process intensification or revamping of the plant. I-131 was used as a radioactive tracer and was instantaneously injected into the feed stream of the first tank and monitored at the outlet of different tanks. Both sampling and online measurement methods were used to monitor the tracer concentration. The results of measurements indicated that both the methods provided identical RTD curves. The mean residence time (MRT) and effective volume of each tank was estimated. The tanks-in-series model with exchange between active and stagnant volume was used and found suitable to describe the flow structure of aqueous phase in the tanks. The estimated effective volume of the tanks and high degree of mixing in tanks could validate the design data and confirmed the expectation of the plant engineer after intensification of the process.

  10. Grafting single molecule magnets on gold nanoparticles.


    Perfetti, Mauro; Pineider, Francesco; Poggini, Lorenzo; Otero, Edwige; Mannini, Matteo; Sorace, Lorenzo; Sangregorio, Claudio; Cornia, Andrea; Sessoli, Roberta


    The chemical synthesis and characterization of the first hybrid material composed by gold nanoparticles and single molecule magnets (SMMs) are described. Gold nanoparticles are functionalized via ligand exchange using a tetrairon(III) SMM containing two 1,2-dithiolane end groups. The grafting is evidenced by the shift of the plasmon resonance peak recorded with a UV-vis spectrometer, by the suppression of nuclear magnetic resonance signals, by X-ray photoemission spectroscopy peaks, and by transmission electron microscopy images. The latter evidence the formation of aggregates of nanoparticles as a consequence of the cross-linking ability of Fe4 through the two 1,2-dithiolane rings located on opposite sides of the metal core. The presence of intact Fe4 molecules is directly proven by synchrotron-based X-ray absorption spectroscopy and X-ray magnetic circular dichroism spectroscopy, while a detailed magnetic characterization, obtained using electron paramagnetic resonance and alternating-current susceptibility, confirms the persistence of SMM behavior in this new hybrid nanostructure.

  11. The Tintina Gold Belt - A global perspective

    USGS Publications Warehouse

    Goldfarb, Richard J.; Hart, Craig J.R.; Miller, Marti L.; Miller, Lance D.; Farmer, G. Lang; Groves, David I.; Tucker, T.L.; Smith, M.T.


    The so-called Tintina Gold Belt extends for more than 1000 km along the length of the northern North American Cordillera. Middle to Late Cretaceous Au deposits within the belt have various similar characteristics, among which are a spatial and temporal association with magmatism; Bi-W-Te signatures in deposits hosted by granitod stocks and As-Sb signatures where hosted by sedimentary rocks and dyke systems; and δ180 values consistently > 12 per mil for Au-bearing quartz. Nevertheless significant differences in structural styles, levels of deposit emplacement, ore-fluid chemistry, and Au grades suggest that the characteristics represent a broad range of deposit types. Many of these are best classified as orogenic Au deposits in the Yukon-Tanana terrane, as epithermal and porphyry-style Au deposits in the Kuskokwim region, and as Au-bearing, granite-related veins and stockworks, replacements, and skarns, as well as associated polymetallic lodes, in central Yukon. The diverse types of Au deposits and associated plutons of the Tintina Gold Belt collectively define a 45-m.y.-long period of arc magmatism that migrated northwesterly, for about 1000 km, across the active collisional margin of Cretaceous northwestern North America. The initiation of fluid flow and plutonism in Albian time seems to correlate with the onset of oblique subduction and dextral strike-slip on the Denali-Farewell, Tintina-Kaltag, and related fault systems. Initial Au-vein formation and subduction-related magmatism at about 115-110 Ma (e.g., including the Goodpaster and Fortymile districts), within the seaward side of the Yukon-Tanana terrane, correlate with the arrival of the Wrangellia superterrane off the continental margin. Dextral translation of the allochthonous Wrangellia block was associated with the migration of the thermal pulse to the northwest at about 95-90 Ma. Orogenic (or so­ called mesotherrnal) and granitoid-related Au deposits formed across the width of the Yukon

  12. Altered biodistribution of Ga-67 by intramuscular gold salts

    SciTech Connect

    Moult, R.G.; Bekerman, C. )


    The authors observed a deviation from the normal scintigraphic pattern of Ga-67 citrate biodistribution. An 8-year-old black girl with juvenile rheumatoid arthritis, who had been treated with intramuscular injections of gold salts, had a Ga-67 study as part of her workup. The study demonstrated no hepatic uptake, but showed elevated skeletal and renal activity. This characteristic biodistribution of Ga-67 may be due to inhibition of lysosomal enzymes by gold and/or to accumulation of gold in lysosomes. To study these possibilities, the authors reviewed the mechanisms of Ga-67 localization and gold metabolism. Alteration of the Ga-67 citrate scintigraphic pattern due to earlier treatment with gold salts has not been reported previously.

  13. Templated growth of gold satellites on dimpled silica cores.


    Chomette, C; Duguet, E; Mornet, S; Yammine, E; Manoharan, V N; Schade, N B; Hubert, C; Ravaine, S; Perro, A; Tréguer-Delapierre, M


    We synthesize robust clusters of gold satellites positioned with tetrahedral symmetry on the surface of a patchy silica core by adsorption and growth of gold on the patches. First we conduct emulsion polymerization of styrene in the presence of 52 nm silica seeds whose surface has been modified with methacryloxymethyltriethoxysilane (MMS). We derive four-dimple particles from the resulting silica/polystyrene tetrapods. Polystyrene chains are covalently bound to the silica surface within the dimples due to the MMS grafts and they may be thiolated to induce adsorption of 12 nm gold particles. Using chloroauric acid, ascorbic acid and sodium citrate at room temperature, we grow gold from these 12 nm seeds without detachment from or deformation of the dimpled silica surface. We obtain gold satellites of tunable diameter up to 140 nm.

  14. Terminalia chebula mediated green and rapid synthesis of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Mohan Kumar, Kesarla; Mandal, Badal Kumar; Sinha, Madhulika; Krishnakumar, Varadhan


    Biologically inspired experimental process in synthesising nanoparticles is of great interest in present scenario. Biosynthesis of nanoparticles is considered to be one of the best green techniques in synthesising metal nanoparticles. Here, an in situ green biogenic synthesis of gold nanoparticles using aqueous extracts of Terminalia chebula as reducing and stabilizing agent is reported. Gold nanoparticles were confirmed by surface plasmon resonance in the range of 535 nm using UV-visible spectrometry. TEM analysis revealed that the morphology of the particles thus formed contains anisotropic gold nanoparticles with size ranging from 6 to 60 nm. Hydrolysable tannins present in the extract of T. chebula are responsible for reductions and stabilization of gold nanoparticles. Antimicrobial activity of gold nanoparticles showed better activity towards gram positive S. aureus compared to gram negative E. coli using standard well diffusion method.

  15. Biosorption of gold from computer microprocessor leachate solutions using chitin.


    Côrtes, Letícia N; Tanabe, Eduardo H; Bertuol, Daniel A; Dotto, Guilherme L


    The biosorption of gold from discarded computer microprocessor (DCM) leachate solutions was studied using chitin as a biosorbent. The DCM components were leached with thiourea solutions, and two procedures were tested for recovery of gold from the leachates: (1) biosorption and (2) precipitation followed by biosorption. For each procedure, the biosorption was evaluated considering kinetic, equilibrium, and thermodynamic aspects. The general order model was able to represent the kinetic behavior, and the equilibrium was well represented by the BET model. The maximum biosorption capacities were around 35 mg g(-1) for both procedures. The biosorption of gold on chitin was a spontaneous, favorable, and exothermic process. It was found that precipitation followed by biosorption resulted in the best gold recovery, because other species were removed from the leachate solution in the precipitation step. This method enabled about 80% of the gold to be recovered, using 20 g L(-1) of chitin at 298 K for 4 h.

  16. Strong gold atom strands formed by incorporation of carbon atoms

    NASA Astrophysics Data System (ADS)

    Oshima, Yoshifumi; Kurui, Yoshihiko; Nguyen, Huy Duy; Ono, Tomoya; Takayanagi, Kunio


    Single metal atom strands have attracted significant interest because of their unique properties, such as quantization effects and a high degree of strength. Recently it was suggested that the strength of a gold atom strand can be enhanced by the insertion of an impurity atom, but it has not been experimentally investigated. Using a transmission electron microscope under ultrahigh vacuum conditions, we observed that gold atoms were pulled out one by one from a carbon-contaminated gold (111) surface to form a long atom strand. The strand was so strong that it did not break even upon bending. Supported by first-principles calculations, the strand was found to have two carbon atoms at each gold atom interval. Our observations suggest that the carbon atoms act as a glue to form a long gold atom strand.

  17. Functionalized Gold Nanorods for Tumor Imaging and Targeted Therapy

    PubMed Central

    Gui, Chen; Cui, Da-xiang


    Gold nanorods, as an emerging noble metal nanomaterial with unique properties, have become the new exciting focus of theoretical and experimental studies in the past few years. The structure and function of gold nanorods, especially their biocompatibility, optical property, and photothermal effects, have been attracting more and more attention. Gold nanorods exhibit great potential in applications such as tumor molecular imaging and photothermal therapy. In this article, we review some of the main advances made over the past few years in the application of gold nanorods in surface functionalization, molecular imaging, and photothermal therapy. We also explore other prospective applications and discuss the corresponding concepts, issues, approaches, and challenges, with the aim of stimulating broader interest in gold nanorod-based nanotechnology and improving its practical application. PMID:23691482

  18. Reducing wall plasma expansion with gold foam irradiated by laser

    SciTech Connect

    Zhang, Lu; Ding, Yongkun Jiang, Shaoen Yang, Jiamin; Li, Hang; Kuang, Longyu; Lin, Zhiwei; Jing, Longfei; Li, Liling; Deng, Bo; Yuan, Zheng; Chen, Tao; Yuan, Guanghui; Tan, Xiulan; Li, Ping


    The experimental study on the expanding plasma movement of low-density gold foam (∼1% solid density) irradiated by a high power laser is reported in this paper. Experiments were conducted using the SG-III prototype laser. Compared to solid gold with 19.3 g/cc density, the velocities of X-ray emission fronts moving off the wall are much smaller for gold foam with 0.3 g/cc density. Theoretical analysis and MULTI 1D simulation results also show less plasma blow-off, and that the density contour movement velocities of gold foam are smaller than those of solid gold, agreeing with experimental results. These results indicate that foam walls have advantages in symmetry control and lowering plasma fill when used in ignition hohlraum.

  19. Terminalia chebula mediated green and rapid synthesis of gold nanoparticles.


    Kumar, Kesarla Mohan; Mandal, Badal Kumar; Sinha, Madhulika; Krishnakumar, Varadhan


    Biologically inspired experimental process in synthesising nanoparticles is of great interest in present scenario. Biosynthesis of nanoparticles is considered to be one of the best green techniques in synthesising metal nanoparticles. Here, an in situ green biogenic synthesis of gold nanoparticles using aqueous extracts of Terminalia chebula as reducing and stabilizing agent is reported. Gold nanoparticles were confirmed by surface plasmon resonance in the range of 535 nm using UV-visible spectrometry. TEM analysis revealed that the morphology of the particles thus formed contains anisotropic gold nanoparticles with size ranging from 6 to 60 nm. Hydrolysable tannins present in the extract of T. chebula are responsible for reductions and stabilization of gold nanoparticles. Antimicrobial activity of gold nanoparticles showed better activity towards gram positive S. aureus compared to gram negative E. coli using standard well diffusion method.

  20. Monomer adsorption of indocyanine green to gold nanoparticles.


    Guerrini, Luca; Hartsuiker, Liesbeth; Manohar, Srirang; Otto, Cees


    NIR-dye encoded gold nanoparticles (GNP) are rapidly emerging as contrast agents in many bio-imaging/sensing applications. The coding process is usually carried out without control or a clear understanding of the metal-liquid interface properties which, in contrast, are critical in determining the type and extension of dye-metal interaction. In this paper, we investigated the effect of gold surface composition on the adsorption of indocyanine green (ICG) on GNP, simulating the surface conditions of gold nanorods on citrate-capped gold nanospheres. These substrates allowed a careful control of the metal-liquid interface composition and, thus, detailed absorption and fluorescence concentration studies of the effects of each individual chemical in the colloidal solution (i.e. bromide anions, cetyl trimethylammonium ions and Ag(+) ions) on the ICG-gold interaction. This study reveals the drastic effect that these experimental parameters can have on the ICG adsorption on GNP.

  1. Conjugation of gold nanoparticles to polypropylene mesh for enhanced biocompatibility.


    Grant, D N; Benson, J; Cozad, M J; Whelove, O E; Bachman, S L; Ramshaw, B J; Grant, D A; Grant, S A


    Polypropylene mesh materials have been utilized in hernia surgery for over 40 years. However, they are prone to degradation due to the body's aggressive foreign body reaction, which may cause pain or complications, forcing mesh removal from the patient. To mitigate these complications, gold nanomaterials were attached to polypropylene mesh in order to improve cellular response. Pristine samples of polypropylene mesh were exposed to hydrogen peroxide/cobalt chloride solutions to induce formation of surface carboxyl functional groups. Gold nanoparticles were covalently linked to the mesh. Scanning electron microscopy confirmed the presence of gold nanoparticles. Differential scanning calorimetry and mechanical testing confirmed that the polypropylene did not undergo any significantly detrimental changes in physicochemical properties. A WST-1 cell culture study showed an increase in cellularity on the gold nanoparticle-polypropylene mesh as compared to pristine mesh. This study showed that biocompatibility of polypropylene mesh may be improved via the conjugation of gold nanoparticles.

  2. Preparation of gold tetrananocages and their photothermal effect

    NASA Astrophysics Data System (ADS)

    Yin, Nai-Qiang; Liu, Ling; Lei, Jie-Mei; Jiang, Tong-Tong; Zhu, Li-Xin; Xu, Xiao-Liang


    A gold tetrahedral nanocage, i.e., a tetrananocage, that converts near-infrared (NIR) light into heat was fabricated by using a simple method. Silver tetrahedra with good homogeneity and dispersity were synthesized by a hydrothermal route. Gold tetrananocages were obtained using a galvanic replacement reaction between Ag tetrahedra and HAuCl4 solution. The surface plasmon resonance (SPR) of gold tetrananocages was tuned from 412 nm to 850 nm through controlling the volume of HAuCl4 solution added. This Au tetrananocage can effectively convert NIR light into heat when the SPR couples with the exciting light. When cancer cells are cultured with the gold tetrananocages for several hours and irradiated, the gold tetrananocages destroy the cancer cells effectively and demonstrate themselves to be a good candidate for combating cancer.

  3. Enormous enhancement of electric field in active gold nanoshells

    NASA Astrophysics Data System (ADS)

    Jiang, Shu-Min; Wu, Da-Jian; Wu, Xue-Wei; Liu, Xiao-Jun


    The electric field enhancement properties of an active gold nanoshell with gain material inside have been investigated by using Mie theory. As the gain coefficient of the inner core increases to a critical value, a super-resonance appears in the active gold nanoshell, and enormous enhancements of the electric fields can be found near the surface of the particle. With increasing shell thickness, the critical value of the gain coefficient for the super-resonance of the active gold nanoshell first decreases and then increases, and the corresponding surface enhanced Raman scattering (SERS) enhancement factor (G factor) also first increases and then decreases. The optimized active gold nanoshell can be obtained with an extremely high SERS G factor of the order of 1019-1020. Such an optimized active gold nanoshell possesses a high-efficiency SERS effect and may be useful for single-molecule detection.

  4. Concentration of gold in in situ laterites from Mato Grosso

    NASA Astrophysics Data System (ADS)

    Michel, Dominique


    The gold concentration studied is located in lateritic soils overlying Precambrian schists of the Cuiaba Group in Mato Grosso, Brazil. The following five horizons may be recognized from bottom to top: (1) a gray-blue altered schist horizon, (2) a red argillaceous alterite, (3) a horizon characterized by iron oxihydroxide-rich pebbles and quartz fragments in an iron oxihydroxide-rich matrix and clays, (4) an iron crust, and (5) the present soil. The most significant gold content is found in the third horizon just below the iron crust. According to geological study and morphological observations of the gold particles, the gold ore mined today is the result of two combined processes, i.e., the ferrallitic alteration of quartz lodes enclosed in schists and the effect of the red argillaceous alterite which acts as an impervious structure preventing the largest gold grains from migrating downward during their mechanical concentration.

  5. Synthesis and optical properties of colloidal gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Long, Nguyen Ngoc; Van Vu, Le; Kiem, Chu Dinh; Cong Doanh, Sai; Thi Nguyet, Cao; Thi Hang, Pham; Duy Thien, Nguyen; Quynh, Luu Manh


    Colloidal gold nanoparticles (spheres) have been prepared from HAuCl4 containing aqueous solution by using X-ray irradiation and by chemical reduction method. Gold nanorods were synthesized according to the seed-mediated growth method. The colloidal gold nanoparticles were characterized by using transmission electron microscopy, X-ray diffraction, and UV-VIS absorption spectroscopy. It was found that the concentration of the precursors affects the size of the nanoparticles. In the chemical reduction approach the size of nanoparticles can be controlled by varying amount of trisodium citrate, but in the photochemical method the size of nanoparticles can been controlled by varying the ratio of HAuCl4 to TX-100 and X-ray irradiation duration. Gold nanorods have been synthesized according to the seed-mediated growth method with two steps. The effect of silver acetate and CTAB on formation of gold nanorods has been studied.

  6. Gold-Organic Hybrids: On-Surface Synthesis and Perspectives.


    Zhang, Haiming; Chi, Lifeng


    Gold-organic hybrids can be prepared on gold substrates by on-surface dehalogenation of molecular precursors with multiple halogen substituents. Various contact geometries of covalent arylAu bonds are achieved by changing the halogen substituents in the bay or peri regions. Scanning tunneling microscopy/spectroscopy (STM/STS) investigations allow a better understanding of the structure/property relationships in various gold-aryl contacts. Recent progress on the synthesis, large-scale alignment, and STS measurement of gold-organic hybrids is described, ending with an emphasis on potential future applications, e.g., as precursors (intermediates) for the synthesis of graphene nanoribbons (GNRs) on insulating surfaces, and as a model system to investigate the role of covalent arylAu bonds in electron transport through gold-GNR contacts.

  7. Spectroradiometric Determination of the Freezing Temperature of Gold

    PubMed Central

    Mielenz, Klaus D.; Saunders, Robert D.; Shumaker, John B.


    A direct spectroradiometric determination of the temperature of freezing gold was performed by measuring the spectral radiances of a gold blackbody relative to those of a laser-irradiated integrating sphere which was calibrated with absolute silicon detectors and an electrically calibrated radiometer. The measurements were performed at three laser wavelengths near 600 nm, and the temperature of the blackbody was calculated by substituting the measured spectral radiances into Planck’s radiation formula. The result obtained, TAu=(1337.33± 0.34) K, is 0.25 K below the gold-point assignment in the International Practical Temperature Scale of 1968 (IPTS-68) and has been adopted in September 1990 as the new gold-point value in the International Temperature Scale of 1990 (ITS-90). The effect of this change in the gold-point assignment on pyrometric, radiometric, and photometric measurement services provided by the National Institute of Standards and Technology is assessed. PMID:28179757

  8. Two step continuous method to synthesize colloidal spheroid gold nanorods.


    Chandra, S; Doran, J; McCormack, S J


    This research investigated a two-step continuous process to synthesize colloidal suspension of spheroid gold nanorods. In the first step; gold precursor was reduced to seed-like particles in the presence of polyvinylpyrrolidone and ascorbic acid. In continuous second step; silver nitrate and alkaline sodium hydroxide produced various shape and size Au nanoparticles. The shape was manipulated through weight ratio of ascorbic acid to silver nitrate by varying silver nitrate concentration. The specific weight ratio of 1.35-1.75 grew spheroid gold nanorods of aspect ratio ∼1.85 to ∼2.2. Lower weight ratio of 0.5-1.1 formed spherical nanoparticle. The alkaline medium increased the yield of gold nanorods and reduced reaction time at room temperature. The synthesized gold nanorods retained their shape and size in ethanol. The surface plasmon resonance was red shifted by ∼5 nm due to higher refractive index of ethanol than water.

  9. Global demand for gold is another threat for tropical forests

    NASA Astrophysics Data System (ADS)

    Alvarez-Berríos, Nora L.; Aide, T. Mitchell


    The current global gold rush, driven by increasing consumption in developing countries and uncertainty in financial markets, is an increasing threat for tropical ecosystems. Gold mining causes significant alteration to the environment, yet mining is often overlooked in deforestation analyses because it occupies relatively small areas. As a result, we lack a comprehensive assessment of the spatial extent of gold mining impacts on tropical forests. In this study, we provide a regional assessment of gold mining deforestation in the tropical moist forest biome of South America. Specifically, we analyzed the patterns of forest change in gold mining sites between 2001 and 2013, and evaluated the proximity of gold mining deforestation to protected areas (PAs). The forest cover maps were produced using the Land Mapper web application and images from the MODIS satellite MOD13Q1 vegetation indices 250 m product. Annual maps of forest cover were used to model the incremental change in forest in ˜1600 potential gold mining sites between 2001-2006 and 2007-2013. Approximately 1680 km2 of tropical moist forest was lost in these mining sites between 2001 and 2013. Deforestation was significantly higher during the 2007-2013 period, and this was associated with the increase in global demand for gold after the international financial crisis. More than 90% of the deforestation occurred in four major hotspots: Guianan moist forest ecoregion (41%), Southwest Amazon moist forest ecoregion (28%), Tapajós-Xingú moist forest ecoregion (11%), and Magdalena Valley montane forest and Magdalena-Urabá moist forest ecoregions (9%). In addition, some of the more active zones of gold mining deforestation occurred inside or within 10 km of ˜32 PAs. There is an urgent need to understand the ecological and social impacts of gold mining because it is an important cause of deforestation in the most remote forests in South America, and the impacts, particularly in aquatic systems, spread well

  10. Cytogenetic evaluation of gold nanorods using Allium cepa test.


    Rajeshwari, A; Roy, Barsha; Chandrasekaran, Natarajan; Mukherjee, Amitava


    The current study reveals the impact of gold nanorods (NRs) capped with CTAB (cetyltrimethylammonium bromide) or PEG (polyethylene glycol) on Allium cepa. The morphology and surface charge of CTAB- and PEG-capped gold NRs were characterized by electron microscopic and zeta potential analyses. The chromosomal aberrations like clumped chromosome, chromosomal break, chromosomal bridge, diagonal anaphase, disturbed metaphase, laggard chromosome, and sticky chromosome were observed in the root tip cells exposed to different concentrations (0.1, 1, and 10 μg/mL) of CTAB- and PEG-capped gold NRs. We found that both CTAB- and PEG-capped gold NRs were able to induce toxicity in the plant system after 4-h interaction. At a maximum concentration of 10 μg/mL, the mitotic index reduction induced by CTAB-capped gold NRs was 40-fold higher than that induced by PEG-capped gold NRs. The toxicity of gold NRs was further confirmed by lipid peroxidation and oxidative stress analyses. The unbound CTAB also contributed to the toxicity in root tip cells, while PEG alone shows less toxicity to the cells. The vehicle control CTAB contributed to the toxic effects in root tip cells, while PEG alone did not show any toxicity to the cells. The results revealed that even though both the particles have adverse effects on A. cepa, there was a significant difference in the mitotic index and oxidative stress generation in root cells exposed to CTAB-capped gold NRs. Thus, this study concludes that the surface polymerization of gold NRs by PEG can reduce the toxicity of CTAB-capped gold NRs.

  11. Comparative hyperthermia effects of silica–gold nanoshells with different surface coverage of gold clusters on epithelial tumor cells

    PubMed Central

    Park, Sang-Eun; Lee, Jaewon; Lee, Taeksu; Bae, Saet-Byeol; Kang, Byunghoon; Huh, Yong-Min; Lee, Sang-Wha; Haam, Seungjoo


    Silica–gold nanoshell (SGNS), which is a silica core surrounded by a gold layer, was synthesized by seed-mediated coalescence of gold clusters in an electroless plating solution. SGNS variations with different surface coverage of gold clusters were prepared by adjusting the amounts of gold salts in the presence of formaldehyde-reducing agents. Fully covered SGNS (f-SGNS) with connected gold clusters exhibited stronger intensity and more redshift of plasmon bands located around 820 nm than those of partially covered SGNS (p-SGNS) with disconnected gold clusters. Upon irradiation with near-infrared light (30 W/cm2, 700–800 nm), f-SGNS caused a larger hyperthermia effect, generating a large temperature change (ΔT =42°C), as compared to the relatively small temperature change (ΔT =24°C) caused by p-SGNS. The therapeutic antibody, Erbitux™ (ERB), was further conjugated to SGNS for specific tumor cell targeting. The f-ERB-SGNS showed excellent therapeutic efficacy based on the combined effect of both the therapeutic antibody and the full hyperthermia dose under near-infrared irradiation. Thus, SGNS with well-controlled surface morphology of gold shells may be applicable for near-infrared-induced hyperthermia therapy with tunable optical properties. PMID:26425093

  12. Speciation of surface gold in pressure oxidized carbonaceous gold ores by TOF-SIMS and TOF-LIMS

    NASA Astrophysics Data System (ADS)

    Dimov, S. S.; Chryssoulis, S. L.; Sodhi, R. N.


    To the best of our knowledge, this is the first attempt ever to speciate gold preg-robbed by carbonaceous matter using a surface sensitive microbeam technique. This approach enables the direct determination of gold species sorbed on carbonaceous particulates thus providing a new tool in understanding the chemistry of gold sorption on carbon. The reasoning behind this effort was to study the detrimental effect chloride ions have on gold recovery by pressure oxidation of carbonaceous sulfide ores, a technology largely used by the mining industry. The characterization of the sorbed gold species involved three surface sensitive microbeam analytical techniques (TOF-SIMS, TOF-LIMS and XPS) providing confirmatory results for better accuracy. Optimum conditions for detection of gold compounds with minimum fragmentation by TOF-SIMS and TOF-LIMS mass spectrometers have been determined. A reference library of 16 major gold complexes with halogen, thiosulfate, cyanide and thiocyanate groups relevant to the gold recovery processes has been established. The most suitable of the microbeam techniques tested was found to be negative (-ve) ion TOF-LIMS, offering best sensitivity and a small analytical spot size.

  13. Comparative hyperthermia effects of silica-gold nanoshells with different surface coverage of gold clusters on epithelial tumor cells.


    Park, Sang-Eun; Lee, Jaewon; Lee, Taeksu; Bae, Saet-Byeol; Kang, Byunghoon; Huh, Yong-Min; Lee, Sang-Wha; Haam, Seungjoo


    Silica-gold nanoshell (SGNS), which is a silica core surrounded by a gold layer, was synthesized by seed-mediated coalescence of gold clusters in an electroless plating solution. SGNS variations with different surface coverage of gold clusters were prepared by adjusting the amounts of gold salts in the presence of formaldehyde-reducing agents. Fully covered SGNS (f-SGNS) with connected gold clusters exhibited stronger intensity and more redshift of plasmon bands located around 820 nm than those of partially covered SGNS (p-SGNS) with disconnected gold clusters. Upon irradiation with near-infrared light (30 W/cm(2), 700-800 nm), f-SGNS caused a larger hyperthermia effect, generating a large temperature change (ΔT =42°C), as compared to the relatively small temperature change (ΔT =24°C) caused by p-SGNS. The therapeutic antibody, Erbitux™ (ERB), was further conjugated to SGNS for specific tumor cell targeting. The f-ERB-SGNS showed excellent therapeutic efficacy based on the combined effect of both the therapeutic antibody and the full hyperthermia dose under near-infrared irradiation. Thus, SGNS with well-controlled surface morphology of gold shells may be applicable for near-infrared-induced hyperthermia therapy with tunable optical properties.

  14. Enhanced chemiluminescence-based detection on gold substrate after electrografting of diazonium precursor-coated gold nanoparticles.


    Houmed Adabo, Ali; Zeggari, Rabah; Mohamed Saïd, Nasser; Bazzi, Rana; Elie-Caille, Céline; Marquette, Christophe; Martini, Matteo; Tillement, Olivier; Perriat, Pascal; Chaix, Carole; Boireau, Wilfrid; Roux, Stéphane


    Since it was demonstrated that nanostructured surfaces are more efficient for the detection based on the specific capture of analytes, there is a real need to develop strategies for grafting nanoparticles onto flat surfaces. Among the different routes for the functionalization of a surface, the reduction of diazonium salts appears very attractive for the covalent immobilization of nanoparticles because this method does not require a pre-treatment of the surface. For achieving this goal, gold nanoparticles coated by precursor of diazonium salts were synthesized by reduction of gold salt in presence of mercaptoaniline. These mercaptoaniline-coated gold nanoparticles (Au@MA) were successfully immobilized onto various conducting substrates (indium tin oxide (ITO), glassy carbon (GC) and gold electrodes with flat terraces) after addition of sodium nitrite at fixed potential. When applied onto the gold electrodes, such a grafting strategy led to an obvious enhancement of the luminescence of luminol used for the biodetection.

  15. Multifunctional gold nanoparticles for photodynamic therapy of cancer

    NASA Astrophysics Data System (ADS)

    Khaing Oo, Maung Kyaw

    As an important and growing branch of photomedicine, photodynamic therapy (PDT) is being increasingly employed in clinical applications particularly for the treatment of skin cancer. This dissertation focuses on the synthesis, characterization and deployment of gold nanoparticles for enhanced PDT of fibrosarcoma cancer cells. We have developed robust strategies and methods in fabrication of gold nanoparticles with positively- and negatively-tethered surface charges by photo-reduction of gold chloride salt using branched polyethyleneimine and sodium citrate respectively. An optimal concentration window of gold salt has been established to yield the most stable and monodispersed gold nanoparticles. 5-aminolevulinic acid (5-ALA), a photosensitizing precursor, has been successfully conjugated on to positively charged gold nanoparticles through electrostatic interactions. The 5-ALA/gold nanoparticle conjugates are biocompatible and have shown to be preferably taken up by cancer cells. Subsequent light irradiation results in the generation of reactive oxygen species (ROS) in cancer cells, leading to their destruction without adverse effects on normal fibroblasts. We have demonstrated for the first time that gold nanoparticles can enhance PDT efficacy by 50% compared to the treatment with 5-ALA alone. Collected evidence has strongly suggested that this enhancement stems from the elevated formation of ROS via the strongly localized electric field of gold nanoparticles. Through single cell imaging using surface-enhanced Raman scattering enabled by the very same gold nanoparticles, we have shown that multifunctionality of gold nanoparticles can be harvested concurrently for biomedical applications in general and for PDT in specific. In other words, gold nanoparticles can be used not only for targeted drug delivery and field-enhanced ROS formation, but also for monitoring cell destructions during PDT. Finally, our COMSOL Multiphysics simulation of the size-dependent electric

  16. Ionic transport properties of template-synthesized gold nanotube membranes

    NASA Astrophysics Data System (ADS)

    Gao, Peng

    Ionic transport in nanotubes exhibits unique properties due to the strong interactions between ions and the nanotube surface. The main objective of my research is to explore and regulate the ionic transport in gold nanotube membranes. Chapter 1 overviews a versatile method of fabricating nanostructured materials, called the template synthesis. Important parameters of the template synthesis are introduced such as templates and deposition methods. The template synthesis method is used to prepare membranes used in this dissertation. Chapter 2 describes a method to increase the ionic conductivity in membranes containing gold nanotubes with small diameter (4 nm). The gold nanotube membrane is prepared by the electroless plating of gold in a commercially available polycarbonate membrane. Voltages are applied to the gold nanotube membrane and fixed charges are injected on the gold nanotube walls. We show that ionic conductivity of the gold nanotube membrane can be enhanced in aqueous potassium chloride (KCl) solution at negative applied voltages. When the most negative voltage (-0.8 V vs. Ag/AgCl) is applied to the membrane, the ionic conductivity of the solution inside the gold nanotube (94 is comparable to that of 1 M aqueous KCl, over two orders of magnitude higher than that of the 0.01 M KCl contacting the membrane. Chapter 3 explores another important transport property of the gold nanotube membrane -- ion permselectivity. When the permselective membrane separates two electrolyte solutions at different concentrations, a membrane potential is developed and measured by the potentiometric method. Surface charge density and the ion mobilities are estimated by fitting the experimental data with a pre-existing model. The surface charge density of the gold nanotube membrane in this research is estimated to be 2 muC/cm2. Chapter 4 describes voltage-controlled ionic transport in a gold/polypyrrole membrane doped with sodium dodecylbenzene sulfonate (DBS). Polypyrrole

  17. Ultraclean derivatized monodisperse gold nanoparticles through laser drop ablation customization of polymorph gold nanostructures.


    Bueno-Alejo, Carlos J; D'Alfonso, Claudio; Pacioni, Natalia L; González-Béjar, María; Grenier, Michel; Lanzalunga, Osvaldo; Alarcon, Emilio Isaac; Scaiano, Juan C


    We report a novel nanosecond laser ablation synthesis for spherical gold nanoparticles as small as 4 nm in only 5 s (532 nm, 0.66 J/cm(2)), where the desired protecting agent can be selected in a protocol that avoids repeated sample irradiation and undesired exposure of the capping agent during ablation. This method takes advantage of the recently developed synthesis of clean unprotected polymorph and polydisperse gold nanostructures using H(2)O(2) as a reducing agent. The laser drop technique provides a unique tool for delivering controlled laser doses to small drops that undergo assisted fall into a solution or suspension of the desired capping agent, yielding monodisperse custom-derivatized composite materials using a simple technique.

  18. Chemiluminescent Reactions Catalyzed by Nanoparticles of Gold, Silver, and Gold/Silver Alloys

    NASA Astrophysics Data System (ADS)

    Abideen, Saqib Ul

    Chemiluminescence (CL) reactions are catalyzed by metals nanoparticles, which display unique catalytic properties due to an increased surface area. The present study describes the catalytic effects of nanoparticles (NP) of silver, gold, and alloys of Au/Ag nanoparticles on the chemiluminescent reaction taking place between luminol and potassium ferricyanide. It was found that silver nanoparticles and alloy nanoparticles enhance the CL process when their sizes remained in the range of 30 nm to 50 nm. The data show that the intensity and rate of chemiluminescence were influenced by the mole fraction of gold and silver in the alloy. Data to this chemiluminescence reaction are modeled by a double exponential curve, which indicates that two competing processes are occurring.

  19. Density functional study of hydrogen binding on gold and silver-gold clusters.


    Zhao, Shuang; Ren, YunLi; Ren, YunLai; Wang, JianJi; Yin, WeiPing


    A theoretical study was carried out on the binding of hydrogen on small bimetallic Ag(m)Au(n) (m + n < or = 5) and pure Au(n) (n < or = 5) clusters with neutral, negative, and positive charge state. It is found that the composition and charge state of clusters have strong influence on the most favorable binding site. The adiabatic ionization potentials, electron affinities, and hydrogen binding energies of cluster hydrides increase with the Au content increasing for the given cluster size. The cationic silver-gold cluster hydrides prefer ejection of Au-containing products whereas the anionic silver-gold cluster hydrides prefer ejection of Ag-containing products. The magnitude of metal-H frequency in combination with the metal-H bond length indicates that, with the same type of the binding site, the Au-H interaction is stronger than the Ag-H interaction.

  20. Ellipsometry study on gold-nanoparticle-coated gold thin film for biosensing application

    PubMed Central

    Moirangthem, Rakesh Singh; Chang, Yia-Chung; Wei, Pei-Kuen


    The amplified plasmonic response from various distributions of gold nanoparticles (AuNPs) coated on top of gold thin film was studied via ellipsometry under total internal reflection mode. The surface plasmon resonance dip can be tuned from the visible to near infrared by simply varying the AuNP concentration. Theoretical modeling based on effective medium theory with a multi-slice model has been employed to fit the experimental results. Additionally, this experimental tool has been further extended to study bio-molecular interactions with metal surfaces as well as in studying protein-protein interaction without any labeling. Hence, this technique could provide a non-destructive way of designing tunable label-free optical biosensors with very high sensitivity. PMID:21991549

  1. Spot-free catalysis using gold carbon nanotube & gold graphene composites for hydrogen evolution reaction

    NASA Astrophysics Data System (ADS)

    Sai Siddhardha, R. S.; Lakshminarayanan, V.; Ramamurthy, Sai Sathish


    Hydrogen has been proposed as the green fuel of the future in the wake of depleting fossil fuels. Recently, carbon paste electrodes (CPE) modified with nanomaterials as electrocatalysts have drawn wide attention for hydrogen evolution reaction (HER) in acid medium. The CPEs are advantageous owing to their chemical stability and ease of fabrication. Their applications for HER without any modification, however, are hampered on account of large hydrogen overpotential associated with carbon surface. In the present study, CPE has been modified with novel gold composites as electro-catalysts for HER in acid medium. The nanocomposites have shown ∼100 fold increased current density than unmodified CPE at -0.3 V. Most strikingly for the first time, this study has quantitatively brought out the difference in catalysis between surfactant capped and pristine gold nanoparticles in terms of their application as spot-free catalysts towards hydrogen gas production by electrochemical route.

  2. Geology and mineralization at the Ishmas Kabir gold prospect, Ishmas gold district, Kingdom of Saudi Arabia

    USGS Publications Warehouse

    Walker, B.M.; Ben Talib, Majed; El Komi, Mohamed; Hussain, M.A.; Christian, R.P.


    Quartz veins intersected by drill holes are surrounded by mylonite schist. Quartz and carbonate veins less than 5 mm thick are boudined, whereas thick quartz veins (£ 1.2 m) have disrupted and brecciated margins; mylonitized country rock envelops quartz-vein fragments. Sulfide mineralization associated with vein formation predates this rock-deformation event. Contemporaneous brittle and ductile deformation of quartz veins and country rocks occurred during the Nabitah orogeny. Supergene gold enrichment took place much later.

  3. Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

    PubMed Central

    Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein


    Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at −1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol−1, a linear concentration range of 10 zmol dm−3 to 10 pmol dm−3, and a detection limit of 1.71 zmol dm−3. PMID:26657828

  4. From gold nanoparticles to luminescent nano-objects: experimental aspects for better gold-chromophore interactions

    NASA Astrophysics Data System (ADS)

    Navarro, Julien R. G.; Lerouge, Frederic


    Gold nanoparticles have been the center of interest for scientists since many decades. Within the last 20 years, the research in that field has soared with the possibility to design and study nanoparticles with controlled shapes. From spheres to more complex shapes such as stars, or anisotropic architectures like rods or bipyramids, these new systems feature plasmonic properties making them the tools of choice for studies on light-matter interactions. In that context, fluorescence quenching and enhancement by gold nanostructures is a growing field of research. In this review, we report a non-exhaustive summary of the synthetic modes for various shapes and sizes of isotropic and anisotropic nanoparticles. We then focus on fluorescent studies of these gold nano-objects, either considering "bare" particles (without modifications) or hybrid particles (surface interaction with a chromophore). In the latter case, the well-known metal-enhanced fluorescence (MEF) is more particularly developed; the mechanisms of MEF are discussed in terms of the additional radiative and non-radiative decay rates caused by several parameters such as the vicinity of the chromophore to the metal or the size and shape of the nanostructures.

  5. From gold nanoparticles to luminescent nano-objects: experimental aspects for better gold-chromophore interactions

    NASA Astrophysics Data System (ADS)

    Navarro, Julien R. G.; Lerouge, Frederic


    Gold nanoparticles have been the center of interest for scientists since many decades. Within the last 20 years, the research in that field has soared with the possibility to design and study nanoparticles with controlled shapes. From spheres to more complex shapes such as stars, or anisotropic architectures like rods or bipyramids, these new systems feature plasmonic properties making them the tools of choice for studies on light-matter interactions. In that context, fluorescence quenching and enhancement by gold nanostructures is a growing field of research. In this review, we report a non-exhaustive summary of the synthetic modes for various shapes and sizes of isotropic and anisotropic nanoparticles. We then focus on fluorescent studies of these gold nano-objects, either considering "bare" particles (without modifications) or hybrid particles (surface interaction with a chromophore). In the latter case, the well-known metal-enhanced fluorescence (MEF) is more particularly developed; the mechanisms of MEF are discussed in terms of the additional radiative and non-radiative decay rates caused by several parameters such as the vicinity of the chromophore to the metal or the size and shape of the nanostructures.

  6. Undersea safety mining of the large gold deposit in Xinli District of Sanshandao Gold Mine

    NASA Astrophysics Data System (ADS)

    Liu, Zhi-xiang; Dang, Wen-gang; He, Xian-qun


    The exploration of undersea resources becomes popular as land resources decrease. Researches were conducted with emphasis on the safety and efficiency of undersea mining of the large gold deposit in Xinli District of Sanshandao Gold Mine. A series of tests for the physical and mechanical characteristics of rock mass were carried out, and the three-dimensional geo-stress distribution was tested in the mining area. Further, a similar experimental simulation platform, which revealed the mechanism of water inrush and ascertained the reasonable thickness of the safety isolate layer, was established for the undersea mining. Meanwhile, the feasibility of cancelling the ore pillars and the safety conditions was checked by numerical simulation. The simulation results show that it is safe to exploit the ore body below the -85 m level (presently, the exploitation level is below -160 m in Xinli District), and the ore pillars can be cancelled below the -560 m level. Furthermore, a novel backfill method was designed to reduce the rock strata disturbance and settlement, and the settlement of roof strata was monitored during the mining process. Engineering practice shows that the settlement of roof strata was small and that no disaster happened. This indicates that the undersea safety mining technology of the large gold deposit is achieved in Xinli District.

  7. The nature and role of the gold-krypton interactions in small neutral gold clusters.


    Mancera, Luis A; Benoit, David M


    We investigate the nature and role of krypton embedding in small neutral gold clusters. For some of these clusters, we observe a particular site-dependent character of the Kr binding that does not completely follow the criterion of binding at low-coordinated sites, widely accepted for interaction of a noble gas with closed-shell metal systems such as metal surfaces. We aim at understanding the effect of low dimensionality and open-shell electronic structure of the odd-numbered clusters on the noble gas-metal cluster interaction. First, we investigate the role of attractive and repulsive forces, and the frontier molecular orbitals. Second, we investigate the Au-Kr interaction in terms of reactivity and bonding character. We use a reactivity index derived from Fukui formalism, and criteria provided by the electron localization function (ELF), in order to classify the type of bonding. We carry out this study on the minimum energy structures of neutral gold clusters, as obtained using pseudo potential plane-wave density functional theory (DFT). A model is proposed that includes the effect of attractive electrostatic, van der Waals and repulsive forces, together with effects originating from orbital overlap. This satisfactorily explains minimum configurations of the noble gas-gold cluster systems, the site preference of the noble gas atoms, and changes in electronic properties.

  8. Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

    NASA Astrophysics Data System (ADS)

    Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein


    Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.

  9. The gold content of volcanogenic massive sulfide deposits

    NASA Astrophysics Data System (ADS)

    Mercier-Langevin, Patrick; Hannington, Mark D.; Dubé, Benoît; Bécu, Valérie


    Volcanogenic massive sulfide deposits contain variable amounts of gold, both in terms of average grade and total gold content, with some VMS deposits hosting world-class gold mines with more than 100 t Au. Previous studies have identified gold-rich VMS as having an average gold grade, expressed in g/t, exceeding the total abundance of base metals, expressed in wt.%. However, statistically meaningful criteria for the identification of truly anomalous deposits have not been established. This paper presents a more extensive analysis of gold grades and tonnages of 513 VMS deposits worldwide, revealing a number of important features in the distribution of the data. A large proportion of deposits are characterized by a relatively low gold grade (<2 g/t), with a gradual decrease in frequency towards maximum gold grades, defining a log-normal distribution. In the analysis presented in this paper, the geometric mean and geometric standard deviation appear to be the simplest metric for identifying subclasses of VMS deposits based on gold grade, especially when comparing deposits within individual belts and districts. The geometric mean gold grade of 513 VMS deposits worldwide is 0.76 g/t; the geometric standard deviation is +2.70 g/t Au. In this analysis, deposits with more than 3.46 g/t Au (geometric mean plus one geometric standard deviation) are considered auriferous. The geometric mean gold content is 4.7 t Au, with a geometric standard deviation of +26.3 t Au. Deposits containing 31 t Au or more (geometric mean plus one geometric standard deviation) are also considered to be anomalous in terms of gold content, irrespective of the gold grade. Deposits with more than 3.46 g/t Au and 31 t Au are considered gold-rich VMS. A large proportion of the total gold hosted in VMS worldwide is found in a relatively small number of such deposits. The identification of these truly anomalous systems helps shed light on the geological parameters that control unusual enrichment of gold


    SciTech Connect



    Although intensely colored, even the largest colloidal gold particles are not, on their own, sufficiently colored for routine use as a light microscopy stain: only with very abundant antigens or with specialized illumination methods can bound gold be seen. Colloidal gold probes were developed primarily as markers for electron microscopy, for which their very high electron density and selectivity for narrow size distributions when prepared in different ways rendered them highly suited. The widespread use of gold labeling for light microscopy was made possible by the introduction of autometallographic enhancement methods. In these processes, the bound gold particles are exposed to a solution containing metal ions and a reducing agent; they catalyze the reduction of the ions, resulting in the deposition of additional metal selectively onto the particles. On the molecular level, the gold particles are enlarged up to 30-100 nm in diameter; on the macroscale level, this results in the formation of a dark stain in regions containing bound gold particles, greatly increasing visibility and contrast. The applications of colloidal gold have been described elsewhere in this chapter, we will focus on the use of covalently linked cluster complexes of gold and other metals. A gold cluster complex is a discrete molecular coordination compound comprising a central core, or ''cluster'' of electron-dense metal atoms, ligated by a shell of small organic molecules (ligands), which are linked to the metal atoms on the surface of the core. This structure gives clusters several important advantages as labels. The capping of the metal surface by ligands prevents non-specific binding to cell and tissue components, which can occur with colloidal gold. Cluster compounds are more stable and may be used under a wider range of conditions. Unlike colloidal gold, clusters do not require additional macromolecules such as bovine serum albumin or polyethylene glycol for stabilization, and the total

  11. Thermodynamics of DNA hybridization on gold nanoparticles.


    Xu, Jun; Craig, Stephen L


    Dynamic light scattering is used as a sensitive probe of hybridization on DNA-functionalized colloidal gold nanoparticles. When a target DNA strand possesses an 8 base "dangling end", duplex formation on the surface of the nanoparticles leads to an increase in hydrodynamic radius. Duplex melting is manifested in a drop in hydrodynamic radius with increasing temperature, and the concentration dependence of the melting temperature provides a measure of the thermodynamics of binding. The hybridization thermodynamics are found to be significantly lower at higher hybridization densities than those previously reported for initial hybridization events. The pronounced deviation from Langmuir adsorption behavior is greater for longer duplexes, and it is, therefore, consistent with electrostatic repulsion between densely packed oligonucleotides. The results have implications for sensing and DNA-directed nanoparticle assembly.

  12. Gold Nanoshell-Mediated Remote Myotube Activation.


    Marino, Attilio; Arai, Satoshi; Hou, Yanyan; Degl'Innocenti, Andrea; Cappello, Valentina; Mazzolai, Barbara; Chang, Young-Tae; Mattoli, Virgilio; Suzuki, Madoka; Ciofani, Gianni


    Mild heat stimulation of muscle cells within the physiological range represents an intriguing approach for the modulation of their functions. In this work, photothermal conversion was exploited to remotely stimulate striated muscle cells by using gold nanoshells (NSs) in combination with near-infrared (NIR) radiation. Temperature increments of approximately 5 °C were recorded by using an intracellular fluorescent molecular thermometer and were demonstrated to efficiently induce myotube contraction. The mechanism at the base of this phenomenon was thoroughly investigated and was observed to be a Ca(2+)-independent event directly involving actin-myosin interactions. Finally, chronic remote photothermal stimulations significantly increased the mRNA transcription of genes encoding heat shock proteins and sirtuin 1, a protein which in turn can induce mitochondrial biogenesis. Overall, we provide evidence that remote NIR + NS muscle excitation represents an effective wireless stimulation technique with great potential in the fields of muscle tissue engineering, regenerative medicine, and bionics.

  13. 1 mil gold bond wire study.

    SciTech Connect

    Huff, Johnathon; McLean, Michael B.; Jenkins, Mark W.; Rutherford, Brian Milne


    In microcircuit fabrication, the diameter and length of a bond wire have been shown to both affect the current versus fusing time ratio of a bond wire as well as the gap length of the fused wire. This study investigated the impact of current level on the time-to-open and gap length of 1 mil by 60 mil gold bond wires. During the experiments, constant current was provided for a control set of bond wires for 250ms, 410ms and until the wire fused; non-destructively pull-tested wires for 250ms; and notched wires. The key findings were that as the current increases, the gap length increases and 73% of the bond wires will fuse at 1.8A, and 100% of the wires fuse at 1.9A within 60ms. Due to the limited scope of experiments and limited data analyzed, further investigation is encouraged to confirm these observations.

  14. Highly stretchable wrinkled gold thin film wires

    PubMed Central

    Kim, Joshua; Park, Sun-Jun; Nguyen, Thao; Chu, Michael; Pegan, Jonathan D.; Khine, Michelle


    With the growing prominence of wearable electronic technology, there is a need to improve the mechanical reliability of electronics for more demanding applications. Conductive wires represent a vital component present in all electronics. Unlike traditional planar and rigid electronics, these new wearable electrical components must conform to curvilinear surfaces, stretch with the body, and remain unobtrusive and low profile. In this paper, the piezoresistive response of shrink induced wrinkled gold thin films under strain demonstrates robust conductive performance in excess of 200% strain. Importantly, the wrinkled metallic thin films displayed negligible change in resistance of up to 100% strain. The wrinkled metallic wires exhibited consistent performance after repetitive strain. Importantly, these wrinkled thin films are inexpensive to fabricate and are compatible with roll to roll manufacturing processes. We propose that these wrinkled metal thin film wires are an attractive alternative to conventional wires for wearable applications. PMID:26937042

  15. Organocatalysis--after the gold rush.


    Bertelsen, Søren; Jørgensen, Karl Anker


    The use of secondary amines as asymmetric catalysts in transformations of carbonyl compounds has seen tremendous development in recent years. Going from sporadic reports of selected reactions, aminocatalysis can now be considered as one of the methods of choice for many asymmetric functionalizations of carbonyl compounds--primarily of aldehydes and ketones. These functionalizations have been published at a breathtaking pace over the last few years--during the "golden age" and "gold rush" of organocatalysis. This tutorial review will firstly sketch the basic developments in organocatalysis, focussing especially on the use of secondary amines as catalysts for the functionalization of aldehydes and alpha,beta-unsaturated aldehydes, with emphasis on the mechanisms of the transformations and, secondly, outline recent trends within central areas of this research topic. Lastly, we will present our guesses as to where new developments might take organocatalysis in the years to come.

  16. Surface chemistry driven actuation in nanoporous gold

    SciTech Connect

    Biener, J; Wittstock, A; Zepeda-Ruiz, L; Biener, M M; Zielasek, V; Kramer, D; Viswanath, R N; Weissmuller, J; Baumer, M; Hamza, A V


    Although actuation in biological systems is exclusively powered by chemical energy, this concept has not been realized in man-made actuator technologies, as these rely on generating heat or electricity first. Here, we demonstrate that surface-chemistry driven actuation can be realized in high surface area materials such as nanoporous gold. For example, we achieve reversible strain amplitudes in the order of a few tenths of a percent by alternating exposure of nanoporous Au to ozone and carbon monoxide. The effect can be explained by adsorbate-induced changes of the surface stress, and can be used to convert chemical energy directly into a mechanical response thus opening the door to surface-chemistry driven actuator and sensor technologies.

  17. Green Chemistry Techniques for Gold Nanoparticles Synthesis

    NASA Astrophysics Data System (ADS)

    Cannavino, Sarah A.; King, Christy A.; Ferrara, Davon W.

    Gold nanoparticles (AuNPs) are often utilized in many technological and research applications ranging from the detection of tumors, molecular and biological sensors, and as nanoantennas to probe physical processes. As these applications move from the research laboratory to industrial settings, there is a need to develop efficient and sustainable synthesis techniques. Recent research has shown that several food products and beverages containing polyphenols, a common antioxidant, can be used as reducing agents in the synthesis of AuNPs in solution. In this study, we explore a variety of products to determine which allow for the most reproducible solution of nanoparticles based on the size and shapes of particles present. We analyzed the AuNPs solutions using extinction spectroscopy and atomic force microscopy. We also develop a laboratory activity to introduce introductory chemistry and physics students to AuNP synthesis techniques and analysis.

  18. Detection of Quadruplex DNA by Gold Nanoparticles

    PubMed Central

    Crouse, Heather F.; Doudt, Alex; Zerbe, Cassie; Basu, Swarna


    Gold nanoparticles have been used as a probe to detect low (<10 ppb) concentrations of quadruplex DNA. These nanoparticles display a tendency to form aggregates in the presence of certain quadruplex forms, as observed via enhanced plasmon resonance light scattering (PRLS) signals. These nanoparticles showed differing degrees of interactions with different types of quadruplex and mixed sequences but no interaction with duplex DNA. Enhancement of PRLS signals greater than 50% was observed at nanomolar DNA concentration, and a lower limit of detection of 2.1 nM was established for three different quadruplex DNA sequences, including the thrombin-inhibiting single-stranded 15 mer aptamer DNA, d(GGTTGGTGTGGTTGG), and the double-stranded 12 mer DNA, d(G4T4G4). Two different sample preparation protocols were used for the PRLS experiments, and they yielded similar results. PMID:22567555

  19. Deposition of plasmon gold-fluoropolymer nanocomposites

    NASA Astrophysics Data System (ADS)

    Safonov, Alexey I.; Sulyaeva, Veronica S.; Timoshenko, Nikolay I.; Kubrak, Konstantin V.; Starinskiy, Sergey V.


    Degradation-resistant two-dimensional metal-fluoropolymer composites consisting of gold nanoparticles coated with a thin fluoropolymer film were deposited on a substrate by hot wire chemical vapour deposition (HWCVD) and ion sputtering. The morphology and optical properties of the obtained coatings were determined. The thickness of the thin fluoropolymer film was found to influence the position of the surface plasmon resonance peak. Numerical calculations of the optical properties of the deposited materials were performed using Mie theory and the finite-difference time-domain (FDTD) method. The calculation results are consistent with the experimental data. The study shows that the position of the resonance peak can be controlled by changing the surface concentration of particles and the thickness of the fluoropolymer coating. The protective coating was found to prevent the plasmonic properties of the nanoparticles from changing for several months.

  20. Optimized gold nanoshell ensembles for biomedical applications

    PubMed Central


    We theoretically study the properties of the optimal size distribution in the ensemble of hollow gold nanoshells (HGNs) that exhibits the best performance at in vivo biomedical applications. For the first time, to the best of our knowledge, we analyze the dependence of the optimal geometric means of the nanoshells’ thicknesses and core radii on the excitation wavelength and the type of human tissue, while assuming lognormal fit to the size distribution in a real HGN ensemble. Regardless of the tissue type, short-wavelength, near-infrared lasers are found to be the most effective in both absorption- and scattering-based applications. We derive approximate analytical expressions enabling one to readily estimate the parameters of optimal distribution for which an HGN ensemble exhibits the maximum efficiency of absorption or scattering inside a human tissue irradiated by a near-infrared laser. PMID:23537206

  1. Optimized gold nanoshell ensembles for biomedical applications.


    Sikdar, Debabrata; Rukhlenko, Ivan D; Cheng, Wenlong; Premaratne, Malin


    : We theoretically study the properties of the optimal size distribution in the ensemble of hollow gold nanoshells (HGNs) that exhibits the best performance at in vivo biomedical applications. For the first time, to the best of our knowledge, we analyze the dependence of the optimal geometric means of the nanoshells' thicknesses and core radii on the excitation wavelength and the type of human tissue, while assuming lognormal fit to the size distribution in a real HGN ensemble. Regardless of the tissue type, short-wavelength, near-infrared lasers are found to be the most effective in both absorption- and scattering-based applications. We derive approximate analytical expressions enabling one to readily estimate the parameters of optimal distribution for which an HGN ensemble exhibits the maximum efficiency of absorption or scattering inside a human tissue irradiated by a near-infrared laser.

  2. Gold Nanowires and Their Chemical Modifications

    NASA Astrophysics Data System (ADS)

    Häkkinen, Hannu; Barnett, Robert N.; Landman, Uzi


    Atomic structure, electronic structure, and ballistic transport in thin gold nanowires at their final stages before break-up, recently imaged by high-resolution electron microscopy,(H. Ohnishi et al., Nature 395), 780 (1998) are investigated with density functional simulations.(H. Häkkinen et al., J. Phys. Chem. B 103), 8814 (1999) We discuss stretching mechanisms leading to elongated chain-like structures showing dimerization akin to a Peierls transition and retaining conductance close to unity for stretching lengths that exceed considerably a typical interatomic bond length. We also demonstrate a chemical modification of the wire via adsorption of a methyl thiol molecule and discuss its effects on the structure and conductance.

  3. Optical Plasmons of Individual Gold Nanosponges

    PubMed Central


    The search for novel plasmonic nanostructures, which can act simultaneously as optical detectors and stimulators, is crucial for many applications in the fields of biosensing, electro- and photocatalysis, electrochemistry, and biofuel generation. In most of these areas, a large surface-to-volume ratio, as well as high density of active surface sites, is desirable. We investigate sponge-like, that is, fully porous, nanoparticles, called nanosponges, where both the gold and the air phase are fully percolated in three dimensions. We correlate, on a single nanoparticle basis, their optical scattering spectra (using dark field microscopy) with their individual morphology (using electron microscopy). We find that the scattering spectra of nanosponges depend only weakly on their size and outer shape, but are greatly influenced by their unique percolation, in qualitative agreement with numerical simulations. PMID:26523285

  4. Tabular equation of state for gold

    NASA Astrophysics Data System (ADS)

    Boettger, Jonathan; Honnell, Kevin G.; Peterson, Jeffrey H.; Greeff, Carl; Crockett, Scott


    A new, SESAME-type equation of state (EOS) , suitable for use in hydrodynamic calculations, is described for gold. Pressures, internal energies, and Helmholtz free energies are tabulated on a rectangular temperature-and-density grid, spanning densities from 0 - 36 g/cc, temperatures from 0 - 800 eV, and extending up to pressures of 800 GPa. The EOS is constructed using the standard decomposition of the pressure into a static-lattice cold curve, a thermal nuclear contribution, and a thermal electronic contribution. The cold curve is derived from existing diamond-anvil-cell measurements, the thermal nuclear contribution from the Johnson model, and the thermal electronic contribution using Thomas-Fermi-Dirac theory. Predictions of the new EOS (SESAME 2705) for the cold curve, roomtemperature isotherm, principal Hugoniot, thermal expansion, heat capacity, melt line, and vapor pressure compare favorably with experimental data and are superior to the EOS currently available in the SESAME library (SESAME 2700).

  5. Tabular Equation of State for Gold

    NASA Astrophysics Data System (ADS)

    Boettger, Jonathan; Honnell, Kevin; Peterson, Jeffrey; Greeff, Carl; Crockett, Scott


    A new, SESAME-type equation of state (EOS) is described for gold, suitable for use in hydrodynamic calculations. The EOS is tabulated on a rectangular temperature-and-density grid, spanning densities from 0 - 29 g/cc, temperatures from 0 - 85,000 K, and extending up to pressures of 1000 GPa. It is constructed using the standard decomposition of the pressure into a static-lattice cold curve, a thermal nuclear contribution, and a thermal electronic contribution. The cold curve is derived from a combination of empirical data and density functional theory, the thermal nuclear contribution from the Johnson model, and the thermal electronic contribution using Thomas-Fermi-Dirac theory. Pressures, internal energies, and Helmholtz free energies are tabulated as functions of temperature and density. Predictions for the room-temperature isotherm, principal Hugoniot, thermal expansion, heat capacity, and vapor pressure are compared with experimental data and with the EOS currently available in the SESAME library (SESAME 2700).

  6. Gold nanorod vaccine for respiratory syncytial virus

    NASA Astrophysics Data System (ADS)

    Stone, John W.; Thornburg, Natalie J.; Blum, David L.; Kuhn, Sam J.; Wright, David W.; Crowe, James E., Jr.


    Respiratory syncytial virus (RSV) is a major cause of pneumonia and wheezing in infants and the elderly, but to date there is no licensed vaccine. We developed a gold nanorod construct that displayed the major protective antigen of the virus, the fusion protein (F). Nanorods conjugated to RSV F were formulated as a candidate vaccine preparation by covalent attachment of viral protein using a layer-by-layer approach. In vitro studies using ELISA, electron microscopy and circular dichroism revealed that conformation-dependent epitopes were maintained during conjugation, and transmission electron microscopy studies showed that a dispersed population of particles could be achieved. Human dendritic cells treated with the vaccine induced immune responses in primary human T cells. These results suggest that this vaccine approach may be a potent method for immunizing against viruses such as RSV with surface glycoproteins that are targets for the human immune response.

  7. Highly stretchable wrinkled gold thin film wires

    SciTech Connect

    Kim, Joshua Park, Sun-Jun; Nguyen, Thao; Chu, Michael; Pegan, Jonathan D.; Khine, Michelle


    With the growing prominence of wearable electronic technology, there is a need to improve the mechanical reliability of electronics for more demanding applications. Conductive wires represent a vital component present in all electronics. Unlike traditional planar and rigid electronics, these new wearable electrical components must conform to curvilinear surfaces, stretch with the body, and remain unobtrusive and low profile. In this paper, the piezoresistive response of shrink induced wrinkled gold thin films under strain demonstrates robust conductive performance in excess of 200% strain. Importantly, the wrinkled metallic thin films displayed negligible change in resistance of up to 100% strain. The wrinkled metallic wires exhibited consistent performance after repetitive strain. Importantly, these wrinkled thin films are inexpensive to fabricate and are compatible with roll to roll manufacturing processes. We propose that these wrinkled metal thin film wires are an attractive alternative to conventional wires for wearable applications.

  8. 'Pot of Gold' and 'Rotten Rocks'

    NASA Technical Reports Server (NTRS)


    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

    To the right is a set of rocks referred to as 'Rotten Rocks' for their resemblance to rotting loaves of bread. The insides of these rocks appear to have been eroded, while their outer rinds remain more intact. These outer rinds are reminiscent of those found on rocks at Meridiani Planum's 'Eagle Crater.' This image was captured on sol 158 (June 13, 2004).

  9. Melting a Gold Sample within TEMPUS

    NASA Technical Reports Server (NTRS)


    A gold sample is heated by the TEMPUS electromagnetic levitation furnace on STS-94, 1997, MET:10/09:20 (approximate). The sequence shows the sample being positioned electromagnetically and starting to be heated to melting. TEMPUS (stands for Tiegelfreies Elektromagnetisches Prozessiere unter Schwerelosigkeit (containerless electromagnetic processing under weightlessness). It was developed by the German Space Agency (DARA) for flight aboard Spacelab. The DARA project scientist was Igon Egry. The experiment was part of the space research investigations conducted during the Microgravity Science Laboratory-1R mission (STS-94, July 1-17 1997). DARA and NASA are exploring the possibility of flying an advanced version of TEMPUS on the International Space Station. (378KB JPEG, 2380 x 2676 pixels; downlinked video, higher quality not available) The MPG from which this composite was made is available at

  10. Formyloxyl radical-gold nanoparticle binding: a theoretical study.


    Hull, Jacob M; Provorse, Makenzie R; Aikens, Christine M


    The citrate reduction method is one of the simplest and most common methods used in the synthesis of gold nanoparticles. It has been thought that citrate acts as both a reducing agent for the gold salt and as the capping agent. However, it has recently been reported using density functional theory (DFT) that electron density builds up on uncomplexed apex gold atoms and the binding of formate (the simplest carboxylate and a model for citrate) becomes unfavorable after two additions, limiting citrate's utility as a capping agent. In this study, Au(20)-formyloxyl radical interactions are investigated using DFT at the BP86/DZ level of theory to model neutral carboxylate-gold nanoparticle binding (corresponding to carboxylates interacting with a partially oxidized gold nanoparticle). Binding energies are refined using a TZP basis set. It is found that the incremental binding energies of formyloxyl radicals remain highly favorable through eight additions (the highest number tested). The addition of one formyloxyl radical is 56 kJ/mol less than the addition of one formate but becomes 210 kJ/mol more favorable for the second addition. The range of binding energies through the eight additions is 154-331 kJ/mol. Furthermore, after the third addition, the most favorable geometries feature distortion of the gold tetrahedron. These results suggest that oxidized species formed in the citrate reduction method are likely capping agents and that binding of these ligands may affect the properties of the nanoparticles through distortion of the gold structure.

  11. Formation of gold nanoparticles by glycolipids of Lactobacillus casei

    PubMed Central

    Kikuchi, Fumiya; Kato, Yugo; Furihata, Kazuo; Kogure, Toshihiro; Imura, Yuki; Yoshimura, Etsuro; Suzuki, Michio


    Gold nanoparticles have particular properties distinct from those of bulk gold crystals, and such nanoparticles are used in various applications in optics, catalysis, and drug delivery. Many reports on microbial synthesis of gold nanoparticles have appeared. However, the molecular details (reduction and dispersion) of such synthesis remain unclear. In the present study, we studied gold nanoparticle synthesis by Lactobacillus casei. A comparison of L. casei components before and after addition of an auric acid solution showed that the level of unsaturated lipids decreased significantly after addition. NMR and mass spectrum analysis showed that the levels of diglycosyldiacylglycerol (DGDG) and triglycosyldiacylglycerol (TGDG) bearing unsaturated fatty acids were much reduced after formation of gold nanoparticles. DGDG purified from L. casei induced the synthesis of gold nanoparticles in vitro. These results suggested that glycolipids, such as DGDG, play important roles in reducing Au(III) to Au(0) and in ensuring that the nanoparticles synthesized remain small in size. Our work will lead to the development of novel, efficient methods by which gold nanoparticles may be produced by, and accumulated within, microorganisms. PMID:27725710

  12. Extracellular mycosynthesis of gold nanoparticles using Fusarium solani

    NASA Astrophysics Data System (ADS)

    Gopinath, K.; Arumugam, A.


    The development of eco-friendly methods for the synthesis of nanomaterial shape and size is an important area of research in the field of nanotechnology. The present investigation deals with the extracellular rapid biosynthesis of gold nanoparticles using Fusarium solani culture filtrate. The UV-vis spectra of the fungal culture filtrate medium containing gold ion showed peak at 527 nm corresponding to the plasmon absorbance of gold nanoparticles. FTIR spectra provide an evidence for the presence of heterocyclic compound in the culture filtrate, which increases the stability of the synthesized gold nanoparticles. The X-ray analysis respects the Bragg's law and confirmed the crystalline nature of the gold nanoparticles. AFM analysis showed the results of particle sizes (41 nm). Transmission electron microscopy (TEM) showed that the gold nanoparticles are spherical in shape with the size range from 20 to 50 nm. The use of F. solani will offer several advantages since it is considered as a non-human pathogenic organism. The fungus F. solani has a fast growth rate, rapid capacity of metallic ions reduction, NPs stabilization and facile and economical biomass handling. Extracellular biosynthesis of gold nanoparticles could be highly advantageous from the point of view of synthesis in large quantities, time consumption, eco-friendly, non-toxic and easy downstream processing.

  13. Gold complexes with benzimidazole derivatives: synthesis, characterization and biological studies.


    Mota, Vinicius Zamprogno; de Carvalho, Gustavo Senra Gonçalves; da Silva, Adilson David; Costa, Luiz Antônio Sodré; de Almeida Machado, Patrícia; Coimbra, Elaine Soares; Ferreira, Carmen Veríssima; Shishido, Silvia Mika; Cuin, Alexandre


    Synthesis, characterization, DFT studies and biological assays of new gold(I) and gold(III) complexes of benzimidazole are reported. Molecular and structural characterizations of the compounds were based on elemental (C, H and N) and thermal (TG-DTA) analyses, and FT-IR and UV-Visible spectroscopic measurements. The structures of complexes were proposed based DFT calculations. The benzimidazole compounds (Lig1 and Lig2) and the gold complexes were tested against three Leishmania species related to cutaneous manifestations of leishmaniasis. The free benzimidazole compounds showed no leishmanicidal activity. On the other hand, the gold(I and III) complexes have shown to possess significant activity against Leishmania in both stages of parasite, and the gold(III) complex with Lig2 exhibited expressive leishmanicidal activity with IC50 values below 5.7 μM. Also, the gold complexes showed high leishmania selectivity. The gold(I) complex with Lig1, for example, is almost 50 times more toxic for the parasite than for macrophages. Besides the leishmanicidal activity, all complexes exhibited toxic effect against SK-Mel 103 and Balb/c 3T3, cancer cells.

  14. Constraining Modern and Historic Mercury Emissions From Gold Mining

    NASA Astrophysics Data System (ADS)

    Strode, S. A.; Jaeglé, L.; Selin, N. E.; Sunderland, E.


    Mercury emissions from both historic gold and silver mining and modern small-scale gold mining are highly uncertain. Historic mercury emissions can affect the modern atmosphere through reemission from land and ocean, and quantifying mercury emissions from historic gold and silver mining can help constrain modern mining sources. While estimates of mercury emissions during historic gold rushes exceed modern anthropogenic mercury emissions in North America, sediment records in many regions do not show a strong gold rush signal. We use the GEOS-Chem chemical transport model to determine the spatial footprint of mercury emissions from mining and compare model runs from gold rush periods to sediment and ice core records of historic mercury deposition. Based on records of gold and silver production, we include mercury emissions from North and South American mining of 1900 Mg/year in 1880, compared to modern global anthropogenic emissions of 3400 Mg/year. Including this large mining source in GEOS-Chem leads to an overestimate of the modeled 1880 to preindustrial enhancement ratio compared to the sediment core record. We conduct sensitivity studies to constrain the level of mercury emissions from modern and historic mining that is consistent with the deposition records for different regions.

  15. Orogenic gold and geologic time: A global synthesis

    USGS Publications Warehouse

    Goldfarb, R.J.; Groves, D.I.; Gardoll, S.


    Orogenic gold deposits have formed over more than 3 billion years of Earth's history, episodically during the Middle Archean to younger Precambrian, and continuously throughout the Phanerozoic. This class of gold deposit is characteristically associated with deformed and metamorphosed mid-crustal blocks, particularly in spatial association with major crustal structures. A consistent spatial and temporal association with granitoids of a variety of compositions indicates that melts and fluids were both inherent products of thermal events during orogenesis. Including placer accumulations, which are commonly intimately associated with this mineral deposit type, recognized production and resources from economic Phanerozoic orogenic-gold deposits are estimated at just over one billion ounces gold. Exclusive of the still-controversial Witwatersrand ores, known Precambrian gold concentrations are about half this amount. The recent increased applicability of global paleo-reconstructions, coupled with improved geochronology from most of the world's major gold camps, allows for an improved understanding of the distribution pattern of orogenic gold in space and time.

  16. Peptide-functionalized iron oxide magnetic nanoparticle for gold mining

    NASA Astrophysics Data System (ADS)

    Shen, Wei-Zheng; Cetinel, Sibel; Sharma, Kumakshi; Borujeny, Elham Rafie; Montemagno, Carlo


    Here, we present our work on preparing a novel nanomaterial composed of inorganic binding peptides and magnetic nanoparticles for inorganic mining. Two previously selected and well-characterized gold-binding peptides from cell surface display, AuBP1 and AuBP2, were exploited. This nanomaterial (AuBP-MNP) was designed to fulfill the following two significant functions: the surface conjugated gold-binding peptide will recognize and selectively bind to gold, while the magnetic nano-sized core will respond and migrate according to the applied external magnetic field. This will allow the smart nanomaterial to mine an individual material (gold) from a pool of mixture, without excessive solvent extraction, filtration, and concentration steps. The working efficiency of AuBP-MNP was determined by showing a dramatic reduction of gold nanoparticle colloid concentration, monitored by spectroscopy. The binding kinetics of AuBP-MNP onto the gold surface was determined using surface plasmon resonance (SPR) spectroscopy, which exhibits around 100 times higher binding kinetics than peptides alone. The binding capacity of AuBP-MNP was demonstrated by a bench-top mining test with gold microparticles.

  17. Multifunctional gold nanoparticles for diagnosis and therapy of disease

    PubMed Central

    Mieszawska, Aneta J.; Mulder, Willem J. M.; Fayad, Zahi A.


    Gold nanoparticles (AuNPs) have a number of physical properties that make them appealing for medical applications. For example, the attenuation of X-rays by gold nanoparticles has led to their use in computed tomography imaging and as adjuvants for radiotherapy. AuNPs have numerous other applications in imaging, therapy and diagnostic systems. The advanced state of synthetic chemistry of gold nanoparticles offers precise control over physicochemical and optical properties. Furthermore gold cores are inert and are considered to be biocompatible and non-toxic. The surface of gold nanoparticles can easily be modified for a specific application and ligands for targeting, drugs or biocompatible coatings can be introduced. AuNPs can be incorporated into larger structures such as polymeric nanoparticles or liposomes that deliver large payloads for enhanced diagnostic applications, efficiently encapsulate drugs for concurrent therapy or add additional imaging labels. This array of features has led to the afore-mentioned applications in biomedical fields, but more recently in approaches where multifunctional gold nanoparticles are used for multiple methods, such as concurrent diagnosis and therapy, so called theranostics. The following review covers basic principles and recent findings in gold nanoparticle applications for imaging, therapy and diagnostics, with a focus on reports of multifunctional AuNPs. PMID:23360440

  18. Optical absorption analysis and optimization of gold nanoshells.


    Tuersun, Paerhatijiang; Han, Xiang'e


    Gold nanoshells, consisting of a nanoscale dielectric core coated with an ultrathin gold shell, have wide biomedical applications due to their strong optical absorption properties. Gold nanoshells with high absorption efficiencies can help to improve these applications. We investigate the effects of the core material, surrounding medium, core radius, and shell thickness on the absorption spectra of gold nanoshells by using the light-scattering theory of a coated sphere. Our results show that the position and intensity of the absorption peak can be tuned over a wide range by manipulating the above-mentioned parameters. We also obtain the optimal absorption efficiencies and structures of hollow gold nanoshells and gold-coated SiO(2) nanoshells embedded in water at wavelengths of 800, 820, and 1064 nm. The results show that hollow gold nanoshells possess the maximum absorption efficiency (5.42) at a wavelength of 800 nm; the corresponding shell thickness and core radius are 4.8 and 38.9 nm, respectively. They can be used as the ideal photothermal conversation particles for biomedical applications.

  19. Malaria in gold-mining areas in Colombia.


    Castellanos, Angélica; Chaparro-Narváez, Pablo; Morales-Plaza, Cristhian David; Alzate, Alberto; Padilla, Julio; Arévalo, Myriam; Herrera, Sócrates


    Gold-mining may play an important role in the maintenance of malaria worldwide. Gold-mining, mostly illegal, has significantly expanded in Colombia during the last decade in areas with limited health care and disease prevention. We report a descriptive study that was carried out to determine the malaria prevalence in gold-mining areas of Colombia, using data from the public health surveillance system (National Health Institute) during the period 2010-2013. Gold-mining was more prevalent in the departments of Antioquia, Córdoba, Bolívar, Chocó, Nariño, Cauca, and Valle, which contributed 89.3% (270,753 cases) of the national malaria incidence from 2010-2013 and 31.6% of malaria cases were from mining areas. Mining regions, such as El Bagre, Zaragoza, and Segovia, in Antioquia, Puerto Libertador and Montelíbano, in Córdoba, and Buenaventura, in Valle del Cauca, were the most endemic areas. The annual parasite index (API) correlated with gold production (R2 0.82, p < 0.0001); for every 100 kg of gold produced, the API increased by 0.54 cases per 1,000 inhabitants. Lack of malaria control activities, together with high migration and proliferation of mosquito breeding sites, contribute to malaria in gold-mining regions. Specific control activities must be introduced to control this significant source of malaria in Colombia.

  20. Contributions to the gold metallogeny of northern Nevada

    USGS Publications Warehouse

    Tosdal, Richard M.


    Nevada is one of the Earth's premier gold producing regions, accounting for approximately 64 percent of the U.S and nine percent of the world total. The impact of these mines on nearby local economies and on our national balance of payments is profound, and will continue well into the next century. Of principal importance in this region are giant sedimentary-rock-hosted (Carlin-type) deposits. These are some of the world's largest deposits, but yet are poorly understood. Other sedimentary-rock hosted deposits in the region, the distal-disseminated Ag-Au type, are genetically related to shallow plutonic complexes. Hot-spring gold-silver systems associated with Tertiary volcanic rocks represent a third type of precious metal deposit in northern Nevada. These deposits, despite being generally smaller than sedimentary-rock-hosted gold deposits, are also important gold-silver resources. Aspects about the geologic and metallogenic setting of gold-silver deposits in northern Nevada are addressed in the twenty-two chapters that compose this volume. The volume is organized along four themes: (1) crustal structure; (2) Carlin-type deposits; (3) pluton-related gold-silver deposits near Battle Mountain; and (4) hot-spring gold-silver deposits. This Open-File Report, the result of ongoing geologic and mineral-resource investigations, provides a basis for mineral exploration, for land-use planning decisions, and for environmental questions in northern Nevada.

  1. Malaria in gold-mining areas in Colombia

    PubMed Central

    Castellanos, Angélica; Chaparro-Narváez, Pablo; Morales-Plaza, Cristhian David; Alzate, Alberto; Padilla, Julio; Arévalo, Myriam; Herrera, Sócrates


    Gold-mining may play an important role in the maintenance of malaria worldwide. Gold-mining, mostly illegal, has significantly expanded in Colombia during the last decade in areas with limited health care and disease prevention. We report a descriptive study that was carried out to determine the malaria prevalence in gold-mining areas of Colombia, using data from the public health surveillance system (National Health Institute) during the period 2010-2013. Gold-mining was more prevalent in the departments of Antioquia, Córdoba, Bolívar, Chocó, Nariño, Cauca, and Valle, which contributed 89.3% (270,753 cases) of the national malaria incidence from 2010-2013 and 31.6% of malaria cases were from mining areas. Mining regions, such as El Bagre, Zaragoza, and Segovia, in Antioquia, Puerto Libertador and Montelíbano, in Córdoba, and Buenaventura, in Valle del Cauca, were the most endemic areas. The annual parasite index (API) correlated with gold production (R2 0.82, p < 0.0001); for every 100 kg of gold produced, the API increased by 0.54 cases per 1,000 inhabitants. Lack of malaria control activities, together with high migration and proliferation of mosquito breeding sites, contribute to malaria in gold-mining regions. Specific control activities must be introduced to control this significant source of malaria in Colombia. PMID:26814645

  2. Surface-modified gold nanoshells for enhanced cellular uptake.


    Liang, Zhongshi; Liu, Yun; Li, Xiangyang; Wu, Qinge; Yu, Jiahui; Luo, Shufang; Lai, Lihui; Liu, Shunying


    Gold nanoshells have shown a great potential for use as agents in a wide variety of biomedical applications, and some of which require the delivery of large numbers of gold nanoshells onto or into the cells. Here, we develop a ready method to enhance the cellular uptake of gold nanoshells by modifying with meso-2,3-dimercaptosuccinic acid (DMSA). The quantifiable technique of inductively coupled plasma atomic emissions spectroscopy (ICP-AES) and transmission electron microscopy (TEM) were used to investigate the cellular uptake of unmodified and DMSA-modified gold nanoshells. Three cell lines (RAW 264.7, A549, and BEL-7402) were involved and the results indicated that the cellular uptake of the DMSA-modified gold nanoshells was obviously enhanced versus the unmodified gold nanoshells. The reason possibly lies in the nonspecific adsorption of serum protein on the DMSA-modified gold nanoshells (DMSA-GNs), which consequently enhanced the cellular uptake. As a continued effort, in vitro experiments with endocytic inhibitors suggested the DMSA-GNs internalized into cells via receptor-mediated endocytosis (RME) pathway. This study has provided a valuable insight into the effects of surface modification on cellular uptake of nanoparticles.

  3. Synthesis and tuning of gold nanorods with surface plasmon resonance

    NASA Astrophysics Data System (ADS)

    Shajari, Daryush; Bahari, Ali; Gill, Pooria; Mohseni, Mojtaba


    Gold nanostructures in general and gold nanorods in particular due to their plasmon resonance has been employed for many applications, such as biosensors. For the biosensors uses, gold nanorods remain popular and reproducibility of them is the most important and critical. In the present work we used six different CTAB (Hexadecyltrimethylammonium bromide) products and one BDAC (Benzyldimethylhexadecylammonium chloride) with varying silver nitrate concentration in the seed-mediated growth of gold nanostructures. We synthesized gold nanorods with varying aspect ratio up to 5.5 with a longitudinal surface plasmon resonance peak from 670 to 950 nm. We obtained excellent rod-shape gold nanostructures witch were reliable and reproducible with our method based on common seed-mediated growth. The synthesized nanostructures were characterized by UV-visible spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Here, we report our method in more detail as a user-friendly guide for the production of gold nanorods and tuning of their aspect ratios.

  4. Weakened Flexural Strength of Nanocrystalline Nanoporous Gold by Grain Refinement.


    Gwak, Eun-Ji; Kim, Ju-Young


    High density of grain boundaries in solid materials generally leads to high strength because grain boundaries act as strong obstacles to dislocation activity. We find that the flexural strength of nanoporous gold of grain size 206 nm is 33.6% lower than that of grain size 238 μm. We prepared three gold-silver precursor alloys, well-annealed, prestrained, and high-energy ball-milled, from which nanoporous gold samples were obtained by the same free-corrosion dealloying process. Ligaments of the same size are formed regardless of precursor alloys, and microstructural aspects of precursor alloys such as crystallographic orientation and grain size is preserved in the dealloying process. While the nanoindentation hardness of three nanoporous golds is independent of microstructural variation, flexural strength of nanocrystalline nanoporous gold is significantly lower than that of nanoporous golds with much larger grain size. We investigate weakening mechanisms of grain boundaries in nanocrystalline nanoporous gold, leading to weakening of flexural strength.

  5. Plasmonic Gold Decorated MWCNT Nanocomposite for Localized Plasmon Resonance Sensing

    NASA Astrophysics Data System (ADS)

    Ozhikandathil, J.; Badilescu, S.; Packirisamy, M.


    The synergism of excellent properties of carbon nanotubes and gold nanoparticles is used in this work for bio-sensing of recombinant bovine growth hormones (rbST) by making Multi Wall Carbon Nanotubes (MWCNT) locally optically responsive by augmenting it optical properties through Localized Surface Plasmon Resonance (LSPR). To this purpose, locally gold nano particles decorated gold-MWCNT composite was synthesized from a suspension of MWCNT bundles and hydrogen chloroauric acid in an aqueous solution, activated ultrasonically and, then, drop-casted on a glass substrate. The slow drying of the drop produces a “coffee ring” pattern that is found to contain gold-MWCNT nanocomposites, accumulated mostly along the perimeter of the ring. The reaction is studied also at low-temperature, in the vacuum chamber of the Scanning Electron Microscope and is accounted for by the local melting processes that facilitate the contact between the bundle of tubes and the gold ions. Biosensing applications of the gold-MWCNT nanocomposite using their LSPR properties are demonstrated for the plasmonic detection of traces of bovine growth hormone. The sensitivity of the hybrid platform which is found to be 1 ng/ml is much better than that measuring with gold nanoparticles alone which is only 25 ng/ml.

  6. Cytotoxicity of gold nanoparticles prepared by ultrasonic spray pyrolysis.


    Rudolf, R; Friedrich, B; Stopić, S; Anžel, I; Tomić, S; Čolić, M


    The aim of this work was to study the cytotoxicity of different fractions of gold nanoparticles prepared by ultrasonic spray pyrolysis from gold scrap. The target cells were rat thymocytes, as a type of nonproliferating cells, and L929 mouse fibroblasts, as a type of continuous proliferating cells. Fractions 1 and 2, composed of pure gold nanoparticles, as determined by scanning electron microscopy with a combination of energy dispersive X-ray analysis, were nontoxic for thymocytes, but reduced moderately the proliferative activity of L929 cells. The inhibitory effect of fraction 2, containing particles smaller in size than fraction 1, was stronger. Fraction 3, composed of Au and up to 3% Cu was noncytotoxic for thymocytes, but was cytotoxic for L929 cells. Fraction 4, composed of Au and Ag nanoparticles, and fraction 5, composed of Au together with Cu, Ni, Zn, Fe, and In were cytotoxic for both thymocytes and L929 cells. These results suggest that USP enables the synthesis of pure gold nanoparticles with controlled size, even from gold scrap. However, microstructural analyses and biocompatibility testing are necessary for their proper selection from more cytotoxic gold nanoparticles, contaminated with other elements of gold alloys.

  7. Formation of different gold nanostructures by silk nanofibrils.


    Fang, Guangqiang; Yang, Yuhong; Yao, Jinrong; Shao, Zhengzhong; Chen, Xin


    Metal nanostructures that have unique size- and shape-dependent electronic, optical and chemical properties gain more and more attention in modern science and technology. In this article, we show the possibility that we are able to obtain different gold nanostructures simply with the help of silk nanofibrils. We demonstrate that only by varying the pH of the reaction solution, we get gold nanoparticles, nano-icosahedrons, nanocubes, and even microplates. Particularly, we develop a practical method for the preparation of gold microplates in acid condition in the presence of silk nanofibrils, which is impossible by using other forms of silk protein. We attribute the role of silk nanofibrils in the formation of gold nanostructure to their reduction ability from several specific amino acid residues, and the suitable structural anisotropic features to sustain the crystal growth after the reduction process. Although the main purpose of this article is to demonstrate that silk nanofibrils are able to mediate the formation of different gold nanostructure, we show the potential applications of these resulting gold nanostructures, such as surface-enhanced Raman scattering (SERS) and photothermal transformation effect, as same as those produced by other methods. In conclusion, we present in this communication a facile and green synthesis route to prepare various gold nanostructures with silk nanofibrils by simply varying pH in the reaction system, which has remarkable advantages in future biomedical applications.

  8. Microbial synthesis of Flower-shaped gold nanoparticles.


    Singh, Priyanka; Kim, Yeon Ju; Wang, Chao; Mathiyalagan, Ramya; Yang, Deok Chun


    The shape of nanoparticles has been recognized as an important attribute that determines their applicability in various fields. The flower shape (F-shape) has been considered and is being focused on, because of its enhanced properties when compared to the properties of the spherical shape. The present study proposed the microbial synthesis of F-shaped gold nanoparticles within 48 h using the Bhargavaea indica DC1 strain. The F-shaped gold nanoparticles were synthesized extracellularly by the reduction of auric acid in the culture supernatant of B. indica DC1. The shape, size, purity, and crystalline nature of F-shaped gold nanoparticles were revealed by various instrumental techniques including UV-Vis, FE-TEM, EDX, elemental mapping, XRD, and DLS. The UV-Vis absorbance showed a maximum peak at 536 nm. FE-TEM revealed the F-shaped structure of nanoparticles. The EDX peak obtained at 2.3 keV indicated the purity. The peaks obtained on XRD analysis corresponded to the crystalline nature of the gold nanoparticles. In addition, the results of elemental mapping indicated the maximum distribution of gold elements in the nanoproduct obtained. Particle size analysis revealed that the average diameter of the F-shaped gold nanoparticles was 106 nm, with a polydispersity index (PDI) of 0.178. Thus, the methodology developed for the synthesis of F-shaped gold nanoparticles is completely green and economical.

  9. CFB roasting for gold ore processing

    SciTech Connect

    Hubbard, G.; D'Acierno, J.P.


    This paper describes how KTI/Dorr-Oliver applied the results from CFB boiler technology to the design for a CFB mineral processing plant built in Africa in 1992. The whole ore gold roaster plant located in Syama, Mali is presently owned and operated by Randgold of South Africa and it processes over 216 tons per hour of whole gold ore. The plant has operated continuously for over four years. The CFB reactor operates in the turbulent CFB mode of fluidization with over 40 minutes of solids residence time in the dense phase for optimum conversion of the feed material. The success of the plant after four years of operation is in large part due to the choice of the turbulent CFB mode of fluidization. This mode is very flexible in face of significant variations in feed composition and size distribution. Sulfur capture takes place in situ and the sorbent is present naturally in the feed. An electrostatic precipitator is used for particulate removal from the flue gas. The energy balance for the system requires auxiliary fuel oil burned in the CFB reactor. Energy from the 1,200--1,350 F roasted product stream is recovered and recycled back into the CFB using two fluidized bed coolers; one to directly heat the secondary air and the other to indirectly heat the primary fluidizing air. Pilot plant testing and the scale up of pilot plant results to the full scale plant is described. The plant start up including resolution of some unique start up difficulties is covered. A comparison of results for the pilot plant and commercial plant is presented.

  10. Do oil and gold mix in Alaska

    SciTech Connect

    Bailey, R.V.


    Excellent potential for sea-floor-placer heavy mineral deposits exists locally along the coast of Alaska within lands owned by the state. Aspen Exploration first applied for precious metal offshore prospecting permits (OPPs) from the state in 1980 for certain lands in Cook Inlet, including lands that are prospective for oil and gas production. Exploration to date has included geologic mapping, beach sampling at many locations, and a 6400 mile low-level aeromagnetic survey. More than 20,000 ft of sediments underlie areas that appear most prospective for placer gold deposits, thereby facilitating geophysical interpretation of sea-floor magnetic anomalies. Work to date, now suspended, suggests large, linear, offshore heavy mineral concentrations, which likely include gold. Obtaining permits in Alaska is difficult, frustrating, and expensive. After 5 years of effort, no permits have been issues to Aspen. Primary opposition has come from the Alaska Department of Fish and Game, which has taken the position that insufficient biological resource information is available in the prospect areas. These same offshore areas, however, are held under oil and gas leases from the state by various companies. The difficulties encountered by smaller oil companies in attempting to carry out exploration in Alaska, which have forced virtually all of them to abandon their efforts in this state, are compared with difficulties hard-mineral companies are encountering. It is important to recognize that income to the state of Alaska from oil royalties and taxes is of such magnitude, that needed support for hard-mineral exploration and mining is being suppressed by a hostile bureaucracy and by preservationists.

  11. Radiolabeled theranostics: magnetic and gold nanoparticles

    PubMed Central

    Same, Saeideh; Aghanejad, Ayuob; Akbari Nakhjavani, Sattar; Barar, Jaleh; Omidi, Yadollah


    Introduction: Growing advances in nanotechnology have facilitated the applications of newly emerged nanomaterials in the field of biomedical/pharmaceutical sciences. Following this trend, the multifunctional nanoparticles (NPs) play a significant role in development of advanced drug delivery systems (DDSs) such as diapeutics/theranostics used for simultaneous diagnosis and therapy. Multifunctional radiolabeled NPs with capability of detecting, visualizing and destroying diseased cells with least side effects have been considered as an emerging filed in presentation of the best choice in solving the therapeutic problems. Functionalized magnetic and gold NPs (MNPs and GNPs, respectively) have produced the potential of nanoparticles as sensitive multifunctional probes for molecular imaging, photothermal therapy and drug delivery and targeting. Methods: In this study, we review the most recent works on the improvement of various techniques for development of radiolabeled magnetic and gold nanoprobes, and discuss the methods for targeted imaging and therapies. Results: The receptor-specific radiopharmaceuticals have been developed to localized radiotherapy in disease sites. Application of advanced multimodal imaging methods and related modality imaging agents labeled with various radioisotopes (e.g., 125I, 111In, 64Cu, 68Ga, 99mTc) and MNPs/GNPs have significant effects on treatment and prognosis of cancer therapy. In addition, the surface modification with biocompatible polymer such as polyethylene glycol (PEG) have resulted in development of stealth NPs that can evade the opsonization and immune clearance. These long-circulating agents can be decorated with homing agents as well as radioisotopes for targeted imaging and therapy purposes. Conclusion: The modified MNPs or GNPs have wide applications in concurrent diagnosis and therapy of various malignancies. Once armed with radioisotopes, these nanosystems (NSs) can be exploited for combined multimodality imaging with

  12. Boronyl Mimics Gold: a Photoelectron Spectroscopy Study

    NASA Astrophysics Data System (ADS)

    Jian, Tian; Lopez, Gary; Wang, Lai-Sheng


    Previous studies have found that gold atom and boronyl bear similarities in bonding in many gas phase clusters. B10(BO), B12(BO), B3(BO)n (n=1, 2) were found to possess similar bonding and structures to B10Au, B12Au, B3Aun (n=1, 2), respectively. During the recent photoelectron spectroscopy experiments, the spectra of BiBO- and BiAu- clusters are found to exhibit similar patterns, hinting that they possess similar geometric structures. While BiAu- is a linear molecule, BiBO- is also linear. The similarity in bonding between BiBO- and BiAu- is owing to the fact that Au and BO are monovalent σ ligands. The electron affinities are measured to be 1.79±0.04eV for BiBO- and 1.36±0.02eV for BiAu-. The current results provide new examples for the BO/Au isolobal analogy and enrich the chemistry of boronyl and gold. H.-J. Zhai, C.-Q. Miao, S.-D. Li, L.-S. Wang, J. Phys. Chem. A 2010, 114, 12155-1216 Q. Chen, H. Bai, H.-J. Zhai, S.-D. Li, L.-S. Wang, J. Chem. Phys. 2013, 139, 044308 H. Bai, H.-J. Zhai, S.-D. Li, L.-S. Wang, Phys. Chem. Chem. Phys., 2013, 15, 9646-9653 H.-J. Zhai, Q. Chen, H. Bai, S.-D. Li, L.-S. Wang, Acc. Chem. Res. 2014, 47, 2435-2445

  13. Obituary: Thomas Gold, 1920-2004

    NASA Astrophysics Data System (ADS)

    Dermott, Stanley F.


    Thomas "Tommy" Gold died of heart disease at Cayuga Medical Center, Ithaca NY on 22 June 2004 at the age of 84. He will be remembered as one of the most interesting, dynamic and influential scientists of his generation. Tommy's paradigm-changing ideas in astronomy and planetary science, while original and bold, were also highly controversial. With his radical work on the origin of natural gas and petroleum, the controversy is likely to continue. Tommy was born in Vienna, Austria on 22 May 1920, moving with his family to Berlin at age 10 and then, after the rise of Hitler in 1933, to England. His parents were Josephine (nee Martin) and Maximillian Gold, a successful steel magnate. Tommy was educated at Zuoz College in Switzerland where he became an expert skier and developed an athletic prowess that he maintained throughout his life, winning a NASTAR gold medal for skiing at the age of 65. He studied Mechanical Sciences at Trinity College, Cambridge, but much to his disgust his education was interrupted because of internment by the British as a suspected enemy alien. That unfortunate period (I remember him saying to me "Can you believe the stupidity, interring people like me who had fled from Nazi Germany?") had one good outcome: on his first night in camp he met Hermann Bondi who had an important influence on his early development as a scientist. They were both born in Vienna, their parents knew each other, and they were fellow students at Trinity, but this was their first meeting. On release, he went immediately into top-secret radar research for the British Admiralty, working as a team with Bondi and Fred Hoyle in a farm cottage in Dunsfold, Surrey. Tommy's first published research, which was a Nature paper with R.J. Pumphrey in 1947, was not in astronomy but physiology. He applied his engineer's understanding of positive feedback to develop and test a resonance model for how the human ear determines pitch. His conclusion that pitch discrimination occurs

  14. Manual for the Construction of a Mercury Capture System for Use in Gold Shops

    EPA Pesticide Factsheets

    Download a manual for the construction of a mercury capture system for use in gold shops with detailed information for constructing a device to capture mercury aerosol particles emitted from gold shops that process gold dore’, a gold-mercury amalgam.

  15. 31 CFR 406.1 - Secret Service officers authorized to make seizures of gold.

    Code of Federal Regulations, 2014 CFR


    ... make seizures of gold. 406.1 Section 406.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.1 Secret Service officers authorized...

  16. 31 CFR 406.1 - Secret Service officers authorized to make seizures of gold.

    Code of Federal Regulations, 2010 CFR


    ... make seizures of gold. 406.1 Section 406.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.1 Secret Service officers authorized...

  17. 31 CFR 406.1 - Secret Service officers authorized to make seizures of gold.

    Code of Federal Regulations, 2013 CFR


    ... make seizures of gold. 406.1 Section 406.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.1 Secret Service officers authorized...

  18. 31 CFR 101.4 - Extraction of gold bullion from the counterfeit coins.

    Code of Federal Regulations, 2010 CFR


    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Extraction of gold bullion from the... MITIGATION OF FORFEITURE OF COUNTERFEIT GOLD COINS § 101.4 Extraction of gold bullion from the counterfeit coins. If the petition is approved, the Assistant Secretary shall then forward the gold coins to...

  19. 78 FR 72139 - Nevada Gold Corp.; Order of Suspension of Trading

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Nevada Gold Corp.; Order of Suspension of Trading November 27, 2013. It appears to the Securities... securities of Nevada Gold Corp. (``Nevada Gold'') because of questions regarding the accuracy of assertions by Nevada Gold, and by others, to investors in press releases and promotional material...

  20. 31 CFR 406.1 - Secret Service officers authorized to make seizures of gold.

    Code of Federal Regulations, 2011 CFR


    ... make seizures of gold. 406.1 Section 406.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.1 Secret Service officers authorized...