Successful recruiting strategies for geoscience degrees and careers at the two-year college: An example from Metropolitan Community College - Kansas City

NASA Astrophysics Data System (ADS)

Wolfe, B.

2012-12-01

The overwhelming majority of students at 2-year colleges take geoscience courses (e.g. physical geology or physical geography) to fulfill part of the general education requirements of the Associates in Arts degree or General Education certificates for transfer to a 4-year school. It is common in community college earth science programs to have a relatively small number of students continuing on to major in geoscience programs at their transfer 4-year institution. To increase interest and retention in geosciences courses, we have developed a two prong approach - one aimed at students looking to transfer to a 4-year institution and the other aimed at students in the often overlooked career and technical education (CTE) programs. In the case of transfer students, we employ a "high touch" approach in introductory Physical Geology courses. This includes raising awareness of geoscience related careers combined with faculty mentor and advisor activities for students who express interest in science on their admission forms or in discussions of potential careers in science in first-year experience courses. Faculty mentorships have been very effective, not only in recruiting students to consider careers in geology, but also in advising a curriculum for students necessary to be successful upon transfer to a 4-year institution (such as completing college level chemistry, physics, and calculus courses prior to transfer). The second approach focuses on students pursuing certificates and degrees in CTE energy-related programs (such as HVAC, industrial engineering technology, electrician, and utility linemen). To increase awareness of vocational related geoscience careers, many of which require a good foundation in the vocational training students are currently pursing, we developed a foundation energy course - Energy and the Environment - which fulfills both the science general education component of the AA degree for students looking to transfer as well as CTE students. The curriculum focuses on fundamental concepts of energy generation and environmental impact, including analysis of energy fundamentals, fossil fuel exploration and use, atmospheric pollution, global climate change, nuclear energy, alternative energy sources, and energy conservation, all of which are directly related to geologic processes. This new course is part of newly created energy certificate programs in Photovoltaics, energy efficiency, and solar thermal - with the intention of expanding to AAS degrees in each.

TNF-α-308/-238 polymorphisms are associated with gastric cancer: A case-control family study in China.

PubMed

Xu, Yajuan; Cao, Xiaoqin; Jiang, Jicheng; Chen, Yi; Wang, Kaijuan

2017-02-01

Associations of TNF-α-308 (rs1800629) and -238 (rs361525) with gastric cancer had the inconsistent indication among different populations. In this case-control family study, 47 families were determined with the probands diagnosed with gastric cancer (case family, n=296), accordingly 47 families without gastric cancer were matched with the case families by multivariate distribution of age, sex, social class, and pedigree size (control family, n=319). Polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) was used to identify the TNF genotype. Chi-square test was used to compare the groups regarding genotype and the allele frequencies, HWE test for Hardy-Weinberg equilibrium. The frequencies of TNF-α-308 GA and AA genotypes were significantly higher in case family than that in control family. The risk of gastric cancer was increased in GA and AA carriers in the first degree (OR=2.06, 95% CI=1.20-3.51 and OR=4.89, 95% CI=2.74-8.74), however the similar result was not found in the second degree. Helicobacter pylori infection status were significantly associated with risk of gastric cancer in first-degree relatives (OR=1.96, 95% CI=1.26-3.05) while no statistical significance was noted in the second-degree relatives. Haplotypes of TNF-α-308/-238 alleles, GA/GG, AA/GG and AA/GA indicated the susceptibilities to gastric cancer with OR and 95% confident intervals resulting 2.07 (1.34-3.21), 4.49 (2.74-7.33) and 4.98 (1.76-14.01) respectively. TNF-α-G308A (rs1800629) polymorphisms are associated with gastric cancer in Chinese population. Haplotypes of TNF-α-308/-238 GA/GG, AA/GG and AA/GA increase the susceptibilities to gastric cancer. The first-degree relatives are more likely to develop into gastric cancer with TNF-α-G308 polymorphisms and H. pylori positive than the second-degree are. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Cyclooxygenase-2 polymorphisms and the risk of gastric cancer in various degrees of relationship in the Chinese Han population

PubMed Central

LI, YUCHUN; DAI, LIPING; ZHANG, JIANZHONG; WANG, PENG; CHAI, YURONG; YE, HUA; ZHANG, JIANYING; WANG, KAIJUAN

2012-01-01

A number of studies have shown that cyclooxygenase-2 (COX-2) gene polymorphisms were associated with gastric cancer. However, the results from different research groups have not been consistent. The present study aimed to investigate the association between polymorphisms of the cyclooxygenase-2 promoter region (-1195G>A, -765G>C) and gastric cancer patients with various degrees of relationship in the Chinese Han population. COX-2-1195G>A and COX-2-765G>C polymorphisms in 296 gastric cancer patients and 319 control family members were genotyped using polymerase chain reaction-restriction fragment length polymorphism. An increased risk of gastric cancer was observed in subjects with the COX-2-1195AA genotype (OR=2.03; 95% CI, 1.27–3.22), and the association strength decreased as the degree of relationship decreased. Stratification analysis revealed that the OR value of COX-2-1195AA genotype and A carriers exhibited synergy with Helicobacter pylori (H. pylori) infection (AA genotype: OR=2.96; 95% CI, 1.57–5.58; A carriers: OR=2.04; 95% CI, 1.18–3.52). No significant difference was found in each genotype of COX-2-765G>C between gastric cancer patients and control family members, as well as gastric cancer patients with various degrees of relationship. Our study demonstrated that the polymorphism of COX-2-1195AA genotype may be a risk factor for gastric cancer patients with various degrees of relationship among the Chinese Han population. H. pylori infection therefore may enhance the risk of gastric cancer in individuals with the COX-2-1195 AA genotype. PMID:22740864

An Existential Approach: An Alternative to the AA Model of Recovery

ERIC Educational Resources Information Center

Rogers, Maria A.; Cobia, Debra

2008-01-01

Alcoholics Anonymous (AA) is the most widely used organization for the treatment of alcoholism. AA's philosophy has changed how many people view themselves and their substance use. The majority of substance abuse programs in the United States use the 12 steps, either by making them the basis of their treatment program, or by introducing AA to…

[Exposure degree of important non-target arthropods to Cry2Aa in Bt rice fields].

PubMed

Zhang, Qing-Ling; Li, Yun-He; Hua, Hong-Xia; Yang, Chang-Ju; Wu, Hong-Jin; Peng, Yu-Fa

2013-06-01

Based on the principle of "risk = hazard x exposure", the selected representative nontarget organisms in the assessment of the potential effects of insect-resistant genetically modified (GM) crops on non-target arthropods in laboratory are generally the arthropod species highly exposed to the insecticidal proteins expressed by the GM crops in farmland ecosystem. In order to understand the exposure degree of the important arthropod species to Cry proteins in Bt rice fields, and to select the appropriate non-target arthropods in the risk assessment of insect-resistant GM crops, the enzyme-linked immunosorbent assay (ELISA) was conducted to measure the Cry2Aa protein concentration in the arthropods collected from the cry2Aa rice fields at different rice growth stages. The results showed that there was a significant difference in the Cry2Aa content protein concentration in different arthropod species. Some species did not contain Cry2Aa protein, while some species contained larger amounts of Cry2Aa protein. Relative to the arthropods colleted after rice anthesis, the arthropods colleted in rice anthesis contained relative higher concentrations of Cry2Aa protein, especially for the predacious arthropods. No Cry proteins were detected in parasitic arthropods. This study provided references for the laboratory assessment of the effects of GM rice on nontarget arthropods.

The relationship of family history and risk of type 2 diabetes differs by ancestry.

PubMed

Kral, B G; Becker, D M; Yanek, L R; Vaidya, D; Mathias, R A; Becker, L C; Kalyani, R R

2018-05-21

Type 2 diabetes (T2DM) in a first-degree relative is a risk factor for incident diabetes. Americans of African ancestry (AA) have higher rates of T2DM than Americans of European ancestry (EA). Thus, we aimed to determine whether the presence, number and kinship of affected relatives are associated with race-specific T2DM incidence in a prospective study of participants from the Genetic Study of Atherosclerosis Risk (GeneSTAR), who underwent baseline screening including a detailed family history. Nondiabetic healthy siblings (n=1405) of patients with early-onset coronary artery disease (18-59 years) were enrolled (861 EA and 544 AA) and followed for incident T2DM (mean 14±6 years). Baseline age was 46.2±7.3 years and 56% were female. T2DM occurred in 12.3% of EA and 19.1% of AA. Among EA, 32.6% had ≥1 affected first-degree relatives versus 53.1% in AA, P<0.0001. In fully adjusted Cox proportional hazard analyses, any family history was related to incident T2DM in EA (HR=2.53, 95% CI: 1.58-4.06) but not in AA (HR=1.01, 0.67-1.53). The number of affected relatives conferred incremental risk of T2DM in EA with HR=1.82 (1.08-3.06), 4.83 (2.15-10.85) and 8.46 (3.09-23.91) for 1, 2, and ≥3 affected, respectively. In AA only ≥3 affected increased risk (HR=2.45, 1.44-4.19). Specific kinship patterns were associated with incident T2DM in EA but not in AA. The presence of any first-degree relative with T2DM does not discriminate risk in AA given the high race-specific prevalence of diabetes. Accounting for the number of affected relatives may more appropriately estimate risk for incident diabetes in both races. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

76 FR 63959 - Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2011-10-14

...) administers the Medicare program for persons covered by the railroad retirement system. The RRB uses Form AA-6, Employee Application for Medicare; Form AA-7, Spouse/Divorced Spouse Application for Medicare; and Form AA... each respondent. The RRB proposes minor editorial changes to Forms AA-6, AA- 7 and AA-8. The RRB...

A review of Alcoholics Anonymous/ Narcotics Anonymous programs for teens.

PubMed

Sussman, Steve

2010-03-01

The investigation of the applicability of Alcoholics Anonymous/Narcotics Anonymous (AA/NA) for teens has only been a subject of empirical research investigation since the early 1990s. In the present review, the author describes teen involvement in AA/NA programming, provides an exhaustive review of the outcomes of 19 studies that used an AA/NA model as part of their formal teen substance abuse treatment programs, and provides data on the effects of AA/NA attendance on abstinence at follow-up, on which youth tend to become involved in AA/NA, and on mediation of the benefits of AA/NA participation. In addition, the author suggests the reasons for somewhat limited participation by teens in more informal, community-based 12-step meetings, and makes suggestions for maximizing participation at meetings in the community. The author concludes that AA/ NA participation is a valuable modality of substance abuse treatment for teens and that much can be done to increase teen participation, though more research is needed.

Breast cancer survivorship program: testing for cross-cultural relevance.

PubMed

Chung, Lynna K; Cimprich, Bernadine; Janz, Nancy K; Mills-Wisneski, Sharon M

2009-01-01

Taking CHARGE, a theory-based self-management program, was developed to assist women with survivorship concerns that arise after breast cancer treatment. Few such programs have been evaluated for cultural relevance with diverse groups. This study determined the utility and cultural relevance of the program for African American (AA) breast cancer survivors. Two focus groups were held with AA women (n = 13), aged 41 to 72 years, who had completed primary treatment. Focus group participants assessed the program content, format, materials, and the self-regulation process. Content analysis of audiotapes was conducted using an open, focused coding process to identify emergent themes regarding program relevance and topics requiring enhancement and/or further emphasis. Although findings indicated that the program's content was relevant to participants' experiences, AA women identified need for cultural enhancements in spirituality, self-preservation, and positive valuations of body image. Content areas requiring more emphasis included persistent fatigue, competing demands, disclosure, anticipatory guidance, and age-specific concerns about body image/sexuality. Suggested improvements to program materials included portable observation logs, additional resources, more photographs of younger AA women, vivid colors, and images depicting strength. These findings provide the basis for program enhancements to increase the utility and cultural relevance of Taking CHARGE for AA survivors and underscore the importance of evaluating interventions for racially/ethnically diverse groups.

Policy Statements for the Associate Degree, the Associate in Applied Science Degree, and the Associate Degree in Nursing.

ERIC Educational Resources Information Center

American Association of Community and Junior Colleges, Washington, DC.

The policy statements contained in this document present the position of the American Association of Community and Junior Colleges (AACJC) on the Associate Degree, the Associate in Applied Science Degree (AAS), and the Associate Degree in Nursing. In its statement on the Associate Degree, the AACJC: (1) stresses the responsibility of faculty and…

Assessment of postruminal amino acid digestibility of roasted and extruded whole soybeans with the precision-fed rooster assay.

PubMed

Aldrich, C G; Merchen, N R; Parsons, C M; Hussein, H S; Ingram, S; Clodfelter, J R

1997-11-01

The objectives of these studies were to predict the effects of roasting and extrusion temperatures of whole soybeans (SB) on intestinal protein digestibility in cattle. Intestinal digestibility was assessed with a two-stage in vitro or in situ ruminal incubation/precision-fed cecectomized rooster bioassay. In Exp. 1, whole SB (raw SB or SB roasted to 141, 149, or 157 degrees C exit temperature from a commercial roaster and steeped for 30 min) were incubated in strained ruminal fluid and McDougall's buffer (50:50) at 39 degrees C for 16 h. In Exp. 2, SB (ground raw SB or SB extruded at 116, 138, or 160 degrees C) were placed in polyester bags (20 x 30 cm) and suspended in the ventral rumen of steers for 16 h. Lyophilized residue of the in vitro or in situ incubations and samples of raw SB and most extensively heated SB (roasted SB at 157 degrees C or extruded SB at 160 degrees C) for each respective experiment were crop-intubated to cecectomized roosters. Total excreta were collected for 48 h after intubation and lyophilized, and amino acid (AA) concentrations were determined. In Exp. 1, total AA digestibility was 61.6 and 84.5% for unincubated whole raw SB and 157 degrees C roasted SB, respectively, and 66.2, 88.9, 91.3, and 91.6% for in vitro residues of whole raw SB and SB roasted at 141, 149, and 157 degrees C, respectively. Trypsin inhibitor (TI) activity was 20.09, 1.69, 1.54, and 1.84 mg/g fat-free DM for unincubated whole raw SB and 141, 149, and 157 degrees C roasted SB, respectively, and 30.84, 1.01, .90, and .26 mg/g fat-free DM for in vitro residues of whole raw SB, 141, 149, and 157 degrees C roasted SB, respectively. In Exp. 2, total AA digestibility was 68.5 and 87.7% for unincubated ground raw SB and 160 degrees C extruded SB, respectively, and 81.9, 91.3, 89.7, and 89.4% for in situ residues of ground raw SB and 116, 138, and 160 degrees C extruded SB, respectively. Trypsin inhibitor activity was 17.61, 4.89, 4.08, and 1.56 mg/g fat-free DM for unincubated ground raw SB, 116, 138, and 160 degrees C extruded SB, respectively, and 3.62, .59, .55, and .21 mg/g fat-free DM for incubated ground raw SB, 116, 138, and 160 degrees C extruded SB, respectively. Heat treatment by roasting and extrusion improved AA digestibilities of SB, but there were no differences detected among the roasting or extrusion temperatures. Ruminal fermentation did not eliminate the negative effects of TI activity on intestinal digestibility of AA in whole SB but did reduce TI activity in ground SB.

[Comparison of texture distribution of cold rolled DC and CC AA 5052 aluminum alloy at different positions through thickness direction by XRD].

PubMed

Chen, Ming-biao; Ma, Min; Yang, Qing-xiang; Wang, Shan; Liu, Wen-chang; Zhao, Ying-mei

2013-09-01

To provide gist of DC AA 5052 and CC AA 5052 aluminum alloy to industry production and application, the texture variation of cold rolled sheets through thickness direction was studied by X-ray diffraction method, and the difference in texture at surface, quarter and center layer was analyzed. The hot plates of direct chill cast (DC) AA 5052 and continuous cast (CC) AA 5052 aluminum alloy were annealed at 454 degrees C for 4 hours and then cold rolled to different reductions. The strength and volume fraction of the fiber in CC AA 5052 aluminum alloy is larger than in DC AA 5052 aluminum alloy after same rolling reduction The volume fraction of the recrystallization texture cube in the CC AA 5052 aluminum alloy is less than in the DC AA 5052 aluminum alloy, which result in that CC AA 5052 aluminum alloy needs less cold rolling reduction than DC AA 5052 aluminum alloy for generating the texture with same intensity and volume fraction at surface layer, quarter layer and center layer. The manufacturability and performance of CC AA 5052 aluminum alloy is superior to DC AA 5052 aluminum alloy for use in stamping.

Community-based participatory research to design a faith-enhanced diabetes prevention program: The Better Me Within randomized trial.

PubMed

Kitzman, Heather; Dodgen, Leilani; Mamun, Abdullah; Slater, J Lee; King, George; Slater, Donna; King, Alene; Mandapati, Surendra; DeHaven, Mark

2017-11-01

Reducing obesity positively impacts diabetes and cardiovascular risk; however, evidence-based lifestyle programs, such as the diabetes prevention program (DPP), show reduced effectiveness in African American (AA) women. In addition to an attenuated response to lifestyle programs, AA women also demonstrate high rates of obesity, diabetes, and cardiovascular disease. To address these disparities, enhancements to evidence-based lifestyle programs for AA women need to be developed and evaluated with culturally relevant and rigorous study designs. This study describes a community-based participatory research (CBPR) approach to design a novel faith-enhancement to the DPP for AA women. A long-standing CBPR partnership designed the faith-enhancement from focus group data (N=64 AA adults) integrating five components: a brief pastor led sermon, memory verse, in class or take-home faith activity, promises to remember, and scripture and prayer integrated into participant curriculum and facilitator materials. The faith components were specifically linked to weekly DPP learning objectives to strategically emphasize behavioral skills with religious principles. Using a CBPR approach, the Better Me Within trial was able to enroll 12 churches, screen 333 AA women, and randomize 221 (M age =48.8±11.2; M BMI =36.7±8.4; 52% technical or high school) after collection of objective eligibility measures. A prospective, randomized, nested by church, design will be used to evaluate the faith-enhanced DPP as compared to a standard DPP on weight, diabetes and cardiovascular risk, over a 16-week intervention and 10-month follow up. This study will provide essential data to guide enhancements to evidence-based lifestyle programs for AA women who are at high risk for chronic disease. Copyright © 2017 Elsevier Inc. All rights reserved.

Empirical investigation of topological and weighted properties of a bus transport network from China

NASA Astrophysics Data System (ADS)

Shu-Min, Feng; Bao-Yu, Hu; Cen, Nie; Xiang-Hao, Shen; Yu-Sheng, Ci

2016-03-01

Many bus transport networks (BTNs) have evolved into directed networks. A new representation model for BTNs is proposed, called directed-space P. The bus transport network of Harbin (BTN-H) is described as a directed and weighted complex network by the proposed representation model and by giving each node weights. The topological and weighted properties are revealed in detail. In-degree and out-degree distributions, in-weight and out-weight distributions are presented as an exponential law, respectively. There is a strong relation between in-weight and in-degree (also between out-weight and out-degree), which can be fitted by a power function. Degree-degree and weight-weight correlations are investigated to reveal that BTN-H has a disassortative behavior as the nodes have relatively high degree (or weight). The disparity distributions of out-degree and in-degree follow an approximate power-law. Besides, the node degree shows a near linear increase with the number of routes that connect to the corresponding station. These properties revealed in this paper can help public transport planners to analyze the status quo of the BTN in nature. Project supported by the National High Technology Research and Development Program of China (Grant No. 2014AA110304).

Rheology and adhesion of poly(acrylic acid)/laponite nanocomposite hydrogels as biocompatible adhesives.

PubMed

Shen, Muxian; Li, Li; Sun, Yimin; Xu, Jun; Guo, Xuhong; Prud'homme, Robert K

2014-02-18

Biocompatible nanocomposite hydrogels (NC gels) consisting of poly(acrylic acid) (PAA) and nanosized clay (Laponite) were successfully synthesized by in situ free-radical polymerization of acrylic acid (AA) in aqueous solutions of Laponite. The obtained NC gels were uniform and transparent. Their viscosity, storage modulus G', and loss modulus G″ increased significantly upon increasing the content of Laponite and the dose of AA, while exhibiting a maximum with increasing the neutralization degree of AA. They showed tunable adhesion by changing the dose of Laponite and monomer as well as the neutralization degree of AA, as determined by 180° peel strength measurement. The maximal adhesion was shown when reaching a balance between cohesion and fluidity. A homemade Johnson-Kendall-Roberts (JKR) instrument was employed to study the surface adhesion behavior of the NC gels. The combination of peel strength, rheology, and JKR measurements offers the opportunity of insight into the mechanism of adhesion of hydrogels. The NC gels with tunable adhesion should be ideal candidates for dental adhesive, wound dressing, and tissue engineering.

IMAGING THE DISK AND JET OF THE CLASSICAL T TAURI STAR AA TAU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cox, Andrew W.; Grady, Carol A.; Hammel, Heidi B.

2013-01-01

Previous studies of the classical T Tauri star AA Tau have interpreted the UX-Orionis-like photo-polarimetric variability as being due to a warp in the inner disk caused by an inclined stellar magnetic dipole field. We test that these effects are macroscopically observable in the inclination and alignment of the disk. We use Hubble Space Telescope (HST)/STIS coronagraphic imagery to measure the V magnitude of the star for both STIS coronagraphic observations, compare these data with optical photometry in the literature, and find that, unlike other classical T Tauri stars observed in the same HST program, the disk is most robustlymore » detected in scattered light at stellar optical minimum light. We measure the outer disk radius, 1.''15 {+-} 0.''10, major-axis position angle, and disk inclination and find that the inner disk, as reported in the literature, is both misinclined and misaligned with respect to the outer disk. AA Tau drives a faint jet, detected in both STIS observations and in follow-on Goddard Fabry-Perot imagery, which is also misaligned with respect to the projection of the outer disk minor axis and is poorly collimated near the star, but which can be traced 21'' from the star in data from 2005. The measured outer disk inclination, 71 Degree-Sign {+-} 1 Degree-Sign , is out of the range of inclinations suggested for stars with UX-Orionis-like variability when no grain growth has occurred in the disk. The faintness of the disk, small disk size, and detection of the star despite the high inclination all indicate that the dust disk must have experienced grain growth and settling toward the disk midplane, which we verify by comparing the observed disk with model imagery from the literature.« less

Comparing Panelists' Understanding of Standard Setting across Multiple Levels of an Alternate Science Assessment

ERIC Educational Resources Information Center

Hansen, Mary A.; Lyon, Steven R.; Heh, Peter; Zigmond, Naomi

2013-01-01

Large-scale assessment programs, including alternate assessments based on alternate achievement standards (AA-AAS), must provide evidence of technical quality and validity. This study provides information about the technical quality of one AA-AAS by evaluating the standard setting for the science component. The assessment was designed to have…

Vaginal douching in adolescents attending a family planning clinic

PubMed

Foch; McDaniel; Chacko

2000-05-01

Background: One of the variables most consistently associated with vaginal douching is race, with African-American women douching more regularly. Sparse data exists in the medical literature about the practice of vaginal douching among adolescents. The purpose of this study was to assess the prevalence, knowledge, attitude, and practices of vaginal douching among adolescent females attending a public family planning clinic, and determine whether African-American (AA) females douche to a greater degree than Caucasian females.Methods: In this cross-sectional study, a one-page questionnaire was administered to all adolescent females (

Effect of Chronic Training on Heart Rate Variability, Salivary IgA and Salivary Alpha-Amylase in Elite Swimmers with a Disability

PubMed Central

Edmonds, Rohan

2015-01-01

The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic nervous system influence on sAA. PMID:26043224

Effect of chronic training on heart rate variability, salivary IgA and salivary alpha-amylase in elite swimmers with a disability.

PubMed

Edmonds, Rohan; Burkett, Brendan; Leicht, Anthony; McKean, Mark

2015-01-01

The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic nervous system influence on sAA.

Transforming the Terminal Associates of Applied Science into a Four-Year Degree: A Win-Win Situation for Students, Community Colleges, Universities, and Businesses

ERIC Educational Resources Information Center

Batts, David L.; Pagliari, Leslie R.

2013-01-01

Associates of Applied Science (AAS) degrees were once considered terminal degrees and were developed for people seeking technical skills to join the workforce. This paper discusses the transformation from a transferable degree into technical four-year baccalaureate degree. It also discusses survey results of students currently in a degree…

45 CFR 170.575 - Removal of the ONC-AA.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.575 Removal of the ONC-AA. (a...

45 CFR 170.575 - Removal of the ONC-AA.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.575 Removal of the ONC-AA. (a...

The Microjet of AA Tau

NASA Astrophysics Data System (ADS)

Cox, A. W.; Hilton, G. M.; Williger, G. M.; Grady, C. A.; Woodgate, B.

2005-12-01

The microjet of AA Tau A.W. Cox (Atholton High School, Columbia MD), G.M. Hilton (SSAI and GSFC), G.M. Williger (JHU and U. Louisville), C.A. Grady (Eureka Scientific and GSFC) B.Woodgate (NASA's GSFC) AA Tau is a classical T Tauri star with a spatially resolved disk viewed at approximately 70 degrees from pole-on. Photo-polarimetric variability of the star has been interpreted as being caused by the stellar magnetic field being inclined at 30 degrees with respect to the stellar rotation axis, producing a warp in the inner disk. Under these conditions, any jet should be less collimated than typical of T Tauri microjets, and should show signs of the jet axis precessing around the stellar rotation axis. When compared with the microjets imaged in the HST/STIS coronagraphic imaging survey, the AA Tau jet has an opening half-angle of approximately 10-15 degrees rather than the 3-5 degrees typical of the other T Tauri stars which have been coronagraphically imaged by HST/STIS. Using the HST data with ultra-narrowband imagery and long slit spectroscopy obtained with the Goddard Fabry-Perot and the Dual Imaging Spectrograph at the Apache Point Observatory 3.5m telescope, we derive the jet inclination, knot ejection epochs, and ejection frequency. We also compare the jet opening angle with model predictions. Apache Point Observatory observations with the Goddard Fabry-Perot were made through a grant of Director's Discretionary Time. Apache Point Observatory is operated by the Astrophysical Research Consortium. The GFP was supported under NASA RTOP 51-188-01-22 to GSFC. Grady is supported under NASA contract NNH05CD30C to Eureka Scientific.

Renal Liver-Type Fatty Acid Binding Protein (L-FABP) Attenuates Acute Kidney Injury in Aristolochic Acid Nephrotoxicity

PubMed Central

Matsui, Katsuomi; Kamijo-Ikemorif, Atsuko; Sugaya, Takeshi; Yasuda, Takashi; Kimura, Kenjiro

2011-01-01

Injection of aristolochic acid (AA) in mice causes AA-induced nephrotoxicity, in which oxidative stress contributes to development of tubulointerstitial damage (TID). Liver-type fatty acid binding protein (L-FABP) is expressed in human proximal tubules and has an endogenous antioxidative function. The renoprotection of renal L-FABP was examined in a model of AA-induced nephrotoxicity. Established human L-FABP (hL-FABP) transgenic (Tg) mice and wild-type (WT) mice were treated with AA for up to 5 days. Mice were sacrificed on days 1, 3, and 5 after the start of AA injection. Although mouse L-FABP was not expressed in proximal tubules of WT mice, hL-FABP was expressed in proximal tubules of Tg mice. The expression of renal hL-FABP was significantly increased in Tg mice administered AA (Tg-AA), compared with the control (saline-treated Tg mice). In WT-AA mice, there was high urinary excretion of Nε-(hexanoyl)-lysine, the production of heme oxygenase-1 and receptor for advanced glycation end products increased, and TID was provoked. In contrast, renal hL-FABP in Tg-AA mice suppressed production of Nε-(hexanoyl)lysine, heme oxygenase-1, and receptor for advanced glycation end products. Renal dysfunction was significantly milder in Tg-AA mice than in WT-AA mice. The degree of TID was significantly attenuated in Tg-AA mice, compared with WT-AA. In conclusion, renal hL-FABP reduced the oxidative stress in AA-induced nephrotoxicity and attenuated TID. PMID:21356355

45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... responsibilities. 170.503 Section 170.503 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Permanent Certification Program for HIT...

45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... responsibilities. 170.503 Section 170.503 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Permanent Certification Program for HIT...

Abstinence-Only Sex Education Fails African American Youth.

PubMed

Breunig, Michelle

Sexually transmitted infections (STIs) disproportionately affect U.S. African American (AA) youth. In AA faith communities, cultural practices have contributed to increased STI rates because abstinence-only-until-marriage education programs do not teach the use of condoms or birth control for preventing STIs or pregnancy. Comprehensive sex education or abstinence-plus programs have been reported to increase STI knowledge and reduce risk-taking behaviors in adolescents and young adults. Evidence supports computerized education to increase STI knowledge and decrease risky sexual behaviors of AA churchgoing youth.

Wind Energy Workforce Development: Engineering, Science, & Technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lesieutre, George A.; Stewart, Susan W.; Bridgen, Marc

2013-03-29

Broadly, this project involved the development and delivery of a new curriculum in wind energy engineering at the Pennsylvania State University; this includes enhancement of the Renewable Energy program at the Pennsylvania College of Technology. The new curricula at Penn State includes addition of wind energy-focused material in more than five existing courses in aerospace engineering, mechanical engineering, engineering science and mechanics and energy engineering, as well as three new online graduate courses. The online graduate courses represent a stand-alone Graduate Certificate in Wind Energy, and provide the core of a Wind Energy Option in an online intercollege professional Mastersmore » degree in Renewable Energy and Sustainability Systems. The Pennsylvania College of Technology erected a 10 kilowatt Xzeres wind turbine that is dedicated to educating the renewable energy workforce. The entire construction process was incorporated into the Renewable Energy A.A.S. degree program, the Building Science and Sustainable Design B.S. program, and other construction-related coursework throughout the School of Construction and Design Technologies. Follow-on outcomes include additional non-credit opportunities as well as secondary school career readiness events, community outreach activities, and public awareness postings.« less

A Comparison of Associate in Arts Transfer Rates between 1994-95 and 1998-99.

ERIC Educational Resources Information Center

Windham, Patricia

This study of the of the Florida Community College System compares Associate of Arts (AA) transfers over a five-year period, from 1994-95 to 1998-99. The study tracked transfers with Florida's centralized student database system, which uses social security numbers as student identifiers. It included only students who completed the AA degree, and…

Links for Academic Learning (LAL): A Conceptual Model for Investigating Alignment of Alternate Assessments Based on Alternate Achievement Standards

ERIC Educational Resources Information Center

Flowers, Claudia; Wakeman, Shawnee; Browder, Diane M.; Karvonen, Meagan

2009-01-01

This article describes an alignment procedure, called Links for Academic Learning (LAL), for examining the degree of alignment of alternate assessments based on alternate achievement standards (AA-AAS) to grade-level content standards and instruction. Although some of the alignment criteria are similar to those used in general education…

Racial Differences in Prediction of Time to Prostate Cancer Diagnosis in a Prospective Screening Cohort of High-Risk Men: Effect of TMPRSS2 Met160Val

PubMed Central

Giri, Veda N.; Ruth, Karen; Hughes, Lucinda; Uzzo, Robert G.; Chen, David Y.T.; Boorjian, Stephen A.; Viterbo, Rosalia; Rebbeck, Timothy R.

2011-01-01

Introduction The TMPRSS2-ERG gene fusion occurs in >50% of prostate tumors and has been associated with poor outcomes. The T-allele (Valine) of the Met160Val (rs12329760) in TMPRSS2 has been associated with this fusion. We evaluated this polymorphism with respect to self-identified race or ethnicity (SIRE), time to prostate cancer (PCA) diagnosis, and screening parameters in the Prostate Cancer Risk Assessment Program, a prospective screening program for high-risk men. Patients and Methods 631 men ages 35-69 years were studied. “High-risk” was defined as ≥ one first degree or two second degree relatives with PCA, any African American (AA) man regardless of familial PCA, and men with BRCA1/2 mutations. Men with elevated PSA or other indications for PCA underwent biopsy. Men were followed from time of study entry to PCA diagnosis. Cox models were used to evaluate time to PCA diagnosis by genotype. Results Genotype distribution differed significantly by SIRE (CT/TT vs. CC, p<0.0001). Among 183 Caucasian men with at least one follow-up visit, PCA was more than doubled in men carrying CT/TT vs CC genotypes (HR= 2.55, 95% CI=1.14-5.70) after controlling for age and PSA. No association was seen among AA men by TMPRSS2 genotype. Conclusions The T-allele of the Met160Val variant in TMPRSS2, which has been associated with the TMPRSS2-ERG fusion, may be informative of time to PCA diagnosis for a subset of high-risk Caucasian men who are undergoing regular PCA screening. This variant along with other genetic markers warrant further study for personalizing PCA screening. PMID:20735386

Nevada Renewable Energy Training Project: Geothermal Power Plant Operators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jim, Nichols

2014-04-29

The purpose of this project was to develop and institute a training program for certified geothermal power plant operators (GPO). An advisory board consisting of subject matter experts from the geothermal energy industry and academia identified the critical skill sets required for this profession. A 34-credit Certificate of Achievement (COA), Geothermal Power Plant Operator, was developed using eight existing courses and developing five new courses. Approval from the Nevada System of Higher Education Board of Regents was obtained. A 2,400 sq. ft. geothermal/fluid mechanics laboratory and a 3,000 sq. ft. outdoor demonstration laboratory were constructed for hands-on training. Students alsomore » participated in field trips to geothermal power plants in the region. The majority of students were able to complete the program in 2-3 semesters, depending on their level of math proficiency. Additionally the COA allowed students to continue to an Associate of Applied Science (AAS), Energy Technologies with an emphasis in Geothermal Energy (26 additional credits), if they desired. The COA and AAS are stackable degrees, which provide students with an ongoing career pathway. Articulation agreements with other NSHE institutions provide students with additional opportunities to pursue a Bachelor of Applied Science in Management or Instrumentation. Job placement for COA graduates has been excellent.« less

45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.

Code of Federal Regulations, 2014 CFR

2014-10-01

... responsibilities. 170.503 Section 170.503 Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.503...

45 CFR 170.503 - Requests for ONC-AA status and ONC-AA ongoing responsibilities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... responsibilities. 170.503 Section 170.503 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.503...

Intergranular corrosion in AA5XXX aluminum alloys with discontinuous precipitation at the grain boundaries

NASA Astrophysics Data System (ADS)

Bumiller, Elissa

The US Navy currently uses AA5xxx aluminum alloys for structures exposed to a marine environment. These alloys demonstrate excellent corrosion resistance over other aluminum alloys (e.g., AA2xxx or AA7xxx) in this environment, filling a niche in the marine structures market when requiring a light-weight alternative to steel. However, these alloys are susceptible to localized corrosion; more specifically, intergranular corrosion (IGC) is of concern. IGC of AA5xxx alloys due to the precipitation of beta phase on the grain boundaries is a well-established phenomenon referred to as sensitization. At high degrees of sensitization, the IGC path is a continuous anodic path of beta phase particles. At lower degrees of sensitization, the beta phase coverage at the grain boundaries is not continuous. The traditional ranges of susceptibility to IGC as defined by ASTM B928 are in question due to recent studies. These studies showed that even at mid range degrees of sensitization where the beta phase is no longer continuous, IGC may still occur. Previous thoughts on IGC of these alloy systems were founded on the idea that once the grain boundary precipitate became discontinuous the susceptibility to IGC was greatly reduced. Additionally, IGC susceptibility has been defined metallurgically by compositional gradients at the grain boundaries. However, AA5xxx alloys show no compositional gradients at the grain boundaries, yet are still susceptible to IGC. The goal of this work is to establish criteria necessary for IGC to occur given no continuous beta phase path and no compositional gradient at the grain boundaries. IGC performance of the bulk alloy system AA5083 has been studied along with the primary phases present in the IGC system: alpha and beta phases using electrochemistry and modeling as the primary tools. Numerical modeling supports that at steady-state the fissure tip is likely saturated with Mg in excess of the 4% dissolved in the matrix. By combining these results, quantitative insights into the IGC susceptibility of AA5xxx alloys is gained. As the aspect ratio increases, the concentration of metal ions in the fissure solution increases, thus driving up the ability to form corrosion product, whether precipitate or gelatinous product. As the theta beta increases, the IGC rates increase for a constant potential. By a combination of aspect ratio, φp, thetabeta, and likely fissure chemistry, the potential drop within the fissure is fully described and the IGC penetration rate can be predicted.

The controlled preparation of polypyrrole nanostructures via tuning the concentration of acrylic acid.

PubMed

Wang, Yujie; Zhong, Wenbin; Ning, Xutao; Li, Yuntao; Chen, Xiaohua; Wang, Yongxin; Yang, Wantai

2013-03-01

Two types of nanostructures, nanowires and nanoribbons were prepared with polypyrrole (PPy) by controlling the concentration of acrylic acid (AA) in systems containing cationic surfactant, cetyltrimethylammonium bromide (CTAB) at about 12 degrees C. The effect of reaction conditions involving the concentration of AA, CTAB, pyrrole as well as the reaction temperature was systematically studied on the final structures of prepared PPy. The results revealed that the polymerization of AA, resulting in PAA, played a key role in the evolution of PPy nanostructures. A possible mechanism was briefly discussed on the formation of these two nanostructures, nanowires and nanoribbons.

Exploring Reading Growth Profiles for Middle School Students with Significant Cognitive Disabilities

ERIC Educational Resources Information Center

Farley, Daniel Patrick

2017-01-01

Statewide accountability programs are incorporating academic growth estimates for general assessments. This transition focuses attention on modeling growth for students with significant cognitive disabilities (SWSCD) who take alternate assessments based on alternate achievement standards (AA-AAS), as most states attempt to structure their AA-AAS…

Structural Brain Imaging of Long-Term Anabolic-Androgenic Steroid Users and Nonusing Weightlifters.

PubMed

Bjørnebekk, Astrid; Walhovd, Kristine B; Jørstad, Marie L; Due-Tønnessen, Paulina; Hullstein, Ingunn R; Fjell, Anders M

2017-08-15

Prolonged high-dose anabolic-androgenic steroid (AAS) use has been associated with psychiatric symptoms and cognitive deficits, yet we have almost no knowledge of the long-term consequences of AAS use on the brain. The purpose of this study is to investigate the association between long-term AAS exposure and brain morphometry, including subcortical neuroanatomical volumes and regional cortical thickness. Male AAS users and weightlifters with no experience with AASs or any other equivalent doping substances underwent structural magnetic resonance imaging scans of the brain. The current paper is based upon high-resolution structural T1-weighted images from 82 current or past AAS users exceeding 1 year of cumulative AAS use and 68 non-AAS-using weightlifters. Images were processed with the FreeSurfer software to compare neuroanatomical volumes and cerebral cortical thickness between the groups. Compared to non-AAS-using weightlifters, the AAS group had thinner cortex in widespread regions and significantly smaller neuroanatomical volumes, including total gray matter, cerebral cortex, and putamen. Both volumetric and thickness effects remained relatively stable across different AAS subsamples comprising various degrees of exposure to AASs and also when excluding participants with previous and current non-AAS drug abuse. The effects could not be explained by differences in verbal IQ, intracranial volume, anxiety/depression, or attention or behavioral problems. This large-scale systematic investigation of AAS use on brain structure shows negative correlations between AAS use and brain volume and cortical thickness. Although the findings are correlational, they may serve to raise concern about the long-term consequences of AAS use on structural features of the brain. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

The AAS Visiting Professor Programs: Three Anniversaries

NASA Astrophysics Data System (ADS)

Philip, A. G. Davis

2003-05-01

The AAS Program of Visiting Professors was started in 1958 with three astronomers as lecturers. They were Paul Merrill (Mt. Wilson and Palomar Observatories), Seth Nicholson (Mt. Wilson and Palomar Observatories) and Harlow Shapley (Harvard College Observatory). The program was run by a Committee on Visiting Professors from 1958 through 1963. The program was funded by grants from the National Science Foundation. The Executive Officer of the AAS, Paul Routley headed the program from the 1963 - 64 academic year through the 1968 - 69 academic year. Larry Fredrick headed the program for 1969 - 70 and then Hank Gurin headed it through 1973 -74, the last year of the program. At the end of this summer meeting, the combined Visiting Professors Program and the Shapley Program will be starting their 47th year. The Shapley Visiting Lectureships in Astronomy Program was started in the 1974 - 75 academic year under the leadership of Hank Gurin. The original funding came from the Perkin Fund and a three year grant from the Research Corporation. In 1975 the Shapley Endowment fund was set up to help pay the expenses of the program. In 1976 there was support from the Slipher fund which lasted through the 1978 - 79 academic year. From 1979 to the present the program is financed by the Shapley Endowment Fund and by the contributions made by institutions which host the visits. In the fall of 1998 the fee that Institutions pay to the AAS in support of their Shapley visits was reduced from 300 to 250 to make it easier for them to apply for visits. Members of the AAS have made contributions to the program over the years and we are very appreciative of this support. In 1974 there were 42 lecturers in the program, of whom four are still active giving lectures (George Carruthers, Larry Fredrick, Arlo Landolt and Davis Philip). After the summer meeting, the Shapley Program will be embarking on its 30th year. Now there are 82 astronomers in the program and we get from 40 to 60 requests a year. Shapley visits have been made to Canadian institutions since 1976 and to Mexican institutions since 1998. After the summer meeting it will be the start of the 10th year of my directing the program. On May 26 there will be a Shapley Dinner at Dyer Observatory in Nashville for the Shapley lecturers who are attending the AAS meeting and we will celebrate these three anniversaries.

A Status Report on the AAS Astronomy Ambassadors Program

NASA Astrophysics Data System (ADS)

Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

2014-06-01

The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

Education and Public Outreach at the American Astronomical Society

NASA Astrophysics Data System (ADS)

Fienberg, R. T.

2011-09-01

Recently the Council of the American Astronomical Society (AAS) adopted its first-ever mission-and-vision statement. Independently, the Astronomy Education Board (AEB), which has oversight of the Society's educational activities, adopted new goals for the AAS education program. Much of the responsibility for aligning the AAS mission-and-vision statement and AEB goals and implementing them is vested in a new position: AAS Press Officer and Education and Outreach Coordinator. Here I describe the AAS's priorities for education and public outreach and explain how they are being, or will be, achieved.

A Capstone Experience in Physics

NASA Astrophysics Data System (ADS)

Ba, Jean-Claude; Lott, Trina

1997-04-01

This is an intergrated science course required for all AS/AA degree seeking students. It includes; ethical issues in science, the scientific method and interpretation of scientific results. This paper will present the work done by the only student enrolled in the course Autumn Quarter 1996. This course is in its 2 nd year at Columbus State Community College and may open the door to the development of more programs/courses that will introduce students from two-year Colleges to the different steps of a research project of a research project. In the future such projects could be completed in a local company as part of an internship.

Effect of temperature on Brettanomyces bruxellensis: metabolic and kinetic aspects.

PubMed

Brandam, Cédric; Castro-Martínez, Claudia; Délia, Marie-Line; Ramón-Portugal, Felipe; Strehaiano, Pierre

2008-01-01

The effect of temperatures ranging from 15 to 35 degrees C on a culture of Brettanomyces bruxellensis was investigated in regards to thermodynamics, metabolism, and kinetics. In this temperature range, we observed an increase in growth and production rates. The growth behavior was well represented using the Arrhenius model, and an apparent activation energy of 16.61 kcal/mol was estimated. A stuck fermentation was observed at 35 degrees C as represented by high cell death. The carbon balance established that temperature had no effect on repartition of the glucose consumption between biomass and products. Hence, the same biomass concentration was obtained for all temperatures, except at 35 degrees C. Moreover, using logistic and Luedeking-Piret models, we demonstrated that production rates of ethanol and acetic acid were partially growth associated. Parameters associated with growth (alpha eth and alpha aa) remained constant with changing temperature, whereas, parameters associated with the population (beta eth and beta aa) varied. Optimal values were obtained at 32 degrees C for ethanol and at 25 degrees C for acetic acid.

[Therapeutic effect of nux vomica total alkali gel on adjuvants arthritis rats].

PubMed

Zheng, Yongqiu; Wu, Zhenzhen; Liu, Jianxun; Hu, Jie; Yang, Chi

2012-05-01

To observe the therapeutic effect and mechanism of nux vomica total alkali gel (NVTAG) on adjuvants arthritis (AA) rats. SD rats were randomly divided into nine groups: the normal group, the AA model group, NVTAG high, middle and low-dose (25, 12.5, 6.25 mg x kg(-1)) groups and the Votalin control (diclofenac diethylamine emulgel, 50 mg x kg(-1)) group. Except for the normal group, the remaining groups were transcutaneously administered with 0.1 mL freund's adjuvant complete (FCA) for inflammation in left rear feet and then evenly treated with medicine and packed with oilpapers. The foot volume method was adopted to determine foot swelling degree, with pain scoring and polyarthritis scoring. HE staining was used to observe arthro-pathologic injury. The content of prostaglandin E2 (PGE2), interleukin-1 (IL-1), IL-6, tumor necrosis factor (TNF-alpha) and vascular epidermal growth factor (VEGF) in synovium homogenates were measured by enzyme-linked immuno-absorbent assay (ELISA) respectively. Compared with the model group, NVTAG and control gel can obviously reduce the foot swelling degree, polyarthritis indicators and relieve arthro-pathologic injury in AA rats (17-21 d). The levels of IL-1, PGE2, IL-6, VEGF and TNF-alpha in synovial homogenates of AA rats were also reduced by NVTAG significantly. NVTAG shows an antergic effect on AA progress in rats, which is closely related to inhibition of development of inflammatory mediator.

Prevalence of any size adenomas and advanced adenomas in 40- to 49-year-old individuals undergoing screening colonoscopy because of a family history of colorectal carcinoma in a first-degree relative.

PubMed

Gupta, Akshay K; Samadder, Jewel; Elliott, Eric; Sethi, Saurabh; Schoenfeld, Philip

2011-07-01

Per current guidelines, patients with a first-degree relative (FDR) with colorectal cancer (CRC) should get screened at least at age 40. Data about the prevalence of adenomas and advanced adenomas (AAs) in these patients are lacking. To examine the prevalence of adenomas and AAs in 40- to 49-year-old individuals undergoing screening colonoscopy for family history of CRC. Retrospective chart review. Asymptomatic patients 40 to 49 years of age undergoing their first screening colonoscopy at the University of Michigan during the period 1999 to 2009 because of an FDR with CRC. Prevalence of adenomas (any size), AAs, and risk factors associated with adenomas. Among 640 study patients, the prevalence of adenomas (any size) was 15.4% and 3.3% for AAs. Adenoma prevalence was lower if the FDR with CRC was younger than 60 years of age versus an FDR with CRC older than 60 years of age (12.4% vs 19%, P = .034). Male sex (odds ratio 2.6; 95% CI, 1.06-4.4) and advancing age (odds ratio 1.16; 95% CI, 1.03-1.31) were associated with adenomas. Limited data on risk factor exposure and insufficient sample size to assess risk factors for AAs. Among 40- to 49-year-old patients undergoing screening colonoscopy because of an FDR with CRC, the prevalence of adenomas and AAs is low. Further research should determine whether these individuals have a higher prevalence of adenomas compared with average-risk individuals. Copyright © 2011 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.

Identification of conjugate adducts formed in the reactions of malonaldehyde-acetaldehyde and malonaldehyde-formaldehyde with cytidine.

PubMed

Pluskota-Karwatka, Donata; Le Curieux, Frank; Munter, Tony; Sjöholm, Rainer; Kronberg, Leif

2002-02-01

Malonaldehyde was reacted with cytidine in buffered aqueous solutions in the presence of acetaldehyde or formaldehyde. The reaction mixtures were analyzed by HPLC, and the products were isolated by preparative C18 chromatography and structurally characterized by UV absorbance, fluorescence emission, (1)H and (13)C NMR spectroscopy, and mass spectrometry. The major adducts formed in the reaction of malonaldehyde and acetaldehyde were identified as 7-(beta-D-ribofuranosyl)-4-methyl-6-oxo-6,7-dihydro-4H-pyrimido[1,6-a]pyrimidine-3-carbaldehyde (M(1)AA-Cyd) and 1-(beta-D-ribofuranosyl)-4-(3,5-diformyl-4-methyl-1,4-dihydro-1-pyridyl)pyrimidine (M(2)AA-Cyd). In the reaction of malonaldehyde and formaldehyde, the major product was identified as 7-(beta-D-ribofuranosyl)-6-oxo-6,7-dihydro-4H-pyrimido[1,6-a]pyrimidine-3-carbaldehyde (M(1)FA-Cyd). The highest yields of M(1)AA-Cyd and M(2)AA-Cyd, 3.2 and 0.5 mol %, respectively, were obtained in the reaction performed at pH 4.6 and 37 degrees C for 8 days, while M(1)FA-Cyd was produced at a yield of 0.3 mol % after 3 days of reaction at pH 4.0 and 37 degrees C. The products consist of units derived from malonaldehyde and acetaldehyde (M(1)AA-Cyd and M(2)AA-Cyd) or from malonaldehyde and formaldehyde (M(1)FA-Cyd), and are thus further examples of nucleoside modifications containing structural elements derived from aldehyde condensation reactions. Trace amounts of the adducts may be formed at physiological conditions and may be involved in the mutagenicity of the studied aldehydes.

40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

Code of Federal Regulations, 2013 CFR

2013-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to...

40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

Code of Federal Regulations, 2012 CFR

2012-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to...

40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

Code of Federal Regulations, 2011 CFR

2011-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to...

Motivational interviewing fails to improve outcomes of a behavioral weight loss program for obese African American women: a pilot randomized trial.

PubMed

Befort, Christie A; Nollen, Nicole; Ellerbeck, Edward F; Sullivan, Debra K; Thomas, Janet L; Ahluwalia, Jasjit S

2008-10-01

Compared to other racial/ethnic groups, African American (AA) women are more likely to be obese but less likely to participate in weight loss interventions or to successfully lose weight. Sustained motivation for weight loss may be especially difficult for AA women due to socioeconomic and cultural factors. The purpose of this study was to examine whether the addition of motivational interviewing (MI) to a culturally-targeted behavioral weight loss program for AA women improved adherence to the program, diet and physical activity behaviors, and weight loss outcomes. Forty-four obese (mean BMI = 39.4, SD = 7.1) AA women were randomized to receive a 16-week behavioral weight loss program plus four MI sessions, or the same behavioral weight loss program plus four health education (HE; attention control) sessions. Results showed that participants in both MI and HE conditions lost a significant amount of weight, reduced their energy intake and percent calories from fat, and increased their fruit and vegetable consumption (ps < .05). However, adherence to the behavioral weight loss program and changes in diet, physical activity, and weight did not differ across MI and HE conditions. Future research is warranted to determine the subpopulations with which MI is most effective.

Significant association between renal function and area of amyloid deposition in kidney biopsy specimens in both AA amyloidosis associated with rheumatoid arthritis and AL amyloidosis.

PubMed

Kuroda, Takeshi; Tanabe, Naohito; Hasegawa, Eriko; Wakamatsu, Ayako; Nozawa, Yukiko; Sato, Hiroe; Nakatsue, Takeshi; Wada, Yoko; Ito, Yumi; Imai, Naofumi; Ueno, Mitsuhiro; Nakano, Masaaki; Narita, Ichiei

2017-06-01

The kidney is a major target organ for systemic amyloidosis, which results in proteinuria and an elevated serum creatinine level. The clinical manifestations and precursor proteins of amyloid A (AA) and light-chain (AL) amyloidosis are different, and the renal damage due to amyloid deposition also seems to differ. The purpose of this study was to clarify haw the difference in clinical features between AA and AL amyloidosis are explained by the difference in the amount and distribution of amyloid deposition in the renal tissues. A total of 119 patients participated: 58 patients with an established diagnosis of AA amyloidosis (AA group) and 61 with AL amyloidosis (AL group). We retrospectively investigated the correlation between clinical data, pathological manifestations, and the area occupied by amyloid in renal biopsy specimens. In most of the renal specimens the percentage area occupied by amyloid was less than 10%. For statistical analyses, the percentage area of amyloid deposition was transformed to a common logarithmic value (Log 10 %amyloid). The results of sex-, age-, and Log 10 %amyloid-adjusted analyses showed that systolic blood pressure (SBP) was higher in the AA group. In terms of renal function parameters, serum creatinine, creatinine clearance (Ccr) and estimated glomerular filtration rate (eGFR) indicated significant renal impairment in the AA group, whereas urinary protein indicated significant renal impairment in the AL group. Pathological examinations revealed amyloid was predominantly deposited at glomerular basement membrane (GBM) and easily transferred to the mesangial area in the AA group, and it was predominantly deposited at in the AL group. The degree of amyloid deposition in the glomerular capillary was significantly more severe in AL group. The frequency of amyloid deposits in extraglomerular mesangium was not significantly different between the two groups, but in AA group, the degree amyloid deposition was significantly more severe, and the deposition pattern in the glomerulus was nodular. Nodular deposition in extraglomerular mesangium leads to renal impairment in AA group. There are significant differences between AA and AL amyloidosis with regard to the renal function, especially in terms of Ccr, eGFR and urinary protein, even after Log10%amyloid was adjusted; showing that these inter-group differences in renal function would not be depend on the amount of renal amyloid deposits. These differences could be explained by the difference in distribution and morphological pattern of amyloid deposition in the renal tissue.

The Effectiveness of the AAS REU Program

NASA Astrophysics Data System (ADS)

Hemenway, M. K.; Boyce, P. B.; Milkey, R. W.

1996-05-01

In an attempt to address the particular needs of astronomy faculty and undergraduate students, in 1991 the Education Office of the American Astronomical Society approached the National Science Foundation with a unique proposal for funding through the Research Experiences for Undergraduates program. The goals of the AAS program were to "slow the hemorrhage of students out of science...", extend the REU program to non-NSF-funded scientists, to reach under-represented women and minority students particularly in small educational institutions, and to encourage research scientists there to mentor students. As this grant has now expired, the AAS has surveyed the 44 mentors and their students to assess the program's effect on the mentor and the mentor's career; the educational institution; and the student's education and career choices. More than half the mentors responded by the abstract deadline. The program clearly had an effect upon the individuals involved. The greatest effect (in 85% of the cases) was to develop more interest in the mentor's research project both among the students and among the mentor's faculty colleagues. The mentors rated the grant to be a medium or strong factor in their student's decision to pursue graduate study, which 90% of them did. All but one of the AAS-REU students attended an AAS meeting and 3/4 of those gave a paper on their project research. Over 90% of the mentors felt that the research experience strongly promoted a greater interest in science, a greater understanding of science and a desire to continue in science. According to the mentors, this was a very positive and beneficial program for the students as well as for themselves.

Spectroscopic signatures of AA' and AB stacking of chemical vapor deposited bilayer MoS 2

DOE PAGES

Xia, Ming; Li, Bo; Yin, Kuibo; ...

2015-11-04

We discuss prominent resonance Raman and photoluminescence spectroscopic differences between AA'and AB stacked bilayer molybdenum disulfide (MoS 2) grown by chemical vapor deposition are reported. Bilayer MoS 2 islands consisting of the two stacking orders were obtained under identical growth conditions. Also, resonance Raman and photoluminescence spectra of AA' and AB stacked bilayer MoS 2 were obtained on Au nanopyramid surfaces under strong plasmon resonance. Both resonance Raman and photoluminescence spectra show distinct features indicating clear differences in interlayer interaction between these two phases. The implication of these findings on device applications based on spin and valley degrees of freedom.

Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

PubMed

Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

1997-04-11

Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

Effect of tenderizers combined with organic acids on Escherichia coli O157:H7 thermal resistance in non-intact beef.

PubMed

Yoon, Yohan; Mukherjee, Avik; Belk, Keith E; Scanga, John A; Smith, Gary C; Sofos, John N

2009-07-31

Non-intact beef products include beef cuts that have been ground, mechanically tenderized, restructured, or have been injected with solutions to enhance tenderness and/or flavor. This study examined the effects of tenderizing salts and organic acids on thermal inactivation of Escherichia coli O157:H7 in a ground beef model system simulating non-intact beef products. Ground beef (95% lean; 700 g batches) was mixed (2 min) with nothing (C) or solutions (22 ml) of water (WA), calcium ascorbate (CaA, 0.86%; wt/wt), calcium chloride (CaC, 0.23%; wt/wt), acetic acid (AA, 0.3%; v/wt), citric acid (CA, 0.2%; wt/wt), NaCl (NA, 0.5%; wt/wt), and mixtures of CaA/NA, CaC/NA, AA/NA, CA/NA, CaA/CaC/NA, CaA/AA/NA, CaA/CA/NA, CaC/AA/NA and CaC/CA/NA. Samples (30 g) were extruded into test tubes, inoculated (7 log CFU/g) with E. coli O157:H7 (5-strain mixture), and stored (4 degrees C) overnight. Samples were then cooked to 60 degrees C or 65 degrees C, in a water bath, to simulate rare or medium-rare doneness of beef, respectively. Weight, fat and moisture losses, total bacterial (tryptic soy agar) and E. coli O157:H7 (modified eosin methylene blue agar, and modified sorbitol MacConkey agar) populations were determined after inoculation, storage, and cooking. Fat and moisture losses were not affected by treatment and temperature, while weight losses increased at 65 degrees C and in acid treated samples (60 degrees C). E. coli O157:H7 survivors were generally lower (P<0.05) in acid treated than non-acid treated samples. Pathogen counts in samples treated with tenderizers (CaA, CaC) and NA were not different (P> or =0.05) than those of control samples. Thus, inclusion of organic acids in beef tenderizing recipes may help in thermal inactivation of E. coli O157:H7 that may been transferred to the interior of non-intact products during their production.

AAS Career Services

NASA Astrophysics Data System (ADS)

Marvel, Kevin B.

2012-08-01

The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

Minimal Polynomial Method for Estimating Parameters of Signals Received by an Antenna Array

NASA Astrophysics Data System (ADS)

Ermolaev, V. T.; Flaksman, A. G.; Elokhin, A. V.; Kuptsov, V. V.

2018-01-01

The effectiveness of the projection minimal polynomial method for solving the problem of determining the number of sources of signals acting on an antenna array (AA) with an arbitrary configuration and their angular directions has been studied. The method proposes estimating the degree of the minimal polynomial of the correlation matrix (CM) of the input process in the AA on the basis of a statistically validated root-mean-square criterion. Special attention is paid to the case of the ultrashort sample of the input process when the number of samples is considerably smaller than the number of AA elements, which is important for multielement AAs. It is shown that the proposed method is more effective in this case than methods based on the AIC (Akaike's Information Criterion) or minimum description length (MDL) criterion.

Effects of acetaldehyde and L-carnitine on morphology and enzyme activity of myocardial mitochondria in rats.

PubMed

Jin, Yuan-Zhe; Wang, Guo-Feng; Wang, Qi; Zhang, Xue-Ying; Yan, Bin; Hu, Wei-Na

2014-12-01

This study aimed to investigate the effects of acetaldehyde (AA) and L-carnitine (LC) on morphology and enzyme activity of myocardial mitochondria in rats. Sixty-five Wistar rats were randomly divided into 4 groups: the control group (n = 20), the AA low-dose group (n = 15), the AA high-dose group (n = 15) and the AA + LC group (n = 15). Different doses (110 mg/kg and 220 mg/kg) AA was injected intraperitoneally once a day for 4 weeks. After 4 weeks administration, transmission electron microscope (TEM) observation of morphology of rat myocardial mitochondria was performed. Serum levels of succinate dehydrogenase (SDH), superoxide dismutase (SOD), malondialdehyde (MDA) and cardiac troponin I (cTnI) were detected to evaluate mitochondrial enzymes activities. Light micrograph of rat myocardiocytes in the control group showing normal architecture of myocytes. The numerical density and number of mitochondria in both low-dose and high-dose AA groups were lower than that of the control group. After administration of LC, the rats in the AA + LC group showed an obvious increase in the numerical density and number of mitochondria. TEM showed that both low-dose and high-dose AA could induce myocardial mitochondrial damage in rats in a dose-dependent manner, such as mitochondrial swelling, disruptions of crest and membrane, mitochondrial deficiency. The degree of mitochondrial damage of the AA + LC group was significantly decreased after administration of LC. Our results showed that serum levels of SDH and SOD in the AA + LC and control groups were also higher than those of the low-dose and high-dose AA groups; while the MDA level in the AA + LC and control groups were lower than that of the low-dose and high-dose AA groups. The low-dose AA, high-dose AA and AA + LC groups exhibited a higher level of serum cTnI than that of the control group. However, there was no significant difference in serum cTnI level among the low-dose AA, high-dose AA and AA + LC groups. Our findings indicate that AA may lead to myocardial mitochondrial damage and the induction of enzyme activity in rats, while administration of LC could alleviate AA-related damage of rat myocardial mitochondria.

The Brand's PREACH Model: Predicting Readiness to Engage African American Churches in Health.

PubMed

Brand, Dorine J; Alston, Reginald J

2017-09-01

Despite many attempts to reduce health disparities, health professionals face obstacles in improving poor health outcomes within the African American (AA) community. To promote change for improved health measures, it is important to implement culturally tailored programming through a trusted institution, such as the AA church. While churches have the potential to play an important role in positively impacting health among AAs, it is unclear what attributes are necessary to predict success or failure for health promotion within these institutions. The purpose of this study was to create a model, the Brand's PREACH ( Predicting Readiness to Engage African American Churches in Health) Model, to predict the readiness of AA churches to engage in health promotion programming. Thirty-six semistructured key informant interviews were conducted with 12 pastors, 12 health leaders, and 12 congregants to gain information on the relationship between church infrastructure (physical structure, personnel, funding, and social/cultural support), readiness, and health promotion programming. The findings revealed that church infrastructure has an association with and will predict the readiness of a church to engage in health promotion programming. The ability to identify readiness early on will be useful for developing, implementing, and evaluating faith-based interventions, in partnership with churches, which is a key factor for sustainable and effective programs.

The Role of Minority Serving Institutions and REU Programs for Enhancing Diversity in Astronomy

NASA Astrophysics Data System (ADS)

Stassun, K. G.

2002-12-01

In this Special Session we will highlight the important role of Minority Serving Institutions in preparing future minority astronomers. Minority Serving Institutions include Historically Black Colleges and Universities (HBCUs), Hispanic Serving Institutions (HSIs), and Tribal Colleges and Universities (TCUs). We will also stress the role that REU (Research Experiences for Undergraduates) programs can have in enhancing diversity in astronomy. The session will feature a panel of invited speakers from Minority Serving Institutions and REU programs who will present viewpoints, strategies, and discussion on processes that encourage and mentor individuals who elect to pursue science-related careers including astronomy and astrophysics. Specific objectives for the Session include: Report to the AAS membership on the important role played by Minority Serving Institutions, where these institutions are, the populations they serve; Introduce the AAS membership to representatives from various Minority Serving Institutions, including an HBCU, an HSI, a TCU, and a community college, and to representatives from REU programs; Provide an opportunity for representatives from these institutions to describe their role in preparing minority undergraduates in the sciences, how their programs bridge to PhD-granting programs in astronomy, and ways they suggest for the AAS to help enhance these bridges; Provide an opportunity for AAS members to dialogue with these representatives, hopefully resulting in specific ``action items" that will serve to strengthen partnerships with Minority Serving Institutions.

Developing the community empowered research training program: building research capacity for community-initiated and community-driven research.

PubMed

Kwon, Simona; Rideout, Catlin; Tseng, Winston; Islam, Nadia; Cook, Won Kim; Ro, Marguerite; Trinh-Shevrin, Chau

2012-01-01

Health promotion practice research conducted by or in partnership with community-based organizations (CBOs) serving Asian Americans, Native Hawaiians, and Pacific Islanders (AA and NHPI) can address health disparities. Few CBOs have the tools to integrate or initiate research into their programmatic agenda. The New York University (NYU) Center for the Study of Asian American Health (CSAAH) and the Asian & Pacific Islander American Health Forum (APIAHF) created a partnership with the goal to support CBO research infrastructure development by creating the Community Empowered Research Training (CERT) program. A survey was conducted and discussions held with CBO leaders representing AA and NHPI communities to inform the development of the CERT program. The majority of participants are engaged in service-related research and reported interest in building their research capacity. CBOs may require help reframing how data can be collected and used to better inform programmatic activities and to address health disparities facing AA and NHPI communities. CBOs possess both an interest in and access to local knowledge that can inform health priorities. Findings have been applied to the CERT program to build capacity to support community-initiated/driven research to address health disparities affecting AAs and NHPIs.

Creating developmentally auspicious school environments for African American boys.

PubMed

Barbarin, Oscar A; Chinn, Lisa; Wright, Yamanda F

2014-01-01

African American (AA) boys face serious barriers to academic success, many of which are uncommon--or absent--in the lives of AA girls, other children of color, and European American children. In this chapter, we identify nine critical challenges to the successful education of AA boys and review possible solutions. In addition, we evaluate one particular reform, public single-sex schooling, as a possible solution to the challenges facing AA boys. Considering the evidence, we argue that recent efforts to expand the existence of public single-sex schools are rarely grounded in empirical findings. Given the lack of compelling evidence and the high stakes for AA boys, we call for more rigorous evaluations of the outcomes of sex-segregated programs that specifically target AA boys.

Making meaning of Alcoholics Anonymous for social workers: myths, metaphors, and realities.

PubMed

Davis, D R; Jansen, G G

1998-03-01

Alcoholics Anonymous (AA), the increasingly popular mutual-help program for alcoholics, is often criticized for being just another substitute addiction, emphasizing "powerlessness" to already disenfranchised groups, being a religion or cult, adhering to a medical model of disease instead of a strengths perspective, and other such areas of concern to social workers. Many of these interpretations are based on viewing AA as an alternative treatment model or a rational service delivery model. This article addresses common critiques of AA by offering a way of understanding it as a "normative narrative community," where identity transformation takes place through the use of metaphor and storytelling. The article suggests alternative meanings of key metaphors, such as "powerlessness," describes areas of program strength and potential barriers for social workers, and reviews current research on AA effectiveness.

Robust gene network analysis reveals alteration of the STAT5a network as a hallmark of prostate cancer.

PubMed

Reddy, Anupama; Huang, C Chris; Liu, Huiqing; Delisi, Charles; Nevalainen, Marja T; Szalma, Sandor; Bhanot, Gyan

2010-01-01

We develop a general method to identify gene networks from pair-wise correlations between genes in a microarray data set and apply it to a public prostate cancer gene expression data from 69 primary prostate tumors. We define the degree of a node as the number of genes significantly associated with the node and identify hub genes as those with the highest degree. The correlation network was pruned using transcription factor binding information in VisANT (http://visant.bu.edu/) as a biological filter. The reliability of hub genes was determined using a strict permutation test. Separate networks for normal prostate samples, and prostate cancer samples from African Americans (AA) and European Americans (EA) were generated and compared. We found that the same hubs control disease progression in AA and EA networks. Combining AA and EA samples, we generated networks for low low (<7) and high (≥7) Gleason grade tumors. A comparison of their major hubs with those of the network for normal samples identified two types of changes associated with disease: (i) Some hub genes increased their degree in the tumor network compared to their degree in the normal network, suggesting that these genes are associated with gain of regulatory control in cancer (e.g. possible turning on of oncogenes). (ii) Some hubs reduced their degree in the tumor network compared to their degree in the normal network, suggesting that these genes are associated with loss of regulatory control in cancer (e.g. possible loss of tumor suppressor genes). A striking result was that for both AA and EA tumor samples, STAT5a, CEBPB and EGR1 are major hubs that gain neighbors compared to the normal prostate network. Conversely, HIF-lα is a major hub that loses connections in the prostate cancer network compared to the normal prostate network. We also find that the degree of these hubs changes progressively from normal to low grade to high grade disease, suggesting that these hubs are master regulators of prostate cancer and marks disease progression. STAT5a was identified as a central hub, with ~120 neighbors in the prostate cancer network and only 81 neighbors in the normal prostate network. Of the 120 neighbors of STAT5a, 57 are known cancer related genes, known to be involved in functional pathways associated with tumorigenesis. Our method is general and can easily be extended to identify and study networks associated with any two phenotypes.

A Qualitative Analysis of Medical Students' Reflection on Attending an Alcoholics Anonymous Meeting: Insights for Future Addiction Curricula.

PubMed

Kastenholz, Kurt J; Agarwal, Gaurava

2016-06-01

This paper describes medical students' views of alcoholism and their response to attending an Alcoholics Anonymous (AA) meeting during their psychiatry clerkship. This may assist other educators in planning their addiction curricula. Medical students were required to attend an AA meeting during their psychiatry clerkship and then to write a reflection piece on this experience. We selected a random sample of 40 pieces and performed a qualitative analysis to identify the prominent ideas and themes in this sample. Medical students found their experience attending an AA meeting to be educationally valuable. They reported their familiarity with AA prior to this experience was largely limited to popular media depictions. Students reported understanding alcoholism as a disease with both biological and psychosocial components. They were often concerned with the presence of religiosity and spirituality at the meetings. Following the experience, students felt more comfortable referring patients to AA and identified empathy, honesty, and openness as crucial contributors to the efficacy of AA. Students felt that attending an AA meeting during their psychiatry clerkship was an educationally valuable experience. Medical students' familiarity with addiction treatment is limited, and attending an AA meeting may be helpful in increasing their comfort with treating addicted patients in the future. In addition, educators may want to explicitly address the spirituality issue related to some treatment programs to increase the likelihood that future physicians feel comfortable referring their patients to recovery programs.

Ascorbic acid as a free radical scavenger in porcine and bovine aqueous humour.

PubMed

Erb, Carl; Nau-Staudt, Kerstin; Flammer, Josef; Nau, Werner

2004-01-01

To study the antioxidant activity, UV absorption, concentration and stability of ascorbic acid (AA) in porcine and bovine aqueous humour (AH). Porcine and bovine AH was taken within 5 min after death and frozen at -70 degrees C. The characteristic UV absorption band of AA and the concentration of AA in AH was determined by UV spectrophotometry. The antioxidant activity of AA to serve as a free radical scavenger in AH has been determined by using a novel fluorescent probe for antioxidants, the azoalkane 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO). The fluorescence lifetime and intensity of this probe reflect the concentration of dissolved antioxidants. The time-resolved fluorescence of DBO (laser excitation at 351 nm) in AH and in a neutral phosphate-buffered saline (PBS) solution containing only the natural amount of AA as an additive were measured. The characteristic UV absorption band of AA has its maximum at 266 nm in AH. The concentration of AA in porcine and bovine AH was found to be 0.547 +/- 0.044 and 1.09 +/- 0.16 mM, respectively, by spectrophotometry. The fluorescence lifetime of the probe DBO was reduced from 320 +/- 5 ns in pure aerated PBS to 205 +/- 5 ns in porcine AH and 165 +/- 3 ns in bovine AH. A detailed kinetic analysis of the lifetime shortening suggests that AA contributes approximately 75 and 85% to the antioxidant activity of porcine and bovine AH, respectively. Our experiments suggest that AA is the major contributor to the antioxidant activity of porcine and bovine AH. The role of AA to serve as an antioxidant in AH is discussed. In addition, UV spectrophotometry is established as an alternative method to determine the concentration of AA in AH. Copyright 2004 S. Karger AG, Basel

Rates and predictors of colorectal cancer screening by race among motivated men participating in a prostate cancer risk assessment program

PubMed Central

Hall, Michael J.; Ruth, Karen; Giri, Veda N.

2011-01-01

Background Screening by fecal occult blood test and lower endoscopy have lowered colorectal cancer (CRC) mortality, but compliance gaps persist. Of concern are possible disparities in uptake of CRC screening between White and African American (AA) men. Our goal was to assess for disparities in uptake of CRC screening among men participating in a high-risk prostate cancer clinic. If present, such disparities could support hypotheses for further research examining racial differences in awareness and patient preferences in undergoing CRC screening. Methods Baseline data on a racially diverse cohort of men age 50–69 at increased risk of prostate cancer collected via the prostate cancer risk assessment program (PRAP) at Fox Chase Cancer Center were analyzed. Predictors of uptake of CRC screening were assessed using multivariable logistic regression. Results Compared to Whites, AA men had statistically significantly lower uptake of fecal occult blood testing (AA 49.0% vs White 60.7%, p=0.035), lower endoscopy (AA 44.1% vs White 58.5%, p=0.011), and any CRC screening (AA 66.2% vs White 76.3%, p=0.053). Predictors of uptake of lower endoscopy among AA men included older age (OR 3.61, 95% CI 1.87–6.97), family history of CRC (OR 3.47, 95% CI 1.30–9.25), and insurance status (OR 1.90, 95% CI 1.04–3.46). Conclusion Despite awareness of cancer risk and motivation to seek prostate cancer screening through a specialized prostate cancer risk assessment program, evidence supporting compliance gaps with CRC screening among men was found. Tailored messages to younger AA men with and without a family history of CRC are needed. PMID:21751189

Final Technical Report Laramie County Community College: Utility-Scale Wind Energy Technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Douglas P. Cook

The Utility-Scale Wind Energy Technology U.S. Department of Energy (DOE) grant EE0000538, provided a way ahead for Laramie County Community College (LCCC) to increase educational and training opportunities for students seeking an Associate of Applied Science (AAS) or Associate of Science (AS) degree in Wind Energy Technology. The DOE grant enabled LCCC to program, schedule, and successfully operate multiple wind energy technology cohorts of up to 20-14 students per cohort simultaneously. As of this report, LCCC currently runs four cohorts. In addition, the DOE grant allowed LCCC to procure specialized LABVOLT electronic equipment that directly supports is wind energy technologymore » curriculum.« less

The Role of Twelve-Step-Related Spirituality in Addiction Recovery.

PubMed

Dermatis, Helen; Galanter, Marc

2016-04-01

This paper reviews empirical studies conducted on the role of spirituality and religiosity (S/R) characteristics in 12-step recovery among program members followed up after substance abuse treatment and those assessed independent of formal treatment. Aspects of spiritual functioning that change in relation to program participation and those S/R characteristics that were found to mediate the association between program involvement and drinking-related outcomes are discussed. In addition, a review is provided of 12-step program studies investigating S/R-related predictors of clinical outcomes relevant to risk of relapse among members in long-term recovery. To further examine the role of S/R characteristics in recovery, a study was conducted on long-term AA members to assess the relationship of S/R characteristics and AA program involvement to craving for alcohol and emotional distress after controlling for relevant demographic variables. Feeling God's presence daily, believing in a higher power as a universal spirit, and serving as an AA sponsor were all predictive of positive outcomes.

13 CFR 124.204 - How does SBA process applications for 8(a) BD program admission?

Code of Federal Regulations, 2011 CFR

2011-01-01

... admission? (a) The AA/BD is authorized to approve or decline applications for admission to the 8(a) BD... from ANC-owned applicants and review them for completeness before sending them to the AA/BD for further... admittance. (e) The decision of the AA/BD to approve or deny an application will be in writing. A decision to...

13 CFR 124.204 - How does SBA process applications for 8(a) BD program admission?

Code of Federal Regulations, 2013 CFR

2013-01-01

... admission? (a) The AA/BD is authorized to approve or decline applications for admission to the 8(a) BD... information relates. (d) An applicant must be eligible as of the date the AA/BD issues a decision. The...) The decision of the AA/BD to approve or deny an application will be in writing. A decision to deny...

An estimation of global solar p-mode frequencies from IRIS network data: 1989-1996

NASA Astrophysics Data System (ADS)

Serebryanskiy, A.; Ehgamberdiev, Sh.; Kholikov, Sh.; Fossat, E.; Gelly, B.; Schmider, F. X.; Grec, G.; Cacciani, A.; Palle, P. L.; Lazrek, M.; Hoeksema, J. T.

2001-06-01

The IRIS network has accumulated full disk helioseismological data since July 1989, i.e. a complete 11-year solar cycle. Since the last paper publishing a frequency list [A&A 317 (1997) L71], not only has the network acquired new data, but has also developed new co-operative programs with compatible instruments [Abstr. SOHO 6/GONG 98 Workshop (1998) 51], so that merging IRIS files with these co-operative program data sets has made possible the improvement of the overall duty cycle. This paper presents new estimations of low degree p-mode frequencies obtained from this IRIS++ data bank covering the period 1989-1996, as well as the variation of their main parameters along the total range of magnetic activity, from before the last maximum to the very minimum. A preliminary estimation of the peak profile asymmetries is also included.

Unique anthranilic acid chemistry facilitates profiling and characterization of Ser/Thr-linked sugar chains following hydrazinolysis.

PubMed

Anumula, Kalyan Rao

2008-02-01

A novel method for the analysis of Ser/Thr-linked sugar chains was made possible by the virtue of unique anthranilic acid (AA, 2-aminobenzoic acid [2AA]) chemistry for labeling carbohydrates in aqueous salt solutions (K. R. Anumula, Anal. Biochem. 350 (2006) 1-23). The protocol for profiling of Ser/Thr carbohydrates by hydrazinolysis was made simple by eliminating intermediary isolation steps involved in a sample preparation such as desalting and various chromatographic purification schemes. A 6-h hydrazinolysis was carried out at 60 degrees C for O-linked oligosaccharides and at 95 degrees C for total oligosaccharides (N-linked with some O-linked). Following evaporation of hydrazine (<10 min), the oligosaccharides were N-acetylated and derivatized with AA in the same reaction mixture containing salts. Presumably, the glycosyl-hydrazines/hydrazones present in the mixture did not interfere with AA labeling. Because AA is the most fluorescent and highly reactive tag for labeling carbohydrates, the procedures described are suitable for the analysis of a limited amount of samples ( approximately 5 microg) by the current high-resolution high-performance liquid chromatography (HPLC) methods. HPLC conditions developed for the separation of O-linked sugar chains based on size on an amide column were satisfactory for quantitative profiling and characterization. Common O-linked sugar chains found in fetuin, equine chorionic gonadotropin, and glycophorin can be analyzed in less than 50 min. In addition, these fast profiling methods were comparable to profiling by PNGase F (peptide N-glycosidase from Flavobacterium meningosepticum) digestion in terms of time, effort, and simplicity and also were highly reproducible for routine testing. The procedures for the release of sugar chains by hydrazinolysis at the microgram level, labeling with fluorescent tag AA, and profiling by HPLC should be useful in characterization of carbohydrates found in glycoproteins.

Innovative and Community-Guided Evaluation and Dissemination of a Prostate Cancer Education Program for African-American Men and Women

PubMed Central

Jackson, Dawnyea D.; Owens, Otis L.; Friedman, Daniela B.; Dubose-Morris, Ragan

2014-01-01

African Americans (AA) are more likely to develop and die from cancer than any other racial or ethnic group. The aims of this research were to: (1) evaluate current education materials being implemented in a community-based prostate cancer education program for AA communities; (2) refine materials based on findings from Aim 1; (3) share updated materials with participants from Aim 1 for additional improvements; and (4) disseminate and evaluate the improved education program through a statewide videoconference with AA men and women. AA individuals evaluated the current education program through a mail survey (n=32) and community forum (n=38). Participants reported that the existing prostate cancer education program content could be understood by lay persons, but recommendations for improvement were identified. They included: defining unknown and/or scientific terminology, increasing readability by increasing font size and enlarging images, and including more recent and relevant statistics. Following refinement of the education materials based on survey and forum feedback, a statewide videoconference was implemented. Following the videoconference, participants (25 men; 3 women) reported that they would encourage others to learn more about prostate cancer, talk to their doctor about whether or not to get screened for prostate cancer, and would recommend the conference to others. There is great potential for using this type of iterative approach to education program development with community and clinical partners for others conducting similar work. PMID:25510370

Hypothermic inhibition of apoptotic pathways for combined neurotoxicity of iron and ascorbic acid in differentiated PC12 cells: reduction of oxidative stress and maintenance of the glutathione redox state.

PubMed

Hasegawa, Masashi; Ogihara, Tohru; Tamai, Hiroshi; Hiroi, Mayo

2009-08-04

Recent clinical trials have demonstrated the efficacy and safety of therapeutic hypothermia for neonatal hypoxic ischemic encephalopathy (HIE). We previously reported that the levels of non-protein-bound iron and ascorbic acid (AA) are increased in the CSF of infants with HIE. In this study, we investigated the effect of hypothermia on the combined cytotoxicity of Fe and AA for differentiated PC12 cells. The optimal settings for hypothermic treatment were a temperature of 30-32 degrees C, rescue time window of less than 6 h, and minimum duration of at least 24 h. Hypothermia effectively prevented the loss of the mitochondrial transmembrane potential from 6 h to 72 h (end of the study period) and attenuated the release of apoptotic proteins (cytochrome c and apoptosis-inducing factor) at 6 h of exposure to Fe-AA. Activation of caspase-3 was also delayed until 24 h. Akt was transiently activated, although no influence of temperature was observed. Elevation of oxidative stress markers, including ortho-, meta-, and di-tyrosine (markers of protein oxidation) and 4-hydroxynonenal (lipid peroxidation) was significantly attenuated when the temperature was reduced by 5 degrees C. The half-cell reduction potential (Ehc) of GSSG/2GSH redox couple ranged from -220 to -180 mV in unstressed differentiated PC12 cells, and apoptosis was triggered when Ehc exceeded -180 mV. Hypothermia prevented Ehc from rising above -180 mV within 24 h of exposure to Fe-AA. In conclusion, hypothermia prevented cell death due to Fe-AA toxicity by inhibiting apoptotic pathways through maintenance of a reduced cellular environment, as well as by alleviating oxidative stress.

Department of Defense Manpower Requirements Report: Fy 1993

DTIC Science & Technology

1992-02-01

retention programs are dealing effectively with the available strength shortfall; however, NOS qualifi- cation (MOSQ) remains the primary readiness inhibitor ...n r- nLn P4 r- 0 .a. W 43) 0%~~~ aa a aa a aa a VU 4343 Uf .ai 0 a 4 .44 0 ~ ~ ~ ~ ~ ~ ~ ~ ~ .’ 0n 󈧄% Or - 0 - o% e n 5 ac vi𔃼 %oc 4I oa jL nc "P

Permanent certification program for health information technology; revisions to ONC-Approved Accreditor processes. Final rule.

PubMed

2011-11-25

Under the authority granted to the National Coordinator for Health Information Technology by section 3001(c)(5) of the Public Health Service Act (PHSA) as added by the Health Information Technology for Economic and Clinical Health (HITECH) Act, this final rule establishes a process for addressing instances where the ONC-Approved Accreditor (ONC-AA) engages in improper conduct or does not perform its responsibilities under the permanent certification program. This rule also addresses the status of ONC-Authorized Certification Bodies (ONC-ACBs) in instances where there may be a change in the accreditation organization serving as the ONC-AA and clarifies the responsibilities of the new ONC-AA.

The AAS Taskforce on Diversity and Inclusion in Graduate Education: a Proposed White Paper

NASA Astrophysics Data System (ADS)

Rudolph, Alexander L.

2018-06-01

At the January 2017 AAS meeting in Texas, the AAS Council approved the creation of a Graduate Education Taskforce focusing on Diversity and Inclusion. This task force is conducting a review of practices in recruiting, admissions, and retention in PhD programs in astronomy (including astronomy programs in departments of physics and astronomy). It is also engaging the broader astronomical community and selected outside experts in diversity in STEM in a discussion of best practices in these activities, with the goal of promoting diversity (race/ethnicity, gender, LGBTQ+, disability status, etc.) and inclusion in astronomy PhD programs. Building on the Nashville Recommendations from the Inclusive Astronomy 2015 meeting, the task force is developing a set of specific recommendations with the aim of endorsement by the AAS, in parallel with a campaign to get them adopted by astronomy departments. Finally, the task force will suggest and push adoption of a set of permanent measurements to be collected by the AAS to track progress on these goals. There is a separate special session at this meeting intended to report on the task force’s progress and to solicit community input on its draft recommendations to date.This presentation will give a brief overview of the task force's charge and activities and their plans to turn their final report into a White Paper for the Decadal Survey.

Characterization of Factors Affecting Attainment of Glycemic Control in Asian Americans With Diabetes in a Culturally Specific Program

PubMed Central

Le, Hung; Wong, Sophia; Iftikar, Tracy; Keenan, Hillary; King, George L.; Hsu, William C.

2014-01-01

Purpose The purpose of this study is to examine the effectiveness of a culturally specific pilot clinic for Asian Americans (AA) in reaching glycemic target and to characterize factors affecting the attainment of glycemic control in comparison with white counterparts. Methods This electronic health record review included all new AA patients with type 2 diabetes (n = 109) in a culturally specific program and a randomly selected sample of new white patients with type 2 diabetes (n = 218) in the adult clinic within the same time period and diabetes center. Results AA and whites had a comparable proportion of patients with A1C ≤7% (32.1%, 34.9%; P = .621) at baseline and after 12 months of care (48.6%, 56.0%; P = .210), with a similar A1C decline (−0.9% ± 1.6%, −0.8% ± 1.7%, P = .710) by 12 months. Factors associated with the lack of success in reaching target in AA but not in whites included older age, lower educational attainment, less likelihood of having health insurance, and a need for more educational visits. The percentage of AA reaching A1C ≤7%, as compared to whites, worsened among those with highest initial A1C when stratified by ascending quartiles (96.7% vs 85.2%, P = .101; 61.9% vs 58.9%, P = .813; 24.0% vs 37.7%, P = .230; 15.2% vs 35.4%, P = .044). Conclusion While a culturally specific diabetes program in a specialty setting achieved a similar glycemic outcome for AA compared with whites, reasons for not reaching glycemic target differed. The findings suggest that the elimination of diabetes disparities requires not only culturally and linguistically specific programs, but must also identify and address the socio-environmental differences unique to each population. PMID:23771841

Evaluation of a rapid agglutination method for detection of equine red cell surface antigens (Ca and Aa) as part of pretransfusion testing.

PubMed

Owens, Sean D; Snipes, Joy; Magdesian, K Gary; Christopher, Mary M

2008-03-01

Blood typing before transfusion minimizes the risk of transfusion reactions and prevents immunization of the recipient against incompatible RBC antigens. The major RBC antigens that warrant identification before packed RBC or whole blood transfusions in horses are Ca and Aa. Standard blood-typing protocols are time-consuming (2.5-3.0 hours) and impractical in emergency settings. The purpose of this study was to determine whether equine RBCs could be typed for Ca and Aa antigens using sera from horses with RBC antibodies in a modified rapid (15 minute) blood-typing protocol. Serum was obtained from a horse with anti-Ca antibodies and from another horse with anti-Aa antibodies. The presence of agglutinating antibodies was confirmed with antibody screening. Venous blood samples, collected in citrate-phosphate-dextrose, were obtained from 21 horses of various breeds. Samples were blood typed in the Veterinary Medical Teaching Hospital Hematology Laboratory using standard methodology. Washed RBCs from each of the 21 horses were incubated individually with anti-Ca and anti-Aa sera at dilutions of 1:4, 1:8, and 1:16 for 15 and 30 minutes at room temperature and 37 degrees C. Of the 21 horses, 13 were identified as Aa+/Ca+, four were Aa+/Ca-, two were Aa-/Ca+, and two were Aa-/Ca-. All 17 Aa-positive horses had a positive agglutination reaction at all dilutions of anti-Aa serum, incubation times, and temperatures, while all Aa-negative horses were negative. Each Ca-positive horse had a positive agglutination reaction at all incubation time points and temperatures up to the 1:16 dilution of the anti-Ca serum. All Ca-negative horses were negative at all times, temperatures, and dilutions of anti-Ca serum. Use of the modified protocol on 26 hospitalized horses resulted in accurate typing, based on complete antibody screens. These results support the hypothesis that equine RBCs can be blood typed using a rapid (15 minute) protocol, at room temperature, for the presence of Ca and Aa antigens using equine-derived antisera. This technique may be beneficial for pretransfusion testing of equine patients in an emergency setting.

Ascorbic acid supplementation does not alter oxidative stress markers in healthy volunteers engaged in a supervised exercise program.

PubMed

Bunpo, Piyawan; Anthony, Tracy G

2016-02-01

The purpose of this study was to investigate the impact of ascorbic acid (AA) consumption on the oxidative stress status of untrained volunteers participating in a supervised exercise program. The study included 46 young adults (average age, 23.5 ± 0.59 years; 37 females, 9 males) who remained sedentary (n = 16) or participated in 30 min of outdoor aerobic running (n = 30) at an intensity corresponding to 65%-75% of maximum heart rate for 3 times per week for 12 weeks. Exercised subjects were randomly assigned to an exercise group without AA supplementation (control; n = 10) or received either 250 mg (n = 10) or 500 mg (n = 10) of AA supplementation previous to each exercise session. Blood samples were taken on day 0 and day 84 to evaluate metabolic profiles and antioxidant status. Sedentary subjects underwent in a single bout of aerobic running to determine total antioxidant status (TAS) and malondiadehyde (MDA) at pre- and postexercise with or without AA supplementation. No significant change in TAS was observed. Plasma MDA significantly increased at postexercise (P < 0.05), and AA supplementation decreased MDA level significantly (P < 0.05). After 3 months of exercise, there was no significant change in blood glucose, lipid profile, MDA, TAS, superoxide dismutase (SOD), glutathione peroxidase (GPx), and catalase activities amongst groups. Supplementation of AA was associated with minor and inconsistent reductions in SOD, GPx, and catalase activities (P < 0.05). These findings indicate that pre-exercise supplementation of ascorbic acid does not alter oxidative stress markers in the plasma and erythrocytes of young adults engaged in a supervised exercise program.

Biochemical and molecular characterization of a detergent-stable serine alkaline protease from Bacillus pumilus CBS with high catalytic efficiency.

PubMed

Jaouadi, Bassem; Ellouz-Chaabouni, Semia; Rhimi, Moez; Bejar, Samir

2008-09-01

We have described previously the potential use of an alkaline protease from Bacillus pumilus CBS as an effective additive in laundry detergent formulations [B. Jaouadi, S. Ellouz-Chaabouni, M. Ben Ali, E. Ben Messaoud, B. Naili, A. Dhouib, S. Bejar, A novel alkaline protease from Bacillus pumilus CBS having a high compatibility with laundry detergent and a high feather-degrading activity, Process Biochem, submitted for publication]. Here, we purified this enzyme (named SAPB) and we cloned, sequenced and over-expressed the corresponding gene. The enzyme was purified to homogeneity using salt precipitation and gel filtration HPLC. The pure protease was found to be monomeric protein with a molecular mass of 34598.19Da as determined by MALDI-TOF mass spectrometry. The NH2-terminal sequence of first 21 amino acids (aa) of the purified SAPB was AQTVPYGIPQIKAPAVHAQGY and was completely identical to proteases from other Bacillus pumilus species. This protease is strongly inhibited by PMSF and DFP, showing that it belongs to the serine proteases superfamily. Interestingly, the optimum pH is 10.6 while the optimum temperature was determined to be 65 degrees C. The enzyme was completely stable within a wide range of pH (7.0-10.6) and temperature (30-55 degrees C). One of the distinguishing properties is its catalytic efficiency (kcat/Km) calculated to be 45,265min(-1)mM(-1) and 147,000min(-1)mM(-1) using casein and AAPF as substrates, respectively, which is higher than that of Subtilisin Carlsberg, Subtilisin BPN' and Subtilisin 309 determined under the same conditions. In addition, SAPB showed remarkable stability, for 24h at 40 degrees C, in the presence of 5% Tween-80, 1% SDS, 15% urea and 10% H2O2, which comprise the common bleach-based detergent formulation. The sapB gene encoding SAPB was cloned, sequenced and over-expressed in Escherichia coli. The purified recombinant enzyme (rSAPB) has the same physicochemical and kinetic properties as the native one. SapB gene had an ORF of 1149bp encoding a protein of 383 aa organized into a signal peptide (29 aa), a pro-protein (79 aa) and a mature enzyme (275 aa). The deduced amino acid sequence inspection displays an important homology with other bacterial proteases. The highest homology of 98.1% was found with BPP-A protease from Bacillus pumilus MS-1, with only 8 aa of difference.

Selection and characterization of resistance to the Vip3Aa20 protein from Bacillus thuringiensis in Spodoptera frugiperda.

PubMed

Bernardi, Oderlei; Bernardi, Daniel; Horikoshi, Renato J; Okuma, Daniela M; Miraldo, Leonardo L; Fatoretto, Julio; Medeiros, Fernanda Cl; Burd, Tony; Omoto, Celso

2016-09-01

Spodoptera frugiperda is one the main target pests of maize events expressing Vip3Aa20 protein from Bacillus thuringiensis (Bt) in Brazil. In this study, we selected a resistant strain of S. frugiperda on Bt maize expressing Vip3Aa20 protein and characterized the inheritance and fitness costs of the resistance. The resistance ratio of the Vip3Aa20-resistant strain of S. frugiperda was >3200-fold. Neonates of the Vip3Aa20-resistant strain were able to survive and emerge as fertile adults on Vip3Aa20 maize, while larvae from susceptible and heterozygous strains did not survive. The inheritance of Vip3Aa20 resistance was autosomal recessive and monogenic. Life history studies to investigate fitness cost revealed an 11% reduction in the survival rate until adult stage and a ∼50% lower reproductive rate of the Vip3Aa20-resistant strain compared with susceptible and heterozygous strains. This is the first characterization of S. frugiperda resistance to Vip3Aa protein. Our results provide useful information for resistance management programs designed to prevent or delay resistance evolution to Vip3Aa proteins in S. frugiperda. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Prevention of alcoholic fatty liver and mitochondrial dysfunction in the rat by long-chain polyunsaturated fatty acids

PubMed Central

Song, Byoung-Joon; Moon, Kwan-Hoon; Olsson, Nils U.; Salem, Norman

2008-01-01

Background/Aims We reported that reduced dietary intake of polyunsaturated fatty acids (PUFA) such as arachidonic (AA,20:4n6, omega-6) and docosahexaenoic (DHA,22:6n3, omega-3) acids led to alcohol-induced fatty liver and fibrosis. This study was aimed at studying the mechanisms by which a DHA/AA-supplemented diet prevents alcohol-induced fatty liver. Methods Male Long-Evans rats were fed an ethanol or control liquid-diet with or without DHA/AA for 9 weeks. Plasma transaminase levels, liver histology, oxidative/nitrosative stress markers, and activities of oxidatively-modified mitochondrial proteins were evaluated. Results Chronic alcohol administration increased the degree of fatty liver but fatty liver decreased significantly in rats fed the alcohol-DHA/AA-supplemented diet. Alcohol exposure increased oxidative/nitrosative stress with elevated levels of ethanol-inducible CYP2E1, nitric oxide synthase, nitrite and mitochondrial hydrogen peroxide. However, these increments were normalized in rats fed the alcohol-DHA/AA-supplemented diet. The number of oxidatively-modified mitochondrial proteins was markedly increased following alcohol exposure but significantly reduced in rats fed the alcohol-DHA/AA-supplemented diet. The suppressed activities of mitochondrial aldehyde dehydrogenase, ATP synthase, and 3-ketoacyl-CoA thiolase in ethanol-exposed rats were also recovered in animals fed the ethanol-DHA/AA-supplemented diet. Conclusions Addition of DHA/AA prevents alcohol-induced fatty liver and mitochondrial dysfunction in an animal model by protecting various mitochondrial enzymes most likely through reducing oxidative/nitrosative stress. PMID:18571270

Histopathologic observations of anorectal abnormalities in anal atresia.

PubMed

Meier-Ruge, W A; Holschneider, A M

2000-01-01

Over the years from 1992 to 1997, 41 anorectal malformations (ARM) with histopathologic alterations were investigated to determine which morphologic abnormalities of the distal rectum accompany ARMs. Three other cases showed normal neuromuscular morphology; 9 further cases could not be evaluated owing to scanty biopsies. All resected specimens were caudocranially coiled and cryostat cut at -20 degrees C into serial sections, which were stained with a lactic dehydrogenase, succinic dehydrogenase, nitroxide synthase, and acetylcholinesterase reaction as well as hemalum and sirius red. Ten low, 15 intermediate, and 10 high forms of anal atresia (AA) were studied. In addition, six cloacal abnormalities were investigated. In 7 cases (17%) (5 intermediate, 2 low AAs), the characteristics of Hirschsprung's disease were observed. Oligoneuronal hypoganglionosis of the myenteric plexus proximal to the anal floor was diagnosed in 7 AAs (12%). In 10 children with high-type AA and resection of 1-5 cm distal rectum and in all cloacal anomalies (n = 6) defects of the muscularis propria were seen in the rectal-atresia sac. These defects were characterized by hypoplasia of the circular-muscle layer and/or the internal anal sphincter (IAS). Intestinal neuronal dysplasia of the submucous plexus was most frequently observed (12%) in high-type AA. A correlation between innervation anomalies or anomalies of the muscularis propria and the type of fistula could not be seen. In conclusion, all cases with high-type AA and cloacal anomalies were characterized by anomalies of the muscularis propria and/or IAS but this was not the case in intermediate and low-type AAs. Anomalies of the enteric nervous system were diagnosed in 60% of AAs.

Implementing health promotion activities using community-engaged approaches in Asian American faith-based organizations in New York City and New Jersey.

PubMed

Kwon, S C; Patel, S; Choy, C; Zanowiak, J; Rideout, C; Yi, S; Wyatt, L; Taher, M D; Garcia-Dia, M J; Kim, S S; Denholm, T K; Kavathe, R; Islam, N S

2017-09-01

Faith-based organizations (FBOs) (e.g., churches, mosques, and gurdwaras) can play a vital role in health promotion. The Racial and Ethnic Approaches to Community Health for Asian Americans (REACH FAR) Project is implementing a multi-level and evidence-based health promotion and hypertension (HTN) control program in faith-based organizations serving Asian American (AA) communities (Bangladeshi, Filipino, Korean, Asian Indian) across multiple denominations (Christian, Muslim, and Sikh) in New York/New Jersey (NY/NJ). This paper presents baseline results and describes the cultural adaptation and implementation process of the REACH FAR program across diverse FBOs and religious denominations serving AA subgroups. Working with 12 FBOs, informed by implementation research and guided by a cultural adaptation framework and community-engaged approaches, REACH FAR strategies included (1) implementing healthy food policies for communal meals and (2) delivering a culturally-linguistically adapted HTN management coaching program. Using the Ecological Validity Model (EVM), the program was culturally adapted across congregation and faith settings. Baseline measures include (i) Congregant surveys assessing social norms and diet (n = 946), (ii) HTN participant program surveys (n = 725), (iii) FBO environmental strategy checklists (n = 13), and (iv) community partner in-depth interviews assessing project feasibility (n = 5). We describe the adaptation process and baseline assessments of FBOs. In year 1, we reached 3790 (nutritional strategies) and 725 (HTN program) via AA FBO sites. Most AA FBOs lack nutrition policies and present prime opportunities for evidence-based multi-level interventions. REACH FAR presents a promising health promotion implementation program that may result in significant community reach.

Design of a Cluster-Randomized Controlled Trial of a Diabetes Prevention Program within African-American Churches: The Fit Body and Soul Study

PubMed Central

Williams, Lovoria B.; Sattin, Richard W.; Dias, James; Garvin, Jane T.; Marion, Lucy; Joshua, Thomas; Kriska, Andrea; Kramer, M. Kaye; Echouffo-Tcheugui, Justin B.; Freeman, Arin; Narayan, K.M. Venkat

2013-01-01

Evidence from varied community settings has shown that the Group Lifestyle Balance (GLB) Program and other adaptations of the Diabetes Prevention Program (DPP) intervention are effective in lowering diabetes risk. Most DPP data originated from studies of pre-diabetic whites, with only sparse evidence of the effect of DPP in African Americans (AAs) in community settings. This paper describes the design, methods, baseline characteristics and cost effective measures, of a single-blinded, cluster- randomized trial of a faith-based adaptation of the GLB program, Fit Body and Soul (FBAS). The major aims are to test efficacy and cost utility of FBAS in twenty AA churches. Randomization occurred at the church level and 604 AA overweight/obese (BMI≥25 kg/m2) adults with fasting plasma glucose range from normal to pre-diabetic received either FBAS or a health-education comparison program. FBAS is a group-based, multi-level intervention delivered by trained church health advisors (health professionals from within the church), with the goal of ≥7% weight loss, achieved through increasing physical activity, healthy eating and behavior modification. The primary outcome is weight change at 12-weeks post intervention. Secondary outcomes include hemoglobin A1C, fasting plasma glucose, waist circumference, blood pressure, physical activity level, quality of life measures, and cost-effectiveness. FBAS is the largest known cohort of AAs enrolled in a faith-based DPP translation. Reliance on health professionals from within the church for program implementation and the cost analysis are unique aspects of this trial. The design provides a model for faith-based DPPs and holds promise for program sustainability and widespread dissemination. PMID:23354313

Comparison of ZP3 protein sequences among vertebrate species: to obtain a consensus sequence for immunocontraception.

PubMed

Zhu, X; Naz, R K

1999-03-01

The deduced ZP3 amino acid (aa) sequences of 13 vertebrate species namely mouse, hamster, rabbit, pig, porcine, cow, dog, cat, human, bonnet, marmoset, carp, and frog were compared using the PILEUP and PRETTY alignment programs (GCG, Wisconsin, USA). The published aa sequences obtained from 13 vertebrate species indicated the overall evolutionarily conservation in the N-terminus, central region, and C-terminus of the ZP3 polypeptide. More variations of ZP3 polypeptide sequences were seen in the alignments of carp and frog from the 11 mammalian species making the leader sequence more prominent. The canonical furin proteolytic processing signal at the C-terminus was found in all the ZP3 polypeptide sequences except of carp and frog. In the central region, the ZP3 deduced aa sequences of all the 13 vertebrate species aligned well, and six relatively conserved sequences were found. There are 11 conserved cysteine residues in the central region across all species including carp and frog, indicating that these residues have longer evolutionary history. The ZP3 aa sequence similarities were examined using the GAP program (GCG). The highest aa similarities are observed between the members of the same order within the class mammalia, and also (95.4%) between pig (ungulata) and rabbit (lagomorpha). The deduced ZP3 aa sequences per se may not be enough to build a phylogenetic tree.

Introducing the AAS Astronomy Ambassadors Program

NASA Astrophysics Data System (ADS)

Gurton, S.; Fienberg, R. T.; Fraknoi, A.; Prather, E. E.

2013-04-01

Newly established by the American Astronomical Society (AAS), the Astronomy Ambassadors program is designed to support early-career AAS members with training in resources and techniques for effective outreach to students and/or the public. A pilot Astronomy Ambassadors workshop will be held at the January 2013 AAS meeting. Workshop participants will learn to communicate effectively with public and school audiences; find outreach opportunities and establish ongoing partnerships with local schools, science centers, museums, parks, and/or community centers; reach audiences with personal stories, hands-on activities, and jargon-free language; identify strategies and techniques to improve their presentation skills; gain access to a menu of outreach resources that work in a variety of settings; and become part of an active community of astronomers who do outreach. Applications are welcome from advanced undergraduates (those doing research and committed to continuing in astronomy), graduate students, and postdocs and new faculty in their first two years after receipt of the PhD. We especially encourage applications from members of groups that are presently underrepresented in science.

Imaging the Disk and Jet of the Classical T Tauri Star AA Tau

NASA Astrophysics Data System (ADS)

Cox, Andrew; Grady, C.; Hammel, H. B.; Hornbeck, J.; Russell, R. W.; Sitko, M. L.; Woodgate, B. E.

2013-01-01

Previous studies of the classical T Tauri star AA Tau have interpreted the UX Orionis-like photo-polarimetric variability as being due to a warp in the inner disk caused by an inclined stellar magnetic dipole field. We test that these effects are macroscopically observable in the inclination and alignment of the disk. We use HST/STIS coronagraphic imagery to measure the V magnitude of the star for both STIS corona graphic observations, compare these data with optical photometry in the literature and find that unlike other classical T Tauri stars observed on the same HST program, the disk is most robustly detected at optical minimum light. We measure the outer disk radius, major axis position angle, and disk inclination, and find that the inner disk, as reported in the literature, is both mis-inclined and misaligned with respect to the outer disk. AA Tau drives a faint jet which is also misaligned with respect to the projection of the outer disk minor axis and which is poorly collimated near the star. The measured outer disk inclination, 71±1 degrees, is out of the inclination band suggested for stars with UX Orionis-like variability where no grain growth has occurred in the disk. The faintness of the disk, the small disk size, and visibility of the star and despite the high inclination, all indicate that the disk must have experienced grain growth and settling toward the disk midplane, which we verify by comparing the observed disk with model imagery from the literature.

Introducing AstroGen: the Astronomy Genealogy Project

NASA Astrophysics Data System (ADS)

Tenn, Joseph S.

2016-12-01

The Astronomy Genealogy Project (AstroGen), a project of the Historical Astronomy Division of the American Astronomical Society (AAS), will soon appear on the AAS website. Ultimately, it will list the world's astronomers with their highest degrees, theses for those who wrote them, academic advisors (supervisors), universities, and links to the astronomers or their obituaries, their theses when online, and more. At present the AstroGen team is working on those who earned doctorates with astronomy-related theses. We show what can be learned already, with just ten countries essentially completed.

Time-dependent changes in the plasma amino acid concentration in diabetes mellitus.

PubMed

Mochida, Taiga; Tanaka, Takayuki; Shiraki, Yasuko; Tajiri, Hiroko; Matsumoto, Shirou; Shimbo, Kazutaka; Ando, Toshihiko; Nakamura, Kimitoshi; Okamoto, Masahiro; Endo, Fumio

2011-08-01

We investigated longitudinal change in the amino acid (AA) profile in type 1 diabetes mellitus (DM) using AKITA mice, which develop DM as a result of insulin deficiency. The plasma concentrations of valine, leucine, isoleucine, as well as the total branched chain amino acids, alanine, citrulline and proline, were significantly higher in the diabetic mice. We show that the degree and timing of the changes were different among the plasma amino acid concentrations (pAAs) during the development of type 1 DM. Copyright © 2011 Elsevier Inc. All rights reserved.

Influence of Ametropia and Its Correction on Measurement of Accommodation.

PubMed

Bernal-Molina, Paula; Vargas-Martín, Fernando; Thibos, Larry N; López-Gil, Norberto

2016-06-01

Amplitude of accommodation (AA) is reportedly greater for myopic eyes than for hyperopic eyes. We investigated potential explanations for this difference. Analytical analysis and computer ray tracing were performed on two schematic eye models of axial ametropia. Using paraxial and nonparaxial approaches, AA was specified for the naked and the corrected eye using the anterior corneal surface as the reference plane. Assuming that axial myopia is due entirely to an increase in vitreous chamber depth, AA increases with the amount of myopia for two reasons that have not always been taken into account. First is the choice of reference location for specifying refractive error and AA in diopters. When specified relative to the cornea, AA increases with the degree of myopia more than when specified relative to the eye's first Gaussian principal plane. The second factor is movement of the eye's second Gaussian principal plane toward the retina during accommodation, which has a larger dioptric effect in shorter eyes. Using the corneal plane (placed at the corneal vertex) as the reference plane for specifying accommodation, AA depends slightly on the axial length of the eye's vitreous chamber. This dependency can be reduced significantly by using a reference plane located 4 mm posterior to the corneal plane. A simple formula is provided to help clinicians and researchers obtain a value of AA that closely reflects power changes of the crystalline lens, independent of axial ametropia and its correction with lenses.

The twelve-step recovery model of AA: a voluntary mutual help association.

PubMed

Borkman, Thomasina

2008-01-01

Alcoholism treatment has evolved to mean professionalized, scientifically based rehabilitation. Alcoholics Anonymous (AA) is not a treatment method; it is far better understood as a Twelve-Step Recovery Program within a voluntary self-help/mutual aid organization of self-defined alcoholics. The Twelve-Step Recovery Model is elaborated in three sections, patterned on the AA logo (a triangle within a circle): The triangle's legs represent recovery, service, and unity; the circle represents the reinforcing effect of the three legs upon each other as well as the "technology" of the sharing circle and the fellowship. The first leg of the triangle, recovery, refers to the journey of individuals to abstinence and a new "way of living." The second leg, service, refers to helping other alcoholics which also connects the participants into a fellowship. The third leg, unity, refers to the fellowship of recovering alcoholics, their groups, and organizations. The distinctive AA organizational structure of an inverted pyramid is one in which the members in autonomous local groups direct input to the national service bodies creating a democratic, egalitarian organization maximizing recovery. Analysts describe the AA recovery program as complex, implicitly grounded in sound psychological principles, and more sophisticated than is typically understood. AA provides a nonmedicalized and anonymous "way of living" in the community and should probably be referred to as the Twelve-Step/Twelve Tradition Recovery Model in order to clearly differentiate it from professionally based twelve-step treatments. There are additional self-help/mutual aid groups for alcoholics who prefer philosophies other than AA.

JUH-1H Redesigned Pneumatic Boot Deicing System Flight Test Evaluation

DTIC Science & Technology

1987-08-01

Company (BFG) Initiated a program to evaluate the feasibility of pneumatic deicing systems for helicopter rotor blades. The concept was revived by...Goodrich Company (BFG) polyurethane erosion material. All tubes 53 Photo 6. Control Switch V. in each delcer are simultaneously Inflated...laaaaaaaaaaaaaBBaaaa «••aaaaaaaffaaaaaaaaaaaaaaaaeaaaaaaaHaaaaaaaaaaa««««*«* a afiaa.a.aaaaaaaaaan a sa aa aaa ■ 8a»a saa B^iiBaBa ax ■ aa aaa aa aal .a

Evaluation of thrombelastographic platelet-mapping in healthy cats.

PubMed

Blois, Shauna L; Banerjee, Amrita; Wood, R Darren

2012-06-01

Thrombelastography (TEG) permits analysis of clot formation but it is not specific for platelet activity. TEG PlateletMapping (TEG-PM) is a modification of TEG that uses adenosine diphosphate (ADP) and arachidonic acid (AA) as platelet agonists to define the contribution of platelets to clot formation. The objectives of this study were to determine values for TEG-PM in healthy cats and the interassay variation of TEG-PM. TEG-PM analysis was performed on blood specimens collected from 12 healthy cats and was repeated using a second blood specimen collected 2 hours later. Maximum amplitudes generated by thrombin (MA(thrombin)), fibrin (MA(fibrin)), ADP-stimulated platelet activity (MA(ADP)), and AA-stimulated platelet activity (MA(AA)) were recorded. Mean ± SD for MA(thrombin) was 51.1 ± 8.5 mm, for MA(fibrin) was 32.3 ± 17.7 mm, for MA(ADP) was 32.3 ± 15.0 mm, and for MA(AA) was 24.5 ± 12.2 mm. Mean MA(ADP) and MA(fibrin) were not significantly different, whereas mean MA(AA) was significantly lower than mean MA(fibrin). Results from the first and second specimens were not significantly different. Correlation between the first and second specimens was moderate for MA(thrombin), MA(fibrin), and MA(ADP), but was poor for MA(AA). A high degree of variability (coefficient of variation 47.7-60.0%) was observed for MA(fibrin), MA(ADP), and MA(AA). As MA(ADP) and MA(AA) (AA) were the same as or lower than MA(fibrin), a valid baseline to determine platelet-stimulated clot formation could not be established. Considerable interassay variation and wide intervals for MA(fibrin), MA(ADP), and MA(AA) values in this study indicate that TEG-PM should be used cautiously in feline patients. Several preanalytical factors should be examined in further detail. © 2012 American Society for Veterinary Clinical Pathology.

Stability of MCT/LCT-based total nutrient admixtures for neonatal use over 30 hours at room temperature: applying pharmacopeial standards.

PubMed

Driscoll, David F; Silvestri, Anthony P; Bistrian, Bruce R

2010-01-01

United States Pharmacopeial Chapter <729> places a limit on the percentage of large fat globules >5 microm, expressed as a PFAT5 of <0.05% for all native lipid emulsions. Some adult total nutrient admixtures (TNAs) have also remained below this limit for up to 48 hours. In 2003, medium-chain/long-chain triglyceride (MCT/LCT)-based neonatal TNAs with between 2% and 3% amino acid (AA) concentrations were shown to be similarly stable by the PFAT5 parameter. Stability assessment of neonatal TNAs with AA <2% or > or =3% were tested. Eight neonatal TNAs with various combinations of AA (1%, 1.5%, 3%, and 4%), glucose (G; 5% and 10%), and MCT/LCT (ML; 2% and 4%) and standard concentrations of additives were tested in triplicate (n = 24) over 30 hours (immediately after mixing, then at 6, 24, and 30 hours) at 25 degrees C +/- 2 degrees C. PFAT5 determinations for all 24 formulations were made in duplicate, immediately after mixing, and then at 6, 24, and 30 hours later. Mean droplet size (MDS) and pH were assessed at the outset and end of the study. The differences in the PFAT5 levels were significant (P < .001) by a 2-way analysis of variance based on formula and time as the independent variables. The TNAs with 1% and 1.5% AA with all Gs and MLs (group 1, n = 12) had PFAT5 levels >0.05% (up to 0.50%) in most samples (68 of 96 samples, or 71% of cases) in the study, whereas in the same TNAs, but made with 3% and 4% AA (group 2, n = 12), 100% of samples (all 96 cases) had PFAT5 levels <0.05% (up to 0.04%), and this difference was significant (P < .001). Pairwise comparisons between groups based on overall values of PFAT5, MDS, and pH showed significant differences between groups for all variables. For neonatal TNAs, AA level is the most sensitive determinant of stability, and the PFAT5 parameter is the most sensitive indicator of stability.

The 2% Transition: Supporting Access to State Assessments for Students with Disabilities

ERIC Educational Resources Information Center

Jamgochian, Elisa M.; Ketterlin-Geller, Leanne R.

2015-01-01

Most students with disabilities participate in state assessments with or without accommodations [based on each student's Individualized Education Program (IEP)]. A small number of students with the most severe or profound intellectual disabilities participate in an alternate assessment based on alternate achievement standards (AA-AAS). Until…

Powerlessness Reinterpreted: Reframing Step One.

ERIC Educational Resources Information Center

Young, Susan L.

The 12 steps of the well-known mutual help group, Alcoholics Anonymous (AA), begin with Step One, admitting powerlessness. Although Step One has helped many problem drinkers and other addicts, its spiritual concepts have been criticized. The possibility of reconceptualizing powerlessness as empowering, not only within AA and its offshoot programs,…

Getting and Holding a Job with an Astronomy Degree

NASA Astrophysics Data System (ADS)

Guinan, E. F.

1995-12-01

This panel session will focus on a realistic assessment of the current and future employment opportunities for trained Astronomers. The development of strategies for finding worthwhile employment in today's \\it challenging\\ job market. Opportunities both within and without the traditional astronomy fields will be explored. Astronomy degrees can provide a broad training in related physical sciences, mathematics, computers, and innovative, new technologies while honing a person's ability to solve a wide spectrum of difficult and complex problems. With these skills, a number of past and present AAS members have found interesting and rewarding employment outside of mainstream Astronomy and in fields unrelated to Astronomy. This session will: \\hang 1. Summarize the results of the recent job survey conducted among AAS members. \\hang 2. Provide job search information from people who have recently found jobs and from experts who assist people with scientific and technical backgrounds to find jobs. \\hang 3. Focus attention on possible alternative careers.

Does Age Moderate the Effect of Spirituality/Religiousness in Accounting for Alcoholics Anonymous Benefit?

PubMed Central

Montes, K. S.; Tonigan, J. S.

2017-01-01

Objective Gains in spiritual/religious (S/R) practices among Alcoholics Anonymous (AA) members are associated with reductions in drinking. This study had the following aims: (a) examine spirituality/religiousness as a mediator of the relationship between AA attendance and reductions in drinking behavior to replicate past research findings and to (b) examine age-cohort as a moderator of the mediational analyses given that empirical evidence (e.g., generational differences in spirituality) suggests that age may influence the acquisition of gains in spirituality/religiousness during AA as well as the expression of these gains on drinking behavior. Method Measures were administered to 253 participants recruited from community-based AA and outpatient treatment programs at baseline, 3, 6, 9, and 12-months, and 210 (83%) participants provided complete data to test study aims. Results Gains in S/R practices mediated the relationship between AA attendance and increased abstinence, but not drinking intensity. Simple slopes analyses indicated a positive association between AA attendance and gains in S/R practices among younger AA affiliates but not older AA affiliates in the moderated-mediational analyses. However, age was not found to moderate the global mediational effect. Conclusions The results from the current study inform efforts to increase positive change in AA affiliates’ drinking behavior by highlighting specific aspects of S/R practices that should be targeted based on the age of an AA affiliate. PMID:28824222

Does Age Moderate the Effect of Spirituality/Religiousness in Accounting for Alcoholics Anonymous Benefit?

PubMed

Montes, K S; Tonigan, J S

2017-01-01

Gains in spiritual/religious (S/R) practices among Alcoholics Anonymous (AA) members are associated with reductions in drinking. This study had the following aims: (a) examine spirituality/religiousness as a mediator of the relationship between AA attendance and reductions in drinking behavior to replicate past research findings and to (b) examine age-cohort as a moderator of the mediational analyses given that empirical evidence (e.g., generational differences in spirituality) suggests that age may influence the acquisition of gains in spirituality/religiousness during AA as well as the expression of these gains on drinking behavior. Measures were administered to 253 participants recruited from community-based AA and outpatient treatment programs at baseline, 3, 6, 9, and 12-months, and 210 (83%) participants provided complete data to test study aims. Gains in S/R practices mediated the relationship between AA attendance and increased abstinence, but not drinking intensity. Simple slopes analyses indicated a positive association between AA attendance and gains in S/R practices among younger AA affiliates but not older AA affiliates in the moderated-mediational analyses. However, age was not found to moderate the global mediational effect. The results from the current study inform efforts to increase positive change in AA affiliates' drinking behavior by highlighting specific aspects of S/R practices that should be targeted based on the age of an AA affiliate.

Individual differences in aversion to ambiguity regarding medical tests and treatments: association with cancer screening cognitions.

PubMed

Han, Paul K J; Williams, Andrew E; Haskins, Amy; Gutheil, Caitlin; Lucas, F Lee; Klein, William M P; Mazor, Kathleen M

2014-12-01

Aversion to "ambiguity"-uncertainty about the reliability, credibility, or adequacy of information-about medical tests and treatments is an important psychological response that varies among individuals, but little is known about its nature and extent. The purpose of this study was to examine how individual-level ambiguity aversion relates to important health cognitions related to different cancer screening tests. A survey of 1,074 adults, ages 40 to 70 years, was conducted in four integrated U.S. healthcare systems. The Ambiguity Aversion in Medicine (AA-Med) scale, a measure of individual differences in aversion to ambiguity (AA) about medical tests and treatments, was administered along with measures of several cancer screening-related cognitions: perceived benefits and harms of colonoscopy, mammography, and PSA screening, and ambivalence and future intentions regarding these tests. Multivariable analyses were conducted to assess the associations between AA-Med scores and cancer screening cognitions. Individual-level AA as assessed by the AA-Med scale was significantly associated (P < 0.05) with lower perceived benefits, greater perceived harms, and greater ambivalence about all three screening tests, and lower intentions for colonoscopy but not mammography or PSA screening. Individual-level AA is broadly and simultaneously associated with various pessimistic cognitive appraisals of multiple cancer screening tests. The breadth of these associations suggests that the influence of individual-level AA is insensitive to the degree and nonspecific with respect to the causes of ambiguity. Individual-level AA constitutes a measurable, wide-ranging cognitive bias against medical intervention, and more research is needed to elucidate its mechanisms and effects. ©2014 American Association for Cancer Research.

A GTPase reaction accompanying the rejection of Leu-tRNA2 by UUU-programmed ribosomes. Proofreading of the codon-anticodon interaction by ribosomes.

PubMed

Thompson, R C; Dix, D B; Gerson, R B; Karim, A M

1981-01-10

The characteristics of a GTPase reaction between poly(U)-programmed ribosomes, EFTu . GTP, and the near-cognate aminoacyl (aa)-tRNA, Leu-tRNA Leu 2, have been studied to assess the role of this reaction in proofreading of the codon-anticodon interaction. The reaction resembles the GTPase reaction with cognate aa-tRNAs and EFTu . GTP in its substrate requirements, in its involving EFTu . GTP . aa-tRNA ternary complexes, and in its requiring a free ribosomal A-site. The noncognate reaction differs from the cognate one in that aa-tRNA becomes stably bound to the ribosomes only 5% of the time; it therefore seems best characterized as an abortive enzymatic binding reaction. The rate of reaction is a significant fraction (4%) of that of the cognate aa-tRNA, indicating that recognition of ternary complexes by ribosomes involves a level of error greater than that of translation as a whole. The rejection of the noncognate aa-tRNA following GTP hydrolysis is therefore a vital step in the translation process and fulfills the criteria set for a proofreading reaction. Leu-tRNA Leu 2 which escapes rejection through proofreading, forms a stable complex with the ribosomal A-site, so it appears that the Leu-tRNA2 which was rejected never reached the A-site and that proofreading precedes full A-site binding.

Social networks as mediators of the effect of Alcoholics Anonymous.

PubMed

Kaskutas, Lee Ann; Bond, Jason; Humphreys, Keith

2002-07-01

This study tested the hypothesis that the relationship between Alcoholics Anonymous (AA) involvement and reduced substance use is partially explained (or 'mediated') by changes in social networks. This is a naturalistic longitudinal study of the course of alcohol problems. Study sites were the 10 largest public and private alcohol treatment programs in a northern California county. Three hundred and seventy-seven men and 277 women were recruited upon seeking treatment at study sites. At baseline and 1-year follow-up, we assessed alcohol consequences and dependence symptoms, consumption, social support for abstinence, pro-drinking social influences and AA involvement. In the structural equation model, AA involvement was a significant predictor of lower alcohol consumption and fewer related problems. The size of this effect decreased by 36% when network size and support for drinking were included as mediators. In logistic regression models predicting abstinence at follow-up, AA remained highly significant after including social network variables but was again reduced in magnitude. Thirty-day abstinence was predicted by AA involvement (OR=2.9), not having pro-drinking influences in one's network (OR=0.7) and having support for reducing consumption from people met in AA (versus no support; OR=3.4). In contrast, having support from non-AA members was not a significant predictor of abstinence. For alcohol-related outcomes other than abstinence, significant relationships were found for both AA-based and non-AA-based support. The type of social support specifically given by AA members, such as 24-hour availability, role modeling and experientially based advice for staying sober, may help to explain AA's mechanism of action. Results highlight the value of focusing on outcomes reflective of AA's goals (such as abstinence) when studying how AA works.

Effect of dietary soybean oil and soybean protein concentration on the concentration of digestible amino acids in soybean products fed to growing pigs.

PubMed

Cervantes-Pahm, S K; Stein, H H

2008-08-01

An experiment was conducted to measure the effect of adding soybean oil to soybean meal (SBM) and soy protein concentrate (SPC) on apparent (AID) and standardized (SID) ileal digestibility of CP and AA by growing pigs. A second objective was to compare AID and SID of AA in a new high-protein variety of full fat soybeans (FFSB) to values obtained in other soybean products. Commercial sources of FFSB (FFSB-CV), SBM, and SPC, and of a new high-protein variety of FFSB (FFSB-HP) were used in the experiment. Four diets were prepared using each soybean product as the sole source of CP and AA in 1 diet. Two additional diets were formulated by adding soybean oil (7.55 and 7.35%, respectively) to the diets containing SBM and SPC. A nitrogen-free diet was also used to measure basal endogenous losses of CP and AA. The 2 sources of FFSB were extruded at 150 degrees C before being used in the experiment. Seven growing barrows (initial BW = 26.2 kg) were prepared with a T-cannula in the distal ileum and allotted to a 7 x 7 Latin square design. Ileal digesta were collected from the pigs on d 6 and 7 of each period. All digesta samples were lyophilized and analyzed for DM, CP, AA, and chromium, and values for AID and SID of CP and AA were calculated. The addition of oil improved (P < 0.05) the SID of most indispensable AA in SBM and SPC. The SID for 6 of the indispensable AA in FFSB-HP were greater (P < 0.05) than in FFSB-CV, and the SID for all indispensable AA except Met was greater (P < 0.05) in FFSB-HP than in SBM. However, the SID for most AA in FFSB-HP was similar to SBM with oil and SPC, but these values were lower (P < 0.05) than in SPC with oil. In conclusion, the addition of oil improved the SID of most AA in SBM and SPC fed to growing pigs, and the SID of AA in FFSB-HP were greater than in SBM and similar to the SID of AA in SBM with oil and in SPC.

Incidence rate of amyloidosis in patients from a medical care program in Buenos Aires, Argentina: a prospective cohort.

PubMed

Aguirre, María Adela; Boietti, Bruno Rafael; Nucifora, Elsa; Sorroche, Patricia Beatriz; González Bernaldo de Quirós, Fernán; Giunta, Diego Hernan; Posadas-Martínez, María Lourdes

2016-09-01

There are limited data concerning the incidence density (ID) of ATTRwt, AL and AA amyloidosis in the Argentinean population. Our aim was to estimate the ID of ATTRwt, AL and AA amyloidosis at the Hospital Italiano Medical Care Program in Buenos Aires, Argentina. Population was all members of a hospital-based health maintenance organization who were affiliated since January 2006 to December 2014. Each person was followed contributing time at risk since January 2006 or enrollment date to the final date. Incident cases of amyloidosis were captured from the institutional registry of amyloidosis. Incidence rate was calculated with 95% confidence intervals. During the nine-year study period, there were 15 patients with ATTRwt, 12 with AL and 2 with AA amyloidosis for 1 105 152 person-years of follow-up. The crude ID of ATTRwt amyloidosis was 13.5 (95%CI 8.1-22.4), that of AL amyloidosis 11 (95%CI: 6-19) and that of AA amyloidosis 1.8 (95%CI: 0.5-7.2) per 1 000 000 person-years. The highest ID was found in men (31.7 for ATTRwt, 15.9 for AL and 2.27 for AA amyloidosis per 1 000 000 person-years). The ID adjusted to the population of the city of Buenos Aires was 6.46 (95%CI: 3.17-9.74) for ATTRwt, 6.13 (95%CI: 2.57-9.7) for AL and 1.21 (95%CI: 0.56 to 2.99) for AA amyloidosis. This is the first paper to report the incidence density of ATTRwt, AL and AA amyloidosis in Latin America. Our results are consistent with other studies from other regions. Although systemic amyloidosis is a rare disease, it is a major health problem because of its morbi-mortality.

Resistance Risk Assessment of Spodoptera frugiperda (Lepidoptera: Noctuidae) and Diatraea saccharalis (Lepidoptera: Crambidae) to Vip3Aa20 Insecticidal Protein Expressed in Corn.

PubMed

Bernardi, Oderlei; Bernardi, Daniel; Amado, Douglas; Sousa, Renan S; Fatoretto, Julio; Medeiros, Fernanda C L; Conville, Jared; Burd, Tony; Omoto, Celso

2015-12-01

Transgenic Agrisure Viptera 3 corn that expresses Cry1Ab, Vip3Aa20, and EPSPS proteins and Agrisure Viptera expressing Vip3Aa20 are used for control of Spodoptera frugiperda (J.E. Smith) and Diatraea saccharalis (F.) in Brazil. To support a resistance management program, resistance risk assessment studies were conducted to characterize the dose expression of Vip3Aa20 protein and level of control against these species. The Vip3Aa20 expression in Agrisure Viptera 3 and Agrisure Viptera decreased from V6 to V10 stage of growth. However, Vip3Aa20 expression in Agrisure Viptera 3 at V6 and V10 stages was 13- and 16-fold greater than Cry1Ab, respectively. The Vip3Aa20 expression in lyophilized tissue of Agrisure Viptera 3 and Agrisure Viptera diluted 25-fold in an artificial diet caused complete larval mortality of S. frugiperda and D. saccharalis. In contrast, lyophilized tissue of Bt11 at the same dilution does not provide complete mortality of these species. Agrisure Viptera 3 and Agrisure Viptera also caused a high level of mortality against S. frugiperda and D. saccharalis. Moreover, 100% mortality was observed for S. frugiperda larvae (neonates through fifth-instar larvae) when fed in corn with the Vip trait technology. Viptera corn achieves a high level of control against S. frugiperda and D. saccharalis providing a high dose, which is an important determination to support the refuge strategy for an effective resistance management program. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Measurement of admixture proportions and description of admixture structure in different US populations

PubMed Central

Halder, Indrani; Yang, Bao-Zhu; Kranzler, Henry R.; Stein, Murray B.; Shriver, Mark D.; Gelernter, Joel

2010-01-01

Variation in individual admixture proportions leads to heterogeneity within populations. Though novel methods and marker panels have been developed to quantify individual admixture, empirical data describing individual admixture distributions are limited. We investigated variation in individual admixture in four US populations [European American (EA), African American (AA) and Hispanics from Connecticut (EC) and California (WC)] assuming three-way intermixture among Europeans, Africans and Indigenous Americans. Admixture estimates were inferred using a panel of 36 microsatellites and 1 SNP, which have significant allele frequency differences between ancestral populations, and by using both a maximum likelihood (ML) based method and a Bayesian method implemented in the program STRUCTURE. Simulation studies showed that estimates obtained with this marker panel are within 96% of expected values. EAs had the lowest non-European admixture with both methods, but showed greater homogeneity with STRUCTURE than with ML. All other samples showed a high degree of variation in admixture estimates with both methods, were highly concordant and showed evidence of admixture stratification. With both methods, AA subjects had 16% European and <10% Indigenous American admixture on average. EC Hispanics had higher mean African admixture and the WC Hispanics higher mean Indigenous American admixture, possibly reflecting their different continental origins. PMID:19572378

Determination of acrylamide in processed foods by LC/MS using column switching.

PubMed

Takatsuki, Satoshi; Nemoto, Satoru; Sasaki, Kumiko; Maitani, Tamio

2003-04-01

An LC/MS method was developed for the determination of acrylamide (AA) in processed or cooked foods. AA was extracted with a mixture of water and acetone from homogenized food samples after the addition of 13C-labeled acrylamide (AA-1-(13)C) as an internal standard. The extract was concentrated, washed with dichloromethane for defatting, and cleaned up on Bond Elut C18, PSA and ACCUCAT cartridge-columns, and then AA was determined by LC/MS in the selected ion recording (SIR) mode. For the LC/MS analysis, four LC columns were connected in-line and the flow of the mobile phase was switched according to a time-program. Monitoring ions for AA were m/z 72 and 55, and those for AA-1-(13)C were m/z 73 and 56. AA and AA-1-(13)C were determined without interference from the matrices in all samples. The recoveries of AA from potato chips, corn snack, pretzel and roasted tea spiked at the level of 500 ng/g of AA were 99.5-101.0% with standard deviations (SD) in the range from 0.3 to 1.6%. The limits of detection and quantification of the developed method were 9 and 30 ng/g for AA in samples, respectively. The method was applied to the analysis of AA in various processed or cooked food samples purchased from retail markets. High levels of AA were found in potato chips and French-fried potato (467-3,544 ng/g). Fried and sugar-coated dough cakes (karinto) contained 374 and 1,895 ng/g. Corn snacks contained 117-535 ng/g of AA. Roasted foods (such as roasted sesame seed, roasted barley (mugi-cha), roasted tea (hoji-cha), coffee beans and curry powder) contained 116-567 ng/g of AA. Foods made from fish, egg and meat contained lower levels of AA than the plant-based foods. Foods containing much water showed a tendency to have low levels of AA compared with dry foods. The proposed method was applicable to the analysis of AA in variety of processed foods.

The Impact of Alcoholics Anonymous on other substance abuse related Twelve Step programs

PubMed Central

Laudet, Alexandre B.

2008-01-01

This chapter explores the influence of the AA model on self-help fellowships addressing problems of drug dependence. Fellowships that have adapted the 12-step recovery model to other substances of abuse are reviewed; next similarities and differences between AA and drug-recovery 12-step organizations are examined; finally, we present empirical findings on patterns of attendance and perceptions of AA and Narcotics Anonymous (NA) among polydrug dependent populations, many of whom are cross-addicted to alcohol. Future directions in 12-step research are noted in closing. PMID:19115764

Manpower Forecasts and Planned Maintenance Personnel Skill Level Changes

DTIC Science & Technology

1980-08-01

McDonnell Aircraft Company performed a study to determine the relationship between subsystem design characteristics * training costs, training difficulties...I~ea)I.JJ ~* N 2u,~J~: a I# 3AU JIUA ’M aa uvJ~d~ I AWNaILa~ aa-; Jjau..rii Luu Ca 4 0 * a’ - -~e o ititti a I saa ’ -- I - 1 4 J b4𔃻 -,f JIL 1 .aa...one hundred man years of effort and several civilian companies an well as Air Force resources. The flexibility and detail available *in this programming

Coarse-Graining of Polymer Dynamics via Energy Renormalization

NASA Astrophysics Data System (ADS)

Xia, Wenjie; Song, Jake; Phelan, Frederick; Douglas, Jack; Keten, Sinan

The computational prediction of the properties of polymeric materials to serve the needs of materials design and prediction of their performance is a grand challenge due to the prohibitive computational times of all-atomistic (AA) simulations. Coarse-grained (CG) modeling is an essential strategy for making progress on this problem. While there has been intense activity in this area, effective methods of coarse-graining have been slow to develop. Our approach to this fundamental problem starts from the observation that integrating out degrees of freedom of the AA model leads to a strong modification of the configurational entropy and cohesive interaction. Based on this observation, we propose a temperature-dependent systematic renormalization of the cohesive interaction in the CG modeling to recover the thermodynamic modifications in the system and the dynamics of the AA model. Here, we show that this energy renormalization approach to CG can faithfully estimate the diffusive, segmental and glassy dynamics of the AA model over a large temperature range spanning from the Arrhenius melt to the non-equilibrium glassy states. Our proposed CG strategy offers a promising strategy for developing thermodynamically consistent CG models with temperature transferability.

[Modified Cheng's Juanbi Decoction downregulates expression of prostaglandin E receptor 4 in synovial tissue in rats with adjuvant arthritis].

PubMed

Xu, Xia; Cheng, Hui; Cao, Jian; DU, Huan; Meng, Qingwei; Guo, Mengyuan

2017-06-01

Objective To investigate the effect of modified Cheng's Juanbi Decoction on the expression of prostaglandin E receptor 4 (PTGER4), the T cell receptor in the synovial tissues, in rats with adjuvant arthritis (AA). Methods A rat model of AA was established by subcutaneous injection of Freund's complete adjuvant at the vola pedis combined with ice-water bath and blowing. The degree of joint swelling and arthritis index were determined in each group. The quantitative real-time PCR was performed to assess the effect of modified Cheng's Juanbi Decoction on the mRNA expression of PTGER4in the synovial tissue. Results Cheng's Juanbi Decoction significantly alleviated the damage in the joints and synovial tissues in the AA rats. High-dose (the content of crude drug: 4 g/mL) Cheng's Juanbi Decoction significantly reduced the mRNA expression of PTGER4 in the synovial tissues. Conclusion Cheng's Juanbi Decoction can reduce the level of PTGER4 mRNA in the synovial tissue in AA rats.

The Eastland Prostate Cancer Survey: instrument development and psychometric testing.

PubMed

Eastland, Taryn Y; Dancy, Barbara L

2013-03-01

African-American (AA) women could be instrumental in communicating positive prostate screening behavior to the significant males in their lives. However, little is known about AA women's prostate cancer attitudes, perceived behavioral control, subjective norms, intentions, behaviors, and knowledge regarding prostate cancer screening. This study describes the development and psychometric testing of the Eastland Prostate Cancer Survey (EPCS). A nonexperimental, correlational study with 200 AA women was used to test the psychometric properties of the six-subscale EPCS with 66 items. Construct validity, internal consistency, and test-retest reliability for the EPCS were acceptable and resulted in an eight-subscale EPCS with 56 items. Cronbach's alphas for the subscales ranged from 0.69 to 0.92. The EPCS is a culturally sensitive, gender-relevant instrument that could be used by community health providers to develop community health programs aimed at engaging AA women in the promotion of prostate cancer screening for AA men.

Nandrolone inhibits MMP-2 in the left ventricle of rats.

PubMed

Marqueti, R C; Micocci, K C; Leite, R D; Selistre-de-Araujo, H S

2012-03-01

The indiscriminate use of anabolic-androgenic steroids has been shown to induce left ventricular dysfunctions. The main objective of the present study was to investigate the effects of nandrolone decanoate on matrix metalloprotease (MMP-2) activity and protein level in the left ventricle (LV) of rats after 7 weeks of mechanical load exercise. Wistar rats were grouped into: sedentary (S); nandrolone decanoate-treated sedentary (AAS); trained without AAS (T) and trained and treated with AAS (AAST). Exercised groups performed a 7-weeks water-jumping program. Training significantly increased the MMP-2 activity by zymography and the protein level by Western blotting analysis. However, the AAS treatment abolished both the increase in MMP activity and protein level induced by exercise. These results suggest that AAS may impair cardiac tissue remodeling which may lead to the heart malfunction. © Georg Thieme Verlag KG Stuttgart · New York.

76 FR 6688 - Land Border Carrier Initiative Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-08

... [Docket No. USCBP-2006-0132; CBP Dec. No. 11-04] RIN 1651-AA68 Land Border Carrier Initiative Program... Carrier Initiative Program (LBCIP). The LBCIP was established as a voluntary industry partnership program... Initiative Program (LBCIP) was established as a CBP-industry partnership regulatory program enlisting the...

Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Darai, G

1993-10-01

The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

Nuclear Blast Response Computer Program. Volume I. Program Description.

DTIC Science & Technology

1981-08-01

VEL 13 - AAS / , \\ / I ’ / I 4 2 Y VERTICAL PLANE NRMAL ’ , TO XAAs 3 / / , / 12 -’C’- Figure 6. Blast Orientations for Aero Module The spacing of...lag across 75 ’ " -0- Zi I ,AAS \\ \\ &,8 (8) VEgrrCA PLANE S .NORMAL TO YAAS XAAS VEL / ) - . +/ f \\ " 4 (4) 2 (2) 3 (3) Corresponding Aero...DEFINITION CDIl I Li NTFM-MXOPD ANUM TEMPORARY ARRAYS FOP 2 L2 NTFM-MXOFD ADEN FORMING TRANSFEF 3 L3 2-MXCRE ATEN FUNCTION POLYNOMIALS 4 L4 2.MXCRE

Do women differ from men on Alcoholics Anonymous participation and abstinence? A multi-wave analysis of treatment seekers

PubMed Central

Delucchi, Kevin

2011-01-01

Background Given the widespread use of Alcoholics Anonymous (AA) and other similar groups in the US and the increasing membership of women, the present paper compares women to men on their meeting attendance and AA-prescribed behaviors, factors associated with that AA participation, and tests how these relate to women’s and men’s abstinence across time. Methods All consecutive new admissions (age ≥ 18) from county-wide public and private alcohol and drug treatment programs representing the larger population of treatment seekers were approached to be in the study at treatment entry. Those consenting at baseline (n = 926) were sought for follow-up interviews 1, 3, 5 and 7 years later. Generalized linear models were used to test whether various help-seeking factors associated with AA participation differentially by gender and, controlling for AA and other confounders, whether women differ from men on abstinence. Results At each follow-up interview, women and men attended AA at similar rates and similarly practiced specific AA-behaviors, and they were alike on most factors associated with AA participation and abstention across time including abstinence goal, drink volume, negative consequences, prior treatment, and encouragement to reduce drinking. Relative to men, women with higher ASI drug severity were less likely to participate in AA. Though higher AA participation was a predictor of abstinence for both genders, males were less likely to be abstinent across time. Men were also more likely to reduce their AA participation across time. Conclusion These findings add to an emerging literature on how women compare to men on factors related to AA participation and subsequent drinking outcomes across time. Findings have clinical implications for service providers referring clients to such groups. PMID:21689121

Stabilization of Proteins and Noncovalent Protein Complexes during Electrospray Ionization by Amino Acid Additives.

PubMed

Zhang, Hua; Lu, Haiyan; Chingin, Konstantin; Chen, Huanwen

2015-07-21

Ionization of proteins and noncovalent protein complexes with minimal disturbance to their native structure presents a great challenge for biological mass spectrometry (MS). In living organisms, the native structure of intracellular proteins is commonly stabilized by solute amino acids (AAs) accumulated in cells at very high concentrations. Inspired by nature, we hypothesized that AAs could also pose a stabilizing effect on the native structure of proteins and noncovalent protein complexes during ionization. To test this hypothesis, here we explored MS response for various protein complexes upon the addition of free AAs at mM concentrations into the electrospray ionization (ESI) solution. Thermal activation of ESI droplets in the MS inlet capillary was employed as a model destabilizing factor during ionization. Our results indicate that certain AAs, in particular proline (Pro), pose considerable positive effect on the stability of noncovalent protein complexes in ESI-MS without affecting the signal intensity of protein ions and original protein-ligand equilibrium, even when added at the 20 mM concentration. The data suggest that the degree of protein stabilization is primarily determined by the osmolytic and ampholytic characteristics of AA solutes. The highest stability and visibility of noncovalent protein complexes in ESI-MS are achieved using AA additives with neutral isoelectric point, moderate proton affinity, and unfavorable interaction with the native protein state. Overall, our results indicate that the simple addition of free amino acids into the working solution can notably improve the stability and accuracy of protein analysis by native ESI-MS.

42 CFR 54a.2 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND... of the PHS Act, 42 U.S.C. 290aa, et seq., for the provision of substance abuse prevention and or... beneficiary means an individual who receives substance abuse services under a program funded in whole or in...

42 CFR 54a.2 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND... of the PHS Act, 42 U.S.C. 290aa, et seq., for the provision of substance abuse prevention and or... beneficiary means an individual who receives substance abuse services under a program funded in whole or in...

42 CFR 54a.2 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND... of the PHS Act, 42 U.S.C. 290aa, et seq., for the provision of substance abuse prevention and or... beneficiary means an individual who receives substance abuse services under a program funded in whole or in...

42 CFR 54a.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND... of the PHS Act, 42 U.S.C. 290aa, et seq., for the provision of substance abuse prevention and or... beneficiary means an individual who receives substance abuse services under a program funded in whole or in...

Existing data on breast cancer in African-American women: what we know and what we need to know.

PubMed

Clarke, Christina A; West, Dee W; Edwards, Brenda K; Figgs, Larry W; Kerner, Jon; Schwartz, Ann G

2003-01-01

Much of what is known about breast cancer in African-American (AA) women is based on existing cancer surveillance data. Thus, it is important to consider the accuracy of these resources in describing the impact of breast cancer in AA populations. National cancer surveillance data bases are described, their most recent findings are presented, their limitations are outlined, and recommendations are made for improving their utility. Breast cancer characteristics have been studied well in urban (but not in rural) and Southern AA populations. The recent Surveillance, Epidemiology, and End Results (SEER) Program expansion and the continued improvement of state cancer registry operations will provide opportunities to study larger and more diverse AA subpopulations. Recommendations for improving the utility of surveillance data bases include adding new items to better describe correlates of advanced stage at diagnosis and reduced survival of AA women with breast cancer by linking surveillance data bases with other large data bases to provide area-level socioeconomic status, health insurance status, and retrieving new information about patient comorbidities and biomarkers from medical records; improving the completeness and accuracy of treatment and survival information already collected for all patients; working to improve the dissemination of appropriate cancer data to nonresearch consumer communities, including clinicians, patients, advocates, politicians, and health officials; and the development of new training programs for cancer registrars and researchers. The continued improvement of cancer surveillance systems should be considered important activities in this research agenda, because these data will play a far-reaching role in the prevention and control of breast cancer in AA women.

Changes in growth and antioxidant status of alfalfa sprouts during sprouting as affected by gamma irradiation of seeds.

PubMed

Fan, Xuetong; Thayer, Donald W; Sokorai, Kimberly J B

2004-03-01

Viking 3000 alfalfa seeds irradiated with gamma rays to doses of 0, 1, 2, 3, or 4 kGy were sprouted and allowed to grow for up to 8 days at 23 degrees C. Germination, growth (yield and length), antioxidant capacity, and ascorbic acid (AA) were measured during sprouting. Results showed percent germination of the seeds and the rates of growth of the sprouts were inversely related to the radiation dose absorbed by the seeds. Both antioxidant capacity and AA content expressed on a fresh weight basis decreased during growth of the sprouts. Sprouts grown from irradiated seeds had greater antioxidant capacity and AA content on a fresh weight basis than those grown from nonirradiated seeds. However, when the nutritive values were expressed on a per gram of seed basis, irradiation had no effect on the nutritive values of sprouts.

Programming Post-Translational Control over the Metabolic Labeling of Cellular Proteins with a Noncanonical Amino Acid.

PubMed

Thomas, Emily E; Pandey, Naresh; Knudsen, Sarah; Ball, Zachary T; Silberg, Jonathan J

2017-08-18

Transcriptional control can be used to program cells to label proteins with noncanonical amino acids by regulating the expression of orthogonal aminoacyl tRNA synthetases (aaRSs). However, we cannot yet program cells to control labeling in response to aaRS and ligand binding. To identify aaRSs whose activities can be regulated by interactions with ligands, we used a combinatorial approach to discover fragmented variants of Escherichia coli methionyl tRNA synthetase (MetRS) that require fusion to associating proteins for maximal activity. We found that these split proteins could be leveraged to create ligand-dependent MetRS using two approaches. When a pair of MetRS fragments was fused to FKBP12 and the FKBP-rapamycin binding domain (FRB) of mTOR and mutations were introduced that direct substrate specificity toward azidonorleucine (Anl), Anl metabolic labeling was significantly enhanced in growth medium containing rapamycin, which stabilizes the FKBP12-FRB complex. In addition, fusion of MetRS fragments to the termini of the ligand-binding domain of the estrogen receptor yielded proteins whose Anl metabolic labeling was significantly enhanced when 4-hydroxytamoxifen (4-HT) was added to the growth medium. These findings suggest that split MetRS can be fused to a range of ligand-binding proteins to create aaRSs whose metabolic labeling activities depend upon post-translational interactions with ligands.

76 FR 24343 - Advanced Biofuel Payment Program; Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-02

...-AA75 Advanced Biofuel Payment Program; Correction AGENCY: Rural Business-Cooperative Service; Rural... Federal Register of February 11, 2011, establishing the Advanced Biofuel Payment Program authorized under... this Program, the Agency will enter into contracts with advanced biofuel producers to pay such...

Perceptions regarding genetic testing in populations at risk for nephropathy.

PubMed

Freedman, Barry I; Fletcher, Alison J; Sanghani, Vivek R; Spainhour, Mitzie; Graham, Angelina W; Russell, Gregory B; Cooke Bailey, Jessica N; Iltis, Ana S; King, Nancy M P

2013-01-01

Population ancestry-based differences exist in genetic risk for many kidney diseases. Substantial debate remains regarding returning genetic test results to participants. African-Americans (AAs) and European-Americans (EAs) at risk for end-stage kidney disease were queried for views on the value and use of genetic testing in research. A standardized survey regarding attitudes toward genetic testing was administered to 130 individuals (64 AA, 66 EA) with first-degree relatives on dialysis. Fisher's exact test was used to assess differences in participant attitudes between population groups. Mean (SD) age of surveyed AAs and EAs was 45.5 (12.8) and 50.5 (14.4) years, respectively (p = 0.04), with similar familial relationships (p = 0.22). AAs and EAs wished to know their test results if risk could be: (1) reduced by diet or exercise (100 and 98%, p = 0.99); (2) reduced by medical treatment (100 and 98%, p = 0.99), or (3) if no treatments were available (90 and 82%, p = 0.21). If informed they lacked a disease susceptibility variant, 87% of AAs and 88% of EAs would be extremely or pretty likely to inform family members (p = 0.84). If informed they had a disease susceptibility variant, 92% of AAs and 89% of EAs would be extremely or pretty likely to inform their family (p = 0.43). Attitudes toward obtaining and using genetic test results for disease in research contexts were similar in AAs and EAs at risk for end-stage kidney disease. A substantial majority would want information regardless of available treatments and would share the information with the family. These results have important implications for patient care, study design and the informed consent process. © 2013 S. Karger AG, Basel.

Independent association between time to prostate-specific antigen (PSA) nadir and PSA progression-free survival in patients with docetaxel-naïve, metastatic castration-resistant prostate cancer receiving abiraterone acetate, but not enzalutamide.

PubMed

Miyake, Hideaki; Hara, Takuto; Tamura, Keita; Sugiyama, Takayuki; Furuse, Hiroshi; Ozono, Seiichiro; Fujisawa, Masato

2017-06-01

The objective of this study was to compare the prognostic effect of time to prostate-specific antigen (PSA) nadir (TTPN) after treatment with abiraterone acetate (AA) and enzalutamide (Enz) in patients with docetaxel-naïve, metastatic castration-resistant prostate cancer (mCRPC). This study included a total of 297 consecutive patients with mCRPC, of whom 125 and 172 received AA and Enz, respectively, without previous treatment with docetaxel and subsequently achieved any degree of PSA reduction after the administration of either agent. The mean values of TTPN in the AA and Enz groups were 19 and 14 weeks, respectively. Despite the lack of significant differences in several parameters according to the mean TTPN in the Enz group, patients with TTPN>19 weeks were characterized by longer duration of androgen deprivation therapy, better performance status, lower incidence of bone metastasis, lower value of nadir PSA, and higher incidence of PSA response than those with TTPN ≤19 weeks in the AA group. The PSA progression-free survival (PFS) in patients with TTPN >19 weeks was significantly superior when compared with TTPN ≤19 weeks in the AA group; however, there was no significant effect of the mean TTPN on the PSA-PFS in the Enz group. Furthermore, TTPN was identified as one of the independent predictors of PSA-PFS in the AA group but not in Enz group. A longer time to reach a PSA nadir after treatment with AA, but not Enz, appeared to be associated with favorable disease control in patients with docetaxel-naïve mCRPC. Copyright © 2017 Elsevier Inc. All rights reserved.

Determining the relative importance of the mechanisms of behavior change within Alcoholics Anonymous: a multiple mediator analysis.

PubMed

Kelly, John F; Hoeppner, Bettina; Stout, Robert L; Pagano, Maria

2012-02-01

Evidence indicates that Alcoholics Anonymous (AA) participation reduces relapse risk but less is known about the mechanisms through which AA confers this benefit. Initial studies indicate self-efficacy, negative affect, adaptive social networks and spiritual practices are mediators of this effect, but because these have been tested in isolation, their relative importance remains elusive. This study tested multiple mediators simultaneously to help determine the most influential pathways. Prospective, statistically controlled, naturalistic investigation examined the extent to which these previously identified mechanisms mediated AA attendance effects on alcohol outcomes controlling for baseline outcome values, mediators, treatment, and other confounders. Nine clinical sites within the United States. Adults (n = 1726) suffering from alcohol use disorder (AUD) initially enrolled in a randomized study with two arms: aftercare (n = 774); and out-patient (n = 952) comparing three out-patient treatments (Project MATCH). AA attendance during treatment; mediators at 9 months; and outcomes [percentage of days abstinent (PDA) and drinks per drinking day (DDD)] at 15 months. Among out-patients the effect of AA attendance on alcohol outcomes was explained primarily by adaptive social network changes and increases in social abstinence self-efficacy. Among more impaired aftercare patients, in addition to mediation through adaptive network changes and increases in social self-efficacy, AA lead to better outcomes through increasing spirituality/religiosity and by reducing negative affect. The degree to which mediators explained the relationship between AA and outcomes ranged from 43% to 67%. While Alcoholics Anonymous facilitates recovery by mobilizing several processes simultaneously, it is changes in social factors which appear to be of primary importance. © 2011 The Authors, Addiction © 2011 Society for the Study of Addiction.

Systemic lupus erythematosus in three ethnic groups. VI: Factors associated with fatigue within 5 years of criteria diagnosis. LUMINA Study Group. LUpus in MInority populations: NAture vs Nurture.

PubMed

Zonana-Nacach, A; Roseman, J M; McGwin, G; Friedman, A W; Baethge, B A; Reveille, J D; Alarcón, G S

2000-01-01

To determine the frequency, degree and associated features of fatigue among Hispanic (H), African American (AA) and Caucasian (C) patients with recent onset (< or = 5 yr) systemic lupus erythematosus (SLE) at their baseline evaluation. H (n = 69), AA (n = 83) and C (n = 71) patients from the LUMINA (LUpus in MInority populations: NAture vs Nurture) cohort were studied. Fatigue [Fatigue Severity Scale (FSS)] was defined as present if FSS score > or = 3.0. Variables from functional, clinical, sociodemographic, health behaviors, behavioral and psychological and immunogenetics domains were ascertained at study entry. Associations were examined using regression models. Eighty-six percent (85.7%) of patients reported having fatigue (82.6% H; 85.5% AA; 88.7% C); median FSS score, 5.3. Factors from the psychological and clinical domains were primarily associated with FSS; immunogenetic (HLA Class II phenotypes) features were not. Increased fatigue was strongly associated with decreasing function, both physical and mental. Variables associated with significantly greater degree of fatigue at baseline in the multivariable stepwise model in order of decreasing additional partial R2 explained included: abnormal illness-related behaviors, older age, higher self-reported pain, greater degree of helplessness, greater disease activity, Caucasian race, and lacking health insurance (model R2 = 37%). Fatigue is one of the most prevalent clinical manifestations of SLE across all ethnic groups. The perception of fatigue severity in SLE may be multifactorial in origin, including psychosocial factors and disease activity. If these prove causal, knowledge of their contribution may suggest therapeutic and/or behavioral interventions, which could ameliorate this pervasive and often incapacitating symptom of SLE.

National Dam Safety Program. Lake Wanda Dam (NJ00510), Hudson River Basin, Tributary to Wawayanda Creek, Sussex County, New Jersey. Phase 1 Inspection Report.

DTIC Science & Technology

1980-03-01

8217 7rA’Al’A𔄀 /O’ 3 4 5 $-eS 7W# 55 Af1--7;72 6 10 12 - . . . . . ... . . . . . .’ . . .. 13 l 14 15 £ F6 3I f’f . 16 A6 18 19 200 _.._. . . . .. . . . 21’ 22...191, ~ C! . .. .. C.C C C L. C . C W .C . . . .C .C . . . .C .C . . . . .C . C . C C. . C . C 4 4 . . . a CC aa acca a aa aa C C

Morphotype-Dependent Flow Characteristics in Bicuspid Aortic Valve Ascending Aortas: A Benchtop Particle Image Velocimetry Study

PubMed Central

McNally, Andrew; Madan, Ashish; Sucosky, Philippe

2017-01-01

The bicuspid aortic valve (BAV) is a major risk factor for secondary aortopathy such as aortic dilation. The heterogeneous BAV morphotypes [left-right-coronary cusp fusion (LR), right-non-coronary cusp fusion (RN), and left-non-coronary cusp fusion (LN)] are associated with different dilation patterns, suggesting a role for hemodynamics in BAV aortopathogenesis. However, assessment of this theory is still hampered by the limited knowledge of the hemodynamic abnormalities generated by the distinct BAV morphotypes. The objective of this study was to compare experimentally the hemodynamics of a normal (i.e., non-dilated) ascending aorta (AA) subjected to tricuspid aortic valve (TAV), LR-BAV, RN-BAV, and NL-BAV flow. Tissue BAVs reconstructed from porcine TAVs were subjected to physiologic pulsatile flow conditions in a left-heart simulator featuring a realistic aortic root and compliant aorta. Phase-locked particle image velocimetry experiments were carried out to characterize the flow in the aortic root and in the tubular AA in terms of jet skewness and displacement, as well as mean velocity, viscous shear stress and Reynolds shear stress fields. While all three BAVs generated skewed and asymmetrical orifice jets (up to 1.7- and 4.0-fold increase in flow angle and displacement, respectively, relative to the TAV at the sinotubular junction), the RN-BAV jet was out of the plane of observation. The LR- and NL-BAV exhibited a 71% increase in peak-systolic orifice jet velocity relative to the TAV, suggesting an inherent degree of stenosis in BAVs. While these two BAV morphotypes subjected the convexity of the aortic wall to viscous shear stress overloads (1.7-fold increase in maximum peak-systolic viscous shear stress relative to the TAV-AA), the affected sites were morphotype-dependent (LR-BAV: proximal AA, NL-BAV: distal AA). Lastly, the LR- and NL-BAV generated high degrees of turbulence in the AA (up to 2.3-fold increase in peak-systolic Reynolds shear stress relative to the TAV) that were sustained from peak systole throughout the deceleration phase. This in vitro study reveals substantial flow abnormalities (increased jet skewness, asymmetry, jet velocity, turbulence, and shear stress overloads) in non-dilated BAV aortas, which differ from those observed in dilated aortas but still coincide with aortic wall regions prone to dilation. PMID:28203207

[Behaviour of the LAP (leucine-amino-peptidase) in the serum of blood in subjects affected of cirrhosis of the liver in stage ascitical (author's transl)].

PubMed

Pace, M; Fernandes, D

1980-12-01

The AA. have studied behaviour of the LAP (leucine-amino-peptidase) in the serum of blood in subjects affected of cirrhosis of the liver in stage ascitical, of cause toxic-alcoholic excluding about of the casuistry the cirrhosis of the another cause and the cirrhosis that are compled white an obstruction in and extrahepatic standard biliary cirrhosis 1 degree e 2 degree. After the exposition of the casuistry in the registred normality of the test (seric-LAP) in some cases of hepatic-alcoholic cirrhosis, the AA. concluded considering the LAP an indicator only of the obstruction in and extra-hepatic, consistent with hepatic-organ well operating; do not be a secure test to follow development of a chronic hepatitis of any kind, even if in the hepatic disease is present an infiltration and an overturning of the hepatic-lobule, like it is normally in the hepatic alcoholic diseases.

Generation of proton-motive force by an archaeal terminal quinol oxidase from Sulfolobus acidocaldarius.

PubMed

Gleissner, M; Elferink, M G; Driessen, A J; Konings, W N; Anemüller, S; Schäfer, G

1994-09-15

The terminal quinol oxidase of the cytochrome aa3 type was isolated from the extreme thermoacidophilic archaeon Sulfolobus acidocaldarius. In micellar solution, the enzyme oxidized various quinols and exerted the highest activity with the physiological substrate caldariella quinol. The enzyme was functionally reconstituted into monolayer liposomes composed of archaeal tetraether lipids also derived from S. acidocaldarius. With the electron donor system ascorbate and N,N,N',N'-tetramethyl-p-phenylenediamine, the reconstituted enzyme was more active in the archaeal lipids as compared to lipids derived from Escherichia coli at temperatures above 50 degrees C. Due to the low proton permeability of the tetraether lipids, it was possible to generate a steady-state transmembrane electrical potential (delta psi, interior negative), and transmembrane pH gradient (delta pH, interior alkaline) at temperatures up to 70 degrees C. The successful functional reconstitution of the cytochrome aa3-type quinol oxidase from Sulfolobus identifies it as the key energy converter in the respiratory system of this hyperthermophilic archaeon.

Sesavirus: prototype of a new parvovirus genus in feces of a sea lion.

PubMed

Phan, Tung Gia; Gulland, Frances; Simeone, Claire; Deng, Xutao; Delwart, Eric

2015-02-01

We describe the nearly complete genome of a highly divergent parvovirus, we tentatively name Sesavirus, from the feces of a California sea lion pup (Zalophus californianus) suffering from malnutrition and pneumonia. The 5,049-base-long genome contained two major ORFs encoding a 553-aa nonstructural protein and a 965-aa structural protein which shared closest amino acid identities of 25 and 28 %, respectively, with members of the copiparvovirus genus known to infect pigs and cows. Given the low degree of similarity, Sesavirus might be considered as prototype for a new genus with a proposed name of Marinoparvovirus in the subfamily Parvovirinae.

77 FR 37284 - Technical Amendments

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-21

... DEPARTMENT OF LABOR Office of Workers' Compensation Programs 20 CFR Parts 701, 702, 703, 725, and 726 RIN 1240-AA05 Technical Amendments AGENCY: Office of Workers' Compensation Programs, Labor. ACTION: Final rule. SUMMARY: The Office of Workers' Compensation Programs is making [[Page 37285

TAILORING A FRUIT AND VEGETABLE INTERVENTION ON ETHNIC IDENTITY: RESULTS OF A RANDOMIZED STUDY

PubMed Central

Resnicow, Ken; Davis, Rachel; Zhang, Nanhua; Saunders, Ed; Strecher, Victor; Tolsma, Dennis; Calvi, Josephine; Alexander, Gwen; Anderson, Julia; Wiese, Cheryl; Cross, William

2009-01-01

Objective Many targeted health interventions have been developed and tested with African American (AA) populations; however, AAs are a highly heterogeneous group. One characteristic that varies across AAs is Ethnic Identity (EI). Despite the recognition that AAs are heterogeneous with regard to EI, little research has been conducted on how to incorporate EI into the design of health messages and programs. Design This randomized trial tested whether tailoring a print-based fruit and vegetable (F & V) intervention based on individual EI would enhance program impact beyond that of social cognitive tailoring alone. AA adults were recruited from two integrated healthcare delivery systems, one based in the Detroit Metro area and the other in the Atlanta Metro area, and then randomized to receive three newsletters focused on F & V behavior change over three months. One set of newsletters was tailored only on demographic, behavioral, and social cognitive variables (control condition) whereas the other (experimental condition) was additionally tailored on EI. Main Outcome Measures The primary outcome for the study was F & V intake, which was assessed at baseline and three months later using the composite of two brief self-report frequency measures. Results A total of 560 eligible participants were enrolled, of which 468 provided complete 3-month follow-up data. The experimental group increased their daily mean F & V intake by 1.1 servings compared to .8 servings in the control group (p = .13). Several variables were found to interact with intervention group. For instance, Afrocentric experimental group participants showed a 1.4 increase in F & V servings per day compared to a .43 servings per day increase among Afrocentric controls (p < .05). Conclusions Although the overall between-group effects were not significant, this study confirms that AAs are a highly diverse population and that tailoring dietary messages on ethnic identity may improve intervention impact for some AA subgroups. PMID:19594262

The potential investment impact of improved access to accelerated approval on the development of treatments for low prevalence rare diseases

PubMed Central

2011-01-01

Background Over 95% of rare diseases lack treatments despite many successful treatment studies in animal models. To improve access to treatments, the Accelerated Approval (AA) regulations were implemented allowing the use of surrogate endpoints to achieve drug approval and accelerate development of life-saving therapies. Many rare diseases have not utilized AA due to the difficulty in gaining acceptance of novel surrogate endpoints in untreated rare diseases. Methods To assess the potential impact of improved AA accessibility, we devised clinical development programs using proposed clinical or surrogate endpoints for fifteen rare disease treatments. Results We demonstrate that better AA access could reduce development costs by approximately 60%, increase investment value, and foster development of three times as many rare disease drugs for the same investment. Conclusion Our research brings attention to the need for well-defined and practical qualification criteria for the use of surrogate endpoints to allow more access to the AA approval pathway in clinical trials for rare diseases. PMID:21733145

Relation between small airways disease and parenchymal destruction in surgical lung specimens.

PubMed Central

Willems, L N; Kramps, J A; Stijnen, T; Sterk, P J; Weening, J J; Dijkman, J H

1990-01-01

The relation between small airways disease and parenchymal destruction was investigated in lungs and lobes removed at surgery from 27 patients aged 15-70 years. Eight of the 27 patients were life-long non-smokers. The degree of small airways disease was assessed by semi-quantitative grading (SAD score) and by measuring diameter and wall thickness of membranous bronchioles. Parenchymal destruction was measured in three ways. Firstly, the number of alveolar attachments on membranous bronchioles per millimetre of circumference (AA/mm) was counted; the number of broken attachments was subtracted from the total AA/mm to give the numbers of intact attachments (normal AA/mm). Secondly, a point counting technique was used to give a destructive index (DI). Thirdly, the mean linear intercept (Lm) was determined. Total and normal AA/mm correlated negatively with the SAD score of membranous bronchioles (rs = -0.48 and -0.51) and with wall thickness (rs = -0.37 and -0.45) and DI correlated with wall thickness (rs = 0.5) and with the SAD score of respiratory bronchioles (rs = 0.53). Lm did not correlate with indices of small airway disease and total and normal AA/mm did not correlate with diameter. Multiple regression analyses showed that the correlation of total AA/mm with the SAD score of membranous and respiratory bronchioles and with wall thickness were not confounded by age or smoking. It is concluded that small airways disease is related to destruction of peribronchiolar alveoli, and it is postulated that small airways disease has a direct role in the causation of centrilobular emphysema. PMID:2315880

Deinococcus frigens sp. nov., Deinococcus saxicola sp. nov., and Deinococcus marmoris sp. nov., low temperature and draught-tolerating, UV-resistant bacteria from continental Antarctica.

PubMed

Hirsch, Peter; Gallikowski, Claudia A; Siebert, Jörg; Peissl, Klaus; Kroppenstedt, Reiner; Schumann, Peter; Stackebrandt, Erko; Anderson, Robert

2004-11-01

Six Gram-positive, non-motile, UV- and draught-tolerant bacteria were isolated from antarctic soil and rock samples. The pink to orange cocci grew well on oligotrophic medium PYGV (pH 7.5) at 9-18 degrees C. They tolerated 0-10% NaCl, were aerobic to facultatively anaerobic and contained ornithine in their cell wall (type A3beta, Orn-Gly2). The lipid profiles of four strains were found to be typical for those of D. radiodurans. Major fatty acids were 16:1cis9, 15:1cis9, 17:1cis9 and i17:1cis9, the respiratory quinone of three strains was MK-8. Comparative 16S rDNA gene sequencing revealed phylogenetic relationships to the Deinococcus clade, especially to D. radiopugnans. The levels of 16S rRNA gene sequence similarity and DNA-DNA hybridisation data showed the six isolates represented new taxa. Phenotypic properties supported the description of three new species which were different from the eight known Deinococcus species and particularly from D. radiopugnans. Soil isolate AA-692T (DSM 12807T) is the type strain of Deinococcus frigens sp. nov., with AA-752 (DSM 15993) and AA-829 (DSM 15994) as additional strains from soil. The endolithic isolate AA-1444T, Deinococcus saxicola sp. nov., (DSM 15974T) came from antarctic sandstone, and Deinococcus marmoris sp. nov. (isolate AA-63T [DSM 12784T]) as well as AA-69 (DSM 15951) were isolated from antarctic marble.

Contrasting amino acid profiles among permissive and non-permissive hosts of Candidatus Liberibacter asiaticus, putative causal agent of Huanglongbing

PubMed Central

Alabi, Olufemi J.; Simpson, Catherine R.; Jifon, John L.

2017-01-01

Huanglongbing is a devastating disease of citrus. In this study, a comprehensive profile of phloem sap amino acids (AA) in four permissive host plants of Candidatus Liberibacter asiaticus (CLas) and three non-permissive Rutaceae plants was conducted to gain a better understanding of host factors that may promote or suppress the bacterium. The AA profiles of Diaphorina citri nymphs and adults were similarly analyzed. A total of 38 unique AAs were detected in phloem sap of the various plants and D. citri samples, with phloem sap of young shoots containing more AAs and at higher concentrations than their mature counterparts. All AAs detected in phloem sap of non-permissive plants were also present in CLas -permissive hosts plus additional AAs in the latter class of plants. However, the relative composition of 18 commonly shared AAs varied between CLas -permissive hosts and non-permissive plants. Multivariate analysis with a partial least square discriminant methodology revealed a total of 12 AAs as major factors affecting CLas host status, of which seven were positively related to CLas tolerance/resistance and five positively associated with CLas susceptibility. Most of the AAs positively associated with CLas susceptibility were predominantly of the glutamate family, notably stressed-induced AAs such as arginine, GABA and proline. In contrast, AAs positively correlated with CLas tolerance/resistance were mainly of the serine family. Further analysis revealed that whereas the relative proportions of AAs positively associated with CLas susceptibility did not vary with host developmental stages, those associated with CLas tolerance/resistance increased with flush shoot maturity. Significantly, the proline-to-glycine ratio was determined to be an important discriminating factor for CLas permissivity with higher values characteristic of CLas -permissive hosts. This ratio could be exploited as a biomarker in HLB-resistance breeding programs. PMID:29236706

The NSF Undergraduate ALFALFA Team: Partnering with Arecibo Observatory to Offer Undergraduate and Faculty Extragalactic Radio Astronomy Research Opportunities

NASA Astrophysics Data System (ADS)

Ribaudo, Joseph; Koopmann, Rebecca A.; Haynes, Martha P.; Balonek, Thomas J.; Cannon, John M.; Coble, Kimberly A.; Craig, David W.; Denn, Grant R.; Durbala, Adriana; Finn, Rose; Hallenbeck, Gregory L.; Hoffman, G. Lyle; Lebron, Mayra E.; Miller, Brendan P.; Crone-Odekon, Mary; O'Donoghue, Aileen A.; Olowin, Ronald Paul; Pantoja, Carmen; Pisano, Daniel J.; Rosenberg, Jessica L.; Troischt, Parker; Venkatesan, Aparna; Wilcots, Eric M.; ALFALFA Team

2017-01-01

The NSF-sponsored Undergraduate ALFALFA (Arecibo Legacy Fast ALFA) Team (UAT) is a consortium of 20 institutions across the US and Puerto Rico, founded to promote undergraduate research and faculty development within the extragalactic ALFALFA HI blind survey project and follow-up programs. The objective of the UAT is to provide opportunities for its members to develop expertise in the technical aspects of observational radio spectroscopy, its associated data analysis, and the motivating science. Partnering with Arecibo Observatory, the UAT has worked with more than 280 undergraduates and 26 faculty to date, offering 8 workshops onsite at Arecibo (148 undergraduates), observing runs at Arecibo (69 undergraduates), remote observing runs on campus, undergraduate research projects based on Arecibo science (120 academic year and 185 summer projects), and presentation of results at national meetings such as the AAS (at AAS229: Ball et al., Collova et al., Davis et al., Miazzo et al., Ruvolo et al, Singer et al., Cannon et al., Craig et al., Koopmann et al., O'Donoghue et al.). 40% of the students and 45% of the faculty participants have been women and members of underrepresented groups. More than 90% of student alumni are attending graduate school and/or pursuing a career in STEM. 42% of those pursuing graduate degrees in Physics or Astronomy are women.In this presentation, we summarize the UAT program and the current research efforts of UAT members based on Arecibo science, including multiwavelength followup observations of ALFALFA sources, the UAT Collaborative Groups Project, the Survey of HI in Extremely Low-mass Dwarfs (SHIELD), and the Arecibo Pisces-Perseus Supercluster Survey (APPSS). This work has been supported by NSF grants AST-0724918/0902211, AST-075267/0903394, AST-0725380, AST-121105, and AST-1637339.

Organ Donation in the United States: The Tale of the African-American Journey of Moving From the Bottom to the Top.

PubMed

Callender, C O; Koizumi, N; Miles, P V; Melancon, J K

2016-09-01

The purpose was to review the increase of minority organ donation. The methodology was based on the efforts of the DC Organ Donor Program and the Dow Take Initiative Program that focused on increasing donors among African Americans (AAs). From 1982 to 1988, AA donor card signings increased from 20/month to 750/month, and Black donations doubled. A review of the data, including face-to-face grassroots presentations combined with national media, was conducted. Gallup polls in 1985 and 1990 indicated a tripling of black awareness of transplantation and the number of blacks signing donor cards. Based on the applied successful methodologies, in 1991, the National Minority Organ Tissues Transplant Education Program was established targeting AA, Hispanic, Asian, and other ethnic groups. A review of the United Network for Organ Sharing (UNOS) database from 1990 to 2010 was accomplished. Nationally, ethnic minority organ donors per million (ODM) increased from 8-10 ODM (1982) to 35 ODM (AA and Latino/Hispanics) in 2002. In 1995, ODMs were white 34.2, black 33.1, Hispanic 31.5, and Asian 17.9. In 2010, Black organ donors per million totaled 35.36 versus white 27.07, Hispanic 25.59, and Asian 14.70. Based on the data retrieved from UNOS in 2010, blacks were ranked above whites and other ethnic minority populations as the number one ethnic group of organ donors per million in the US. Copyright © 2016 Elsevier Inc. All rights reserved.

Moderating Effect of Residential History on the Effects of a Fatherhood Program on Parenting Skills Satisfaction among Nonresident African American Fathers.

PubMed

Qian, Yiqing; De Loney, E Hill; Caldwell, Cleopatra Howard

2018-02-09

Nonresident African American (AA) fathers sometimes face challenges to achieving satisfaction with their parenting skills, which may inhibit their motivations for parenting. Studies have found that residential history of fathers is associated with parental involvement; however, current fatherhood programs rarely consider the influence of different residential history on fathering. In the current study, we examined whether nonresident AA fathers' residential history with their sons moderated their parenting skills satisfaction after participating in the Fathers and Sons Program. Our results indicated that after controlling for fathers' pretest parenting skills satisfaction, age, education, marital status, employment, and ever lived with their son's mother; there was a moderating effect of residential history on the intervention's effects on posttest parenting skills satisfaction. The regression analyses showed that fathers in the intervention group who had lived with their son increased their parenting skills satisfaction more at posttest compared with fathers who had never lived with their sons. However, fathers in the comparison group who had lived with their sons had lower posttest parenting skills satisfaction. Future fatherhood programs for nonresident AA fathers should develop more nuanced group-specific interventions that consider residential history as a critical factor to enhance their parenting skills satisfaction as a strategy for improving father involvement.

Moderating Effect of Residential History on the Effects of a Fatherhood Program on Parenting Skills Satisfaction among Nonresident African American Fathers

PubMed Central

De Loney, E. Hill; Caldwell, Cleopatra Howard

2018-01-01

Nonresident African American (AA) fathers sometimes face challenges to achieving satisfaction with their parenting skills, which may inhibit their motivations for parenting. Studies have found that residential history of fathers is associated with parental involvement; however, current fatherhood programs rarely consider the influence of different residential history on fathering. In the current study, we examined whether nonresident AA fathers’ residential history with their sons moderated their parenting skills satisfaction after participating in the Fathers and Sons Program. Our results indicated that after controlling for fathers’ pretest parenting skills satisfaction, age, education, marital status, employment, and ever lived with their son’s mother; there was a moderating effect of residential history on the intervention’s effects on posttest parenting skills satisfaction. The regression analyses showed that fathers in the intervention group who had lived with their son increased their parenting skills satisfaction more at posttest compared with fathers who had never lived with their sons. However, fathers in the comparison group who had lived with their sons had lower posttest parenting skills satisfaction. Future fatherhood programs for nonresident AA fathers should develop more nuanced group-specific interventions that consider residential history as a critical factor to enhance their parenting skills satisfaction as a strategy for improving father involvement. PMID:29425126

75 FR 21191 - Subpart B-Advanced Biofuel Payment Program; Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-23

... Service 7 CFR Part 4288 RIN 0570-AA75 Subpart B--Advanced Biofuel Payment Program; Correction AGENCY... for producers of advanced biofuels to supporting existing advanced biofuel production and to encourage...

77 FR 4885 - Rural Business Investment Program

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-01

...-AA80 Rural Business Investment Program AGENCY: Rural Business-Cooperative Service and Rural Utilities... several technical amendments to correct the Rural Business Investment Program (RBIP) regulation, including one to conform to the 2008 Farm Bill provision that allows a Rural Business Investment Company two...

76 FR 19909 - International Terrorism Victim Expense Reimbursement Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-11

... 1121-AA78 International Terrorism Victim Expense Reimbursement Program AGENCY: Office of Justice... promulgating this interim-final rule for its International Terrorism Victim Expense Reimbursement Program... international terrorism. DATES: Effective date: This interim-final rule is effective April 11, 2011. Comment...

'It Was about Claiming Space': Exposure to Asian American Studies, Ethnic Organization Participation, and the Negotiation of Self among Southeast Asian Americans

ERIC Educational Resources Information Center

Trieu, Monica M.

2018-01-01

Despite the growing number of Asian American Studies (AAS) programs and Asian ethnic organizations across colleges and universities since the 1970s, surprisingly little empirical research examines the role of these aspects of higher education on Asian American identity. How do the roles of AAS curriculum and Asian American student organizations…

Is Alcoholics Anonymous religious, spiritual, neither? Findings from 25 years of mechanisms of behavior change research.

PubMed

Kelly, John F

2017-06-01

Alcoholics Anonymous (AA) is a world-wide recovery mutual-help organization that continues to arouse controversy. In large part, concerns persist because of AA's ostensibly quasi-religious/spiritual orientation and emphasis. In 1990 the United States' Institute of Medicine called for more studies on AA's effectiveness and its mechanisms of behavior change (MOBC) stimulating a flurry of federally funded research. This paper reviews the religious/spiritual origins of AA and its program and contrasts its theory with findings from this latest research. Literature review, summary and synthesis of studies examining AA's MOBC. While AA's original main text ('the Big Book', 1939) purports that recovery is achieved through quasi-religious/spiritual means ('spiritual awakening'), findings from studies on MOBC suggest this may be true only for a minority of participants with high addiction severity. AA's beneficial effects seem to be carried predominantly by social, cognitive and affective mechanisms. These mechanisms are more aligned with the experiences reported by AA's own larger and more diverse membership as detailed in its later social, cognitive and behaviorally oriented publications (e.g. Living Sober, 1975) written when AA membership numbered more than a million men and women. Alcoholics Anonymous appears to be an effective clinical and public health ally that aids addiction recovery through its ability to mobilize therapeutic mechanisms similar to those mobilized in formal treatment, but is able to do this for free over the long term in the communities in which people live. © 2016 Society for the Study of Addiction.

Authentic Astronomy Research Experiences for Teachers: the NASA/IPAC Teacher Archive Research Program (NITARP)

NASA Astrophysics Data System (ADS)

Rebull, L.; NITARP Team

2011-12-01

Since 2004, we have provided authentic astronomy research experiences for teachers using professional astronomical data. (The program used to be called the Spitzer Teacher Program for Teachers and Students, and in 2009 was renamed NITARP--NASA/IPAC Teacher Archive Research Program.) We partner small groups of teachers with a mentor astronomer, the team does research, writes up a poster, and presents it at the major annual meeting for professional US astronomers, the American Astronomical Society (winter meeting). The teachers incorporate this research experience into their classroom, and their experiences color their teaching for years to come, influencing hundreds of students per teacher. This program, to the best of our knowledge, is completely unique in the following three ways: (1) Each team does original research using real astronomical data, not canned labs or reproductions of previously done research. (2) Each team writes up the results of their research and presents it at an AAS meeting. Each team also presents the educational results of their experience. (3) The 'products' of the program are primarily the scientific results, as opposed to curriculum packets. The teachers in the program involve students at their school and incorporate the experience into their teaching in a way that works for them, their environment, and their local/state standards. The educators in the program are selected from a nationwide annual application process, and they get three trips, all reasonable expenses paid. First, they attend a winter AAS meeting to get their bearings as attendees of the largest professional astronomy meetings in the world. We sponsor a kickoff workshop specifically for the NITARP educators on the day before the AAS meeting starts. After the meeting, they work remotely with their team to write a proposal, as well as read background literature. In the summer (at a time convenient to all team members), the educators plus up to two students per teacher come out to visit Caltech for 3-4 days and get started on their project in earnest. They return home and continue to work through the Fall, finish their research, and write their AAS abstracts and posters in preparation for the winter AAS. The educators plus up to two students per teacher then attend the AAS and present their results. Each team presents one science poster and at least one education poster. The science posters are intermingled in science sessions, and must "hold their own" next to other professional astronomer posters. Each teacher finally serves as NASA/NITARP ambassadors in their community, giving at least 12 hours' worth of professional development. Since the original Spitzer program in 2004, news coverage associated with any of these projects has reached more than 6 million people, largely in home-town newspapers from the teachers' cities. More than 200 presentations have been given, reaching over 14,000 people. More than 120 students have traveled for NITARP, and more than 1200 students have used real astronomical data through this program. Almost 60 educators have been trained in real research. Nearly 50 science or education posters have been presented. Four refereed journal articles (in major astronomical journals) have come out of work associated with these teams.

Safety and Abuse Testing of Energizer LiFeS2 AA Cells

NASA Technical Reports Server (NTRS)

Jeevarajan, Judith A.; Baldwin, Laura; Bragg, Bobby J.

2003-01-01

The LiFeS2 test program was part of the study on state-of-the-art batteries/cells available in the commercial market. It was carried out in an effort to replace alkaline AA cells for Shuttle and Station applications. A large number of alkaline cells are used for numerous Shuttle and Station applications as loose cells. Other government agencies reported good performance and abuse tolerance of the AA LiFeS2 cells. In this study, only abuse testing was performed on the cells to determine their tolerance. The tests carried out were over-discharge, external short circuit, heat-to-vent, vibration and drop.

38 CFR 21.4267 - Approval of independent study.

Code of Federal Regulations, 2014 CFR

2014-07-01

... correspondence course. (Authority: 38 U.S.C. 3676(e), 3680A(a)) (d) Undergraduate resident training. VA considers the following undergraduate courses to be resident training. (1) A course which meets the requirements... which is an integral part of a standard undergraduate college degree. (e) Graduate resident training. VA...

38 CFR 21.4267 - Approval of independent study.

Code of Federal Regulations, 2012 CFR

2012-07-01

... correspondence course. (Authority: 38 U.S.C. 3676(e), 3680A(a)) (d) Undergraduate resident training. VA considers the following undergraduate courses to be resident training. (1) A course which meets the requirements... which is an integral part of a standard undergraduate college degree. (e) Graduate resident training. VA...

38 CFR 21.4267 - Approval of independent study.

Code of Federal Regulations, 2013 CFR

2013-07-01

... correspondence course. (Authority: 38 U.S.C. 3676(e), 3680A(a)) (d) Undergraduate resident training. VA considers the following undergraduate courses to be resident training. (1) A course which meets the requirements... which is an integral part of a standard undergraduate college degree. (e) Graduate resident training. VA...

An initial fMRI study on neural correlates of prayer in members of Alcoholics Anonymous.

PubMed

Galanter, Marc; Josipovic, Zoran; Dermatis, Helen; Weber, Jochen; Millard, Mary Alice

2017-01-01

Many individuals with alcohol-use disorders who had experienced alcohol craving before joining Alcoholics Anonymous (AA) report little or no craving after becoming long-term members. Their use of AA prayers may contribute to this. Neural mechanisms underlying this process have not been delineated. To define experiential and neural correlates of diminished alcohol craving following AA prayers among members with long-term abstinence. Twenty AA members with long-term abstinence participated. Self-report measures and functional magnetic resonance imaging of differential neural response to alcohol-craving-inducing images were obtained in three conditions: after reading of AA prayers, after reading irrelevant news, and with passive viewing. Random-effects robust regressions were computed for the main effect (prayer > passive + news) and for estimating the correlations between the main effect and the self-report measures. Compared to the other two conditions, the prayer condition was characterized by: less self-reported craving; increased activation in left-anterior middle frontal gyrus, left superior parietal lobule, bilateral precuneus, and bilateral posterior middle temporal gyrus. Craving following prayer was inversely correlated with activation in brain areas associated with self-referential processing and the default mode network, and with characteristics reflecting AA program involvement. AA members' prayer was associated with a relative reduction in self-reported craving and with concomitant engagement of neural mechanisms that reflect control of attention and emotion. These findings suggest neural processes underlying the apparent effectiveness of AA prayer.

76 FR 72623 - Literacy Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-25

... INFORMATION: This document finalizes the Bureau's Literacy Program regulations, published as an interim rule... DEPARTMENT OF JUSTICE Bureau of Prisons 28 CFR Part 544 [BOP-1036-F] RIN 1120-AA33 Literacy... Bureau's Literacy Program regulations, published as an interim rule on September 26, 1997 (62 FR 50791...

Identification of GAD65 AA 114-122 reactive 'memory-like' NK cells in newly diagnosed Type 1 diabetic patients by HLA-class I pentamers.

PubMed

Perri, Valentina; Gianchecchi, Elena; Cifaldi, Loredana; Pellegrino, Marsha; Giorda, Ezio; Andreani, Marco; Cappa, Marco; Fierabracci, Alessandra

2017-01-01

Type 1 diabetes is an autoimmune disease, in which pancreatic β cells are destroyed by autoreactive T cells in genetically predisposed individuals. Serum beta cell autoantibody specificities have represented the mainstay for classifying diabetes as autoimmune-mediated and for stratifying risk in first-degree relatives. In recent years, approaches were attempted to solve the difficult issue of detecting rare antigen-specific autoreactive T cells and their significance to etiopathogenesis such as the use of the MHC multimer technology. This tool allowed the specific detection of increased percentages of GAD65 autoreactive T cells by means of HLA A*02:01 GAD65 AA 114-122 pentamers in newly diagnosed diabetics. Here we provide evidence that GAD65 AA 114-122 pentamers can depict a GAD65 AA114-122 peptide expandable population of functionally and phenotypically skewed, preliminary characterized CD3-CD8dullCD56+ 'memory-like' NK cells in PBMC of newly diagnosed diabetics. Our data suggest that the NK cell subset could bind the HLA class I GAD65 AA 114-122 pentamer through ILT2 inhibitory receptor. CD107a expression revealed increased degranulation of CD3-CD8dullCD56+ NK cells in GAD65 AA 114-122 and FLU peptide expanded peripheral blood mononuclear cells of diabetics following GAD65 AA 114-122 peptide HLA A*02:01 presentation in respect to the unpulsed condition. CD107a expression was enriched in ILT2 positive NK cells. As opposite to basal conditions where similar percentages of CD3-CD56+ILT2+ cells were detected in diabetics and controls, CD3-CD56+CD107a+ and CD3-CD56+ILT2+CD107a+ cells were significantly increased in T1D PBMC either GAD65 AA 114-122 or FLU peptides stimulated after co-culture with GAD65 AA 114-122 pulsed APCs. As control, healthy donor NK cells showed similar degranulation against both GAD65 AA 114-122 pulsed and unpulsed APCs. The pathogenetic significance of the CD3-CD8dullCD56+ 'memory-like NK cell subset' with increased response upon secondary challenge in diabetics remains to be elucidated.

Toward Radiocarbon Measurement of Individual Amino Acids in Marine Dissolved Organic Matter (DOM): Δ14C Blank Quantification for an HPLC Purification Method.

NASA Astrophysics Data System (ADS)

Bour, A. L.; Broek, T.; Walker, B. D.; Mccarthy, M. D.

2014-12-01

The presence of much of the marine dissolved organic nitrogen (DON) pool as uncharacterized, biologically recalcitrant molecules is a central mystery in the marine nitrogen cycle. Radiocarbon (Δ14C) isotopic measurements have been perhaps the most important data constraining the cycling of dissolved organic matter (DOM), but little Δ14C data specific to DON is available. Amino acids (AAs) are the major component of DON that can be isolated on a molecular level. Δ14C measurements for the operational "protein-like" fraction of DOM in the deep ocean indicate that this compound class has radiocarbon ages greater than several ocean mixing cycles, suggesting remarkable preservation of labile AAs exported from the surface. However, it is possible that the previously defined operational "protein-like" fraction may also contain non-AA material. Radiocarbon measurement of purified individual AAs would provide a more direct and reliable proxy for DON Δ14C age and cycling rate. We present here Δ14C blank characterization of an AA purification method based on HPLC, with on-line fraction collection. This method allows the recovery of unmodified AAs, but accurate measurement of small AA samples that can be extracted from DOM requires a system with extremely low Δ 14C blanks. Here we assess the impact of HPLC purification on the Δ14C age of known amino acids standards. Individual AA standards with contrasting (modern vs. dead) and well- characterized Δ14C ages were processed in a range of sample sizes. The eluted peaks were collected and dried, and measurement of their post-chromatography Δ14C content allowed for determination of the Δ14C blank by method of additions. The same protocol was applied to a mixture of six AA standards, to evaluate tailing effects in consecutive AA peaks of contrasting Δ14C age. AA standards were selected to include both Δ14C modern and dead AAs that elute both early and late in the chromatographic solvent program. We discuss implications for future Δ14C analysis of AAs purified from DOM by this method.

42 CFR 54a.13 - Educational requirements for personnel in drug treatment programs.

Code of Federal Regulations, 2013 CFR

2013-10-01

....S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.13 Educational requirements for personnel in drug treatment programs. In determining whether personnel of a program... treatment programs. 54a.13 Section 54a.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND...

42 CFR 54a.13 - Educational requirements for personnel in drug treatment programs.

Code of Federal Regulations, 2012 CFR

2012-10-01

....S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.13 Educational requirements for personnel in drug treatment programs. In determining whether personnel of a program... treatment programs. 54a.13 Section 54a.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND...

42 CFR 54a.13 - Educational requirements for personnel in drug treatment programs.

Code of Federal Regulations, 2011 CFR

2011-10-01

....S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.13 Educational requirements for personnel in drug treatment programs. In determining whether personnel of a program... treatment programs. 54a.13 Section 54a.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND...

42 CFR 54a.13 - Educational requirements for personnel in drug treatment programs.

Code of Federal Regulations, 2014 CFR

2014-10-01

....S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.13 Educational requirements for personnel in drug treatment programs. In determining whether personnel of a program... treatment programs. 54a.13 Section 54a.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND...

42 CFR 54a.13 - Educational requirements for personnel in drug treatment programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

....S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.13 Educational requirements for personnel in drug treatment programs. In determining whether personnel of a program... treatment programs. 54a.13 Section 54a.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND...

The Ongoing Evolution of the WFIRST Mission and Implications for Future Flagship Missions

NASA Astrophysics Data System (ADS)

Bregman, Joel N.

2018-01-01

What is the community’s reaction when a decadal priority is modified? How does community buy-in of nascent programs in turn affect Congressional or Administration buy-in? What is the role of the AAS in engaging stakeholders in such circumstances? In this panel discussion, AAS CAPP will facilitate a conversation about how astronomers -- individually and collectively -- can effectively advocate for community-derived priorities.

Identification of AaCASPS7, an effector caspase in Aedes albopictus.

PubMed

Feng, Lingyan; Liu, Hao; Li, Xiaomei; Qiao, Jialu; Wang, Shengya; Guo, Deyin; Liu, Qingzhen

2016-11-15

Aedes albopictus mosquito is a vector of various arboviruses and is becoming a significant threat to public health due to its rapid global expansion. Several reports suggest that apoptosis could be a factor limiting arbovirus infection in mosquitoes. Thus, it is significant to identify apoptosis pathway and study the correlation between apoptosis and virus infection in mosquitoes. Apoptosis is a type of programmed cell death that plays a vital role in immunity, development, and tissue homeostasis. Caspases are a family of conserved proteases playing important roles in apoptosis. In this study, we identified Aedes albopictus AaCASPS7, a caspase shared high identity with dipteran insect drICE orthologs. Phylogenetic analysis showed the closest relative of AaCASPS7 was Aedes aegypti AeCASPS7. AaCASPS7 displayed several features that were typical of an effector caspase and showed significant activity to effector caspase substrates. Aacasps7 transcripts were expressed ubiquitously in developmental and adult stages in Aedes albopictus mosquitoes. Transient expression of AaCASPS7 induced caspase-dependent apoptosis in C6/36 cells. Taken together the above data, this study identified a novel caspase, AaCASPS7, which might function as an apoptotic caspase. Further study the function of AaCASPS7 would facilitate better understanding the apoptotic mechanism in Aedes albopictus mosquito. Copyright © 2016 Elsevier B.V. All rights reserved.

EMPOWER: a randomized trial using community health workers to deliver a lifestyle intervention program in African American women with Type 2 diabetes: design, rationale, and baseline characteristics.

PubMed

Cummings, Doyle M; Lutes, Lesley D; Littlewood, Kerry; Dinatale, Emily; Hambidge, Bertha; Schulman, Kathleen

2013-09-01

African American (AA) women with Type 2 diabetes mellitus (T2DM) in the rural south experience less weight loss and poorer glycemic control in traditional diabetes management programs compared to Caucasians. This paper describes the design, rationale, and baseline characteristics from an innovative community health worker (CHW) delivered intervention program in this population. This prospective trial randomized rural AA women with uncontrolled T2DM (HbA1c ≥ 7.0) to receive a behaviorally-centered, culturally-tailored lifestyle intervention during 16 contacts from a trained AA CHW or 16 approved diabetes educational mailings. Changes from baseline in glycosylated hemoglobin levels (HbA1c), blood pressure (BP), weight, body mass index (BMI), self-reported dietary and physical activity patterns, and psychosocial measures including diabetes distress, empowerment, depression, self-care, medication adherence, and life satisfaction will be assessed at 6- and 12-months. Two hundred AA women (mean age = 53.09 ± 10.89 years) with T2DM from impoverished rural communities were enrolled. Baseline data demonstrated profoundly uncontrolled diabetes of long term duration (mean HbA1c = 9.11 ± 1.82; mean BMI = 37.68 ± 8.20; mean BP = 134.51 ± 20.39/84.19 ± 11.68; 10.5 ± 0.7 years). Self-care behavior assessment revealed poor dietary and medication adherence and sedentary lifestyle. Most psychosocial measures ranged within normal limits. The present sample of AA women from impoverished rural communities exhibited significantly uncontrolled T2DM of long duration with associated obesity and poor lifestyle behaviors. An innovative CHW led lifestyle intervention may lead to more effective strategies for T2DM management in this population. Copyright © 2013 Elsevier Inc. All rights reserved.

Acidolysis and glyceride synthesis reactions using fatty acids with two Pseudomonas lipases having different substrate specificities.

PubMed

Kojima, Yuzo; Sakuradani, Eiji; Shimizu, Sakayu

2006-09-01

Enzymatic acidolysis and glyceride synthesis using polyunsaturated fatty acids (PUFAs) with lipases from Pseudomonas fluorescens HU380 (HU-lipase), P. fluorescens AK102 (AK-lipase), and Candida rugosa (CR-lipase) were studied. The acidolysis of triolein with eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) in n-hexane was evaluated with lipases immobilized on Celite 545. HU-lipase showed the highest incorporation rate at a low temperature (10 degrees C) with either EPA or DHA as the acyl donor, and the rate decreased with increasing reaction temperature. At 45 degrees C, the rates for EPA and DHA were 7.1 and 0.5 relative to those at 10 degrees C, respectively. The EPA incorporation rate was even higher at a low temperature (10 degrees C), and the DHA incorporation rate increased with decreasing temperature. Although AK-lipase showed the reverse tendency for incorporation rate, the DHA incorporation rate increased with increasing reaction temperature with both PUFAs. HU-lipase reacted well with PUFAs such as DHA, EPA, arachidonic acid (AA), mead acid (MA), and dihomo-gamma-linolenic acid (DGLA) on acidolysis and glyceride synthesis. The reactivities of AK-lipase toward these PUFAs except for DGLA, i.e., MA, AA, EPA, and DHA, were low for both reactions. The unique substrate specificities of the lipases from the Pseudomonas strains will enable us to use these lipases for the modification of fats and oils containing PUFAs such as fish oil.

Nanoscale zerovalent iron (nZVI) supported by natural and acid-activated sepiolites: the effect of the nZVI/support ratio on the composite properties and Cd2+ adsorption.

PubMed

Habish, Amal Juma; Lazarević, Slavica; Janković-Častvan, Ivona; Jokić, Bojan; Kovač, Janez; Rogan, Jelena; Janaćković, Đorđe; Petrović, Rada

2017-01-01

Natural (SEP) and partially acid-activated (AAS) sepiolites were used to prepare composites with nanoscale zerovalent iron (nZVI) at different (SEP or AAS)/nZVI ratios in order to achieve the best nZVI dispersibility and the highest adsorption capacity for Cd 2+ . Despite the higher surface area and pore volume of AAS, better nZVI dispersibility was achieved by using SEP as the support. On the other hand, a lower oxidation degree was achieved during the synthesis using AAS. X-ray photoelectron spectroscopy (XPS) analysis of the composite with the best nZVI dispersibility, before and after Cd 2+ adsorption, confirmed that the surface of the nZVI was composed of oxidized iron species. Metallic iron was not present on the surface, but it was detected in the subsurface region after sputtering. The content of zerovalent iron decreased after Cd 2+ adsorption as a result of iron oxidation during Cd 2+ adsorption. The XPS depth profile showed that cadmium was present not only at the surface of the composite but also in the subsurface region. The adsorption isotherms for Cd 2+ confirmed that the presence of SEP and AAS decreased the agglomeration of the nZVI particles in comparison to the pure nZVI, which provided a higher adsorption capacity. The results showed that the prevention of both aggregation and oxidation during the synthesis was necessary for obtaining an SEP/AAS-nZVI composite with a high adsorption capacity, but oxidation during adsorption was beneficial for Cd 2+ removal. The formation of strong bonds between Cd 2+ and the adsorbents sites of different energy until monolayer formation was proposed according to modeling of the adsorption isotherms.

Standardization and validation of a new atomic absorption spectroscopy technique for determination and quantitation of aluminium adjuvant in immunobiologicals.

PubMed

Mishra, Arti; Bhalla, Sumir Rai; Rawat, Sameera; Bansal, Vivek; Sehgal, Rakesh; Kumar, Sunil

2007-10-01

In the present study, Aluminium quantification in immunobiologicals has been described using atomic absorption spectroscopy (AAS) technique. The assay was found to be linear in 25-125 microg/ml Aluminium range. The procedure was found to be accurate for different vaccines with recoveries of external additions ranging between 93.26 and 103.41%. The mean Limit of Variation (L.V.) for both intra- and inter-assay precision was calculated to be 1.62 and 2.22%, respectively. Further the procedure was found to be robust in relation to digestion temperature, alteration in acid (HNO(3) and H(2)SO(4)) ratio used for sample digestion and storage of digested vaccine samples up to a period of 15 days. After validation, AAS method was compared for its equivalency with routinely used complexometric titration method. On simultaneously applying on seven different groups of both bacterial and viral vaccines, viz., DPT, DT, TT, Hepatitis-A and B, Antirabies vaccine (cell culture) and tetravalent DPT-Hib, a high degree of positive correlation (+0.85-0.998) among AAS and titration methods was observed. Further AAS method was found to have an edge over complexometric titration method that a group of vaccines, viz., ARV (cell culture, adsorbed) and Hepatitis-A, in which Aluminium estimation is not feasible by pharmacopoeial approved complexometric titration method (possibly due to some interference in the sample matrix), this newly described and validated AAS assay procedure delivered accurate and reproducible results.

Provider-Based Research Networks May Improve Early Access to Innovative Colon Cancer Treatment for African Americans Treated in the Community

PubMed Central

Penn, Dolly C.; Chang, YunKyung; Meyer, Anne-Marie; Mack, Christina DeFilippo; Sanoff, Hanna; Stitzenberg, Karyn; Carpenter, William

2014-01-01

Background African Americans (AA) with colon cancer (CC) experience worse outcomes than Caucasian Americans (CA) partly due to differential treatment. The National Cancer Institute's (NCI) Community Clinical Oncology Program (CCOP), a provider-based research network (PBRN), adopts and diffuses innovative CC treatments quickly. We hypothesized that CCOP participation would lessen racial differences in receipt of oxaliplatin, innovative CC treatment, for patients with stage III CC in the community. Methods Using SEER-Medicare data, we performed a population-based retrospective cohort study of AA and CA individuals ≥66years diagnosed with stage III CC from 2003-2005. We used generalized estimating equations to calculate odds of receiving an oxaliplatin-containing regimen. Predicted probabilities of oxaliplatin receipt for race-CCOP combinations were calculated. The absolute difference in oxaliplatin receipt between races was estimated using interaction contrast ratio (ICR). Results Of 2,971 included individuals, 36% received oxaliplatin, 29.5% were CCOP-affiliated, and 7.6% were AA. In multivariate analysis, early diffusion of oxaliplatin was not associated with race or CCOP participation. The probability of receiving oxaliplatin for CCOP AAs (0.46) almost doubled that of non-CCOP AAs (0.25,p<0.05). For CAs the probabilities of receiving oxaliplatin did not differ by CCOP participation. For oxaliplatin receipt, the joint effects assessment suggested a greater benefit of CCOP participation among AAs (ICR=1.7). Conclusions Among older stage III CC patients there is a differential impact of race on oxaliplatin receipt depending on CCOP participation. AAs treated by CCOPs were more likely to receive oxaliplatin than AAs treated elsewhere. PBRNs may facilitate early access to innovative treatment for AAs with stage III CC. PMID:25209056

Ethnic Differences in Achievement of Cholesterol Treatment Goals

PubMed Central

Clark, Luther T; Maki, Kevin C; Galant, Ron; Maron, David J; Pearson, Thomas A; Davidson, Michael H

2006-01-01

BACKGROUND African Americans (AA) have the highest coronary heart disease mortality rate of any ethnic group in the United States. Data from the National Cholesterol Education Program Evaluation ProjecT Utilizing Novel E-Technology (NEPTUNE) II survey were used to assess ethnic differences in low-density lipoprotein cholesterol (LDL-C) goal achievement. METHODS NEPTUNE II surveyed patients with treated dyslipidemia to assess achievement of treatment goals established by the Adult Treatment Panel III of the National Cholesterol Education Program. United States physicians working in primary care or relevant subspecialties enrolled 10 to 20 consecutive patients (May to September 2003), and patient data were recorded in Personal Digital Assistants and uploaded to a central database via the internet. RESULTS Among 4,885 patients receiving treatment for dyslipidemia, 79.7% were non-Hispanic white (NHW) and 8.4% were AA. Non-Hispanic white and AA patients had significantly different frequencies of treatment success, with 69.0% and 53.7%, respectively, having achieved their LDL-C goal (P <.001). African-American patients were more likely to be in the highest risk category, and less likely to be using lipid drug therapy, taking high-efficacy statins, and receiving care from a subspecialist, but the difference in goal achievement remained significant (P <.001) after adjustment for these and other predictors of treatment success. CONCLUSIONS The frequency of treatment success in dyslipidemia management was significantly lower in AA than NHW patients. Additional research is needed to elucidate reasons for this disparity and to evaluate strategies for improving goal achievement among AA patients receiving therapy for dyslipidemia. PMID:16686806

75 FR 65595 - Retired and Senior Volunteer Program Amendments

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-26

... CORPORATION FOR NATIONAL AND COMMUNITY SERVICE 45 CFR Part 2553 RIN 3045-AA52 Retired and Senior... recipients for the Retired and Senior Volunteer Program (``RSVP'') beginning in fiscal year 2013. Section 201... Senior Volunteer Program. The competitive process, as directed by statute, will include the use of peer...

76 FR 22453 - Energy Conservation Program: Energy Conservation Standards for Residential Clothes Dryers and...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-21

.... These impacts continue well beyond 2100. Table I-3 shows the annualized values for the clothes dryer... Conservation Program: Energy Conservation Standards for Residential Clothes Dryers and Room Air Conditioners... 1904-AA89 Energy Conservation Program: Energy Conservation Standards for Residential Clothes Dryers and...

76 FR 8965 - National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-16

... DEPARTMENT OF HEALTH AND HUMAN SERVICES 42 CFR Part 100 RIN 0907-AA National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table AGENCY: Health Resources and Services... ``National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table.'' Date and Time: The...

78 FR 36449 - State Long-Term Care Ombudsman Program

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-18

... 0985-AA08 State Long-Term Care Ombudsman Program AGENCY: Administration on Aging, Administration for... Act, the State Long-Term Care Ombudsman program. This proposed rule replaces AoA's 1994 Notice of... highlighted the difficulty of determining State compliance in carrying out the Long-Term Care Ombudsman...

76 FR 57940 - CCC Export Credit Guarantee (GSM-102) Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-19

... Corporation 7 CFR Part 1493 RIN 0551-AA74 CCC Export Credit Guarantee (GSM-102) Program AGENCY: Foreign.... SUMMARY: The Commodity Credit Corporation (CCC) published a proposed rule on July 27, 2011 (76 FR 44836..., and include other administrative revisions to enhance clarity and program integrity. CCC is extending...

75 FR 41695 - Rural Microentrepreneur Assistance Program; Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-19

... DEPARTMENT OF AGRICULTURE Rural Business-Cooperative Service 7 CFR Part 4280 RIN 0570-AA71 Rural Microentrepreneur Assistance Program; Correction AGENCY: Rural Business-Cooperative Service, USDA. ACTION... of rural microenterprises. This document has an incorrect definition of ``nonprofit entity...

Graduate Education in Psychology: A Comment on Rogers' Passionate Statement

ERIC Educational Resources Information Center

Brown, Robert C., Jr.; Tedeschi, James T.

1972-01-01

Authors' hope that this critical evaluation can place Carl Rogers' assumptions into perspective; they propose a compromise program meant to satisfy the basic aims of a humanistic psychology program. For Rogers' rejoinder see AA 512 869. (MB)

EDUCATIONAL DEGREES AND ADULT MORTALITY RISK IN THE UNITED STATES*

PubMed Central

Rogers, Richard G.; Everett, Bethany G.; Zajacova, Anna; Hummer, Robert A.

2011-01-01

We present the first published estimates of U.S. adult mortality risk by detailed educational degree, including advanced postsecondary degrees. We use the 1997–2002 National Health Interview Survey (NHIS) Linked Mortality Files and Cox proportional hazards models to reveal wide graded differences in mortality by educational degree. Compared to adults who have a professional degree, those with an MA are 5 percent, those with a BA 26 percent, those with an AA 44 percent, those with some college 65 percent, HS graduates 80 percent, and those with a GED or 12 or fewer years of schooling are at least 95 percent more likely to die during the follow-up period, net of sociodemographic controls. These differentials vary by gender and cohort. Advanced educational degrees are not only associated with increased workforce skill level, but also with a reduced risk of death. PMID:20589989

Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

DTIC Science & Technology

1985-02-01

governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

Allelopathic effects of aconitic acid on wild poinsettia (Euphorbia heterophylla) and morningglory (Ipomoea grandifolia).

PubMed

Voll, Elemar; Voll, Cristiano Elemar; Filho, Ricardo Victória

2005-01-01

High infestations of alexandergrass (Brachiaria plantaginea) in experimental area have reduced seedbank of some weed species in soil at a greater degree compared to those obtained with the use of an efficient herbicide. Aconitic acid (AA) has been identified in those plants in high concentration. Thus, two experiments were carried out in the laboratory to determine the effects of pure AA on weed seed germination and on endophytic fungi in wild poinsettia (Euphorbia heterophylla) and morningglory (Ipomoea grandifolia) weed species. Doses of AA (0, 0.5, 1.0, and 2.0 mM) were introduced in agar-water 0.5% medium and weed seeds treated with and without external sterilization by sodium hypochloride. Four replications of fifty seeds of each species by treatment were sown in plastic boxes with cover and maintained in germination chamber for 12 days. Reduction in germination rate, root and stem growth were observed in both species, as well as reduction in root number in morningglory were also observed at 2.0 mM concentration of AA. An increase in number of seeds with presence of endophytic fungi was also observed in both species, independently of seed sterilization, mainly of a green type fungi coloration in wild poinsettia. Aconitic acid presents allelopathic activity and can stimulate endophytic fungi species growth in weed seeds.

Growth and development in preterm infants fed long-chain polyunsaturated fatty acids: a prospective, randomized controlled trial.

PubMed

O'Connor, D L; Hall, R; Adamkin, D; Auestad, N; Castillo, M; Connor, W E; Connor, S L; Fitzgerald, K; Groh-Wargo, S; Hartmann, E E; Jacobs, J; Janowsky, J; Lucas, A; Margeson, D; Mena, P; Neuringer, M; Nesin, M; Singer, L; Stephenson, T; Szabo, J; Zemon, V

2001-08-01

A randomized, masked, controlled trial was conducted to assess effects of supplementing premature infant formulas with oils containing the long-chain polyunsaturated fatty acids, arachidonic acid (AA; 20:4 n6), and docosahexaenoic acid (DHA; 22:6 n3) on growth, visual acuity, and multiple indices of development. Infants (N = 470) with birth weights 750 to 1800 g were assigned within 72 hours of the first enteral feeding to 1 of 3 formula groups with or without long-chain polyunsaturated fatty acids: 1) control (N = 144), 2) AA+DHA from fish/fungal oil (N = 140), and 3) AA+DHA from egg-derived triglyceride (egg-TG)/fish oil (N = 143). Infants were fed human milk and/or Similac Special Care with or without 0.42% AA and 0.26% DHA to term corrected age (CA), then fed human milk or NeoSure with or without 0.42% AA and 0.16% DHA to 12 months' CA. Infants fed exclusively human milk to term CA (EHM-T; N = 43) served as a reference. Visual acuity measured by acuity cards at 2, 4, and 6 months' CA was not different among groups. Visual acuity measured by swept-parameter visual-evoked potentials in a subgroup from 3 sites (45 control, 50 AA+DHA [fish/fungal]; 39 AA+DHA [egg-TG/fish]; and 23 EHM-T) was better in both the AA+DHA (fish/fungal; least square [LS] means [cycle/degree] +/- standard error [SE; octaves] 11.4 +/- 0.1) and AA+DHA (egg-TG/fish; 12.5 +/- 0.1) than control (8.4 +/- 0.1) and closer to that of the EHM-T group (16.0 +/- 0.2) at 6 months' CA. Visual acuity improved from 4 to 6 months' CA in all but the control group. Scores on the Fagan test of novelty preference were greater in AA+DHA (egg-TG/fish; LS means +/- SE, 59.4 +/- 7.7) than AA+DHA (fish/fungal; 57.0 +/- 7.5) and control (57.5 +/- 7.4) at 6 months' CA, but not at 9 months' CA. There were no differences in the Bayley Mental Development Index at 12 months' CA. However, the Bayley motor development index was higher for AA+DHA (fish/fungal; LS means +/- SE, 90.6 +/- 4.4) than control (81.8 +/- 4.3) for infants

Consumption of Red Meat, but Not Cooking Oils High in Polyunsaturated Fat, Is Associated with Higher Arachidonic Acid Status in Singapore Chinese Adults.

PubMed

Seah, Jowy Yi Hoong; Gay, Gibson Ming Wei; Su, Jin; Tai, E-Shyong; Yuan, Jian-Min; Koh, Woon-Puay; Ong, Choon Nam; van Dam, Rob M

2017-01-31

High arachidonic acid (AA; 20:4 n - 6) status may have adverse effects on inflammation and risk of cardiovascular diseases. Concerns about high intake of n - 6 polyunsaturated fatty acids (PUFAs) are based on the premise that endogenous conversion from linoleic acid (LA; 18:2 n - 6) is an important source of AA, but few population-based studies have investigated dietary determinants of AA status. In this study, we examined habitual food consumption in relation to plasma concentrations of AA and other PUFAs in population-based studies. We used cross-sectional data from 269 healthy, ethnic Chinese participants (25-80 years old) with contrasting intakes of fish and red meat from the Singapore Prospective Study Program and 769 healthy participants (44-74 years old) from the Singapore Chinese Health Study as a validation set. Multivariable linear regression was used to examine PUFA intake (% energy) and food sources of PUFA (fish, red meat, poultry, soy and cooking oils) in relation to plasma PUFAs (AA, LA, dihomo-gamma-linolenic acid (DGLA; 20:3 n - 6), alpha-linolenic acid (ALA; 18:3 n - 3), eicosapentaenoic acid (EPA; 20:5 n - 3), and docosahexaenoic acid (DHA; 22:6 n - 3)) concentrations. Higher intake of red meat was associated with higher plasma AA concentrations. High intake of PUFA or PUFA-rich oils was associated with higher plasma ALA but not with plasma AA. Higher intakes of soy were associated with higher ALA and fish with higher DHA and EPA concentrations. These associations were statistically significant (p < 0.05) in both studies. Red meat consumption, but not PUFA or PUFA-rich cooking oil, was associated with circulating AA suggesting that intake of pre-formed AA rather than LA is an important determinant of AA status. A diet high in fish, soy products and polyunsaturated cooking oil, and low in red meat may be associated with an optimal plasma profile of PUFA in this Chinese population.

Hair regrowth in alopecia areata patients following Stem Cell Educator therapy.

PubMed

Li, Yanjia; Yan, Baoyong; Wang, Hepeng; Li, Heng; Li, Quanhai; Zhao, Dong; Chen, Yana; Zhang, Ye; Li, Wenxia; Zhang, Jun; Wang, Shanfeng; Shen, Jie; Li, Yunxiang; Guindi, Edward; Zhao, Yong

2015-04-20

Alopecia areata (AA) is one of the most common autoimmune diseases and targets the hair follicles, with high impact on the quality of life and self-esteem of patients due to hair loss. Clinical management and outcomes are challenged by current limited immunosuppressive and immunomodulating regimens. We have developed a Stem Cell Educator therapy in which a patient's blood is circulated through a closed-loop system that separates mononuclear cells from the whole blood, allows the cells to briefly interact with adherent human cord blood-derived multipotent stem cells (CB-SC), and returns the "educated" autologous cells to the patient's circulation. In an open-label, phase 1/phase 2 study, patients (N = 9) with severe AA received one treatment with the Stem Cell Educator therapy. The median age was 20 years (median alopecic duration, 5 years). Clinical data demonstrated that patients with severe AA achieved improved hair regrowth and quality of life after receiving Stem Cell Educator therapy. Flow cytometry revealed the up-regulation of Th2 cytokines and restoration of balancing Th1/Th2/Th3 cytokine production in the peripheral blood of AA subjects. Immunohistochemistry indicated the formation of a "ring of transforming growth factor beta 1 (TGF-β1)" around the hair follicles, leading to the restoration of immune privilege of hair follicles and the protection of newly generated hair follicles against autoimmune destruction. Mechanistic studies revealed that co-culture with CB-SC may up-regulate the expression of coinhibitory molecules B and T lymphocyte attenuator (BTLA) and programmed death-1 receptor (PD-1) on CD8β(+)NKG2D(+) effector T cells and suppress their proliferation via herpesvirus entry mediator (HVEM) ligands and programmed death-1 ligand (PD-L1) on CB-SCs. Current clinical data demonstrated the safety and efficacy of the Stem Cell Educator therapy for the treatment of AA. This innovative approach produced lasting improvement in hair regrowth in subjects with moderate or severe AA. ClinicalTrials.gov, NCT01673789, 21 August 2012.

45 CFR 170.575 - Removal of the ONC-AA.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Permanent Certification Program for HIT § 170.575 Removal of the ONC...

The Misuse of Anabolic-Androgenic Steroids among Iranian Recreational Male Body-Builders and Their Related Psycho-Socio-Demographic factors

PubMed Central

ANGOORANI, Hooman; HALABCHI, Farzin

2015-01-01

Background: The high prevalence and potential side effects of anabolic-androgenic steroids (AAS) misuse by athletes has made it a major public health concern. Epidemiological studies on the abuse of such drugs are mandatory for developing effective preventive drug control programs in sports community. This study aimed to investigate the prevalence of AAS abuse and their association with some psycho-socio-demographic factors in Iranian male recreational body-builders. Methods: Between March and October 2011; 906 recreational male body-builders from 103 randomly selected bodybuilding clubs in Tehran, Iran were participated in this study. Some psycho-socio- demographic factors including age, job, average family income, family size, sport experience (months), weekly duration of the sporting activity (h), purpose of participation in sporting activity, mental health as well as body image (via General Health Questionnaire and Multidimensional Body-Self Relations Questionnaire, respectively), and history of AAS use were obtained by interviews using questionnaires. Results: Participants were all recreational male body-builders [mean age (SD): 25.7 (7.1), ranging 14–56 yr]. Self-report of AAS abuse was registered in 150 body-builders (16.6%). Among different psycho-socio-demographic factors, only family income and sport experience were inversely associated with AAS abuse. Conclusion: Lifetime prevalence of AAS abuse is relatively high among recreational body-builders based on their self-report. Some psycho-socio-demographic factors including family income and sport experience may influence the prevalence of AAS abuse. PMID:26811817

The Misuse of Anabolic-Androgenic Steroids among Iranian Recreational Male Body-Builders and Their Related Psycho-Socio-Demographic factors.

PubMed

Angoorani, Hooman; Halabchi, Farzin

2015-12-01

The high prevalence and potential side effects of anabolic-androgenic steroids (AAS) misuse by athletes has made it a major public health concern. Epidemiological studies on the abuse of such drugs are mandatory for developing effective preventive drug control programs in sports community. This study aimed to investigate the prevalence of AAS abuse and their association with some psycho-socio-demographic factors in Iranian male recreational body-builders. Between March and October 2011; 906 recreational male body-builders from 103 randomly selected bodybuilding clubs in Tehran, Iran were participated in this study. Some psycho-socio- demographic factors including age, job, average family income, family size, sport experience (months), weekly duration of the sporting activity (h), purpose of participation in sporting activity, mental health as well as body image (via General Health Questionnaire and Multidimensional Body-Self Relations Questionnaire, respectively), and history of AAS use were obtained by interviews using questionnaires. Participants were all recreational male body-builders [mean age (SD): 25.7 (7.1), ranging 14-56 yr]. Self-report of AAS abuse was registered in 150 body-builders (16.6%). Among different psycho-socio-demographic factors, only family income and sport experience were inversely associated with AAS abuse. Lifetime prevalence of AAS abuse is relatively high among recreational body-builders based on their self-report. Some psycho-socio-demographic factors including family income and sport experience may influence the prevalence of AAS abuse.

Ionizing radiation in the field of hydrogels used for agriculture and medicine

NASA Astrophysics Data System (ADS)

Radoiu, M.; Martin, D.; Oproiu, C.; Toma, M.; Popescu, A. S.; Bestea, V.; Dragusin, M.; Moraru, R.; Calinescu, I.; Manea, A.

1999-01-01

Some hydrogel types, obtained by gamma ray and electron beam irradiation, such as homopolymers of acrylamide (pAA type), co-polymers of acrylamide and sodium acrylate (pAANA type), homo-polymers of sodium acrylate (pNA type) and homo-polymers of 2-hydroxyethylmethacrylate (pHEMA type), are presented. The effects of the solution's chemical composition, swelling medium nature, radiation absorbed dose and radiation absorbed dose rate upon the swelling degree and mechanical strength of pAA, pAANA, pNA types are discussed. For the pHEMA type, which are reinforced in the polyester network, the studies concerning the influence of the irradiation parameters and chemical composition upon the shape stability after swelling and surface's roughness are also discussed.

Analysis of Enrollment Trends for HCCC Programs and Academic Status Classifications, Fall 1993 to Fall 1999.

ERIC Educational Resources Information Center

Taffy, Fred

The study of enrollment trends for each of Hudson County Community College's programs and for its academic status classifications will be used in the college's program reviews and should also prove useful in its strategic planning. The significant growth in combined Liberal Arts AA English/ Humanities and Business/Social Sciences program majors…

45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.

Code of Federal Regulations, 2011 CFR

2011-10-01

... status. 170.504 Section 170.504 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Permanent Certification Program for HIT...

45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.

Code of Federal Regulations, 2012 CFR

2012-10-01

... status. 170.504 Section 170.504 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Permanent Certification Program for HIT...

75 FR 4474 - Energy Conservation Program: Certification, Compliance, and Enforcement Requirements for Certain...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-28

... titled ``Certification, Compliance, and Enforcement Requirements for Certain Consumer Products and...-AA96 and 1904-AB53 Energy Conservation Program: Certification, Compliance, and Enforcement Requirements for Certain Consumer Products and Commercial and Industrial Equipment; Correction AGENCY: Office of...

Evaluating alcoholics anonymous sponsor attributes using conjoint analysis.

PubMed

Stevens, Edward B; Jason, Leonard A

2015-12-01

Alcoholics Anonymous (AA) considers sponsorship an important element of the AA program, especially in early recovery. 225 adult individuals who had experience as either a sponsor, sponsee, or both, participated in a hypothetical sponsor ranking exercise where five attributes were varied across three levels. Conjoint analysis was used to compute part-worth utility of the attributes and their levels for experience, knowledge, availability, confidentiality, and goal-setting. Differences in utilities by attribute were found where confidentiality had the greatest overall possible impact on utility and sponsor knowledge had the least. These findings suggest qualitative differences in sponsors may impact their effectiveness. Future research on AA should continue to investigate sponsor influence on an individual's overall recovery trajectory. Copyright © 2015 Elsevier Ltd. All rights reserved.

Sorption reaction mechanism of some hazardous radionuclides from mixed waste by impregnated crown ether onto polymeric resin.

PubMed

Shehata, F A; Attallah, M F; Borai, E H; Hilal, M A; Abo-Aly, M M

2010-02-01

A novel impregnated polymeric resin was practically tested as adsorbent material for removal of some hazardous radionuclides from radioactive liquid waste. The applicability for the treatment of low-level liquid radioactive waste was investigated. The material was prepared by loading 4,4'(5')di-t-butylbenzo 18 crown 6 (DtBB18C6) onto poly(acrylamide-acrylic acid-acrylonitril)-N, N'-methylenediacrylamide (P(AM-AA-AN)-DAM). The removal of (134)Cs, (60)Co, (65)Zn , and ((152+154))Eu onto P(AM-AA-AN)-DAM/DtBB18C6 was investigated using a batch equilibrium technique with respect to the pH, contact time, and temperature. Kinetic models are used to determine the rate of sorption and to investigate the mechanism of sorption process. Five kinetics models, pseudo-first-order, pseudo-second-order, intra-particle diffusion, homogeneous particle diffusion (HPDM), and Elovich models, were used to investigate the sorption process. The obtained results of kinetic models predicted that, pseudo-second-order is applicable; the sorption is controlled by particle diffusion mechanism and the process is chemisorption. The obtained values of thermodynamics parameters, DeltaH degrees , DeltaS degrees , and DeltaG degrees indicated that the endothermic nature, increased randomness at the solid/solution interface and the spontaneous nature of the sorption processes. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

Autoimmune, atopic, and mental health comorbid conditions associated with alopecia areata in the United States.

PubMed

Huang, Kathie P; Mullangi, Samyukta; Guo, Ye; Qureshi, Abrar A

2013-07-01

To evaluate the prevalence of comorbid conditions among patients with alopecia areata (AA) seen at tertiary care hospitals in Boston, Massachusetts, during an 11-year period. Retrospective cross-sectional study. Tertiary care hospitals in Boston, including Brigham and Women's Hospital and Massachusetts General Hospital. We identified 3568 individuals with AA seen in the Partners health care system in Boston between January 1, 2000, and January 1, 2011. We performed comprehensive searches of the Research Patient Data Repository using International Classification of Diseases, Ninth Revision code 704.01. We randomly selected 350 patients and manually reviewed their medical records to train and validate a novel artificial intelligence program. This program then used natural language processing to review free-text medical records and confirm a diagnosis of AA. To confirm the algorithm, we manually reviewed a subset of records and found 93.9% validity. The prevalence of comorbid conditions was assessed. Common comorbid conditions included autoimmune diagnoses (thyroid disease in 14.6%, diabetes mellitus in 11.1%, inflammatory bowel disease in (2.0%) [corrected], systemic lupus erythematosus in 4.3%, rheumatoid arthritis in 3.9%, and psoriasis and psoriatic arthritis in (6.3%) [corrected], atopy (allergic rhinitis, asthma, and/or eczema in 38.2% and contact dermatitis and other eczema in 35.9%), and mental health problems (depression or anxiety in 25.5%). We also found high prevalences of hyperlipidemia (24.5%), hypertension (21.9%), and gastroesophageal reflux disease (17.3%). This profile was different from that seen in a comparison psoriasis and psoriatic arthritis group. We found a high prevalence of comorbid conditions among individuals with AA presenting to academic medical centers in Boston. Physicians caring for patients with AA should consider screening for comorbid conditions.

Recruitment Methods and Show Rates to a Prostate Cancer Early Detection Program for High-Risk Men: A Comprehensive Analysis

PubMed Central

Giri, Veda N.; Coups, Elliot J.; Ruth, Karen; Goplerud, Julia; Raysor, Susan; Kim, Taylor Y.; Bagden, Loretta; Mastalski, Kathleen; Zakrzewski, Debra; Leimkuhler, Suzanne; Watkins-Bruner, Deborah

2009-01-01

Purpose Men with a family history (FH) of prostate cancer (PCA) and African American (AA) men are at higher risk for PCA. Recruitment and retention of these high-risk men into early detection programs has been challenging. We report a comprehensive analysis on recruitment methods, show rates, and participant factors from the Prostate Cancer Risk Assessment Program (PRAP), which is a prospective, longitudinal PCA screening study. Materials and Methods Men 35–69 years are eligible if they have a FH of PCA, are AA, or have a BRCA1/2 mutation. Recruitment methods were analyzed with respect to participant demographics and show to the first PRAP appointment using standard statistical methods Results Out of 707 men recruited, 64.9% showed to the initial PRAP appointment. More individuals were recruited via radio than from referral or other methods (χ2 = 298.13, p < .0001). Men recruited via radio were more likely to be AA (p<0.001), less educated (p=0.003), not married or partnered (p=0.007), and have no FH of PCA (p<0.001). Men recruited via referrals had higher incomes (p=0.007). Men recruited via referral were more likely to attend their initial PRAP visit than those recruited by radio or other methods (χ2 = 27.08, p < .0001). Conclusions This comprehensive analysis finds that radio leads to higher recruitment of AA men with lower socioeconomic status. However, these are the high-risk men that have lower show rates for PCA screening. Targeted motivational measures need to be studied to improve show rates for PCA risk assessment for these high-risk men. PMID:19758657

Evaluation of Predictability of Quartz-Crystal Oscillators and other Devices.

DTIC Science & Technology

1981-01-15

8217-A OZG ,EE D E; " EE D- GIEE GE.;RZE AA 1IA DEGREE ) k- 3ER 3E AZ Or0.(EE I D.Y 0 .Cz Q.U. 0 .03 O.C3 O.35 3.32 3.J4 ).33 033 0.04 Z GAYS O2.C4 0.04...DEGREE DEGREE DEGREE AP.I.A DEGREE DEGREE 3E3RikE OZG EE I OAy 0.01 Q.0b 0.05 0.04 J.04 J.32 0.11k 3.083 3.07 :).13 2CAYS J.cz G.07 0.04 0.05 0.35 Q.32...DEG.REE DEOREE OzG ^EE I DAY 0.01 0.03 0.02 0.02 0.02 .. 02 0.03 0.03 O.JZ 0.03 2 CDYS 0.02 0.0t 0.04 0.03 3.04 0.03 0.34 0.04 0.04 3.05 5 DAY5 O.Ob C.0o

Stereopsis and fusion in anisometropia according to the presence of amblyopia.

PubMed

Jeon, Hyun Sun; Choi, Dong Gyu

2017-12-01

To evaluate the level of stereopsis and fusion in patients with anisometropia according to the presence of amblyopia. We included 107 children with anisometropia, divided into groups with non-amblyopic anisometropia (NA, n = 72) and amblyopic anisometropia (AA, n = 35). Normal subjects without anisometropia were enrolled in the control group (n = 73). Main outcome measures were the level of stereopsis and sensory fusion as evaluated by Titmus stereotest and Worth 4-dot test, respectively, using anisometropic glasses. The degree of anisometropia in the NA, AA, and control groups was 2.54 diopters (D), 4.29 D, and 0.30 D, respectively (P = 0.014). Stereopsis (arcsec) was significantly worse in the AA group than the NA and control groups (641.71, 76.25, 54.52, respectively, P < 0.001), while no significant difference was found between the NA and control groups. The rate of fusion was significantly lower in the AA than the NA group (14.3% vs. 65.3%, P < 0.001), and was significantly lower in the NA than the control group (65.3% vs. 80.6%, P = 0.001). The levels of stereopsis and sensory fusion with anisometropic glasses were significantly worse in the AA than in the NA group. The level of stereopsis in the NA group, however, did not differ significantly from that in the isometropic control, while the rate of fusion was significantly lower. Early prescription of anisometropic glasses is needed to improve visual acuity and binocularity in children with possible amblyopic anisometropia.

Synthesis of wheat straw cellulose-g-poly (potassium acrylate)/PVA semi-IPNs superabsorbent resin.

PubMed

Liu, Jia; Li, Qian; Su, Yuan; Yue, Qinyan; Gao, Baoyu; Wang, Rui

2013-04-15

To better use wheat straw and minimize its negative impact on environment, a novel semi-interpenetrating polymer networks (semi-IPNs) superabsorbent resin (SAR) composed of wheat straw cellulose-g-poly (potassium acrylate) (WSC-g-PKA) network and linear polyvinyl alcohol (PVA) was prepared by polymerization in the presence of a redox initiating system. The structure and morphology of semi-IPNs SAR were characterized by means of FTIR, SEM and TGA, which confirmed that WSC and PVA participated in the graft polymerization reaction with acrylic acid (AA). The factors that can influence the water absorption of the semi-IPNs SAR were investigated and optimized, including the weight ratios of AA to WSC and PVA to WSC, the content of initiator and crosslinker, neutralization degree (ND) of AA, reaction temperature and time. The semi-IPNs SAR prepared under optimized synthesis condition gave the best water absorption of 266.82 g/g in distilled water and 34.32 g/g in 0.9 wt% NaCl solution. Copyright © 2013 Elsevier Ltd. All rights reserved.

Convective drying kinetics of strawberry (Fragaria ananassa): Effects on antioxidant activity, anthocyanins and total phenolic content.

PubMed

Méndez-Lagunas, Lilia; Rodríguez-Ramírez, Juan; Cruz-Gracida, Marlene; Sandoval-Torres, Sadoth; Barriada-Bernal, Gerardo

2017-09-01

The thermal drying effects on strawberries were investigated in terms of the kinetics of antioxidant activity (AA), anthocyanins (A) and total phenolic compound content (TPC), as well as the final colour. The evaluated drying temperatures were 50 and 60°C with an air rate of 1.5m/s. The 2,2-diphenyl-2-picryl-hydrazyl, pH differential and Folin-Ciocalteu methods were used to assess the antioxidant properties. The kinetics of TPC and AA showed an initial and final period of degradation attributed to inhibition of enzymes. A plateau between these two periods suggests that under certain conditions of temperature and water content, no degradation reactions occurred. Final losses of up to 74, 45 and 78% were found for AA, A and TPC, respectively. The total colour change (ΔE) was lesser degree at 60 than 50°C. Thermal degradation of the antioxidant compounds followed a first-order reaction kinetics and the degradation rate constants (k) were calculated. Copyright © 2017 Elsevier Ltd. All rights reserved.

Direct laser writing of synthetic poly(amino acid) hydrogels and poly(ethylene glycol) diacrylates by two-photon polymerization.

PubMed

Käpylä, Elli; Sedlačík, Tomáš; Aydogan, Dogu Baran; Viitanen, Jouko; Rypáček, František; Kellomäki, Minna

2014-10-01

The additive manufacturing technique of direct laser writing by two-photon polymerization (2PP-DLW) enables the fabrication of three-dimensional microstructures with superior accuracy and flexibility. When combined with biomimetic hydrogel materials, 2PP-DLW can be used to recreate the microarchitectures of the extracellular matrix. However, there are currently only a limited number of hydrogels applicable for 2PP-DLW. In order to widen the selection of synthetic biodegradable hydrogels, in this work we studied the 2PP-DLW of methacryloylated and acryloylated poly(α-amino acid)s (poly(AA)s). The performance of these materials was compared to widely used poly(ethylene glycol) diacrylates (PEGdas) in terms of polymerization and damage thresholds, voxel size, line width, post-polymerization swelling and deformation. We found that both methacryloylated and acryloylated poly(AA) hydrogels are suitable to 2PP-DLW with a wider processing window than PEGdas. The poly(AA) with the highest degree of acryloylation showed the greatest potential for 3D microfabrication. Copyright © 2014 Elsevier B.V. All rights reserved.

Microstructural development from interdiffusion and reaction between Usbnd Mo and AA6061 alloys annealed at 600° and 550 °C

NASA Astrophysics Data System (ADS)

Perez, E.; Keiser, D. D.; Sohn, Y. H.

2016-08-01

The U.S. Material Management and Minimization Reactor Conversion Program is developing low enrichment fuel systems encased in Al-alloy for use in research and test reactors. Monolithic fuel plates have local regions where the Usbnd Mo fuel plate may come into contact with the Al-alloy 6061 (AA6061) cladding. This results in the development of interdiffusion zones with complex microstructures with multiple phases. In this study, the microstructural development of diffusion couples, Usbnd 7 wt%Mo, Usbnd 10 wt%Mo, and Usbnd 12 wt%Mo vs. AA6061, annealed at 600 °C for 24 h and at 550 °C for 1, 5, and 20 h, were analyzed by scanning electron microscopy with x-ray energy dispersive spectroscopy. The microstructural development and kinetics were compared to diffusion couples Usbnd Mo vs. high purity Al and binary Alsbnd Si alloys. The diffusion couples developed complex interaction regions where phase development was influenced by the alloying additions of the AA6061.

45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.

Code of Federal Regulations, 2014 CFR

2014-10-01

... status. 170.504 Section 170.504 Public Welfare Department of Health and Human Services HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.504...

45 CFR 170.504 - Reconsideration process for requests for ONC-AA status.

Code of Federal Regulations, 2013 CFR

2013-10-01

... status. 170.504 Section 170.504 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY ONC HIT Certification Program § 170.504...

76 FR 70639 - Agricultural Career and Employment Grants Program; Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-15

... DEPARTMENT OF AGRICULTURE Office of Advocacy and Outreach 7 CFR Part 2502 RIN 0503-AA49 Agricultural Career and Employment Grants Program; Correction AGENCY: Office of Advocacy and Outreach, Departmental Management, USDA. ACTION: Interim rule with request for comments; correction. SUMMARY: On November...

Wetlands Research Program. Wetland Evaluation Technique (WET). Volume 2. Methodology.

DTIC Science & Technology

1987-10-01

in Zones B or C fiom wind. (b) Open water fetch is less than 100 ft (Figure 19)? 19.1B (Answer "I" if the AA/IA is mostly a riverine wetland system ...and upland .... 58 19 Examples of sheltered open water in the AA/IA .................. 59 20 Example of a wetland protected shoreline...the wetland and adjacent of the channel, as well as contiguous wetlands within open water for a distance of 300 ft. from the deep 0.5 mile. water

USAF 1990 Research Initiation Program. Volume 3

DTIC Science & Technology

1992-06-25

the reinforcement outward, both on the entrance and exit sides. The reinforcement was bent outward like a membrane under internal prressure. This led...potential of a neuron. C: cell capacitance. R: membrane resistance. w: synaptic weight. h(x): sigmoidal function describing the firing rate. y: external...Proof: The uncertain closed loop plant may be written as x(t)=(A+AA)x(t)+(Ao+ AAo )x(t-T) (B+AB)F(C AC)x(t) =(A+BFC)x(t)+(AA+ABFC+BFAC+ABFAC)x(t)+(Ao+Ao)X(t

76 FR 20243 - Retired and Senior Volunteer Program Amendments

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-12

... CORPORATION FOR NATIONAL AND COMMUNITY SERVICE 45 CFR Part 2553 RIN 3045-AA52 Retired and Senior... competitive grantmaking process for the Retired and Senior Volunteer Program (RSVP). The proposed rule... with expertise in senior service and aging, site inspections, as appropriate, and evaluations of...

Charge Weld Effects on High Cycle Fatigue Behavior of a Hollow Extruded AA6082 Profile

NASA Astrophysics Data System (ADS)

Nanninga, N.; White, C.; Dickson, R.

2011-10-01

Fatigue properties of specimens taken from different locations along the length of a hollow AA6082 extrusion, where charge weld (interface between successive billets in multi-billet extrusions) properties and the degree of coring (accumulation of highly sheared billet surface material at back end of billet) are expected to vary, have been evaluated. The fatigue strength of transverse specimens containing charge welds is lower near the front of the extrusion where the charge weld separation is relatively large. The relationship between fatigue failure and charge weld separation appears to be directly related to charge weld properties. The lower fatigue properties of the specimens are likely associated with early overload fatigue failure along the charge weld interface. Coring does not appear to have significantly affected fatigue behavior.

Consumption of Red Meat, but Not Cooking Oils High in Polyunsaturated Fat, Is Associated with Higher Arachidonic Acid Status in Singapore Chinese Adults

PubMed Central

Seah, Jowy Yi Hoong; Gay, Gibson Ming Wei; Su, Jin; Tai, E-Shyong; Yuan, Jian-Min; Koh, Woon-Puay; Ong, Choon Nam; van Dam, Rob M.

2017-01-01

High arachidonic acid (AA; 20:4n-6) status may have adverse effects on inflammation and risk of cardiovascular diseases. Concerns about high intake of n-6 polyunsaturated fatty acids (PUFAs) are based on the premise that endogenous conversion from linoleic acid (LA; 18:2n-6) is an important source of AA, but few population-based studies have investigated dietary determinants of AA status. In this study, we examined habitual food consumption in relation to plasma concentrations of AA and other PUFAs in population-based studies. We used cross-sectional data from 269 healthy, ethnic Chinese participants (25–80 years old) with contrasting intakes of fish and red meat from the Singapore Prospective Study Program and 769 healthy participants (44–74 years old) from the Singapore Chinese Health Study as a validation set. Multivariable linear regression was used to examine PUFA intake (% energy) and food sources of PUFA (fish, red meat, poultry, soy and cooking oils) in relation to plasma PUFAs (AA, LA, dihomo-gamma-linolenic acid (DGLA; 20:3n-6), alpha-linolenic acid (ALA; 18:3n-3), eicosapentaenoic acid (EPA; 20:5n-3), and docosahexaenoic acid (DHA; 22:6n-3)) concentrations. Higher intake of red meat was associated with higher plasma AA concentrations. High intake of PUFA or PUFA-rich oils was associated with higher plasma ALA but not with plasma AA. Higher intakes of soy were associated with higher ALA and fish with higher DHA and EPA concentrations. These associations were statistically significant (p < 0.05) in both studies. Red meat consumption, but not PUFA or PUFA-rich cooking oil, was associated with circulating AA suggesting that intake of pre-formed AA rather than LA is an important determinant of AA status. A diet high in fish, soy products and polyunsaturated cooking oil, and low in red meat may be associated with an optimal plasma profile of PUFA in this Chinese population. PMID:28146136

When Will It Be... USNO Seasons and Apsides Calculator

NASA Astrophysics Data System (ADS)

Chizek Frouard, Malynda; Bartlett, Jennifer Lynn

2018-01-01

The turning of the Earth’s seasons (solstices and equinoxes) and apsides (perihelions and aphelions) are times often used in observational astronomy and also of interest to the public. To avoid tedious calculations, the U.S. Naval Observatory (USNO) has developed an on-line interactive calculator, Earth’s Seasons and Apsides to provide information about events between 1600 and 2200. The new data service uses an Application Programming Interface (API), which returns values in JavaScript Object Notation (JSON) that can be incorporated into third-party websites or applications. For a requested year, the Earth’s Seasons and Apsides API provides the Gregorian calendar date and time of the Vernal Equinox, Summer Solstice, Autumnal Equinox, Winter Solstice, Aphelion, and Perihelion. The user may specify the time zone for their results, including the optional addition of U.S. daylight saving time for years after 1966.On-line documentation for using the API-enabled Earth’s Seasons and Apsides is available, including sample calls (http://aa.usno.navy.mil/data/docs/api.php). A traditional forms-based interface is available as well (http://aa.usno.navy.mil/data/docs/EarthSeasons.php). This data service replaces the popular Earth's Seasons: Equinoxes, Solstices, Perihelion, and Aphelion page that provided a static list of events for 2000–2025. The USNO also provides API-enabled data services for Complete Sun and Moon Data for One Day (http://aa.usno.navy.mil/data/docs/RS_OneDay.php), Dates of the Primary Phases of the Moon (http://aa.usno.navy.mil/data/docs/MoonPhase.php), Selected Christian Observances (http://aa.usno.navy.mil/data/docs/easter.php), Selected Islamic Observances (http://aa.usno.navy.mil/data/docs/islamic.php), Selected Jewish Observances (http://aa.usno.navy.mil/data/docs/passover.php), Julian Date Conversion (http://aa.usno.navy.mil/data/docs/JulianDate.php), and Sidereal Time (http://aa.usno.navy.mil/data/docs/siderealtime.php) as well as its Solar Eclipse Computer (http://aa.usno.navy.mil/data/docs/SolarEclipses.php).

Accuracy assessment in the Large Area Crop Inventory Experiment

NASA Technical Reports Server (NTRS)

Houston, A. G.; Pitts, D. E.; Feiveson, A. H.; Badhwar, G.; Ferguson, M.; Hsu, E.; Potter, J.; Chhikara, R.; Rader, M.; Ahlers, C.

1979-01-01

The Accuracy Assessment System (AAS) of the Large Area Crop Inventory Experiment (LACIE) was responsible for determining the accuracy and reliability of LACIE estimates of wheat production, area, and yield, made at regular intervals throughout the crop season, and for investigating the various LACIE error sources, quantifying these errors, and relating them to their causes. Some results of using the AAS during the three years of LACIE are reviewed. As the program culminated, AAS was able not only to meet the goal of obtaining accurate statistical estimates of sampling and classification accuracy, but also the goal of evaluating component labeling errors. Furthermore, the ground-truth data processing matured from collecting data for one crop (small grains) to collecting, quality-checking, and archiving data for all crops in a LACIE small segment.

40 CFR 421.302 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

Code of Federal Regulations, 2013 CFR

2013-07-01

... CATEGORY Primary and Secondary Titanium Subcategory § 421.302 Effluent limitations guidelines representing...) Chlorination off-gas wet air pollution control. BPT Limitations for the Primary and Secondary Titanium... Titanium 0.880 0.384 Oil and grease 18.720 11.230 Total suspended solids 38.380 18.250 pH (1) (1) AA1...

40 CFR 421.302 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

Code of Federal Regulations, 2014 CFR

2014-07-01

... CATEGORY Primary and Secondary Titanium Subcategory § 421.302 Effluent limitations guidelines representing...) Chlorination off-gas wet air pollution control. BPT Limitations for the Primary and Secondary Titanium... Titanium 0.880 0.384 Oil and grease 18.720 11.230 Total suspended solids 38.380 18.250 pH (1) (1) AA1...

40 CFR 421.302 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

Code of Federal Regulations, 2012 CFR

2012-07-01

... CATEGORY Primary and Secondary Titanium Subcategory § 421.302 Effluent limitations guidelines representing...) Chlorination off-gas wet air pollution control. BPT Limitations for the Primary and Secondary Titanium... Titanium 0.880 0.384 Oil and grease 18.720 11.230 Total suspended solids 38.380 18.250 pH (1) (1) AA1...

Solid State Research

DTIC Science & Technology

1997-11-15

Vll LIST OF ILLUSTRATIONS (Continued) Figure page No. 3-2 Representative trace from the imaging interferometric end point system of etched...of Nomarski contrast microscopy. Double-crystal x-ray diffraction (DCXD) was used to measure the degree of lattice mismatch Aa/a to GaSb substrates...was increased further, however, Nomarski contrast microscopy revealed surface texture which increases with V/m ratio. These results are similar to

Amino Acid Enantiomeric Ratios in Semi-Labile vs. Refractory Dissolved Organic Matter: Implications for a Microbial N Pump

NASA Astrophysics Data System (ADS)

Bour, A. L.; Broek, T.; Gier, E. J.; Mccarthy, M. D.

2016-02-01

Microbes are key moderators in the cycling of marine dissolved organic matter (DOM), most of which remains unidentifiable at the molecular level. A major current question, however, is to what degree heterotrophic bacteria directly mediate C and N sequestration in the deep sea. Amino acids (AA) represent almost all organic N that can be identified at the molecular level, while D-AA enantiomers represent unique source-specific biomarkers for prokaryotes, known to be highly enriched in ocean DOM. If increasing bacterial-sourced material ultimately leads to millennial scale sequestration of refractory DOM (RDOM), then one would expect a clear correlation between bacterial biomarkers and DOM radiocarbon (Δ14C) ages, in particular in the deep sea. Here we directly test this idea for the first time, by measuring D-AA abundance and distribution in isolated Δ14C young vs. old DOM from the central north pacific gyre. We used a coupled ultrafiltration/solid phase extraction approach to isolate semi-labile vs. RDOM, based on known molecular weight and Δ14C age correlations. The Δ14C ages of isolated material ranged from 205-275 ybp for surface semi-labile DOM, to 6680-6740 ybp for deep ocean RDOM. We measured enantiomeric (D/L) AA ratios, as well as AA molar percentages to estimate traditional degradation parameters (DI and RI), in semi-labile vs. RDOM fractions from the surface to deep ocean at HOT, Station ALOHA. We interpret our results in terms of the hypothesis of a microbial N pump, examining the similarity of microbial source signatures (D/L distributions) and calculated organic N contributions from heterotrophic bacteria, in the context of the Δ14C age of each fraction. Finally, we also evaluate these data vs. common AA molar percentage based indices of degradation.

77 FR 62167 - World Trade Center Health Program; Addition of Certain Types of Cancer to the List of WTC-Related...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-12

... DEPARTMENT OF HEALTH AND HUMAN SERVICES 42 CFR Part 88 [Docket No. CDC-2012-0007; NIOSH-257] RIN 0920-AA49 World Trade Center Health Program; Addition of Certain Types of Cancer to the List of WTC...

78 FR 5726 - Nationwide Permit Program

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-28

... of Engineers Regulatory Home Page at http://www.usace.army.mil/Missions/CivilWorks/Regulatory... DEPARTMENT OF DEFENSE Department of the Army, Corps of Engineers 33 CFR Part 330 RIN 0710-AA60 Nationwide Permit Program AGENCY: U.S. Army Corps of Engineers, DoD. ACTION: Final rule. SUMMARY: The U.S...

DPS Planetary Science Graduate Programs Database for Students and Advisors

NASA Astrophysics Data System (ADS)

Klassen, David R.; Roman, Anthony; Meinke, Bonnie K.

2017-10-01

Planetary science is a topic that covers an extremely diverse set of disciplines; planetary scientists are typically housed in a departments spanning a wide range of disciplines. As such it is difficult for undergraduate students to find programs that will give them a degree and research experience in our field as Department of Planetary Science is a rare sighting, indeed. Not only can this overwhelm even the most determined student, it can even be difficult for many undergraduate advisers.Because of this, the DPS Education committee decided several years ago that it should have an online resource that could help undergraduate students find graduate programs that could lead to a PhD with a focus in planetary science. It began in 2013 as a static page of information and evolved from there to a database-driven web site. Visitors can browse the entire list of programs or create a subset listing based on several filters. The site should be of use not only to undergraduates looking for programs, but also for advisers looking to help their students decide on their future plans. We present here a walk-through of the basic features as well as some usage statistics from the collected web site analytics. We ask for community feedback on additional features to make the system more usable for them. We also call upon those mentoring and advising undergraduates to use this resource, and for program admission chairs to continue to review their entry and provide us with the most up-to-date information.The URL for our site is http://dps.aas.org/education/graduate-schools.

Growing pains: Hank Chamberlin and the Arkansas A&M forestry program, 1946-1957

Treesearch

Don C. Bragg

2017-01-01

Almost immediately after he started in the fall of 1945, Henry H. "Hank" Chamberlin faced many challenges in getting the two-year applied forestry program at Arkansas A&M College (AA&M) up and running. As the newly hired director of the one-mandepartment, Chamberlin needed to build this program with virtually no financial resources...

Extreme deep white matter hyperintensity volumes are associated with African American race.

PubMed

Nyquist, Paul A; Bilgel, Murat S; Gottesman, Rebecca; Yanek, Lisa R; Moy, Taryn F; Becker, Lewis C; Cuzzocreo, Jennifer; Prince, Jerry; Yousem, David M; Becker, Diane M; Kral, Brian G; Vaidya, Dhananjay

2014-01-01

African Americans (AAs) have a higher prevalence of extreme ischemic white matter hyperintensities (WMHs) on magnetic resonance imaging (MRI) than do European Americans (EAs) based on the Cardiovascular Health Study (CHS) score. Ischemic white matter disease, limited to the deep white matter, may be biologically distinct from disease in other regions and may reflect a previously observed trend toward an increased risk of subcortical lacunar infarcts in AAs. We hypothesized that extreme deep WMH volume (DWMV) or periventricular volume (PV) may also have a higher prevalence in AAs. Thus, we studied extreme CHS scores and extreme DWMV and PV in a healthy population enriched for cardiovascular disease risk factors. We imaged the brains of 593 subjects who were first-degree relatives of probands with early onset coronary disease prior to 60 years of age. WMHs were manually delineated on 3-tesla cranial MRI by a trained radiology reader; the location and volume of lesions were characterized using automated software. DWMV and PV were measured directly with automated software, and the CHS score was determined by a neuroradiologist. Volumes were characterized as being in the upper 25% versus lower 75% of total lesion volume. Volumes in the upper versus the remaining quartiles were examined for AA versus EA race using multiple logistic regression (generalized estimating equations adjusted for family relatedness) and adjusted for major vascular disease risk factors including age ≥55 years versus <55, sex, current smoking, obesity, hypertension, diabetes and low-density lipoprotein >160 mg/dl. Participants were 58% women and 37% AAs, with a mean age of 51.5 ± 11.0 years (range, 29-74 years). AAs had significantly higher odds of having extreme DWMVs (odds ratio, OR, 1.8; 95% confidence interval, CI, 1.2-2.9; p = 0.0076) independently of age, sex, hypertension and all other risk factors. AAs also had significantly higher odds of having extreme CHS scores ≥3 (OR, 1.3; 95% CI, 1.1-3.6; p = 0.025). Extreme PV was not significantly associated with AA race (OR, 1.3; 95% CI, 0.81-2.1; p = 0.26). AAs from families with early-onset cardiovascular disease are more likely to have extreme DWMVs (a subclinical form of cerebrovascular disease) and an extreme CHS score, but not extreme PV, independently of age and other cardiovascular disease risk factors. These findings suggest that this AA population is at an increased risk for DWMV and may be at an increased risk for future subcortical stroke. Longitudinal studies are required to see if DWMV is predictive of symptomatic subcortical strokes in this population. © 2014 S. Karger AG, Basel.

Melanocortin agonism as a viable strategy to control alveolar bone loss induced by oral infection.

PubMed

Madeira, Mila F M; Queiroz-Junior, Celso M; Montero-Melendez, Trinidad; Werneck, Silvia M C; Corrêa, Jôice D; Soriani, Frederico M; Garlet, Gustavo P; Souza, Daniele G; Teixeira, Mauro M; Silva, Tarcilia A; Perretti, Mauro

2016-12-01

Alveolar bone loss is a result of an aggressive form of periodontal disease (PD) associated with Aggregatibacter actinomycetemcomitans (Aa) infection. PD is often observed with other systemic inflammatory conditions, including arthritis. Melanocortin peptides activate specific receptors to exert antiarthritic properties, avoiding excessing inflammation and modulating macrophage function. Recent work has indicated that melanocortin can control osteoclast development and function, but whether such protection takes place in infection-induced alveolar bone loss has not been investigated. The purpose of this study was to evaluate the role of melanocortin in Aa-induced PD. Mice were orally infected with Aa and treated with the melanocortin analog DTrp 8 -γMSH or vehicle daily for 30 d. Then, periodontal tissue was collected and analyzed. Aa-infected mice treated with DTrp 8 -γMSH presented decreased alveolar bone loss and a lower degree of neutrophil infiltration in the periodontium than vehicle-treated animals; these actions were associated with reduced periodontal levels of TNF-α, IFN-γ, and IL-17A. In vitro experiments with cells differentiated into osteoclasts showed that osteoclast formation and resorptive activity were attenuated after treatment with DTrp 8 -γMSH. Thus, melanocortin agonism could represent an innovative way to tame overexuberant inflammation and, at the same time, preserve bone physiology, as seen after Aa infection.-Madeira, M. F. M., Queiroz-Junior, C. M., Montero-Melendez, T., Werneck, S. M. C., Corrêa, J. D., Soriani, F. M., Garlet, G. P., Souza, D. G., Teixeira, M. M., Silva, T. A., Perretti, M. Melanocortin agonism as a viable strategy to control alveolar bone loss induced by oral infection. © FASEB.

Omentin Polymorphism and its Relations to Bone Mineral Density in Women.

PubMed

Boron, Dariusz; Czerny, Boguslaw; Bartkowiak-Wieczorek, Joanna; Sieron, Dominik; Wolski, Hubert

2015-04-01

Recognition of different genetic variants underlying development of osteoporosis would make it possible to administer individual symptomatic treatment as well as early prophylactics of osteoporosis. The aim of the study was to evaluate frequency of polymorphism 326A/T of gene ITLN-1 and assessment of its relations with the clinical parameters of osseous turnover and degree of postmenopausal osteoporosis. The study included 800 women at the postmenopausal (505) and reproductive (295) age throughout Wielkopolska region in Poland. The postmenopausal group included women with osteoporosis and osteopenia and the healthy ones. Women at the reproductive age were healthy. Frequency of the tested gene polymorphism was evaluated in the group where BMD was marked and in the control group. The analysis of the polymorphism A326T of gene ITLN-1 showed that in healthy postmenopausal female with genotype AA birth weight, BMD L2-L4 YA (%) and BMD L2-L4 AM (%) were significantly higher (BMD-bone mineral density; L2-L4-- lumbar vertebrae no 2, 4; YA--peak adult bone mass; AM--age-matched bone mass). In women with osteopenia BMD L2-L4 YA (%) and BMD L2-L4 AM (%) were significantly higher in women with genotype AA, but BMD L2-L4 was significantly higher in women with genotype TT. In women with osteoporosis with genotype AA T-score was significantly higher, but BMD L2-L4 and BMD L2-L4 YA (%) were significantly lower in this group. BMD L2-L4 AM (%) was significantly higher in women with AA genotype. In women with osteoporosis and osteopenia homozygous AA genotype may predispose to lower BMD in the lumbar spine. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

Effects of alpha lipoic acid, ascorbic acid-6-palmitate, and fish oil on the glutathione, malonaldehyde, and fatty acids levels in erythrocytes of streptozotocin induced diabetic male rats.

PubMed

Yilmaz, Okkeş; Ozkan, Yusuf; Yildirim, Mehmet; Oztürk, A Ihsan; Erşan, Yasemin

2002-01-01

In this research, it has been aimed to evaluate the improvement effects of alpha lipoic acid (ALA), ascorbic acid-6-palmitate (AA6P), fish oil (FO), and their combination (COM) on some biochemical properties in erythrocytes of streptozotocin (STZ)-induced diabetic male rats. According to experimental results, glutathione (GSH) level in erythrocytes decreased in diabetes (P < 0.01), D + ALA, and D + AA6P groups (P < 0.001). Malonaldehyde (MA) level increased in diabetes (P < 0.05), D + FO, and D + COM groups (P < 0.001), but its level in D + AA6P and D + ALA groups was lower in diabetes group (P < 0.01). Total lipid level in diabetes and diabetes plus antioxidant administered groups were higher than control. Total cholesterol level was high in diabetes and D + ALA groups (P < 0.05), but its level reduced in D + FO compared to control and diabetes groups, P < 0.05, < 0.001, respectively. Total triglyceride (TTG) level was high in the D + ALA (P < 0.05) and D + COM (P < 0.001) groups. In contrast, TTG level in blood of diabetes group was higher than diabetes plus antioxidant and FO administered groups (P < 0.001). According to gas chromatography analysis results, while the palmitic acid raised in diabetes group (P < 0.05), stearic acid in D + FO, D + ALA, and diabetes groups was lower than control (P < 0.05), oleic acid reduced in D + COM and D + FO groups, but its level raised in D + AA6P and D + ALA groups (P < 0.01). As the linoleic acid (LA) elevated in ALA + D, D + AA6P, and diabetes groups, linolenic acid level in diabetes, D + AA6P, and D + FO groups was lower than control (P < 0.001). Arachidonic acid (AA) decreased in D + ALA, D+ AA6P, and diabetes groups (P < 0.01), but its level in D + COM and D + FO was higher than control (P < 0.05). Docosahexaenoic acid (DHA) increased in D + AA6P and D + COM (P < 0.05). While the total saturated fatty acid level raised in diabetes group, its level reduced in D + ALA and D + FO groups (P < 0.05). In contrast, total unsaturated fatty acid level in D + ALA and D + FO groups was higher than control (P < 0.05). In conclusion, present data have confirmed that the combination of the ALA, AA6P, and FO have improvement effects on the recycling of GSSG to reduced GSH in erythrocytes of diabetic rats, and in addition to this, oxidative stress was suppressed by ALA and AA6P, and unsaturated fatty acid degree was raised by the effects of ALA and FO. Copyright 2002 Wiley-Liss, Inc.

Health Science Education

ERIC Educational Resources Information Center

Hartsell, Horace C.

1970-01-01

Briefly describes several instructional techniques including computer aid simulation of the medical encounter, media-biased approaches for teaching doctor-patient relationships, and programed media for teaching decision-making to nursing students." (Author/AA)

Teleost growth factor independence (gfi) genes differentially regulate successive waves of hematopoiesis.

PubMed

Cooney, Jeffrey D; Hildick-Smith, Gordon J; Shafizadeh, Ebrahim; McBride, Paul F; Carroll, Kelli J; Anderson, Heidi; Shaw, George C; Tamplin, Owen J; Branco, Diana S; Dalton, Arthur J; Shah, Dhvanit I; Wong, Clara; Gallagher, Patrick G; Zon, Leonard I; North, Trista E; Paw, Barry H

2013-01-15

Growth Factor Independence (Gfi) transcription factors play essential roles in hematopoiesis, differentially activating and repressing transcriptional programs required for hematopoietic stem/progenitor cell (HSPC) development and lineage specification. In mammals, Gfi1a regulates hematopoietic stem cells (HSC), myeloid and lymphoid populations, while its paralog, Gfi1b, regulates HSC, megakaryocyte and erythroid development. In zebrafish, gfi1aa is essential for primitive hematopoiesis; however, little is known about the role of gfi1aa in definitive hematopoiesis or about additional gfi factors in zebrafish. Here, we report the isolation and characterization of an additional hematopoietic gfi factor, gfi1b. We show that gfi1aa and gfi1b are expressed in the primitive and definitive sites of hematopoiesis in zebrafish. Our functional analyses demonstrate that gfi1aa and gfi1b have distinct roles in regulating primitive and definitive hematopoietic progenitors, respectively. Loss of gfi1aa silences markers of early primitive progenitors, scl and gata1. Conversely, loss of gfi1b silences runx-1, c-myb, ikaros and cd41, indicating that gfi1b is required for definitive hematopoiesis. We determine the epistatic relationships between the gfi factors and key hematopoietic transcription factors, demonstrating that gfi1aa and gfi1b join lmo2, scl, runx-1 and c-myb as critical regulators of teleost HSPC. Our studies establish a comparative paradigm for the regulation of hematopoietic lineages by gfi transcription factors. Copyright © 2012 Elsevier Inc. All rights reserved.

Protein and amino acid supplementation in older humans.

PubMed

Fukagawa, Naomi K

2013-06-01

The aging process is a continuum throughout life and often associated with deterioration of body function as well as accumulation of chronic disabilities and of disease. The impact of nutritional status on morbidity and mortality is unquestioned. Malnutrition increases the risk for frailty and nutritional deficits can influence immune status, response to medical treatments and recovery from acute illnesses, including surgery. Health-promoting interventions implemented individually, such as exercise programs, preventive home visits, comprehensive geriatric evaluation and management, and attention to adequate nutrition with or without nutritional supplements, have been shown in separate studies to be both feasible and effective in reducing age-related deterioration. Protein and its constituent amino acids (AA) are key components of any healthy diet. Sarcopenia, the slow but progressive loss of lean muscle mass associated with advancing age, has been the focus of many studies but there is no clear-cut answer to the question of how to restrain the process. The more general question of how the requirements for protein and specific AA change with age continues to be investigated. A shift towards studying the efficacy and safety of specific AA or combination of AA that may sustain and/or enhance physiologic processes, ranging from specific tissue metabolism to overall function (e.g. exercise performance, immune function, cognition, and chronic disease development) has occurred. This review focuses on recent studies examining the use of specific AA or mixtures as supplements in the elderly and whether/how AA may assist in the maintenance of health and independence.

Venus - Lakshmi Region

NASA Technical Reports Server (NTRS)

1991-01-01

This Magellan image is centered at 55 degrees north latitude, 348.5 degrees longitude, in the eastern Lakshmi region of Venus. This image, which is of an area 300 kilometers (180 miles) in width and 230 kilometers (138 miles) in length, is a mosaic of orbits 458 through 484. The image shows a relatively flat plains region composed of many lava flows. The dark flows mostly likely represent smooth lava flows similar to 'pahoehoe' flows on Earth while the brighter lava flows are rougher flows similar to 'aa' flows on Earth. (The terms 'pahoehoe' and 'aa' refer to textures of lava with pahoehoe a smooth or ropey surface, and aa a rough, clinkery texture). The rougher flows are brighter because the rough surface returns more energy to the radar than the smooth flows. Situated on top of the lava flows are three dark splotches. Because of the thick Venusian atmosphere, the small impactors break up before they reached the surface. Only the fragments from the broken up impactor are deposited on the surface and these fragments produce the dark splotches in this image. The splotch at the far right (east) has a crater centered in it, indicating that the impactor was not completely destroyed during its journey through the atmosphere. The dark splotches in the center and to the far left in this image each represent an impactor that was broken up into small fragments that did not penetrate the surface to produce a crater. The dark splotch at the left has been modified by the wind. A southwest northeast wind flow has moved some of the debris making up the splotch to the northeast where it has piled up against some small ridges.

The correlation between TNF-α-308 gene polymorphism and susceptibility to cervical cancer.

PubMed

Li, Liping; Liu, Jie; Liu, Chunjing; Lu, Xianghui

2018-05-01

Tumor necrosis factor-α (TNF-α) is closely related to the occurrence of human cancers. Cervical cancer seriously affects female health. Therefore, our study aimed to investigate the correlation between the polymorphism of TNF-α-308 gene and susceptibility to cervical cancer. Whole blood was collected from 142 patients with cervical cancer and 150 healthy controls. PCR-RFLP was used to detect the polymorphism of TNF-α-308 and the correlation between polymorphism of TNF-α-308 and the susceptibility to cervical cancer was analyzed. The three genotypes of TNF-α-308 were GG, GA and AA, and the distributions of genotypes of TNF-α-308 were consistent with Hardy-Weinberg equilibrium in both cervical cancer group and control group. There were no significant differences in genotype and allele frequency between cervical cancer group and healthy control group (P>0.05). A/A genotype increased the risk of cervical cancer by 1.46 times with 95% confidence interval of 0.32-6.67. Different genotypes were not associated with tumor type (P>0.05). Different genotypes are correlated with cervical cancer TNM stages, tumor differentiation and lymph node metastasis. Proportion of GA+AA genotype in TNM stage III+IV group, low differentiation group and lymph node metastasis group were 28.1, 29.0 and 29.8%, respectively, which were significantly higher than those in stage I+II group, moderate/high differentiation group and non-lymph node metastasis group (P<0.05). The results suggested that TNF-α-308 gene polymorphism is associated with the degree of malignancy of cervical cancer. Female patients with A allele have higher malignant degree of cervical cancer.

Cell cycle arrest and biochemical changes accompanying cell death in harmful dinoflagellates following exposure to bacterial algicide IRI-160AA

NASA Astrophysics Data System (ADS)

Pokrzywinski, Kaytee L.; Tilney, Charles L.; Warner, Mark E.; Coyne, Kathryn J.

2017-03-01

Bacteria may play a role in regulating harmful algal blooms, but little is known about the biochemical and physiological changes associated with cell death induced by algicidal bacteria. Previous work characterized an algicidal exudate (IRI-160AA) produced by Shewanella sp. IRI-160 that is effective against dinoflagellates, while having little to no effect on other phytoplankton species in laboratory culture experiments. The objective of this study was to evaluate biochemical changes associated with cell death and impacts on the cell cycle in three dinoflagellate species (Prorocentrum minimum, Karlodinium veneficum and Gyrodinium instriatum) after exposure to IRI-160AA. In this study, IRI-160AA induced cell cycle arrest in all dinoflagellates examined. Several indicators for programmed cell death (PCD) that are often observed in phytoplankton in response to a variety of stressors were also evaluated. Cell death was accompanied by significant increases in DNA degradation, intra- and extracellular ROS concentrations and DEVDase (caspase-3 like) protease activity, which have been associated with PCD in other phytoplankton species. Overall, results of this investigation provide strong evidence that treatment with the bacterial algicide, IRI-160AA results in cell cycle arrest and induces biochemical changes consistent with stress-related cell death responses observed in other phytoplankton.

Cell cycle arrest and biochemical changes accompanying cell death in harmful dinoflagellates following exposure to bacterial algicide IRI-160AA

PubMed Central

Pokrzywinski, Kaytee L.; Tilney, Charles L.; Warner, Mark E.; Coyne, Kathryn J.

2017-01-01

Bacteria may play a role in regulating harmful algal blooms, but little is known about the biochemical and physiological changes associated with cell death induced by algicidal bacteria. Previous work characterized an algicidal exudate (IRI-160AA) produced by Shewanella sp. IRI-160 that is effective against dinoflagellates, while having little to no effect on other phytoplankton species in laboratory culture experiments. The objective of this study was to evaluate biochemical changes associated with cell death and impacts on the cell cycle in three dinoflagellate species (Prorocentrum minimum, Karlodinium veneficum and Gyrodinium instriatum) after exposure to IRI-160AA. In this study, IRI-160AA induced cell cycle arrest in all dinoflagellates examined. Several indicators for programmed cell death (PCD) that are often observed in phytoplankton in response to a variety of stressors were also evaluated. Cell death was accompanied by significant increases in DNA degradation, intra- and extracellular ROS concentrations and DEVDase (caspase-3 like) protease activity, which have been associated with PCD in other phytoplankton species. Overall, results of this investigation provide strong evidence that treatment with the bacterial algicide, IRI-160AA results in cell cycle arrest and induces biochemical changes consistent with stress-related cell death responses observed in other phytoplankton. PMID:28332589

Gene organization and primary structure of human hormone-sensitive lipase: possible significance of a sequence homology with a lipase of Moraxella TA144, an antarctic bacterium.

PubMed Central

Langin, D; Laurell, H; Holst, L S; Belfrage, P; Holm, C

1993-01-01

The human hormone-sensitive lipase (HSL) gene encodes a 786-aa polypeptide (85.5 kDa). It is composed of nine exons spanning approximately 11 kb, with exons 2-5 clustered in a 1.1-kb region. The putative catalytic site (Ser423) and a possible lipid-binding region in the C-terminal part are encoded by exons 6 and 9, respectively. Exon 8 encodes the phosphorylation site (Ser551) that controls cAMP-mediated activity and a second site (Ser553) that is phosphorylated by 5'-AMP-activated protein kinase. Human HSL showed 83% identity with the rat enzyme and contained a 12-aa deletion immediately upstream of the phosphorylation sites with an unknown effect on the activity control. Besides the catalytic site motif (Gly-Xaa-Ser-Xaa-Gly) found in most lipases, HSL shows no homology with other known lipases or proteins, except for a recently reported unexpected homology between the region surrounding its catalytic site and that of the lipase 2 of Moraxella TA144, an antarctic psychrotrophic bacterium. The gene of lipase 2, which catalyses lipolysis below 4 degrees C, was absent in the genomic DNA of five other Moraxella strains living at 37 degrees C. The lipase 2-like sequence in HSL may reflect an evolutionarily conserved cold adaptability that might be of critical survival value when low-temperature-mobilized endogenous lipids are the primary energy source (e.g., in poikilotherms or hibernators). The finding that HSL at 10 degrees C retained 3- to 5-fold more of its 37 degrees C catalytic activity than lipoprotein lipase or carboxyl ester lipase is consistent with this hypothesis. Images Fig. 5 PMID:8506334

Race, Genetic West African Ancestry, and Prostate Cancer Prediction by PSA in Prospectively Screened High-Risk Men

PubMed Central

Giri, Veda N.; Egleston, Brian; Ruth, Karen; Uzzo, Robert G.; Chen, David Y.T.; Buyyounouski, Mark; Raysor, Susan; Hooker, Stanley; Torres, Jada Benn; Ramike, Teniel; Mastalski, Kathleen; Kim, Taylor Y.; Kittles, Rick

2008-01-01

Introduction “Race-specific” PSA needs evaluation in men at high-risk for prostate cancer (PCA) for optimizing early detection. Baseline PSA and longitudinal prediction for PCA was examined by self-reported race and genetic West African (WA) ancestry in the Prostate Cancer Risk Assessment Program, a prospective high-risk cohort. Materials and Methods Eligibility criteria are age 35–69 years, FH of PCA, African American (AA) race, or BRCA1/2 mutations. Biopsies have been performed at low PSA values (<4.0 ng/mL). WA ancestry was discerned by genotyping 100 ancestry informative markers. Cox proportional hazards models evaluated baseline PSA, self-reported race, and genetic WA ancestry. Cox models were used for 3-year predictions for PCA. Results 646 men (63% AA) were analyzed. Individual WA ancestry estimates varied widely among self-reported AA men. “Race-specific” differences in baseline PSA were not found by self-reported race or genetic WA ancestry. Among men with ≥ 1 follow-up visit (405 total, 54% AA), three-year prediction for PCA with a PSA of 1.5–4.0 ng/mL was higher in AA men with age in the model (p=0.025) compared to EA men. Hazard ratios of PSA for PCA were also higher by self-reported race (1.59 for AA vs. 1.32 for EA, p=0.04). There was a trend for increasing prediction for PCA with increasing genetic WA ancestry. Conclusions “Race-specific” PSA may need to be redefined as higher prediction for PCA at any given PSA in AA men. Large-scale studies are needed to confirm if genetic WA ancestry explains these findings to make progress in personalizing PCA early detection. PMID:19240249

Exploration of the utility of ancestry informative markers for genetic association studies of African Americans with type 2 diabetes and end stage renal disease.

PubMed

Keene, Keith L; Mychaleckyj, Josyf C; Leak, Tennille S; Smith, Shelly G; Perlegas, Peter S; Divers, Jasmin; Langefeld, Carl D; Freedman, Barry I; Bowden, Donald W; Sale, Michèle M

2008-09-01

Admixture and population stratification are major concerns in genetic association studies. We wished to evaluate the impact of admixture using empirically derived data from genetic association studies of African Americans (AA) with type 2 diabetes (T2DM) and end-stage renal disease (ESRD). Seventy ancestry informative markers (AIMs) were genotyped in 577 AA with T2DM-ESRD, 596 AA controls, 44 Yoruba Nigerian (YRI) and 39 European American (EA) controls. Genotypic data and association results for eight T2DM candidate gene studies in our AA population were included. Ancestral estimates were calculated using FRAPPE, ADMIXMAP and STRUCTURE for all AA samples, using varying numbers of AIMs (25, 50, and 70). Ancestry estimates varied significantly across all three programs with the highest estimates obtained using STRUCTURE, followed by ADMIXMAP; while FRAPPE estimates were the lowest. FRAPPE estimates were similar using varying numbers of AIMs, while STRUCTURE estimates using 25 AIMs differed from estimates using 50 and 70 AIMs. Female T2DM-ESRD cases showed higher mean African proportions as compared to female controls, male cases, and male controls. Age showed a weak but significant correlation with individual ancestral estimates in AA cases (r2 = 0.101; P = 0.019) and in the combined set (r2 = 0.131; P = 3.57 x 10(-5)). The absolute difference between frequencies in parental populations, absolute delta, was correlated with admixture impact for dominant, additive, and recessive genotypic models of association. This study presents exploratory analyses of the impact of admixture on studies of AA with T2DM-ESRD and supports the use of ancestral proportions as a means of reducing confounding effects due to admixture.

Exploration of the utility of ancestry informative markers for genetic association studies of African Americans with type 2 diabetes and end stage renal disease

PubMed Central

Keene, Keith L.; Mychaleckyj, Josyf C.; Leak, Tennille S.; Smith, Shelly G.; Perlegas, Peter S.; Divers, Jasmin; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.; Sale, Michèle M.

2009-01-01

Admixture and population stratification are major concerns in genetic association studies. We wished to evaluate the impact of admixture using empirically derived data from genetic association studies of African Americans (AA) with type 2 diabetes (T2DM) and end-stage renal disease (ESRD). Seventy ancestry informative markers (AIMs) were genotyped in 577 AA with T2DM-ESRD, 596 AA controls, 44 Yoruba Nigerian (YRI) and 39 European American (EA) controls. Genotypic data and association results for eight T2DM candidate gene studies in our AA population were included. Ancestral estimates were calculated using FRAPPE, ADMIXMAP and STRUCTURE for all AA samples, using varying numbers of AIMs (25, 50, and 70). Ancestry estimates varied significantly across all three programs with the highest estimates obtained using STRUCTURE, followed by ADMIXMAP; while FRAPPE estimates were the lowest. FRAPPE estimates were similar using varying numbers of AIMs, while STRUCTURE estimates using 25 AIMs differed from estimates using 50 and 70 AIMs. Female T2DM-ESRD cases showed higher mean African proportions as compared to female controls, male cases, and male controls. Age showed a weak but significant correlation with individual ancestral estimates in AA cases (r2=0.101; P=0.019) and in the combined set (r2=0.131; P=3.57×10−5). The absolute difference between frequencies in parental populations, absolute δ, was correlated with admixture impact for dominant, additive, and recessive genotypic models of association. This study presents exploratory analyses of the impact of admixture on studies of AA with T2DM-ESRD and supports the use of ancestral proportions as a means of reducing confounding effects due to admixture. PMID:18654799

Microstructural development from interdiffusion and reaction between U–Mo and AA6061 alloys annealed at 600° and 550 °C

DOE PAGES

Perez, E.; Keiser, D. D.; Sohn, Y. H.

2016-05-10

The U.S. Material Management and Minimization Reactor Conversion Program is developing low enrichment fuel systems encased in Al-alloy for use in research and test reactors. Monolithic fuel plates have local regions where the Usingle bondMo fuel plate may come into contact with the Al-alloy 6061 (AA6061) cladding. This results in the development of interdiffusion zones with complex microstructures with multiple phases. In this study, the microstructural development of diffusion couples, U–7 wt%Mo, U–10 wt%Mo, and U–12 wt%Mo vs. AA6061, annealed at 600 °C for 24 h and at 550 °C for 1, 5, and 20 h, were analyzed by scanningmore » electron microscopy with x-ray energy dispersive spectroscopy. The microstructural development and kinetics were compared to diffusion couples U–Mo vs. high purity Al and binary Al–Si alloys. As a result, the diffusion couples developed complex interaction regions where phase development was influenced by the alloying additions of the AA6061.« less

Theoretical Implications of Gender, Power, and Sexual Scripts for HIV Prevention Programs Aimed at Young, Substance-Using African-American Women.

PubMed

Hill, Mandy; Granado, Misha; Stotts, Angela

2017-12-01

HIV continues to be a major public health problem for African-American (AA) women, and the burden of new cases to our society is significant because each case is at risk of infecting others. Substance use worsens the risk of HIV transmission to AA women. We provide specific recommendations to move the concept of tailoring HIV prevention interventions for substance users forward by focusing on young, sexually active, substance-using AA women and applying a culturally relevant revision to existing theoretical frameworks to include the Sexual Script Theory and the Theory of Gender and Power. We encourage use of these theories to guide adaptation of interventions to demonstrate efficacy within this hard-to-reach population. Consistent use of theories designed to exploit powerlessness and sexual scripts as barriers to adoption of protective sexual behaviors has potential to permeate sexual and substance use networks among African-Americans. This recommendation is being made because this theoretical framework has not been used in HIV prevention interventions targeting young, sexually active, substance-using AA women.

Empowerment: A Framework to Develop Advocacy in African American Grandmothers Providing Care for Their Grandchildren

PubMed Central

Carr, Gloria F.

2011-01-01

Purpose. Based on a review of the literature, this paper presents a unique and innovative model that offers an empowerment framework, which may be used to develop advocacy in African American (AA) grandmother caregivers. This proposed framework centers on education as a catalyst to the empowerment process in these grandmothers. Application of this model has potential to guide the practice of healthcare providers as they assist these caregivers in managing their own lives. Methodology. Various empowerment definitions and research were used to develop this empowerment framework. Discussion. This framework offers an empowerment education program for AA grandmothers providing care for their grandchildren on topics that they feel are necessary to appropriately care for themselves and their grandchildren. Outcomes of this empowerment education are to develop skills within these grandmothers so that they will be able to advocate for themselves, their grandchildren, and others within their communities. This education will ultimately produce skillful AA grandmothers who will develop abilities to empower themselves and other AA grandmothers who are in similar circumstances. PMID:21994894

[Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

PubMed

Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

2010-12-01

The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

Design and Real-Time Implementation of a Baseband LPC Coder for Speech Transmission over 9600 BPS Noisy Channels. Volume II. Programming Listings.

DTIC Science & Technology

1980-02-01

cwc N (w~ mm. IDmm m w. C. msite &C-ew %a~m MCI I Di . m1a.2 ,% v oa m.1] W.k1i . . 13.M mmm r, q.W.3.44. I&1242 %D2 1.J1 M.1. ItP a b nNM - f .M2 47 4...a a a a a.a a.a0 IBM a aa a11,11 a .0 a1 . U q M4 MS K IaI u C% A4 U u0 1. w4 . N MKV Ia IO1 U a,". 44 4 .4 N m N N N N N6 N N N (M M M M U M M M CD

Identification of Genetic Co-Modifiers in Shwachman-Diamond Syndrome

DTIC Science & Technology

2012-08-01

pancreatic insufficient, and bone marrow failure.5 Neutropenia characterizes the primary defect in SDS, however, the degree of neutropenia can fluctuate and...factors for myelodysplasias, leukemias and death from infection among patients with congenital neutropenia . Experience of the French Severe Chronic... Neutropenia Study Group. Haematologica. 2005;90:45-53. 3. Rosenberg PS, Alter BP, Bolyard AA, et al. The incidence of leukemia and mortality from

Complete and draft genome sequences of six members of the Aquificales.

PubMed

Reysenbach, Anna-Louise; Hamamura, N; Podar, M; Griffiths, E; Ferreira, S; Hochstein, R; Heidelberg, J; Johnson, J; Mead, D; Pohorille, A; Sarmiento, M; Schweighofer, K; Seshadri, R; Voytek, M A

2009-03-01

The Aquificales are widespread in marine and terrestrial hydrothermal environments. Here, we report the complete and draft genome sequences of six new members of the Aquificales: two marine species, Persephonella marina strain EX-H1 and Hydrogenivirga strain 128-5-R1 (from the East Pacific Rise, 9 degrees 50.3'N, 104 degrees 17.5'W, and the Eastern Lau Spreading Center, 176 degrees 11.5'W, 20 degrees 45.8'S, respectively), and four terrestrial isolates, Sulfurihydrogenibium azorense strain Az-Fu1, Sulfurihydrogenibium yellowstonense strain SS-5, and Sulfurihydrogenibium strain Y03AOP1 (from Furnas, Azores, Portugal, and Calcite Springs and Obsidian Pool in Yellowstone National Park, United States, respectively), and the only thermoacidophilic isolate, Hydrogenobaculum strain Y04AAS1 (from a stream adjacent to Obsidian Pool). Significant differences among the different species exist that include nitrogen metabolism, hydrogen utilization, chemotaxis, and signal transduction, providing insights into their ecological niche adaptations.

Phenindamine overdose

MedlinePlus

... Goldfrank's Toxicologic Emergencies . 10th ed. New York, NY: McGraw Hill-Medical; 2015:chap 49. Monte AA, Hoppe ... urac.org). URAC's accreditation program is an independent audit to verify that A.D.A.M. follows ...

Pheniramine overdose

MedlinePlus

... Goldfrank's Toxicologic Emergencies . 10th ed. New York, NY: McGraw Hill-Medical; 2015:chap 49. Monte AA, Hoppe ... urac.org). URAC's accreditation program is an independent audit to verify that A.D.A.M. follows ...

75 FR 21981 - Energy Conservation Program: Energy Conservation Standards for Residential Water Heaters, Direct...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-27

... DEPARTMENT OF ENERGY 10 CFR Part 430 [Docket Number EE-2006-BT-STD-0129] RIN 1904-AA90 Energy Conservation Program: Energy Conservation Standards for Residential Water Heaters, Direct Heating Equipment, and Pool Heaters Correction In rule document 2010-7611 beginning on page 20112 in the issue of Friday...

A Distance Blended Learning Program to Upgrade the Clinical Competence of District Non-doctor Anesthesia Providers in Nepal.

PubMed

Shah, Shristi; Knoble, Stephen; Ross, Oliver; Pickering, Stephen

2017-12-01

Across Nepal, anesthesia at a district level is provided mostly by non-doctor anesthesia providers (anesthesia assistants-AAs). Nepal's Government recognized the need to sustain competence with continuous professional development and to upgrade 6-month trained working AAs to professional equivalence with the new national standard of 12-month training. As they are essential district health workers and AA clinical training sites are full, an innovative distance blended learning, competency-based, upgrade 1-year course was developed and conducted in 2014-2017 for two batches. The course content was developed over 18 months by a team of Nepali and overseas AA training experts. The 1-year course started with a refresher course, continued with tablet-based 12-month self-learning modules and clinical case logs, regular educational mentor communication, midcourse 2-week contact time in an AA training site, regular text messaging and ended with clinical examination and multiple-choice questions. Tablet content included 168 new case studies, pre- and posttests, video lectures, matching exercises and a resource library. All module work and logged clinical cases were uploaded centrally, where clinical mentors were able to review work. Clinical skills were upgraded, as needed, through direct clinical contact midway through the course. Quantitative and qualitative course assessments were included. Fourteen working AAs in first batch and eight working AAs in second batch from district, zonal and mission hospitals across Nepal were enrolled. All remained working at their hospitals throughout the course, and there were no significant tablet problems inhibiting course completion. Twenty-one AAs completed all modules successfully with time required for module completion averaging 19.2 h (range 11.2-32). One AA left the course after 3 months with a personal problem. Subjectively, AAs felt that the obstetric and pediatric modules were more difficult; lowest marks were objectively seen in the airway module. Clinical mentors averaged 8.2 h mentoring review work per module with direct student communication of 2.9 h per module per month. Participants logged a total of 5473 clinical cases, ranging between 50 and 788 cases each. Complications were recorded; outcomes were good. Challenges were the national IT infrastructure making data synchronization difficult and the lack of clinical exposure at some AA's hospitals. Nineteen AAs attended the final examination, and all passed. Two AAs withdrew before the final examination period due to personal and logistic reasons. This is the first use of distance blended learning to upgrade district health workers in Nepal and perhaps for non-doctor anesthesia providers globally. Key success factors were motivated students, cultural and contextualized clinical content, good educational mentoring relationships with regular communication, central IT and motivational support, and face-to-face midcourse clinical contact time.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Branched-chain amino acids to tyrosine ratio value as a potential prognostic factor for hepatocellular carcinoma.

PubMed

Ishikawa, Toru

2012-05-07

The prognosis of hepatocellular carcinoma (HCC) depends on tumor extension as well as hepatic function. Hepatic functional reserve is recognized as a factor affecting survival in the treatment of HCC; the Child-Pugh classification system is the most extensively used method for assessing hepatic functional reserve in patients with chronic liver disease, using serum albumin level to achieve accurate assessment of the status of protein metabolism. However, insufficient attention has been given to the status of amino acid (AA) metabolism in chronic liver disease and HCC. Fischer's ratio is the molar ratio of branched-chain AAs (BCAAs: leucine, valine, isoleucine) to aromatic AAs (phenylalanine, tyrosine) and is important for assessing liver metabolism, hepatic functional reserve and the severity of liver dysfunction. Although this ratio is difficult to determine in clinical situations, BCAAs/tyrosine molar concentration ratio (BTR) has been proposed as a simpler substitute. BTR correlates with various liver function examinations, including markers of hepatic fibrosis, hepatic blood flow and hepatocyte function, and can thus be considered as reflecting the degree of hepatic impairment. This manuscript examines the literature to clarify whether BTR can serve as a prognostic factor for treatment of HCC.

Experiment-based modelling of grain boundary β-phase (Mg2Al3) evolution during sensitisation of aluminium alloy AA5083.

PubMed

Zhang, R; Steiner, M A; Agnew, S R; Kairy, S K; Davies, C H J; Birbilis, N

2017-06-07

An empirical model for the evolution of β-phase (Mg 2 Al 3 ) along grain boundaries in aluminium alloy AA5083 (Al-Mg-Mn) during isothermal exposures is proposed herein. Developing a quantitative understanding of grain boundary precipitation is important to interpreting intergranular corrosion and stress corrosion cracking in this alloy system. To date, complete ab initio models for grain boundary precipitation based upon fundamental principles of thermodynamics and kinetics are not available, despite the critical role that such precipitates play in dictating intergranular corrosion phenomena. Empirical models can therefore serve an important role in advancing the understanding of grain boundary precipitation kinetics, which is an approach applicable beyond the present context. High resolution scanning electron microscopy was to quantify the size and distribution of β-phase precipitates on Ga-embrittled intergranular fracture surfaces of AA5083. The results are compared with the degree of sensitisation (DoS) as judged by nitric acid mass loss testing (ASTM-G67-04), and discussed with models for sensitisation in 5xxx series Al-alloys. The work herein allows sensitisation to be quantified from an unambiguous microstructural perspective.

In vivo encapsulation of nucleic acids using an engineered nonviral protein capsid.

PubMed

Lilavivat, Seth; Sardar, Debosmita; Jana, Subrata; Thomas, Geoffrey C; Woycechowsky, Kenneth J

2012-08-15

In Nature, protein capsids function as molecular containers for a wide variety of molecular cargoes. Such containers have great potential for applications in nanotechnology, which often require encapsulation of non-native guest molecules. Charge complementarity represents a potentially powerful strategy for engineering novel encapsulation systems. In an effort to explore the generality of this approach, we engineered a nonviral, 60-subunit capsid, lumazine synthase from Aquifex aeolicus (AaLS), to act as a container for nucleic acid. Four mutations were introduced per subunit to increase the positive charge at the inner surface of the capsid. Characterization of the mutant (AaLS-pos) revealed that the positive charges lead to the uptake of cellular RNA during production and assembly of the capsid in vivo. Surprisingly, AaLS-pos capsids were found to be enriched with RNA molecules approximately 200-350 bases in length, suggesting that this simple charge complementarity approach to RNA encapsulation leads to both high affinity and a degree of selectivity. The ability to control loading of RNA by tuning the charge at the inner surface of a protein capsid could illuminate aspects of genome recognition by viruses and pave the way for the development of improved RNA delivery systems.

Athletic trainers' familiarity with and perceptions of academic accommodations in secondary school athletes after sport-related concussion.

PubMed

Williams, Richelle M; Welch, Cailee E; Parsons, John T; McLeod, Tamara C Valovich

2015-03-01

Sport-related concussion can affect athletes' sport participation and academic success. With the recent emphasis on cognitive rest, student-athletes may benefit from academic accommodations (AA) in the classroom; however, athletic trainers' (ATs') perceived familiarity with, and use of, AA is unknown. To assess secondary school ATs' perceived familiarity with, attitudes and beliefs about, and incorporation of AA for student-athletes after sport-related concussion. A secondary purpose was to determine whether employment status altered familiarity and use of AA. Cross-sectional study. Online survey. Of 3286 possible respondents, 851 secondary school ATs accessed the survey (response rate = 25.9%; 308 men [36.2%], 376 women [44.2%], 167 respondents [19.6%] with sex information missing; age = 37.3 ± 10.1 years). Participants were solicited via e-mail to complete the Beliefs, Attitudes and Knowledge Following Pediatric Athlete Concussion among Athletic Trainers employed in the secondary school setting (BAKPAC-AT) survey. The BAKPAC-AT assessed ATs' perceived familiarity, perceptions, and roles regarding 504 plans, Individualized Education Programs (IEPs), and returning student-athletes to the classroom. Independent variables were employment status (full time versus part time), employment model (direct versus outreach), years certified, and years of experience in the secondary school setting. The dependent variables were participants' responses to the AA questions. Spearman rank-correlation coefficients were used to assess relationships and Mann-Whitney U and χ(2) tests (P < .05) were used to identify differences. Respondents reported that approximately 41% of the student-athletes whose sport-related concussions they managed received AA. Respondents employed directly by the school were more familiar with 504 plans (P < .001) and IEPs (P < .001) and had a greater belief that ATs should have a role in AA. Both the number of years certified and the years of experience at the secondary school were significantly correlated with perceived familiarity regarding 504 plans and IEPs. The ATs employed directly by secondary schools and those with more experience as secondary school ATs were more familiar with AA. Understanding AA is important for all ATs because cognitive rest and "return to learn" are becoming more widely recommended in concussion management.

Theoretical approaches for dynamical ordering of biomolecular systems.

PubMed

Okumura, Hisashi; Higashi, Masahiro; Yoshida, Yuichiro; Sato, Hirofumi; Akiyama, Ryo

2018-02-01

Living systems are characterized by the dynamic assembly and disassembly of biomolecules. The dynamical ordering mechanism of these biomolecules has been investigated both experimentally and theoretically. The main theoretical approaches include quantum mechanical (QM) calculation, all-atom (AA) modeling, and coarse-grained (CG) modeling. The selected approach depends on the size of the target system (which differs among electrons, atoms, molecules, and molecular assemblies). These hierarchal approaches can be combined with molecular dynamics (MD) simulation and/or integral equation theories for liquids, which cover all size hierarchies. We review the framework of quantum mechanical/molecular mechanical (QM/MM) calculations, AA MD simulations, CG modeling, and integral equation theories. Applications of these methods to the dynamical ordering of biomolecular systems are also exemplified. The QM/MM calculation enables the study of chemical reactions. The AA MD simulation, which omits the QM calculation, can follow longer time-scale phenomena. By reducing the number of degrees of freedom and the computational cost, CG modeling can follow much longer time-scale phenomena than AA modeling. Integral equation theories for liquids elucidate the liquid structure, for example, whether the liquid follows a radial distribution function. These theoretical approaches can analyze the dynamic behaviors of biomolecular systems. They also provide useful tools for exploring the dynamic ordering systems of biomolecules, such as self-assembly. This article is part of a Special Issue entitled "Biophysical Exploration of Dynamical Ordering of Biomolecular Systems" edited by Dr. Koichi Kato. Copyright © 2017 Elsevier B.V. All rights reserved.

75 FR 38537 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-02

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11960, AA-12011, AA-12010, AA-11963, AA-11974, AA-11999, AA-12019, AA-12000, AA-12001, AA-12002, AA-11975, AA-11998, AA-11997, AA-11976, AA-11966, AA-11965, AA-12009, AA-12007, AA-12008, AA-11955, AA-11953, AA-11954, AA-12006, AA-11945, AA...

Making Behavior Change Interventions Available to Young African American Women: Development and Feasibility of an eHealth Lifestyle Program.

PubMed

Staffileno, Beth A; Tangney, Christy C; Fogg, Louis; Darmoc, Rebecca

2015-01-01

Less is known about young African American (AA) women, largely because the young are hard to reach. Traditional approaches to behavior changes interventions impose several challenges, especially for AA women at risk for developing hypertension. This feasibility study describes the process of transforming a face-to-face lifestyle change intervention into a Web-based platform (eHealth) accessible by iPads, iPhones, smartphones, and personal computers. Four sequential phases were conducted using elements of formative evaluation and quantitative analysis. A convenience sample of AA women, aged 18 to 45 years, with self-reported prehypertension and regular access to the Internet were eligible to participate. Eleven women involved in phase 1 expressed that they (1) currently use the Internet to retrieve health-related information, (2) prefer to use the Internet rather than face-to-face contact for nonserious conditions, (3) need convenience and easily accessible health-related interventions, and (4) are amenable to the idea of an eHealth lifestyle modification program. During phase 2, learning modules derived from printed manuals were adapted and compressed for a Web audience. The modules were designed to present evidence-based content but allowed for tailoring and individualization according to the needs of the target population. During phase 3, 8 women provided formative information concerning appeal and usability of the eHealth program in relation to delivery, visual quality, interactivity, and engagement. Phase 4 involved 8 women beta testing the 12-week program, with a 63% completion rate. Most of the women agreed that the program and screens opened with ease, the functions on the screens did what they were supposed to do, and the discussion board was easy to access. Program completion was greater for physical activity compared with dietary content. This study outlines a step-by-step process for transforming face-to-face content into a Web-based platform, which, importantly, can serve as a template for promoting other health behaviors.

75 FR 51098 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-18

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11956, AA-11991, AA-11992, AA-11983, AA-11990, AA-11962, AA-11946, AA-11947, AA-11964, AA-11951, AA-11989, AA-11952, AA-11959, AA-11988, AA-11948, AA-11949, AA-11980, AA-11985, AA-11950, AA-11986, AA-11981, AA-11982, AA-12004, AA-12005; LLAK...

Potential for Using Acetic Acid Plus Pear Ester Combination Lures to Monitor Codling Moth in an SIT Program.

PubMed

Judd, Gary J R

2016-11-25

Studies were conducted in commercial apple orchards in British Columbia, Canada, to determine whether lures combining ethyl-( E , Z )-2,4-decadienoate, pear ester (PE), with either acetic acid (AA) or sex pheromone, ( E , E )-8,10-dodecadien-1-ol (codlemone), might improve monitoring of codling moth, Cydia pomonella (L.), in an area-wide programme integrating sterile insect technology (SIT) and mating disruption (MD). Catches of sterile and wild codling moths were compared in apple orchards receiving weekly delivery of sterile moths (1:1 sex ratio) using white delta traps baited with either AA or PE alone, and in combination. Sterile and wild codling moths responded similarly to these kairomone lures. For each moth sex and type (sterile and wild), AA-PE lures were significantly more attractive than AA or PE alone. Bisexual catches with AA-PE lures were compared with those of commercial bisexual lures containing 3 mg of codlemone plus 3 mg of PE (Pherocon CM-DA Combo lure, Trécé Inc., Adair, OK, USA), and to catches of males with standard codlemone-loaded septa used in SIT (1 mg) and MD (10 mg) programmes, respectively. CM-DA lures caught the greatest number of sterile and wild male moths in orchards managed with SIT alone, or combined with MD, whereas AA-PE lures caught 2-3× more females than CM-DA lures under both management systems. Sterile to wild (S:W) ratios for male versus female moths in catches with AA-PE lures were equivalent, whereas in the same orchards, male S:W ratios were significantly greater than female S:W ratios when measured with CM-DA lures. Male S:W ratios measured with CM-DA lures were similar to those with codlemone lures. CM-DA and codlemone lures appear to overestimate S:W ratios as measured by AA-PE lures, probably by attracting relatively more sterile males from long range. Using AA-PE lures to monitor codling moths in an SIT programme removes fewer functional sterile males and reduces the need for trap maintenance compared with using codlemone lures. AA-PE lures allow detection of wild female moths that may measure damage potential more accurately than detection of wild males. The short-range activity of AA-PE lures compared with that of codlemone-based lures appears to improve the ability to measure S:W ratios and the impact of SIT on population control near the site where wild moths are trapped.

Physics of the Cosmos Program Analysis Group (PhysPAG) Report

NASA Astrophysics Data System (ADS)

Nousek, John A.

2015-01-01

The Physics of the Cosmos Program Analysis Group (PhysPAG) serves as a forum for soliciting and coordinating input and analysis from the scientific community in support of the PCOS program objectives. I will outline the activities of the PhysPAG over the past year, since the last meeting during the AAS meeting in National Harbor, and mention the activities of the PhysPAG related Scientific Interest Groups.

NASA Alumni League Dialogue

NASA Image and Video Library

2011-03-04

Former NASA Administrator James Beggs smiles during a dialogue on the future of the space program, Friday, March 4, 2011, at NASA Headquarters in Washington. Beggs was NASA's sixth administrator serving from July 1981 to December 1985. The dialogue was part of the program “The State of the Agency: NASA Future Programs Presentation” sponsored by the NASA Alumni League with support from the AAS, AIAA, CSE and WIA.Photo Credit: (NASA/Paul E. Alers)

75 FR 26784 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-12

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11973, AA-11993, AA-11968, AA-11972, AA-12018, AA-12013, AA-12014, AA-12015, AA-12016, AA-12017, AA-11984, AA-11994, AA-11995, AA-11996, AA-12003, AA-12012, AA-11967, AA-12020, AA-12021; LLAK-962000- L14100000-HY0000-P] Alaska Native Claims...

AAS Oral History Project

NASA Astrophysics Data System (ADS)

Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

2016-06-01

Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

CG2AA: backmapping protein coarse-grained structures.

PubMed

Lombardi, Leandro E; Martí, Marcelo A; Capece, Luciana

2016-04-15

Coarse grain (CG) models allow long-scale simulations with a much lower computational cost than that of all-atom simulations. However, the absence of atomistic detail impedes the analysis of specific atomic interactions that are determinant in most interesting biomolecular processes. In order to study these phenomena, it is necessary to reconstruct the atomistic structure from the CG representation. This structure can be analyzed by itself or be used as an onset for atomistic molecular dynamics simulations. In this work, we present a computer program that accurately reconstructs the atomistic structure from a CG model for proteins, using a simple geometrical algorithm. The software is free and available online at http://www.ic.fcen.uba.ar/cg2aa/cg2aa.py Supplementary data are available at Bioinformatics online. lula@qi.fcen.uba.ar. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A STUDY OF THE CHARACTERISTICS OF STUDENTS ENROLLED IN BUSINESS DATA PROCESSING CLASSES, LOS ANGELES METROLITAN COLLEGE, FALL, 1965.

ERIC Educational Resources Information Center

HILLEARY, HELENA

AN INFORMATION FORM ADMINISTERED TO 520 STUDENTS IN BUSINESS DATA PROCESSING CLASSES SHOWED THAT THESE STUDENTS WERE ENROLLED IN AN AVERAGE OF 1.5 SUCH CLASSES, AND THAT THEY INCLUDED MORE MEN AND STUDENTS OVER 30 YEARS OF AGE THAN THE TOTAL COLLEGE POPULATION. OVER 15 PERCENT HAD EARNED AA DEGREES OR HIGHER, AND 32 PERCENT HAD NO PREVIOUS…

The 12 Steps of Addiction Recovery Programs as an Influence on Leadership Development: A Personal Narrative

ERIC Educational Resources Information Center

Friedman, Mitchell

2016-01-01

My participation in a 12-step addiction program based on the principles and traditions of Alcoholics Anonymous (AA) has been critical for my leadership development. As I worked to refrain from addictive behaviors and practiced 12-step principles, I experienced a shift from individualistic, self-centered leadership towards a servant leader…

76 FR 59074 - State Fiscal Stabilization Fund Program and Discretionary and Other Formula Grant Programs

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-23

... assessment type, is provided by States as part of the Elementary and Secondary Education Act (ESEA... DEPARTMENT OF EDUCATION 34 CFR Subtitle B, Chapter II [Docket ID ED-2011-OS-0005] RIN 1894-AA02...: Department of Education. ACTION: Notice of proposed revisions to certain data collection and reporting...

77 FR 7960 - Unified Agenda of Federal Regulatory and Deregulatory Actions

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-13

... Identifier No. 373 Secure Handling of 1601-AA52 Ammonium Nitrate Program (Reg Plan Seq No. 53). 374 Homeland...) Proposed Rule Stage 373. Secure Handling of Ammonium Nitrate Program Regulatory Plan: This entry is Seq. No... performance standards to 33 CFR part 151, subparts C and D, for discharges of ballast water. It supports the...

Computer programming: quality and safety for neonatal parenteral nutrition orders.

PubMed

Huston, Robert K; Markell, Andrea M; McCulley, Elizabeth A; Marcus, Matthew J; Cohen, Howard S

2013-08-01

Computerized software programs reduce errors and increase consistency when ordering parenteral nutrition (PN). The purpose of this study was to evaluate the effectiveness of our computerized neonatal PN calculator ordering program in reducing errors and optimizing nutrient intake. This was a retrospective study of infants requiring PN during the first 2-3 weeks of life. Caloric, protein, calcium, and phosphorus intakes; days above and below amino acid (AA) goals; and PN ordering errors were recorded. Infants were divided into 3 groups by birth weight for analysis: ≤1000 g, 1001-1500 g, and >1500 g. Intakes and outcomes of infants before (2007) vs after (2009) implementation of the calculator for each group were compared. There were no differences in caloric, protein, or phosphorus intakes in 2007 vs 2009 in any group. Mean protein intakes were 97%-99% of goal for ≤1000-g and 1001- to 1500-g infants in 2009 vs 87% of goal for each group in 2007. In 2007, 7.6 per 100 orders were above and 11.5 per 100 were below recommended AA intakes. Calcium intakes were higher in 2009 vs 2007 in ≤1000-g (46.6 ± 6.1 vs 39.5 ± 8.0 mg/kg/d, P < .001) and >1500-g infants (50.6 ± 7.4 vs 39.9 ± 8.3 mg/kg/d, P < .001). Ordering errors were reduced from 4.6 per 100 in 2007 to 0.1 per 100 in 2009. Our study reaffirms that computerized ordering systems can increase the quality and safety of neonatal PN orders. Calcium and AA intakes were optimized and ordering errors were minimized using the computer-based ordering program.

Racial Disparities in the Molecular Landscape of Cancer.

PubMed

Heath, Elisabeth I; Lynce, Filipa; Xiu, Joanne; Ellerbrock, Angela; Reddy, Sandeep K; Obeid, Elias; Liu, Stephen V; Bollig-Fischer, Aliccia; Separovic, Duska; Vanderwalde, Ari

2018-04-01

African Americans (AA) have the highest incidence and mortality of any racial/ethnic group in the US for most cancer types. Heterogeneity in the molecular biology of cancer, as a contributing factor to this disparity, is poorly understood. To address this gap in knowledge, we explored the molecular landscape of colorectal cancer (CRC), non-small cell lung cancer (NSCLC) and high-grade glioma (HGG) from 271 AA and 636 Caucasian (CC) cases. DNA from formalin-fixed paraffin-embedded tumors was sequenced using next-generation sequencing. Additionally, we evaluated protein expression using immunohistochemistry. The Exome Aggregation Consortium Database was evaluated for known ethnicity associations. Considering only pathogenic or presumed pathogenic mutations, as determined by the American College of Medical Genetics and Genomics guidelines, and using Bonferroni and Benjamini-Hochberg corrections for multiple comparisons, we found that CRC tumors from AA patients harbored significantly more mutations of phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA) than those from CC patients. CRC tumors in AA patients also appeared to harbor more mutations of mitogen-activated protein kinase kinase 1 (MAP2K1/MEK1), MPL proto-oncogene (MPL), thrombo-poietin receptor, and neurofibromin 1 (NF1) than those from CC patients. In contrast, CRCs from AA patients were likely to carry fewer mutations of ataxia-telangiectasia mutated (ATM), as well as of proto-oncogene B-Raf (BRAF), including the V600E variant, than those from CC patients. Rates of immunohistochemical positivity for epidermal growth factor receptor (EGFR) and DNA topoisomerase 2-alpha (TOP2A) tended to be higher in CRCs from AA patients than in CC patients. In NSCLC adenocarcinoma, BRAF variants appeared to be more frequent in the AA than in the CC cohort, whereas in squamous cell lung carcinoma, programmed death-ligand 1 (PD-L1) expression tended to be lower in the AA than in CC group. Moreover, HGG tumors from AA patients showed a trend toward harboring more mutations of protein tyrosine phosphatase non-receptor 11 (PTPN11), than HGG tumors from the CC cohort. In contrast, mutations of phosphatase and tensin homolog (PTEN) and tumor protein 53 (TP53) appeared to be higher in HGG tumors in CC patients than in their AA counterparts. Our data revealed significant differences and trends in molecular signatures of the three cancer types in AA and CC cohorts. These findings imply that there may be differences in carcinogenesis between AA and CC patients and that race may be a factor that should be considered regarding cancer incidence and outcome. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

42 CFR 54a.10 - Fiscal accountability.

Code of Federal Regulations, 2010 CFR

2010-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE... applicable program funds for substance abuse services are subject to the same regulations as other...

42 CFR 54a.10 - Fiscal accountability.

Code of Federal Regulations, 2014 CFR

2014-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE... applicable program funds for substance abuse services are subject to the same regulations as other...

42 CFR 54a.10 - Fiscal accountability.

Code of Federal Regulations, 2011 CFR

2011-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE... applicable program funds for substance abuse services are subject to the same regulations as other...

42 CFR 54a.10 - Fiscal accountability.

Code of Federal Regulations, 2012 CFR

2012-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE... applicable program funds for substance abuse services are subject to the same regulations as other...

42 CFR 54a.10 - Fiscal accountability.

Code of Federal Regulations, 2013 CFR

2013-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE... applicable program funds for substance abuse services are subject to the same regulations as other...

Combined use of visible, reflected infrared, and thermal infrared images for mapping Hawaiian lava flows

NASA Technical Reports Server (NTRS)

Abrams, Michael; Abbott, Elsa; Kahle, Anne

1991-01-01

The weathering of Hawaiian basalts is accompanied by chemical and physical changes of the surfaces. These changes have been mapped using remote sensing data from the visible and reflected infrared and thermal infrared wavelength regions. They are related to the physical breakdown of surface chill coats, the development and erosion of silica coatings, the oxidation of mafic minerals, and the development of vegetation cover. These effects show systematic behavior with age and can be mapped using the image data and related to relative ages of pahoehoe and aa flows. The thermal data are sensitive to silica rind development and fine structure of the scene; the reflectance data show the degree of oxidation and differentiate vegetation from aa and cinders. Together, data from the two wavelength regions show more than either separately. The combined data potentially provide a powerful tool for mapping basalt flows in arid to semiarid volcanic environments.

Dispensing patterns for antidiabetic agents in New Zealand: are the guidelines being followed?

PubMed

Murray, Peter; Norris, Hew; Metcalfe, Scott; Betty, Bryan; Young, Vanessa; Locke, Bronwyn

2017-11-10

Type 2 diabetes mellitus (T2DM) is a significant public health issue in New Zealand. Effective management and glycaemic control is critical for reducing diabetes-related complications. Treatment guidelines are well established in New Zealand. Using dispensing data as a proxy for prescribing data, this paper aims to describe the pattern of first- and second-line antidiabetic agent (AA) dispensing for T2DM in New Zealand and assess adherence with treatment guidelines. Analysis of national dispensing data for AA medications using the Pharmaceutical Collection database from 2007/08 to 2015/16. Metformin monotherapy remains the most commonly prescribed first-line T2DM medication prescribed, accounting for 85% of initial agents prescribed. Sulfonylureas are the most common second-line agents used, accounting for 70% of all second-line agents. There is a high degree of adherence with the T2DM treatment guidelines in New Zealand.

Determination of germanium by AAS in chloride-containing matrices.

PubMed

Anwari, M A; Abbasi, H U; Volkan, M; Ataman, O Y

1996-06-01

Interference effects of NaCl on the ET-AAS determination of Ge have been studied. The use of several matrix modifiers to alleviate this problem such as Ni and Zn perchlorates and nitrates, nitric acid, ammonium nitrate are reported. The stabilizing effect of Zn and Ni perchlorates allows the use of high pretreatment temperatures. NaCl is thus thermally volatilized from the atomizer by employing pretreatment temperatures higher than 1500 degrees C resulting in an improved sensitivity. Germanium levels in zinc plant slag samples, have been determined and compared to those obtained for the same samples spiked with NaCl with platform and wall atomization using nickel perchlorate as a matrix modifier. The results were compared with those from a hydride generation system equipped with a liquid nitrogen trap. The recoveries for germanium have been almost complete and amount to 99% for the original slag samples and 80% for 15% (w/w) NaCl containing spiked samples.

Mobility of adsorbed Cry1Aa insecticidal toxin from Bacillus thuringiensis (Bt) on montmorillonite measured by fluorescence recovery after photobleaching (FRAP)

NASA Astrophysics Data System (ADS)

Helassa, Nordine; Daudin, Gabrielle; Noinville, Sylvie; Janot, Jean-Marc; Déjardin, Philippe; Staunton, Siobhán; Quiquampoix, Hervé

2010-06-01

The insecticidal toxins produced by genetically modified Bt crops are introduced into soil through root exudates and tissue decomposition and adsorb readily on soil components, especially on clays. This immobilisation and the consequent concentration of the toxins in "hot spots" could increase the exposure of soil organisms. Whereas the effects on non-target organisms are well documented, few studies consider the migration of the toxin in soil. In this study, the residual mobility of Bt Cry1Aa insecticidal toxin adsorbed on montmorillonite was assessed using fluorescence recovery after photobleaching (FRAP). This technique, which is usually used to study dynamics of cytoplasmic and membrane molecules in live cells, was applied for the first time to a protein adsorbed on a finely divided swelling clay mineral, montmorillonite. No mobility of adsorbed toxin was observed at any pH and at different degrees of surface saturation.

The Undergraduate ALFALFA Team: Outcomes for Over 250 Undergraduate Participants

NASA Astrophysics Data System (ADS)

Troischt, Parker; Koopmann, Rebecca A.; Haynes, Martha P.; ALFALFA Team

2016-01-01

The NSF-sponsored Undergraduate ALFALFA (Arecibo Legacy Fast ALFA) Team (UAT) is a consortium of 19 institutions founded to promote undergraduate research and faculty development within the extragalactic ALFALFA HI blind survey project and follow-up programs. In this talk we present outcomes for the more than 250 undergraduate students who have who have participated in the program during the 8 years of funding. 40% of these students have been women and members of underrepresented groups. To date 148 undergraduate students have attended annual workshops at Arecibo Observatory, interacting with faculty, graduate students, their peers, and Arecibo staff in lectures, group activities, tours, and observing runs. Team faculty have supervised 159 summer research projects and 120 academic year (e.g., senior thesis) projects. 68 students have traveled to Arecibo Observatory for observing runs and 55 have presented their results at national meetings such as the AAS. Through participation in the UAT, students are made aware of career paths they may not have previously considered. More than 90% of alumni are attending graduate school and/or pursuing a career in STEM. 42% of those pursuing graduate degrees in Physics or Astronomy are women. This work has been supported by NSF grants AST-0724918/0902211, AST-075267/0903394, AST-0725380, and AST-1211005

Controllable Fabrication of GeSi Nanowires in Diameter of About 10 nm Using the Top-Down Approach

NASA Astrophysics Data System (ADS)

Zeng, Cheng; Li, Yi; Xia, Jin-Song

2017-11-01

Not Available Supported by the State Key Program of the National Natural Science Foundation of China under Grant No 61335002, the National High Technology Research and Development Program of China under Grant No 2015AA016904, the National Natural Science Foundation of China under Grant No 11574102, and the National Basic Research Program of China under Grant Nos 2013CB933303 and 2013CB632104.

Computer Programs in Marine Science

DTIC Science & Technology

1976-04-01

AD-A279 795 U.S. DEPARTMENT OF COMMERCE National Technical Information Service PB-258 082 Computer Programs in Marine Science National Ocearncgraphic...NO. 5 fo r- Computer nPrograms in ’StlrSO " Marine Science U.S. DEPARTMENT OF COMMERCE National Oceanic and AtmosPheric AdmInistration Environmental...N0,AA?76062212 I I 4. TITLE A?.’D.UBTITLE S. REPORT DATE Comnuter Progrims in Marine Science April 1976 Koy tc Oceanographic Records Documentation No

13 CFR 127.102 - What are the definitions of the terms used in this part?

Code of Federal Regulations, 2013 CFR

2013-01-01

... expired or otherwise left the 8(a) BD program early. AA/GC&BD means SBA's Associate Administrator for Government Contracting and Business Development. Central Contractor Registration (CCR) Database means the...

13 CFR 127.102 - What are the definitions of the terms used in this part?

Code of Federal Regulations, 2012 CFR

2012-01-01

... expired or otherwise left the 8(a) BD program early. AA/GC&BD means SBA's Associate Administrator for Government Contracting and Business Development. Central Contractor Registration (CCR) Database means the...

Structural characterization of Al0.55Ga0.45N epitaxial layer determined by high resolution x-ray diffraction and transmission electron microscopy

NASA Astrophysics Data System (ADS)

Xu, Qing-Jun; Liu, Bin; Zhang, Shi-Ying; Tao, Tao; Xie, Zi-Li; Xiu, Xiang-Qian; Chen, Dun-Jun; Chen, Peng; Han, Ping; Zhang, Rong; Zheng, You-Dou

2017-04-01

Not Available Project supported by the National Key Research and Development Project of China (Grant No. 2016YFB0400100), the Hi-tech Research Project of China (Grant Nos. 2014AA032605 and 2015AA033305), the National Natural Science Foundation of China (Grant Nos. 61274003, 61422401, 51461135002, and 61334009), the Natural Science Foundation of Jiangsu Province, China (Grant Nos. BY2013077, BK20141320, and BE2015111), the Project of Green Young and Golden Phenix of Yangzhou City, the Postdoctoral Sustentation Fund of Jiangsu Province, China (Grant No. 1501143B), the Project of Shandong Provinceial Higher Educational Science and Technology Program, China (Grant No. J13LN08), the Solid State Lighting and Energy-saving Electronics Collaborative Innovation Center, Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and Research Funds from NJU-Yangzhou Institute of Opto-electronics.

Descriptive Summaries for Program Elements of the Research, Development Test and Evaluation, Army Program FY 1981. Volume III.

DTIC Science & Technology

1980-01-01

td Sad 1.60 adlii ~addo U CID ’A46- . 0 Ad 41 log aa Ia4 0 0 . *63 w- 4 0 06 Iw0 Aa 0£6 -0-.. 1.0 No id...w - ~~ffa ’U _ - - ~ .~..,.5 ’a 0 0 0 0 * ’a * U -’ -4 ’U= A a 3 U M - - 13a td ~ 0 -~ 00 0 0 * S Uo ’. Ut I ti ’a 00 0 0 II - 83 - VI ~ I. 1 Ug...lw .,j o w 0u a MS a : .. 4MS_~ ~ * UU.4 4.: ~ * o A- 4 0 05 6 I4 I𔃽 Ef td i Sa ’a SaS w a A. ~ w CU M6 A 1 ~* 3 Ma: O - C w A@ ~ W 6. %0d b- 2 a =U

Detailed clinicopathological characterization of progressive alopecia areata patients treated with i.v. corticosteroid pulse therapy toward optimization of inclusion criteria.

PubMed

Sato, Misato; Amagai, Masayuki; Ohyama, Manabu

2014-11-01

The management of progressive alopecia areata (AA) is often challenging. Recently, i.v. corticosteroid pulse therapy has been reported to be effective for acute and severe AA, however, inclusion criteria have not been sufficiently precise, leaving a chance that its efficacy could be further improved by optimizing therapeutic indications. In our attempts to delineate the factors that correlate with favorable outcomes, we minutely evaluated the clinicopathological findings and the prognoses of single-round steroid pulse-treated progressive AA cases with full sets of image and pathology records during the course. Almost complete hair regrowth has been achieved and maintained up to 2 years in five out of seven AA patients with varying degrees of clinical severity. Interestingly, the worst clinical presentation observed during the course correlated with the size of the area where hairs with dystrophic roots were pulled rather than the extent of visible hair loss on the first visit. Dermoscopy detected disease spread but contributed little in assessing prognoses. Dense perifollicular cell infiltration was detected in all cases treated within 4 weeks of onset and those treated later but with excellent response. Importantly, the cases with poor or incomplete hair regrowth were treated 6-8 weeks of onset and showed moderate inflammatory change with high telogen conversion rate. These findings mandate global dermoscopy and hair pull test for judging the treatment indication and suggest that early administration of high-dose corticosteroid, ideally within 4 weeks of onset, enable efficient suppression of active inflammation and maximize the effectiveness of the remedy. © 2014 Japanese Dermatological Association.

Maternal nutritional determinants of colostrum fatty acids in the EDEN mother-child cohort.

PubMed

Armand, Martine; Bernard, Jonathan Y; Forhan, Anne; Heude, Barbara; Charles, Marie-Aline

2017-10-21

Programming of infant development and later health may depend on early-milk polyunsaturated fatty acids (PUFA) contents, that are very variable between women for reasons not well elucidated. Indeed, a high n-6/n-3 PUFA in milk was associated with higher adiposity, arterial pressure and lower psychomotor scores in childhood. We aimed to explore the respective contribution of several maternal and perinatal factors to the variability of linoleic (LA), α-linolenic (ALA), arachidonic (AA), and docosahexaenoic (DHA) acid levels in early milk. Fatty acids of 934 colostrum samples from the EDEN mother-child cohort were analyzed by gas chromatography. The dietary intakes during the last trimester of pregnancy were estimated using a quantitative food frequency questionnaire. Relationship between milk PUFA and dietary fatty acids, and other maternal or pregnancy variables were analyzed by multiple linear regression. The means (±SD) of colostrum LA, ALA, AA and DHA levels were, respectively, 9.85 ± 1.85, 0.65 ± 0.22, 0.86 ± 0.16, and 0.64 ± 0.19% of total fatty acids. Obese mothers colostrum contained the highest level of LA and AA and the lowest level of ALA and DHA. Colostrum LA, AA and DHA levels were higher in primiparous women. Mother's age was positively associated with colostrum AA and DHA. Dietary n-6 PUFA were associated with higher LA and lower DHA levels in colostrum, while dietary n-3 PUFA were related to higher LA and lower AA levels. Contrary to what was observed for DHA, AA level in colostrum was not related to its dietary intake. High dietary AA/DHA and total n-6/n-3 ratios were critical for the content of DHA in colostrum lipids. Our study brings new insights in the understanding of the main maternal factors involved in PUFA levels variability in early milk. These data are important to consider for dietary counseling for women prior to and during pregnancy. Copyright © 2017 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Risk of prostate cancer in African-American men: Evidence of mixed effects of dietary quercetin by serum vitamin D status.

PubMed

Paller, C J; Kanaan, Y M; Beyene, D A; Naab, T J; Copeland, R L; Tsai, H L; Kanarek, N F; Hudson, T S

2015-09-01

African-American (AA) men experience higher rates of prostate cancer (PCa) and vitamin D (vitD) deficiency than white men. VitD is promoted for PCa prevention, but there is conflicting data on the association between vitD and PCa. We examined the association between serum vitD and dietary quercetin and their interaction with PCa risk in AA men. Participants included 90 AA men with PCa undergoing treatment at Howard University Hospital (HUH) and 62 controls participating in HUH's free PCa screening program. We measured serum 25-hydroxy vitD [25(OH)D] and used the 98.2 item Block Brief 2000 Food Frequency Questionnaires to measure dietary intake of quercetin and other nutrients. Case and control groups were compared using a two-sample t-test for continuous risk factors and a Fisher exact test for categorical factors. Associations between risk factors and PCa risk were examined via age-adjusted logistic regression models. Interaction effects of dietary quercetin and serum vitD on PCa status were observed. AA men (age 40-70) with normal levels of serum vitD (>30 ng/ml) had a 71% lower risk of PCa compared to AA men with vitD deficiency (OR = 0.29, 95%CI: 0.08-1.03; P = 0.055). In individuals with vitD deficiency, increased dietary quercetin showed a tendency toward lower risk of PCa (OR = 0.91, 95%CI: 0.82-1.00; P = 0.054, age-adjusted) while men with normal vitD were at elevated risk (OR = 1.23, 95%CI: 1.04-1.45). These findings suggest that AA men who are at a higher risk of PCa may benefit more from vitD intake, and supplementation with dietary quercetin may increase the risk of PCa in AA men with normal vitD levels. Further studies with larger populations are needed to better understand the impact of the interaction between sera vitD levels and supplementation with quercetin on PCa in AA men. © 2015 Wiley Periodicals, Inc.

NASA Alternate Access to Station Service Concept

NASA Technical Reports Server (NTRS)

Bailey, Michelle D.; Crumbly, Chris

2001-01-01

The evolving nature of the NASA space enterprise compels the agency to develop new and innovative space systems concepts. NASA, working with increasingly strained budgets and a declining manpower base, is attempting to transform from operational activities to procurement of commercial services. NASA's current generation reusable launch vehicle, the Shuttle, is in transition from a government owned and operated entity to a commercial venture to reduce the civil servant necessities for that program. NASA foresees its second generation launch vehicles being designed and operated by industry for commercial and government services. The "service" concept is a pioneering effort by NASA. The purpose the "service" is not only to reduce the civil servant overhead but will free up government resources for further research - and enable industry to develop a space business case so that industry can sustain itself beyond government programs. In addition, NASA desires a decreased responsibility thereby decreasing liability. The Second Generation Reusable Launch Vehicle (RLV) program is implementing NASA's Space Launch Initiative (SLI) to enable industry to develop the launch vehicles of the future. The Alternate Access to Station (AAS) project office within this program is chartered with enabling industry to demonstrate an alternate access capability for the International Space Station (ISS). The project will not accomplish this by traditional government procurement methods, not by integrating the space system within the project office, or by providing the only source of business for the new capability. The project funds will ultimately be used to purchase a service to take re-supply cargo to the ISS, much the same as any business might purchase a service from FedEx to deliver a package to its customer. In the near term, the project will fund risk mitigation efforts for enabling technologies. AAS is in some ways a precursor to the 2nd Generation RLV. By accomplishing ISS resupply with existing technologies, not only will a new category of autonomous vehicles deliver cargo, but a commercial business base will be incubated that will improve the likelihood of commercial convergence with the next generation of RLVs. Traditional paradigms in government management and acquisition philosophy are being challenged in order to bring about the objective of the AAS project. The phased procurement approach is proving to be the most questionable aspect to date. This work addresses the fresh approach AAS is adopting in management and procurement through a study of the AAS history, current solutions, key technologies, procurement complications, and an incremental forward plan leading to the purchase of a service to deliver goods to ISS. Included in this work is a discussion of the Commercial Space Act of 1998 and how it affects government purchase of space launch and space vehicle services. Industry should find these topics pertinent to their current state of business.

NASA Alternate Access to Station Service Concept

NASA Astrophysics Data System (ADS)

Bailey, M. D.; Crumbly, C.

2002-01-01

The evolving nature of the NASA space enterprise compels the agency to develop new and innovative space systems concepts. NASA, working with increasingly strained budgets and a declining manpower base, is attempting to transform from operational activities to procurement of commercial services. NASA's current generation reusable launch vehicle, the Shuttle, is in transition from a government owned and operated entity to a commercial venture to reduce the civil servant necessities for that program. NASA foresees its second generation launch vehicles being designed and operated by industry for commercial and government services. The "service" concept is a pioneering effort by NASA. The purpose the "service" is not only to reduce the civil servant overhead but will free up government resources for further research and enable industry to develop a space business case so that industry can sustain itself beyond government programs. In addition, NASA desires a decreased responsibility thereby decreasing liability. The Second Generation Reusable Launch Vehicle (RLV) program is implementing NASA's Space Launch Initiative (SLI) to enable industry to develop the launch vehicles of the future. The Alternate Access to Station (AAS) project office within this program is chartered with enabling industry to demonstrate an alternate access capability for the International Space Station (ISS). The project will not accomplish this by traditional government procurement methods, not by integrating the space system within the project office, or by providing the only source of business for the new capability. The project funds will ultimately be used to purchase a service to take re-supply cargo to the ISS, much the same as any business might purchase a service from FedEx to deliver a package to its customer. In the near term, the project will fund risk mitigation efforts for enabling technologies. AAS is in some ways a precursor to the 2nd Generation RLV. By accomplishing ISS resupply with existing technologies, not only will a new category of autonomous vehicles deliver cargo, but a commercial business base will be incubated that will improve the likelihood of commercial convergence with the next generation of RLVs. Traditional paradigms in government management and acquisition philosophy are being challenged in order to bring about the objective of the AAS project. The phased procurement approach is proving to be the most questionable aspect to date. This work addresses the fresh approach AAS is adopting in management and procurement through a study of the AAS history, current solutions, key technologies, procurement complications, and an incremental forward plan leading to the purchase of a service to deliver goods to ISS. Included in this work is a discussion of the Commercial Space Act of 1998 and how it affects government purchase of space launch and space vehicle services. Industry should find these topics pertinent to their current state of business.

Nationwide survey on the use of horse antithymocyte globulins (ATGAM) in patients with acquired aplastic anemia: A report on behalf of the French Reference Center for Aplastic Anemia.

PubMed

Peffault de Latour, Régis; Tabrizi, Reza; Marcais, Ambroise; Leblanc, Thierry; Lamy, Thierry; Mohty, Mohamad; Tavitian, Suzanne; Jubert, Charlotte; Pasquet, Marlène; Galambrun, Claire; Nguyen, Stéphanie; Cahn, Jean Yves; Braun, Thorsten; Deconinck, Eric; Bay, Jacques Olivier; Sicre de Fontbrune, Flore; Barraco, Fiorenza; Socié, Gérard

2018-05-01

Antithymocyte globulins (ATG) plus cyclosporine (CSA) is the gold standard immunosuppressive treatment (IST) for patients with aplastic anemia. A prospective randomized trial showed in 2011 that hATG was superior to rabbit ATG for first-line treatment of severe AA. The French Health Agency (ANSM) permitted a patient-named authorization for temporary use (ATU) program of hATG (ATGAM, Pfizer) in patients with AA in 2011 since commercial access to hATG is not approved. We took advantage of this program to analyze the outcomes of 465 patients who received antithymocyte globulins (ATGAM) plus CSA as first line treatment (n = 379; 81.5%), or for refractory (n = 26) or relapsed disease (n = 33), from September 2011 to March 2017. In the entire cohort one year, 72% of the patients had partial and 13% had complete response, with worse response for patients with severe AA and a longer interval between diagnosis and IST (more than 6 months). Severe adverse events were mainly linked to infections (24%), hemorrhages (6%), and elevated liver function tests (5%). Overall at 12 months, 9.7% of patients required second line IST and 15.6% received transplantation. Fifty-five patients died during the study mainly because of infections (53%). Factors predicting independently worse survival were age over 40 years, neutrophils less than 0.5 × 10 9 /L, male gender and longer delay between diagnosis and hATG (>6 months period). This study does illustrate the results of ATGAM with CSA in a true-life perspective and confirms ATGAM as standard of care IST to treat patients with AA not eligible for HSCT. © 2018 Wiley Periodicals, Inc.

Barriers and Motivators to Participating in mHealth Research Among African American Men.

PubMed

James, Delores C S; Harville, Cedric

2017-11-01

Most African American (AA) men own a smartphone, which positions them to be targeted for a variety of programs, services, and health interventions using mobile devices (mHealth). The goal of this study was to assess AA men's use of technology and the barriers and motivators to participating in mHealth research. A self-administered survey was completed by 311 men. Multinomial logistic regression examined associations between three age groups (18-29 years, 30-50 years, and 51+ years), technology access, and motivators and barriers to participating in mHealth research. Sixty-five percent of men owned a smartphone and a laptop. Men aged 18 to 29 years were more likely willing to use a health app and smartwatch/wristband monitor than older men ( p < .01). Men aged 18 to 29 years were also more likely than older men to be motivated to participate for a free cell phone/upgraded data plan and contribution to the greater good ( p < .05). Older men were more likely than younger ones to be motivated to become more educated about the topic ( p < .05). Younger men were more likely than older ones to report lack of interest in the topic as a barrier to participating ( p < .01), while older men were more likely than younger ones to cite lack of research targeted to minority communities as a barrier ( p < .05). This study suggests that culturally tailored mHealth research using smartphones may be of interest to AA men interested in risk reduction and chronic disease self-management. Opportunities also exist to educate AA men about the topic at hand and why minority men are being targeted for the programs and interventions.

Barriers and Motivators to Participating in mHealth Research Among African American Men

PubMed Central

James, Delores C. S.; Harville, Cedric

2015-01-01

Most African American (AA) men own a smartphone, which positions them to be targeted for a variety of programs, services, and health interventions using mobile devices (mHealth). The goal of this study was to assess AA men’s use of technology and the barriers and motivators to participating in mHealth research. A self-administered survey was completed by 311 men. Multinomial logistic regression examined associations between three age groups (18-29 years, 30-50 years, and 51+ years), technology access, and motivators and barriers to participating in mHealth research. Sixty-five percent of men owned a smartphone and a laptop. Men aged 18 to 29 years were more likely willing to use a health app and smartwatch/wristband monitor than older men (p < .01). Men aged 18 to 29 years were also more likely than older men to be motivated to participate for a free cell phone/upgraded data plan and contribution to the greater good (p < .05). Older men were more likely than younger ones to be motivated to become more educated about the topic (p < .05). Younger men were more likely than older ones to report lack of interest in the topic as a barrier to participating (p < .01), while older men were more likely than younger ones to cite lack of research targeted to minority communities as a barrier (p < .05). This study suggests that culturally tailored mHealth research using smartphones may be of interest to AA men interested in risk reduction and chronic disease self-management. Opportunities also exist to educate AA men about the topic at hand and why minority men are being targeted for the programs and interventions. PMID:26634861

76 FR 19757 - The Federal Student Aid Programs Under Title IV of the Higher Education Act of 1965, as Amended

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-08

... application for participation in the Quality Assurance Program. SUMMARY: The Secretary of Education invites... 487A(a) of the Higher Education Act of 1965, as amended (HEA), to submit a letter of application to... application to Barbara Mroz, Federal Student Aid, U.S. Department of Education, and submitting this letter of...

76 FR 29183 - Exclusion of Orphan Drugs for Certain Covered Entities Under 340B Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-20

... and, if they are, at what price. These covered entities do not know if they can buy these orphan drugs... DEPARTMENT OF HEALTH AND HUMAN SERVICES 42 CFR Part 10 RIN 0906-AA94 Exclusion of Orphan Drugs for... Prices of Drugs Purchased by Covered Entities.'' Section 340B implemented a drug pricing program by which...

Coffee and Cigarette Consumption and Perceived Effects in Recovering Alcoholics Participating in Alcoholics Anonymous in Nashville, TN

PubMed Central

Reich, Michael S.; Dietrich, Mary S.; Finlayson, A.J. Reid; Fischer, Edward F.; Martin, Peter R.

2008-01-01

Background Alcoholics Anonymous (AA) members represent an important and relatively understudied population for improving our understanding of alcohol dependence recovery since over one million Americans participate in the program. Further insight into coffee and cigarette use by these individuals is necessary given AA members’ apparent widespread consumption and the recognized health consequences and psychopharmacological actions of these substances. Methods Volunteers were sought from all open-AA meetings in Nashville, TN during the summer of 2007 to complete a questionnaire (n=289, completion rate=94.1%) including timeline followback for coffee, cigarette, and alcohol consumption; the Alcoholics Anonymous Affiliation Scale; coffee consumption and effects questions; the Fagerstrom Test for Nicotine Dependence (FTND); and the Smoking Effects Questionnaire. Results Mean (±SD) age of onset of alcohol consumption was 15.4±4.2 years and mean lifetime alcohol consumption was 1026.0±772.8 kg ethanol. Median declared alcohol abstinence was 2.1 years (range: 0 days–41.1 years) and median lifetime AA attendance was 1000.0 meetings (range: 4–44209 meetings); average AA affiliation score was 7.6±1.5. Most (88.5%) individuals consumed coffee and approximately 33% of coffee consumers drank more than four cups per day (M=3.9±3.9). The most common self-reported reasons for coffee consumption and coffee-associated behavioral changes were related to stimulatory effects. More than half (56.9%) of individuals in AA smoked cigarettes. Of those who smoked, 78.7% consumed at least half a pack of cigarettes per day (M=21.8±12.3). Smokers’ FTND scores were 5.8±2.4; over 60% of smokers were highly or very highly dependent. Reduced negative affect was the most important subjective effect of smoking. Conclusions A greater proportion of AA participants drink coffee and smoke cigarettes in larger per capita amounts than observed in general US populations. The effects of these products as described by AA participants suggest significant stimulation and negative affect reduction. Fundamental knowledge of the quantitative and qualitative aspects of coffee and cigarette consumption among AA members will enable future research to discern their impact on alcohol abstinence and recovery. PMID:18657129

Amino acid metabolism in intestinal bacteria and its potential implications for mammalian reproduction.

PubMed

Dai, Zhaolai; Wu, Zhenlong; Hang, Suqin; Zhu, Weiyun; Wu, Guoyao

2015-05-01

Reproduction is vital for producing offspring and preserving genetic resources. However, incidences of many reproductive disorders (e.g. miscarriage, intrauterine growth restriction, premature delivery and lower sperm quality) have either increased dramatically or remained at high rates over the last decades. Mounting evidence shows a strong correlation between enteral protein nutrition and reproduction. Besides serving as major nutrients in the diet, amino acids (AA) are signaling molecules in the regulation of diverse physiological processes, ranging from spermatogenesis to oocyte fertilization and to embryo implantation. Notably, the numbers of bacteria in the intestine exceed the numbers of host cells by 10 times. Microbes in the small-intestinal lumen actively metabolize large amounts of dietary AA and, therefore, affect the entry of AA into the portal circulation for whole-body utilization. Changes in the composition and abundance of AA-metabolizing bacteria in the gut during pregnancy, as well as their translocation to the uterus, may alter uterine function and epigenetic modifications of maternal physiology and metabolism, which are crucial for pregnancy recognition and fetal development. Thus, the presence of the maternal gut microbiota and AA metabolites in the intrauterine environments (e.g. endometrium and placenta) and breast milk is likely a unique signature for the programming of the whole-body microbiome and metabolism in both the fetus and infant. Dietary intervention with functional AA, probiotics and prebiotics to alter the abundance and activity of intestinal bacteria may ameliorate or prevent the development of metabolic syndrome, while improving reproductive performance in both males and females as well as their offspring. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Options for Meeting U.S. Navy Foreign Language and Cultural Expertise Requirements in the Post 9/11 Security Environment

DTIC Science & Technology

2009-06-01

inquire about weather or sea conditions or inspect vessels. Higher-level language skills, especially those associated with the art of diplomacy...and Schools, and since 2002 has conferred Associates of Arts in Foreign Language (AA/FL) Degrees upon resident students who successfully complete all...Specialist (RP), Machinery Repairman (MR), Gas Turbine System Technician (GS), Culinary Specialist (CS), Naval Aircrewman (AW), and Command Master Chief

What's Missing in Most of Our Early Childhood Degrees? Focusing More Deeply on Relationships and Learning with Infants, Toddlers, and Their Families

ERIC Educational Resources Information Center

Chu, Marilyn

2016-01-01

Infant-toddler teachers have the least education, the lowest pay, and the highest turnover rate of all adults in the field of early childhood education. In this article, the unique needs of infants, toddlers, and their families are explored at the 2-year associate (AA) and the 4-year bachelor (BA) levels of early childhood higher education degree…

Proposals for Codaer (Combat Data Exchange Relay)

DTIC Science & Technology

1949-04-22

Target Reporting 6 CODAER INDICATORS 7 SHAFT POSITION TRANSMISSION AND CODING 9 OPERATIONS CONTROL 10 AA FIRE COORDINATION 10 INTERSHIP PLOTS 12 RELAY...of providing tactical data on at least 500 different targets or friends. The link should be insensitive to jamming and have a high degree of security...gyrations of high speed air targets. This sets the minimum data repetition rate at about 5 reports per second. Better results, particularly in view of

75 FR 65644 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-26

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11937, AA-11938, AA-11939, AA-11940, AA-11944, AA-11943, AA-11941, AA-11936, AA-11933, AA-11928, AA-11929, AA-11931, AA-11932; LLAK- 962000-L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION...

Achiral-chiral two-dimensional chromatography of free amino acids in milk: A promising tool for detecting different levels of mastitis in cows.

PubMed

Ianni, Federica; Sardella, Roccaldo; Lisanti, Antonella; Gioiello, Antimo; Cenci Goga, Beniamino Terzo; Lindner, Wolfgang; Natalini, Benedetto

2015-12-10

In two-dimensional HPLC (2D-HPLC) "heart-cut" applications, two columns are connected in series via a switching valve and volume fractions from the "primary" column are re-injected on the "secondary" column. The heart-cut 2D-HPLC system here described was implemented by connecting a reversed-phase (RP) column (first dimension) to a chiral column (second dimension) containing a quinidine-based chiral stationary phase. The system was used to evaluate the change in the enantiomeric excess value of dansylated (Dns) amino acids (AAs) in milk samples from two cows with different "California Mastitis Test" scores: negative test for sample 1, positive for sample 2. Apart from the co-elution of Dns-Arg/Dns-Gly and the reduced chemoselectivity for Dns-Leu/Dns-allo-Ile, the optimized achiral RP method distinguished the remaining standard Dns-AAs. Dns-AAs were identified in the chromatograms of the real samples, and in higher concentration Dns-Ala, Dns-Arg, Dns-Asp, Dns-Glu, Dns-Ile, Dns-Leu, Dns-Phe and Dns-Val. Except Dns-Arg, the chiral column enabled the RP enantioseparation of all the other compounds (α and RS values up to 1.65 and 8.63, respectively, for Dns-Phe). In sample 2, the amounts of Dns-d-AAs were rather elevated, in particular for Dns-Ala and Dns-Asp. Instead, for sample 1, D-isomers were detected for Dns-Ala, Dns-Glu and Dns-Leu. The proposed 2D-HPLC method could be useful for the identification of clinical mastitis difficult to be diagnosed. Moreover, the eventual progressive reduction of D-AAs levels with the degree of sub-clinical mastitis could allow the building of mathematical models to use for the diagnosis of early stages of mastitis. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular and biochemical identification of alien chromosome additions in shallot (Allium cepa L. Aggregatum group) carrying extra chromosome(s) of bunching onion (A. fistulosum L.).

PubMed

Yaguchi, Shigenori; Hang, Tran Thi Minh; Tsukazaki, Hikaru; Hoa, Vu Quynh; Masuzaki, Shin-ichi; Wako, Tadayuki; Masamura, Noriya; Onodera, Shuichi; Shiomi, Norio; Yamauchi, Naoki; Shigyo, Masayoshi

2009-02-01

To develop the bunching onion (Allium fistulosum L.; genomes, FF) chromosome-specific genetic markers for identifying extra chromosomes, eight shallot (A. cepa L. Aggregatum group; genomes, AA)--A. fistulosum monosomic addition plants (AA+nF) and 62 shallot--A. fistulosum single-alien deletion plants (AAF-nF) were analyzed by 23 different chromosome-specific genetic markers of shallot. The eight monosomic addition plants consisted of one AA+2F, two AA+6F, and five AA+8F. Of the 62 single-alien deletion plants, 60 could be identified as six different single-alien deletion lines (AAF-1F, -3F, -4F, -6F, -7F, and -8F) out of the eight possible types. Several single-alien deletion lines were classified on the basis of leaf and bulb characteristics. AAF-8F had the largest number of expanded leaves of five deletion plants. AAF-7F grew most vigorously, as expressed by its long leaf blade and biggest bulb size. AAF-4F had very small bulbs. AAF-7F and AAF-8F had different bulbs from those of shallot as well as other types of single-alien deletion lines in skin and outer scale color. Regarding the sugar content of the bulb tissues, the single-alien deletion lines showed higher fructan content than shallot. Moreover, shallot could not produce fructan with degree of polymerization (DP) 12 or higher, although the single-alien deletion lines showed DP 20 or higher. The content of S-alk(en)yl-L-cysteine sulfoxide (ACSO) in the single-alien deletion lines was significantly lower than that in shallot. These results indicated that chromosomes from A. fistulosum might carry anonymous factors to increase the highly polymerized fructan production and inhibit the synthesis of ACSO in shallot bulbs. Accordingly, alien chromosomes from A. fistulosum in shallot would contribute to modify the quality of shallot bulbs.

Asymmetric Stetter reactions catalyzed by thiamine diphosphate-dependent enzymes.

PubMed

Kasparyan, Elena; Richter, Michael; Dresen, Carola; Walter, Lydia S; Fuchs, Georg; Leeper, Finian J; Wacker, Tobias; Andrade, Susana L A; Kolter, Geraldine; Pohl, Martina; Müller, Michael

2014-12-01

The intermolecular asymmetric Stetter reaction is an almost unexplored transformation for biocatalysts. Previously reported thiamine diphosphate (ThDP)-dependent PigD from Serratia marcescens is the first enzyme identified to catalyze the Stetter reaction of α,β-unsaturated ketones (Michael acceptor substrates) and α-keto acids. PigD is involved in the biosynthesis of the potent cytotoxic agent prodigiosin. Here, we describe the investigation of two new ThDP-dependent enzymes, SeAAS from Saccharopolyspora erythraea and HapD from Hahella chejuensis. Both show a high degree of homology to the amino acid sequence of PigD (39 and 51 %, respectively). The new enzymes were heterologously overproduced in Escherichia coli, and the yield of soluble protein was enhanced by co-expression of the chaperone genes groEL/ES. SeAAS and HapD catalyze intermolecular Stetter reactions in vitro with high enantioselectivity. The enzymes possess a characteristic substrate range with respect to Michael acceptor substrates. This provides support for a new type of ThDP-dependent enzymatic activity, which is abundant in various species and not restricted to prodigiosin biosynthesis in different strains. Moreover, PigD, SeAAS, and HapD are also able to catalyze asymmetric carbon-carbon bond formation reactions of aldehydes and α-keto acids, resulting in 2-hydroxy ketones.

Taking stress response out of the box: stability, discontinuity, and temperament effects on HPA and SNS across social stressors in mother-infant dyads.

PubMed

Laurent, Heidemarie K; Ablow, Jennifer C; Measelle, Jeffrey

2012-01-01

This study investigated continuity and stability of hypothalamic-pituitary-adrenal (HPA) and sympathetic nervous system (SNS) response measures in mother-infant dyads across 2 different types of social stress sessions. Synchrony of response trajectories across systems (SNS-HPA coordination) and partners (mother-infant attunement) was addressed, as were associations with infant temperament. Primiparous mothers and their 18-month-old infants (n = 86 dyads) completed an attachment stressor--Strange Situation (Ainsworth, Blehar, Waters, & Wall, 1978)--at Session 1 and challenge stressors--cleanup task and emotion task battery--at Session 2. Mother and infant saliva samples collected to index pre-stress, stress, and post-stress response during each session were assayed for cortisol (HPA marker) and salivary alpha-amylase (sAA; SNS marker). Multilevel modeling of cortisol/sAA trajectories across sessions revealed rank-order stability in mother/infant stress measures but discontinuity in absolute levels; cortisol trajectories were higher during attachment stress, and sAA trajectories were higher during challenge stress. Varying degrees of mother-infant attunement were found across sessions/systems. Infant surgency predicted higher stress measures, and negative affect and effortful control predicted lower stress measures, though associations depended on session/system. Findings are discussed in terms of advancing a multisystemic, contextual definition of developing stress responsiveness.

Race, common genetic variation, and therapeutic response disparities in heart failure.

PubMed

Taylor, Mathew R; Sun, Albert Y; Davis, Gordon; Fiuzat, Mona; Liggett, Stephen B; Bristow, Michael R

2014-12-01

Because of its comparatively recent evolution, Homo sapiens exhibit relatively little within-species genomic diversity. However, because of genome size, a proportionately small amount of variation creates ample opportunities for both rare mutations that may cause disease as well as more common genetic variations that may be important in disease modification or pharmacogenetics. Primarily because of the East African origin of modern humans, individuals of African ancestry (AA) exhibit greater degrees of genetic diversity than more recently established populations, such as those of European ancestry (EA) or Asian ancestry. Those population effects extend to differences in frequency of common gene variants that may be important in heart failure natural history or therapy. For cell-signaling mechanisms important in heart failure, we review and present new data for genetic variation between AA and EA populations. Data indicate that: 1) neurohormonal signaling mechanisms frequently (16 of the 19 investigated polymorphisms) exhibit racial differences in the allele frequencies of variants comprising key constituents; 2) some of these differences in allele frequency may differentially affect the natural history of heart failure in AA compared with EA individuals; and 3) in many cases, these differences likely play a role in observed racial differences in drug or device response. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

PEP Talk: Prostate Education Program, "Cutting Through the Uncertainty of Prostate Cancer for Black Men Using Decision Support Instruments in Barbershops".

PubMed

Frencher, Stanley K; Sharma, Arun K; Teklehaimanot, Senait; Wadzani, Dennis; Ike, Ijeoma E; Hart, Alton; Norris, Keith

2016-09-01

The objective of this study was to investigate the effectiveness of using decision support instruments (DSI) to assist African-American (AA) men in making a prostate cancer (CaP) screening decision. This nonrandomized pretest-posttest comparison study assessed two DSI that were either culturally tailored or culturally nonspecific. CaP knowledge, intention to screen, and preferences were assessed before and after exposure to DSI using a convenience sample of 120 AA men aged 40 years and above. Participants interested in screening were referred to healthcare providers through a community-based patient navigator to obtain prostate-specific antigen (PSA) testing. We followed up 3 months after to determine if participants screened for CaP. CaP knowledge increased following exposure to both DSI in equivalent proportions. While similar proportions of men ultimately intended on having a PSA test following both DSI, bivariate analysis revealed that the culturally tailored DSI demonstrated a statistically significant increase in intention to screen. Participants' degree of certainty in their decision-making process with regard to CaP screening increased following the culturally tailored DSI (p < .001). The majority of participants planned on discussing CaP screening with a healthcare provider upon completion of the study. Barbershop-based health education can change the knowledge, preferences, intentions, and behaviors of this at-risk population. At 3 months follow-up, half (n = 58) of the participants underwent PSA testing, which led to the diagnosis of CaP in one participant. Community-led interventions for CaP, such as cluster-randomized designs in barbershops, are needed to better assess the efficacy of DSI in community settings.

Selections from 2017: Hubble Survey Explores Distant Galaxies

NASA Astrophysics Data System (ADS)

Kohler, Susanna

2017-12-01

Editors note:In these last two weeks of 2017, well be looking at a few selections that we havent yet discussed on AAS Nova from among the most-downloaded paperspublished in AAS journals this year. The usual posting schedule will resume in January.CANDELS Multi-Wavelength Catalogs: Source Identification and Photometry in the CANDELS COSMOSSurvey FieldPublished January2017Main takeaway:A publication led byHooshang Nayyeri(UC Irvine and UC Riverside) early this year details acatalog of sources built using the Cosmic Assembly Near-infrared Deep Extragalactic Legacy Survey(CANDELS), a survey carried out by cameras on board the Hubble Space Telescope. The catalogliststhe properties of 38,000 distant galaxies visiblewithin the COSMOS field, a two-square-degree equatorial field explored in depthto answer cosmological questions.Why its interesting:Illustration showing the three-dimensional map of the dark matter distribution in theCOSMOS field. [Adapted from NASA/ESA/R. Massey(California Institute of Technology)]The depth and resolution of the CANDELS observations areuseful for addressingseveral major science goals, including the following:Studying the most distant objects in the universe at the epoch of reionization in the cosmic dawn.Understanding galaxy formation and evolution during the peak epoch of star formation in the cosmic high noon.Studying star formation from deep ultravioletobservations and studying cosmology from supernova observations.Why CANDELS is a major endeavor:CANDELS isthe largest multi-cycle treasury program ever approved on the Hubble Space Telescope using over 900 orbits between 2010 and 2013 withtwo cameras on board the spacecraftto study galaxy formation and evolution throughout cosmic time. The CANDELS images are all publicly available, and the new catalogrepresents an enormous source of information about distant objectsin our universe.CitationH. Nayyeri et al 2017 ApJS 228 7. doi:10.3847/1538-4365/228/1/7

My Most Memorial Meeting - The June, 1997, San Diego Meeting

NASA Astrophysics Data System (ADS)

Philip, A. G. Davis

1999-05-01

At the June, 1997 AAS meeting in San Diego I arranged a topical session on the Shapley Visiting Lectureships Program. There were poster papers and speakers from the early days of the program, going back to the Visiting Lectureships Program of the AAS. Then the three past directors and the present director described their activities in running the program from 1979 to 1997. We had other speakers who described their many visits to institutions over the years and representatives from two institutions which had received many visits. This session provided much interesting information about the Shapley Program and its history. At the end of the program several people pledged, and then gave, a substantial sum to the Shapley Endowment Fund. Because of all these events and happenings, the San Diego Meeting was a highlight meeting for me. A second meeting with significance to the Shapley Program was the June, 1996 meeting in Madison, Wisconsin. At this meeting certificates were awarded to 31 lecturers who had made 15 or more Shapley visits and 18 lecturers who had made 25 or more visits. A dinner was held at which those lecturers in these two groups who were present at the meeting were personally awarded their certificates. The remaining certificates were mailed after the meeting. The success of the Shapley Program is directly related to the devotion of its group of lecturers who spend considerable time and effort in making the two day visits to host institutions.

NASA Alumni League Dialogue

NASA Image and Video Library

2011-03-04

Former NASA Administrator James Beggs is seen during a dialogue with present NASA Administrator Charles Bolden on the future of the space program, Friday, March 4, 2011, at NASA Headquarters in Washington. Beggs was NASA's sixth administrator serving from July 1981 to December 1985. The dialogue was part of the program “The State of the Agency: NASA Future Programs Presentation” sponsored by the NASA Alumni League with support from the AAS, AIAA, CSE and WIA.Photo Credit: (NASA/Paul E. Alers)

Tech-Prep/Associate Degree Program Guide: Tech Prep Associate Degree Program, Business Administration Associate Degree Program, Office Administration Associate Degree Program, Allied Health Associate Degree Program.

ERIC Educational Resources Information Center

Marmaras, Judy; Neri, Pat

The Tech-Prep Associate Degree Program (TPAD) at the Community College of Rhode Island (CCRI) in Warwick, is a high school/community college partnership providing high school students with an alternative program of study focused on goal setting, basic academic skills development, and the skills needed to pursue a career in a technical, business or…

Vitamin D intake needed to maintain target serum 25-hydroxyvitamin D concentrations in participants with low sun exposure and dark skin pigmentation is substantially higher than current recommendations.

PubMed

Hall, Laura M; Kimlin, Michael G; Aronov, Pavel A; Hammock, Bruce D; Slusser, James R; Woodhouse, Leslie R; Stephensen, Charles B

2010-03-01

Cutaneous cholecalciferol synthesis has not been considered in making recommendations for vitamin D intake. Our objective was to model the effects of sun exposure, vitamin D intake, and skin reflectance (pigmentation) on serum 25-hydroxyvitamin D (25[OH]D) in young adults with a wide range of skin reflectance and sun exposure. Four cohorts of participants (n = 72 total) were studied for 7-8 wk in the fall, winter, spring, and summer in Davis, CA [38.5 degrees N, 121.7 degrees W, Elev. 49 ft (15 m)]. Skin reflectance was measured using a spectrophotometer, vitamin D intake using food records, and sun exposure using polysulfone dosimeter badges. A multiple regression model (R(2) = 0.55; P < 0.0001) was developed and used to predict the serum 25(OH)D concentration for participants with low [median for African ancestry (AA)] and high [median for European ancestry (EA)] skin reflectance and with low [20th percentile, approximately 20 min/d, approximately 18% body surface area (BSA) exposed] and high (80th percentile, approximately 90 min/d, approximately 35% BSA exposed) sun exposure, assuming an intake of 200 iu/d (5 ug/d). Predicted serum 25(OH)D concentrations for AA individuals with low and high sun exposure in the winter were 24 and 42 nmol/L and in the summer were 40 and 60 nmol/L. Corresponding values for EA individuals were 35 and 60 nmol/L in the winter and in the summer were 58 and 85 nmol/L. To achieve 25(OH)D > or =75 nmol/L, we estimate that EA individuals with high sun exposure need 1300 iu/d vitamin D intake in the winter and AA individuals with low sun exposure need 2100-3100 iu/d year-round.

Associations between biological markers of prenatal stress and infant negative emotionality are specific to sex.

PubMed

Braithwaite, Elizabeth C; Murphy, Susannah E; Ramchandani, Paul G; Hill, Jonathan

2017-12-01

Fetal programming is the idea that environmental stimuli can alter the development of the fetus, which may have a long-term effect on the child. We have recently reported that maternal prenatal cortisol predicts infant negative emotionality in a sex-dependent manner: high prenatal cortisol was associated with increased negative emotionality in females, and decreased negative emotionality in males. This study aims to test for this sex-specific effect in a different cohort, and investigate whether sex differences in fetal programming may be specific to glucocorticoid mechanisms by also examining a maternal salivary alpha-amylase (sAA) by sex interaction. 88 pregnant women (mean gestational age=27.4 weeks, SD=7.4) collected saliva samples at home over two working days to be assayed for the hormone cortisol (range=0.13-88.22nmol/l) and the enzyme alpha-amylase (range=4.57-554.8units/ml). Samples were collected at waking, 30-min post-waking and 12h post-waking. Two months after birth participants reported infant negative emotionality using the distress to limits subscale of the Infant Behavior Questionnaire. The interaction between maternal prenatal cortisol and infant sex to predict distress to limits approached significance (p=0.067). In line with our previous finding there was a positive association between prenatal cortisol and negative emotionality in females, and a negative association in males. The interaction between sAA and sex to predict distress was significant (p=0.025), and the direction of effect was the same as for the cortisol data; high sAA associated with increased negative emotionality in females and reduced negative emotionality in males. In line with our previous findings, this research adds to an emerging body of literature, which suggests that fetal programming mechanisms may be sex-dependent. This is the first study to demonstrate that maternal prenatal sAA may be an important biomarker for infant behavior, and the findings have implications for understanding sex differences in developmental psychopathology. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

40 CFR 62.9190 - Identification of sources.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 9 2014-07-01 2014-07-01 false Identification of sources. 62.9190 Section 62.9190 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS...: (a) A&A Enterprises, Ardmore, Oklahoma. (b) Henryetta Pallet Company, Henryetta, Oklahoma. (c...

40 CFR 62.9190 - Identification of sources.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 9 2013-07-01 2013-07-01 false Identification of sources. 62.9190 Section 62.9190 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS...: (a) A&A Enterprises, Ardmore, Oklahoma. (b) Henryetta Pallet Company, Henryetta, Oklahoma. (c...

40 CFR 62.9190 - Identification of sources.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 9 2012-07-01 2012-07-01 false Identification of sources. 62.9190 Section 62.9190 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS...: (a) A&A Enterprises, Ardmore, Oklahoma. (b) Henryetta Pallet Company, Henryetta, Oklahoma. (c...

Large Space Structures Fielding Plan

DTIC Science & Technology

1991-01-01

15830 STS PAYLOARE SYSTESETY 3C (A %AA IASB STS DAYLCODSICARGO SRORM 1PVFR! PR 111L 5 SOL? CIE. JR-012 SAFETY 19LENEVIASO PLA PSOR 1, ,I -1 AR S’EATIOR...support/safety measures in space will interface. Although these features can be developed to some degree as stated objectives, many must be designed from...continuity 7. Check system for mechanical continuity 8. Verify LSS assembly continuity B. Productivity Measurements 1. Note duration of assembly activities

Effect of cold storage and packaging material on the major aroma components of sweet cream butter.

PubMed

Lozano, Patricio R; Miracle, Evan R; Krause, Andrea J; Drake, Maryanne; Cadwallader, Keith R

2007-09-19

The major aroma compounds of commercial sweet cream AA butter quarters were analyzed by GC-olfactometry and GC-MS combined with dynamic headspace analysis (DHA) and solvent-assisted flavor evaporation (SAFE). In addition, the effect of long-term storage (0, 6, and 12 months) and type of wrapping material (wax parchment paper vs foil) on the aroma components and sensory properties of these butters kept under refrigerated (4 degrees C) and frozen (-20 degrees C) storage was evaluated. The most intense compounds in the aroma of pasteurized AA butter were butanoic acid, delta-octalactone, delta-decalactone, 1-octen-3-one, 2-acetyl-1-pyrroline, dimethyl trisulfide, and diacetyl. The intensities of lipid oxidation volatiles and methyl ketones increased as a function of storage time. Refrigerated storage caused greater flavor deterioration compared with frozen storage. The intensity and relative abundance of styrene increased as a function of time of storage at refrigeration temperature. Butter kept frozen for 12 months exhibited lower styrene levels and a flavor profile more similar to that of fresh butter compared to butter refrigerated for 12 months. Foil wrapping material performed better than wax parchment paper in preventing styrene migration into butter and in minimizing the formation of lipid oxidation and hydroxyl acid products that contribute to the loss of fresh butter flavor.

Implementation of the power to prevent diabetes prevention educational curriculum into rural African American communities: a feasibility study.

PubMed

Cené, Crystal W; Haymore, Laura Beth; Ellis, Danny; Whitaker, Shaketa; Henderson, Stacey; Lin, Feng-Chang; Corbie-Smith, Giselle

2013-01-01

The purpose of this study was to describe the feasibility of using a community-based participatory research (CBPR) approach to implement the Power to Prevent (P2P) diabetes prevention education curriculum in rural African American (AA) settings. Trained community health workers facilitated the 12-session P2P curriculum across 3 community settings. Quantitative (based on the pre- and post-curriculum questionnaires and changes in blood glucose, blood pressure [BP], and weight at baseline and 6 months) and qualitative data (based on semi-structured interviews with facilitators) were collected. Indicators of feasibility included: demand, acceptability, implementation fidelity, and limited efficacy testing. Across 3 counties, 104 AA participants were recruited; 43% completed ≥ 75% of the sessions. There was great demand for the program. Fifteen community health ambassadors (CHAs) were trained, and 4 served as curriculum facilitators. Content and structure of the intervention was acceptable to facilitators but there were challenges to implementing the program as designed. Improvements were seen in diabetes knowledge and the impact of healthy eating and physical activity on diabetes prevention, but there were no significant changes in blood glucose, BP, or weight. While it is feasible to use a CBPR approach to recruit participants and implement the P2P curriculum in AA community settings, there are significant challenges that must be overcome.

A method to transfer an individual graphene flake to a target position with a precision of sub-micrometer

NASA Astrophysics Data System (ADS)

Wang, Yubing; Yin, Weihong; Han, Qin; Yang, Xiaohong; Ye, Han; Lü, Qianqian; Yin, Dongdong

2017-04-01

Graphene field-effect transistors have been intensively studied. However, in order to fabricate devices with more complicated structures, such as the integration with waveguide and other two-dimensional materials, we need to transfer the exfoliated graphene samples to a target position. Due to the small area of exfoliated graphene and its random distribution, the transfer method requires rather high precision. In this paper, we systematically study a method to selectively transfer mechanically exfoliated graphene samples to a target position with a precision of sub-micrometer. To characterize the doping level of this method, we transfer graphene flakes to pre-patterned metal electrodes, forming graphene field-effect transistors. The hole doping of graphene is calculated to be 2.16 × {10}12{{{cm}}}-2. In addition, we fabricate a waveguide-integrated multilayer graphene photodetector to demonstrate the viability and accuracy of this method. A photocurrent as high as 0.4 μA is obtained, corresponding to a photoresponsivity of 0.48 mA/W. The device performs uniformly in nine illumination cycles. Project supported by the National Key Research and Development Program of China (No. 2016YFB0402404), the High-Tech Research and Development Program of China (Nos. 2013AA031401, 2015AA016902, 2015AA016904), and the National Natural Foundation of China (Nos. 61674136, 61176053, 61274069, 61435002).

Efficacy of surface disinfectant cleaners against emerging highly resistant gram-negative bacteria

PubMed Central

2014-01-01

Background Worldwide, the emergence of multidrug-resistant gram-negative bacteria is a clinical problem. Surface disinfectant cleaners (SDCs) that are effective against these bacteria are needed for use in high risk areas around patients and on multi-touch surfaces. We determined the efficacy of several SDCs against clinically relevant bacterial species with and without common types of multidrug resistance. Methods Bacteria species used were ATCC strains; clinical isolates classified as antibiotic-susceptible; and multi-resistant clinical isolates from Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens (all OXA-48 and KPC-2); Acinetobacter baumannii (OXA-23); Pseudomonas aeruginosa (VIM-1); and Achromobacter xylosoxidans (ATCC strain). Experiments were carried out according to EN 13727:2012 in quadruplicate under dirty conditions. The five evaluated SDCs were based on alcohol and an amphoteric substance (AAS), an oxygen-releaser (OR), surface-active substances (SAS), or surface-active-substances plus aldehydes (SASA; two formulations). Bactericidal concentrations of SDCs were determined at two different contact times. Efficacy was defined as a log10 ≥ 5 reduction in bacterial cell count. Results SDCs based on AAS, OR, and SAS were effective against all six species irrespective of the degree of multi-resistance. The SASA formulations were effective against the bacteria irrespective of degree of multi-resistance except for one of the four P. aeruginosa isolates (VIM-1). We found no general correlation between SDC efficacy and degree of antibiotic resistance. Conclusions SDCs were generally effective against gram-negative bacteria with and without multidrug resistance. SDCs are therefore suitable for surface disinfection in the immediate proximity of patients. Single bacterial isolates, however, might have reduced susceptibility to selected biocidal agents. PMID:24885029

[The study of ultra-fine diamond powder used in magnetic head polishing slurry].

PubMed

Jin, Hong-Yun; Hou, Shu-En; Pan, Yong; Xiao, Hong-Yan

2008-05-01

In the present paper, atomic absorption spectrometry(AAS), inductively-coupled plasma mass spectrometry (ICP-MS), transmission electron microscopy (TEM), X-ray diffraction (XRD) and laser Raman spectroscopy (RM) were employed to study the commercial ultra-fine diamond powders prepared by the static pressure-catalyst method and used in magnetic head polishing slurry. The results of AAS and ICP-MS indicated that there were silicon oxide, Fe, Ni, Al and some other metal elements in the ultra-fine powders. XRD patterns showed the peaks of SiO2 at 2theta = 35.6 degrees, 39.4 degrees and 59.7 degrees and diamond sharp peaks in agreement with the results above. Diamond sharp peaks implied perfect crystal and high-hardness beneficial to high-efficiency in polishing. The broader Raman band of graphite at 1 592 cm(-1) observed by Raman analysis proved graphite existing in the diamond powders. In the TEM images, the size of ultra-fine powders was estimated between 0.1 and 0.5 microm distributed in a wide scope, however, sharp edges of the powder particles was useful to polish. The ultra-fine diamond powders have many advantages, for example, high-hardness, well abrasion performance, high-polishing efficiency and being useful in magnetic head polishing slurry. But, the impurities influence the polishing efficiency, shortening its service life and the wide distribution reduces the polishing precision. Consequently, before use the powders must be purified and classified. The purity demands is 99.9% and trace silicon oxide under 0.01% should be reached. The classification demands that the particle distribution should be in a narrower scope, with the mean size of 100 nm and the percentage of particles lager than 200 nm not over 2%.

Recruiting African American Churches to Participate in Research: The Learning and Developing Individual Exercise Skills for a Better Life Study

PubMed Central

Whitt-Glover, Melicia C.; Borden, Shanice L.; Alexander, Dayna S.; Kennedy, Betty M.; Goldmon, Moses V.

2016-01-01

Physical activity among African Americans (AA) is low; effective intervention strategies are needed. Community-based settings are useful for delivering health-related interventions in racial/ethnic minority communities. This article describes strategies used to recruit churches for participation in a 22-month intervention designed to increase physical activity levels in AA women. Initial recruitment efforts, led by AA study staff, included direct mailers, phone calls, and in-person meetings with church representatives. After 10 months, only five churches were enrolled. Seven community members with existing partnerships/contacts in the faith community were subsequently hired and an additional 26 churches were enrolled within 6 months. Overall response rate was 45%, and churches required 3.5 ± 3.0 months of multiple contacts prior to enrollment. The main primary contacts within churches were individuals with personal interest in the program and pastors. Prior relationship between the research team and churches did not appear to influence church enrollment as much as community member recruiters. The current study identifies several potential strategies that may be useful for increasing success in efforts to recruit AA churches into studies. Additional research is warranted that tests and compares a variety of recruitment strategies to determine the most successful strategies for recruitment in different populations. PMID:26724311

Department of the Navy Supporting Data for FY1991 Budget Estimates Descriptive Summaries

DTIC Science & Technology

1990-01-01

deployments of the F/A-18 aircraft. f. (U) Engineering and technical support for AAS-38 tracker and F/A-18 C/D WSSA. g. (U) Provided support to ATARS program...for preliminary testing of RECCE/ ATARS common nose and associated air data computer (ADC) algorithms. h. (U) Initiated integration of full HARPOON and...to ATARS program for testing of flight control computer software. 28 UNCLASSIFIED 0]PgLa .e 2 4136N Budget Activity: 4 Program Elemhk* Title: F/A-18

OH radicals from the indirect actions of X-rays induce cell lethality and mediate the majority of the oxygen enhancement effect.

PubMed

Hirayama, Ryoichi; Ito, Atsushi; Noguchi, Miho; Matsumoto, Yoshitaka; Uzawa, Akiko; Kobashi, Gen; Okayasu, Ryuichi; Furusawa, Yoshiya

2013-11-01

We examined OH radical-mediated indirect actions from X irradiation on cell killing in wild-type Chinese hamster ovary cell lines (CHO and AA8) under oxic and hypoxic conditions, and compared the contribution of direct and indirect actions under both conditions. The contribution of indirect action on cell killing can be estimated from the maximum degree of protection by dimethylsulfoxide, which suppresses indirect action by quenching OH radicals without affecting the direct action of X rays on cell killing. The contributions of indirect action on cell killing of CHO cells were 76% and 50% under oxic and hypoxic conditions, respectively, and those for AA8 cells were 85% and 47%, respectively. Therefore, the indirect action on cell killing was enhanced by oxygen during X irradiation in both cell lines tested. Oxygen enhancement ratios (OERs) at the 10% survival level (D10 or LD90) for CHO and AA8 cells were 2.68 ± 0.15 and 2.76 ± 0.08, respectively. OERs were evaluated separately for indirect and direct actions, which gave the values of 3.75 and 2.01 for CHO, and 4.11 and 1.32 for AA8 cells, respectively. Thus the generally accepted OER value of ∼3 is best understood as the average of the OER values for both indirect and direct actions. These results imply that both indirect and direct actions on cell killing require oxygen for the majority of lethal DNA damage, however, oxygen plays a larger role in indirect than for direct effects. Conversely, the lethal damage induced by the direct action of X rays are less affected by oxygen concentration.

Biological characteristics of genetic variants of Urabe AM9 mumps vaccine virus.

PubMed

Wright, K E; Dimock, K; Brown, E G

2000-03-01

The Urabe AM9 mumps vaccine is composed of a mixture of variants distinguishable by a difference at nucleotide (nt) 1081 of the hemagglutinin-neuraminidase (HN) gene (Brown, E.G., Dimock, K., Wright, K.E., 1996. The Urabe AM9 mumps vaccine is a mixture of viruses differing at amino acid (aa) 335 of the hemagglutinin-neuraminidase gene with one form associated with disease. J. Infect. Dis. 174, 619-622.). Further genetic and biological variation was detected in plaque purified viruses from the Urabe AM9 vaccine by examining the HN gene sequence, plaque morphology, cytopathic effects and growth in Vero cells, and temperature sensitivity (ts). Infection of Vero cells with plaque purified viruses with a G at nt 1081 of the HN gene produced large, clear plaques, caused significant CPE early after infection but yielded lower titres of virus than other purified viruses. None of these viruses were ts. In contrast, half of the plaque purified viruses with an A at nt 1081 were sensitive to a temperature of 39.5 degrees C. These viruses produced small plaques, caused significant CPE and grew to low titres. Two ts viruses possessed a unique aa substitution at aa 468 of HN. The remaining A(1081) viruses were not ts, produced large plaques but little CPE, and grew to titres 10-fold higher than the G(1081) viruses. Isolates of Urabe AM9 associated with post-vaccination illness were similar to these non-ts A(1081) viruses, but could be further sub-divided into two groups on the basis of a difference at aa 464 of HN. The post-vaccination isolates may represent insufficiently attenuated components of the vaccine, while the G(1081) and ts subset of A(1081) viruses may be more fully attenuated.

Impact of Environmental Conditions on the Form and Function of Candida albicans Biofilms

PubMed Central

Daniels, Karla J.; Park, Yang-Nim; Srikantha, Thyagarajan; Pujol, Claude

2013-01-01

Candida albicans, like other pathogens, can form complex biofilms on a variety of substrates. However, as the number of studies of gene regulation, architecture, and pathogenic traits of C. albicans biofilms has increased, so have differences in results. This suggests that depending upon the conditions employed, biofilms may vary widely, thus hampering attempts at a uniform description. Gene expression studies suggest that this may be the case. To explore this hypothesis further, we compared the architectures and traits of biofilms formed in RPMI 1640 and Spider media at 37°C in air. Biofilms formed by a/α cells in the two media differed to various degrees in cellular architecture, matrix deposition, penetrability by leukocytes, fluconazole susceptibility, and the facilitation of mating. Similar comparisons of a/a cells in the two media, however, were made difficult given that in air, although a/a cells form traditional biofilms in RPMI medium, they form polylayers composed primarily of yeast cells in Spider medium. These polylayers lack an upper hyphal/matrix region, are readily penetrated by leukocytes, are highly fluconazole susceptible, and do not facilitate mating. If, however, air is replaced with 20% CO2, a/a cells make a biofilm in Spider medium similar architecturally to that of a/α cells, which facilitates mating. A second, more cursory comparison is made between the disparate cellular architectures of a/a biofilms formed in air in RPMI and Lee's media. The results demonstrate that C. albicans forms very different types of biofilms depending upon the composition of the medium, level of CO2 in the atmosphere, and configuration of the MTL locus. PMID:23954841

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

A profile of Keith AA Fox, cardiologist and researcher.

PubMed

Fox, Keith A A; Telfer, Caroline

2014-01-01

Professor Keith AA Fox speaks to Caroline Telfer, Commissioning Editor. Professor Keith AA Fox is the British Heart Foundation and the Duke of Edinburgh Professor of Cardiology at the University of Edinburgh (UK). He is a founding fellow of the European Society of Cardiology and is currently Chair of the Programme of the European Society of Cardiology. In addition, he was President of the British Cardiovascular Society from 2009 to 2012. Professor Fox gave the State-of-the-Art lecture on acute coronary syndromes at the American Heart Association, as well as the 2009 Plenary lecture at the European Society of Cardiology-American College of Cardiology Symposium, the Lord Rayner lecture of the Royal College of Physicians (London, UK) and the Sir Stanley Davidson Lecture of the Royal College (Edinburgh, UK). He was awarded the Silver Medal of the European Society of Cardiology in 2010. Professor Fox's major research interest lies in the mechanisms and manifestations of acute coronary arterial disease; his work extends from underlying biological mechanisms to in vitro and in vivo studies and clinical trials. He is the author of more than 587 scientific papers (H-index Web of Science 73, Citations: 30,261 to March 2013). Professor Fox is chairman of the RITA program, co-chairman of ROCKET-AF and OASIS program, and chair of the GRACE program (the largest multinational study in acute coronary syndromes), and a lead investigator for studies on novel antithrombins, anticoagulants and antiplatelets. He is an International Associate Editor of the European Heart Journal and a member of the editorial boards of a number of journals. His current areas of research include the inhibition of coronary thrombosis and the role of platelets and inflammation in acute coronary syndromes.

Six-Month Changes in Spirituality and Religiousness in Alcoholics Predict Drinking Outcomes at Nine Months*

PubMed Central

Robinson, Elizabeth A. R.; Krentzman, Amy R.; Webb, Jon R.; Brower, Kirk J.

2011-01-01

Objective: Although spiritual change is hypothesized to contribute to recovery from alcohol dependence, few studies have used prospective data to investigate this hypothesis. Prior studies have also been limited to treatment-seeking and Alcoholics Anonymous (AA) samples. This study included alcohol-dependent individuals, both in treatment and not, to investigate the effect of spiritual and religious (SR) change on subsequent drinking outcomes, independent of AA involvement. Method: Alcoholics (N = 364) were recruited for a panel study from two abstinence-based treatment centers, a moderation drinking program, and untreated individuals from the local community. Quantitative measures of SR change between baseline and 6 months were used to predict 9-month drinking outcomes, controlling for baseline drinking and AA involvement. Results: Significant 6-month changes in 8 of 12 SR measures were found, which included private SR practices, beliefs, daily spiritual experiences, three measures of forgiveness, negative religious coping, and purpose in life. Increases in private SR practices and forgiveness of self were the strongest predictors of improvements in drinking outcomes. Changes in daily spiritual experiences, purpose in life, a general measure of forgiveness, and negative religious coping also predicted favorable drinking outcomes. Conclusions: SR change predicted good drinking outcomes in alcoholics, even when controlling for AA involvement. SR variables, broadly defined, deserve attention in fostering change even among those who do not affiliate with AA or religious institutions. Last, future research should include SR variables, particularly various types of forgiveness, given the strong effects found for forgiveness of self. PMID:21683048

Animation-assisted CPRII program as a reminder tool in achieving effective one-person-CPR performance.

PubMed

Choa, Minhong; Cho, Junho; Choi, Young Hwan; Kim, Seungho; Sung, Ji Min; Chung, Hyun Soo

2009-06-01

The objective of this study is to compare the skill retention of two groups of lay persons, six months after their last CPR training. The intervention group was provided with animation-assisted CPRII (AA-CPRII) instruction on their cellular phones, and the control group had nothing but what they learned from their previous training. This study was a single blind randomized controlled trial. The participants' last CPR trainings were held at least six months ago. We revised our CPR animation for on-site CPR instruction content emphasizing importance of chest compression. Participants were randomized into two groups, the AA-CPRII group (n=42) and the control group (n=38). Both groups performed three cycles of CPR and their performances were video recorded. These video clips were assessed by three evaluators using a checklist. The psychomotor skills were evaluated using the ResusciAnne SkillReporter. Using the 30-point scoring checklist, the AA-CPRII group had a significantly better score compared to the control group (p<0.001). Psychomotor skills evaluated with the AA-CPRII group demonstrated better performance in hand positioning (p=0.025), compression depth (p=0.035) and compression rate (p<0.001) than the control group. The AA-CPRII group resulted in better checklist scores, including chest compression rate, depth and hand positioning. Animation-assisted CPR could be used as a reminder tool in achieving effective one-person-CPR performance. By installing the CPR instruction on cellular phones and having taught them CPR with it during the training enabled participants to perform better CPR.

Gender, Treatment and Self-Help in Remission from Alcohol Use Disorders

PubMed Central

Moos, Rudolf H.; Moos, Bernice S.; Timko, Christine

2006-01-01

Objectives: To examine gender differences in the influence of treatment, self-help groups and life context and coping factors on remission among initially untreated individuals with alcohol use disorders. Design: A naturalistic study in which individuals were assessed at baseline and 1, 8 and 16 years later. Setting: Participants initiated help-seeking with the alcoholism service system by contacting an information and referral service or detoxification program. Participants: A total of 461 individuals with alcohol use disorders (50% women). Methods: Participants were assessed by mail surveys and telephone interviews on participation in professional treatment and Alcoholics Anonymous (AA), alcohol-related functioning and indices of life context and coping. Results: Compared to men, women were more likely to participate in treatment and AA, and to experience better alcohol-related and life context outcomes. In general, women and men who participated in treatment and/or AA for a longer duration were more likely to achieve remission. However, women benefited somewhat more than men from extended participation in AA. Continuing depression and reliance on avoidance coping were more closely associated with lack of remission among men than among women. Conclusion: Compared to men, women with alcohol use disorders were more likely to obtain help and achieve remission. Women tended to benefit more from continued participation in AA and showed greater reductions in depression and avoidance coping than men did. These findings identify specific targets for clinical interventions that appear to be especially beneficial for women and that may also enhance the likelihood of recovery among men. PMID:16988095

An Update on the AAS Astronomy Ambassadors Program

NASA Astrophysics Data System (ADS)

Fienberg, Richard T.; Gurton, S.; Fraknoi, A.; Prather, E. E.; Hurst, A.; Schatz, D. L.

2013-06-01

The American Astronomical Society, partnering with organizations active in science education and public outreach (EPO), has launched a series of professional-development workshops and a community of practice designed to help improve early-career astronomers’ ability to effectively communicate with students and the public. Called Astronomy Ambassadors, the program provides mentoring and training experiences for young astronomers, from advanced undergraduates to beginning faculty; it also provides access to resources and a network of contacts within the astronomy EPO community. By learning how to implement effective education and outreach strategies, Astronomy Ambassadors become better teachers, better presenters at meetings, and better representatives of our science to the public and to government. And because young astronomers are a more diverse group than those who currently do the majority of outreach, they help the astronomical community present a more multicultural and gender-balanced face to the public, enabling members of underserved groups to see themselves as scientists. Ambassadors are provided with a large library of outreach activities and materials that are suitable for a range of venues and audiences and that will grow with time. For much of this library we are using resources developed by organizations such as the Astronomical Society of the Pacific, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. The first Astronomy Ambassadors workshop was held at the 221st meeting of the AAS in January 2013 and served 30 young astronomers chosen from more than 75 applicants. Incorporating feedback from workshop participants and lessons learned from the reports they’ve submitted after conducting their own outreach events, we are now planning the second annual workshop to be held 4-5 January 2014 at the 223rd AAS meeting in National Harbor, Maryland.

Age Differences of Salivary Alpha-Amylase Levels of Basal and Acute Responses to Citric Acid Stimulation Between Chinese Children and Adults.

PubMed

Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong

2015-01-01

It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults.

Age Differences of Salivary Alpha-Amylase Levels of Basal and Acute Responses to Citric Acid Stimulation Between Chinese Children and Adults

PubMed Central

Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong

2015-01-01

It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults. PMID:26635626

Recommendations for the development of rare disease drugs using the accelerated approval pathway and for qualifying biomarkers as primary endpoints.

PubMed

Kakkis, Emil D; O'Donovan, Mary; Cox, Gerald; Hayes, Mark; Goodsaid, Federico; Tandon, P K; Furlong, Pat; Boynton, Susan; Bozic, Mladen; Orfali, May; Thornton, Mark

2015-02-10

For rare serious and life-threatening disorders, there is a tremendous challenge of transforming scientific discoveries into new drug treatments. This challenge has been recognized by all stakeholders who endorse the need for flexibility in the regulatory review process for novel therapeutics to treat rare diseases. In the United States, the best expression of this flexibility was the creation of the Accelerated Approval (AA) pathway. The AA pathway is critically important for the development of treatments for diseases with high unmet medical need and has been used extensively for drugs used to treat cancer and infectious diseases like HIV.In 2012, the AA provisions were amended to enhance the application of the AA pathway to expedite the development of drugs for rare disorders under the Food and Drug Administration Safety and Innovation Act (FDASIA). FDASIA, among many provisions, requires the development of a more relevant FDA guidance on the types of evidence that may be acceptable in support of using a novel surrogate endpoint. The application of AA to rare diseases requires more predictability to drive greater access to appropriate use of AA for more rare disease treatments that might not be developed otherwise.This white paper proposes a scientific framework for assessing biomarker endpoints to enhance the development of novel therapeutics for rare and devastating diseases currently without adequate treatment and is based on the opinions of experts in drug development and rare disease patient groups. Specific recommendations include: 1) Establishing regulatory rationale for increased AA access in rare disease programs; 2) Implementing a Biomarker Qualification Request Process to provide the opportunity for an early determination of biomarker acceptance; and 3) A proposed scientific framework for qualifying biomarkers as primary endpoints. The paper's final section highlights case studies of successful examples that have incorporated biomarker endpoints into FDA approvals for rare disease therapies. The focus of this paper is on the situation in the Unites States, but the recommendations are reasonably applicable to any jurisdiction.

mHealth Intervention Promoting Cardiovascular Health Among African-Americans: Recruitment and Baseline Characteristics of a Pilot Study

PubMed Central

2018-01-01

Background Mobile health (mHealth) interventions are promising avenues to promote cardiovascular (CV) health among African-Americans (AAs) and culturally tailored technology-based interventions are emerging for this population. Objective The objectives of this study were to use a community-based participatory research (CBPR) approach to recruit AAs into a pilot intervention study of an innovative mHealth CV health promotion program and to characterize technology use patterns and eHealth literacy (EHL). Methods Community partners from five predominately AA churches in southeast Minnesota collaborated with our academic institution to recruit AA congregants into the pilot study. Field notes as well as communications between the study team and community partners were used to design the recruitment strategy and its implementation with a goal of enrolling 50 participants. At its core, the recruitment strategy included community kickoff events to detail the state-of-the-art nature of the mHealth intervention components, the utility of CV health assessments (physical examination, laboratory studies and surveys) and the participants’ role in advancing our understanding of the efficacy of mHealth interventions among racial/ethnic minority groups. Detailed recruitment data were documented throughout the study. A self-administered, electronic survey measured sociodemographics, technology use and EHL (eHEALS scale). Results A total of 50 participants (70% women) from five AA churches were recruited over a one-month period. The majority (>90%) of participants reported using some form of mobile technology with all utilizing these technologies within their homes. Greater than half (60% [30/50]) reported being “very comfortable” with mobile technologies. Overall, participants had high EHL (84.8% [39/46] with eHEALS score ≥26) with no differences by sex. Conclusions This study illustrates the feasibility and success of a CBPR approach in recruiting AAs into mHealth intervention research and contributes to the growing body of evidence that AAs have high EHL, are high-users of mobile technologies, and thus are likely to be receptive to mHealth interventions. PMID:29386174

41 CFR 101-26.507-1 - Submission of requisitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...

41 CFR 101-26.507-1 - Submission of requisitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...

41 CFR 101-26.507-1 - Submission of requisitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...

41 CFR 101-26.507-1 - Submission of requisitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...

41 CFR 101-26.507-1 - Submission of requisitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...

The Structural Parameters of the Globular Clusters in M31 with PAndAS

NASA Astrophysics Data System (ADS)

Woodley, Kristin; Pan-Andromeda Archaeological Survey (PAndAS)

2012-05-01

The Pan-Andromeda Archaeological Survey (PAndAS) has obtained images with the Canada France Hawaii Telescope using the instrument MegaCam, covering over 400 square degrees in the sky and extending beyond 150 kpc in radius from the center of M31. With this extensive data set, we have measured the structural parameters of all confirmed globular clusters in M31 as well as for a large fraction of the candidate globular clusters in the Revised Bologna Catalog V.4 (Galleti et al. 2004, A&A, 416, 917). In this paper, we present their parameters, including their core-, effective (half-light)-, and tidal radii, as well as their ellipticities measured in a homogeneous manner with ISHAPE (Larsen 1999, A&AS, 139, 393). We examine these parameters as functions of radial position, luminosity, color, metallicity, and age. We also use our measurements as an additional parameter to help constrain the candidacy of the unconfirmed globular clusters.

The gender identity/gender dysphoria questionnaire for adolescents and adults: further validity evidence.

PubMed

Singh, Devita; Deogracias, Joseph J; Johnson, Laurel L; Bradley, Susan J; Kibblewhite, Sarah J; Owen-Anderson, Allison; Peterson-Badali, Michele; Meyer-Bahlburg, Heino F L; Zucker, Kenneth J

2010-01-01

This study aimed to provide further validity evidence for the dimensional measurement of gender identity and gender dysphoria in both adolescents and adults. Adolescents and adults with gender identity disorder (GID) were compared to clinical control (CC) adolescents and adults on the Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults (GIDYQ-AA), a 27-item scale originally developed by Deogracias et al. (2007). In Study 1, adolescents with GID (n = 44) were compared to CC adolescents (n = 98); and in Study 2, adults with GID (n = 41) were compared to CC adults (n = 94). In both studies, clients with GID self-reported significantly more gender dysphoria than did the CCs, with excellent sensitivity and specificity rates. In both studies, degree of self-reported gender dysphoria was significantly correlated with recall of cross-gender behavior in childhood-a test of convergent validity. The research and clinical utility of the GIDYQ-AA is discussed, including directions for further research in distinct clinical populations.

Simple control of surface topography of gold nanoshells by a surfactant-less seeded-growth method.

PubMed

Topete, Antonio; Alatorre-Meda, Manuel; Villar-Álvarez, Eva M; Cambón, Adriana; Barbosa, Silvia; Taboada, Pablo; Mosquera, Víctor

2014-07-23

We report the synthesis of branched gold nanoshells (BGNS) through a seeded-growth surfactant-less method. This was achieved by decorating chitosan-Pluronic F127 stabilized poly(lactic-co-gycolic) acid nanoparticles (NPs) with Au seeds (NP-seed), using chitosan as an electrostatic self-assembling agent. Branched shells with different degrees of anisotropy and optical response were obtained by modulating the ratios of HAuCl4/K2CO3 growth solution, ascorbic acid (AA) and NP-seed precursor. Chitosan and AA were crucial in determining the BGNS size and structure, acting both as coreductants and structure directing growth agents. Preliminary cytotoxicity experiments point to the biocompatibility of the obtained BGNS, allowing their potential use in biomedical applications. In particular, these nanostructures with "hybrid" compositions, which combine the features of gold nanoshells and nanostars showed a better performance as surface enhanced Raman spectroscopy probes in detecting intracellular cell components than classical smoother nanoshells.

Electron-beam-induced post-grafting polymerization of acrylic acid onto the surface of Kevlar fibers

NASA Astrophysics Data System (ADS)

Xu, Lu; Hu, Jiangtao; Ma, Hongjuan; Wu, Guozhong

2018-04-01

The surface of Kevlar fibers was successfully modified by electron beam (EB)-induced post-grafting of acrylic acid (AA). The generation of radicals in the fibers was confirmed by electron spin resonance (ESR) measurements, and the concentration of radicals was shown to increase as the absorbed dose increased, but decrease with increasing temperature. The influence of the synthesis conditions on the degree of grafting was also investigated. The surface microstructure and chemical composition of the modified Kevlar fibers were characterized by scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS). The SEM images revealed that the surface of the grafted fibers was rougher than those of the pristine and irradiated fibers. XPS analysis confirmed an increase in C(O)OH groups on the surface of the Kevlar fibers, suggesting successful grafting of AA. These results indicate that EB-induced post-grafting polymerization is effective for modifying the surface properties of Kevlar fibers.

Effect of Back Diffusion of Mg Dopants on Optoelectronic Properties of InGaN-Based Green Light-Emitting Diodes

NASA Astrophysics Data System (ADS)

Zhang, Ning; Wei, Xue-Cheng; Lu, Kun-Yi; Feng, Liang-Sen; Yang, Jie; Xue, Bin; Liu, Zhe; Li, Jin-Min; Wang, Jun-Xi

2016-11-01

Not Available Supported by the National Natural Science Foundation of China under Grant Nos 61505197 and 61334009, and the National High-Technology Research and Development Program of China under Grant No 2014AA032604.

78 FR 48048 - Student Assistance General Provisions

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-07

... DEPARTMENT OF EDUCATION 34 CFR Part 668 RIN 1880-AA87 Student Assistance General Provisions AGENCY: Office of Hearings & Appeals, Office of Management, Department of Education. ACTION: Final regulations... participation in the student financial assistance programs authorized under Title IV of the Higher Education Act...

Recovery Online

ERIC Educational Resources Information Center

Clark, John R.

2007-01-01

Since the founding of Alcoholics Anonymous (AA) in 1935, programs offering opportunity for recovery from alcoholism and other addictions have undergone vast changes. The Internet has created nearly limitless opportunities for recovering people and those seeking recovery to find both meetings and places where they can gather virtually and discuss…

Laser Atmospheric Propagation Kinetics

DTIC Science & Technology

1975-07-01

the available data. Section III also describes the mathematical model used to calculate the relaxation of the vibrational degrees of freedom in...has been used. This relation is derived in Appendix C, 11 -30- ---— ^^^^UM^ MUfi L^^MAamMMWaaMbAaMMMMMAMÜMMMM MMUMfa*,«« M^Mi mmm \\i •s T...is when the change in the optical path length is of the order of \\/2-n. Mathematically , this is expressed by the formula t vf (n - l)4jrdx = O

In vitro fatty acid enrichment of macrophages alters inflammatory response and net cholesterol accumulation

PubMed Central

Wang, Shu; Wu, Dayong; Lamon-Fava, Stefania; Matthan, Nirupa R.; Honda, Kaori L.; Lichtenstein, Alice H.

2010-01-01

Dietary long-chain PUFA, both n-3 and n-6, have unique benefits with respect to CVD risk. The aim of the present study was to determine the mechanisms by which n-3 PUFA (EPA, DHA) and n-6 PUFA (linoleic acid (LA), arachidonic acid (AA)) relative to SFA (myristic acid (MA), palmitic acid (PA)) alter markers of inflammation and cholesterol accumulation in macrophages (MΦ). Cells treated with AA and EPA elicited significantly less inflammatory response than control cells or those treated with MA, PA and LA, with intermediate effects for DHA, as indicated by lower levels of mRNA and secretion of TNFα, IL-6 and monocyte chemoattractant protein-1. Differences in cholesterol accumulation after exposure to minimally modified LDL were modest. AA and EPA resulted in significantly lower MΦ scavenger receptor 1 mRNA levels relative to control or MA-, PA-, LA- and DHA-treated cells, and ATP-binding cassette A1 mRNA levels relative to control or MA-, PA- and LA-treated cells. These data suggest changes in the rate of bidirectional cellular cholesterol flux. In summary, individual long-chain PUFA have differential effects on inflammatory response and markers of cholesterol flux in MΦ which are not related to the n position of the first double bond, chain length or degree of saturation. PMID:19660150

Effects of Glucose with Casein Peptide Supplementation on Post-Exercise Muscle Glycogen Resynthesis in C57BL/6J Mice.

PubMed

Matsunaga, Yutaka; Sakata, Yasuyuki; Yago, Takumi; Nakamura, Hirohiko; Shimizu, Takashi; Takeda, Yasuhiro

2018-06-11

Numerous studies have reported that post-exercise ingestion of carbohydrates with protein supplementation can enhance glycogen recovery. However, few reports have focused on the degrees of degradation of the ingested proteins due to post-exercise glycogen resynthesis. Accordingly, the aim of this study was to clarify the effects of differences in protein degradation on muscle glycogen recovery. Male seven-week-old C57BL/6J mice performed a single bout of 60-min treadmill running exercise and were then orally administered glucose (Glu; 1.5 mg/g body weight (BW)), glucose with casein peptide (Glu + Pep; 1.5 + 0.5 mg/g BW) or its constituent amino acid mixture (Glu + AA; 1.5 + 0.5 mg/g BW). At 120 min after supplementation, the soleus muscle glycogen content in the Glu and Glu + AA groups was significantly higher than that immediately after exercise; however, no such difference was observed in the Glu + Pep group. Blood substrate concentration and insulin signaling did not differ among the three groups. Furthermore, energy expenditure during the recovery period in the Glu + Pep group was significantly higher than that in the Glu and Glu + AA groups. These findings suggest that post-exercise co-ingestion of glucose and casein peptide might delay glycogen resynthesis, at least in part through increased energy expenditure caused by casein peptide ingestion.

Effects of quench rate and natural ageing on the age hardening behaviour of aluminium alloy AA6060

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strobel, Katharina, E-mail: katharina.strobel@aol.com; Lay, Matthew D.H., E-mail: mlay@fbrice.com; Easton, Mark A., E-mail: mark.easton@rmit.edu.au

Quench sensitivity in Al–Mg–Si alloys has been largely attributed to the solute loss at the heterogeneous nucleation sites, primarily dispersoids, during slow cooling after extrusion. As such, the number density of dispersoids, the solute type and concentration are considered to be the key variables for the quench sensitivity. In this study, quench sensitivity and the influence of natural ageing in a lean Al–Mg–Si alloy, AA6060, which contains few dispersoids, have been investigated by hardness measurement, thermal analysis, transmission electron microscopy (TEM) and positron annihilation lifetime spectroscopy (PALS). It is shown that the quench sensitivity in this alloy is associated withmore » the degree of supersaturation of vacancies after cooling. Due to vacancy annihilation and clustering during natural ageing, the quench sensitivity is more pronounced after a short natural ageing time (30 min) compared to a longer natural ageing time (24 h). Therefore, prolonged natural ageing not only leads to an increase in hardness, but can also have a positive effect on the quench sensitivity of lean Al–Mg–Si alloys. - Highlights: • Significant quench sensitivity observed in AA6060 alloy after 30 min natural ageing • Prolonged natural ageing increased hardness and reduced QS. • Low dispersoid density leads to insignificant QS from non-hardening precipitates. • Vacancy supersaturation identified as a contributor to QS.« less

The roles of AMY1 copies and protein expression in human salivary α-amylase activity.

PubMed

Yang, Ze-Min; Lin, Jing; Chen, Long-Hui; Zhang, Min; Chen, Wei-Wen; Yang, Xiao-Rong

2015-01-01

Salivary α-amylase (sAA) activity has been extensively investigated in nutrition and psychology. But few studies were performed to assess the role played by sAA gene (AMY1) copies and protein expression in basal and stimulus-induced sAA activity. The sAA activity, amount and AMY1 copy number were determined from 184 saliva samples pre- and post-citric acid stimulation. Our findings showed that citric acid could induce significant increase in sAA activity, total sAA amount, and glycosylated sAA amount, among which the glycosylated sAA amount had the largest response. The correlation analysis showed that AMY1 copy number, total sAA amount and AMY1 copy number×total sAA amount had significantly positive and successively increasing correlations with sAA activity in unstimulated and stimulated saliva, respectively, and furthermore, we observed higher correlations in unstimulated saliva when compared with the corresponding correlations in stimulated saliva. We also observed significant correlations between glycosylated sAA amount and sAA activity in unstimulated and stimulated saliva, respectively. Interestingly, the correlations were higher in stimulated saliva than in unstimulated saliva, and the correlations between glycosylated sAA amount and sAA activity were higher than that of between total sAA amount and sAA activity in stimulated saliva. Moreover, total sAA amount ratio and glycosylated sAA amount ratio showed significantly positive correlation with sAA activity ratio. AMY1 copy number had no correlation with sAA activity ratio. These findings suggested that AMY1 copy number and sAA amount played crucial roles in sAA activity; however, the roles were attenuated after stimulation due to fortified release of glycosylated sAA. Copyright © 2014 Elsevier Inc. All rights reserved.

On the cellular metabolism of the click chemistry probe 19-alkyne arachidonic acid[S

PubMed Central

Robichaud, Philippe Pierre; Poirier, Samuel J.; Boudreau, Luc H.; Doiron, Jérémie A.; Barnett, David A.; Boilard, Eric; Surette, Marc E.

2016-01-01

Alkyne and azide analogs of natural compounds that can be coupled to sensitive tags by click chemistry are powerful tools to study biological processes. Arachidonic acid (AA) is a FA precursor to biologically active compounds. 19-Alkyne-AA (AA-alk) is a sensitive clickable AA analog; however, its use as a surrogate to study AA metabolism requires further evaluation. In this study, AA-alk metabolism was compared with that of AA in human cells. Jurkat cell uptake of AA was 2-fold greater than that of AA-alk, but significantly more AA-Alk was elongated to 22:4. AA and AA-alk incorporation into and remodeling between phospholipid (PL) classes was identical indicating equivalent CoA-independent AA-PL remodeling. Platelets stimulated in the pre­sence of AA-alk synthesized significantly less 12-lipoxygenase (12-LOX) and cyclooxygenase products than in the presence of AA. Ionophore-stimulated neutrophils produced significantly more 5-LOX products in the presence of AA-alk than AA. Neutrophils stimulated with only exogenous AA-alk produced significantly less 5-LOX products compared with AA, and leukotriene B4 (LTB4)-alk was 12-fold less potent at stimulating neutrophil migration than LTB4, collectively indicative of weaker leukotriene B4 receptor 1 agonist activity of LTB4-alk. Overall, these results suggest that the use of AA-alk as a surrogate for the study of AA metabolism should be carried out with caution. PMID:27538823

Induction of rapid and selective cell necrosis in Drosophila using Bacillus thuringiensis Cry toxin and its silkworm receptor.

PubMed

Obata, Fumiaki; Tanaka, Shiho; Kashio, Soshiro; Tsujimura, Hidenobu; Sato, Ryoichi; Miura, Masayuki

2015-07-08

Genetic ablation of target cells is a powerful tool to study the origins and functions of cells, tissue regeneration, or pathophysiology in a human disease model in vivo. Several methods for selective cell ablation by inducing apoptosis have been established, using exogenous toxins or endogenous proapoptotic genes. However, their application is limited to cells with intact apoptotic machinery. Herein, we established a method for inducing rapid and selective cell necrosis by the pore-forming bacterial toxin Cry1Aa, which is specifically active in cells expressing the Cry1Aa receptor (CryR) derived from the silkworm Bombyx mori. We demonstrated that overexpressing CryR in Drosophila melanogaster tissues induced rapid cell death of CryR-expressing cells only, in the presence of Cry1Aa toxin. Cry/CryR system was effective against both proliferating cells in imaginal discs and polyploid postmitotic cells in the fat body. Live imaging analysis of cell ablation revealed swelling and subsequent osmotic lysis of CryR-positive cells after 30 min of incubation with Cry1Aa toxin. Osmotic cell lysis was still triggered when apoptosis, JNK activation, or autophagy was inhibited, suggesting that Cry1Aa-induced necrotic cell death occurred independently of these cellular signaling pathways. Injection of Cry1Aa into the body cavity resulted in specific ablation of CryR-expressing cells, indicating the usefulness of this method for in vivo cell ablation. With Cry toxins from Bacillus thuringiensis, we developed a novel method for genetic induction of cell necrosis. Our system provides a "proteinous drill" for killing target cells through physical injury of the cell membrane, which can potentially be used to ablate any cell type in any organisms, even those that are resistant to apoptosis or JNK-dependent programmed cell death.

5 CFR 213.3102 - Entire executive civil service.

Code of Federal Regulations, 2014 CFR

2014-01-01

... the National Research Council under its post-doctoral research associate program, may not exceed 2..., stores and other businesses in which the servicing examining office can schedule tests and/or reasonably.... (aa) Scientific and professional research associate positions at GS-11 and above when filled on a...

5 CFR 213.3102 - Entire executive civil service.

Code of Federal Regulations, 2010 CFR

2010-01-01

... the National Research Council under its post-doctoral research associate program, may not exceed 2..., stores and other businesses in which the servicing examining office can schedule tests and/or reasonably.... (aa) Scientific and professional research associate positions at GS-11 and above when filled on a...

5 CFR 213.3102 - Entire executive civil service.

Code of Federal Regulations, 2012 CFR

2012-01-01

... the National Research Council under its post-doctoral research associate program, may not exceed 2..., stores and other businesses in which the servicing examining office can schedule tests and/or reasonably.... (aa) Scientific and professional research associate positions at GS-11 and above when filled on a...

5 CFR 213.3102 - Entire executive civil service.

Code of Federal Regulations, 2011 CFR

2011-01-01

... the National Research Council under its post-doctoral research associate program, may not exceed 2..., stores and other businesses in which the servicing examining office can schedule tests and/or reasonably.... (aa) Scientific and professional research associate positions at GS-11 and above when filled on a...

Mighty Morphin Power Ranger Play: Research and Reality.

ERIC Educational Resources Information Center

Crosser, Sandra

1995-01-01

Explores the question of whether or not Mighty Morphin Power Rangers-type aggressive play is developmentally appropriate for the early childhood classroom. Compares results from research in child development to the reality of television programming, highlighting the relationship between television violence and children's aggressive behavior. (AA)

Inhibition of free radical-induced erythrocyte hemolysis by 2-O-substituted ascorbic acid derivatives.

PubMed

Takebayashi, Jun; Kaji, Hiroaki; Ichiyama, Kenji; Makino, Kazutaka; Gohda, Eiichi; Yamamoto, Itaru; Tai, Akihiro

2007-10-15

Inhibitory effects of 2-O-substituted ascorbic acid derivatives, ascorbic acid 2-glucoside (AA-2G), ascorbic acid 2-phosphate (AA-2P), and ascorbic acid 2-sulfate (AA-2S), on 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH)-induced oxidative hemolysis of sheep erythrocytes were studied and were compared with those of ascorbic acid (AA) and other antioxidants. The order of the inhibition efficiency was AA-2S> or =Trolox=uric acid> or =AA-2P> or =AA-2G=AA>glutathione. Although the reactivity of the AA derivatives against AAPH-derived peroxyl radical (ROO(*)) was much lower than that of AA, the derivatives exerted equal or more potent protective effects on AAPH-induced hemolysis and membrane protein oxidation. In addition, the AA derivatives were found to react per se with ROO(*), not via AA as an intermediate. These findings suggest that secondary reactions between the AA derivative radical and ROO(*) play a part in hemolysis inhibition. Delayed addition of the AA derivatives after AAPH-induced oxidation of erythrocytes had already proceeded showed weaker inhibition of hemolysis compared to that of AA. These results suggest that the AA derivatives per se act as biologically effective antioxidants under moderate oxidative stress and that AA-2G and AA-2P may be able to act under severe oxidative stress after enzymatic conversion to AA in vivo.

The degree-related clustering coefficient and its application to link prediction

NASA Astrophysics Data System (ADS)

Liu, Yangyang; Zhao, Chengli; Wang, Xiaojie; Huang, Qiangjuan; Zhang, Xue; Yi, Dongyun

2016-07-01

Link prediction plays a significant role in explaining the evolution of networks. However it is still a challenging problem that has been addressed only with topological information in recent years. Based on the belief that network nodes with a great number of common neighbors are more likely to be connected, many similarity indices have achieved considerable accuracy and efficiency. Motivated by the natural assumption that the effect of missing links on the estimation of a node's clustering ability could be related to node degree, in this paper, we propose a degree-related clustering coefficient index to quantify the clustering ability of nodes. Unlike the classical clustering coefficient, our new coefficient is highly robust when the observed bias of links is considered. Furthermore, we propose a degree-related clustering ability path (DCP) index, which applies the proposed coefficient to the link prediction problem. Experiments on 12 real-world networks show that our proposed method is highly accurate and robust compared with four common-neighbor-based similarity indices (Common Neighbors(CN), Adamic-Adar(AA), Resource Allocation(RA), and Preferential Attachment(PA)), and the recently introduced clustering ability (CA) index.

Conference Proceedings for Optical Fiber Sensors Conference (8th) held in Monterey, California on January 29 - 31 1992

DTIC Science & Technology

1992-01-01

Research Center, East Hartford, CT Program Chair Anthony Dandridge Naval Research Laboratory, Washington, DC PROGRAM COMMnrTEE KIIIl BIetekjaer WAilliam W...Moray Norwegian knst. of Technology, Norway tkited Technologies Research Center, East Hartford, CT Jacek Chrostowski Julchl Noda National Research ...Technology, Boulder, CO Aa .Rgr Shacul Ezekiel *Vngs College, London, United lingdomn MIT, Lexington, MA Pee J. Samson Masamltsu Haruna BHP Central Research

Humans and machines in space: The vision, the challenge, the payoff; AAS Goddard Memorial Symposium, 29th, Washington, DC, March 14-15, 1991

NASA Astrophysics Data System (ADS)

Johnson, Bradley; May, Gayle L.; Korn, Paula

A recent symposium produced papers in the areas of solar system exploration, man machine interfaces, cybernetics, virtual reality, telerobotics, life support systems and the scientific and technology spinoff from the NASA space program. A number of papers also addressed the social and economic impacts of the space program. For individual titles, see A95-87468 through A95-87479.

Lowering the driving voltage and improving the luminance of blue fluorescent organic light-emitting devices by thermal annealing a hole injection layer of pentacene

NASA Astrophysics Data System (ADS)

Gao, Jian; Yu, Qian-Qian; Zhang, Juan; Liu, Yang; Jia, Ruo-Fei; Han, Jun; Wu, Xiao-Ming; Hua, Yu-Lin; Yin, Shou-Gen

2017-08-01

Not Available Project supported by the National Natural Science Foundation of China (Grant No. 60906022), the Natural Science Foundation of Tianjin, China (Grant No. 10JCYBJC01100), the Key Science and Technology Support Program of Tianjin, China (Grant No. 14ZCZDGX00006), and the National High Technology Research and Development Program of China (Grant No. 2013AA014201).

Anabolic/androgenic steroid administration during adolescence and adulthood differentially modulates aggression and anxiety.

PubMed

Morrison, Thomas R; Ricci, Lesley A; Melloni, Richard H

2015-03-01

Anabolic/androgenic steroid (AAS) use remains high in both teens and adults in the U.S. and worldwide despite studies showing that AAS use is associated with a higher incidence of aggression and anxiety. Recently we showed that chronic exposure to AAS through adolescence increases aggression and decreases anxious behaviors, while during AAS-withdrawal aggression is lowered to species-normative levels and anxiety increases. AAS exposure is known to differentially alter behaviors and their underlying neural substrates between adults and adolescents and thus the current study investigated whether exposure to AAS during adulthood affects the relationship between aggression and anxiety in a manner similar to that previously observed in adolescents. Male hamsters were administered a moderate dose of AAS (5.0mg/kg/day×30days) during adolescence (P27-56) or young adulthood (P65-P94) and then tested for aggression and anxiety during AAS exposure (i.e., on P57 or P95) and during AAS withdrawal (i.e., 30days later on P77 or P115). Adolescent exposure to AAS increased aggressive responding during the AAS exposure period and anxiety-like responding during AAS withdrawal. Neither behavior was similarly influenced by adult exposure to AAS. Adult AAS exposure produced no difference in aggressive responding during AAS exposure (P95) or AAS withdrawal (P115); however, while AAS exposure during adulthood produced no difference in anxiety-like responding during AAS exposure, adult hamsters administered AAS were less anxious than vehicle control animals following AAS withdrawal. Together these data suggest that the aggression and anxiety provoking influence of AAS are likely a developmental phenomenon and that adult exposure to AAS may be anxiolytic over the long term. Copyright © 2015 Elsevier Inc. All rights reserved.

Passive Multistatic Detection of Maritime Targets using Opportunistic Radars

DTIC Science & Technology

2014-03-01

coordinate position for aa =1:1:length(Err_time1) Err_Total1( aa ) = max(abs(Err_time1( aa )),abs(Err_L1( aa ))+abs(Err_thetaR1( aa ))); end for aa =1...1:length(Err_time1) Err_Total1( aa ) = max(abs(Err_Total1( aa )),abs(Err_thetaR1( aa ))); end 93 %%%%%%%%%%%%%%%%%%%%% Tx 2...Err_Total2=zeros(size(Err_time2)); % Find th emax of the three source of error and use that for that % coordinate position for aa =1:1:length

Concept Development for Software Health Management

NASA Technical Reports Server (NTRS)

Riecks, Jung; Storm, Walter; Hollingsworth, Mark

2011-01-01

This report documents the work performed by Lockheed Martin Aeronautics (LM Aero) under NASA contract NNL06AA08B, delivery order NNL07AB06T. The Concept Development for Software Health Management (CDSHM) program was a NASA funded effort sponsored by the Integrated Vehicle Health Management Project, one of the four pillars of the NASA Aviation Safety Program. The CD-SHM program focused on defining a structured approach to software health management (SHM) through the development of a comprehensive failure taxonomy that is used to characterize the fundamental failure modes of safety-critical software.

NASA Alumni League Dialogue

NASA Image and Video Library

2011-03-04

Former NASA Administrator James Beggs, left, and present NASA Administrator Charles Bolden conduct a dialogue on the future of the space program, Friday, March 4, 2011, at NASA Headquarters in Washington. Beggs was NASA's sixth administrator serving from July 1981 to December 1985. Bolden took over the post as NASA's 12th administrator in July 2009. The dialogue is part of the program “The State of the Agency: NASA Future Programs Presentation” sponsored by the NASA Alumni League with support from the AAS, AIAA, CSE and WIA.Photo Credit: (NASA/Paul E. Alers)

The influence of ochratoxin A on DNA adduct formation by the carcinogen aristolochic acid in rats.

PubMed

Stiborová, Marie; Bárta, František; Levová, Kateřina; Hodek, Petr; Frei, Eva; Arlt, Volker M; Schmeiser, Heinz H

2015-11-01

Exposure to the plant nephrotoxin and carcinogen aristolochic acid (AA) leads to the development of AA nephropathy, Balkan endemic nephropathy (BEN) and upper urothelial carcinoma (UUC) in humans. Beside AA, exposure to ochratoxin A (OTA) was linked to BEN. Although OTA was rejected as a factor for BEN/UUC, there is still no information whether the development of AA-induced BEN/UUC is influenced by OTA exposure. Therefore, we studied the influence of OTA on the genotoxicity of AA (AA-DNA adduct formation) in vivo. AA-DNA adducts were formed in liver and kidney of rats treated with AA or AA combined with OTA, but no OTA-related DNA adducts were detectable in rats treated with OTA alone or OTA combined with AA. Compared to rats treated with AA alone, AA-DNA adduct levels were 5.4- and 1.6-fold higher in liver and kidney, respectively, of rats treated with AA combined with OTA. Although AA and OTA induced quinone oxidoreductase (NQO1) activating AA to DNA adducts, their combined treatment did not lead to either higher NQO1 enzyme activity or higher AA-DNA adduct levels in ex vivo incubations. Oxidation of AA I (8-methoxy-6-nitrophenanthro[3,4-d]-1,3-dioxole-5-carboxylic acid) to its detoxification metabolite, 8-hydroxyaristolochic acid, was lower in microsomes from rats treated with AA and OTA, and this was paralleled by lower activities of cytochromes P450 1A1/2 and/or 2C11 in these microsomes. Our results indicate that a decrease in AA detoxification after combined exposure to AA and OTA leads to an increase in AA-DNA adduct formation in liver and kidney of rats.

40 CFR Table Aa-1 to Subpart Aa of... - Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 22 2013-07-01 2013-07-01 false Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O AA Table AA-1 to Subpart AA of Part 98 Protection of Environment... Paper Manufacturing Pt. 98, Subpt. AA, Table AA-1 Table AA-1 to Subpart AA of Part 98—Kraft Pulping...

40 CFR Table Aa-1 to Subpart Aa of... - Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 21 2011-07-01 2011-07-01 false Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O AA Table AA-1 to Subpart AA of Part 98 Protection of Environment... Paper Manufacturing Pt. 98, Subpt. AA, Table AA-1 Table AA-1 to Subpart AA of Part 98—Kraft Pulping...

40 CFR Table Aa-2 to Subpart Aa of... - Kraft Lime Kiln and Calciner Emissions Factors for CH4 and N2O

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 21 2014-07-01 2014-07-01 false Kraft Lime Kiln and Calciner Emissions Factors for CH4 and N2O AA Table AA-2 to Subpart AA of Part 98 Protection of Environment ENVIRONMENTAL... Manufacturing Pt. 98, Subpt. AA, Table AA -2 Table AA-2 to Subpart AA of Part 98—Kraft Lime Kiln and Calciner...

40 CFR Table Aa-1 to Subpart Aa of... - Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 22 2012-07-01 2012-07-01 false Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O AA Table AA-1 to Subpart AA of Part 98 Protection of Environment... Paper Manufacturing Pt. 98, Subpt. AA, Table AA-1 Table AA-1 to Subpart AA of Part 98—Kraft Pulping...

40 CFR Table Aa-1 to Subpart Aa of... - Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 21 2014-07-01 2014-07-01 false Kraft Pulping Liquor Emissions Factors for Biomass-Based CO2, CH4, and N2O AA Table AA-1 to Subpart AA of Part 98 Protection of Environment... Paper Manufacturing Pt. 98, Subpt. AA, Table AA-1 Table AA-1 to Subpart AA of Part 98—Kraft Pulping...

Effects of kale ingestion on pharmacokinetics of acetaminophen in rats.

PubMed

Yamasaki, Izumi; Uotsu, Nobuo; Yamaguchi, Kohji; Takayanagi, Risa; Yamada, Yasuhiko

2011-12-01

Kale is a cruciferous vegetable (Brassicaceae) that contains a large amount of health-promoting phytochemicals. The chronic ingestion of cabbage of the same family is known to accelerate conjugating acetaminophen (AA) and decrease the plasma AA level. Therefore, we examined to clarify the effects of kale on the pharmacokinetics of AA, its glucuronide (AA-G) and sulfate (AA-S). AA was orally administered to rats pre-treated with kale or cabbage (2000 mg/kg/day) for one week. Blood samples were collected from the jugular vein, and the concentrations of AA, AA-G and AA-S were determined. In results, kale ingestion induced an increase in the area under the concentration-time curve (AUC) and a decrease in the clearance of AA, whereas cabbage had almost no influence. In addition, there were significant differences in the AUC of AA-G between the control and kale groups. mRNA expression levels of UDP-glucuronosyltransferases, the enzymes involved in glucuronidation, in the kale group were significantly higher than those in the control group. In conclusion, kale ingestion increased the plasma concentrations of both AA and AA-G. The results suggest that kale ingestion accelerates the glucuronidation of AA, but an increase of plasma AA levels has a different cause than the cause of glucuronidation.

Trajectories of Suicidal Ideation from Sixth through Tenth Grades in Predicting Suicide Attempts in Young Adulthood in an Urban African American Cohort.

PubMed

Musci, Rashelle J; Hart, Shelley R; Ballard, Elizabeth D; Newcomer, Alison; Van Eck, Kathryn; Ialongo, Nicholas; Wilcox, Holly

2016-06-01

The trajectory of suicidal ideation across early adolescence may inform the timing of suicide prevention program implementation. This study aimed to identify developmental trajectories of suicidal ideation among an urban cohort of community-residing African Americans (AA) longitudinally followed from middle school through early adulthood (ages 11-19 years). Subtypes based on the developmental course of suicidal ideation from late childhood through mid-adolescence were identified using longitudinal latent class analysis (LLCA) with 581 AA adolescents (52.7% male; 71.1% free or reduced school meals). The developmental trajectories of suicidal ideation were then used to predict suicide attempts in young adulthood. Our LLCA indicated two subtypes (i.e., ideators and nonideators), with 8% of the sample in the ideator class. This trajectory class shows a peak of suicidal ideation in seventh grade and a steady decline in ideation in subsequent grades. Additionally, suicidal ideation trajectories significantly predicted suicide attempt. Results of these analyses suggest the need for suicide prevention approaches prior to high school for AA youth. © 2015 The American Association of Suicidology.

The AAS Working Group on Accessibility and Disability (WGAD): Year 1 Highlights

NASA Astrophysics Data System (ADS)

Aarnio, Alicia; Monkiewicz, Jacqueline; Murphy, Nicholas Arnold; Nordhaus, Jason; Tuttle, Sarah E.

2017-01-01

The AAS Working Group on Accessibility and Disability (WGAD) was formed in January of 2016 with the express purpose of seeking equity of opportunity and building inclusive practices for disabled astronomers at all career stages. In our first year, the WGAD has been actively developing resources and the online infrastructure for the dissemination of information and engagement with the astronomy community. Our official WGAD website has gone live, and we have used both the access: astronomy google group and blog to discuss specific issues of disability justice and to raise awareness for less-discussed barriers to access. The WGAD has developed relationships and collaboration with AAS inclusion committees (SGMA, CSMA, CSWA) so our work can recognize and address the intersections of identity astronomers occupy. In this presentation, we summarize our year one activities, focusing on our recently developed set of recommendations for journal accessibility to ensure everyone can engage with journal content and navigate the submission process. We will also discuss ongoing and future endeavors: a best practices guide for accessibility to be available via our website, and a site visit program.

Peer navigation in African American breast cancer survivors.

PubMed

Mollica, Michelle A; Nemeth, Lynne S; Newman, Susan D; Mueller, Martina; Sterba, Katherine

2014-01-01

The purpose of this study was to explore the feasibility and acceptability of a peer navigation survivorship program for African American (AA) breast cancer survivors (BCS) and its potential effects on selected short-term outcomes according to the Quality of Life Model Applied to Cancer Survivors. An AA BCS who completed treatment over 1 year prior to the study was trained as a peer navigator (PN), and then paired with AA women completing primary breast cancer treatment (n=4) for 2 months. This mixed-methods, proof of concept study utilized a convergent parallel approach to explore feasibility and investigate whether changes in scores are favorable using interviews and self-administered questionnaires. Results indicate that the PN intervention was acceptable by both PN and BCS, and was feasible in outcomes of recruitment, cost, and time requirements. Improvements in symptom distress, perceived support from God, and preparedness for recovery outcomes were observed over time. Qualitative analysis revealed six themes emerging from BCS interviews: "learning to ask the right questions", "start living life again", "shifting my perspective", "wanting to give back", "home visits are powerful", and "we both have a journey": support from someone who has been there. Results support current literature indicating that AA women who have survived breast cancer can be an important source of support, knowledge, and motivation for those completing breast cancer treatment. Areas for future research include standardization of training and larger randomized trials of PN intervention. The transition from breast cancer patient to survivor is a period when there can be a loss of safety net concurrent with persistent support needs. AA cancer survivors can benefit from culturally tailored support and services after treatment for breast cancer. With further testing, this PN intervention may aid in decreasing general symptom distress and increase readiness for recovery post-treatment.

My First AAS Meeting: Bloomington and ANN Arbor, June 1950

NASA Astrophysics Data System (ADS)

Osterbrock, D. E.

1999-05-01

I attended my first AAS meeting at the end of my first year as a graduate student at Yerkes Observatory, in the summer of 1950. Yerkes was the home base of the astronomy faculty, staff, and graduate students of the University of Chicago, and a large contingent went to this meeting at nearby Indiana University, and then on to the symposium immediately following it at the University of Michigan. In this paper I will describe these meetings so as to bring out the differences between this typical AAS meeting nearly half a century ago, and one today, as well as their similarities. Briefly, the main differences resulted from the fact that astronomy was much smaller then, and less well funded. Membership in the AAS, attendance at its 1950 meeting, and the number of papers presented were all smaller by factors of roughly ten than now. Most astronomers paid their own expenses to meetings, or were only reimbursed for part of them by their universities. Hence most meetings were held on university campuses. There were no registration fees, and the receptions, picnics, and outings were provided by the ``host" institution, which treated the visiting astronomers as its guests. The AAS had no paid staff. There were no parallel sessions nor poster papers. Members submitted only titles for their papers, most of them on stars; fewer on planets, asteroids and meteors; and fewer still on interstellar matter, gaseous nebulae, galaxies, or cosmology. Research papers were the most important part of the meeting, but ``teachers' sessions," the equivalent of the education sessions of today, were part of the program too. Seeing old friends and meeting new ones were an important, unscheduled part of the meeting. This paper will provide a narrative of these meetings, illustrated by photographs of groups, scenes, and astronomers.

AAS Oral History Project - Seeking Planetary Scientist

NASA Astrophysics Data System (ADS)

Buxner, Sanlyn; Holbrook, Jarita

2016-10-01

Now in its fourth year, the AAS Oral History Project has interviewed over 100 space scientists from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from space scientists at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees' personal and professional lives. Questions include those about one's family, childhood, strong influences on one's scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. We will present preliminary analysis of those interviewed including characterizing career status, age range, nationality, and primary field. Additionally, we will discuss trends beginning to emerge in analysis of participants' responses about data driven science and advice to the next generation. Future analysis will reveal a rich story of space scientists and will help the community address issues of diversity, controversies, and the changing landscape of science. We are actively recruiting individuals to be interviewed at this meeting from all stages of career from undergraduate students to retired and emeritus astronomers. We are especially interested in interviewing 40+E members of DPS. Contact Sanlyn Buxner to schedule an interview or to find out more information about the project (buxner@psi.edu). Contact Jarita Holbrook if you would like to become an interviewer for the project (astroholbrook@gmail.com).

The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubota, Akira; Bainy, Afonso C.D.; Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900

2013-10-01

The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs.more » On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with any CYP2 subfamily in mammals. • Induction of CYP2AA1 and CYP2AA2 indicates a phenobarbital-type response in fish.« less

Comparative readability of enroute low altitude charts with and without terrain depiction.

DOT National Transportation Integrated Search

1978-04-01

The U.S. National Ocean Survey has issued an experimental copy of Enroute Low Altitude Chart L-3/4 dated April 21, 1977, as part of a program to explore the feasibility of introducing terrain depiction on the charts. The FAA's Air Traffic Service (AA...

77 FR 67572 - Magnet Schools Assistance Program

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-13

... DEPARTMENT OF EDUCATION 34 CFR Part 280 [Docket ID ED-2010-OII-0003] RIN 1855-AA07 Magnet Schools... school districts in light of Parents Involved. On December 2, 2011, the Departments of Education and... Racial Isolation in Elementary and Secondary Schools'' (Guidance) is available on the Department's Web...

75 FR 50713 - Procedural Changes to the Fire Management Assistance Declaration Process

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-17

... FEMA-2010-0036] RIN-1660-AA72 Procedural Changes to the Fire Management Assistance Declaration Process... Federal Emergency Management Agency (FEMA) is updating its Fire Management Assistance Grant Program regulations to reflect a change in the internal delegation of authority for fire management assistance...

78 FR 14740 - Disaster Assistance; Fire Management Assistance Grant (FMAG) Program-Deadline Extensions and...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-07

... [Docket ID FEMA-2013-0004] RIN 1660-AA78 Disaster Assistance; Fire Management Assistance Grant (FMAG..., DHS. ACTION: Proposed rule. SUMMARY: FEMA proposes to revise its Fire Management Assistance Grant...-2340, or (email) [email protected] . SUPPLEMENTARY INFORMATION: I. Background The Fire Management...

76 FR 36482 - Affirmative Action and Nondiscrimination Obligations of Contractors and Subcontractors Regarding...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-22

... DEPARTMENT OF LABOR Office of Federal Contract Compliance Programs 41 CFR Parts 60-250 and 60-300 RIN 1250-AA00 Affirmative Action and Nondiscrimination Obligations of Contractors and Subcontractors... Nondiscrimination Obligations of Contractors and Subcontractors Regarding Protected Veterans'' (76 FR 23358). OFCCP...

75 FR 55503 - National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-13

... hepatitis A, trivalent influenza, meningococcal, and human papillomavirus (HPV) vaccines. The Table includes... 300aa-14(e)(2). The prerequisites for adding the hepatitis A, trivalent influenza, meningococcal, and... Secretary published a notice in the Federal Register announcing that hepatitis A vaccines were covered under...

The Edelman Galileoscope Education Program: A Collaboration Among Professional Societies

NASA Astrophysics Data System (ADS)

Pompea, Stephen M.; Marvel, K. B.; Fienberg, R. T.; Arion, D. N.; Herrold, A.; Kruse, B.; Sparks, R. T.; Dugan, C.

2011-01-01

The Edelman Galileoscope Education Program is an ongoing national effort to provide K-12 teachers with Galileoscope refractor kits and the proper training to use them effectively for teaching scientific concepts and observational skills. As such it represents a strategic effort to excite children about astronomy and provides them with a powerful tool to increase science literacy. The program was made possible by a generous gift from Jean and Ric Edelman to the American Astronomical Society (AAS). The AAS teamed with the National Optical Astronomy Observatory (NOAO); Galileoscope, LLC; the National Earth Science Teachers Association (NESTA); and the Astronomical Society of the Pacific (ASP) to distribute telescopes, mainly during teacher workshops. Through the professional development efforts of NESTA, ASP, and NOAO's Teaching With Telescopes program some 1,400 teachers received Galileoscopes and hands-on training on how to teach optics and astronomy with them. All participating teachers received Galileoscopes free of charge. Another 1,500 or so teachers not connected with these organizations also received telescopes free of charge through an Internet ordering system, paying only for shipping. Under this combination of programs more than 15,000 Galileoscopes have been given to active teachers, reaching an estimated 300,000 students. The professional development program uses a combination of face-to-face workshops, a train-the-trainer model, and Internet-based self-paced instruction. We describe the Edelman Galileoscope Education Program design, training materials, and distribution networks, as well as the geographic distribution of the teachers who received Galileoscopes. This program represents an efficient and effective model for quickly distributing valuable science teaching materials to urban, suburban, and rural teachers _ including homeschoolers _ across the United States.

75 FR 80838 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-23

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11908, AA-11915, AA-11916, AA-11917, AA-11909, AA-11913, AA-11914; LLAK-962000-L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of decision approving lands for conveyance. SUMMARY: As...

76 FR 55415 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-07

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-9428, AA-9752, AA-11237, AA-9755, AA-9837, AA-10075, AA-11467; LLAK-965000-L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of decision approving lands for conveyance. SUMMARY: As...

Influences of AMY1 gene copy number and protein expression on salivary alpha-amylase activity before and after citric acid stimulation in splenic asthenia children.

PubMed

Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen

2015-06-01

To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.

Risk Analysis in Support of the Chemical Stockpile Disposal Program (CSDP). Volume 2. Consequence Data

DTIC Science & Technology

1987-12-17

OO O~oO~o OQOQCoOQOO 0000000000 UI z 00.00000000 0 0 0 0 0 0 0 0 0 0 0 0 U- (11KW f1 0Z =. -c OQ OO OO O OO O OO O OO O OO O OOIn O-WO 0 0 00 0 0 0 0...I.-.Oc.eaa aL ac ca ac aa ec a - acu~~~~~~~~~~~~~ .*..**-w aaca a8ac c e c acca ~~~~~~~~C a a9 a a ! a! a9 an aaacaaca aa aao ecaaaa z " .- C; Va ~cc a

Evolution of insect arylalkylamine N-acetyltransferases: Structural evidence from the yellow fever mosquito, Aedes aegypti

PubMed Central

Han, Qian; Robinson, Howard; Ding, Haizhen; Christensen, Bruce M.; Li, Jianyong

2012-01-01

Arylalkylamine N-acetyltransferase (aaNAT) catalyzes the transacetylation from acetyl-CoA to arylalkylamines. aaNATs are involved in sclerotization and neurotransmitter inactivation in insects. Phyletic distribution analysis confirms three clusters of aaNAT-like sequences in insects: typical insect aaNAT, polyamine NAT-like aaNAT, and mosquito unique putative aaNAT (paaNAT). Here we studied three proteins: aaNAT2, aaNAT5b, and paaNAT7, each from a different cluster. aaNAT2, a protein from the typical insect aaNAT cluster, uses histamine as a substrate as well as the previously identified arylalkylamines. aaNAT5b, a protein from polyamine NAT -like aaNAT cluster, uses hydrazine and histamine as substrates. The crystal structure of aaNAT2 was determined using single-wavelength anomalous dispersion methods, and that of native aaNAT2, aaNAT5b and paaNAT7 was detected using molecular replacement techniques. All three aaNAT structures have a common fold core of GCN5-related N-acetyltransferase superfamily proteins, along with a unique structural feature: helix/helices between β3 and β4 strands. Our data provide a start toward a more comprehensive understanding of the structure–function relationship and physiology of aaNATs from the mosquito Aedes aegypti and serve as a reference for studying the aaNAT family of proteins from other insect species. The structures of three different types of aaNATs may provide targets for designing insecticides for use in mosquito control. PMID:22753468

Topical Application of Trisodium Ascorbyl 6-Palmitate 2-Phosphate Actively Supplies Ascorbate to Skin Cells in an Ascorbate Transporter-Independent Manner

PubMed Central

Shibuya, Shuichi; Sakaguchi, Ikuyo; Ito, Shintaro; Kato, Eiko; Watanabe, Kenji; Izuo, Naotaka; Shimizu, Takahiko

2017-01-01

Ascorbic acid (AA) possesses multiple beneficial functions, such as regulating collagen biosynthesis and redox balance in the skin. AA derivatives have been developed to overcome this compound’s high fragility and to assist with AA supplementation to the skin. However, how AA derivatives are transferred into cells and converted to AA in the skin remains unclear. In the present study, we showed that AA treatment failed to increase the cellular AA level in the presence of AA transporter inhibitors, indicating an AA transporter-dependent action. In contrast, torisodium ascorbyl 6-palmitate 2-phosphate (APPS) treatment significantly enhanced the cellular AA level in skin cells despite the presence of inhibitors. In ex vivo experiments, APPS treatment also increased the AA content in a human epidermis model. Interestingly, APPS was readily metabolized and converted to AA in keratinocyte lysates via an intrinsic mechanism. Furthermore, APPS markedly repressed the intracellular superoxide generation and promoted viability associated with an enhanced AA level in Sod1-deficient skin cells. These findings indicate that APPS effectively restores the AA level and normalizes the redox balance in skin cells in an AA transporter-independent manner. Topical treatment of APPS is a beneficial strategy for supplying AA and improving the physiology of damaged skin. PMID:28640219

An evaluation of pharmacology curricula in Australian science and health-related degree programs.

PubMed

Lloyd, Hilary; Hinton, Tina; Bullock, Shane; Babey, Anna-Marie; Davis, Elizabeth; Fernandes, Lynette; Hart, Joanne; Musgrave, Ian; Ziogas, James

2013-11-19

Pharmacology is a biomedical discipline taught in basic science and professional degree programs. In order to provide information that would facilitate pharmacology curricula to be refined and developed, and approaches to teaching to be updated, a national survey was undertaken in Australia that investigated pharmacology course content, teaching and summative assessment methods. Twenty-two institutions participated in a purpose-built online questionnaire, which enabled an evaluation of 147 courses taught in 10 different degrees. To enable comparison, degrees were grouped into four major degree programs, namely science, pharmacy, medicine and nursing. The pharmacology content was then classified into 16 lecture themes, with 2-21 lecture topics identified per theme. The resultant data were analysed for similarities and differences in pharmacology curricula across the degree programs. While all lecture themes were taught across degree programs, curriculum content differed with respect to the breadth and hours of coverage. Overall, lecture themes were taught most broadly in medicine and with greatest coverage in pharmacy. Reflecting a more traditional approach, lectures were a dominant teaching method (at least 90% of courses). Sixty-three percent of science courses provided practical classes but such sessions occurred much less frequently in other degree programs, while tutorials were much more common in pharmacy degree programs (70%). Notably, problem-based learning was common across medical programs. Considerable diversity was found in the types of summative assessment tasks employed. In science courses the most common form of in-semester assessment was practical reports, whereas in other programs pen-and-paper quizzes predominated. End-of-semester assessment contributed 50-80% to overall assessment across degree programs. The similarity in lecture themes taught across the four different degree programs shows that common knowledge- and competency-based learning outcomes can be defined for pharmacology. The authors contend that it is the differences in breadth and coverage of material for each lecture theme, and the differing teaching modes and assessment that characterise particular degree programs. Adoption of pharmacology knowledge-based learning outcomes that could be tailored to suit individual degree programs would better facilitate the sharing of expertise and teaching practice than the current model where pharmacology curricula are degree-specific.

Bridging soft-hard transport properties of quark-gluon plasmas with CUJET3.0

DOE PAGES

Xu, Jiechen; Liao, Jinfeng; Gyulassy, Miklos

2016-02-01

A new model (CUJET3.0) of jet quenching in nuclear collisions coupled to bulk data constrained (VISH2+1D) viscous hydrodynamic backgrounds is constructed by generalizing the perturbative QCD based (CUJET2.0) model to include two complementary non-perturbative chromodynamical features of the QCD con_nement cross-over phase transition near Tc ≈ 160 MeV: (1) the suppression of quark and gluon chromo-electric-charged (cec) degrees of freedom and (2) the emergence of chromo-magnetic-monopole (cmm) degrees of freedom. Such a semi Quark Gluon Monopole Plasma (sQGMP) microscopic scenario is tested by comparing predictions of the leading hadron nuclear modification factors, R AA h (pT > 10GeV=c;√s), and theirmore » azimuthal elliptic asymmetry v 2 h (pT > 10GeV=c;√s) with available data on h =π, D;B jet fragments from nuclear collisions at RHIC (√s = 0.2 ATeV) and LHC(√s = 2.76 ATeV). The cmm degrees of freedom in the sQGMP model near T c are shown to solve robustly the long standing R AA vs v 2 puzzle by predicting a maximum of the jet quenching parameter field g(E; T)/T 3 near T c. The robustness of CUJET3.0 model to a number of theoretical uncertainties is critically tested. Moreover the consistency of jet quenching with observed bulk perfect uidity is demonstrated by extrapolating the sQGMP qˆ down to thermal energy E ~ 3T scales and showing that the sQGMP shear viscosity to entropy density ratio η/s ≈ T 3/qˆ falls close to the unitarity bound, 1/4π, in the range (1–2)Tc. Detailed comparisons of the CUJET2.0 and CUJET3.0 models reveal the fact that remarkably different qˆ(T) dependence could be consistent with the same R AA data and could only be distinguished by anisotropy observables. Furthermore, these findings demonstrate clearly the inadequacy of focusing on the jet path averaged quantity as the only relevant medium property to characterize jet quenching, and point to the crucial roles of other essential factors beyond just the , such as the chromo electric and magnetic composition of the plasma, the screening masses and the running couplings at multiple scales which all strongly influence jet energy loss.« less

[Levels of serum ascorbate and its metabolites in hemodialysis patients].

PubMed

Hirano, Hiroko; Tone, Yoshinori; Otani, Haruhisa; Oya, Masaki; Kimura, Keigo; Saika, Yasushi; Fujii, Ryoichi; Mune, Masatoshi; Ichinose, Masakazu; Yukawa, Susumu

2004-07-01

The status of ascorbic acid (AA) in dialysis patients is the subject of debate. Some reports have found AA to be deficient in dialysis patients, while others have found that AA is not deficient. In an attempt to confirm AA serum concentrations in dialysis patients, we analyzed the concentrations of AA as well as its metabolites using the specific determination of AA with chemical derivatization and the HPLC method. We studied 131 patients under maintenance hemodialysis therapy (HD), 23 patients with chronic renal failure (CRF) and 48 healthy controls (C). Serum concentrations of AA and the AA metabolites dehydroascorbic acid (DHA) and 2, 3-diketogulonate (DKG) were measured by HPLC. Nine HD patients were taking AA supplements. Seventy-six (62.3%) of the 122 HD patients not taking AA supplements exhibited deficient levels of AA (< 20 microM), while 13 (56.5%) of the 23 CRF patients and 9 (18.8%) of the 48 C showed deficient levels of AA. Analysis of AA metabolites in the normal-range AA (20-80 microM) group revealed that the DHA/AA ratio in HD patients was significantly higher than in C (3.3 +/- 2.6% and 1.2 +/- 2.2%, respectively). The DKG/AA ratio in HD patients was higher than in CRF patients (3.6 +/- 5.2% vs. 0.9 +/- 1.9%), whereas DKG was not detected in C. When compared to serum levels before the start of dialysis, serum AA, DHA and DKG concentrations at the end of the dialysis session decreased by an average of 74.2, 84.0 and 78.8% respectively. In HD patients, serum levels of thiobarbituric reactive substances (TBARS) were significantly lower in the higher AA (> 80 microM) group than in the deficient and normal-range AA groups. In 12 AA-deficient patients, after 1 month of taking AA supplements (200 mg/day), serum AA levels rose to 79.9 microM, while serum TBARS level declined when compared with levels before supplementation. In conclusion, the frequency of AA deficiency in dialysis patients is extremely high. AA deficiency in HD patients may result in high TBARS levels, which reflect increased oxidative stress. Adequate AA supplementation should therefore be considered in such patients.

76 FR 16804 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-25

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-8102-05, AA-8102-08, AA-8102-10, AA-8102-25, AA-8102-28, AA-8102- 37, AA-8102-47; LLAK965000-L14100000-KC0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of decision approving lands for...

76 FR 43340 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-20

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-6682-B, AA-6682-D, AA-6682-E, AA-6682-G, AA-6682-H, AA-6682-I, AA- 6682-A2; LLAK965000-L14100000-KC0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of Decision Approving Lands for Conveyance...

75 FR 13296 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-19

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-6679-B, AA-6679-C, AA-6679-F, AA-6679-G, AA-6679-K, AA-6679-M, AA- 6679-A2, LLAK964000-L14100000-KC0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of Decision Approving Lands for Conveyance...

Synthesis and characterization of agricultural controllable humic acid superabsorbent.

PubMed

Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

2013-12-01

Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent. Copyright © 2013 The Research Centre for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V. All rights reserved.

The ratio of serum n-3 to n-6 polyunsaturated fatty acids is associated with diabetes mellitus in patients with prior myocardial infarction: a multicenter cross-sectional study.

PubMed

Takahashi, Masao; Ando, Jiro; Shimada, Kazunori; Nishizaki, Yuji; Tani, Shigemasa; Ogawa, Takayuki; Yamamoto, Masato; Nagao, Ken; Hirayama, Atsushi; Yoshimura, Michihiro; Daida, Hiroyuki; Nagai, Ryozo; Komuro, Issei

2017-01-26

In prior myocardial infarction (PMI) patients, diabetes mellitus (DM), dyslipidemia, and hypertension increase the risk of secondary cardiovascular events. Although a decreased ratio of serum eicosapentaenoic acid (EPA) to arachidonic acid (AA; EPA/AA) has been shown to significantly correlate with the onset of acute coronary syndrome, the associations between polyunsaturated fatty acid (PUFA) levels and coronary risk factors in PMI patients have not been evaluated thoroughly. This study aimed to assess the associations between PUFAs levels and the risk factors in PMI patients. We enrolled 1733 patients with known PUFA levels who were treated in five divisions of cardiology in a metropolitan area of Japan, including 303 patients with PMI. EPA/AA and docosahexaenoic acid (DHA) to AA level ratio (DHA/AA) in patients with and without PMI were analyzed according to presence of coronary risk factors. Diabetes patients with PMI had significantly lower EPA/AA and DHA/AA than diabetes patients without PMI (EPA/AA: P <0.01; DHA/AA: P =0.003), with no such differences in dyslipidemia and hypertension patients. In DM patients with high high-sensitivity C-reactive protein (hs-CRP) levels (>0.1 mg/dL), EPA/AA was low in individuals who also had PMI, whereas DHA/AA was not (EPA/AA, with PMI: 0.43 ± 0.24; without PMI: 0.53 ± 0.30, P < 0.05). Moreover, patients on statins had significantly lower DHA/AA ratios, whereas the EPA/AA ratio did not depend on statin use. Multiple regression analysis revealed that statin use in DM patients was associated with low DHA/AA but not EPA/AA. PMI patients with DM have low EPA/AA and DHA/AA. EPA/AA and DHA/AA are differently related to hs-CRP level in DM patients with PMI. Statin use can potentially affect DHA/AA but not EPA/AA, and therefore EPA/AA ratio is a better marker of assessment for cardiovascular events.

Ascorbic acid deficiency aggravates stress-induced gastric mucosal lesions in genetically scorbutic ODS rats.

PubMed

Ohta, Y; Chiba, S; Imai, Y; Kamiya, Y; Arisawa, T; Kitagawa, A

2006-12-01

We examined whether ascorbic acid (AA) deficiency aggravates water immersion restraint stress (WIRS)-induced gastric mucosal lesions in genetically scorbutic ODS rats. ODS rats received scorbutic diet with either distilled water containing AA (1 g/l) or distilled water for 2 weeks. AA-deficient rats had 12% of gastric mucosal AA content in AA-sufficient rats. AA-deficient rats showed more severe gastric mucosal lesions than AA-sufficient rats at 1, 3 or 6 h after the onset of WIRS, although AA-deficient rats had a slight decrease in gastric mucosal AA content, while AA-sufficient rats had a large decrease in that content. AA-deficient rats had more decreased gastric mucosal nonprotein SH and vitamin E contents and increased gastric mucosal lipid peroxide content than AA-sufficient rats at 1, 3 or 6 h of WIRS. These results indicate that AA deficiency aggravates WIRS-induced gastric mucosal lesions in ODS rats by enhancing oxidative damage in the gastric mucosa.

Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

PubMed

Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

2016-01-01

Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

Authentic Astronomy Research Experiences for Teachers: The NASA/IPAC Teacher Archive Research Program (NITARP)

NASA Astrophysics Data System (ADS)

Rebull, L. M.; Gorjian, V.; Squires, G.; Nitarp Team

2012-08-01

How many times have you gotten a question from the general public, or read a news story, and concluded that "they just don't understand how real science works?" One really good way to get the word out about how science works is to have more people experience the process of scientific research. Since 2004, the way we have chosen to do this is to provide authentic research experiences for teachers using real data (the program used to be called the Spitzer Teacher Program for Teachers and Students, which in 2009 was rechristened the NASA/IPAC Teacher Archive Research Program, or NITARP). We partner small groups of teachers with a mentor astronomer, they do research as a team, write up a poster, and present it at an American Astronomical Society (AAS) meeting. The teachers incorporate this experience into their classroom, and their experiences color their teaching for years to come, influencing hundreds of students per teacher. This program differs from other similar programs in several important ways. First, each team works on an original, unique project. There are no canned labs here! Second, each team presents their results in posters at the AAS, in science sessions (not outreach sessions). The posters are distributed throughout the meeting, in amongst other researchers' work; the participants are not "given a free pass" because they are teachers. Finally, the "product" of this project is the scientific result, not any sort of curriculum packet. The teachers adapt their project to their classroom environment, and we change the way they think about science and scientists.

Proposed Accreditation Standards for Degree-Granting Correspondence Programs Offered by Accredited Institutions.

ERIC Educational Resources Information Center

McGraw-Hill Continuing Education Center, Washington, DC.

A study on proposed accreditation standards grew out of a need to (1) stimulate the growth of quality correspondence degree programs; and (2) provide a policy for accreditation of correspondence degree programs so that graduates would be encouraged to pursue advanced degree programs offered elsewhere by educational institutions. The study focused…

Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

PubMed

Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

2018-03-01

To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

75 FR 69457 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-12

..., AA-8102-30, AA-8102-31, AA-8102-32, AA-8102-33, AA-8102-34, AA-8102-47; LLAK965000-L14100000-KC0000-P... at 907-271-5960, by e-mail at ak[email protected] , or by telecommunication device (TTD...

Effects of a retention intervention program for associate degree nursing students.

PubMed

Fontaine, Karen

2014-01-01

To evaluate the effects of a retention intervention program on nursing students' persistence in obtaining an associate's degree. An associate degree nursing program at a large community college used a three-year grant from the US Department of Labor to create a program to improve retention of nursing students. Seven retention interventions (stipends, learning communities, comprehensive orientation, individualized academic planning, counseling, peer tutoring, and community nurse mentoring) were provided to participants. Correlational analyses were conducted between demographic variables and degree completion and between individual intervention program participation and degree completion. The program produced a statistically significant improvement in retention, but no specific intervention or mixture of interventions was significantly correlated with retention. Retention programs must be comprehensive, integrated efforts in order to increase the degree completion rate.

MD/MBA Students: An Analysis of Medical Student Career Choice.

PubMed

Sherrill, Windsor Westbrook

2004-12-01

An increasing number of medical schools are offering dual degree MD/MBA programs. Career choices and factors influencing students to enter these programs provide an indicator of the roles in which dual degree students will serve in health care as well as the future of dual degree programs. Using career choice theory as a conceptual framework, career goals and factors influencing decisions to enter dual degree programs were assessed among dual degree medical students. Students enrolled at dual degree programs at six medical schools were surveyed and interviewed. A control group of traditional medical students was also surveyed. Factors influencing students to seek both medical and business training are varied but are often related to a desire for leadership opportunities, concerns about change in medicine and job security and personal career goals. Most students expect to combine clinical and administrative roles. Students entering these programs do so for a variety of reasons and plan diverse careers. These findings can provide guidance for program development and recruitment for dual degree medical education programs.

7-year trajectories of Alcoholics Anonymous attendance and associations with treatment

PubMed Central

Kaskutas, Lee Ann; Bond, Jason; Avalos, Lyndsay Ammon

2009-01-01

Although many members of Alcoholics Anonymous (AA) are introduced to AA during treatment, the relationship between treatment and AA attendance over time is unknown. This paper describes four latent classes of AA attendance among 586 dependent alcoholics interviewed by telephone 1, 3, 5 and 7 years after baseline, and models the relationship between treatment exposure and AA attendance in each class. There was a low AA group (averaging fewer than 5 meetings at most follow-ups), a medium AA group (about 50 meetings a year at each follow-up), a descending AA group (about 150 meetings year 1, then decreasing steeply), and a high AA group (about 200 meetings at 1 year, then decreasing gradually by year 7). Declines in meeting attendance were not always accompanied by decreases in abstinence. After accounting for the effect of time on AA attendance (i.e., the “ups-and-downs” that occur over time), treatment exposure was minimally related to AA attendance in all but the descending AA group, where it was negatively associated (p<.001). Considering AA patterns over time highlights a different role for treatment in AA attendance than what is gleaned from analyses at single timepoints. PMID:19632789

Second-Degree Learners in Associate Degree Nursing Programs: Characteristics and Progression Success

ERIC Educational Resources Information Center

McGinley, Patricia M.

2013-01-01

Second degree learners are attending associate (ADN), accelerated baccalaureate (BSN), and entry level masters (ELM) degree nursing programs. There is limited data related to the socio-demographic characteristics and graduation success rates of students attending accelerated BSN or ELM programs and no data related to second-degree learners…

Two Universities, Two Degrees: A Dual Degree Program for Pharmacists.

ERIC Educational Resources Information Center

Milio, Frank

2001-01-01

Describes a dual degree program between Towson University and the University of Maryland School of Pharmacy, which allows a student to receive both a B.S. degree in Medicinal Chemistry and a Doctor of Pharmacy degree in a combined 7-year program. It also allows flexibility in pursuing alternate career goals. (EV)

Affinity resins as new tools for identifying target proteins of ascorbic acid.

PubMed

Iwaoka, Yuji; Nishino, Kohei; Ishikawa, Takahiro; Ito, Hideyuki; Sawa, Yoshihiro; Tai, Akihiro

2018-02-12

l-Ascorbic acid (AA) has diverse physiological functions, but little is known about the functional mechanisms of AA. In this study, we synthesized two types of affinity resin on which AA is immobilized in a stable form to identify new AA-targeted proteins, which can provide important clues for elucidating unknown functional mechanisms of AA. To our knowledge, an affinity resin on which AA as a ligand is immobilized has not been prepared, because AA is very unstable and rapidly degraded in an aqueous solution. By using the affinity resins, cytochrome c (cyt c) was identified as an AA-targeted protein, and we showed that oxidized cyt c exhibits specific affinity for AA. These results suggest that two kinds of AA-affinity resin can be powerful tools to identify new target proteins of AA.

mHealth Intervention Promoting Cardiovascular Health Among African-Americans: Recruitment and Baseline Characteristics of a Pilot Study.

PubMed

Brewer, LaPrincess C; Jenkins, Sarah; Lackore, Kandace; Johnson, Jacqueline; Jones, Clarence; Cooper, Lisa A; Radecki Breitkopf, Carmen; Hayes, Sharonne N; Patten, Christi

2018-01-31

Mobile health (mHealth) interventions are promising avenues to promote cardiovascular (CV) health among African-Americans (AAs) and culturally tailored technology-based interventions are emerging for this population. The objectives of this study were to use a community-based participatory research (CBPR) approach to recruit AAs into a pilot intervention study of an innovative mHealth CV health promotion program and to characterize technology use patterns and eHealth literacy (EHL). Community partners from five predominately AA churches in southeast Minnesota collaborated with our academic institution to recruit AA congregants into the pilot study. Field notes as well as communications between the study team and community partners were used to design the recruitment strategy and its implementation with a goal of enrolling 50 participants. At its core, the recruitment strategy included community kickoff events to detail the state-of-the-art nature of the mHealth intervention components, the utility of CV health assessments (physical examination, laboratory studies and surveys) and the participants' role in advancing our understanding of the efficacy of mHealth interventions among racial/ethnic minority groups. Detailed recruitment data were documented throughout the study. A self-administered, electronic survey measured sociodemographics, technology use and EHL (eHEALS scale). A total of 50 participants (70% women) from five AA churches were recruited over a one-month period. The majority (>90%) of participants reported using some form of mobile technology with all utilizing these technologies within their homes. Greater than half (60% [30/50]) reported being "very comfortable" with mobile technologies. Overall, participants had high EHL (84.8% [39/46] with eHEALS score ≥26) with no differences by sex. This study illustrates the feasibility and success of a CBPR approach in recruiting AAs into mHealth intervention research and contributes to the growing body of evidence that AAs have high EHL, are high-users of mobile technologies, and thus are likely to be receptive to mHealth interventions. ©LaPrincess C. Brewer, Sarah Jenkins, Kandace Lackore, Jacqueline Johnson, Clarence Jones, Lisa A. Cooper, Carmen Radecki Breitkopf, Sharonne N. Hayes, Christi Patten. Originally published in JMIR Research Protocols (http://www.researchprotocols.org), 31.01.2018.

Pediatric Cushing disease: disparities in disease severity and outcomes in the Hispanic and African-American populations.

PubMed

Gkourogianni, Alexandra; Sinaii, Ninet; Jackson, Sharon H; Karageorgiadis, Alexander S; Lyssikatos, Charalampos; Belyavskaya, Elena; Keil, Margaret F; Zilbermint, Mihail; Chittiboina, Prashant; Stratakis, Constantine A; Lodish, Maya B

2017-08-01

BackgroundLittle is known about the contribution of racial and socioeconomic disparities to severity and outcomes in children with Cushing disease (CD).MethodsA total of 129 children with CD, 45 Hispanic/Latino or African-American (HI/AA) and 84 non-Hispanic White (non-HW), were included in this study. A 10-point index for rating severity (CD severity) incorporated the degree of hypercortisolemia, glucose tolerance, hypertension, anthropomorphic measurements, disease duration, and tumor characteristics. Race, ethnicity, age, gender, local obesity prevalence, estimated median income, and access to care were assessed in regression analyses of CD severity.ResultsThe mean CD severity in the HI/AA group was worse than that in the non-HW group (4.9±2.0 vs. 4.1±1.9, P=0.023); driving factors included higher cortisol levels and larger tumor size. Multiple regression models confirmed that race (P=0.027) and older age (P=0.014) were the most important predictors of worse CD severity. When followed up a median of 2.3 years after surgery, the relative risk for persistent CD combined with recurrence was 2.8 times higher in the HI/AA group compared with that in the non-HW group (95% confidence interval: 1.2-6.5).ConclusionOur data show that the driving forces for the discrepancy in severity of CD are older age and race/ethnicity. Importantly, the risk for persistent and recurrent CD was higher in minority children.

Habitual sleep as a contributor to racial differences in cardiometabolic risk.

PubMed

Curtis, David S; Fuller-Rowell, Thomas E; El-Sheikh, Mona; Carnethon, Mercedes R; Ryff, Carol D

2017-08-15

Insufficient and disrupted sleep is linked with cardiovascular and metabolic dysregulation and morbidity. The current study examines the degree to which differences in sleep between black/African American (AA) and white/European American (EA) adults explain racial differences in cardiometabolic (CMB) disease risk. Total sleep time and sleep efficiency (percent of time in bed asleep) were assessed via seven nights of wrist actigraphy among 426 participants in the Midlife in the United States Study (31% AA; 69% EA; 61% female; mean age = 56.8 y). CMB risk was indexed as a composite of seven biomarkers [blood pressure, waist circumference, hemoglobin A1c (HbA 1c ), insulin resistance, triglycerides, HDL cholesterol (HDL-C), and C-reactive protein]. Covariates included sociodemographic characteristics and relevant health behaviors. Results indicated that AAs relative to EAs obtained less sleep (341 vs. 381 min) and had lower sleep efficiency (72.3 vs. 82.2%) ( P values < 0.001). Further, 41% and 58% of the racial difference in CMB risk was explained by sleep time and sleep efficiency, respectively. In models stratified by sex, race was indirectly associated with CMB risk via sleep time and efficiency only among females (explaining 33% and 65% of the race difference, respectively). Indirect effects were robust to alternative model specifications that excluded participants with diabetes or heart disease. Consideration of sleep determinants and sleep health is therefore needed in efforts to reduce racial differences in CMB disease.

Effects of the Chemical Structures of Oligoarginines Conjugated to Biocompatible Polymers as a Mucosal Adjuvant on Antibody Induction in Nasal Cavities.

PubMed

Mohri, Kohta; Miyata, Kohei; Egawa, Tomomi; Tanishita, Sohei; Endo, Rikito; Yagi, Haruya; Ukawa, Masami; Ochiai, Kyohei; Hiwatari, Ken-Ichiro; Tsubaki, Kazufumi; Shigeno, Koichi; Tobita, Etsuo; Uto, Tomofumi; Baba, Masanori; Sakuma, Shinji

2018-01-01

We have been investigating the potential of oligoarginine-linked polymers as an adjuvant for mucosal vaccination that induces immunoglobulin G (IgG) in systemic circulation and immunoglobulin A (IgA) secreted on the mucosa. Our latest infection experiments demonstrated that mice immunized nasally with a mixture of inactivated influenza viruses and poly(N-vinylacetamide-co-acrylic acid) (PNVA-co-AA) modified with D-octaarginine were perfectly protected from homologous virus infection. On the contrary, virus infection was observed in mice immunized with the antigen alone. This difference was presumably due to insignificant induction of secreted IgA on the nasal mucosa in the latter mice. Since it was unclear whether the current induction level was sufficient for heterologous virus infection, we evaluated the effects of the chemical structures of oligoarginines conjugated to PNVA-co-AA on induction of intranasal IgA. The number and optical activity of the arginine residues and the degree of modification with oligoarginines in the polymer backbone were listed as a factor that would influence IgA induction. Mouse experiments revealed that maximization of the modification resulted in an increase in adjuvant activities of oligoarginine-linked polymers most effectively. Glycine segments inserted between oligoarginines and the polymer backbone were a prerequisite for the maximization. The highest IgA level was observed when antigens were coadministered with diglycine-D-octaarginine-linked PNVA-co-AA.

Interactive effects of a high-quality protein diet and high stocking density on the stress response and some innate immune parameters of Senegalese sole Solea senegalensis.

PubMed

Costas, Benjamín; Aragão, Cláudia; Dias, Jorge; Afonso, António; Conceição, Luís E C

2013-10-01

Amino acids (AA) regulate key metabolic pathways, including some immune responses. Therefore, this study aimed to assess whether an increased availability of dietary AA can mitigate the expected increase in plasma cortisol and metabolites levels due to high stocking density and its subsequent immunosuppression. Senegalese sole (Solea senegalensis) were maintained at low stocking density (LSD; 3.5 kg m(-2)) or high stocking density (HSD; 12 kg m(-2)) for 18 days. Additionally, both treatments were fed a control or a high protein (HP) diet (LSD, LSD HP, HSD and HSD HP). The HP diet slightly increased the levels of digestible indispensable AA, together with tyrosine and cysteine. HSD was effective in inducing a chronic stress response after 18 days of treatment since fish held at HSD presented higher plasma cortisol, glucose and lactate levels. Moreover, this increase in stress indicators translated in a decrease in plasma lysozyme, alternative complement pathway (ACP) and peroxidase activities, suggesting some degree of immunosuppression. Interestingly, while plasma glucose and lactate levels in HSD HP specimens decreased to similar values than LSD fish, plasma lysozyme, ACP and peroxidase activities increased, with even higher values than LSD groups for ACP activity. It is suggested that the HP diet may be used as functional feed since it may represent a metabolic advantage during stressful events and may counteract immunosuppression in sole.

Insulin receptor substrate-2 gene variants in subjects with metabolic syndrome: association with plasma monounsaturated and n-3 polyunsaturated fatty acid levels and insulin resistance.

PubMed

Perez-Martinez, Pablo; Delgado-Lista, Javier; Garcia-Rios, Antonio; Tierney, Audrey C; Gulseth, Hanne L; Williams, Christine M; Karlström, Brita; Kieć-Wilk, Beata; Blaak, Ellen E; Helal, Olfa; Saris, Wim H M; Defoort, Catherine; Drevon, Christian A; Lovegrove, Julie A; Dembinska-Kieć, Aldona; Riserus, Ulf; Roche, Helen M; Lopez-Miranda, Jose

2012-02-01

Several insulin receptor substrate-2 (IRS-2) polymorphisms have been studied in relation to insulin resistance and type 2 diabetes. To examine whether the genetic variability at the IRS-2 gene locus was associated with the degree of insulin resistance and plasma fatty acid levels in metabolic syndrome (MetS) subjects. Insulin sensitivity, insulin secretion, glucose effectiveness, plasma fatty acid composition and three IRS-2 tag-single nucleotide polymorphisms (SNPs) were determined in 452 MetS subjects. Among subjects with the lowest level of monounsaturated (MUFA) (below the median), the rs2289046 A/A genotype was associated with lower glucose effectiveness (p<0.038), higher fasting insulin concentrations (p<0.028) and higher HOMA IR (p<0.038) as compared to subjects carrying the minor G-allele (A/G and G/G). In contrast, among subjects with the highest level of MUFA (above the median), the A/A genotype was associated with lower fasting insulin concentrations and HOMA-IR, whereas individuals carrying the G allele and with the highest level of ω-3 polyunsaturated fatty acids (above the median) showed lower fasting insulin (p<0.01) and HOMA-IR (p<0.02) as compared with A/A subjects. The rs2289046 polymorphism at the IRS2 gene locus may influence insulin sensitivity by interacting with certain plasma fatty acids in MetS subjects. © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Habitual sleep as a contributor to racial differences in cardiometabolic risk

PubMed Central

Fuller-Rowell, Thomas E.; El-Sheikh, Mona; Carnethon, Mercedes R.; Ryff, Carol D.

2017-01-01

Insufficient and disrupted sleep is linked with cardiovascular and metabolic dysregulation and morbidity. The current study examines the degree to which differences in sleep between black/African American (AA) and white/European American (EA) adults explain racial differences in cardiometabolic (CMB) disease risk. Total sleep time and sleep efficiency (percent of time in bed asleep) were assessed via seven nights of wrist actigraphy among 426 participants in the Midlife in the United States Study (31% AA; 69% EA; 61% female; mean age = 56.8 y). CMB risk was indexed as a composite of seven biomarkers [blood pressure, waist circumference, hemoglobin A1c (HbA1c), insulin resistance, triglycerides, HDL cholesterol (HDL-C), and C-reactive protein]. Covariates included sociodemographic characteristics and relevant health behaviors. Results indicated that AAs relative to EAs obtained less sleep (341 vs. 381 min) and had lower sleep efficiency (72.3 vs. 82.2%) (P values < 0.001). Further, 41% and 58% of the racial difference in CMB risk was explained by sleep time and sleep efficiency, respectively. In models stratified by sex, race was indirectly associated with CMB risk via sleep time and efficiency only among females (explaining 33% and 65% of the race difference, respectively). Indirect effects were robust to alternative model specifications that excluded participants with diabetes or heart disease. Consideration of sleep determinants and sleep health is therefore needed in efforts to reduce racial differences in CMB disease. PMID:28760970

Possible association of FAS and FASLG polymorphisms with the risk of idiopathic azoospermia in southeast Turkey.

PubMed

Balkan, Mahmut; Atar, Murat; Erdal, Mehmet Emin; Rustemoğlu, Aydin; Yildiz, Ismail; Gunesacar, Ramazan; Hatipoğlu, Namık Kemal; Bodakçi, Mehmet Nuri; Ay, Ozlem Izci; Çevik, Kenan

2014-06-01

To investigate the association of the genetic variants of FAS/FASLG cell death pathway genes in male infertility, we genotyped the FAS -670A/G, -1377G/A, and FASLG -124A/G single-nucleotide polymorphisms (SNPs) by real-time polymerase chain reaction in 108 infertile men with idiopathic azoospermia and in 125 proven fertile controls. The distribution of genotypes and alleles for SNPs at FAS -1377G/A and FASLG -124A/G loci were determined not to be statistically different between the case and control groups. However, the genotype frequencies of SNPs, FAS -670AA and FAS -670AG, were found to be significantly different between the case and control groups. Whereas the FAS -670AA genotype might be regarded as a higher predisposition for idiopathic azoospermia, FAS -670AG could be interpreted to mean that this genotype provides protection against idiopathic azoospermia. The study of combined genotype and haplotype frequencies has found statistically significant differences between case and control subjects for some combinations. The AA-GG binary genotype for the FAS670 and FAS1377 loci couple, in particular, may have a high degree of predisposition to idiopathic azoospermia. Our results suggest that FAS -670A/G SNP may be a genetic predisposing factor of idiopathic azoospermia among southeastern Anatolian men. Larger studies are needed to verify these findings. Furthermore, our data indicated a possible linkage between the FAS and FASLG genes and idiopathic azoospermia.

Brief 74 Nuclear Engineering Enrollments and Degrees Survey, 2014 Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

None, None

2015-03-15

The 2014 survey includes degrees granted between September 1, 2013 and August 31, 2014, and enrollments for fall 2014. There are three academic programs new to this year's survey. Thirty-five academic programs reported having nuclear engineering programs during 2014, and data were provided by all thirty-five. The enrollments and degrees data include students majoring in nuclear engineering or in an option program equivalent to a major. Two nuclear engineering programs have indicated that health physics option enrollments and degrees are also reported in the health physics enrollments and degrees survey.

Short-term nutritional strategies before slaughter are effective in modulating the final pH and color of broiler breast meat.

PubMed

Guardia, Sarah; Lessire, Michel; Corniaux, Alain; Métayer-Coustard, Sonia; Mercerand, Frédéric; Tesseraud, Sophie; Bouvarel, Isabelle; Berri, Cécile

2014-07-01

The poultry meat industry is faced with various quality issues related to variations in the ultimate pH of breast meat. The aim of this study was to evaluate the possibility to control breast ultimate pH by distributing finishing diets varying in amino acid (AA) and energy content for a short period before slaughter. Experimental diets were distributed to PM3 broilers on the last 3 d before slaughter (36 d of age). They consisted of a control (C) diet (3,150 kcal/kg; 200 g/kg of CP; 10.0 g/kg of true digestible Lys) with adequate amounts of AA other than Lys, 6 diets isocaloric to the control diet including 3 Lys-deficient (8.0 g/kg) diets with an adequate (Lys-/AA), low (Lys-/AA-), or high (Lys-/AA+) amount of other essential AA calculated in relation to Lys, and 3 Lys-rich (12.0 g/kg) diets with an adequate (Lys+/AA), low (Lys+/AA-), or high (Lys+/AA+) amount of other essential AA calculated in relation to Lys, and 2 diets isoproteic to C with a high (3,300 kcal/kg, E+) or low (3,000 kcal/kg, E-) energy content. Broiler feed consumption and growth performance were slightly affected by AA and energy content during the finishing period. Feed intake (33-36 d) was lower with the Lys+/AA+ and E+, and FCR between 24 and 36 d was higher with the Lys-/AA- and E- than with the C diet. Body weight at d 36 was lower in Lys-/AA-, Lys+/AA+, and E+ than in C, whereas the breast meat yield and abdominal fatness were not affected by diet. Lower pH values were observed in broilers fed Lys-deficient diets containing a high amount of other AA (Lys-/AA+) than in broilers fed diets containing low (AA-) or adequate (AA) amounts of other AA. This study shows that it is possible to alter the pH of breast meat by changing AA profile over a short period before slaughter, with limited impact on broiler growth and carcass composition. © 2014 Poultry Science Association Inc.

A Novel Glucosylation Reaction on Anthocyanins Catalyzed by Acyl-Glucose–Dependent Glucosyltransferase in the Petals of Carnation and Delphinium[C][W

PubMed Central

Matsuba, Yuki; Sasaki, Nobuhiro; Tera, Masayuki; Okamura, Masachika; Abe, Yutaka; Okamoto, Emi; Nakamura, Haruka; Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki; Nagasawa, Kazuo; Ozeki, Yoshihiro

2010-01-01

Glucosylation of anthocyanin in carnations (Dianthus caryophyllus) and delphiniums (Delphinium grandiflorum) involves novel sugar donors, aromatic acyl-glucoses, in a reaction catalyzed by the enzymes acyl-glucose–dependent anthocyanin 5(7)-O-glucosyltransferase (AA5GT and AA7GT). The AA5GT enzyme was purified from carnation petals, and cDNAs encoding carnation Dc AA5GT and the delphinium homolog Dg AA7GT were isolated. Recombinant Dc AA5GT and Dg AA7GT proteins showed AA5GT and AA7GT activities in vitro. Although expression of Dc AA5GT in developing carnation petals was highest at early stages, AA5GT activity and anthocyanin accumulation continued to increase during later stages. Neither Dc AA5GT expression nor AA5GT activity was observed in the petals of mutant carnations; these petals accumulated anthocyanin lacking the glucosyl moiety at the 5 position. Transient expression of Dc AA5GT in petal cells of mutant carnations is expected to result in the transfer of a glucose moiety to the 5 position of anthocyanin. The amino acid sequences of Dc AA5GT and Dg AA7GT showed high similarity to glycoside hydrolase family 1 proteins, which typically act as β-glycosidases. A phylogenetic analysis of the amino acid sequences suggested that other plant species are likely to have similar acyl-glucose–dependent glucosyltransferases. PMID:20971893

Compact Optical Add-Drop De-Multiplexers with Cascaded Micro-Ring Resonators on SOI

NASA Astrophysics Data System (ADS)

Guan, Huan; Li, Zhi-Yong; Shen, Hai-Hua; Yu, Yu-De

2017-06-01

Not Available Supported by the National High Technology Research and Development Program of China under Grant No 2015AA016904, the National Key Research and Development Plan of China under Grant No 2016YFB0402502, and the National Natural Science Foundation of China under Grant No 61275065.

76 FR 52295 - Amendment of Privacy Act Regulations, Request for Comments

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-22

... DEPARTMENT OF THE INTERIOR 43 CFR Part 2 RIN 1090-AA94 Amendment of Privacy Act Regulations... of the Privacy Act. Specifically, the Department proposes to exempt certain records of the newly-created Debarment and Suspension Program system of records from one or more provisions of the Privacy Act...

78 FR 53109 - Security Zones; Naval Base Point Loma; Naval Mine Anti-Submarine Warfare Command; San Diego Bay...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-28

...-AA87 Security Zones; Naval Base Point Loma; Naval Mine Anti-Submarine Warfare Command; San Diego Bay... Anti-Submarine Warfare Command to protect the relocated marine mammal program. These security zone... Warfare Command, the Commander of Naval Region Southwest, or a designated representative of those...

42 CFR 54a.4 - Religious activities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.4 Religious activities. No funds provided directly from SAMHSA or the relevant State or local government to organizations participating in applicable programs may be expended...

42 CFR 54a.12 - Treatment of intermediate organizations.

Code of Federal Regulations, 2014 CFR

2014-10-01

... DISCRETIONARY FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.12 Treatment of intermediate organizations. If a... applicable program, the intermediate organization shall have the same duties under this part as the...

42 CFR 54a.4 - Religious activities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.4 Religious activities. No funds provided directly from SAMHSA or the relevant State or local government to organizations participating in applicable programs may be expended...

42 CFR 54a.12 - Treatment of intermediate organizations.

Code of Federal Regulations, 2012 CFR

2012-10-01

... DISCRETIONARY FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.12 Treatment of intermediate organizations. If a... applicable program, the intermediate organization shall have the same duties under this part as the...

42 CFR 54a.4 - Religious activities.

Code of Federal Regulations, 2014 CFR

2014-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.4 Religious activities. No funds provided directly from SAMHSA or the relevant State or local government to organizations participating in applicable programs may be expended...

42 CFR 54a.4 - Religious activities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.4 Religious activities. No funds provided directly from SAMHSA or the relevant State or local government to organizations participating in applicable programs may be expended...

42 CFR 54a.6 - Employment practices.

Code of Federal Regulations, 2012 CFR

2012-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.6 Employment practices. (a) The participation of a religious organization in or its receipt of funds from an applicable program does not affect that organization's...

42 CFR 54a.4 - Religious activities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.4 Religious activities. No funds provided directly from SAMHSA or the relevant State or local government to organizations participating in applicable programs may be expended...

42 CFR 54a.12 - Treatment of intermediate organizations.

Code of Federal Regulations, 2013 CFR

2013-10-01

... DISCRETIONARY FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.12 Treatment of intermediate organizations. If a... applicable program, the intermediate organization shall have the same duties under this part as the...

42 CFR 54a.6 - Employment practices.

Code of Federal Regulations, 2010 CFR

2010-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.6 Employment practices. (a) The participation of a religious organization in or its receipt of funds from an applicable program does not affect that organization's...

42 CFR 54a.6 - Employment practices.

Code of Federal Regulations, 2011 CFR

2011-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, ET SEQ., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.6 Employment practices. (a) The participation of a religious organization in or its receipt of funds from an applicable program does not affect that organization's...

42 CFR 54a.6 - Employment practices.

Code of Federal Regulations, 2013 CFR

2013-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.6 Employment practices. (a) The participation of a religious organization in or its receipt of funds from an applicable program does not affect that organization's...

42 CFR 54a.6 - Employment practices.

Code of Federal Regulations, 2014 CFR

2014-10-01

... FUNDING UNDER TITLE V OF THE PUBLIC HEALTH SERVICE ACT, 42 U.S.C. 290aa, et seq., FOR SUBSTANCE ABUSE PREVENTION AND TREATMENT SERVICES § 54a.6 Employment practices. (a) The participation of a religious organization in or its receipt of funds from an applicable program does not affect that organization's...

Exploring Baseline Food-Media Literacy of Adult Women

ERIC Educational Resources Information Center

Peterson, Tina L.

2012-01-01

Many media education researchers have identified the importance of adult media literacy but few have studied it. Such literacy is becoming increasingly important with regard to the growing category of food media--advertisements, television programs, and print media among them. Using two focus groups and guided by Primack and Hobbs' (2009) AA, RR,…

The South Carolina Collaborative Undergraduate HBCU Student Summer Training Program

DTIC Science & Technology

2015-03-01

MANDATORY: Authorship and Plagiarism (lecture/case study/discussion) Ed Krug, PhD 9:20-9:30am - - -Break- - - 9:30-10:10am Research Misconduct...STEM majors Demographic characteristics of STEM students in the 2013–2014 academic year Gender Race/ethnicity Male Female AA Hisp./Latino EA Other CU

Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

PubMed

Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

2016-09-01

To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

Comparative study on Ti/Zr/V and chromate conversion treated aluminum alloys: Anti-corrosion performance and epoxy coating adhesion properties

NASA Astrophysics Data System (ADS)

Zhu, Wen; Li, Wenfang; Mu, Songlin; Fu, Nianqing; Liao, Zhongmiao

2017-05-01

In this study, a Ti/Zr/V conversion coating (TZVCC) was deposited on the surface of aluminum alloy 6063 (AA6063) as an alternative of the chromate conversion coating (CCC). Both the TZVCC treated AA6063 (TZVCC/AA6063) and CCC treated AA6063 (CCC/AA6063) were characterized by scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), atomic force microscope (AFM) and contact angle measuring device. The anti-corrosion performance of the TZVCC/AA6063 and CCC/AA6063 was evaluated by electrochemical measurements and neutral salt spray tests. It showed that both the surface roughness and surface free energy of the AA6063 were significantly increased after TZVCC treatment. The anti-corrosion performance of TZVCC/AA6063 was superior to that of CCC/AA6063. In addition, the effects of the TZVCC and CCC on the adhesion properties and anti-corrosion performance of epoxy coating applied on samples were examined by pull-off tests and electrochemical impedance spectroscopy (EIS). The dry, wet and recovery adhesive strengths of the epoxy coating on TZVCC treated samples (epoxy coated TZVCC/AA6063) were very close to those of epoxy coating on CCC treated ones (epoxy coated CCC/AA6063). The epoxy coated TZVCC/AA6063 showed better corrosion resistance than the epoxy coated CCC/AA6063 and epoxy coated AA6063.

45 CFR 2400.41 - Degree programs.

Code of Federal Regulations, 2013 CFR

2013-10-01

... degree in education that permits a concentration in American history, American government, social studies, or political science. Graduate degrees under which study is excluded from fellowship support are... FELLOWSHIP PROGRAM REQUIREMENTS Graduate Study § 2400.41 Degree programs. (a) Fellows may pursue a master's...

45 CFR 2400.41 - Degree programs.

Code of Federal Regulations, 2012 CFR

2012-10-01

... degree in education that permits a concentration in American history, American government, social studies, or political science. Graduate degrees under which study is excluded from fellowship support are... FELLOWSHIP PROGRAM REQUIREMENTS Graduate Study § 2400.41 Degree programs. (a) Fellows may pursue a master's...

45 CFR 2400.41 - Degree programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

... degree in education that permits a concentration in American history, American government, social studies, or political science. Graduate degrees under which study is excluded from fellowship support are... FELLOWSHIP PROGRAM REQUIREMENTS Graduate Study § 2400.41 Degree programs. (a) Fellows may pursue a master's...

45 CFR 2400.41 - Degree programs.

Code of Federal Regulations, 2011 CFR

2011-10-01

... degree in education that permits a concentration in American history, American government, social studies, or political science. Graduate degrees under which study is excluded from fellowship support are... FELLOWSHIP PROGRAM REQUIREMENTS Graduate Study § 2400.41 Degree programs. (a) Fellows may pursue a master's...

45 CFR 2400.41 - Degree programs.

Code of Federal Regulations, 2014 CFR

2014-10-01

... degree in education that permits a concentration in American history, American government, social studies, or political science. Graduate degrees under which study is excluded from fellowship support are... FELLOWSHIP PROGRAM REQUIREMENTS Graduate Study § 2400.41 Degree programs. (a) Fellows may pursue a master's...

Improving cardiovascular health of underserved populations in the community with Life's Simple 7.

PubMed

Murphy, Marcia Pencak; Coke, Lola; Staffileno, Beth A; Robinson, Janis D; Tillotson, Robin

2015-11-01

The purpose of this nurse practitioner (NP) led initiative was to improve the cardiovascular health of two underserved populations in the community using the American Heart Association (AHA) Life's Simple 7 and My Life Check (MLC) tools. Two inner city community sites were targeted: (a) a senior center servicing African American (AA) older adults, and (b) a residential facility servicing homeless women. Preprogram health data (blood pressure, cholesterol, blood glucose levels, body mass index, and health behaviors) were collected to calculate MLC scores. Postprogram health data were obtained on participants with the lowest MLC scores who completed the program. Eight older adults completed the program with a 37.1% increase in average MLC score (6.2 vs. 8.5). Ten women completed the program with a 9.3% decrease in average MLC score (4.3 vs. 3.9). Favorable benefits were observed in the AA older adults. In contrast, similar benefits were not observed in the women, which may be because of a constellation of social, environmental, biological, and mental health factors. NPs are prepared to target community-based settings to address the health of underserved populations. Engaging key stakeholders in the planning and implementation is essential for success. ©2015 American Association of Nurse Practitioners.

Report on an Investigation into an Entry Level Clinical Doctorate for the Genetic Counseling Profession and a Survey of the Association of Genetic Counseling Program Directors.

PubMed

Reiser, Catherine; LeRoy, Bonnie; Grubs, Robin; Walton, Carol

2015-10-01

The master's degree is the required entry-level degree for the genetic counseling profession in the US and Canada. In 2012 the Association of Genetic Counseling Program Directors (AGCPD) passed resolutions supporting retention of the master's as the entry-level and terminal degree and opposing introduction of an entry-level clinical doctorate (CD) degree. An AGCPD workgroup surveyed directors of all 34 accredited training programs with the objective of providing the Genetic Counseling Advanced Degrees Task Force (GCADTF) with information regarding potential challenges if master's programs were required to transition to an entry-level CD. Program demographics, projected ability to transition to an entry-level CD, factors influencing ability to transition, and potential effects of transition on programs, students and the genetic counseling workforce were characterized. Two programs would definitely be able to transition, four programs would close, thirteen programs would be at risk to close and fourteen programs would probably be able to transition with varying degrees of difficulty. The most frequently cited limiting factors were economic, stress on clinical sites, and administrative approval of a new degree/program. Student enrollment under an entry-level CD model was projected to decrease by 26.2 %, negatively impacting the workforce pipeline. The results further illuminate and justify AGCPD's position to maintain the master's as the entry-level degree.

76 FR 5395 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-31

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-12252, AA-12250, AA-12280, AA-12291, AA-12292, AA-12293; LLAK- 962000-L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of decision approving lands for conveyance. SUMMARY: As required by 43...

76 FR 75899 - Alaska Native Claims Selection

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-05

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-9915, AA-9916, AA-9921, AA-9936, AA-9937, AA-9965; LLAK-965000- L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION: Notice of Decision Approving Lands for Conveyance. SUMMARY: As required by 43...

40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

Code of Federal Regulations, 2014 CFR

2014-07-01

... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

Code of Federal Regulations, 2010 CFR

2010-07-01

... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

VizieR Online Data Catalog: Radial velocities measurements (Duflot+ 1997)

NASA Astrophysics Data System (ADS)

Fehrenbach, C.; Duflot, M.; Mannone, C.; Burnage, R.; Genty, V.

1996-11-01

We publish 1879 radial velocities of stars distributed in 105 fields of 4x4degres. We continue the PPO series (Fehrenbach et al. 1987A&AS...71..263F, 1987A&AS...71..275F, 1990A&AS...83...91F and 1992A&AS...95..541F; Duflot et al. 1990A&AS...83..251D, 1992A&AS...94..479D, 1992A&AS...95..541F and 1995A&AS..110..177D), using the Fehrenbach objective prism method. (2 data files).

Novel hole transport layer of nickel oxide composite with carbon for high-performance perovskite solar cells

NASA Astrophysics Data System (ADS)

Sajid; Elseman, A. M.; Ji, Jun; Dou, Shangyi; Huang, Hao; Cui, Peng; Wei, Dong; Li, Meicheng

2018-01-01

Not Available Project supported by the National High-tech Research and Development Program of China (Grant No. 2015AA034601), the National Natural Science Foundation of China (Grant Nos. 51772096, 91333122, 51372082, 51402106, and 11504107), the Ph.D. Programs Foundation of Ministry of Education of China (Grant No. 20130036110012), the Par-Eu Scholars Program, Beijing Municipal Science and Technology Project, China (Grant No. Z161100002616039), and the Fundamental Research Funds for the Central Universities of China (Grant Nos. 2016JQ01, 2015ZZD03, 2015ZD07, and 2017ZZD02).

Semiannual Report to Congress on the Effectiveness of the Civil Aviation Security Program.

DTIC Science & Technology

1983-10-21

Aviation Security Program -s fro January 1 -June 30, 1983 c> CD C_3 LU DTIC ELECTE NOV 1 8 1983 D <sS^ B Washington, O.C. 20691 October...Effectiveness of the Civil Aviation Security Program 7. A-.W.) Aviation Security Division V. P»tf»m..»» 0>|fi •« Nam» «n4 Aa^rai» DOT/Federal...Aviation Administration Office of Civil Aviation Security 800 Independence Avenue, SW. Washington, P.C. 20591 1. ••€•*.»•<•’• Caiala*. Na. S.

National Dam Safety Program. Junior Lake Dam, (MO 11526) Missouri - Kansas City Basin, Callaway County, Missouri. Phase I Inspection Report.

DTIC Science & Technology

1980-10-01

Lake, Dam Inspection, Private Dams 20 AWTACT (Ce ffm ew - m*1et N naeey ad identfy by block number) This report was prepared under the National Program...cO r " 7 - IM-.r Il: r’ o .rrr4 QM zc PLT DL1 ~OC.4..NW to~.. c pz acca ~ ~ ~ 0 AaO cr~c 0000000000 ca~cc 0 NOCC~C ~ j...a ~ in =o ,0 0 00 O 0~ co

ODPEVP: A program for computing eigenvalues and eigenfunctions and their first derivatives with respect to the parameter of the parametric self-adjoined Sturm-Liouville problem

NASA Astrophysics Data System (ADS)

Chuluunbaatar, O.; Gusev, A. A.; Vinitsky, S. I.; Abrashkevich, A. G.

2009-08-01

A FORTRAN 77 program is presented for calculating with the given accuracy eigenvalues, eigenfunctions and their first derivatives with respect to the parameter of the parametric self-adjoined Sturm-Liouville problem with the parametric third type boundary conditions on the finite interval. The program calculates also potential matrix elements - integrals of the eigenfunctions multiplied by their first derivatives with respect to the parameter. Eigenvalues and matrix elements computed by the ODPEVP program can be used for solving the bound state and multi-channel scattering problems for a system of the coupled second-order ordinary differential equations with the help of the KANTBP programs [O. Chuluunbaatar, A.A. Gusev, A.G. Abrashkevich, A. Amaya-Tapia, M.S. Kaschiev, S.Y. Larsen, S.I. Vinitsky, Comput. Phys. Commun. 177 (2007) 649-675; O. Chuluunbaatar, A.A. Gusev, S.I. Vinitsky, A.G. Abrashkevich, Comput. Phys. Commun. 179 (2008) 685-693]. As a test desk, the program is applied to the calculation of the potential matrix elements for an integrable 2D-model of three identical particles on a line with pair zero-range potentials, a 3D-model of a hydrogen atom in a homogeneous magnetic field and a hydrogen atom on a three-dimensional sphere. Program summaryProgram title: ODPEVP Catalogue identifier: AEDV_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEDV_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC license, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 3001 No. of bytes in distributed program, including test data, etc.: 24 195 Distribution format: tar.gz Programming language: FORTRAN 77 Computer: Intel Xeon EM64T, Alpha 21264A, AMD Athlon MP, Pentium IV Xeon, Opteron 248, Intel Pentium IV Operating system: OC Linux, Unix AIX 5.3, SunOS 5.8, Solaris, Windows XP RAM: depends on the number and order of finite elements; the number of points; and the number of eigenfunctions required. Test run requires 4 MB Classification: 2.1, 2.4 External routines: GAULEG [3] Nature of problem: The three-dimensional boundary problem for the elliptic partial differential equation with an axial symmetry similar to the Schrödinger equation with the Coulomb and transverse oscillator potentials is reduced to the two-dimensional one. The latter finds wide applications in modeling of photoionization and recombination of oppositively charged particles (positrons, antiprotons) in the magnet-optical trap [4], optical absorption in quantum wells [5], and channeling of likely charged particles in thin doped films [6,7] or neutral atoms and molecules in artificial waveguides or surfaces [8,9]. In the adiabatic approach [10] known in mathematics as Kantorovich method [11] the solution of the two-dimensional elliptic partial differential equation is expanded over basis functions with respect to the fast variable (for example, angular variable) and depended on the slow variable (for example, radial coordinate ) as a parameter. An averaging of the problem by such a basis leads to a system of the second-order ordinary differential equations which contain potential matrix elements and the first-derivative coupling terms (see, e.g., [12,13,14]). The purpose of this paper is to present the finite element method procedure based on the use of high-order accuracy approximations for calculating eigenvalues, eigenfunctions and their first derivatives with respect to the parameter of the parametric self-adjoined Sturm-Liouville problem with the parametric third type boundary conditions on the finite interval. The program developed calculates potential matrix elements - integrals of the eigenfunctions multiplied by their derivatives with respect to the parameter. These matrix elements can be used for solving the bound state and multi-channel scattering problems for a system of the coupled second-order ordinary differential equations with the help of the KANTBP programs [1,2]. Solution method: The parametric self-adjoined Sturm-Liouville problem with the parametric third type boundary conditions is solved by the finite element method using high-order accuracy approximations [15]. The generalized algebraic eigenvalue problem AF=EBF with respect to a pair of unknown ( E,F) arising after the replacement of the differential problem by the finite-element approximation is solved by the subspace iteration method using the SSPACE program [16]. First derivatives of the eigenfunctions with respect to the parameter which contained in potential matrix elements of the coupled system equations are obtained by solving the inhomogeneous algebraic equations. As a test desk, the program is applied to the calculation of the potential matrix elements for an integrable 2D-model of three identical particles on a line with pair zero-range potentials described in [1,17,18], a 3D-model of a hydrogen atom in a homogeneous magnetic field described in [14,19] and a hydrogen atom on a three-dimensional sphere [20]. Restrictions: The computer memory requirements depend on: the number and order of finite elements; the number of points; and the number of eigenfunctions required. Restrictions due to dimension sizes may be easily alleviated by altering PARAMETER statements (see sections below and listing for details). The user must also supply DOUBLE PRECISION functions POTCCL and POTCC1 for evaluating potential function U(ρ,z) of Eq. (1) and its first derivative with respect to parameter ρ. The user should supply DOUBLE PRECISION functions F1FUNC and F2FUNC that evaluate functions f(z) and f(z) of Eq. (1). The user must also supply subroutine BOUNCF for evaluating the parametric third type boundary conditions. Running time: The running time depends critically upon: the number and order of finite elements; the number of points on interval [z,z]; and the number of eigenfunctions required. The test run which accompanies this paper took 2 s with calculation of matrix potentials on the Intel Pentium IV 2.4 GHz. References:O. Chuluunbaatar, A.A. Gusev, A.G. Abrashkevich, A. Amaya-Tapia, M.S. Kaschiev, S.Y. Larsen, S.I. Vinitsky, Comput. Phys. Comm. 177 (2007) 649-675 O. Chuluunbaatar, A.A. Gusev, S.I. Vinitsky, A.G. Abrashkevich, Comput. Phys. Comm. 179 (2008) 685-693. W.H. Press, S.A. Teukolsky, W.T. Vetterling, B.P. Flannery, Numerical Recipes: The Art of Scientific Computing, Cambridge University Press, Cambridge, 1986. O. Chuluunbaatar, A.A. Gusev, S.I. Vinitsky, V.L. Derbov, L.A. Melnikov, V.V. Serov, Phys. Rev. A 77 (2008) 034702-1-4. E.M. Kazaryan, A.A. Kostanyan, H.A. Sarkisyan, Physica E 28 (2005) 423-430. Yu.N. Demkov, J.D. Meyer, Eur. Phys. J. B 42 (2004) 361-365. P.M. Krassovitskiy, N.Zh. Takibaev, Bull. Russian Acad. Sci. Phys. 70 (2006) 815-818. V.S. Melezhik, J.I. Kim, P. Schmelcher, Phys. Rev. A 76 (2007) 053611-1-15. F.M. Pen'kov, Phys. Rev. A 62 (2000) 044701-1-4. M. Born, X. Huang, Dynamical Theory of Crystal Lattices, The Clarendon Press, Oxford, England, 1954. L.V. Kantorovich, V.I. Krylov, Approximate Methods of Higher Analysis, Wiley, New York, 1964. U. Fano, Colloq. Int. C.N.R.S. 273 (1977) 127;A.F. Starace, G.L. Webster, Phys. Rev. A 19 (1979) 1629-1640. C.V. Clark, K.T. Lu, A.F. Starace, in: H.G. Beyer, H. Kleinpoppen (eds.), Progress in Atomic Spectroscopy, Part C, Plenum, New York, 1984, pp. 247-320. O. Chuluunbaatar, A.A. Gusev, V.L. Derbov, M.S. Kaschiev, L.A. Melnikov, V.V. Serov, S.I. Vinitsky, J. Phys. A 40 (2007) 11485-11524. A.G. Abrashkevich, D.G. Abrashkevich, M.S. Kaschiev, I.V. Puzynin, Comput. Phys. Comm. 85 (1995) 40-64. K.J. Bathe, Finite Element Procedures in Engineering Analysis, Englewood Cliffs, Prentice-Hall, New York, 1982. O. Chuluunbaatar, A.A. Gusev, M.S. Kaschiev, V.A. Kaschieva, A. Amaya-Tapia, S.Y. Larsen, S.I. Vinitsky, J. Phys. B 39 (2006) 243-269. Yu.A. Kuperin, P.B. Kurasov, Yu.B. Melnikov, S.P. Merkuriev, Ann. Phys. 205 (1991) 330-361. O. Chuluunbaatar, A.A. Gusev, V.P. Gerdt, V.A. Rostovtsev, S.I. Vinitsky, A.G. Abrashkevich, M.S. Kaschiev, V.V. Serov, Comput. Phys. Comm. 178 (2008) 301-330. A.G. Abrashkevich, M.S. Kaschiev, S.I. Vinitsky, J. Comp. Phys. 163 (2000) 328-348.

NITARP: Impact Assessment, 2005-2013

NASA Astrophysics Data System (ADS)

Rebull, Luisa M.; Gorjian, V.; Brinkworth, C.; Squires, G. K.; Burtnyk, K.

2014-01-01

NITARP, the NASA/IPAC Training in Archival Research Program, gets educators involved in authentic astronomical research. We partner small groups of educators with a mentor professional astronomer for a year-long original research project. The educators incorporate the experience into their classrooms and share their experience with other teachers. The teams echo the entire research process, from writing a proposal, to doing the research, to writing up and presenting the results at an AAS meeting. The educators incorporate this experience into their classroom. This program differs from other programs that we know of that get real astronomy data into the classroom in that: (a) Each team works on an original, unique project. There are no canned labs here! (b) Each team presents their results in posters at the AAS, in science sessions (not just outreach sessions). The posters are distributed throughout the meeting, in amongst other researchers' work; the participants are not "given a free pass" because they are teachers. (c) The 'product' of this project is the scientific result, not a curriculum packet. (d) Because the teachers work with students throughout this project, the teachers have already begun to adapt their project to fit in their classroom environment. This poster will describe the program, with highlights of an impact assessment survey conducted of NITARP alumni in June 2013. Including all forms of the project from 2004-2013, there have been 80 educator participants from 33 states; 40 of them responded to our survey. There have been 37 science and 42 education AAS posters presented by NITARP-affiliated educators and scientists (with 8 more expected to be presented at this meeting). There have been 5 refereed journal articles in professional astronomy research journals that directly involve NITARP teachers and scientists (Howell et al. 2006, Guieu et al. 2010, Howell et al. 2008, Rebull et al., 2011, 2013), and 2 more astronomy journal articles describing the software developed in conjunction with NITARP and its Spitzer (Laher et al. 2012ab). There is one more refereed article written by a NITARP alumni teacher for The Physics Teacher (Pereira et al. 2013).

Factors associated with active aging in Finland, Poland, and Spain.

PubMed

Perales, Jaime; Martin, Steven; Ayuso-Mateos, Jose Luis; Chatterji, Somnath; Garin, Noe; Koskinen, Seppo; Leonardi, Matilde; Miret, Marta; Moneta, Victoria; Olaya, Beatriz; Tobiasz-Adamczyk, Beata; Haro, Josep Maria

2014-08-01

Continuous population aging has raised international policy interest in promoting active aging (AA). AA theoretical models have been defined from a biomedical or a psychosocial perspective. These models may be expanded including components suggested by lay individuals. This paper aims to study the correlates of AA in three European countries, namely, Spain, Poland, and Finland using four different definitions of AA. The EU COURAGE in Europe project was a cross-sectional general adult population survey conducted in a representative sample of the noninstitutionalized population of Finland, Poland, and Spain. Participants (10,800) lived in the community. This analysis focuses on individuals aged 50 years old and over (7,987). Four definitions (two biomedical, one psychosocial, and a complete definition including biomedical, psychosocial, and external variables) of AA were analyzed. Differences in AA were found for country, age, education, and occupation. Finland scored consistently the highest in AA followed by Spain and Poland. Younger age was associated with higher AA. Higher education and occupation was associated with AA. Being married or cohabiting was associated with better AA compared to being widowed or separated in most definitions. Gender and urbanicity were not associated with AA, with few exceptions. Men scored higher in AA only in Spain, whereas there was no gender association in the other two countries. Being widowed was only associated with lower AA in Poland and not being married was associated with lower AA in Poland and Finland but not Spain. Associations with education, marital status, and occupation suggest that these factors are the most important components of AA. These association patterns, however, seem to vary across the three countries. Actions to promote AA in these countries may be addressed at reducing inequalities in occupation and education or directly tackling the components of AA lacking in each country.

Characterization of the radical-scavenging reaction of 2-O-substituted ascorbic acid derivatives, AA-2G, AA-2P, and AA-2S: a kinetic and stoichiometric study.

PubMed

Takebayashi, Jun; Tai, Akihiro; Gohda, Eiichi; Yamamoto, Itaru

2006-04-01

The aim of this study was to characterize the antioxidant activity of three ascorbic acid (AA) derivatives O-substituted at the C-2 position of AA: ascorbic acid 2-glucoside (AA-2G), ascorbic acid 2-phosphate (AA-2P), and ascorbic acid 2-sulfate (AA-2S). The radical-scavenging activities of these AA derivatives and some common low molecular-weight antioxidants such as uric acid or glutathione against 1,1-diphenyl-picrylhydrazyl (DPPH) radical, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) radical cation (ABTS+), or galvinoxyl radical were kinetically and stoichiometrically evaluated under pH-controlled conditions. Those AA derivatives slowly and continuously reacted with DPPH radical and ABTS+, but not with galvinoxyl radical. They effectively reacted with DPPH radical under acidic conditions and with ABTS+ under neutral conditions. In contrast, AA immediately quenched all species of radicals tested at all pH values investigated. The reactivity of Trolox, a water-soluble vitamin E analogue, was comparable to that of AA in terms of kinetics and stoichiometrics. Uric acid and glutathione exhibited long-lasting radical-scavenging activity against these radicals under certain pH conditions. The radical-scavenging profiles of AA derivatives were closer to those of uric acid and glutathione rather than to that of AA. The number of radicals scavenged by one molecule of AA derivatives, uric acid, or glutathione was equal to or greater than that by AA or Trolox under the appropriate conditions. These data suggest the potential usage of AA derivatives as radical scavengers.

Cardiorespiratory interactions in patients with atrial flutter.

PubMed

Masè, Michela; Disertori, Marcello; Ravelli, Flavia

2009-01-01

Respiratory sinus arrhythmia (RSA) is generally known as the autonomically mediated modulation of the sinus node pacemaker frequency in synchrony with respiration. Cardiorespiratory interactions have been largely investigated during sinus rhythm, whereas little is known about interactions during reentrant arrhythmias. In this study, cardiorespiratory interactions at the atrial and ventricular level were investigated during atrial flutter (AFL), a supraventricular arrhythmia based on a reentry, by using cross-spectral analysis and computer modeling. The coherence and phase between respiration and atrial (gamma(AA)(2), phi(AA)) and ventricular (gamma(RR)(2), phi(RR)) interval series were estimated in 20 patients with typical AFL (68.0 +/- 8.8 yr) and some degree of atrioventricular (AV) conduction block. In all patients, atrial intervals displayed oscillations strongly coupled and in phase with respiration (gamma(AA)(2)= 0.97 +/- 0.05, phi(AA) = 0.71 +/- 0.31 rad), corresponding to a paradoxical lengthening of intervals during inspiration. The modulation pattern was frequency independent, with in-phase oscillations and short time delays (0.40 +/- 0.15 s) for respiratory frequencies in the range 0.1-0.4 Hz. Ventricular patterns were affected by AV conduction type. In patients with fixed AV conduction, ventricular intervals displayed oscillations strongly coupled (gamma(RR)(2)= 0.97 +/- 0.03) and in phase with respiration (phi(RR) = 1.08 +/- 0.80 rad). Differently, in patients with variable AV conduction, respiratory oscillations were secondary to Wencheback rhythmicity, resulting in a decreased level of coupling (gamma(RR)(2)= 0.50 +/- 0.21). Simulations with a simplified model of AV conduction showed ventricular patterns to originate from the combination of a respiratory modulated atrial input with the functional properties of the AV node. The paradoxical frequency-independent modulation pattern of atrial interval, the short time delays, and the complexity of ventricular rhythm characterize respiratory arrhythmia during AFL and distinguish it from normal RSA. These peculiar features can be explained by assuming a direct mechanical action of respiration on AFL reentrant circuit.

The strain path dependence of plastic deformation response of AA5754: Experiment and modeling

NASA Astrophysics Data System (ADS)

Pham, Minh-Son; Hu, Lin; Iadicola, Mark; Creuziger, Adam; Rollett, Anthony D.

2013-12-01

This work presents modeling of experiments on a balanced biaxial (BB) pre-strained AA5754 alloy, subsequently reloaded uniaxially along the rolling direction and transverse direction. The material exhibits a complex plastic deformation response during the change in strain path due to 1) crystallographic texture, 2) aging (interactions between dislocations and Mg atoms) and 3) recovery (annihilation and re-arrangement of dislocations). With a BB prestrain of about 5 %, the aging process is dominant, and the yield strength for uniaxially deformed samples is observed to be higher than the flow stress during BB straining. The strain hardening rate after changing path is, however, lower than that for pre-straining. Higher degrees of pre-straining make the dynamic recovery more active. The dynamic recovery at higher strain levels compensates for the aging effect, and results in: 1) a reduction of the yield strength, and 2) an increase in the hardening rate of re-strained specimens along other directions. The yield strength of deformed samples is further reduced if these samples are left at room temperature to let static recovery occur. The synergistic influences of texture condition, aging and recovery processes on the material response make the modeling of strain path dependence of mechanical behavior of AA5754 challenging. In this study, the influence of crystallographic texture is taken into account by incorporating the latent hardening into a visco-plastic self-consistent model. Different strengths of dislocation glide interaction models in 24 slip systems are used to represent the latent hardening. Moreover, the aging and recovery effects are also included into the latent hardening model by considering strong interactions between dislocations and dissolved atom Mg and the microstructural evolution. These microstructural considerations provide a powerful capability to successfully describe the strain path dependence of plastic deformation behavior of AA5754.

Establishing a framework for a physician assistant/bioethics dual degree program.

PubMed

Carr, Mark F; Bergman, Brett A

2014-01-01

: Numerous medical schools currently offer a master of arts (MA) in bioethics dual degree for physicians. A degree in bioethics enhances the care physicians provide to patients and prepares physicians to serve on ethics committees and consult services. Additionally, they may work on institutional and public policy issues related to ethics. Several physician assistant (PA) programs currently offer a master of public health (MPH) dual degree for PAs. A degree in public health prepares PAs for leadership roles in meeting community health needs. With the success of PA/MPH dual degree programs, we argue here that a PA/bioethics dual degree would be another opportunity to advance the PA profession and consider how such a program might be implemented. The article includes the individual perspectives of the authors, one of whom completed a graduate-level certificate in bioethics concurrently with his 2-year PA program, while the other served as a bioethics program director.

Acrylamide analysis in food by liquid chromatographic and gas chromatographic methods.

PubMed

Elbashir, Abdalla A; Omar, Mei M Ali; Ibrahim, Wan Aini Wan; Schmitz, Oliver J; Aboul-Enein, Hassan Y

2014-01-01

Acrylamide (AA) is a compound classified as carcinogenic to humans by the International Agency for Research on Cancer. It was first discovered to be present in certain heated processed food by the Swedish National Food Administration (SNFA) and University of Stockholm in early 2002. The major pathway for AA formation in food is the Maillard reaction between reducing sugar and the amino acid asparagine at high temperature. Since the discovery of AA's presence in food, many analytical methods have been developed for determination of AA contents in different food matrices. Also, several studies have been conducted to develop extraction procedures for AA from difficult food matrices. AA is a small, highly polar molecule, which makes its extraction and analysis challenging. Many articles and reviews have been published dealing with AA in food. The aim of the review is to discuss AA formation in food, the factors affecting AA formation and removal, AA exposure assessment, AA extraction and cleanup from food samples, and analytical methods used in AA determination, such as high-performance liquid chromatography (HPLC) and gas chromatography (GC). Special attention is given to sample extraction and cleanup procedures and analytical techniques used for AA determination.

An investigation into the fatty acid content of selected fish-based commercial infant foods in the UK and the impact of commonly practiced re-heating treatments used by parents for the preparation of infant formula milks.

PubMed

Loughrill, Emma; Zand, Nazanin

2016-04-15

The importance of dietary lipids during infancy is paramount for rapid growth and development. Linoleic acid (LA), α-linolenic acid (ALA), eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA) and arachidonic acid (AA) were quantified using RP-HPLC with charged aerosol detection in a range of complementary infant foods and formula milk. Total daily intake of fatty acids for infants aged 6-9 months was calculated based on the consumption of complementary infant foods and formula milk. Total daily intakes of ALA, AA and DHA were below, whereas LA was above the recommended intake. This provides scope for product optimisation, to improve the nutritive value of commercial infant food products. The impact of re-heating treatments by parents on fatty acid content of formula milk was investigated and statistically significant changes were observed. Furthermore, the transparency of the labelling information declared by the manufacturers was within recommendations despite a degree of significant variation. Copyright © 2015 Elsevier Ltd. All rights reserved.

On the intrinsic flexibility of the opioid receptor through multiscale modeling approaches

NASA Astrophysics Data System (ADS)

Vercauteren, Daniel; FosséPré, Mathieu; Leherte, Laurence; Laaksonen, Aatto

Numerous releases of G protein-coupled receptors crystalline structures created the opportunity for computational methods to widely explore their dynamics. Here, we study the biological implication of the intrinsic flexibility properties of opioid receptor OR. First, one performed classical all-atom (AA) Molecular Dynamics (MD) simulations of OR in its apo-form. We highlighted that the various degrees of bendability of the α-helices present important consequences on the plasticity of the binding site. Hence, this latter adopts a wide diversity of shape and volume, explaining why OR interacts with very diverse ligands. Then, one introduces a new strategy for parameterizing purely mechanical but precise coarse-grained (CG) elastic network models (ENMs). The CG ENMs reproduced in a high accurate way the flexibility properties of OR versus the AA simulations. At last, one uses network modularization to design multi-grained (MG) models. They represent a novel type of low resolution models, different in nature versus CG models as being true multi-resolution models, i . e ., each MG grouping a different number of residues. The three parts constitute hierarchical and multiscale approach for tackling the flexibility of OR.

The Astronomy Genealogy Project: It's more than just tracing your ancestry

NASA Astrophysics Data System (ADS)

Tenn, Joseph S.; AstroGen Team

2017-01-01

The Astronomy Genealogy Project ("AstroGen"), a project of the Historical Astronomy Division (HAD), will soon appear on the AAS website (https://astrogen.aas.org/). Ultimately, it will list the world's astronomers with their highest degrees, titles of theses for those who wrote them, academic advisors, universities, and links to the astronomers or their obituaries, their theses when online, and more. At present the AstroGen team is working on those who earned doctorates with astronomy-related theses. We show what can be learned already, with twelve countries essentially complete and about 19,000 theses recorded. For the twelve countries—Australia, Canada, Chile, Ireland, the Netherlands, New Zealand, Norway, South Africa, Spain, Sweden, the United Kingdom, and the United States—half of the theses have been submitted since 1999, and more than 60% are online. We will present information comparing countries, universities, and eras. Nearly all information has been gathered online, and there is much more available. We are seeking people with knowledge of the languages and academic cultures of other countries to join us.

Evaluation of zirconium as a permanent chemical modifier using synchrotron radiation and imaging techniques for lithium determination in sediment slurry samples by ET AAS.

PubMed

Flores, Araceli V; Pérez, Carlos A; Arruda, Marco A Z

2004-02-27

In the present paper, lithium was determined in river sediment using slurry sampling and electrothermal atomic absorption spectrometry (ET AAS) after L'vov platform coating with zirconium (as a permanent chemical modifier). The performance of this modifier and its distribution on the L'vov platform after different heating cycles were evaluated using synchrotron radiation X-ray fluorescence (SRXRF) and imaging scanning electron microscopy (SEM) techniques. The analytical conditions for lithium determination in river sediment slurries were also investigated and the best conditions were obtained employing 1300 and 2300 degrees C for pyrolysis and atomization temperatures, respectively. In addition, 100mg of sediment samples were prepared using 4.0moll(-1) HNO(3). The Zr-coating permitted lithium determination with good precision and accuracy after 480 heating cycles using the same platform for slurry samples. The sediment samples were collected from five different points of the Cachoeira river, São Paulo, Brazil. The detection and quantification limits were, respectively, 0.07 and 0.23mugl(-1).

X-ray diffraction study of nanocrystalline and amorphous structure within major and minor ampullate dragline spider silks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sampath, Sujatha; Isdebski, Thomas; Jenkins, Janelle E.

Synchrotron X-ray micro-diffraction experiments were carried out on Nephila clavipes (NC) and Argiope aurantia (AA) major (MA) and minor ampullate (MiA) fibers that make up dragline spider silk. The diffraction patterns show a semi-crystalline structure with {beta}-poly(L-alanine) nanocrystallites embedded in a partially oriented amorphous matrix. A superlattice reflection 'S' diffraction ring is observed, which corresponds to a crystalline component larger in size and is poorly oriented, when compared to the {beta}-poly(L-alanine) nanocrystallites that are commonly observed in dragline spider silks. Crystallite size, crystallinity and orientation about the fiber axis have been determined from the wide-angle X-ray diffraction (WAXD) patterns. Inmore » both NC and AA, the MiA silks are found to be more highly crystalline, when compared with the corresponding MA silks. Detailed analysis on the amorphous matrix shows considerable differences in the degree of order of the oriented amorphous component between the different silks studied and may play a crucial role in determining the mechanical properties of the silks.« less

Department of the Navy Supporting Data for FY 1990 and FY 1991 Biennial Budget Estimates Submitted to Congress January 1989, Department of the Navy Industrial Funds Asset Capitalization Program

DTIC Science & Technology

1989-01-01

0.. 0 m 44. 0) 0 GDC .40 IA mUG - SD0 0 .J4 0A Aj m =~ 31 C 4 0 1 cW FA 0~ wr ~ " -~~ ~ ~ mWWJŔ 4~ 66 V) 0 >t* -. 4 >’J -4 -v [A. Aj 0, m 4.) U)-4a...29 0~ U K~M 9-. U. 2 0 UL C9-’ .0 U 9 - . L .10 .,’ 0941 .L 00 1 U~~ ~ a a a 4 = a a (Aa LIO * a aa Or4 t- a i UW SCL - a - 0 a a 1, U, a o - a a S L