FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1

PubMed Central

Awan, Aashir; Bell, Aaron J.; Satir, Peter

2009-01-01

A critical process that builds and maintains the eukaryotic cilium is intraflagellar transport (IFT). This process utilizes members of the kinesin-2 superfamily to transport cargo into the cilium (anterograde transport) and a dynein motor for the retrograde traffic. Using a novel RNAi knockdown method, we have analyzed the function of the homodimeric IFT kinesin-2, Kin5, in Tetrahymena ciliary transport. In RNAi transformants, Kin5 was severely downregulated and disappeared from the cilia, but cilia did not resorb, although tip structure was affected. After deciliation of the knockdown cell, cilia regrew and cells swam, which suggested that Kin5 is not responsible for the trafficking of axonemal precursors to build the cilium, but could be transporting molecules that act in ciliary signal transduction, such as guanine nucleotide exchange proteins (GEFs). Gef1 is a Tetrahymena ciliary protein, and current coimmunoprecipitation and immunofluorescence studies showed that it is absent in regrowing cilia of the knockdown cells lacking ciliary Kin5. We suggest that one important cargo of Kin5 is Gef1 and knockdown of Kin5 results in cell lethality. PMID:19290045

RNAi-Mediated Knockdown of vATPase Subunits Affects Survival and Reproduction of Bed Bugs (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) has resurged as one of the most troublesome household pests affecting people across the globe. Bed bug infestations have increased in recent years primarily due to the evolution of insecticide resistance and the insect's ability to hitchhike with travelers. vATPases are one of the most evolutionarily conserved holoenzymes in eukaryotes, which are mainly involved in proton transport across the plasma membranes and intracellular organelles. RNA interference (RNAi) has been developed as a promising tool for insect control. In this study, we used RNAi as an approach to knock down subunits A and E of the vATPase gene of bed bugs. Delivery of 0.2 µg/insect of dsRNA specific to vATPase-A and vATPase-E into female bed bugs dramatically impaired the laying and viability of eggs over time. Injection of the vATPase-E dsRNA decreased survival of the bed bugs over 30 d. Our results also showed that the knockdown of mRNA is highly effective and persistent up to 30 d post injection. This research demonstrated that silencing of the two vATPase subunits A and E offers a potential strategy to suppress bed bug populations.

RNAi-Mediated Knockdown of IKK1 in Transgenic Mice Using a Transgenic Construct Containing the Human H1 Promoter

PubMed Central

Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos

2014-01-01

Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631

Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

PubMed

Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

2014-01-01

Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.

Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

DOE PAGES

Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...

2016-02-17

Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

Pathogen and Pest Responses Are Altered Due to RNAi-Mediated Knockdown of GLYCOALKALOID METABOLISM 4 in Solanum tuberosum.

PubMed

Paudel, Jamuna Risal; Davidson, Charlotte; Song, Jun; Maxim, Itkin; Aharoni, Asaph; Tai, Helen H

2017-11-01

Steroidal glycoalkaloids (SGAs) are major secondary metabolites constitutively produced in cultivated potato Solanum tuberosum, and α-solanine and α-chaconine are the most abundant SGAs. SGAs are toxic to humans at high levels but their role in plant protection against pests and pathogens is yet to be established. In this study, levels of SGAs in potato were reduced by RNA interference (RNAi)-mediated silencing of GLYCOALKALOID METABOLISM 4 (GAME4)-a gene encoding cytochrome P450, involved in an oxidation step in the conversion of cholesterol to SGA aglycones. Two GAME4 RNAi lines, T8 and T9, were used to investigate the effects of manipulation of the SGA biosynthetic pathway in potato. Growth and development of an insect pest, Colorado potato beetle (CPB), were affected in these lines. While no effect on CPB leaf consumption or weight gain was observed, early instar larval death and accelerated development of the insect was found while feeding on leaves of GAME4 RNAi lines. Modulation of SGA biosynthetic pathway in GAME4 RNAi plants was associated with a larger alteration to the metabolite profile, including increased levels of one or both the steroidal saponins or phytoecdysteroids, which could affect insect mortality as well as development time. Colonization by Verticillium dahliae on GAME4 RNAi plants was also tested. There were increased pathogen levels in the T8 GAME4 RNAi line but not in the T9. Metabolite differences between T8 and T9 were found and may have contributed to differences in V. dahliae infection. Drought responses created by osmotic stress were not affected by modulation of SGA biosynthetic pathway in potato.

AAV-Mediated Gene Transfer to Dorsal Root Ganglion.

PubMed

Yu, Hongwei; Fischer, Gregory; Hogan, Quinn H

2016-01-01

Transferring genetic molecules into the peripheral sensory nervous system to manipulate nociceptive pathophysiology is a powerful approach for experimental modulation of sensory signaling and potentially for translation into therapy for chronic pain. This can be efficiently achieved by the use of recombinant adeno-associated virus (rAAV) in conjunction with nociceptor-specific regulatory transgene cassettes. Among different routes of delivery, direct injection into the dorsal root ganglia (DRGs) offers the most efficient AAV-mediated gene transfer selectively into the peripheral sensory nervous system. Here, we briefly discuss the advantages and applications of intraganglionic microinjection, and then provide a detailed approach for DRG injection, including a list of the necessary materials and description of a method for performing DRG microinjection experiments. We also discuss our experience with several adeno-associated virus (AAV) options for in vivo transgene expression in DRG neurons.

Insecticidal potency of RNAi-based catalase knockdown in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae).

PubMed

Al-Ayedh, Hassan; Rizwan-Ul-Haq, Muhammad; Hussain, Abid; Aljabr, Ahmed M

2016-11-01

Palm trees around the world are prone to notorious Rhynchophorus ferrugineus, which causes heavy losses of palm plantations. In Middle Eastern countries, this pest is a major threat to date palm orchards. Conventional pest control measures with the major share of synthetic insecticides have resulted in insect resistance and environmental issues. Therefore, in order to explore better alternatives, the RNAi approach was employed to knock down the catalase gene in fifth and tenth larval instars with different dsRNA application methods, and their insecticidal potency was studied. dsRNA of 444 bp was prepared to knock down catalase in R. ferrugineus. Out of the three dsRNA application methods, dsRNA injection into larvae was the most effective, followed by dsRNA application by artificial feeding. Both methods resulted in significant catalase knockdown in various tissues, especially the midgut. As a result, the highest growth inhibition of 123.49 and 103.47% and larval mortality of 80 and 40% were observed in fifth-instar larvae, whereas larval growth inhibition remained at 86.83 and 69.08% with larval mortality at 30 and 10% in tenth-instar larvae after dsRNA injection and artificial diet treatment. The topical application method was the least efficient, with the lowest larval growth inhibition of 57.23 and 45.61% and 0% mortality in fifth- and tenth-instar larvae. Generally, better results were noted at the high dsRNA dose of 5 µL. Catalase enzyme is found in most insect body tissues, and thus its dsRNA can cause broad-scale gene knockdown within the insect body, depending upon the application method. Significant larval mortality and growth inhibition after catalase knockdown in R. ferrugineus confirms its insecticidal potency and suggests a bright future for RNAi-based bioinsecticides in pest control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

PubMed Central

Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

2004-01-01

Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene

AAV-CRISPR/Cas9-Mediated Depletion of VEGFR2 Blocks Angiogenesis In Vitro.

PubMed

Wu, Wenyi; Duan, Yajian; Ma, Gaoen; Zhou, Guohong; Park-Windhol, Cindy; D'Amore, Patricia A; Lei, Hetian

2017-12-01

Pathologic angiogenesis is a component of many diseases, including neovascular age-related macular degeneration, proliferation diabetic retinopathy, as well as tumor growth and metastasis. The purpose of this project was to examine whether the system of adeno-associated viral (AAV)-mediated CRISPR (clustered regularly interspaced short palindromic repeats)-associated endonuclease (Cas)9 can be used to deplete expression of VEGF receptor 2 (VEGFR2) in human vascular endothelial cells in vitro and thus suppress its downstream signaling events. The dual AAV system of CRISPR/Cas9 from Streptococcus pyogenes (AAV-SpGuide and -SpCas9) was adapted to edit genomic VEGFR2 in primary human retinal microvascular endothelial cells (HRECs). In this system, the endothelial-specific promoter for intercellular adhesion molecule 2 (ICAM2) was cloned into the dual AAV vectors of SpGuide and SpCas9 for driving expression of green fluorescence protein (GFP) and SpCas9, respectively. These two AAV vectors were applied to production of recombinant AAV serotype 5 (rAAV5), which were used to infect HRECs for depletion of VEGFR2. Protein expression was determined by Western blot; and cell proliferation, migration, as well as tube formation were examined. AAV5 effectively infected vascular endothelial cells (ECs) and retinal pigment epithelial (RPE) cells; the ICAM2 promoter drove expression of GFP and SpCas9 in HRECs, but not in RPE cells. The results showed that the rAAV5-CRISPR/Cas9 depleted VEGFR2 by 80% and completely blocked VEGF-induced activation of Akt, and proliferation, migration as well as tube formation of HRECs. AAV-CRISRP/Cas9-mediated depletion of VEGFR2 is a potential therapeutic strategy for pathologic angiogenesis.

RNAi-mediated knockdown of SPOOK reduces ecdysteroid titers and causes precocious metamorphosis in the desert locust Schistocerca gregaria.

PubMed

Sugahara, Ryohei; Tanaka, Seiji; Shiotsuki, Takahiro

2017-09-01

The Halloween gene SPOOK (SPO) is involved in the production of the active metabolite of ecdysteroid, 20-hydroxyecdysone (20E), in insects. A previous study showed that RNAi-mediated knockdown of SPO in Schistocerca gregaria last instar nymphs markedly reduced the hemolymph 20E titer, but did not affect metamorphosis. In the present study, the effects of SPO interference on development were re-examined in this locust. Injections of SPO double-stranded RNA (dsSPO) into nymphs at mid and late instars significantly delayed nymphal development and interfered with molting. The 20E levels of dsSPO-treated nymphs were generally low, with a delayed, small peak, suggesting that disturbance of the 20E levels caused the above developmental abnormalities. A small proportion of the dsSPO-injected nymphs metamorphosed precociously, producing adults and adultoids. Precocious adults were characterized by small body size, short wings with abbreviated venation, and normal reproductive activity. Fourth instar nymphs that precociously metamorphosed at the following instar exhibited temporal expression patterns of ecdysone-induced protein 93F and the juvenile hormone (JH) early-inducible gene Krüppel homolog 1 similar to those observed at the last instar in normal nymphs. Adultoids displayed mating behavior and adultoid females developed eggs, but never laid eggs. JH injection around the expected time of the 20E peak in the dsSPO-injected nymphs completely inhibited the appearance of adultoids, suggesting that appearance of adultoids might be due to a reduced titer of JH rather than of 20E. These results suggest that SPO plays an important role in controlling morphogenesis, metamorphosis, and reproduction in S. gregaria. Copyright © 2017 Elsevier Inc. All rights reserved.

Sex determination in beetles: Production of all male progeny by Parental RNAi knockdown of transformer

PubMed Central

Shukla, Jayendra Nath; Palli, Subba Reddy

2012-01-01

Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109

Knockdown of RRS1 by lentiviral-mediated RNAi promotes apoptosis and suppresses proliferation of human hepatocellular carcinoma cells.

PubMed

Wang, Jitao; Li, Zhi; Zuo, Changzeng; Xie, Qingfan; Li, Hui; Jia, Junhong; Zhen, Zhongguang; Qi, Ruizhao; Li, Zhiwei; Liu, Dengxiang; Sun, Baijun

2017-10-01

In recent years it was found that the synthesis and biological activity of ribosomes are closely associated with tumor cell growth, tumorigenesis, and malignant transformation. However, the role of regulator of ribosome synthesis 1 (RRS1) in hepatocellular carcinoma (HCC) has not yet been reported. In the present study, we aimed to examine the potential role of RRS1 in tumor cell growth by using a lentivirus-mediated RNA interference (RNAi) system in the HCC cell line SMMC-7721 in vitro. Compared with that of the negative control group (Lv-shCon), the mRNA and protein expression levels of RRS1 in SMMC-7721 cells transfected with Lv-shRRS1 were significantly decreased. Further experiments found that silencing of RRS1 gene expression in SMMC-7721 cells significantly suppressed cell proliferation, inhibited colony formation capacity, increased apoptosis and arrested cells in the G1 phase. These results suggest that the RRS1 gene plays a critical role in cell proliferation, colony formation, cell apoptosis and cell cycle distribution in human HCC cells, and that silencing of RRS1 by RNAi is a promising therapeutic approach for the treatment of HCC, and should be further developed.

Genome-wide RNAi screening identifies host restriction factors critical for in vivo AAV transduction

PubMed Central

Mano, Miguel; Ippodrino, Rudy; Zentilin, Lorena; Zacchigna, Serena; Giacca, Mauro

2015-01-01

Viral vectors based on the adeno-associated virus (AAV) hold great promise for in vivo gene transfer; several unknowns, however, still limit the vectors’ broader and more efficient application. Here, we report the results of a high-throughput, whole-genome siRNA screening aimed at identifying cellular factors regulating AAV transduction. We identified 1,483 genes affecting vector efficiency more than 4-fold and up to 50-fold, either negatively or positively. Most of these factors have not previously been associated to AAV infection. The most effective siRNAs were independent from the virus serotype or analyzed cell type and were equally evident for single-stranded and self-complementary AAV vectors. A common characteristic of the most effective siRNAs was the induction of cellular DNA damage and activation of a cell cycle checkpoint. This information can be exploited for the development of more efficient AAV-based gene delivery procedures. Administration of the most effective siRNAs identified by the screening to the liver significantly improved in vivo AAV transduction efficiency. PMID:26305933

Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD.

PubMed

Wallace, Lindsay M; Saad, Nizar Y; Pyne, Nettie K; Fowler, Allison M; Eidahl, Jocelyn O; Domire, Jacqueline S; Griffin, Danielle A; Herman, Adam C; Sahenk, Zarife; Rodino-Klapac, Louise R; Harper, Scott Q

2018-03-16

RNAi emerged as a prospective molecular therapy nearly 15 years ago. Since then, two major RNAi platforms have been under development: oligonucleotides and gene therapy. Oligonucleotide-based approaches have seen more advancement, with some promising therapies that may soon reach market. In contrast, vector-based approaches for RNAi therapy have remained largely in the pre-clinical realm, with limited clinical safety and efficacy data to date. We are developing a gene therapy approach to treat the autosomal-dominant disorder facioscapulohumeral muscular dystrophy. Our strategy involves silencing the myotoxic gene DUX4 using adeno-associated viral vectors to deliver targeted microRNA expression cassettes (miDUX4s). We previously demonstrated proof of concept for this approach in mice, and we are now taking additional steps here to assess safety issues related to miDUX4 overexpression and sequence-specific off-target silencing. In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not. This study provides important data to help advance our goal of translating RNAi gene therapy for facioscapulohumeral muscular dystrophy.

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted

RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smialowska, Agata, E-mail: smialowskaa@gmail.com; School of Life Sciences, Södertörn Högskola, Huddinge 141-89; Djupedal, Ingela

Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its rolemore » in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.« less

AAV Vectorization of DSB-mediated Gene Editing Technologies.

PubMed

Moser, Rachel J; Hirsch, Matthew L

2016-01-01

Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was

AAV-mediated pancreatic overexpression of Igf1 counteracts progression to autoimmune diabetes in mice.

PubMed

Mallol, Cristina; Casana, Estefania; Jimenez, Veronica; Casellas, Alba; Haurigot, Virginia; Jambrina, Claudia; Sacristan, Victor; Morró, Meritxell; Agudo, Judith; Vilà, Laia; Bosch, Fatima

2017-07-01

Type 1 diabetes is characterized by autoimmune destruction of β-cells leading to severe insulin deficiency. Although many improvements have been made in recent years, exogenous insulin therapy is still imperfect; new therapeutic approaches, focusing on preserving/expanding β-cell mass and/or blocking the autoimmune process that destroys islets, should be developed. The main objective of this work was to test in non-obese diabetic (NOD) mice, which spontaneously develop autoimmune diabetes, the effects of local expression of Insulin-like growth factor 1 (IGF1), a potent mitogenic and pro-survival factor for β-cells with immunomodulatory properties. Transgenic NOD mice overexpressing IGF1 specifically in β-cells (NOD-IGF1) were generated and phenotyped. In addition, miRT-containing, IGF1-encoding adeno-associated viruses (AAV) of serotype 8 (AAV8-IGF1-dmiRT) were produced and administered to 4- or 11-week-old non-transgenic NOD females through intraductal delivery. Several histological, immunological, and metabolic parameters were measured to monitor disease over a period of 28-30 weeks. In transgenic mice, local IGF1 expression led to long-term suppression of diabetes onset and robust protection of β-cell mass from the autoimmune insult. AAV-mediated pancreatic-specific overexpression of IGF1 in adult animals also dramatically reduced diabetes incidence, both when vectors were delivered before pathology onset or once insulitis was established. Transgenic NOD-IGF1 and AAV8-IGF1-dmiRT-treated NOD animals had much less islet infiltration than controls, preserved β-cell mass, and normal insulinemia. Transgenic and AAV-treated islets showed less expression of antigen-presenting molecules, inflammatory cytokines, and chemokines important for tissue-specific homing of effector T cells, suggesting IGF1 modulated islet autoimmunity in NOD mice. Local expression of Igf1 by AAV-mediated gene transfer counteracts progression to diabetes in NOD mice. This study suggests a

A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

PubMed

Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

2015-01-01

We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

AAV-mediated netrin-1 overexpression increases peri-infarct blood vessel density and improves motor function recovery after experimental stroke.

PubMed

Sun, Hui; Le, Thang; Chang, Tiffany T J; Habib, Aisha; Wu, Steven; Shen, Fanxia; Young, William L; Su, Hua; Liu, Jialing

2011-10-01

Apart from its role in axon guidance, netrin-1 is also known to be pro-angiogenic. The aim of this study is to determine whether adeno-associated viral (AAV) mediated overexpression of netrin-1 improves post-stroke neurovascular structure and recovery of function. AAV-Netrin-1 or AAV-LacZ of 1×10(10) genome copies each was injected medial and posterior to ischemic lesion at one hour following reperfusion using the distal middle cerebral artery occlusion (MCAO) method. Quantitative RT-PCR revealed that the expression of netrin-1 transgene began as early as one day and increased dramatically about 3 weeks following vector injection. Western blot analysis and confocal microscopy suggested that both the endogenous and transduced netrin-1 were expressed in the neurons of the peri-infarct cortex after MCAO. AAV-mediated netrin-1 overexpression significantly increased vascular density in the peri-infarct cortex and promoted the migration of immature neurons into the peri-infarct white matter, but it did not significantly reduce infarct size. Netrin-1 overexpression also enhanced post-stroke locomotor activity, improved exploratory behavior, and reduced ischemia-induced motor asymmetry in forelimb usage. However, it had little effect on post-stroke spatial learning and memory. Our results suggest that AAV mediated netrin-1 overexpression improves peri-infarct vascular density and post stroke motor function. Published by Elsevier Inc.

Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

PubMed Central

De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

2006-01-01

RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology.

PubMed

Raut, Sandeep; Mallik, Bhagaban; Parichha, Arpan; Amrutha, Valsakumar; Sahi, Chandan; Kumar, Vimlesh

2017-07-05

Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C -Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development. Copyright © 2017 Raut et al.

The Influence of Endocrine Disrupting Chemicals on the Proliferation of ERα Knockdown-Human Breast Cancer Cell Line MCF-7; New Attempts by RNAi Technology

PubMed Central

Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki

2009-01-01

Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024

Establishment of a tissue-specific RNAi system in C. elegans.

PubMed

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

2007-10-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

Establishment of a tissue-specific RNAi system in C. elegans

PubMed Central

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

2011-01-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

Knockdown and replacement therapy mediated by artificial mirtrons in spinocerebellar ataxia 7

PubMed Central

Curtis, Helen J.; Wood, Matthew J.A.

2017-01-01

Abstract We evaluate a knockdown-replacement strategy mediated by mirtrons as an alternative to allele-specific silencing using spinocerebellar ataxia 7 (SCA7) as a model. Mirtrons are introns that form pre-microRNA hairpins after splicing, producing RNAi effectors not processed by Drosha. Mirtron mimics may therefore avoid saturation of the canonical processing pathway. This method combines gene silencing mediated by an artificial mirtron with delivery of a functional copy of the gene such that both elements of the therapy are always expressed concurrently, minimizing the potential for undesirable effects and preserving wild-type function. This mutation- and single nucleotide polymorphism-independent method could be crucial in dominant diseases that feature both gain- and loss-of-function pathologies or have a heterogeneous genetic background. Here we develop mirtrons against ataxin 7 with silencing efficacy comparable to shRNAs, and introduce silent mutations into an ataxin 7 transgene such that it is resistant to their effect. We successfully express the transgene and one mirtron together from a single construct. Hence, we show that this method can be used to silence the endogenous allele of ataxin 7 and replace it with an exogenous copy of the gene, highlighting the efficacy and transferability across patient genotypes of this approach. PMID:28575281

Clathrin Heavy Chain Is Important for Viability, Oviposition, Embryogenesis and, Possibly, Systemic RNAi Response in the Predatory Mite Metaseiulus occidentalis

PubMed Central

Wu, Ke; Hoy, Marjorie A.

2014-01-01

Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis. PMID:25329675

AAV-mediated targeting of gene expression to the peri-infarct region in rat cortical stroke model.

PubMed

Mätlik, Kert; Abo-Ramadan, Usama; Harvey, Brandon K; Arumäe, Urmas; Airavaara, Mikko

2014-10-30

For stroke patients the recovery of cognitive and behavioral functions is often incomplete. Functional recovery is thought to be mediated largely by connectivity rearrangements in the peri-infarct region. A method for manipulating gene expression in this region would be useful for identifying new recovery-enhancing treatments. We have characterized a way of targeting adeno-associated virus (AAV) vectors to the peri-infarct region of cortical ischemic lesion in rats 2days after middle cerebral artery occlusion (MCAo). We used magnetic resonance imaging (MRI) to show that the altered properties of post-ischemic brain tissue facilitate the spreading of intrastriatally injected nanoparticles toward the infarct. We show that subcortical injection of green fluorescent protein-encoding dsAAV7-GFP resulted in transduction of cells in and around the white matter tract underlying the lesion, and in the cortex proximal to the lesion. A similar result was achieved with dsAAV7 vector encoding the cerebral dopamine neurotrophic factor (CDNF), a protein with therapeutic potential. Viral vector-mediated intracerebral gene delivery has been used before in rodent models of ischemic injury. However, the method of targeting gene expression to the peri-infarct region, after the initial phase of ischemic cell death, has not been described before. We demonstrate a straightforward and robust way to target AAV vector-mediated over-expression of genes to the peri-infarct region in a rat stroke model. This method will be useful for studying the action of specific proteins in peri-infarct region during the recovery process. Copyright © 2014 Elsevier B.V. All rights reserved.

Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.

PubMed

Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F

2015-01-01

Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.

RNAi phenotype profiling of kinases identifies potential therapeutic targets in Ewing's sarcoma.

PubMed

Arora, Shilpi; Gonzales, Irma M; Hagelstrom, R Tanner; Beaudry, Christian; Choudhary, Ashish; Sima, Chao; Tibes, Raoul; Mousses, Spyro; Azorsa, David O

2010-08-18

Ewing's sarcomas are aggressive musculoskeletal tumors occurring most frequently in the long and flat bones as a solitary lesion mostly during the teen-age years of life. With current treatments, significant number of patients relapse and survival is poor for those with metastatic disease. As part of novel target discovery in Ewing's sarcoma, we applied RNAi mediated phenotypic profiling to identify kinase targets involved in growth and survival of Ewing's sarcoma cells. Four Ewing's sarcoma cell lines TC-32, TC-71, SK-ES-1 and RD-ES were tested in high throughput-RNAi screens using a siRNA library targeting 572 kinases. Knockdown of 25 siRNAs reduced the growth of all four Ewing's sarcoma cell lines in replicate screens. Of these, 16 siRNA were specific and reduced proliferation of Ewing's sarcoma cells as compared to normal fibroblasts. Secondary validation and preliminary mechanistic studies highlighted the kinases STK10 and TNK2 as having important roles in growth and survival of Ewing's sarcoma cells. Furthermore, knockdown of STK10 and TNK2 by siRNA showed increased apoptosis. In summary, RNAi-based phenotypic profiling proved to be a powerful gene target discovery strategy, leading to successful identification and validation of STK10 and TNK2 as two novel potential therapeutic targets for Ewing's sarcoma.

Microinjection-based RNA interference knockdown of ecdysteroid biosynthetic genes in a non-model hemipteran pest, Lygus hesperus (western tarnished plant bug)

USDA-ARS?s Scientific Manuscript database

RNAi-mediated knockdown of target transcripts offers great potential, both in terms of insect functional genomics and the development of novel insect pest management strategies. Frequently, dsRNAs targeting transcripts of interest are introduced orally to the target organism via feeding. This delive...

Zinc-finger nuclease-mediated gene correction using single AAV vector transduction and enhancement by Food and Drug Administration-approved drugs

PubMed Central

Ellis, BL; Hirsch, ML; Porter, SN; Samulski, RJ; Porteus, MH

2016-01-01

An emerging strategy for the treatment of monogenic diseases uses genetic engineering to precisely correct the mutation(s) at the genome level. Recent advancements in this technology have demonstrated therapeutic levels of gene correction using a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. This strategy requires efficient nucleic acid delivery and among viral vectors, recombinant adeno-associated virus (rAAV) has demonstrated clinical success without pathology. However, a major limitation of rAAV is the small DNA packaging capacity and to date, the use of rAAV for ZFN gene delivery has yet to be reported. Theoretically, an ideal situation is to deliver both ZFNs and the repair substrate in a single vector to avoid inefficient gene targeting and unwanted mutagenesis, both complications of a rAAV co-transduction strategy. Therefore, a rAAV format was generated in which a single polypeptide encodes the ZFN monomers connected by a ribosome skipping 2A peptide and furin cleavage sequence. On the basis of this arrangement, a DNA repair substrate of 750 nucleotides was also included in this vector. Efficient polypeptide processing to discrete ZFNs is demonstrated, as well as the ability of this single vector format to stimulate efficient gene targeting in a human cell line and mouse model derived fibroblasts. Additionally, we increased rAAV-mediated gene correction up to sixfold using a combination of Food and Drug Administration-approved drugs, which act at the level of AAV vector transduction. Collectively, these experiments demonstrate the ability to deliver ZFNs and a repair substrate by a single AAV vector and offer insights for the optimization of rAAV-mediated gene correction using drug therapy. PMID:22257934

Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.

PubMed

Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A

2018-05-01

RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.

Conditional RNAi: towards a silent gene therapy.

PubMed

Lee, Sang-Kyung; Kumar, Priti

2009-07-02

RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

Packaging of Human Chromosome 19-Specific Adeno-Associated Virus (AAV) Integration Sites in AAV Virions during AAV Wild-Type and Recombinant AAV Vector Production

PubMed Central

Hüser, Daniela; Weger, Stefan; Heilbronn, Regine

2003-01-01

Adeno-associated virus type 2 (AAV-2) establishes latency by site-specific integration into a unique locus on human chromosome 19, called AAVS1. During the development of a sensitive real-time PCR assay for site-specific integration, AAV-AAVS1 junctions were reproducibly detected in highly purified AAV wild-type and recombinant AAV vector stocks. A series of controls documented that the junctions were packaged in AAV capsids and were newly generated during a single round of AAV production. Cloned junctions displayed variable AAV sequences fused to AAVS1. These data suggest that packaged junctions represent footprints of AAV integration during productive infection. Apparently, AAV latency established by site-specific integration and the helper virus-dependent, productive AAV cycle are more closely related than previously thought. PMID:12663794

Adeno-Associated Virus Type 6 (AAV6) Vectors Mediate Efficient Transduction of Airway Epithelial Cells in Mouse Lungs Compared to That of AAV2 Vectors

PubMed Central

Halbert, Christine L.; Allen, James M.; Miller, A. Dusty

2001-01-01

Although vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in many somatic tissues, studies with animal models and cultured cells show that the apical surface of airway epithelia is resistant to transduction by AAV2 vectors. Approaches to increase transduction rates include increasing the amount of vector and perturbing the integrity of the epithelia. In this study, we explored the use of vectors based on AAV6 to increase transduction rates in airways. AAV vectors were made using combinations of rep, cap, and packaged genomes from AAV2 or AAV6. The packaged genomes encoded human placental alkaline phosphatase and contained terminal repeat sequences from AAV2 or AAV6. We found that transduction efficiency was primarily dependent on the source of Cap protein, defined here as the vector pseudotype. The AAV6 and AAV2 pseudotype vectors exhibited different tropisms in tissue-cultured cells, and cell transduction by AAV6 vectors was not inhibited by heparin, nor did they compete for entry in a transduction assay, indicating that AAV6 and AAV2 capsid bind different receptors. In vivo analysis of vectors showed that AAV2 pseudotype vectors gave high transduction rates in alveolar cells but much lower rates in the airway epithelium. In contrast, the AAV6 pseudotype vectors exhibited much more efficient transduction of epithelial cells in large and small airways, showing up to 80% transduction in some airways. These results, combined with our previous results showing lower immunogenicity of AAV6 than of AAV2 vectors, indicate that AAV6 vectors may provide significant advantages over AAV2 for gene therapy of lung diseases like cystic fibrosis. PMID:11413329

Establishment of an AAV Reverse Infection-Based Array

PubMed Central

Wang, Gang; Dong, Zheyue; Shen, Wei; Zheng, Gang; Wu, Xiaobing; Xue, Jinglun; Wang, Yue; Chen, Jinzhong

2010-01-01

Background The development of a convenient high-throughput gene transduction approach is critical for biological screening. Adeno-associated virus (AAV) vectors are broadly used in gene therapy studies, yet their applications in in vitro high-throughput gene transduction are limited. Principal Findings We established an AAV reverse infection (RI)-based method in which cells were transduced by quantified recombinant AAVs (rAAVs) pre-coated onto 96-well plates. The number of pre-coated rAAV particles and number of cells loaded per well, as well as the temperature stability of the rAAVs on the plates, were evaluated. As the first application of this method, six serotypes or hybrid serotypes of rAAVs (AAV1, AAV2, AAV5/5, AAV8, AAV25 m, AAV28 m) were compared for their transduction efficiencies using various cell lines, including BHK21, HEK293, BEAS-2BS, HeLaS3, Huh7, Hepa1-6, and A549. AAV2 and AAV1 displayed high transduction efficiency; thus, they were deemed to be suitable candidate vectors for the RI-based array. We next evaluated the impact of sodium butyrate (NaB) treatment on rAAV vector-mediated reporter gene expression and found it was significantly enhanced, suggesting that our system reflected the biological response of target cells to specific treatments. Conclusions/Significance Our study provides a novel method for establishing a highly efficient gene transduction array that may be developed into a platform for cell biological assays. PMID:20976058

AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

PubMed Central

Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

2015-01-01

Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

Scavenger receptor mediates systemic RNA interference in ticks.

PubMed

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.

Scavenger Receptor Mediates Systemic RNA Interference in Ticks

PubMed Central

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043

Recombinant AAV-directed gene therapy for type I glycogen storage diseases

PubMed Central

Chou, JY; Mansfield, BC

2011-01-01

Introduction Glycogen storage disease (GSD) type Ia and Ib are disorders of impaired glucose homeostasis affecting the liver and kidney. GSD-Ib also affects neutrophils. Current dietary therapies cannot prevent long-term complications. In animal studies, recombinant adeno-associated virus (rAAV) vector-mediated gene therapy can correct or minimize multiple aspects of the disorders, offering hope for human gene therapy. Areas covered A summary of recent progress in rAAV-mediated gene therapy for GSD-I; strategies to improve rAAV-mediated gene delivery, transduction efficiency and immune avoidance; and vector refinements that improve expression. Expert opinion rAAV-mediated gene delivery to the liver can restore glucose homeostasis in preclinical models of GSD-I, but some long-term complications of the liver and kidney remain. Gene therapy for GSD-Ib is less advanced than for GSD-Ia and only transient correction of myeloid dysfunction has been achieved. A question remains whether a single rAAV vector can meet the expression efficiency and tropism required to treat all aspects of GSD-I, or if a multi-prong approach is needed. An understanding of the strengths and weaknesses of rAAV vectors in the context of strategies to achieve efficient transduction of the liver, kidney, and hematopoietic stem cells is required for treating GSD-I. PMID:21504389

Delivery of RNAi reagents in murine models of obesity and diabetes.

PubMed

Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

2006-11-29

RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.

PubMed

Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori

2011-02-11

Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.

Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).

PubMed

Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash

2015-01-01

The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.

An RNAi-mediated screen identifies novel targets for next-generation antiepileptic drugs based on increased expression of the homeostatic regulator pumilio.

PubMed

Lin, Wei-Hsiang; He, Miaomiao; Fan, Yuen Ngan; Baines, Richard A

2018-05-02

Despite availability of a diverse range of anti-epileptic drugs (AEDs), only about two-thirds of epilepsy patients respond well to drug treatment. Thus, novel targets are required to catalyse the design of next-generation AEDs. Manipulation of neuron firing-rate homoeostasis, through enhancing Pumilio (Pum) activity, has been shown to be potently anticonvulsant in Drosophila. In this study, we performed a genome-wide RNAi screen in S2R + cells, using a luciferase-based dPum activity reporter and identified 1166 genes involved in dPum regulation. Of these genes, we focused on 699 genes that, on knock-down, potentiate dPum activity/expression. Of this subgroup, 101 genes are activity-dependent based on comparison with genes previously identified as activity-dependent by RNA-sequencing. Functional cluster analysis shows these genes are enriched in pathways involved in DNA damage, regulation of cell cycle and proteasomal protein catabolism. To test for anticonvulsant activity, we utilised an RNA-interference approach in vivo. RNAi-mediated knockdown showed that 57/101 genes (61%) are sufficient to significantly reduce seizure duration in the characterized seizure mutant, para bss . We further show that chemical inhibitors of protein products of some of the genes targeted are similarly anticonvulsant. Finally, to establish whether the anticonvulsant activity of identified compounds results from increased dpum transcription, we performed a luciferase-based assay to monitor dpum promoter activity. Third instar larvae exposed to sodium fluoride, gemcitabine, metformin, bestatin, WP1066 or valproic acid all showed increased dpum promoter activity. Thus, this study validates Pum as a favourable target for AED design and, moreover, identifies a number of lead compounds capable of increasing the expression of this homeostatic regulator.

Direct comparison of administration routes for AAV8-mediated ocular gene therapy.

PubMed

Igarashi, Tsutomu; Miyake, Koichi; Asakawa, Nagisa; Miyake, Noriko; Shimada, Takashi; Takahashi, Hiroshi

2013-05-01

We recently demonstrated that direct subretinal (SR) injection of adeno-associated virus (AAV) type 8 (AAV8) into photoreceptor cells and retinal pigment epithelium (RPE) is a highly efficient model of gene delivery. The current study compared transduction efficiency and expression patterns associated with various routes of vector administration. The efficacy of intravitreal (VT), SR and subconjunctival (SC) injections for delivery of AAV8-derived vectors, i.e. those expressing luciferase (Luc) and enhanced green fluorescent protein (GFP) - AAV8/Luc and AAV8/GFP, respectively - were compared in an animal (mouse) model (n = 8 mice/group). Transduction efficiency and expression patterns were examined at post-injection weeks 1 and 2, and months 1, 3, 6 and 12 via in vivo imaging. One year after AAV injection, AAV8/Luc-treated mice exhibited stable and sustained high expression of vector in the VT and SR groups, but not in the SC group (VT:SR:SC = 3,218:2,923:115; 1 × 10(5 )photons/s). Histological analysis showed that GFP expression was observed in the inner retina of VT group mice, and in photoreceptor cells and RPE of SR group mice, whereas no GFP expression was noted in the SC group. Electroretinography (ERG) revealed adverse effects following SR delivery. Results suggest that both SR and VT injections of AAV8 vectors are useful routes for administering ocular gene therapy, and stress the importance of selecting an appropriate administration route, i.e. one that targets specific cells, for treating ocular disorders.

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Prevalence of Neutralizing Antibodies against Adeno-Associated Virus (AAV) Types 2, 5, and 6 in Cystic Fibrosis and Normal Populations: Implications for Gene Therapy using AAV Vectors

PubMed Central

Halbert, Christine L.; Miller, A. Dusty; McNamara, Sharon; Emerson, Julia; Gibson, Ronald L.; Ramsey, Bonnie; Aitken, Moira L.

2014-01-01

Adeno-associated virus (AAV) vectors are promising candidates for gene therapy directed to the lungs, in particular for treatment of cystic fibrosis (CF). In animal models of lung gene transfer, neutralizing antibodies in serum made in response to vector exposure have been associated with a partial to complete block to repeat transduction by vectors with the same capsid type, thus transduction by AAV vectors might be inefficient in humans previously exposed to the same AAV type. AAV type 2 (AAV2) has been used in clinical trials of lung gene transfer, but AAV5 and AAV6 have been shown to mediate more efficient transduction in rodent lungs and in cultured human airway epithelia compared to that of AAV2. Here we have measured neutralizing antibodies against AAV type 2, 5, and 6 vectors in serum from children and adults with CF, and from normal adults. About 30% of adults were seropositive for AAV2, 20–30% were seropositive for AAV6, and 10–20% were seropositive for AAV5. CF children were seropositive for AAV types 2, 5, or 6 at rates of 4–15%. All individuals seropositive for AAV6 were also seropositive for AAV2, and the AAV6 titer was low compared to the AAV2 titer. AAV5-positive sera were lower both in titers and rates than those seen for AAV6. The results indicate that AAV type 2, 5 or 6 exposure is low in CF and control populations and even lower in CF children. PMID:16610931

Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei

2014-10-10

Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

PubMed

Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited "half-ecdysis". In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua

PubMed Central

Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1st to 5th instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4th instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20–94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited “half-ecdysis”. In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control. PMID

Tyrosine-phosphorylation of AAV2 vectors and its consequences on viral intracellular trafficking and transgene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong Li; Powell Gene Therapy Center, University of Florida College of Medicine, Gainesville, FL; Genetics Institute, University of Florida College of Medicine, Gainesville, FL

2008-11-25

We have documented that epidermal growth factor receptor protein tyrosine kinase (EGFR-PTK) signaling negatively affects intracellular trafficking and transduction efficiency of recombinant adeno-associated virus 2 (AAV2) vectors. Specifically, inhibition of EGFR-PTK signaling leads to decreased ubiquitination of AAV2 capsid proteins, which in turn, facilitates viral nuclear transport by limiting proteasome-mediated degradation of AAV2 vectors. In the present studies, we observed that AAV capsids can indeed be phosphorylated at tyrosine residues by EGFR-PTK in in vitro phosphorylation assays and that phosphorylated AAV capsids retain their structural integrity. However, although phosphorylated AAV vectors enter cells as efficiently as their unphosphorylated counterparts, theirmore » transduction efficiency is significantly reduced. This reduction is not due to impaired viral second-strand DNA synthesis since transduction efficiency of both single-stranded AAV (ssAAV) and self-complementary AAV (scAAV) vectors is decreased by {approx} 68% and {approx} 74%, respectively. We also observed that intracellular trafficking of tyrosine-phosphorylated AAV vectors from cytoplasm to nucleus is significantly decreased, which results from ubiquitination of AAV capsids followed by proteasome-mediated degradation, although downstream consequences of capsid ubiquitination may also be affected by tyrosine-phosphorylation. These studies provide new insights into the role of tyrosine-phosphorylation of AAV capsids in various steps in the virus life cycle, which has implications in the optimal use of recombinant AAV vectors in human gene therapy.« less

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

PubMed

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

AAV9-mediated engineering of autotransplanted kidney of non-human primates.

PubMed

Tomasoni, S; Trionfini, P; Azzollini, N; Zentilin, L; Giacca, M; Aiello, S; Longaretti, L; Cozzi, E; Baldan, N; Remuzzi, G; Benigni, A

2017-05-01

Ex vivo gene transfer to the graft before transplantation is an attractive option for circumventing systemic side effects of chronic antirejection therapy. Gene delivery of the immunomodulatory protein cytotoxic T-lymphocyte-associated protein 4-immunoglobulin (CTLA4-Ig) prevented chronic kidney rejection in a rat model of allotransplantation without the need for systemic immunosuppression. Here we generated adeno-associated virus type 2 (AAV2) and AAV9 vectors encoding for LEA29Y, an optimized version of CTLA4-Ig. Both LEA29Y vectors were equally efficient for reducing T-cell proliferation in vitro. Serotype 9 was chosen for in vivo experiments owing to a lower frequency of preformed antibodies against the AAV9 capsid in 16 non-human primate tested sera. AAV9-LEA29Y was able to transduce the kidney of non-human primates in an autotransplantation model. Expression of LEA29Y mRNA by renal cells translated into the production of the corresponding protein, which was confined to the graft but not detected in serum. Results in non-human primates represent a step forward in maintaining the portability of this strategy into clinics.

Rescue of Pompe disease in mice by AAV-mediated liver delivery of secretable acid α-glucosidase

PubMed Central

Puzzo, Francesco; Colella, Pasqualina; Biferi, Maria G.; Bali, Deeksha; Paulk, Nicole K.; Vidal, Patrice; Collaud, Fanny; Simon-Sola, Marcelo; Charles, Severine; Hardet, Romain; Leborgne, Christian; Meliani, Amine; Cohen-Tannoudji, Mathilde; Astord, Stephanie; Gjata, Bernard; Sellier, Pauline; van Wittenberghe, Laetitia; Vignaud, Alban; Boisgerault, Florence; Barkats, Martine; Laforet, Pascal; Kay, Mark A.; Koeberl, Dwight D.; Ronzitti, Giuseppe; Mingozzi, Federico

2018-01-01

Glycogen storage disease type II or Pompe disease is a severe neuromuscular disorder caused by mutations in the lysosomal enzyme, acid α-glucosidase (GAA), which result in pathological accumulation of glycogen throughout the body. Enzyme replacement therapy is available for Pompe disease; however, it has limited efficacy, has high immunogenicity, and fails to correct pathological glycogen accumulation in nervous tissue and skeletal muscle. Using bioinformatics analysis and protein engineering, we developed transgenes encoding GAA that could be expressed and secreted by hepatocytes. Then, we used adeno-associated virus (AAV) vectors optimized for hepatic expression to deliver the GAA transgenes to Gaa knockout (Gaa−/−) mice, a model of Pompe disease. Therapeutic gene transfer to the liver rescued glycogen accumulation in muscle and the central nervous system, and ameliorated cardiac hypertrophy as well as muscle and respiratory dysfunction in the Gaa−/− mice; mouse survival was also increased. Secretable GAA showed improved therapeutic efficacy and lower immunogenicity compared to nonengineered GAA. Scale-up to nonhuman primates, and modeling of GAA expression in primary human hepatocytes using hepatotropic AAV vectors, demonstrated the therapeutic potential of AAV vector–mediated liver expression of secretable GAA for treating pathological glycogen accumulation in multiple tissues in Pompe disease. PMID:29187643

RNAi-mediated resistance against Cotton leaf curl disease in elite Indian cotton (Gossypium hirsutum) cultivar Narasimha.

PubMed

Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A

2016-08-01

Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.

Assaying the Stability and Inactivation of AAV Serotype 1 Vectors

PubMed Central

Howard, Douglas B.; Harvey, Brandon K.

2017-01-01

Adeno-associated virus (AAV) vectors are a commonplace tool for gene delivery ranging from cell culture to human gene therapy. One feature that makes AAV a desirable vector is its stability, in regard to both the duration of transgene expression and retention of infectivity as a viral particle. This study examined the stability of AAV serotype 1 (AAV1) vectors under different conditions. First, transducibility after storage at 4°C decreased 20% over 7 weeks. Over 10 freeze–thaw cycles, the resulting transduction efficiency became variable at 60–120% of a single thaw. Using small stainless steel slugs to mimic a biosafety cabinet or metal lab bench surface, it was found that an AAV1 vector can be reconstituted after 6 days of storage at room temperature. The stability of AAV is a desired feature, but effective decontamination procedures must be available for safety and experimental integrity. Multiple disinfectants commonly used in the laboratory for ability to inactivate an AAV1 vector were tested, and it was found that autoclaving, 0.25% peracetic acid, iodine, or 10% Clorox bleach completely prevented AAV-mediated transgene expression. These data suggest that peracetic acid should be used for inactivating AAV1 vectors on metal-based surfaces or instruments in order to avoid inadvertent transgene expression in human cells or cross-contamination of instruments. PMID:28192678

Unsupervised automated high throughput phenotyping of RNAi time-lapse movies.

PubMed

Failmezger, Henrik; Fröhlich, Holger; Tresch, Achim

2013-10-04

Gene perturbation experiments in combination with fluorescence time-lapse cell imaging are a powerful tool in reverse genetics. High content applications require tools for the automated processing of the large amounts of data. These tools include in general several image processing steps, the extraction of morphological descriptors, and the grouping of cells into phenotype classes according to their descriptors. This phenotyping can be applied in a supervised or an unsupervised manner. Unsupervised methods are suitable for the discovery of formerly unknown phenotypes, which are expected to occur in high-throughput RNAi time-lapse screens. We developed an unsupervised phenotyping approach based on Hidden Markov Models (HMMs) with multivariate Gaussian emissions for the detection of knockdown-specific phenotypes in RNAi time-lapse movies. The automated detection of abnormal cell morphologies allows us to assign a phenotypic fingerprint to each gene knockdown. By applying our method to the Mitocheck database, we show that a phenotypic fingerprint is indicative of a gene's function. Our fully unsupervised HMM-based phenotyping is able to automatically identify cell morphologies that are specific for a certain knockdown. Beyond the identification of genes whose knockdown affects cell morphology, phenotypic fingerprints can be used to find modules of functionally related genes.

Syngeneic AAV pseudo-particles potentiate gene transduction of AAV vectors

USDA-ARS?s Scientific Manuscript database

Gene delivery vectors based on adeno-associated virus (AAV) have emerged as safe and efficient therapeutic platform for numerous diseases. Excessive empty particles were generated as impurities during AAV vector production, but their effects on clinical outcome of AAV gene therapy are unclear. Here,...

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

PubMed Central

Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

2014-01-01

In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

Comparative biology of rAAV transduction in ferret, pig and human airway epithelia.

PubMed

Liu, X; Luo, M; Guo, C; Yan, Z; Wang, Y; Engelhardt, J F

2007-11-01

Differences between rodent and human airway cell biology have made it difficult to translate recombinant adeno-associated virus (rAAV)-mediated gene therapies to the lung for cystic fibrosis (CF). As new ferret and pig models for CF become available, knowledge about host cell/vector interactions in these species will become increasingly important for testing potential gene therapies. To this end, we have compared the transduction biology of three rAAV serotypes (AAV1, 2 and 5) in human, ferret, pig and mouse-polarized airway epithelia. Our results indicate that apical transduction of ferret and pig airway epithelia with these rAAV serotypes closely mirrors that observed in human epithelia (rAAV1>rAAV2 congruent withrAAV5), while transduction of mouse epithelia was significantly different (rAAV1>rAAV5>rAAV2). Similarly, ferret, pig and human epithelia also shared serotype-specific differences in the polarity (apical vs basolateral) and proteasome dependence of rAAV transduction. Despite these parallels, N-linked sialic acid receptors were required for rAAV1 and rAAV5 transduction of human and mouse airway epithelia, but not ferret or pig airway epithelia. Hence, although the airway tropisms of rAAV serotypes 1, 2 and 5 are conserved better among ferret, pig and human as compared to mouse, viral receptors/co-receptors appear to maintain considerable species diversity.

Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.

PubMed

Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian

2009-03-01

siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.

Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice

PubMed Central

Judge, Adam D.; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian

2009-01-01

siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target’s biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics. PMID:19229107

Assessing the potential for AAV vector genotoxicity in a murine model

PubMed Central

Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

2011-01-01

Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

Recent tissue engineering-based advances for effective rAAV-mediated gene transfer in the musculoskeletal system.

PubMed

Rey-Rico, Ana; Cucchiarini, Magali

2016-04-01

Musculoskeletal tissues are diverse and significantly different in their ability to repair upon injury. Current treatments often fail to reproduce the natural functions of the native tissue, leading to an imperfect healing. Gene therapy might improve the repair of tissues by providing a temporarily and spatially defined expression of the therapeutic gene(s) at the site of the injury. Several gene transfer vehicles have been developed to modify various human cells and tissues from musculoskeletal system among which the non-pathogenic, effective, and relatively safe recombinant adeno-associated viral (rAAV) vectors that have emerged as the preferred gene delivery system to treat human disorders. Adapting tissue engineering platforms to gene transfer approaches mediated by rAAV vectors is an attractive tool to circumvent both the limitations of the current therapeutic options to promote an effective healing of the tissue and the natural obstacles from these clinically adapted vectors to achieve an efficient and durable gene expression of the therapeutic sequences within the lesions.

High-Throughput Dissection of AAV-Host Interactions: The Fast and the Curious.

PubMed

Herrmann, Anne-Kathrin; Grimm, Dirk

2018-05-18

Over fifty years after its initial description, Adeno-associated virus (AAV) remains a most exciting but also most elusive study object in basic or applied virology. On the one hand, its simple structure not only facilitates investigations into virus biology, but combined with the availability of numerous natural AAV variants with distinct infection efficiency and specificity also makes AAV a preferred substrate for engineering of gene delivery vectors. On the other hand, it is striking to witness a recent flurry of reports that highlight and partially close persistent gaps in our understanding of AAV virus and vector biology. This is all the more perplexing considering that recombinant AAVs have already been used in >160 clinical trials and recently been commercialized as gene therapeutics. Here, we discuss a reason for these advances in AAV research, namely, the advent and application of powerful high-throughput technology for dissection of AAV-host interactions and optimization of AAV gene therapy vectors. As relevant examples, we focus on the discovery of (i) a "new" cellular AAV receptor, AAVR, (ii) host restriction factors for AAV entry, and (iii) AAV capsid determinants that mediate trafficking through the blood-brain barrier. While (i)/(ii) are prototypes of extra- or intracellular AAV host factors that were identified via high-throughput screenings, (iii) exemplifies the power of molecular evolution to investigate the virus itself. In the future, we anticipate that these and other key technologies will continue to accelerate the dissection of AAV biology and will yield a wealth of new designer viruses for clinical use. Copyright © 2018. Published by Elsevier Ltd.

RNAi-mediated gene silencing as a principle of action of venoms and poisons.

PubMed

Pereira, Tiago Campos; Lopes-Cendes, Iscia

2008-01-01

RNA interference (RNAi) is a natural phenomenon in which double-stranded RNA molecules (dsRNAs) promote silencing of genes with similar sequence. It is noteworthy that in some instances the effects of gene silencing are similar to those caused by venoms and natural poisons (e.g., hemorrhage and low blood pressure). This observation raises the possibility that venomous/poisonous species in fact produce dsRNAs in their venoms/poisons and leading to the deleterious effects in the victim by RNAi-mediated gene silencing. Two approaches could be used to test this hypothesis, first, the neutralization of the dsRNAs and comparing to a non-treated venom sample; and second, to identify the dsRNA present in the venom and attempt to artificially reproduce its effects in the laboratory. In addition, we present three innovative treatment strategies for accidental interactions with venomous or poisonous species. RNAi has several roles in biological systems: gene regulation, antiviral defense, transposon silencing and heterochromatin formation. The hypothesis presented here provides a new role: a natural attack mechanism.

Systemic Correction of Murine Glycogen Storage Disease Type IV by an AAV-Mediated Gene Therapy.

PubMed

Yi, Haiqing; Zhang, Quan; Brooks, Elizabeth D; Yang, Chunyu; Thurberg, Beth L; Kishnani, Priya S; Sun, Baodong

2017-03-01

Deficiency of glycogen branching enzyme (GBE) causes glycogen storage disease type IV (GSD IV), which is characterized by the accumulation of a less branched, poorly soluble form of glycogen called polyglucosan (PG) in multiple tissues. This study evaluates the efficacy of gene therapy with an adeno-associated viral (AAV) vector in a mouse model of adult form of GSD IV (Gbe1 ys/ys ). An AAV serotype 9 (AAV9) vector containing a human GBE expression cassette (AAV-GBE) was intravenously injected into 14-day-old Gbe1 ys/ys mice at a dose of 5 × 10 11 vector genomes per mouse. Mice were euthanized at 3 and 9 months of age. In the AAV-treated mice at 3 months of age, GBE enzyme activity was highly elevated in heart, which is consistent with the high copy number of the viral vector genome detected. GBE activity also increased significantly in skeletal muscles and the brain, but not in the liver. The glycogen content was reduced to wild-type levels in muscles and significantly reduced in the liver and brain. At 9 months of age, though GBE activity was only significantly elevated in the heart, glycogen levels were significantly reduced in the liver, brain, and skeletal muscles of the AAV-treated mice. In addition, the AAV treatment resulted in an overall decrease in plasma activities of alanine transaminase, aspartate transaminase, and creatine kinase, and a significant increase in fasting plasma glucose concentration at 9 months of age. This suggests an alleviation of damage and improvement of function in the liver and muscles by the AAV treatment. This study demonstrated a long-term benefit of a systemic injection of an AAV-GBE vector in Gbe1 ys/ys mice.

[Recombinant adeno-associated virus mediated RNA interference of angiogenin expression inhibits cell growth of human lung adenocarcinoma].

PubMed

Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong

2009-03-01

To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

Using RNAi in C. "elegans" to Demonstrate Gene Knockdown Phenotypes in the Undergraduate Biology Lab Setting

ERIC Educational Resources Information Center

Roy, Nicole M.

2013-01-01

RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…

Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

PubMed

Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

2011-08-23

Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

RNAi and retroviruses: are they in RISC?

PubMed

Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri

2013-02-01

RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.

The RNAi Inheritance Machinery of Caenorhabditis elegans.

PubMed

Spracklin, George; Fields, Brandon; Wan, Gang; Becker, Diveena; Wallig, Ashley; Shukla, Aditi; Kennedy, Scott

2017-07-01

Gene silencing mediated by dsRNA (RNAi) can persist for multiple generations in Caenorhabditis elegans (termed RNAi inheritance). Here we describe the results of a forward genetic screen in C. elegans that has identified six factors required for RNAi inheritance: GLH-1/VASA, PUP-1/CDE-1, MORC-1, SET-32, and two novel nematode-specific factors that we term here (heritable RNAi defective) HRDE-2 and HRDE-4 The new RNAi inheritance factors exhibit mortal germline (Mrt) phenotypes, which we show is likely caused by epigenetic deregulation in germ cells. We also show that HRDE-2 contributes to RNAi inheritance by facilitating the binding of small RNAs to the inheritance Argonaute (Ago) HRDE-1 Together, our results identify additional components of the RNAi inheritance machinery whose conservation provides insights into the molecular mechanism of RNAi inheritance, further our understanding of how the RNAi inheritance machinery promotes germline immortality, and show that HRDE-2 couples the inheritance Ago HRDE-1 with the small RNAs it needs to direct RNAi inheritance and germline immortality. Copyright © 2017 by the Genetics Society of America.

RNAi-Mediated Knock-Down of transformer and transformer 2 to Generate Male-Only Progeny in the Oriental Fruit Fly, Bactrocera dorsalis (Hendel)

PubMed Central

Li, Jianwei; Zhang, Guifen; Wan, Fanghao

2015-01-01

The transformer (tra) gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2) gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel). Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest. PMID:26057559

RNAi-Mediated Knock-Down of transformer and transformer 2 to Generate Male-Only Progeny in the Oriental Fruit Fly, Bactrocera dorsalis (Hendel).

PubMed

Liu, Guiqing; Wu, Qiang; Li, Jianwei; Zhang, Guifen; Wan, Fanghao

2015-01-01

The transformer (tra) gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2) gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel). Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest.

AAV vector-mediated secretion of chondroitinase provides a sensitive tracer for axonal arborisations.

PubMed

Alves, João Nuno; Muir, Elizabeth M; Andrews, Melissa R; Ward, Anneliese; Michelmore, Nicholas; Dasgupta, Debayan; Verhaagen, Joost; Moloney, Elizabeth B; Keynes, Roger J; Fawcett, James W; Rogers, John H

2014-04-30

As part of a project to express chondroitinase ABC (ChABC) in neurons of the central nervous system, we have inserted a modified ChABC gene into an adeno-associated viral (AAV) vector and injected it into the vibrissal motor cortex in adult rats to determine the extent and distribution of expression of the enzyme. A similar vector for expression of green fluorescent protein (GFP) was injected into the same location. For each vector, two versions with minor differences were used, giving similar results. After 4 weeks, the brains were stained to show GFP and products of chondroitinase digestion. Chondroitinase was widely expressed, and the AAV-ChABC and AAV-GFP vectors gave similar expression patterns in many respects, consistent with the known projections from the directly transduced neurons in vibrissal motor cortex and adjacent cingulate cortex. In addition, diffusion of vector to deeper neuronal populations led to labelling of remote projection fields which was much more extensive with AAV-ChABC than with AAV-GFP. The most notable of these populations are inferred to be neurons of cortical layer 6, projecting widely in the thalamus, and neurons of the anterior pole of the hippocampus, projecting through most of the hippocampus. We conclude that, whereas GFP does not label the thinnest axonal branches of some neuronal types, chondroitinase is efficiently secreted from these arborisations and enables their extent to be sensitively visualised. After 12 weeks, chondroitinase expression was undiminished. Copyright © 2014 Elsevier B.V. All rights reserved.

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Tyrosine Mutation in AAV9 Capsid Improves Gene Transfer to the Mouse Lung.

PubMed

Martini, Sabrina V; Silva, Adriana L; Ferreira, Debora; Rabelo, Rafael; Ornellas, Felipe M; Gomes, Karina; Rocco, Patricia R M; Petrs-Silva, Hilda; Morales, Marcelo M

2016-01-01

Adeno-associated virus (AAV) vectors are being increasingly used as the vector of choice for in vivo gene delivery and gene therapy for many pulmonary diseases. Recently, it was shown that phosphorylation of surface-exposed tyrosine residues from AAV capsid targets the viral particles for ubiquitination and proteasome-mediated degradation, and mutations of these tyrosine residues lead to highly efficient vector transduction in vitro and in vivo in different organs. In this study, we evaluated the pulmonary transgene expression efficacy of AAV9 vectors containing point mutations in surface-exposed capsid tyrosine residues. Eighteen C57BL/6 mice were randomly assigned into three groups: (1) a control group (CTRL) animals underwent intratracheal (i.t.) instillation of saline, (2) the wild-type AAV9 group (WT-AAV9, 1010 vg), and (3) the tyrosine-mutant Y731F AAV9 group (M-AAV9, 1010 vg), which received (i.t.) self-complementary AAV9 vectors containing the DNA sequence of enhanced green fluorescence protein (eGFP). Four weeks after instillation, lung mechanics, morphometry, tissue cellularity, gene expression, inflammatory cytokines, and growth factor expression were analyzed. No significant differences were observed in lung mechanics and morphometry among the experimental groups. However, the number of polymorphonuclear cells was higher in the WT-AAV9 group than in the CTRL and M-AAV9 groups, suggesting that the administration of tyrosine-mutant AAV9 vectors was better tolerated. Tyrosine-mutant AAV9 vectors significantly improved transgene delivery to the lung (30%) compared with their wild-type counterparts, without eliciting an inflammatory response. Our results provide the impetus for further studies to exploit the use of AAV9 vectors as a tool for pulmonary gene therapy. © 2016 The Author(s) Published by S. Karger AG, Basel.

Adeno-associated virus (AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction with AAV-2-based vectors.

PubMed

Handa, A; Muramatsu, S; Qiu, J; Mizukami, H; Brown, K E

2000-08-01

Although adeno-associated virus (AAV)-2 has a broad tissue-host range and can transduce a wide variety of tissue types, some cells, such as erythro-megakaryoblastoid cells, are non-permissive and appear to lack the AAV-2 receptor. However, limited studies have been reported with the related dependovirus AAV-3. We have previously cloned this virus, characterized its genome and produced an infectious clone. In this study, the gene for green fluorescent protein (GFP) was inserted into AAV-2- and AAV-3-based plasmids and recombinant viruses were produced. These viruses were then used to transduce haematopoietic cells and the transduction efficiencies were compared. In contrast to recombinant (r) AAV-2, rAAV-3 successfully transduced erythroid and megakaryoblastoid cells, although rAAV-2 was superior in transduction of lymphocyte-derived cell lines. Recently, it was reported that heparan sulphate can act as a receptor of AAV-2. The infectivity of rAAV-2 and rAAV-3 was tested with mutant cell lines of Chinese hamster ovary cells that were defective for heparin or heparan sulphate expression on the cell surface. There was no correlation between the ability of rAAV-2 or rAAV-3 to infect cells and the cell surface expression of heparan sulphate and, although heparin blocked both rAAV-2 and rAAV-3 transduction, the ID(50) of rAAV-3 was higher than that of rAAV-2. In addition, virus-binding overlay assays indicated that AAV-2 and AAV-3 bound different membrane proteins. These results suggest not only that there are different cellular receptors for AAV-2 and AAV-3, but that rAAV-3 vectors may be preferred for transduction of some haematopoietic cell types.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Restoration of visual response in aged dystrophic RCS rats using AAV-mediated channelopsin-2 gene transfer.

PubMed

Tomita, Hiroshi; Sugano, Eriko; Yawo, Hiromu; Ishizuka, Toru; Isago, Hitomi; Narikawa, Satoko; Kügler, Sebastian; Tamai, Makoto

2007-08-01

To investigate whether the channelopsin-2 (Chop2) gene would restore visual responses in 10-month-old dystrophic Royal College of Surgeons (aged RCS; rdy/rdy) rats, the authors transferred the Chop2 gene into the retinal cells of aged RCS rats using the adenoassociated virus (AAV) vector. The N-terminal fragment (residues 1-315) of Chop2 was fused to a fluorescent protein, Venus, in frame at the end of the Chop2 coding fragment. The viral vector construct (AAV-Chop2V) for the expression of the Chop2V in the retina was made by subcloning into an adenoassociated virus vector, including the CAG promoter. To evaluate the expression profile of Chop2V in the retina, the rats were killed and the eyes were removed and fixed with 4% paraformaldehyde in 0.1 M phosphate-buffered saline. Retinal wholemount specimens and cryosections were made. Under anesthetized conditions, electrodes for the recording of visually evoked potentials (VEPs) were implanted onto the visual cortex in aged-RCS (rdy/rdy) rats. AAV-Chop2V vectors were then injected into the vitreous cavity of the left eyes. As a control, AAV-Venus vectors were applied to the right eyes. VEPs were evoked by the flash of a blue, white, or red light-emitting diode (LED) and were recorded from the visual cortex of the rats at various time points after the AAV vector injection. Chop2V fluorescence was predominantly observed in retinal ganglion cells (RGCs). Some fluorescence was observed in the inner nuclear layer and the inner plexiform layer neurites. A tendency of recovery was observed in the VEPs of aged RCS (rdy/rdy) rats after the AAV-Chop2V injection but not after the AAV-Venus injection. The visual response of AAV-Chop2V-injected aged RCS (rdy/rdy) rats was less sensitive to the blue LED flash than that of nondystrophic RCS (+/+) rats. The AAV-Chop2V-injected aged RCS (rdy/rdy) rats were insensitive to the red LED flash, which evoked a robust VEP in the RCS (+/+) rats. The visual response of aged RCS (rdy/rdy) rats

Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis.

PubMed

Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K

2018-03-22

Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.

Catalytic in vivo protein knockdown by small-molecule PROTACs

PubMed Central

Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

2015-01-01

The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

Role of RNA Interference (RNAi) in Dengue Virus Replication and Identification of NS4B as an RNAi Suppressor

PubMed Central

Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan

2013-01-01

RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001

AAV-Mediated Administration of Myostatin Pro-Peptide Mutant in Adult Ldlr Null Mice Reduces Diet-Induced Hepatosteatosis and Arteriosclerosis

PubMed Central

Guo, Wen; Wong, Siu; Bhasin, Shalender

2013-01-01

Genetic disruption of myostatin or its related signaling is known to cause strong protection against diet-induced metabolic disorders. The translational value of these prior findings, however, is dependent on whether such metabolically favorable phenotype can be reproduced when myostatin blockade begins at an adult age. Here, we reported that AAV-mediated delivery of a myostatin pro-peptide D76A mutant in adult mice attenuates the development of hepatic steatosis and arteriosclerosis, two common diet-induced metabolic diseases. A single dose of AAV-D76A in adult Ldlr null mice resulted in sustained expression of myostatin pro-peptide in the liver. Compared to vehicle-treated mice, D76A-treated mice gained similar amount of lean and fat mass when fed a high fat diet. However, D76A-treated mice displayed significantly reduced aortic lesions and liver fat, in association with a reduction in hepatic expression of lipogenic genes and improvement in liver insulin sensitivity. This suggests that muscle and fat may not be the primary targets of treatment under our experimental condition. In support to this argument, we show that myostatin directly up-regulated lipogenic genes and increased fat accumulation in cultured liver cells. We also show that both myostatin and its receptor were abundantly expressed in mouse aorta. Cultured aortic endothelial cells responded to myostatin with a reduction in eNOS phosphorylation and an increase in ICAM-1 and VCAM-1 expression. Conclusions: AAV-mediated expression of myostatin pro-peptide D76A mutant in adult Ldlr null mice sustained metabolic protection without remarkable impacts on body lean and fat mass. Further investigations are needed to determine whether direct impact of myostatin on liver and aortic endothelium may contribute to the related metabolic phenotypes. PMID:23936482

Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis)

Treesearch

Chaoyang Zhao; Miguel A. Alvarez Gonzales; Therese M. Poland; Omprakash Mittapalli

2015-01-01

The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong...

Development of Intrathecal AAV9 Gene Therapy for Giant Axonal Neuropathy.

PubMed

Bailey, Rachel M; Armao, Diane; Nagabhushan Kalburgi, Sahana; Gray, Steven J

2018-06-15

An NIH-sponsored phase I clinical trial is underway to test a potential treatment for giant axonal neuropathy (GAN) using viral-mediated GAN gene replacement (https://clinicaltrials.gov/ct2/show/NCT02362438). This trial marks the first instance of intrathecal (IT) adeno-associated viral (AAV) gene transfer in humans. GAN is a rare pediatric neurodegenerative disorder caused by autosomal recessive loss-of-function mutations in the GAN gene, which encodes the gigaxonin protein. Gigaxonin is involved in the regulation, turnover, and degradation of intermediate filaments (IFs). The pathologic signature of GAN is giant axonal swellings filled with disorganized accumulations of IFs. Herein, we describe the development and characterization of the AAV vector carrying a normal copy of the human GAN transgene (AAV9/JeT-GAN) currently employed in the clinical trial. Treatment with AAV/JeT-GAN restored the normal configuration of IFs in patient fibroblasts within days in cell culture and by 4 weeks in GAN KO mice. IT delivery of AAV9/JeT-GAN in aged GAN KO mice preserved sciatic nerve ultrastructure, reduced neuronal IF accumulations and attenuated rotarod dysfunction. This strategy conferred sustained wild-type gigaxonin expression across the PNS and CNS for at least 1 year in mice. These results support the clinical evaluation of AAV9/JeT-GAN for potential therapeutic outcomes and treatment for GAN patients.

Adeno-associated virus-RNAi of GlyRα1 and characterization of its synapse-specific inhibition in OFF alpha transient retinal ganglion cells

PubMed Central

Zhang, C.; Rompani, S. B.; Roska, B.

2014-01-01

In the central nervous system, inhibition shapes neuronal excitation. In spinal cord glycinergic inhibition predominates, whereas GABAergic inhibition predominates in the brain. The retina uses GABA and glycine in approximately equal proportions. Glycinergic crossover inhibition, initiated in the On retinal pathway, controls glutamate release from presynaptic OFF cone bipolar cells (CBCs) and directly shapes temporal response properties of OFF retinal ganglion cells (RGCs). In the retina, four glycine receptor (GlyR) α-subunit isoforms are expressed in different sublaminae and their synaptic currents differ in decay kinetics. GlyRα1, expressed in both On and Off sublaminae of the inner plexiform layer, could be the glycinergic isoform that mediates On-to-Off crossover inhibition. However, subunit-selective glycine contributions remain unknown because we lack selective antagonists or cell class-specific subunit knockouts. To examine the role of GlyRα1 in direct inhibition in mature RGCs, we used retrogradely transported adeno-associated virus (AAV) that performed RNAi and eliminated almost all glycinergic spontaneous and visually evoked responses in PV5 (OFFαTransient) RGCs. Comparisons of responses in PV5 RGCs infected with AAV-scrambled-short hairpin RNA (shRNA) or AAV-Glra1-shRNA confirm a role for GlyRα1 in crossover inhibition in cone-driven circuits. Our results also define a role for direct GlyRα1 inhibition in setting the resting membrane potential of PV5 RGCs. The absence of GlyRα1 input unmasked a serial and a direct feedforward GABAAergic modulation in PV5 RGCs, reflecting a complex interaction between glycinergic and GABAAergic inhibition. PMID:25231618

Caspase Inhibition with XIAP as an Adjunct to AAV Vector Gene-Replacement Therapy: Improving Efficacy and Prolonging the Treatment Window

PubMed Central

Yao, Jingyu; Jia, Lin; Khan, Naheed; Zheng, Qiong-Duan; Moncrief, Ashley; Hauswirth, William W.; Thompson, Debra A.; Zacks, David N.

2012-01-01

Purpose AAV-mediated gene therapy in the rd10 mouse, with retinal degeneration caused by mutation in the rod cyclic guanosine monophosphate phosphodiesterase β-subunit (PDEβ) gene, produces significant, but transient, rescue of photoreceptor structure and function. This study evaluates the ability of AAV-mediated delivery of X-linked inhibitor of apoptosis (XIAP) to enhance and prolong the efficacy of PDEβ gene-replacement therapy. Methods Rd10 mice were bred and housed in darkness. Two groups of animals were generated: Group 1 received sub-retinal AAV5-XIAP or AAV5-GFP at postnatal age (P) 4 or 21 days; Group 2 received sub-retinal AAV5-XIAP plus AAV5- PDEβ, AAV5-GFP plus AAV5- PDEβ, or AAV- PDEβ alone at age P4 or P21. Animals were maintained for an additional 4 weeks in darkness before being moved to a cyclic-light environment. A subset of animals from Group 1 received a second sub-retinal injection of AAV8-733-PDEβ two weeks after being moved to the light. Histology, immunohistochemistry, Western blots, and electroretinograms were performed at different times after moving to the light. Results Injection of AAV5-XIAP alone at P4 and 21 resulted in significant slowing of light-induced retinal degeneration, as measured by outer nuclear thickness and cell counts, but did not result in improved outer segment structure and rhodopsin localization. In contrast, co-injection of AAV5-XIAP and AAV5-PDEβ resulted in increased levels of rescue and decreased rates of retinal degeneration compared to treatment with AAV5-PDEβ alone. Mice treated with AAV5-XIAP at P4, but not P21, remained responsive to subsequent rescue by AAV8-733-PDEβ when injected two weeks after moving to a light-cycling environment. Conclusions Adjunctive treatment with the anti-apoptotic gene XIAP confers additive protective effect to gene-replacement therapy with AAV5-PDEβ in the rd10 mouse. In addition, AAV5-XIAP, when given early, can increase the age at which gene-replacement therapy

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

DOE PAGES

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...

2015-03-31

Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less

AAV Delivery of Endothelin-1 shRNA Attenuates Cold-Induced Hypertension.

PubMed

Chen, Peter Gin-Fu; Sun, Zhongjie

2017-02-01

Cold temperatures are associated with increased prevalence of hypertension. Cold exposure increases endothelin-1 (ET1) production. The purpose of this study is to determine whether upregulation of ET1 contributes to cold-induced hypertension (CIH). In vivo RNAi silencing of the ET1 gene was achieved by adeno-associated virus 2 (AAV2) delivery of ET1 short-hairpin small interfering RNA (ET1-shRNA). Four groups of male rats were used. Three groups were given AAV.ET1-shRNA, AAV.SC-shRNA (scrambled shRNA), and phosphate-buffered saline (PBS), respectively, before exposure to a moderately cold environment (6.7 ± 2°C), while the last group was given PBS and kept at room temperature (warm, 24 ± 2°C) and served as a control. We found that systolic blood pressure of the PBS-treated and SC-shRNA-treated groups increased significantly within 2 weeks of exposure to cold, reached a peak level (145 ± 4.8 mmHg) by 6 weeks, and remained elevated thereafter. By contrast, blood pressure of the ET1-shRNA-treated group did not increase, suggesting that silencing of ET1 prevented the development of CIH. Animals were euthanized after 10 weeks of exposure to cold. Cold exposure significantly increased the left ventricle (LV) surface area and LV weight in cold-exposed rats, suggesting LV hypertrophy. Superoxide production in the heart was increased by cold exposure. Interestingly, ET1-shRNA prevented cold-induced superoxide production and cardiac hypertrophy. ELISA assay indicated that ET1-shRNA abolished the cold-induced upregulation of ET1 levels, indicating effective silencing of ET1. In conclusion, upregulation of ET1 plays a critical role in the pathogenesis of CIH and cardiac hypertrophy. AAV delivery of ET1-shRNA is an effective therapeutic strategy for cold-related cardiovascular disease.

Glymphatic fluid transport controls paravascular clearance of AAV vectors from the brain

PubMed Central

Murlidharan, Giridhar; Crowther, Andrew; Reardon, Rebecca A.; Song, Juan

2016-01-01

Adeno-associated viruses (AAV) are currently being evaluated in clinical trials for gene therapy of CNS disorders. However, host factors that influence the spread, clearance, and transduction efficiency of AAV vectors in the brain are not well understood. Recent studies have demonstrated that fluid flow mediated by aquaporin-4 (AQP4) channels located on astroglial end feet is essential for exchange of solutes between interstitial and cerebrospinal fluid. This phenomenon, which is essential for interstitial clearance of solutes from the CNS, has been termed glial-associated lymphatic transport or glymphatic transport. In the current study, we demonstrate that glymphatic transport profoundly affects various aspects of AAV gene transfer in the CNS. Altered localization of AQP4 in aged mouse brains correlated with significantly increased retention of AAV vectors in the parenchyma and reduced systemic leakage following ventricular administration. We observed a similar increase in AAV retention and transgene expression upon i.c.v. administration in AQP4–/– mice. Consistent with this observation, fluorophore-labeled AAV vectors showed markedly reduced flux from the ventricles of AQP4–/– mice compared with WT mice. These results were further corroborated by reduced AAV clearance from the AQP4-null brain, as demonstrated by reduced transgene expression and vector genome accumulation in systemic organs. We postulate that deregulation of glymphatic transport in aged and diseased brains could markedly affect the parenchymal spread, clearance, and gene transfer efficiency of AAV vectors. Assessment of biomarkers that report the kinetics of CSF flux in prospective gene therapy patients might inform variable treatment outcomes and guide future clinical trial design. PMID:27699236

The AAV-mediated and RNA-guided CRISPR/Cas9 system for gene therapy of DMD and BMD.

PubMed

Wang, Jing-Zhang; Wu, Peng; Shi, Zhi-Min; Xu, Yan-Li; Liu, Zhi-Jun

2017-08-01

Mutations in the dystrophin gene (Dmd) result in Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), which afflict many newborn boys. In 2016, Brain and Development published several interesting articles on DMD treatment with antisense oligonucleotide, kinase inhibitor, and prednisolone. Even more strikingly, three articles in the issue 6271 of Science in 2016 provide new insights into gene therapy of DMD and BMD via the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9). In brief, adeno-associated virus (AAV) vectors transport guided RNAs (gRNAs) and Cas9 into mdx mouse model, gRNAs recognize the mutated Dmd exon 23 (having a stop codon), and Cas9 cut the mutated exon 23 off the Dmd gene. These manipulations restored expression of truncated but partially functional dystrophin, improved skeletal and cardiac muscle function, and increased survival of mdx mice significantly. This review concisely summarized the related advancements and discussed their primary implications in the future gene therapy of DMD, including AAV-vector selection, gRNA designing, Cas9 optimization, dystrophin-restoration efficiency, administration routes, and systemic and long-term therapeutic efficacy. Future orientations, including off-target effects, safety concerns, immune responses, precision medicine, and Dmd-editing in the brain (potentially blocked by the blood-brain barrier) were also elucidated briefly. Collectively, the AAV-mediated and RNA-guided CRISPR/Cas9 system has major superiorities compared with traditional gene therapy, and might contribute to the treatment of DMD and BMD substantially in the near future. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

RNAi mediated, stable resistance to Triticum mosaic virus in wheat

USDA-ARS?s Scientific Manuscript database

Triticum mosaic virus (TriMV), discovered in 2006, affects wheat production systems in the Great Plains of the United States. There are no available TriMV resistant commercial varieties. RNA interference (RNAi) was evaluated as an alternative strategy to generate resistance to TriMV. An RNAi pANDA...

Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer.

PubMed

Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R; Acland, Gregory M; Dell'Osso, Lou F; High, Katherine A; Maguire, Albert M; Bennett, Jean

2008-03-01

We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consistent and predictable delivery of a given dose of vector. We observed improved electroretinograms (ERGs) and visual acuity in Rpe65 mutant mice. This has not been reported previously using AAV2 vectors. Subretinal delivery of 8.25 x 10(10) vector genomes in affected dogs was well tolerated both locally and systemically, and treated animals showed improved visual behavior and pupillary responses, and reduced nystagmus within 2 weeks of injection. ERG responses confirmed the reversal of visual deficit. Immunohistochemistry confirmed transduction of retinal pigment epithelium cells and there was minimal toxicity to the retina as judged by histopathologic analysis. The data demonstrate that AAV2.RPE65 delivers the RPE65 transgene efficiently and quickly to the appropriate target cells in vivo in animal models. This vector holds great promise for treatment of LCA due to RPE65 mutations.

Reversal of Blindness in Animal Models of Leber Congenital Amaurosis Using Optimized AAV2-mediated Gene Transfer

PubMed Central

Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R; Acland, Gregory M; Dell’Osso, Lou F; High, Katherine A; Maguire, Albert M; Bennett, Jean

2010-01-01

We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consistent and predictable delivery of a given dose of vector. We observed improved electroretinograms (ERGs) and visual acuity in Rpe65 mutant mice. This has not been reported previously using AAV2 vectors. Subretinal delivery of 8.25 × 1010 vector genomes in affected dogs was well tolerated both locally and systemically, and treated animals showed improved visual behavior and pupillary responses, and reduced nystagmus within 2 weeks of injection. ERG responses confirmed the reversal of visual deficit. Immunohistochemistry confirmed transduction of retinal pigment epithelium cells and there was minimal toxicity to the retina as judged by histopathologic analysis. The data demonstrate that AAV2.RPE65 delivers the RPE65 transgene efficiently and quickly to the appropriate target cells in vivo in animal models. This vector holds great promise for treatment of LCA due to RPE65 mutations. PMID:18209734

Intra-Amniotic rAAV-Mediated Microdystrophin Gene Transfer Improves Canine X-Linked Muscular Dystrophy and May Induce Immune Tolerance

PubMed Central

Hayashita-Kinoh, Hiromi; Yugeta, Naoko; Okada, Hironori; Nitahara-Kasahara, Yuko; Chiyo, Tomoko; Okada, Takashi; Takeda, Shin'ichi

2015-01-01

Duchenne muscular dystrophy (DMD) is a severe congenital disease due to mutations in the dystrophin gene. Supplementation of dystrophin using recombinant adenoassociated virus vector has promise as a treatment of DMD, although therapeutic benefit of the truncated dystrophin still remains to be elucidated. Besides, host immune responses against the vector as well as transgene products have been denoted in the clinical gene therapy studies. Here, we transduced dystrophic dogs fetuses to investigate the therapeutic effects of an AAV vector expressing microdystrophin under conditions of immune tolerance. rAAV-CMV-microdystrophin and a rAAV-CAG-luciferase were injected into the amniotic fluid surrounding fetuses. We also reinjected rAAV9-CMV-microdystrophin into the jugular vein of an infant dystrophic dog to induce systemic expression of microdystrophin. Gait and cardiac function significantly improved in the rAAV-microdystrophin-injected dystrophic dog, suggesting that an adequate treatment of rAAV-microdystrophin with immune modulation induces successful long-term transgene expression to analyze improved dystrophic phenotype. PMID:25586688

Cellular selectivity of AAV serotypes for gene delivery in neurons and astrocytes by neonatal intracerebroventricular injection

PubMed Central

Hammond, Sean L.; Leek, Ashley N.; Richman, Evan H.

2017-01-01

The non-pathogenic parvovirus, adeno-associated virus (AAV), is an efficient vector for transgene expression in vivo and shows promise for treatment of brain disorders in clinical trials. Currently, there are more than 100 AAV serotypes identified that differ in the binding capacity of capsid proteins to specific cell surface receptors that can transduce different cell types and brain regions in the CNS. In the current study, multiple AAV serotypes expressing a GFP reporter (AAV1, AAV2/1, AAVDJ, AAV8, AAVDJ8, AAV9, AAVDJ9) were screened for their infectivity in both primary murine astrocyte and neuronal cell cultures. AAV2/1, AAVDJ8 and AAV9 were selected for further investigation of their tropism throughout different brain regions and cell types. Each AAV was administered to P0-neonatal mice via intracerebroventricular injections (ICV). Brains were then systematically analyzed for GFP expression at 3 or 6 weeks post-infection in various regions, including the olfactory bulb, striatum, cortex, hippocampus, substantia nigra (SN) and cerebellum. Cell counting data revealed that AAV2/1 infections were more prevalent in the cortical layers but penetrated to the midbrain less than AAVDJ8 and AAV9. Additionally, there were differences in the persistence of viral transgene expression amongst the three serotypes examined in vivo at 3 and 6 weeks post-infection. Because AAV-mediated transgene expression is of interest in neurodegenerative diseases such as Parkinson’s Disease, we examined the SN with microscopy techniques, such as CLARITY tissue transmutation, to identify AAV serotypes that resulted in optimal transgene expression in either astrocytes or dopaminergic neurons. AAVDJ8 displayed more tropism in astrocytes compared to AAV9 in the SN region. We conclude that ICV injection results in lasting expression of virally encoded transgene when using AAV vectors and that specific AAV serotypes are required to selectively deliver transgenes of interest to different brain

Pathology Associated with AAV Mediated Expression of Beta Amyloid or C100 in Adult Mouse Hippocampus and Cerebellum

PubMed Central

Drummond, Eleanor S.; Muhling, Jill; Martins, Ralph N.; Wijaya, Linda K.; Ehlert, Erich M.; Harvey, Alan R.

2013-01-01

Accumulation of beta amyloid (Aβ) in the brain is a primary feature of Alzheimer’s disease (AD) but the exact molecular mechanisms by which Aβ exerts its toxic actions are not yet entirely clear. We documented pathological changes 3 and 6 months after localised injection of recombinant, bi-cistronic adeno-associated viral vectors (rAAV2) expressing human Aβ40-GFP, Aβ42-GFP, C100-GFP or C100V717F-GFP into the hippocampus and cerebellum of 8 week old male mice. Injection of all rAAV2 vectors resulted in wide-spread transduction within the hippocampus and cerebellum, as shown by expression of transgene mRNA and GFP protein. Despite the lack of accumulation of Aβ protein after injection with AAV vectors, injection of rAAV2-Aβ42-GFP and rAAV2- C100V717F-GFP into the hippocampus resulted in significantly increased microgliosis and altered permeability of the blood brain barrier, the latter revealed by high levels of immunoglobulin G (IgG) around the injection site and the presence of IgG positive cells. In comparison, injection of rAAV2-Aβ40-GFP and rAAV2-C100-GFP into the hippocampus resulted in substantially less neuropathology. Injection of rAAV2 vectors into the cerebellum resulted in similar types of pathological changes, but to a lesser degree. The use of viral vectors to express different types of Aβ and C100 is a powerful technique with which to examine the direct in vivo consequences of Aβ expression in different regions of the mature nervous system and will allow experimentation and analysis of pathological AD-like changes in a broader range of species other than mouse. PMID:23516609

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

PubMed Central

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E; Chen, Kuchuan; Anguiano-Zarate, Stephanie; Cantu Gutierrez, Manuel; Busby, Theodore; Lin, Wen-Wen; He, Yuchun; Schulze, Karen L; Booth, Benjamin W; Evans-Holm, Martha; Venken, Koen JT; Levis, Robert W; Spradling, Allan C; Hoskins, Roger A; Bellen, Hugo J

2015-01-01

Here, we document a collection of ∼7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstrate reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates. DOI: http://dx.doi.org/10.7554/eLife.05338.001 PMID:25824290

Safety and Efficacy of AAV Retrograde Pancreatic Ductal Gene Delivery in Normal and Pancreatic Cancer Mice.

PubMed

Quirin, Kayla A; Kwon, Jason J; Alioufi, Arafat; Factora, Tricia; Temm, Constance J; Jacobsen, Max; Sandusky, George E; Shontz, Kim; Chicoine, Louis G; Clark, K Reed; Mendell, Joshua T; Korc, Murray; Kota, Janaiah

2018-03-16

Recombinant adeno-associated virus (rAAV)-mediated gene delivery shows promise to transduce the pancreas, but safety/efficacy in a neoplastic context is not well established. To identify an ideal AAV serotype, route, and vector dose and assess safety, we have investigated the use of three AAV serotypes (6, 8, and 9) expressing GFP in a self-complementary (sc) AAV vector under an EF1α promoter (scAAV.GFP) following systemic or retrograde pancreatic intraductal delivery. Systemic delivery of scAAV9.GFP transduced the pancreas with high efficiency, but gene expression did not exceed >45% with the highest dose, 5 × 10 12 viral genomes (vg). Intraductal delivery of 1 × 10 11 vg scAAV6.GFP transduced acini, ductal cells, and islet cells with >50%, ∼48%, and >80% efficiency, respectively, and >80% pancreatic transduction was achieved with 5 × 10 11 vg. In a Kras G12D -driven pancreatic cancer mouse model, intraductal delivery of scAAV6.GFP targeted acini, epithelial, and stromal cells and exhibited persistent gene expression 5 months post-delivery. In normal mice, intraductal delivery induced a transient increase in serum amylase/lipase that resolved within a day of infusion with no sustained pancreatic inflammation or fibrosis. Similarly, in PDAC mice, intraductal delivery did not increase pancreatic intraepithelial neoplasia progression/fibrosis. Our study demonstrates that scAAV6 targets the pancreas/neoplasm efficiently and safely via retrograde pancreatic intraductal delivery.

Optical imaging of RNAi-mediated silencing of cancer

NASA Astrophysics Data System (ADS)

Ochiya, Takahiro; Honma, Kimi; Takeshita, Fumitaka; Nagahara, Shunji

2008-02-01

RNAi has rapidly become a powerful tool for drug target discovery and validation in an in vitro culture system and, consequently, interest is rapidly growing for extension of its application to in vivo systems, such as animal disease models and human therapeutics. Cancer is one obvious application for RNAi therapeutics, because abnormal gene expression is thought to contribute to the pathogenesis and maintenance of the malignant phenotype of cancer and thereby many oncogenes and cell-signaling molecules present enticing drug target possibilities. RNAi, potent and specific, could silence tumor-related genes and would appear to be a rational approach to inhibit tumor growth. In subsequent in vivo studies, the appropriate cancer model must be developed for an evaluation of siRNA effects on tumors. How to evaluate the effect of siRNA in an in vivo therapeutic model is also important. Accelerating the analyses of these models and improving their predictive value through whole animal imaging methods, which provide cancer inhibition in real time and are sensitive to subtle changes, are crucial for rapid advancement of these approaches. Bioluminescent imaging is one of these optically based imaging methods that enable rapid in vivo analyses of a variety of cellular and molecular events with extreme sensitivity.

RNAi Knock-Down of LHCBM1, 2 and 3 Increases Photosynthetic H2 Production Efficiency of the Green Alga Chlamydomonas reinhardtii

PubMed Central

Oey, Melanie; Ross, Ian L.; Stephens, Evan; Steinbeck, Janina; Wolf, Juliane; Radzun, Khairul Adzfa; Kügler, Johannes; Ringsmuth, Andrew K.; Kruse, Olaf; Hankamer, Ben

2013-01-01

Single cell green algae (microalgae) are rapidly emerging as a platform for the production of sustainable fuels. Solar-driven H2 production from H2O theoretically provides the highest-efficiency route to fuel production in microalgae. This is because the H2-producing hydrogenase (HYDA) is directly coupled to the photosynthetic electron transport chain, thereby eliminating downstream energetic losses associated with the synthesis of carbohydrate and oils (feedstocks for methane, ethanol and oil-based fuels). Here we report the simultaneous knock-down of three light-harvesting complex proteins (LHCMB1, 2 and 3) in the high H2-producing Chlamydomonas reinhardtii mutant Stm6Glc4 using an RNAi triple knock-down strategy. The resultant Stm6Glc4L01 mutant exhibited a light green phenotype, reduced expression of LHCBM1 (20.6% ±0.27%), LHCBM2 (81.2% ±0.037%) and LHCBM3 (41.4% ±0.05%) compared to 100% control levels, and improved light to H2 (180%) and biomass (165%) conversion efficiencies. The improved H2 production efficiency was achieved at increased solar flux densities (450 instead of ∼100 µE m−2 s−1) and high cell densities which are best suited for microalgae production as light is ideally the limiting factor. Our data suggests that the overall improved photon-to-H2 conversion efficiency is due to: 1) reduced loss of absorbed energy by non-photochemical quenching (fluorescence and heat losses) near the photobioreactor surface; 2) improved light distribution in the reactor; 3) reduced photoinhibition; 4) early onset of HYDA expression and 5) reduction of O2-induced inhibition of HYDA. The Stm6Glc4L01 phenotype therefore provides important insights for the development of high-efficiency photobiological H2 production systems. PMID:23613840

Lentivirus-Mediated knockdown of tectonic family member 1 inhibits medulloblastoma cell proliferation

PubMed Central

Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie

2015-01-01

Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235

RNAi control of aflatoxins in peanut plants, a multifactorial system

USDA-ARS?s Scientific Manuscript database

RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...

Convection-enhanced delivery of AAV2 in white matter--a novel method for gene delivery to cerebral cortex.

PubMed

Barua, N U; Woolley, M; Bienemann, A S; Johnson, D; Wyatt, M J; Irving, C; Lewis, O; Castrique, E; Gill, S S

2013-10-30

Convection-enhanced delivery (CED) is currently under investigation for delivering therapeutic agents to subcortical targets in the brain. Direct delivery of therapies to the cerebral cortex, however, remains a significant challenge. We describe a novel method of targeting adeno-associated viral vector (AAV) mediated gene therapies to specific cerebral cortical regions by performing high volume, high flow rate infusions into underlying white matter in a large animal (porcine) model. Infusion volumes of up to 700 μl at flow rates as high as 10 μl/min were successfully performed in white matter without adverse neurological sequelae. Co-infusion of AAV2/5-GFP with 0.2% Gadolinium in artificial CSF confirmed transgene expression in the deep layers of cerebral cortex overlying the infused areas of white matter. AAV-mediated gene therapies have been previously targeted to the cerebral cortex by performing intrathalamic CED and exploiting axonal transport. The novel method described in this study facilitates delivery of gene therapies to specific regions of the cerebral cortex without targeting deep brain structures. AAV-mediated gene therapies can be targeted to specific cortical regions by performing CED into underlying white matter. This technique could be applied to the treatment of neurological disorders characterised by cerebral cortical degeneration. Copyright © 2013 Elsevier B.V. All rights reserved.

Engineering AAV receptor footprints for gene therapy.

PubMed

Madigan, Victoria J; Asokan, Aravind

2016-06-01

Adeno-associated viruses (AAV) are currently at the forefront of human gene therapy clinical trials as recombinant vectors. Significant progress has been made in elucidating the structure, biology and tropisms of different naturally occurring AAV isolates in the past decade. In particular, a spectrum of AAV capsid interactions with host receptors have been identified and characterized. These studies have enabled a better understanding of key determinants of AAV cell recognition and entry in different hosts. This knowledge is now being applied toward engineering new, lab-derived AAV capsids with favorable transduction profiles. The current review conveys a structural perspective of capsid-glycan interactions and provides a roadmap for generating synthetic strains by engineering AAV receptor footprints. Copyright © 2016 Elsevier B.V. All rights reserved.

Variable laterality of corticospinal tract axons that regenerate after spinal cord injury as a result of PTEN deletion or knock-down

PubMed Central

Willenberg, Rafer; Zukor, Katherine; Liu, Kai; He, Zhigang; Steward, Oswald

2016-01-01

Corticospinal tract (CST) axons from one hemisphere normally extend and terminate predominantly in the contralateral spinal cord. We previously showed that deleting PTEN in the sensorimotor cortex enables CST axons to regenerate after spinal cord injury and that some regenerating axons extend along the “wrong” side. Here, we characterize the degree of specificity of regrowth in terms of laterality. PTEN was selectively deleted via cortical AAV-Cre injections in neonatal PTEN-floxed mice. As adults, mice received dorsal hemisection injuries at T12 or complete crush injuries at T9. CST axons from one hemisphere were traced by unilateral BDA injections in PTEN-deleted mice with spinal cord injury and in non-injured PTEN-floxed mice that had not received AAV-Cre. In non-injured mice, 97.9 ± 0.7% of BDA-labeled axons in white matter and 88.5 ± 1.0% of BDA-labeled axons in grey matter were contralateral to the cortex of origin. In contrast, laterality of CST axons that extended past a lesion due to PTEN deletion varied across animals. In some cases, regenerated axons extended predominantly on the ipsilateral side, in other cases, axons extended predominantly contralaterally, and in others, axons were similar in numbers on both sides. Similar results were seen in analyses of cases from previous studies using shRNA-mediated PTEN knock-down. These results indicate that CST axons that extend past a lesion due to PTEN deletion or knock-down do not maintain the contralateral rule of the non-injured CST, highlighting one aspect for how resultant circuitry from regenerating axons may differ from that of the uninjured CST. PMID:26878190

Intraganglionic AAV6 results in efficient and long-term gene transfer to peripheral sensory nervous system in adult rats.

PubMed

Yu, Hongwei; Fischer, Gregory; Ferhatovic, Lejla; Fan, Fan; Light, Alan R; Weihrauch, Dorothee; Sapunar, Damir; Nakai, Hiroyuki; Park, Frank; Hogan, Quinn H

2013-01-01

We previously demonstrated safe and reliable gene transfer to the dorsal root ganglion (DRG) using a direct microinjection procedure to deliver recombinant adeno-associated virus (AAV) vector. In this study, we proceed to compare the in vivo transduction patterns of self-complementary (sc) AAV6 and AAV8 in the peripheral sensory pathway. A single, direct microinjection of either AAV6 or AAV8 expressing EGFP, at the adjusted titer of 2×10(9) viral particle per DRG, into the lumbar (L) 4 and L5 DRGs of adult rats resulted in efficient EGFP expression (48±20% for AAV6 and 25±4% for AAV8, mean ± SD) selectively in sensory neurons and their axonal projections 3 weeks after injection, which remained stable for up to 3 months. AAV6 efficiently transfers EGFP to all neuronal size groups without differential neurotropism, while AAV8 predominantly targets large-sized neurons. Neurons transduced with AAV6 penetrate into the spinal dorsal horn (DH) and terminate predominantly in superficial DH laminae, as well as in the dorsal columns and deeper laminae III-V. Only few AAV8-transduced afferents were evident in the superficial laminae, and spinal EGFP was mostly present in the deeper dorsal horn (lamina III-V) and dorsal columns, with substantial projections to the ventral horn. AAV6-mediated EGFP-positive nerve fibers were widely observed in the medial plantar skin of ipsilateral hindpaws. No apparent inflammation, tissue damage, or major pain behaviors were observed for either AAV serotype. Taken together, both AAV6 and AAV8 are efficient and safe vectors for transgene delivery to primary sensory neurons, but they exhibit distinct functional features. Intraganglionic delivery of AAV6 is more uniform and efficient compared to AAV8 in gene transfer to peripheral sensory neurons and their axonal processes.

Dual AAV Vectors for Stargardt Disease.

PubMed

Trapani, Ivana

2018-01-01

Stargardt disease (STGD1), due to mutations in the large ABCA4 gene, is the most common inherited macular degeneration in humans. Attempts at developing gene therapy approaches for treatment of STGD1 are currently ongoing. Among all the vectors available for gene therapy of inherited retinal diseases, those based on adeno-associated viruses (AAV) are the most promising given the efficacy shown in various animal models and their excellent safety profile in humans, as confirmed in many ongoing clinical trials. However, one of the main obstacles for the use of AAV is their limited effective packaging capacity of about 5 kb. Taking advantage of the AAV genome's ability to concatemerize , others and we have recently developed dual AAV vectors to overcome this limit. We tested dual AAV vectors for ABCA4 delivery, and found that they transduce efficiently both mouse and pig photoreceptors , and rescue the Abca4-/- mouse retinal phenotype, indicating their potential for gene therapy of STGD1. This chapter details how we designed dual AAV vectors for the delivery of the ABCA4 gene and describes the techniques that can be explored to evaluate dual AAV transduction efficiency in vitro and in the retina, and their efficacy in the mouse model of STGD1.

Current issues of RNAi therapeutics delivery and development.

PubMed

Haussecker, D

2014-12-10

12 years following the discovery of the RNAi mechanism in Man, a number of RNAi therapeutics development candidates have emerged with profiles suggesting that they could become drugs of significant medical importance for diseases like TTR amyloidosis, HBV, solid cancers, and hemophilia. Despite this robust progress, the perception of RNAi therapeutics has been on a roller-coaster ride driven not only by science, but also regulatory trends, the stock markets, and Big Pharma business development decisions [1]. This presentation provides an update on the current state of RNAi therapeutics development with a particular focus on what RNAi delivery can achieve today and key challenges to be overcome to expand therapeutic opportunities. The delivery of RNAi triggers to disease-relevant cell types clearly represents the rate-limiting factor in broadly expanding the applicability of RNAi therapeutics. Today, with at least 3 delivery options (lipid nanoparticles/LNPs, GalNAc-siRNA conjugates, Dynamic PolyConjugates/DPCs) for which profound gene knockdowns have been demonstrated in non-human primates and in the clinic, RNAi therapeutics should in principle be able to address most diseases related to gene expression in the liver. Given the central importance of the liver in systemic physiology, this already represents a significant therapeutic and commercial opportunity rivaling that of e.g. monoclonal antibodies. Beyond the liver, there is a reason to believe that current RNAi therapeutics technologies can address a number of solid tumors (e.g. LNPs), diseases of the eye (e.g. self-delivering RNAi triggers) as well as diseases involving the respiratory epithelium (e.g. aerosolized LNPs), certain phagocytic cells (LNPs), hematopoietic stem cells and their progeny (lentiviral DNA-directed RNAi), vascular endothelial cells (cationic lipoplexes), and certain cell types in the kidney (self-delivering RNAi triggers, DPCs; Table 1). Despite this success, there has been a sense that

Bax-inhibitor-1 knockdown phenotypes are suppressed by Buffy and exacerbate degeneration in a Drosophila model of Parkinson disease

PubMed Central

2017-01-01

Background Bax inhibitor-1 (BI-1) is an evolutionarily conserved cytoprotective transmembrane protein that acts as a suppressor of Bax-induced apoptosis by regulation of endoplasmic reticulum stress-induced cell death. We knocked down BI-1 in the sensitive dopa decarboxylase (Ddc) expressing neurons of Drosophila melanogaster to investigate its neuroprotective functions. We additionally sought to rescue the BI-1-induced phenotypes by co-expression with the pro-survival Buffy and determined the effect of BI-1 knockdown on the neurodegenerative α-synuclein-induced Parkinson disease (PD) model. Methods We used organismal assays to assess longevity of the flies to determine the effect of the altered expression of BI-1 in the Ddc-Gal4-expressing neurons by employing two RNAi transgenic fly lines. We measured the locomotor ability of these RNAi lines by computing the climbing indices of the climbing ability and compared them to a control line that expresses the lacZ transgene. Finally, we performed biometric analysis of the developing eye, where we counted the number of ommatidia and calculated the area of ommatidial disruption. Results The knockdown of BI-1 in these neurons was achieved under the direction of the Ddc-Gal4 transgene and resulted in shortened lifespan and precocious loss of locomotor ability. The co-expression of Buffy, the Drosophila anti-apoptotic Bcl-2 homologue, with BI-1-RNAi resulted in suppression of the reduced lifespan and impaired climbing ability. Expression of human α-synuclein in Drosophila dopaminergic neurons results in neuronal degeneration, accompanied by the age-dependent loss in climbing ability. We exploited this neurotoxic system to investigate possible BI-1 neuroprotective function. The co-expression of α-synuclein with BI-1-RNAi results in a slight decrease in lifespan coupled with an impairment in climbing ability. In supportive experiments, we employed the neuron-rich Drosophila compound eye to investigate subtle phenotypes

Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses

PubMed Central

Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.

2017-01-01

Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327

RNAi-mediated resistance to viruses in genetically engineered plants.

PubMed

Ibrahim, Abdulrazak B; Aragão, Francisco J L

2015-01-01

RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.

RNAi for functional genomics in plants.

PubMed

McGinnis, Karen M

2010-03-01

RNAi refers to several different types of gene silencing mediated by small, dsRNA molecules. Over the course of 20 years, the scientific understanding of RNAi has developed from the initial observation of unexpected expression patterns to a sophisticated understanding of a multi-faceted, evolutionarily conserved network of mechanisms that regulate gene expression in many organisms. It has also been developed as a genetic tool that can be exploited in a wide range of species. Because transgene-induced RNAi has been effective at silencing one or more genes in a wide range of plants, this technology also bears potential as a powerful functional genomics tool across the plant kingdom. Transgene-induced RNAi has indeed been shown to be an effective mechanism for silencing many genes in many organisms, but the results from multiple projects which attempted to exploit RNAi on a genome-wide scale suggest that there is a great deal of variation in the silencing efficacy between transgenic events, silencing targets and silencing-induced phenotype. The results from these projects indicate several important variables that should be considered in experimental design prior to the initiation of functional genomics efforts based on RNAi silencing. In recent years, alternative strategies have been developed for targeted gene silencing, and a combination of approaches may also enhance the use of targeted gene silencing for functional genomics.

A status report on RNAi therapeutics

PubMed Central

2010-01-01

Fire and Mello initiated the current explosion of interest in RNA interference (RNAi) biology with their seminal work in Caenorhabditis elegans. These observations were closely followed by the demonstration of RNAi in Drosophila melanogaster. However, the full potential of these new discoveries only became clear when Tuschl and colleagues showed that 21-22 bp RNA duplexes with 3" overhangs, termed small interfering (si)RNAs, could reliably execute RNAi in a range of mammalian cells. Soon afterwards, it became clear that many different human cell types had endogenous machinery, the RNA-induced silencing complex (RISC), which could be harnessed to silence any gene in the genome. Beyond the availability of a novel way to dissect biology, an important target validation tool was now available. More importantly, two key properties of the RNAi pathway - sequence-mediated specificity and potency - suggested that RNAi might be the most important pharmacological advance since the advent of protein therapeutics. The implications were profound. One could now envisage selecting disease-associated targets at will and expect to suppress proteins that had remained intractable to inhibition by conventional methods, such as small molecules. This review attempts to summarize the current understanding on siRNA lead discovery, the delivery of RNAi therapeutics, typical in vivo pharmacological profiles, preclinical safety evaluation and an overview of the 14 programs that have already entered clinical practice. PMID:20615220

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

PubMed Central

Novobrantseva, Tatiana I; Borodovsky, Anna; Wong, Jamie; Klebanov, Boris; Zafari, Mohammad; Yucius, Kristina; Querbes, William; Ge, Pei; Ruda, Vera M; Milstein, Stuart; Speciner, Lauren; Duncan, Rick; Barros, Scott; Basha, Genc; Cullis, Pieter; Akinc, Akin; Donahoe, Jessica S; Narayanannair Jayaprakash, K; Jayaraman, Muthusamy; Bogorad, Roman L; Love, Kevin; Whitehead, Katie; Levins, Chris; Manoharan, Muthiah; Swirski, Filip K; Weissleder, Ralph; Langer, Robert; Anderson, Daniel G; de Fougerolles, Antonin; Nahrendorf, Matthias; Koteliansky, Victor

2012-01-01

Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA) to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP) for durable and potent in vivo RNA interference (RNAi)-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs) and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα) which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA). In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells. PMID:23344621

GenomeRNAi: a database for cell-based RNAi phenotypes.

PubMed

Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

2007-01-01

RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.

RNAi-mediated silencing of MAP kinase signalling genes (Fmk1, Hog1, and Pbs2) in Fusarium oxysporum reduces pathogenesis on tomato plants.

PubMed

Pareek, Manish; Rajam, Manchikatla Venkat

2017-09-01

Fusarium oxysporum is a soil-borne plant fungal pathogen, and causes colossal losses in several crop plants including tomato. Effective control measures include the use of harmful fungicides and resistant cultivars, but these methods have shown limited success. Conventional methods to validate fungal pathogenic genes are labour intensive. Therefore, an alternative strategy is required to efficiently characterize unknown pathogenic genes. RNA interference (RNAi) has emerged as a potential tool to functionally characterize novel fungal pathogenic genes and also to control fungal diseases. Here, we report an efficient method to produce stable RNAi transformants of F. oxysporum using Agrobacterium-mediated transformation (AMT). We have transformed F. oxysporum spores using RNAi constructs of Fmk1, Hog1, and Pbs2 MAP kinase signalling genes. Fmk1 RNAi fungal transformants showed loss of surface hydrophobicity, reduced invasive growth on tomato fruits and hypo-virulence on tomato seedlings. Hog1 and Pbs2 RNAi transformants showed altered conidial size, and reduced invasive growth and pathogenesis. These results showed that AMT using RNAi constructs is an effective approach for dissecting the role of genes involved in pathogenesis in F. oxysporum and this could be extended for other fungal systems. The obtained knowledge can be easily translated for developing fungal resistant crops by RNAi. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

AAV-mediated in vivo functional selection of tissue-protective factors against ischaemia

PubMed Central

Ruozi, Giulia; Bortolotti, Francesca; Falcione, Antonella; Dal Ferro, Matteo; Ukovich, Laura; Macedo, Antero; Zentilin, Lorena; Filigheddu, Nicoletta; Cappellari, Gianluca Gortan; Baldini, Giovanna; Zweyer, Marina; Barazzoni, Rocco; Graziani, Andrea; Zacchigna, Serena; Giacca, Mauro

2015-01-01

Functional screening of expression libraries in vivo would offer the possibility of identifying novel biotherapeutics without a priori knowledge of their biochemical function. Here we describe a procedure for the functional selection of tissue-protective factors based on the in vivo delivery of arrayed cDNA libraries from the mouse secretome using adeno-associated virus (AAV) vectors. Application of this technique, which we call FunSel, in the context of acute ischaemia, revealed that the peptide ghrelin protects skeletal muscle and heart from ischaemic damage. When delivered to the heart using an AAV9 vector, ghrelin markedly reduces infarct size and preserves cardiac function over time. This protective activity associates with the capacity of ghrelin to sustain autophagy and remove dysfunctional mitochondria after myocardial infarction. Our findings describe an innovative tool to identify biological therapeutics and reveal a novel role of ghrelin as an inducer of myoprotective autophagy. PMID:26066847

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

RNA therapeutics targeting osteoclast-mediated excessive bone resorption

PubMed Central

Wang, Yuwei; Grainger, David W

2011-01-01

RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

Prolonged Expression of an Anti-HIV-1 gp120 Minibody to the Female Rhesus Macaque Lower Genital Tract by AAV Gene Transfer

PubMed Central

Abdel-Motal, Ussama M.; Harbison, Carole; Han, Thomas; Pudney, Jeffrey; Anderson, Deborah J.; Zhu, Quan; Westmoreland, Susan; Marasco, Wayne A.

2014-01-01

Topical microbicides are a leading strategy for prevention of HIV mucosal infection to women, however, numerous pharmacokinetic limitations associated with coitally-related dosing strategy have contributed to their limited success. Here we test the hypothesis that adeno-associated virus (AAV) mediated delivery of the b12 human anti-HIV-1 gp120 minibody gene to the lower genital tract of female rhesus macaques (Rh) can provide prolonged expression of b12 minibodies in the cervical-vaginal secretions. Gene transfer studies demonstrated that, of various GFP-expressing AAV serotypes, AAV-6 most efficiently transduced freshly immortalized and primary genital epithelial cells (PGECs) of female Rh in vitro. In addition, AAV-6-b12 minibody transduction of Rh PGECs led to inhibition of SHIV162p4 transmigration and virus infectivity in vitro. AAV-6-GFP could also successfully transduce vaginal epithelial cells of Rh when applied intra-vaginally, including p63+ epithelial stem cells. Moreover, intra-vaginal application of AAV-6-b12 to female Rh resulted in prolonged minibody detection in their vaginal secretions throughout the 79 day study period. These data provide proof-of-principle that AAV-6-mediated delivery of anti-HIV broadly neutralizing antibody (BnAb) genes to the lower genital tract of female Rh results in persistent minibody detection for several months. This strategy offers promise that an anti-HIV-1 genetic microbicide strategy may be possible in which topical application of AAV vector, with periodic reapplication as needed, may provide sustained local BnAb expression and protection. PMID:24965083

Prolonged expression of an anti-HIV-1 gp120 minibody to the female rhesus macaque lower genital tract by AAV gene transfer.

PubMed

Abdel-Motal, U M; Harbison, C; Han, T; Pudney, J; Anderson, D J; Zhu, Q; Westmoreland, S; Marasco, W A

2014-09-01

Topical microbicides are a leading strategy for prevention of HIV mucosal infection to women; however, numerous pharmacokinetic limitations associated with coitally related dosing strategy have contributed to their limited success. Here we test the hypothesis that adeno-associated virus (AAV) mediated delivery of the b12 human anti-HIV-1 gp120 minibody gene to the lower genital tract of female rhesus macaques (Rh) can provide prolonged expression of b12 minibodies in the cervical-vaginal secretions. Gene transfer studies demonstrated that, of various green fluorescent protein (GFP)-expressing AAV serotypes, AAV-6 most efficiently transduced freshly immortalized and primary genital epithelial cells (PGECs) of female Rh in vitro. In addition, AAV-6-b12 minibody transduction of Rh PGECs led to inhibition of SHIV162p4 transmigration and virus infectivity in vitro. AAV-6-GFP could also successfully transduce vaginal epithelial cells of Rh when applied intravaginally, including p63+ epithelial stem cells. Moreover, intravaginal application of AAV-6-b12 to female Rh resulted in prolonged minibody detection in their vaginal secretions throughout the 79-day study period. These data provide proof of principle that AAV-6-mediated delivery of anti-HIV broadly neutralizing antibody (BnAb) genes to the lower genital tract of female Rh results in persistent minibody detection for several months. This strategy offers promise that an anti-HIV-1 genetic microbicide strategy may be possible in which topical application of AAV vector, with periodic reapplication as needed, may provide sustained local BnAb expression and protection.

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

GenomeRNAi: a database for cell-based RNAi phenotypes

PubMed Central

Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

2007-01-01

RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at PMID:17135194

Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors

PubMed Central

Uhrig-Schmidt, Silke; Geiger, Matthias; Luippold, Gerd; Birk, Gerald; Mennerich, Detlev; Neubauer, Heike; Grimm, Dirk; Wolfrum, Christian; Kreuz, Sebastian

2014-01-01

In recent years, the increasing prevalence of obesity and obesity-related co-morbidities fostered intensive research in the field of adipose tissue biology. To further unravel molecular mechanisms of adipose tissue function, genetic tools enabling functional studies in vitro and in vivo are essential. While the use of transgenic animals is well established, attempts using viral and non-viral vectors to genetically modify adipocytes in vivo are rare. Therefore, we here characterized recombinant Adeno-associated virus (rAAV) vectors regarding their potency as gene transfer vehicles for adipose tissue. Our results demonstrate that a single dose of systemically applied rAAV8-CMV-eGFP can give rise to remarkable transgene expression in murine adipose tissues. Upon transcriptional targeting of the rAAV8 vector to adipocytes using a 2.2 kb fragment of the murine adiponectin (mAP2.2) promoter, eGFP expression was significantly decreased in off-target tissues while efficient transduction was maintained in subcutaneous and visceral fat depots. Moreover, rAAV8-mAP2.2-mediated expression of perilipin A – a lipid-droplet-associated protein – resulted in significant changes in metabolic parameters only three weeks post vector administration. Taken together, our findings indicate that rAAV vector technology is applicable as a flexible tool to genetically modify adipocytes for functional proof-of-concept studies and the assessment of putative therapeutic targets in vivo. PMID:25551639

"Caenorhabditis Elegans" as an Undergraduate Educational Tool for Teaching RNAi

ERIC Educational Resources Information Center

Andersen, Janet; Krichevsky, Alexander; Leheste, Joerg R.; Moloney, Daniel J.

2008-01-01

Discovery of RNA-mediated interference (RNAi) is widely recognized as one of the most significant molecular biology breakthroughs in the past 10 years. There is a need for science educators to develop teaching tools and laboratory activities that demonstrate the power of this new technology and help students to better understand the RNAi process.…

Therapeutic effect of adeno-associated virus (AAV)-mediated ADNF-9 expression on cochlea of kanamycin-deafened guinea pigs.

PubMed

Zheng, Guoxi; Zhu, Zhu; Zhu, Kang; Wei, Junrong; Jing, Yang; Duan, Maoli

2013-10-01

rAAV-NT4-ADNF-9 could ameliorate the damage to auditory function and repair previous impairment of cochlear hair cell loss induced by kanamycin. To investigate the therapeutic effect of ADNF-9 on cochlear hair cells using the recombinant adeno-associated virus (AAV) carrying fusion gene NT4-ADNF-9 and the kanamycin-deafened guinea pig model. Forty white guinea pigs with normal auricle reflex and normal auditory brainstem responses (ABRs) were randomly divided into four groups. Kanamycin was administered to the animals in groups A, B, and C to establish the deafened guinea pig model. rAAV-NT4-ADNF-9, vector only, and artificial perilymph were then delivered to the cochlear tissue of animals in groups A, B, and C, respectively, through the round window membrane. Animals in group D did not receive any treatment and acted as normal controls. The hearing thresholds on the surgery side were recorded before and after the transfection treatment. Fourteen days after treatment, cochleae were removed for paraffin slide preparation and cochlear surface preparation. A phase contrast microscope was used to observe the protective effect of ADNF-9 on hair cells. Significant reduction of the ABR threshold was observed after rAAV-NT4-ADNF-9 treatment (p < 0.05). After 14 days of treatment, the ABR threshold was also significantly different between the rAAV-NT4-ADNF-9-infected group and the non-infected group. Moreover, phase contrast microscopy showed significantly less hair cell damage or hair cell loss in the group treated with rAAV-NT4-ADNF-9 than in the groups treated with vector only or artificial perilymph (p < 0.05).

Immune Responses to rAAV6: The Influence of Canine Parvovirus Vaccination and Neonatal Administration of Viral Vector.

PubMed

Arnett, Andrea L H; Garikipati, Dilip; Wang, Zejing; Tapscott, Stephen; Chamberlain, Jeffrey S

2011-01-01

Recombinant adeno-associated viral (rAAV) vectors promote long-term gene transfer in many animal species. Significant effort has focused on the evaluation of rAAV delivery and the immune response in both murine and canine models of neuromuscular disease. However, canines provided for research purposes are routinely vaccinated against canine parvovirus (CPV). rAAV and CPV possess significant homology and are both parvoviruses. Thus, any immune response generated to CPV vaccination has the potential to cross-react with rAAV vectors. In this study, we investigated the immune response to rAAV6 delivery in a cohort of CPV-vaccinated canines and evaluated multiple vaccination regimens in a mouse model of CPV-vaccination. We show that CPV-vaccination stimulates production of neutralizing antibodies with minimal cross-reactivity to rAAV6. In addition, no significant differences were observed in the magnitude of the rAAV6-directed immune response between CPV-vaccinated animals and controls. Moreover, CPV-vaccination did not inhibit rAAV6-mediated transduction. We also evaluated the immune response to early rAAV6-vaccination in neonatal mice. The influence of maternal hormones and cytokines leads to a relatively permissive state in the neonate. We hypothesized that immaturity of the immune system would permit induction of tolerance to rAAV6 when delivered during the neonatal period. Mice were vaccinated with rAAV6 at 1 or 5 days of age, and subsequently challenged with rAAV6 exposure during adulthood via two sequential IM injections, 1 month apart. All vaccinated animals generated a significant neutralizing antibody response to rAAV6-vaccination that was enhanced following IM injection in adulthood. Taken together, these data demonstrate that the immune response raised against rAAV6 is distinct from that which is elicited by the standard parvoviral vaccines and is sufficient to prevent stable tolerization in neonatal mice.

Immune Responses to rAAV6: The Influence of Canine Parvovirus Vaccination and Neonatal Administration of Viral Vector

PubMed Central

Arnett, Andrea L. H.; Garikipati, Dilip; Wang, Zejing; Tapscott, Stephen; Chamberlain, Jeffrey S.

2011-01-01

Recombinant adeno-associated viral (rAAV) vectors promote long-term gene transfer in many animal species. Significant effort has focused on the evaluation of rAAV delivery and the immune response in both murine and canine models of neuromuscular disease. However, canines provided for research purposes are routinely vaccinated against canine parvovirus (CPV). rAAV and CPV possess significant homology and are both parvoviruses. Thus, any immune response generated to CPV vaccination has the potential to cross-react with rAAV vectors. In this study, we investigated the immune response to rAAV6 delivery in a cohort of CPV-vaccinated canines and evaluated multiple vaccination regimens in a mouse model of CPV-vaccination. We show that CPV-vaccination stimulates production of neutralizing antibodies with minimal cross-reactivity to rAAV6. In addition, no significant differences were observed in the magnitude of the rAAV6-directed immune response between CPV-vaccinated animals and controls. Moreover, CPV-vaccination did not inhibit rAAV6-mediated transduction. We also evaluated the immune response to early rAAV6-vaccination in neonatal mice. The influence of maternal hormones and cytokines leads to a relatively permissive state in the neonate. We hypothesized that immaturity of the immune system would permit induction of tolerance to rAAV6 when delivered during the neonatal period. Mice were vaccinated with rAAV6 at 1 or 5 days of age, and subsequently challenged with rAAV6 exposure during adulthood via two sequential IM injections, 1 month apart. All vaccinated animals generated a significant neutralizing antibody response to rAAV6-vaccination that was enhanced following IM injection in adulthood. Taken together, these data demonstrate that the immune response raised against rAAV6 is distinct from that which is elicited by the standard parvoviral vaccines and is sufficient to prevent stable tolerization in neonatal mice. PMID:22065964

The Skeletal Muscle Environment and Its Role in Immunity and Tolerance to AAV Vector-Mediated Gene Transfer

PubMed Central

Boisgérault, Florence; Mingozzi, Federico

2015-01-01

Since the early days of gene therapy, muscle has been one the most studied tissue targets for the correction of enzyme deficiencies and myopathies. Several preclinical and clinical studies have been conducted using adeno-associated virus (AAV) vectors. Exciting progress has been made in the gene delivery technologies, from the identification of novel AAV serotypes to the development of novel vector delivery techniques. In parallel, significant knowledge has been generated on the host immune system and its interaction with both the vector and the transgene at the muscle level. In particular, the role of underlying muscle inflammation, characteristic of several diseases affecting the muscle, has been defined in terms of its potential detrimental impact on gene transfer with AAV vectors. At the same time, feedback immunomodulatory mechanisms peculiar of skeletal muscle involving resident regulatory T cells have been identified, which seem to play an important role in maintaining, at least to some extent, muscle homeostasis during inflammation and regenerative processes. Devising strategies to tip this balance towards unresponsiveness may represent an avenue to improve the safety and efficacy of muscle gene transfer with AAV vectors. PMID:26122097

Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

PubMed

Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

2015-10-08

Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Acute tau knockdown in the hippocampus of adult mice causes learning and memory deficits.

PubMed

Velazquez, Ramon; Ferreira, Eric; Tran, An; Turner, Emily C; Belfiore, Ramona; Branca, Caterina; Oddo, Salvatore

2018-05-10

Misfolded and hyperphosphorylated tau accumulates in several neurodegenerative disorders including Alzheimer's disease, frontotemporal dementia with Parkinsonism, corticobasal degeneration, progressive supranuclear palsy, Down syndrome, and Pick's disease. Tau is a microtubule-binding protein, and its role in microtubule stabilization is well defined. In contrast, while growing evidence suggests that tau is also involved in synaptic physiology, a complete assessment of tau function in the adult brain has been hampered by robust developmental compensation of other microtubule-binding proteins in tau knockout mice. To circumvent these developmental compensations and assess the role of tau in the adult brain, we generated an adeno-associated virus (AAV) expressing a doxycycline-inducible short-hairpin (Sh) RNA targeted to tau, herein referred to as AAV-ShRNATau. We performed bilateral stereotaxic injections in 7-month-old C57Bl6/SJL wild-type mice with either the AAV-ShRNATau or a control AAV. We found that acute knockdown of tau in the adult hippocampus significantly impaired motor coordination and spatial memory. Blocking the expression of the AAV-ShRNATau, thereby allowing tau levels to return to control levels, restored motor coordination and spatial memory. Mechanistically, the reduced tau levels were associated with lower BDNF levels, reduced levels of synaptic proteins associated with learning, and decreased spine density. We provide compelling evidence that tau is necessary for motor and cognitive function in the adult brain, thereby firmly supporting that tau loss-of-function may contribute to the clinical manifestations of many tauopathies. These findings have profound clinical implications given that anti-tau therapies are in clinical trials for Alzheimer's disease. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

PubMed

Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

2017-02-01

RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

AAV-Mediated Gene Transfer of the Obesity-Associated Gene Etv5 in Rat Midbrain Does Not Affect Energy Balance or Motivated Behavior

PubMed Central

Boender, Arjen J.; Koning, Nivard A.; van den Heuvel, José K.; Luijendijk, Mieneke C. M.; van Rozen, Andrea J.; la Fleur, Susanne E.; Adan, Roger A. H.

2014-01-01

Several genome-wide association studies have implicated the transcription factor E-twenty- six version 5 (Etv5) in the regulation of body mass index. Further substantiating the role of Etv5 in feeding behavior are the findings that targeted disruption of Etv5 in mice leads to decreased body weight gain and that expression of Etv5 is decreased in the ventral tegmental area and substantia nigra pars compacta (VTA/SNpc) after food restriction. As Etv5 has been suggested to influence dopaminergic neurotransmission by driving the expression of genes that are responsible for the synthesis and release of dopamine, we investigated if expression levels of Etv5 are dependent on nutritional state and subsequently influence the expression levels of tyrosine hydroxylase. While it was shown that Etv5 expression in the VTA/SNpc increases after central administration of leptin and that Etv5 was able to drive expression of tyrosine hydroxylase in vitro, AAV-mediated gene transfer of Etv5 into the VTA/SNpc of rats did not alter expression of tyrosine hydroxylase in vivo. Moreover, AAV-mediated gene transfer of Etv5 in the VTA/SNpc did not affect measures of energy balance or performances in a progressive ratio schedule. Thus, these data do not support a role for increased expression of Etv5 in the VTA/SNpc in the regulation of feeding behavior. PMID:24710089

Adeno-associated Virus (AAV) Assembly-Activating Protein Is Not an Essential Requirement for Capsid Assembly of AAV Serotypes 4, 5, and 11.

PubMed

Earley, Lauriel F; Powers, John M; Adachi, Kei; Baumgart, Joshua T; Meyer, Nancy L; Xie, Qing; Chapman, Michael S; Nakai, Hiroyuki

2017-02-01

Adeno-associated virus (AAV) vectors have made great progress in their use for gene therapy; however, fundamental aspects of AAV's capsid assembly remain poorly characterized. In this regard, the discovery of assembly-activating protein (AAP) sheds new light on this crucial part of AAV biology and vector production. Previous studies have shown that AAP is essential for assembly; however, how its mechanistic roles in assembly might differ among AAV serotypes remains uncharacterized. Here, we show that biological properties of AAPs and capsid assembly processes are surprisingly distinct among AAV serotypes 1 to 12. In the study, we investigated subcellular localizations and assembly-promoting functions of AAP1 to -12 (i.e., AAPs derived from AAV1 to -12, respectively) and examined the AAP dependence of capsid assembly processes of these 12 serotypes using combinatorial approaches that involved immunofluorescence and transmission electron microscopy, barcode-Seq (i. e., a high-throughput quantitative method using DNA barcodes and a next-generation sequencing technology), and quantitative dot blot assays. This study revealed that AAP1 to -12 are all localized in the nucleus with serotype-specific differential patterns of nucleolar association; AAPs and assembled capsids do not necessarily colocalize; AAPs are promiscuous in promoting capsid assembly of other serotypes, with the exception of AAP4, -5, -11, and -12; assembled AAV5, -8, and -9 capsids are excluded from the nucleolus, in contrast to the nucleolar enrichment of assembled AAV2 capsids; and, surprisingly, AAV4, -5, and -11 capsids are not dependent on AAP for assembly. These observations highlight the serotype-dependent heterogeneity of the capsid assembly process and challenge current notions about the role of AAP and the nucleolus in capsid assembly. Assembly-activating protein (AAP) is a recently discovered adeno-associated virus (AAV) protein that promotes capsid assembly and provides new opportunities

Intramyocardial Injection of siRNAs Can Efficiently Establish Myocardial Tissue-Specific Renalase Knockdown Mouse Model.

PubMed

Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili

2016-01-01

Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.

RNAi screen of DAF-16/FOXO target genes in C. elegans links pathogenesis and dauer formation.

PubMed

Jensen, Victor L; Simonsen, Karina T; Lee, Yu-Hui; Park, Donha; Riddle, Donald L

2010-12-31

The DAF-16/FOXO transcription factor is the major downstream output of the insulin/IGF1R signaling pathway controlling C. elegans dauer larva development and aging. To identify novel downstream genes affecting dauer formation, we used RNAi to screen candidate genes previously identified to be regulated by DAF-16. We used a sensitized genetic background [eri-1(mg366); sdf-9(m708)], which enhances both RNAi efficiency and constitutive dauer formation (Daf-c). Among 513 RNAi clones screened, 21 displayed a synthetic Daf-c (SynDaf) phenotype with sdf-9. One of these genes, srh-100, was previously identified to be SynDaf, but twenty have not previously been associated with dauer formation. Two of the latter genes, lys-1 and cpr-1, are known to participate in innate immunity and six more are predicted to do so, suggesting that the immune response may contribute to the dauer decision. Indeed, we show that two of these genes, lys-1 and clc-1, are required for normal resistance to Staphylococcus aureus. clc-1 is predicted to function in epithelial cohesion. Dauer formation exhibited by daf-8(m85), sdf-9(m708), and the wild-type N2 (at 27°C) were all enhanced by exposure to pathogenic bacteria, while not enhanced in a daf-22(m130) background. We conclude that knockdown of the genes required for proper pathogen resistance increases pathogenic infection, leading to increased dauer formation in our screen. We propose that dauer larva formation is a behavioral response to pathogens mediated by increased dauer pheromone production.

TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

PubMed Central

Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

2016-01-01

The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

PubMed

Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

2016-03-28

The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

Differential effects of two MRI contrast agents on the integrity and distribution of rAAV2 and rAAV5 in the rat striatum

PubMed Central

Osting, Sue; Bennett, Antonette; Power, Shelby; Wackett, Jordan; Hurley, Samuel A; Alexander, Andrew L; Agbandje-Mckena, Mavis; Burger, Corinna

2014-01-01

Intraoperative magnetic resonance imaging (MRI) has been proposed as a method to optimize intracerebral targeting and for tracking infusate distribution in gene therapy trials for nervous system disorders. We thus investigated possible effects of two MRI contrast agents, gadoteridol (Gd) and galbumin (Gab), on the distribution and levels of transgene expression in the rat striatum and their effect on integrity and stability of recombinant adeno-associated virus (rAAV) particles. MRI studies showed that contrast agent distribution did not predict rAAV distribution. However, green fluorescent protein (GFP) immunoreactivity revealed an increase in distribution of rAAV5-GFP, but not rAAV2-GFP, in the presence of Gd when compared with viral vector injected alone. In contrast, Gab increased the distribution of rAAV2-GFP not rAAV5-GFP. These observations pointed to a direct effect of infused contrast agent on the rAAV particles. Negative-stain electron microscopy (EM), DNAase treatment, and differential scanning calorimetry (DSC) were used to monitor rAAV2 and rAAV5 particle integrity and stability following contrast agent incubation. EMs of rAAV2-GFP and rAAV5-GFP particles pretreated with Gd appear morphologically similar to the untreated sample; however, Gab treatment resulted in surface morphology changes and aggregation. A compromise of particle integrity was suggested by sensitivity of the packaged genome to DNAase treatment following Gab incubation but not Gd for both vectors. However, neither agent significantly affected particle stability when analyzed by DSC. An increase in Tm was observed for AAV2 in lactated Ringer’s buffer. These results thus highlight potential interactions between MRI contrast agents and AAV that might affect vector distribution and stability, as well as the stabilizing effect of lactated Ringer’s solution on AAV2. PMID:26015943

High throughput RNAi assay optimization using adherent cell cytometry.

PubMed

Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W

2011-04-25

siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.

High throughput RNAi assay optimization using adherent cell cytometry

PubMed Central

2011-01-01

Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450

Copackaged AAV9 Vectors Promote Simultaneous Immune Tolerance and Phenotypic Correction of Pompe Disease

PubMed Central

Doerfler, Phillip A.; Todd, Adrian G.; Clément, Nathalie; Falk, Darin J.; Nayak, Sushrusha; Herzog, Roland W.; Byrne, Barry J.

2016-01-01

Pompe disease is a progressive neuromuscular disorder caused by lysosomal accumulation of glycogen from a deficiency in acid alpha-glucosidase (GAA). Replacement of the missing enzyme is available by repeated protein infusions; however, efficacy is limited by immune response and inability to restore enzymatic function in the central nervous system. An alternative therapeutic option is adeno-associated virus (AAV)-mediated gene therapy, which results in widespread gene transfer and prolonged transgene expression. Both enzyme replacement therapy (ERT) and gene therapy can elicit anti-GAA immune reactions that dampen their effectiveness and pose life-threatening risks to patient safety. To modulate the immune responses related to gene therapy, we show that a human codon-optimized GAA (coGAA) driven by a liver-specific promoter (LSP) using AAV9 is capable of promoting immune tolerance in a Gaa−/− mouse model. Copackaging AAV9-LSP-coGAA with the tissue-restricted desmin promoter (AAV9-DES-coGAA) demonstrates the necessary cell autonomous expression in cardiac muscle, skeletal muscle, peripheral nerve, and the spinal cord. Simultaneous high-level expression in liver led to the expansion of GAA-specific regulatory T-cells (Tregs) and induction of immune tolerance. Transfer of Tregs into naïve recipients prevented pathogenic allergic reactions after repeated ERT challenges. Copackaged AAV9 also attenuated preexisting humoral and cellular immune responses, which enhanced the biochemical correction. Our data present a therapeutic design in which simultaneous administration of two copackaged AAV constructs may provide therapeutic benefit and resolve immune reactions in the treatment of multisystem disorders. PMID:26603344

AAV-Mediated Clarin-1 Expression in the Mouse Retina: Implications for USH3A Gene Therapy.

PubMed

Dinculescu, Astra; Stupay, Rachel M; Deng, Wen-Tao; Dyka, Frank M; Min, Seok-Hong; Boye, Sanford L; Chiodo, Vince A; Abrahan, Carolina E; Zhu, Ping; Li, Qiuhong; Strettoi, Enrica; Novelli, Elena; Nagel-Wolfrum, Kerstin; Wolfrum, Uwe; Smith, W Clay; Hauswirth, William W

2016-01-01

Usher syndrome type III (USH3A) is an autosomal recessive disorder caused by mutations in clarin-1 (CLRN1) gene, leading to progressive retinal degeneration and sensorineural deafness. Efforts to develop therapies for preventing photoreceptor cell loss are hampered by the lack of a retinal phenotype in the existing USH3 mouse models and by conflicting reports regarding the endogenous retinal localization of clarin-1, a transmembrane protein of unknown function. In this study, we used an AAV-based approach to express CLRN1 in the mouse retina in order to determine the pattern of its subcellular localization in different cell types. We found that all major classes of retinal cells express AAV-delivered CLRN1 driven by the ubiquitous, constitutive small chicken β-actin promoter, which has important implications for the design of future USH3 gene therapy studies. Within photoreceptor cells, AAV-expressed CLRN1 is mainly localized at the inner segment region and outer plexiform layer, similar to the endogenous expression of other usher proteins. Subretinal delivery using a full strength viral titer led to significant loss of retinal function as evidenced by ERG analysis, suggesting that there is a critical limit for CLRN1 expression in photoreceptor cells. Taken together, these results suggest that CLRN1 expression is potentially supported by a variety of retinal cells, and the right combination of AAV vector dose, promoter, and delivery method needs to be selected to develop safe therapies for USH3 disorder.

DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation.

PubMed

Nakama, Mina; Kawakami, Kei; Kajitani, Takuya; Urano, Takeshi; Murakami, Yota

2012-03-01

Certain noncoding RNAs (ncRNAs) implicated in the regulation of chromatin structure associate with chromatin. During the formation of RNAi-directed heterochromatin in fission yeast, ncRNAs transcribed from heterochromatin are thought to recruit the RNAi machinery to chromatin for the formation of heterochromatin; however, the molecular details of this association are not clear. Here, using RNA immunoprecipitation assay, we showed that the heterochromatic ncRNA was associated with chromatin via the formation of a DNA-RNA hybrid and bound to the RNA-induced transcriptional silencing (RITS) complex. The presence of DNA-RNA hybrid in the cell was also confirmed by immunofluorescence analysis using anti-DNA-RNA hybrid antibody. Over-expression and depletion of RNase H in vivo decreased and increased the amount of DNA-RNA hybrid formed, respectively, and both disturbed heterochromatin. Moreover, DNA-RNA hybrid was formed on, and over-expression of RNase H inhibited the formation of, artificial heterochromatin induced by tethering of RITS to mRNA. These results indicate that heterochromatic ncRNAs are retained on chromatin via the formation of DNA-RNA hybrids and provide a platform for the RNAi-directed heterochromatin assembly and suggest that DNA-RNA hybrid formation plays a role in chromatic ncRNA function. © 2012 The Authors. Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

NASA Astrophysics Data System (ADS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Yoon, Ho Sup; Swee Chuan, Tjin; Yong, Ken-Tye

2015-09-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications.

Genome-wide RNAi screen reveals ALK1 mediates LDL uptake and transcytosis in endothelial cells

PubMed Central

Kraehling, Jan R.; Chidlow, John H.; Rajagopal, Chitra; Sugiyama, Michael G.; Fowler, Joseph W.; Lee, Monica Y.; Zhang, Xinbo; Ramírez, Cristina M.; Park, Eon Joo; Tao, Bo; Chen, Keyang; Kuruvilla, Leena; Larriveé, Bruno; Folta-Stogniew, Ewa; Ola, Roxana; Rotllan, Noemi; Zhou, Wenping; Nagle, Michael W.; Herz, Joachim; Williams, Kevin Jon; Eichmann, Anne; Lee, Warren L.; Fernández-Hernando, Carlos; Sessa, William C.

2016-01-01

In humans and animals lacking functional LDL receptor (LDLR), LDL from plasma still readily traverses the endothelium. To identify the pathways of LDL uptake, a genome-wide RNAi screen was performed in endothelial cells and cross-referenced with GWAS-data sets. Here we show that the activin-like kinase 1 (ALK1) mediates LDL uptake into endothelial cells. ALK1 binds LDL with lower affinity than LDLR and saturates only at hypercholesterolemic concentrations. ALK1 mediates uptake of LDL into endothelial cells via an unusual endocytic pathway that diverts the ligand from lysosomal degradation and promotes LDL transcytosis. The endothelium-specific genetic ablation of Alk1 in Ldlr-KO animals leads to less LDL uptake into the aortic endothelium, showing its physiological role in endothelial lipoprotein metabolism. In summary, identification of pathways mediating LDLR-independent uptake of LDL may provide unique opportunities to block the initiation of LDL accumulation in the vessel wall or augment hepatic LDLR-dependent clearance of LDL. PMID:27869117

Genome-wide RNAi screen reveals ALK1 mediates LDL uptake and transcytosis in endothelial cells.

PubMed

Kraehling, Jan R; Chidlow, John H; Rajagopal, Chitra; Sugiyama, Michael G; Fowler, Joseph W; Lee, Monica Y; Zhang, Xinbo; Ramírez, Cristina M; Park, Eon Joo; Tao, Bo; Chen, Keyang; Kuruvilla, Leena; Larriveé, Bruno; Folta-Stogniew, Ewa; Ola, Roxana; Rotllan, Noemi; Zhou, Wenping; Nagle, Michael W; Herz, Joachim; Williams, Kevin Jon; Eichmann, Anne; Lee, Warren L; Fernández-Hernando, Carlos; Sessa, William C

2016-11-21

In humans and animals lacking functional LDL receptor (LDLR), LDL from plasma still readily traverses the endothelium. To identify the pathways of LDL uptake, a genome-wide RNAi screen was performed in endothelial cells and cross-referenced with GWAS-data sets. Here we show that the activin-like kinase 1 (ALK1) mediates LDL uptake into endothelial cells. ALK1 binds LDL with lower affinity than LDLR and saturates only at hypercholesterolemic concentrations. ALK1 mediates uptake of LDL into endothelial cells via an unusual endocytic pathway that diverts the ligand from lysosomal degradation and promotes LDL transcytosis. The endothelium-specific genetic ablation of Alk1 in Ldlr-KO animals leads to less LDL uptake into the aortic endothelium, showing its physiological role in endothelial lipoprotein metabolism. In summary, identification of pathways mediating LDLR-independent uptake of LDL may provide unique opportunities to block the initiation of LDL accumulation in the vessel wall or augment hepatic LDLR-dependent clearance of LDL.

Nanoparticle-mediated knockdown of DNA repair sensitizes cells to radiotherapy and extends survival in a genetic mouse model of glioblastoma.

PubMed

Kievit, Forrest M; Wang, Kui; Ozawa, Tatsuya; Tarudji, Aria W; Silber, John R; Holland, Eric C; Ellenbogen, Richard G; Zhang, Miqin

2017-10-01

Glioblastoma (GBM) remains incurable, and recurrent tumors rarely respond to standard-of-care radiation and chemo-therapies. Therefore, strategies that enhance the effects of these therapies should provide significant benefits to GBM patients. We have developed a nanoparticle delivery vehicle that can stably bind and protect nucleic acids for specific delivery into brain tumor cells. These nanoparticles can deliver therapeutic siRNAs to sensitize GBM cells to radiotherapy and improve GBM treatment via systemic administration. We show that nanoparticle-mediated knockdown of the DNA repair protein apurinic endonuclease 1 (Ape1) sensitizes GBM cells to radiotherapy and extend survival in a genetic mouse model of GBM. Specific knockdown of Ape1 activity by 30% in brain tumor tissue doubled the extended survival achieved with radiotherapy alone. Ape1 is a promising target for increasing the effectiveness of radiotherapy, and nanoparticle-mediated delivery of siRNA is a promising strategy for tumor specific knockdown of Ape1. Copyright © 2017. Published by Elsevier Inc.

Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella.

PubMed

Hameed, Muhammad Salman; Wang, Zhengbing; Vasseur, Liette; Yang, Guang

2018-04-20

Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella ( PxAgo3 ) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella .

RNAi revised--target mRNA-dependent enhancement of gene silencing.

PubMed

Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias

2015-12-15

The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

Rescue of bilirubin-induced neonatal lethality in a mouse model of Crigler-Najjar syndrome type I by AAV9-mediated gene transfer

PubMed Central

Bortolussi, Giulia; Zentilin, Lorena; Baj, Gabriele; Giraudi, Pablo; Bellarosa, Cristina; Giacca, Mauro; Tiribelli, Claudio; Muro, Andrés F.

2012-01-01

Crigler-Najjar type I (CNI) syndrome is a recessively inherited disorder characterized by severe unconjugated hyperbilirubinemia caused by uridine diphosphoglucuronosyltransferase 1A1 (UGT1A1) deficiency. The disease is lethal due to bilirubin-induced neurological damage unless phototherapy is applied from birth. However, treatment becomes less effective during growth, and liver transplantation is required. To investigate the pathophysiology of the disease and therapeutic approaches in mice, we generated a mouse model by introducing a premature stop codon in the UGT1a1 gene, which results in an inactive enzyme. Homozygous mutant mice developed severe jaundice soon after birth and died within 11 d, showing significant cerebellar alterations. To rescue neonatal lethality, newborns were injected with a single dose of adeno-associated viral vector 9 (AAV9) expressing the human UGT1A1. Gene therapy treatment completely rescued all AAV-treated mutant mice, accompanied by lower plasma bilirubin levels and normal brain histology and motor coordination. Our mouse model of CNI reproduces genetic and phenotypic features of the human disease. We have shown, for the first time, the full recovery of the lethal effects of neonatal hyperbilirubinemia. We believe that, besides gene-addition-based therapies, our mice could represent a very useful model to develop and test novel technologies based on gene correction by homologous recombination.—Bortolussi, G., Zentilin, L., Baj, G., Giraudi, P., Bellarosa, C., Giacca, M., Tiribelli, C., Muro, A. F. Rescue of bilirubin-induced neonatal lethality in a mouse model of Crigler-Najjar syndrome type I by AAV9-mediated gene transfer. PMID:22094718

Long-term safety and efficacy of AAV gene therapy in the canine model of glycogen storage disease type Ia.

PubMed

Lee, Young Mok; Conlon, Thomas J; Specht, Andrew; Coleman, Kirsten E; Brown, Laurie M; Estrella, Ana M; Dambska, Monika; Dahlberg, Kathryn R; Weinstein, David A

2018-05-25

Viral mediated gene therapy has progressed after overcoming early failures, and gene therapy has now been approved for several conditions in Europe and the USA. Glycogen storage disease (GSD) type Ia, caused by a deficiency of glucose-6-phosphatase-α, has been viewed as an outstanding candidate for gene therapy. This follow-up report describes the long-term outcome for the naturally occurring GSD-Ia dogs treated with rAAV-GPE-hG6PC-mediated gene therapy. A total of seven dogs were treated with rAAV-GPE-hG6PC-mediated gene therapy. The first four dogs were treated at birth, and three dogs were treated between 2 and 6 months of age to assess the efficacy and safety in animals with mature livers. Blood and urine samples, radiographic studies, histological evaluation, and biodistribution were assessed. Gene therapy improved survival in the GSD-Ia dogs. With treatment, the biochemical studies normalized for the duration of the study (up to 7 years). None of the rAAV-GPE-hG6PC-treated dogs had focal hepatic lesions or renal abnormalities. Dogs treated at birth required a second dose of rAAV after 2-4 months; gene therapy after hepatic maturation resulted in improved efficacy after a single dose. rAAV-GPE-hG6PC treatment in GSD-Ia dogs was found to be safe and efficacious. GSD-Ia is an attractive target for human gene therapy since it is a monogenic disorder with limited tissue involvement. Blood glucose and lactate monitoring can be used to assess effectiveness and as a biomarker of success. GSD-Ia can also serve as a model for other hepatic monogenic disorders.

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi.

PubMed

Swevers, Luc; Liu, Jisheng; Smagghe, Guy

2018-05-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products.

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi

PubMed Central

Liu, Jisheng

2018-01-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products. PMID:29723993

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

Comparison of Serum rAAV Serotype-Specific Antibodies in Patients with Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Inclusion Body Myositis, or GNE Myopathy.

PubMed

Zygmunt, Deborah A; Crowe, Kelly E; Flanigan, Kevin M; Martin, Paul T

2017-09-01

Recombinant adeno-associated virus (rAAV) is a commonly used gene therapy vector for the delivery of therapeutic transgenes in a variety of human diseases, but pre-existing serum antibodies to viral capsid proteins can greatly inhibit rAAV transduction of tissues. Serum was assayed from patients with Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), inclusion body myositis (IBM), and GNE myopathy (GNE). These were compared to serum from otherwise normal human subjects to determine the extent of pre-existing serum antibodies to rAAVrh74, rAAV1, rAAV2, rAAV6, rAAV8, and rAAV9. In almost all cases, patients with measurable titers to one rAAV serotype showed titers to all other serotypes tested, with average titers to rAAV2 being highest in all instances. Twenty-six percent of all young normal subjects (<18 years old) had measurable rAAV titers to all serotypes tested, and this percentage increased to almost 50% in adult normal subjects (>18 years old). Fifty percent of all IBM and GNE patients also had antibody titers to all rAAV serotypes, while only 18% of DMD and 0% of BMD patients did. In addition, serum-naïve macaques treated systemically with rAAVrh74 could develop cross-reactive antibodies to all other serotypes tested at 24 weeks post treatment. These data demonstrate that most DMD and BMD patients should be amenable to vascular rAAV-mediated treatment without the concern of treatment blockage by pre-existing serum rAAV antibodies, and that serum antibodies to rAAVrh74 are no more common than those for rAAV6, rAAV8, or rAAV9.

Conditional knockdown of BCL2A1 reveals rate-limiting roles in BCR-dependent B-cell survival

PubMed Central

Sochalska, M; Ottina, E; Tuzlak, S; Herzog, S; Herold, M; Villunger, A

2016-01-01

Bcl2 family proteins control mitochondrial apoptosis and its members exert critical cell type and differentiation stage-specific functions, acting as barriers against autoimmunity or transformation. Anti-apoptotic Bcl2a1/Bfl1/A1 is frequently deregulated in different types of blood cancers in humans but its physiological role is poorly understood as quadruplication of the Bcl2a1 gene locus in mice hampers conventional gene targeting strategies. Transgenic overexpression of A1, deletion of the A1-a paralogue or constitutive knockdown in the hematopoietic compartment of mice by RNAi suggested rate-limiting roles in lymphocyte development, granulopoiesis and mast cell activation. Here we report on the consequences of conditional knockdown of A1 protein expression using a reverse transactivator (rtTA)-driven approach that highlights a critical role for this Bcl2 family member in the maintenance of mature B-cell homeostasis. Furthermore, we define the A1/Bim (Bcl-2 interacting mediator of cell death) axis as a target of key kinases mediating B-cell receptor (BCR)-dependent survival signals, such as, spleen tyrosine kinase (Syk) and Brutons tyrosine kinase (Btk). As such, A1 represents a putative target for the treatment of B-cell-related pathologies depending on hyperactivation of BCR-emanating survival signals and loss of A1 expression accounts, in part, for the pro-apoptotic effects of Syk- or Btk inhibitors that rely on the ‘BH3-only' protein Bim for cell killing. PMID:26450454

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Gene transfer as a strategy to achieve permanent cardioprotection II: rAAV-mediated gene therapy with heme oxygenase-1 limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Ou, Qinghui; Wu, Wen-Jian; Chen, Ning; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Dawn, Buddhadeb; Luo, Li; Hunt, Gregory N; Bolli, Roberto

2011-11-01

Extensive evidence indicates that heme oxygenase-1 (HO-1) exerts potent cytoprotective effects in response to stress. Previous studies have shown that gene therapy with HO-1 protects against myocardial ischemia/reperfusion injury for up to 8 weeks after gene transfer. However, the long-term effects of HO-1 gene therapy on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the HO-1 gene (rAAV/HO-1) that enables long-lasting transgene expression. Mice received injections in the anterior LV wall of rAAV/LacZ (LacZ group) or rAAV/HO-1 (HO-1 group); 1 year later, they were subjected to a 30-min coronary occlusion (O) and 4 h of reperfusion (R). Cardiac HO-1 gene expression was confirmed at 1 month and 1 year after gene transfer by immunoblotting and immunohistochemistry analyses. In the HO-1 group, infarct size (% of risk region) was dramatically reduced at 1 year after gene transfer (11.2 ± 2.1%, n = 12, vs. 44.7 ± 3.6%, n = 8, in the LacZ group; P < 0.05). The infarct-sparing effects of HO-1 gene therapy at 1 year were as powerful as those observed 24 h after ischemic PC (six 4-min O/4-min R cycles) (15.0 ± 1.7%, n = 10). There were no appreciable changes in LV fractional shortening, LV ejection fraction, or LV end-diastolic or end-systolic diameter at 1 year after HO-1 gene transfer as compared to the age-matched controls or with the LacZ group. Histology showed no inflammation in the myocardium 1 year after rAAV/HO-1-mediated gene transfer. These results demonstrate, for the first time, that rAAV-mediated HO-1 gene transfer confers long-term (1 year), possibly permanent, cardioprotection without adverse functional consequences, providing proof of principle for the concept of achieving prophylactic cardioprotection (i.e., "immunization against infarction").

The Triple Functions of D2 Silencing in Treatment of Periapical Disease.

PubMed

Pan, Jie; Wang, Jue; Hao, Liang; Zhu, Guochun; Nguyen, Diep N; Li, Qian; Liu, Yuehua; Zhao, Zhihe; Li, Yi-Ping; Chen, Wei

2017-02-01

Dental caries is the most widespread chronic infectious disease. Inflammation in pulp tissues caused by dental caries will lead to periapical granulomas, bone erosion, loss of the tooth, and severe pain. Despite numerous efforts in recent studies to develop effective treatments for dental caries, the need for a potent therapy is still urgent. In this study, we applied a gene-based therapy approach by administering recombinant adeno-associated virus (AAV)-mediated Atp6v0d2 (d2) RNA interference knockdown of d2 gene expression to prevent periapical bone loss and suppress periapical inflammation simultaneously. The results showed that d2 depletion is simultaneously capable of reducing bone resorption with 75% protection through reducing osteoclasts, enhancing bone formation by increasing osterix expression, and inhibiting inflammation by decreasing T-cell infiltration. Notably, AAV-mediated gene therapy of d2 knockdown significantly reduced proinflammatory cytokine expression, including tumor necrosis factor α, interferon-γ, interleukin-1α, and interleukin 6 levels in periapical diseases caused by bacterial infection. Quantitative real-time polymerase chain reaction revealed that d2 knockdown reduced osteoclast-specific functional genes (ie, Acp5 and Ctsk) and increased osteoblast marker genes (ie, Osx and Opg) in periapical tissues. Collectively, our results showed that AAV-mediated d2 depletion in the periapical lesion area can prevent the progression of endodontic disease and bone erosion while significantly reducing the inflammatory over-response. These findings show that the depletion of d2 simultaneously reduces bone resorption, enhances bone formation, and inhibits inflammation caused by periapical diseases and provide significant insights into the potential effectiveness of AAV-sh-d2-mediated d2 silencing gene therapy as a major endodontic treatment. Copyright © 2016. Published by Elsevier Inc.

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)

PubMed Central

Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.

2011-01-01

Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

PubMed

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System

PubMed Central

Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096

A phase1 study of stereotactic gene delivery of AAV2-NGF for Alzheimer's disease.

PubMed

Rafii, Michael S; Baumann, Tiffany L; Bakay, Roy A E; Ostrove, Jeffrey M; Siffert, Joao; Fleisher, Adam S; Herzog, Christopher D; Barba, David; Pay, Mary; Salmon, David P; Chu, Yaping; Kordower, Jeffrey H; Bishop, Kathie; Keator, David; Potkin, Steven; Bartus, Raymond T

2014-09-01

Nerve growth factor (NGF) is an endogenous neurotrophic-factor protein with the potential to restore function and to protect degenerating cholinergic neurons in Alzheimer's disease (AD), but safe and effective delivery has proved unsuccessful. Gene transfer, combined with stereotactic surgery, offers a potential means to solve the long-standing delivery obstacles. An open-label clinical trial evaluated the safety and tolerability, and initial efficacy of three ascending doses of the genetically engineered gene-therapy vector adeno-associated virus serotype 2 delivering NGF (AAV2-NGF [CERE-110]). Ten subjects with AD received bilateral AAV2-NGF stereotactically into the nucleus basalis of Meynert. AAV2-NGF was safe and well-tolerated for 2 years. Positron emission tomographic imaging and neuropsychological testing showed no evidence of accelerated decline. Brain autopsy tissue confirmed long-term, targeted, gene-mediated NGF expression and bioactivity. This trial provides important evidence that bilateral stereotactic administration of AAV2-NGF to the nucleus basalis of Meynert is feasible, well-tolerated, and able to produce long-term, biologically active NGF expression, supporting the initiation of an ongoing multicenter, double-blind, sham-surgery-controlled trial. Copyright © 2014 The Alzheimer's Association. Published by Elsevier Inc. All rights reserved.

Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV.

PubMed

Xiao, Qing; Min, Taishan; Ma, Shuangping; Hu, Lingna; Chen, Hongyan; Lu, Daru

2018-04-18

Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.

Importins α and β signaling mediates endothelial cell inflammation and barrier disruption.

PubMed

Leonard, Antony; Rahman, Arshad; Fazal, Fabeha

2018-04-01

Nucleocytoplasmic shuttling via importins is central to the function of eukaryotic cells and an integral part of the processes that lead to many human diseases. In this study, we addressed the role of α and β importins in the mechanism of endothelial cell (EC) inflammation and permeability, important pathogenic features of many inflammatory diseases such as acute lung injury and atherosclerosis. RNAi-mediated knockdown of importin α4 or α3 each inhibited NF-κB activation, proinflammatory gene (ICAM-1, VCAM-1, and IL-6) expression, and thereby endothelial adhesivity towards HL-60 cells, upon thrombin challenge. The inhibitory effect of α4 and α3 knockdown was associated with impaired nuclear import and consequently, DNA binding of RelA/p65 subunit of NF-κB and occurred independently of IκBα degradation. Intriguingly, knockdown of importins α4 and α3 also inhibited thrombin-induced RelA/p65 phosphorylation at Ser 536 , showing a novel role of α importins in regulating transcriptional activity of RelA/p65. Similarly, knockdown of importin β1, but not β2, blocked thrombin-induced activation of RelA/p65 and its target genes. In parallel studies, TNFα-mediated inflammatory responses in EC were refractory to knockdown of importins α4, α3 or β1, indicating a stimulus-specific regulation of RelA/p65 and EC inflammation by these importins. Importantly, α4, α3, or β1 knockdown also protected against thrombin-induced EC barrier disruption by inhibiting the loss of VE-cadherin at adherens junctions and by regulating actin cytoskeletal rearrangement. These results identify α4, α3 and β1 as critical mediators of EC inflammation and permeability associated with intravascular coagulation. Copyright © 2018 Elsevier Inc. All rights reserved.

Small interfering RNA mediated knockdown of irisin suppresses food intake and modulates appetite regulatory peptides in zebrafish.

PubMed

Sundarrajan, Lakshminarasimhan; Unniappan, Suraj

2017-10-01

Irisin is a myokine encoded in fibronectin type III domain containing 5 (FNDC5). FNDC5 forms an integral part of the muscle post-exercise, and causes an increase in energy expenditure in mammals. Irisin is abundantly expressed in cardiac and skeletal muscles and is secreted upon activation of peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1 alpha). Irisin regulates feeding behaviour and cardiovascular function in mammals. More recently, irisin has gained importance as a potential biomarker for myocardial infarction due to its abundance in cardiac muscle. The goal of this research was to determine whether irisin influences feeding, and regulates appetite regulatory peptides in zebrafish. Intraperitoneal injection of irisin [0.1, 1, 10 and 100ng/g body weight (BW)] did not affect feeding, but its knockdown using siRNA (10ng/g BW) caused a significant reduction in food intake. Knockdown of irisin reduced ghrelin and orexin-A mRNA expression, and increased cocaine and amphetamine regulated transcript mRNA expression in zebrafish brain and gut. siRNA mediated knockdown of irisin also downregulated brain derived neurotrophic factor mRNA in zebrafish. The role of endogenous irisin on food intake is likely mediated by its actions on other metabolic peptides. Collectively, these results indicate that unaltered endogenous irisin is required to maintain food intake in zebrafish. Copyright © 2017 Elsevier Inc. All rights reserved.

AAV serotype 2/1-mediated gene delivery of anti-inflammatory interleukin-10 enhances neurogenesis and cognitive function in APP+PS1 mice.

PubMed

Kiyota, T; Ingraham, K L; Swan, R J; Jacobsen, M T; Andrews, S J; Ikezu, T

2012-07-01

Brain inflammation is a double-edged sword. It is required for brain repair in acute damage, whereas chronic inflammation and autoimmune disorders are neuropathogenic. Certain proinflammatory cytokines and chemokines are closely related to cognitive dysfunction and neurodegeneration. Representative anti-inflammatory cytokines, such as interleukin (IL)-10, can suppress neuroinflammation and have significant therapeutic potentials in ameliorating neurodegenerative disorders such as Alzheimer's disease (AD). Here, we show that adeno-associated virus (AAV) serotype 2/1 hybrid-mediated neuronal expression of the mouse IL-10 gene ameliorates cognitive dysfunction in amyloid precursor protein+ presenilin-1 bigenic mice. AAV2/1 infection of hippocampal neurons resulted in sustained expression of IL-10 without its leakage into the blood, reduced astro/microgliosis, enhanced plasma amyloid-β peptide (Aβ) levels and enhanced neurogenesis. Moreover, increased levels of IL-10 improved spatial learning, as determined by the radial arm water maze. Finally, IL-10-stimulated microglia enhanced proliferation but not differentiation of primary neural stem cells in the co-culture system, whereas IL-10 itself had no effect. Our data suggest that IL-10 gene delivery has a therapeutic potential for a non-Aβ-targeted treatment of AD.

Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella

PubMed Central

Hameed, Muhammad Salman; Wang, Zhengbing; Yang, Guang

2018-01-01

Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella (PxAgo3) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella. PMID:29677157

Unbiased RNAi screen for hepcidin regulators links hepcidin suppression to proliferative Ras/RAF and nutrient-dependent mTOR signaling

PubMed Central

Mleczko-Sanecka, Katarzyna; Roche, Franziska; Rita da Silva, Ana; Call, Debora; D’Alessio, Flavia; Ragab, Anan; Lapinski, Philip E.; Ummanni, Ramesh; Korf, Ulrike; Oakes, Christopher; Damm, Georg; D’Alessandro, Lorenza A.; Klingmüller, Ursula; King, Philip D.; Boutros, Michael; Hentze, Matthias W.

2014-01-01

The hepatic hormone hepcidin is a key regulator of systemic iron metabolism. Its expression is largely regulated by 2 signaling pathways: the “iron-regulated” bone morphogenetic protein (BMP) and the inflammatory JAK-STAT pathways. To obtain broader insights into cellular processes that modulate hepcidin transcription and to provide a resource to identify novel genetic modifiers of systemic iron homeostasis, we designed an RNA interference (RNAi) screen that monitors hepcidin promoter activity after the knockdown of 19 599 genes in hepatocarcinoma cells. Interestingly, many of the putative hepcidin activators play roles in signal transduction, inflammation, or transcription, and affect hepcidin transcription through BMP-responsive elements. Furthermore, our work sheds light on new components of the transcriptional machinery that maintain steady-state levels of hepcidin expression and its responses to the BMP- and interleukin-6–triggered signals. Notably, we discover hepcidin suppression mediated via components of Ras/RAF MAPK and mTOR signaling, linking hepcidin transcriptional control to the pathways that respond to mitogen stimulation and nutrient status. Thus using a combination of RNAi screening, reverse phase protein arrays, and small molecules testing, we identify links between the control of systemic iron homeostasis and critical liver processes such as regeneration, response to injury, carcinogenesis, and nutrient metabolism. PMID:24385536

Orexin signaling via the orexin 1 receptor mediates operant responding for food reinforcement.

PubMed

Sharf, Ruth; Sarhan, Maysa; Brayton, Catherine E; Guarnieri, Douglas J; Taylor, Jane R; DiLeone, Ralph J

2010-04-15

Orexin (hypocretin) signaling is implicated in drug addiction and reward, but its role in feeding and food-motivated behavior remains unclear. We investigated orexin's contribution to food-reinforced instrumental responding using an orexin 1 receptor (Ox1r) antagonist, orexin -/- (OKO) and littermate wildtype (WT) mice, and RNAi-mediated knockdown of orexin. C57BL/6J (n = 76) and OKO (n = 39) mice were trained to nose poke for food under a variable ratio schedule of reinforcement. After responding stabilized, a progressive ratio schedule was initiated to evaluate motivation to obtain food reinforcement. Blockade of Ox1r in C57BL/6J mice impaired performance under both the variable ratio and progressive ratio schedules of reinforcement, indicating impaired motivational processes. In contrast, OKO mice initially demonstrated a delay in acquisition but eventually achieved levels of responding similar to those observed in WT animals. Moreover, OKO mice did not differ from WT mice under a progressive ratio schedule, indicating delayed learning processes but no motivational impairments. Considering the differences between pharmacologic blockade of Ox1r and the OKO mice, animals with RNAi mediated knockdown of orexin were then generated and analyzed to eliminate possible developmental effects of missing orexin. Orexin gene knockdown in the lateral hypothalamus in C57BL/6J mice resulted in blunted performance under both the variable ratio and progressive ratio schedules, resembling data obtained following Ox1r antagonism. The behavior seen in OKO mice likely reflects developmental compensation often seen in mutant animals. These data suggest that activation of the Ox1r is a necessary component of food-reinforced responding, motivation, or both in normal mice. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Orexin signaling via the orexin 1 receptor mediates operant responding for food reinforcement

PubMed Central

Sharf, Ruth; Sarhan, Maysa; Brayton, Catherine E.; Guarnieri, Douglas J.; Taylor, Jane R.; DiLeone, Ralph J.

2010-01-01

Background Orexin (hypocretin) signaling is implicated in drug addiction and reward, but its role in feeding and food-motivated behavior remains unclear. Methods We investigated orexin’s contribution to food-reinforced instrumental responding using an orexin 1 receptor (Ox1r) antagonist, orexin −/− (OKO) and littermate wild-type (WT) mice, and RNAi-mediated knockdown of orexin. C57BL/6J (n=76) and OKO (n=39) mice were trained to nose poke for food under a variable ratio (VR) schedule of reinforcement. Once responding stabilized, a progressive ratio (PR) schedule was initiated to evaluate motivation to obtain food reinforcement. Results Blockade of Ox1r in C57BL/6J mice impaired performance under both the VR and PR schedules of reinforcement, indicating impaired motivational processes. In contrast, OKO mice initially demonstrated a delay in acquisition, but eventually achieved levels of responding similar to those observed in WT animals. Moreover, OKO mice did not differ from WT mice under a PR schedule, indicating delayed learning processes but no motivational impairments. Considering the differences between pharmacological blockade of Ox1r and the OKO mice, animals with RNAi mediated knockdown of orexin were then generated and analyzed to eliminate possible developmental effects of missing orexin. Orexin gene knockdown in the lateral hypothalamus (LH) in C57BL/6J mice resulted in blunted performance under both the VR and PR schedules, resembling data obtained following Ox1r antagonism. Conclusions The behavior seen in OKO mice likely reflects developmental compensation often seen in mutant animals. These data suggest that activation of the Ox1r is a necessary component of food-reinforced responding and/or motivation in normal mice. PMID:20189166

AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes.

PubMed

Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena

2015-01-01

Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings.

RNAi-mediated male sterility of tobacco by silencing TA29.

PubMed

Nawaz-ul-Rehman, Muhammad Shah; Mansoor, Shahid; Khan, Asif Ali; Zafar, Yusuf; Briddon, Rob W

2007-06-01

The superior performance of F1 hybrids has a significant impact on agricultural productivity. For commercial application, the availability of an efficient system for obtaining male-sterile lines of crops is an essential prerequisite. Here we have investigated the use of RNA interference (RNAi) technology to silence a male-specific gene in the model host tobacco. TA29 is expressed exclusively in anthers at the time of microspore development. About 10 out of 13 tobacco lines transformed with a hairpin RNAi construct containing TA29 sequences were male sterile. Transgenic plants were phenotypically indistinguishable from non-transgenic plants. At the anthesis stage, pollen grains from transgenic, male-sterile plants were aborted and lysed in comparison to the round and fully developed pollen in non-transgenic plants. Microscopic analysis of anthers showed selective degradation of tapetum in transgenic plants with no microspore development. One week after self-pollination, the ovules of non-transgenic plants were double the size of those in transgenic plants, due to successful self-fertilization. Male sterile transgenic plants set seed normally, when cross-pollinated with pollen from non-transgenic plants, confirming no adverse effect on the female parts of the flower. These results show that silencing of male-specific genes by RNAi is potentially a useful tool for generating male-sterile lines for producing hybrid seed.

Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

PubMed Central

Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

2009-01-01

Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

Superior In vivo Transduction of Human Hepatocytes Using Engineered AAV3 Capsid.

PubMed

Vercauteren, Koen; Hoffman, Brad E; Zolotukhin, Irene; Keeler, Geoffrey D; Xiao, Jing W; Basner-Tschakarjan, Etiena; High, Katherine A; Ertl, Hildegund Cj; Rice, Charles M; Srivastava, Arun; de Jong, Ype P; Herzog, Roland W

2016-06-01

Adeno-associated viral (AAV) vectors are currently being tested in multiple clinical trials for liver-directed gene transfer to treat the bleeding disorders hemophilia A and B and metabolic disorders. The optimal viral capsid for transduction of human hepatocytes has been under active investigation, but results across various models are inconsistent. We tested in vivo transduction in "humanized" mice. Methods to quantitate percent AAV transduced human and murine hepatocytes in chimeric livers were optimized using flow cytometry and confocal microscopy with image analysis. Distinct transduction efficiencies were noted following peripheral vein administration of a self-complementary vector expressing a gfp reporter gene. An engineered AAV3 capsid with two amino acid changes, S663V+T492V (AAV3-ST), showed best efficiency for human hepatocytes (~3-times, ~8-times, and ~80-times higher than for AAV9, AAV8, and AAV5, respectively). AAV5, 8, and 9 were more efficient in transducing murine than human hepatocytes. AAV8 yielded the highest transduction rate of murine hepatocytes, which was 19-times higher than that for human hepatocytes. In summary, our data show substantial differences among AAV serotypes in transduction of human and mouse hepatocytes, are the first to report on AAV5 in humanized mice, and support the use of AAV3-based vectors for human liver gene transfer.

Development and validation of novel AAV2 random libraries displaying peptides of diverse lengths and at diverse capsid positions.

PubMed

Naumer, Matthias; Ying, Ying; Michelfelder, Stefan; Reuter, Antje; Trepel, Martin; Müller, Oliver J; Kleinschmidt, Jürgen A

2012-05-01

Libraries based on the insertion of random peptide ligands into the capsid of adeno-associated virus type 2 (AAV2) have been widely used to improve the efficiency and selectivity of the AAV vector system. However, so far only libraries of 7-mer peptide ligands have been inserted at one well-characterized capsid position. Here, we expanded the combinatorial AAV2 display system to a panel of novel AAV libraries, displaying peptides of 5, 7, 12, 19, or 26 amino acids in length at capsid position 588 or displaying 7-mer peptides at position 453, the most prominently exposed region of the viral capsid. Library selections on two unrelated cell types-human coronary artery endothelial cells and rat cardiomyoblasts-revealed the isolation of cell type-characteristic peptides of different lengths mediating strongly improved target-cell transduction, except for the 26-mer peptide ligands. Characterization of vector selectivity by transduction of nontarget cells and comparative gene-transduction analysis using a panel of 44 human tumor cell lines revealed that insertion of different-length peptides allows targeting of distinct cellular receptors for cell entry with similar efficiency, but with different selectivity. The application of such novel AAV2 libraries broadens the spectrum of targetable receptors by capsid-modified AAV vectors and provides the opportunity to choose the best suited targeting ligand for a certain application from a number of different candidates.

Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver.

PubMed

Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A

2010-09-01

shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.

RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.

PubMed

Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu

2017-04-01

Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.

Differential Effects of AAV.BDNF and AAV.Ntf3 in the Deafened Adult Guinea Pig Ear

PubMed Central

Budenz, Cameron L.; Wong, Hiu Tung; Swiderski, Donald L.; Shibata, Seiji B.; Pfingst, Bryan E.; Raphael, Yehoash

2015-01-01

Cochlear hair cell loss results in secondary regression of peripheral auditory fibers (PAFs) and loss of spiral ganglion neurons (SGNs). The performance of cochlear implants (CI) in rehabilitating hearing depends on survival of SGNs. Here we compare the effects of adeno-associated virus vectors with neurotrophin gene inserts, AAV.BDNF and AAV.Ntf3, on guinea pig ears deafened systemically (kanamycin and furosemide) or locally (neomycin). AAV.BDNF or AAV.Ntf3 was delivered to the guinea pig cochlea one week following deafening and ears were assessed morphologically 3 months later. At that time, neurotrophins levels were not significantly elevated in the cochlear fluids, even though in vitro and shorter term in vivo experiments demonstrate robust elevation of neurotrophins with these viral vectors. Nevertheless, animals receiving these vectors exhibited considerable re-growth of PAFs in the basilar membrane area. In systemically deafened animals there was a negative correlation between the presence of differentiated supporting cells and PAFs, suggesting that supporting cells influence the outcome of neurotrophin over-expression aimed at enhancing the cochlear neural substrate. Counts of SGN in Rosenthal's canal indicate that BDNF was more effective than NT-3 in preserving SGNs. The results demonstrate that a transient elevation in neurotrophin levels can sustain the cochlear neural substrate in the long term. PMID:25726967

Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

PubMed Central

van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

2014-01-01

The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

Identification, RNAi Knockdown and Functional Analysis of an Ejaculate Protein that Mediates a Postmating, Prezgotic Phenotype in a cricket

USDA-ARS?s Scientific Manuscript database

Male ejaculate proteins, including both sperm and seminal fluid proteins, play an important role in mediating reproductive biology. The function of ejaculate proteins can include enabling sperm-egg interactions, enhancing sperm storage, mediating female attractiveness, and even regulating female lif...

AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes

PubMed Central

Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena

2015-01-01

Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings. PMID:26445723

RNAi-mediated disruption of neuropeptide genes, nlp-3 and nlp-12, cause multiple behavioral defects in Meloidogyne incognita.

PubMed

Dash, Manoranjan; Dutta, Tushar K; Phani, Victor; Papolu, Pradeep K; Shivakumara, Tagginahalli N; Rao, Uma

2017-08-26

Owing to the current deficiencies in chemical control options and unavailability of novel management strategies, root-knot nematode (M. incognita) infections remain widespread with significant socio-economic impacts. Helminth nervous systems are peptide-rich and appear to be putative drug targets that could be exploited by antihelmintic chemotherapy. Herein, to characterize the novel peptidergic neurotransmitters, in silico mining of M. incognita genomic and transciptomic datasets revealed the presence of 16 neuropeptide-like protein (nlp) genes with structural hallmarks of neuropeptide preproproteins; among which 13 nlps were PCR-amplified and sequenced. Two key nlp genes (Mi-nlp-3 and Mi-nlp-12) were localized to the basal bulb and tail region of nematode body via in situ hybridization assay. Mi-nlp-3 and Mi-nlp-12 were greatly expressed (in qRT-PCR assay) in the pre-parasitic juveniles and adult females, suggesting the association of these genes in host recognition, development and reproduction of M. incognita. In vitro knockdown of Mi-nlp-3 and Mi-nlp-12 via RNAi demonstrated the significant reduction in attraction and penetration of M. incognita in tomato root in Pluronic gel medium. A pronounced perturbation in development and reproduction of NLP-silenced worms was also documented in adzuki beans in CYG growth pouches. The deleterious phenotypes obtained due to NLP knockdown suggests that transgenic plants engineered to express RNA constructs targeting nlp genes may emerge as an environmentally viable option to manage nematode problems in crop plants. Copyright © 2017 Elsevier Inc. All rights reserved.

Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

PubMed

Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

2015-09-01

Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

Knockdown of RIPK1 Markedly Exacerbates Murine Immune-Mediated Liver Injury through Massive Apoptosis of Hepatocytes, Independent of Necroptosis and Inhibition of NF-κB.

PubMed

Suda, Jo; Dara, Lily; Yang, Luoluo; Aghajan, Mariam; Song, Yong; Kaplowitz, Neil; Liu, Zhang-Xu

2016-10-15

Receptor-interacting protein kinase (RIPK)1 has an essential role in the signaling pathways triggered by death receptors through activation of NF-κB and regulation of caspase-dependent apoptosis and RIPK3/mixed lineage kinase domain-like protein (MLKL)-mediated necroptosis. We examined the effect of RIPK1 antisense knockdown on immune-mediated liver injury in C57BL/6 mice caused by α-galactosylceramide (αGalCer), a specific activator for invariant NKT cells. We found that knockdown of RIPK1 markedly exacerbated αGalCer-mediated liver injury and induced lethality. This was associated with increased hepatic inflammation and massive apoptotic death of hepatocytes, as indicated by TUNEL staining and caspase-3 activation. Pretreatment with zVAD.fmk, a pan-caspase inhibitor, or neutralizing Abs against TNF, almost completely protected against the exacerbated liver injury and lethality. Primary hepatocytes isolated from RIPK1-knockdown mice were sensitized to TNF-induced cell death that was completely inhibited by adding zVAD.fmk. The exacerbated liver injury was not due to impaired hepatic NF-κB activation in terms of IκBα phosphorylation and degradation in in vivo and in vitro studies. Lack of RIPK1 kinase activity by pretreatment with necrostatin-1, a RIPK1 kinase inhibitor, or in the RIPK1 kinase-dead knock-in (RIPK1 D138N ) mice did not exacerbate αGalCer-mediated liver injury. Furthermore, RIPK3-knockout and MLKL-knockout mice behaved similarly as wild-type control mice in response to αGalCer, with or without knockdown of RIPK1, excluding a switch to RIPK3/MLKL-mediated necroptosis. Our findings reveal a critical kinase-independent platform role for RIPK1 in protecting against TNF/caspase-dependent apoptosis of hepatocytes in immune-mediated liver injury. Copyright © 2016 by The American Association of Immunologists, Inc.

Development of RNAi methods for Peregrinus maidis, the corn planthopper.

PubMed

Yao, Jianxiu; Rotenberg, Dorith; Afsharifar, Alireza; Barandoc-Alviar, Karen; Whitfield, Anna E

2013-01-01

The corn planthopper, Peregrinus maidis, is a major pest of agronomically-important crops. Peregrinus maidis has a large geographical distribution and transmits Maize mosaic rhabdovirus (MMV) and Maize stripe tenuivirus (MSpV). The objective of this study was to develop effective RNAi methods for P. maidis. Vacuolar-ATPase (V-ATPase) is an essential enzyme for hydrolysis of ATP and for transport of protons out of cells thereby maintaining membrane ion balance, and it has been demonstrated to be an efficacious target for RNAi in other insects. In this study, two genes encoding subunits of P. maidis V-ATPase (V-ATPase B and V-ATPase D) were chosen as RNAi target genes. The open reading frames of V-ATPase B and D were generated and used for constructing dsRNA fragments. Experiments were conducted using oral delivery and microinjection of V-ATPase B and V-ATPase D dsRNA to investigate the effectiveness of RNAi in P. maidis. Real-time quantitative reverse transcriptase-PCR (qRT-PCR) analysis indicated that microinjection of V-ATPase dsRNA led to a minimum reduction of 27-fold in the normalized abundance of V-ATPase transcripts two days post injection, while ingestion of dsRNA resulted in a two-fold reduction after six days of feeding. While both methods of dsRNA delivery resulted in knockdown of target transcripts, the injection method was more rapid and effective. The reduction in V-ATPase transcript abundance resulted in observable phenotypes. Specifically, the development of nymphs injected with 200 ng of either V-ATPase B or D dsRNA was impaired, resulting in higher mortality and lower fecundity than control insects injected with GFP dsRNA. Microscopic examination of these insects revealed that female reproductive organs did not develop normally. The successful development of RNAi in P. maidis to target specific genes will enable the development of new insect control strategies and functional analysis of vital genes and genes associated with interactions between P

Recombinant adeno-associated virus serotype 6 (rAAV2/6)-mediated gene transfer to nociceptive neurons through different routes of delivery

PubMed Central

Towne, Chris; Pertin, Marie; Beggah, Ahmed T; Aebischer, Patrick; Decosterd, Isabelle

2009-01-01

Background Gene transfer to nociceptive neurons of the dorsal root ganglia (DRG) is a promising approach to dissect mechanisms of pain in rodents and is a potential therapeutic strategy for the treatment of persistent pain disorders such as neuropathic pain. A number of studies have demonstrated transduction of DRG neurons using herpes simplex virus, adenovirus and more recently, adeno-associated virus (AAV). Recombinant AAV are currently the gene transfer vehicles of choice for the nervous system and have several advantages over other vectors, including stable and safe gene expression. We have explored the capacity of recombinant AAV serotype 6 (rAAV2/6) to deliver genes to DRG neurons and characterized the transduction of nociceptors through five different routes of administration in mice. Results Direct injection of rAAV2/6 expressing green fluorescent protein (eGFP) into the sciatic nerve resulted in transduction of up to 30% eGFP-positive cells of L4 DRG neurons in a dose dependant manner. More than 90% of transduced cells were small and medium sized neurons (< 700 μm2), predominantly colocalized with markers of nociceptive neurons, and had eGFP-positive central terminal fibers in the superficial lamina of the spinal cord dorsal horn. The efficiency and profile of transduction was independent of mouse genetic background. Intrathecal administration of rAAV2/6 gave the highest level of transduction (≈ 60%) and had a similar size profile and colocalization with nociceptive neurons. Intrathecal administration also transduced DRG neurons at cervical and thoracic levels and resulted in comparable levels of transduction in a mouse model for neuropathic pain. Subcutaneous and intramuscular delivery resulted in low levels of transduction in the L4 DRG. Likewise, delivery via tail vein injection resulted in relatively few eGFP-positive cells within the DRG, however, this transduction was observed at all vertebral levels and corresponded to large non-nociceptive cell

Viral vector-mediated downregulation of RhoA increases survival and axonal regeneration of retinal ganglion cells

PubMed Central

Koch, Jan Christoph; Tönges, Lars; Michel, Uwe; Bähr, Mathias; Lingor, Paul

2014-01-01

The Rho/ROCK pathway is a promising therapeutic target in neurodegenerative and neurotraumatic diseases. Pharmacological inhibition of various pathway members has been shown to promote neuronal regeneration and survival. However, because pharmacological inhibitors are inherently limited in their specificity, shRNA-mediated approaches can add more information on the function of each single kinase involved. Thus, we generated adeno-associated viral vectors (AAV) to specifically downregulate Ras homologous member A (RhoA) via shRNA. We found that specific knockdown of RhoA promoted neurite outgrowth of retinal ganglion cells (RGC) grown on the inhibitory substrate chondroitin sulfate proteoglycan (CSPG) as well as neurite regeneration of primary midbrain neurons (PMN) after scratch lesion. In the rat optic nerve crush (ONC) model in vivo, downregulation of RhoA significantly enhanced axonal regeneration compared to control. Moreover, survival of RGC transduced with AAV expressing RhoA-shRNA was substantially increased at 2 weeks after optic nerve axotomy. Compared to previous data using pharmacological inhibitors to target RhoA, its upstream regulator Nogo or its main downstream target ROCK, the specific effects of RhoA downregulation shown here were most pronounced in regard to promoting RGC survival but neurite outgrowth and axonal regeneration were also increased significantly. Taken together, we show here that specific knockdown of RhoA substantially increases neuronal survival after optic nerve axotomy and modestly increases neurite outgrowth in vitro and axonal regeneration after optic nerve crush. PMID:25249936

Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer.

PubMed

Buchlis, George; Podsakoff, Gregory M; Radu, Antonetta; Hawk, Sarah M; Flake, Alan W; Mingozzi, Federico; High, Katherine A

2012-03-29

In previous work we transferred a human factor IX-encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer.

Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer

PubMed Central

Buchlis, George; Podsakoff, Gregory M.; Radu, Antonetta; Hawk, Sarah M.; Flake, Alan W.; Mingozzi, Federico

2012-01-01

In previous work we transferred a human factor IX–encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer. PMID:22271447

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Small But Increasingly Mighty: Latest Advances in AAV Vector Research, Design, and Evolution.

PubMed

Grimm, Dirk; Büning, Hildegard

2017-11-01

Recombinant gene delivery vectors derived from naturally occurring or genetically engineered adeno-associated viruses (AAV) have taken center stage in human gene therapy, fueled by rapidly accumulating and highly encouraging clinical data. Nonetheless, it has also become evident that the current generation of AAV vectors will require improvements in transduction potency, antibody evasion, and cell specificity in order to realize their full potential and to widen applicability in larger patient cohorts. Fortunately, in the recent past, the field has seen a flurry of exciting new developments that enhance our understanding of AAV vector biology, including virus-host interactions, and/or that expand our arsenal of technologies for AAV capsid design and evolution. This review highlights a collection of latest advances in these areas, which, in the authors' opinion, hold particular promise to propel the AAV vector field forward in the near future, especially when applied in combination. These include fundamental novel insights into the AAV life cycle, from an unexpected role of autophagy and interactions with other viruses to the (re-)discovery of a universal AAV receptor and the function of AAV-AAP for capsid assembly. Concurrently, recent successes in the rational design of next-generation synthetic AAV capsids are pointed out, exemplified by the structure-guided derivation of AAV mutants displaying robust in vivo immune evasion. Finally, a variety of new and innovative strategies for high-throughput generation and screening of AAV capsid libraries are briefly reviewed, including Cre recombinase-based selection, ancestral AAV capsid reconstruction, and DNA barcoding of AAV genomes. All of these examples showcase the present momentum in the AAV field and, together with work by many other academic or industrial entities, raise substantial optimism that the remaining hurdles for human gene therapy with AAV vectors will (soon) be overcome.

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice.

PubMed

Tadokoro, Takahiro; Miyanohara, Atsushi; Navarro, Michael; Kamizato, Kota; Juhas, Stefan; Juhasova, Jana; Marsala, Silvia; Platoshyn, Oleksandr; Curtis, Erik; Gabel, Brandon; Ciacci, Joseph; Lukacova, Nada; Bimbova, Katarina; Marsala, Martin

2017-07-13

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 µL; 1.2 x 10 13 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

Brain gene expression changes elicited by peripheral vitellogenin knockdown in the honey bee.

PubMed

Wheeler, M M; Ament, S A; Rodriguez-Zas, S L; Robinson, G E

2013-10-01

Vitellogenin (Vg) is best known as a yolk protein precursor. Vg also functions to regulate behavioural maturation in adult honey bee workers, but the underlying molecular mechanisms by which it exerts this novel effect are largely unknown. We used abdominal vitellogenin (vg) knockdown with RNA interference (RNAi) and brain transcriptomic profiling to gain insights into how Vg influences honey bee behavioural maturation. We found that vg knockdown caused extensive gene expression changes in the bee brain, with much of this transcriptional response involving changes in central biological functions such as energy metabolism. vg knockdown targeted many of the same genes that show natural, maturation-related differences, but the direction of change for the genes in these two contrasts was not correlated. By contrast, vg knockdown targeted many of the same genes that are regulated by juvenile hormone (JH) and there was a significant correlation for the direction of change for the genes in these two contrasts. These results indicate that the tight coregulatory relationship that exists between JH and Vg in the regulation of honey bee behavioural maturation is manifest at the genomic level and suggest that these two physiological factors act through common pathways to regulate brain gene expression and behaviour. © 2013 Royal Entomological Society.

Adapted Resistance to the Knockdown Effect of shRNA-Derived Srsf3 siRNAs in Mouse Littermates | Center for Cancer Research

Cancer.gov

Gene silencing techniques are widely used to control gene expression and have potential for RNAi-based therapeutics. In this report, transgenic mouse lines were created for conditional knockdown of Srsf3 (SRp20) expression in liver and mammary gland tissues by expressing Srsf3-specific shRNAs driven by a U6 promoter.

Knockdown endogenous CypA with siRNA in U2OS cells results in disruption of F-actin structure and alters tumor phenotype.

PubMed

Calhoun, Colonya C; Lu, Ying-Chun; Song, Jun; Chiu, Robert

2009-01-01

Cyclophilin A (CypA) was originally identified as a cytosolic protein possessing peptidyl-prolyl isomerase activity. CypA has been shown to play a pivotal role in the immune response, but little is known about other molecular mechanisms of CypA-mediated biologic events. In our present study, we demonstrate that knockdown CypA expression using RNAi in U2OS cells resulted in disruption of the F-actin structure, as well as decreased anchorage-independent growth, proliferation, and migration. Wild-type U2OS cells treated with cyclosporine A (CsA), a peptidyl-prolyl isomerase inhibitor, displayed the same phenotype as knockdown CypA cells, suggesting that the isomerase activity of CypA is required to maintain a normal phenotype. In vitro and in vivo binding assays revealed that CypA binds to N-WASP, which functions in the nucleation of actin via the Arp2/3 complex. Pulse-chase labeling study indicated an enhanced degradation of N-WASP in cell lacking CypA, suggesting that CypA is required for stabilizing N-WASP to form a N-WASP/Arp2/3 complex for the nucleation/initiation of F-actin polymerization.

Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.

PubMed

Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung

2016-07-01

Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

PubMed Central

Horn, Thomas; Boutros, Michael

2010-01-01

The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Synergistic inhibition of PARP-1 and NF-κB signaling downregulates immune response against recombinant AAV2 vectors during hepatic gene therapy.

PubMed

Hareendran, Sangeetha; Ramakrishna, Banumathi; Jayandharan, Giridhara R

2016-01-01

Host immune response remains a key obstacle to widespread application of adeno-associated virus (AAV) based gene therapy. Thus, targeted inhibition of the signaling pathways that trigger such immune responses will be beneficial. Previous studies have reported that DNA damage response proteins such as poly(ADP-ribose) polymerase-1 (PARP-1) negatively affect the integration of AAV in the host genome. However, the role of PARP-1 in regulating AAV transduction and the immune response against these vectors has not been elucidated. In this study, we demonstrate that repression of PARP-1 improves the transduction of single-stranded AAV vectors both in vitro (∼174%) and in vivo (two- to 3.4-fold). Inhibition of PARP-1, also significantly downregulated the expression of several proinflammatory and cytokine markers such as TLRs, ILs, NF-κB subunit proteins associated with the host innate response against self-complementary AAV2 vectors. The suppression of the inflammatory response targeted against these vectors was more effective upon combined inhibition of PARP-1 and NF-κB signaling. This strategy also effectively attenuated the AAV capsid-specific cytotoxic T-cell response, with minimal effect on vector transduction, as demonstrated in normal C57BL/6 and hemophilia B mice. These data suggest that targeting specific host cellular proteins could be useful to attenuate the immune barriers to AAV-mediated gene therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain

PubMed Central

Deverman, Benjamin E.; Pravdo, Piers L.; Simpson, Bryan P.; Kumar, Sripriya Ravindra; Chan, Ken Y.; Banerjee, Abhik; Wu, Wei-Li; Yang, Bin; Huber, Nina; Pasca, Sergiu P.; Gradinaru, Viviana

2015-01-01

Recombinant adeno-associated viruses (rAAVs) are commonly used vehicles for in vivo gene transfer1-6. However, the tropism repertoire of naturally occurring AAVs is limited, prompting a search for novel AAV capsids with desired characteristics7-13. Here we describe a capsid selection method, called Cre-recombination-based AAV targeted evolution (CREATE), that enables the development of AAV capsids that more efficiently transduce defined Cre-expressing cell populations in vivo. We use CREATE to generate AAV variants that efficiently and widely transduce the adult mouse central nervous system (CNS) after intravenous injection. One variant, AAV-PHP.B, transfers genes throughout the CNS with an efficiency that is at least 40-fold greater than that of the current standard, AAV914-17, and transduces the majority of astrocytes and neurons across multiple CNS regions. In vitro, it transduces human neurons and astrocytes more efficiently than does AAV9, demonstrating the potential of CREATE to produce customized AAV vectors for biomedical applications. PMID:26829320

Phase 1 Gene Therapy for Duchenne Muscular Dystrophy Using a Translational Optimized AAV Vector

PubMed Central

Bowles, Dawn E; McPhee, Scott WJ; Li, Chengwen; Gray, Steven J; Samulski, Jade J; Camp, Angelique S; Li, Juan; Wang, Bing; Monahan, Paul E; Rabinowitz, Joseph E; Grieger, Joshua C; Govindasamy, Lakshmanan; Agbandje-McKenna, Mavis; Xiao, Xiao; Samulski, R Jude

2012-01-01

Efficient and widespread gene transfer is required for successful treatment of Duchenne muscular dystrophy (DMD). Here, we performed the first clinical trial using a chimeric adeno-associated virus (AAV) capsid variant (designated AAV2.5) derived from a rational design strategy. AAV2.5 was generated from the AAV2 capsid with five mutations from AAV1. The novel chimeric vector combines the improved muscle transduction capacity of AAV1 with reduced antigenic crossreactivity against both parental serotypes, while keeping the AAV2 receptor binding. In a randomized double-blind placebo-controlled phase I clinical study in DMD boys, AAV2.5 vector was injected into the bicep muscle in one arm, with saline control in the contralateral arm. A subset of patients received AAV empty capsid instead of saline in an effort to distinguish an immune response to vector versus minidystrophin transgene. Recombinant AAV genomes were detected in all patients with up to 2.56 vector copies per diploid genome. There was no cellular immune response to AAV2.5 capsid. This trial established that rationally designed AAV2.5 vector was safe and well tolerated, lays the foundation of customizing AAV vectors that best suit the clinical objective (e.g., limb infusion gene delivery) and should usher in the next generation of viral delivery systems for human gene transfer. PMID:22068425

Molecular design for recombinant adeno-associated virus (rAAV) vector production.

PubMed

Aponte-Ubillus, Juan Jose; Barajas, Daniel; Peltier, Joseph; Bardliving, Cameron; Shamlou, Parviz; Gold, Daniel

2018-02-01

Recombinant adeno-associated virus (rAAV) vectors are increasingly popular tools for gene therapy applications. Their non-pathogenic status, low inflammatory potential, availability of viral serotypes with different tissue tropisms, and prospective long-lasting gene expression are important attributes that make rAAVs safe and efficient therapeutic options. Over the last three decades, several groups have engineered recombinant AAV-producing platforms, yielding high titers of transducing vector particles. Current specific productivity yields from different platforms range from 10 3 to 10 5 vector genomes (vg) per cell, and there is an ongoing effort to improve vector yields in order to satisfy high product demands required for clinical trials and future commercialization.Crucial aspects of vector production include the molecular design of the rAAV-producing host cell line along with the design of AAV genes, promoters, and regulatory elements. Appropriately, configuring and balancing the expression of these elements not only contributes toward high productivity, it also improves process robustness and product quality. In this mini-review, the rational design of rAAV-producing expression systems is discussed, with special attention to molecular strategies that contribute to high-yielding, biomanufacturing-amenable rAAV production processes. Details on molecular optimization from four rAAV expression systems are covered: adenovirus, herpesvirus, and baculovirus complementation systems, as well as a recently explored yeast expression system.

Syngeneic AAV pseudo-vectors potentiates full vector transduction

USDA-ARS?s Scientific Manuscript database

An excessive amount of empty capsids are generated during regular AAV vector production process. These pseudo-vectors often remain in final vectors used for animal studies or clinical trials. The potential effects of these pseudo-vectors on AAV transduction have been a major concern. In the current ...

Naturally enveloped AAV vectors for shielding neutralizing antibodies and robust gene delivery in vivo

PubMed Central

György, Bence; Fitzpatrick, Zachary; Crommentuijn, Matheus HW; Mu, Dakai; Maguire, Casey A.

2014-01-01

Recently adeno-associated virus (AAV) became the first clinically approved gene therapy product in the western world. To develop AAV for future clinical application in a widespread patient base, particularly in therapies which require intravenous (i.v.) administration of vector, the virus must be able to evade pre-existing antibodies to the wild type virus. Here we demonstrate that in mice, AAV vectors associated with extracellular vesicles (EVs) can evade human anti-AAV neutralizing antibodies. We observed different antibody evasion and gene transfer abilities with populations of EVs isolated by different centrifugal forces. EV-associated AAV vector (ev-AAV) was up to 136-fold more resistant over a range of neutralizing antibody concentrations relative to standard AAV vector in vitro. Importantly in mice, at a concentration of passively transferred human antibodies which decreased i.v. administered standard AAV transduction of brain by 80%, transduction of ev-AAV transduction was not reduced and was 4,000-fold higher. Finally, we show that expressing a brain targeting peptide on the EV surface allowed significant enhancement of transduction compared to untargeted ev-AAV. Using ev-AAV represents an effective, clinically relevant approach to evade human neutralizing anti-AAV antibodies after systemic administration of vector. PMID:24917028

Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

PubMed Central

Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

2012-01-01

Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

Humoral immunity to AAV-6, 8, and 9 in normal and dystrophic dogs.

PubMed

Shin, Jin-Hong; Yue, Yongping; Smith, Bruce; Duan, Dongsheng

2012-03-01

Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy.

FlyRNAi.org—the database of the Drosophila RNAi screening center and transgenic RNAi project: 2017 update

PubMed Central

Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2017-01-01

The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

PubMed Central

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

RNAi-mediated down-regulation of SHATTERPROOF gene in transgenic oilseed rape.

PubMed

Kord, Hadis; Shakib, Ali Mohammad; Daneshvar, Mohammad Hossein; Azadi, Pejman; Bayat, Vahid; Mashayekhi, Mohsen; Zarea, Mahboobeh; Seifi, Alireza; Ahmad-Raji, Mana

2015-06-01

Oilseed rape is one of the important oil plants. Pod shattering is one of the problems in oilseed rape production especially in regions with dry conditions. One of the important genes in Brassica pod opening is SHATTERPROOF1 (SHP1). Down-regulation of BnSHP1 expression by RNAi can increase resistance to pod shattering. A 470 bp of the BnSHP1 cDNA sequence constructed in an RNAi-silencing vector was transferred to oilseed rape cv. SLM046. Molecular analysis of T2 transgenic plants by RT-PCR and Real-time PCR showed that expression of the BnSHP alleles was highly decreased in comparison with control plants. Morphologically, transgenic plants were normal and produced seeds at greenhouse conditions. At ripening, stage pods failed to shatter, and a finger pressure was needed for pod opening.

5-HT2C Receptor Knockdown in the Amygdala Inhibits Neuropathic-Pain-Related Plasticity and Behaviors.

PubMed

Ji, Guangchen; Zhang, Wei; Mahimainathan, Lenin; Narasimhan, Madhusudhanan; Kiritoshi, Takaki; Fan, Xiuzhen; Wang, Jigong; Green, Thomas A; Neugebauer, Volker

2017-02-08

Neuroplasticity in the amygdala drives pain-related behaviors. The central nucleus (CeA) serves major amygdala output functions and can generate emotional-affective behaviors and modulate nocifensive responses. The CeA receives excitatory and inhibitory inputs from the basolateral nucleus (BLA) and serotonin receptor subtype 5-HT 2C R in the BLA, but not CeA, has been implicated anxiogenic behaviors and anxiety disorders. Here, we tested the hypothesis that 5-HT 2C R in the BLA plays a critical role in CeA plasticity and neuropathic pain behaviors in the rat spinal nerve ligation (SNL) model. Local 5-HT 2C R knockdown in the BLA with stereotaxic injection of 5-HT 2C R shRNA AAV vector decreased vocalizations and anxiety- and depression-like behaviors and increased sensory thresholds of SNL rats, but had no effect in sham controls. Extracellular single-unit recordings of CeA neurons in anesthetized rats showed that 5-HT 2C R knockdown blocked the increase in neuronal activity (increased responsiveness, irregular spike firing, and increased burst activity) in SNL rats. At the synaptic level, 5-HT 2C R knockdown blocked the increase in excitatory transmission from BLA to CeA recorded in brain slices from SNL rats using whole-cell patch-clamp conditions. Inhibitory transmission was decreased by 5-HT 2C R knockdown in control and SNL conditions to a similar degree. The findings can be explained by immunohistochemical data showing increased expression of 5-HT 2C R in non-GABAergic BLA cells in SNL rats. The results suggest that increased 5-HT 2C R in the BLA contributes to neuropathic-pain-related amygdala plasticity by driving synaptic excitation of CeA neurons. As a rescue strategy, 5-HT 2C R knockdown in the BLA inhibits neuropathic-pain-related behaviors. SIGNIFICANCE STATEMENT Neuroplasticity in the amygdala has emerged as an important pain mechanism. This study identifies a novel target and rescue strategy to control abnormally enhanced amygdala activity in an

[Construction of rAAV2-GPIIb/IIIa vector and test of its expression and function in vitro].

PubMed

Wang, Kai; Peng, Jian-Qiang; Chen, Fang-Ping; Wu, Xiao-Bin

2006-04-01

This study was aimed to explore the possibility of rAAV2 vector-mediating gene therapy for Glanzmann' s thrombasthenia. The rAAV2-GPIIb/IIIa vector was constructed. The GPIIb/IIIa gene expression in mammal cell were examined by different methods, such as: detection of mRNA expression in BHK-21 cells after 24 hours of infection (MOI = 1 x 10(5) v.g/cell) was performed by RT-PCR; the relation between MOI and quantity of GPII6/IIIa gene expression was detected by FACS after 48 hours of infection; GPIIb/IIIa protein expression in BHK-21 cells after 48 hours of infection (MOI = 10(5) v x g/cell) was assayed by Western blot, GPIIb/IIIa protein expression on cell surface was detected by immunofluorescence, and the biological function of expressing product was determined by PAC-1 conjunct experiments. The results showed that GPIIb/IIIa gene expression in mRNA level could be detected in BHK-21 cells after 24 hours of infection at MOI = 1 x 10(5) v x g/cell and the GPIIb/IIIa gene expression in protein level could be detected in BHK-21 cells after 48 hours of infection at MOI = 1 x 10(5) v x g/cell. In certain range, quantity of GPIIb/IIIa gene expression increased with MOI, but overdose of MOI decreased quantity of GPIIb/IIIa gene expression. Activated product of GPIIb/IIIa gene expression could combined with PAC-I, and possesed normal biological function. In conclusion, rAAV2 vactor can effectively mediate GPIIb and GPIIIa gene expressing in mammal cells, and the products of these genes exhibit biological function. This result may provide a basis for application of rAAV2 vector in Glanzmann's thrombasthenia gene therapy in furture.

Specific knockdown of Oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells.

PubMed

Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W

2004-01-01

We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.

Blood-brain barrier shuttle peptides enhance AAV transduction in the brain after systemic administration.

PubMed

Zhang, Xintao; He, Ting; Chai, Zheng; Samulski, R Jude; Li, Chengwen

2018-09-01

The adeno-associated virus (AAV) vector has been used in preclinical and clinical trials of gene therapy for central nervous system (CNS) diseases. One of the biggest challenges of effectively delivering AAV to the brain is to surmount the blood-brain barrier (BBB). Herein, we identified several potential BBB shuttle peptides that significantly enhanced AAV8 transduction in the brain after a systemic administration, the best of which was the THR peptide. The enhancement of AAV8 brain transduction by THR is dose-dependent, and neurons are the primary THR targets. Mechanism studies revealed that THR directly bound to the AAV8 virion, increasing its ability to cross the endothelial cell barrier. Further experiments showed that binding of THR to the AAV virion did not interfere with AAV8 infection biology, and that THR competitively blocked transferrin from binding to AAV8. Taken together, our results demonstrate, for the first time, that BBB shuttle peptides are able to directly interact with AAV and increase the ability of the AAV vectors to cross the BBB for transduction enhancement in the brain. These results will shed important light on the potential applications of BBB shuttle peptides for enhancing brain transduction with systemic administration of AAV vectors. Copyright © 2018 Elsevier Ltd. All rights reserved.

Neuromedin U receptor 2 knockdown in the paraventricular nucleus modifies behavioral responses to obesogenic high-fat food and leads to increased body weight.

PubMed

Benzon, C R; Johnson, S B; McCue, D L; Li, D; Green, T A; Hommel, J D

2014-01-31

Neuromedin U (NMU) is a highly conserved neuropeptide which regulates food intake and body weight. Transgenic mice lacking NMU are hyperphagic and obese, making NMU a novel target for understanding and treating obesity. Neuromedin U receptor 2 (NMUR2) is a high-affinity receptor for NMU found in discrete regions of the central nervous system, in particular the paraventricular nucleus of the hypothalamus (PVN), where it may be responsible for mediating the anorectic effects of NMU. We hypothesized that selective knock down of NMUR2 in the PVN of rats would increase their sensitivity to the reinforcing properties of food resulting in increased intake and preference for high-fat obesogenic food. To this end, we used viral-mediated RNAi to selectively knock down NMUR2 gene expression in the PVN. In rats fed a standard chow, NMUR2 knockdown produced no significant effect on food intake or body weight. However, when the same rats were fed a high-fat diet (45% fat), they consumed significantly more food, gained more body weight, and had increased feed efficiency relative to controls. Furthermore, NMUR2 knockdown rats demonstrated significantly greater binge-type food consumption of the high-fat diet and showed a greater preference for higher-fat food. These results demonstrate that NMUR2 signaling in the PVN regulates consumption and preference for high-fat foods without disrupting feeding behavior associated with non-obesogenic standard chow. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

A Single Intravenous rAAV Injection as Late as P20 Achieves Efficacious and Sustained CNS Gene Therapy in Canavan Mice

PubMed Central

Ahmed, Seemin Seher; Li, Huapeng; Cao, Chunyan; Sikoglu, Elif M; Denninger, Andrew R; Su, Qin; Eaton, Samuel; Liso Navarro, Ana A; Xie, Jun; Szucs, Sylvia; Zhang, Hongwei; Moore, Constance; Kirschner, Daniel A; Seyfried, Thomas N; Flotte, Terence R; Matalon, Reuben; Gao, Guangping

2013-01-01

Canavan's disease (CD) is a fatal pediatric leukodystrophy caused by mutations in aspartoacylase (AspA) gene. Currently, there is no effective treatment for CD; however, gene therapy is an attractive approach to ameliorate the disease. Here, we studied progressive neuropathology and gene therapy in short-lived (≤1 month) AspA−/− mice, a bona-fide animal model for the severest form of CD. Single intravenous (IV) injections of several primate-derived recombinant adeno-associated viruses (rAAVs) as late as postnatal day 20 (P20) completely rescued their early lethality and alleviated the major disease symptoms, extending survival in P0-injected rAAV9 and rAAVrh8 groups to as long as 2 years thus far. We successfully used microRNA (miRNA)-mediated post-transcriptional detargeting for the first time to restrict therapeutic rAAV expression in the central nervous system (CNS) and minimize potentially deleterious effects of transgene overexpression in peripheral tissues. rAAV treatment globally improved CNS myelination, although some abnormalities persisted in the content and distribution of myelin-specific and -enriched lipids. We demonstrate that systemically delivered and CNS-restricted rAAVs can serve as efficacious and sustained gene therapeutics in a model of a severe neurodegenerative disorder even when administered as late as P20. PMID:23817205

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

Muscle function recovery in golden retriever muscular dystrophy after AAV1-U7 exon skipping.

PubMed

Vulin, Adeline; Barthélémy, Inès; Goyenvalle, Aurélie; Thibaud, Jean-Laurent; Beley, Cyriaque; Griffith, Graziella; Benchaouir, Rachid; le Hir, Maëva; Unterfinger, Yves; Lorain, Stéphanie; Dreyfus, Patrick; Voit, Thomas; Carlier, Pierre; Blot, Stéphane; Garcia, Luis

2012-11-01

Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder resulting from lesions of the gene encoding dystrophin. These usually consist of large genomic deletions, the extents of which are not correlated with the severity of the phenotype. Out-of-frame deletions give rise to dystrophin deficiency and severe DMD phenotypes, while internal deletions that produce in-frame mRNAs encoding truncated proteins can lead to a milder myopathy known as Becker muscular dystrophy (BMD). Widespread restoration of dystrophin expression via adeno-associated virus (AAV)-mediated exon skipping has been successfully demonstrated in the mdx mouse model and in cardiac muscle after percutaneous transendocardial delivery in the golden retriever muscular dystrophy dog (GRMD) model. Here, a set of optimized U7snRNAs carrying antisense sequences designed to rescue dystrophin were delivered into GRMD skeletal muscles by AAV1 gene transfer using intramuscular injection or forelimb perfusion. We show sustained correction of the dystrophic phenotype in extended muscle areas and partial recovery of muscle strength. Muscle architecture was improved and fibers displayed the hallmarks of mature and functional units. A 5-year follow-up ruled out immune rejection drawbacks but showed a progressive decline in the number of corrected muscle fibers, likely due to the persistence of a mild dystrophic process such as occurs in BMD phenotypes. Although AAV-mediated exon skipping was shown safe and efficient to rescue a truncated dystrophin, it appears that recurrent treatments would be required to maintain therapeutic benefit ahead of the progression of the disease.

Differential effects of RNAi treatments on field populations of the western corn rootworm.

PubMed

Chu, Chia-Ching; Sun, Weilin; Spencer, Joseph L; Pittendrigh, Barry R; Seufferheld, Manfredo J

2014-03-01

RNA interference (RNAi) mediated crop protection against insect pests is a technology that is greatly anticipated by the academic and industrial pest control communities. Prior to commercialization, factors influencing the potential for evolution of insect resistance to RNAi should be evaluated. While mutations in genes encoding the RNAi machinery or the sequences targeted for interference may serve as a prominent mechanism of resistance evolution, differential effects of RNAi on target pests may also facilitate such evolution. However, to date, little is known about how variation of field insect populations could influence the effectiveness of RNAi treatments. To approach this question, we evaluated the effects of RNAi treatments on adults of three western corn rootworm (WCR; Diabrotica virgifera virgifera LeConte) populations exhibiting different levels of gut cysteine protease activity, tolerance of soybean herbivory, and immune gene expression; two populations were collected from crop rotation-resistant (RR) problem areas and one from a location where RR was not observed (wild type; WT). Our results demonstrated that RNAi targeting DvRS5 (a highly expressed cysteine protease gene) reduced gut cysteine protease activity in all three WCR populations. However, the proportion of the cysteine protease activity that was inhibited varied across populations. When WCR adults were treated with double-stranded RNA of an immune gene att1, different changes in survival among WT and RR populations on soybean diets occurred. Notably, for both genes, the sequences targeted for RNAi were the same across all populations examined. These findings indicate that the effectiveness of RNAi treatments could vary among field populations depending on their physiological and genetic backgrounds and that the consistency of an RNAi trait's effectiveness on phenotypically different populations should be considered or tested prior to wide deployment. Also, genes that are potentially subjected

Phylogenetic Origin and Diversification of RNAi Pathway Genes in Insects.

PubMed

Dowling, Daniel; Pauli, Thomas; Donath, Alexander; Meusemann, Karen; Podsiadlowski, Lars; Petersen, Malte; Peters, Ralph S; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Niehuis, Oliver

2016-12-01

RNA interference (RNAi) refers to the set of molecular processes found in eukaryotic organisms in which small RNA molecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect Transcriptome Evolution) project as well as other resources such as i5K (5000 Insect Genome Project). Specifically, we traced the origin of the double stranded RNA binding protein R2D2 to the last common ancestor of winged insects (Pterygota), the loss of Sid-1/Tag-130 orthologs in Antliophora (fleas, flies and relatives, and scorpionflies in a broad sense), and confirm previous evidence for the splitting of the Argonaute proteins Aubergine and Piwi in Brachyceran flies (Diptera, Brachycera). Our study offers new reference points for future experimental research on RNAi-related pathway genes in insects. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Plectin-1 Targeted AAV Vector for the Molecular Imaging of Pancreatic Cancer

PubMed Central

Konkalmatt, Prasad R.; Deng, Defeng; Thomas, Stephanie; Wu, Michael T.; Logsdon, Craig D.; French, Brent A.; Kelly, Kimberly A.

2013-01-01

Pancreatic ductal adenocarcinoma (PDAC) is highly malignant disease that is the fourth leading cause of cancer-related death in the US. Gene therapy using AAV vectors to selectively deliver genes to PDAC cells is an attractive treatment option for pancreatic cancer. However, most AAV serotypes display a broad spectrum of tissue tropism and none of the existing serotypes specifically target PDAC cells. This study tests the hypothesis that AAV2 can be genetically re-engineered to specifically target PDAC cells by modifying the capsid surface to display a peptide that has previously been shown to bind plectin-1. Toward this end, a Plectin-1 Targeting Peptide (PTP) was inserted into the loop IV region of the AAV2 capsid, and the resulting capsid (AAV-PTP) was used in a series of in vitro and in vivo experiments. In vitro, AAV-PTP was found to target all five human PDAC cell lines tested (PANC-1, MIA PaCa-2, HPAC, MPanc-96, and BxPC-3) preferentially over two non-neoplastic human pancreatic cell lines (human pancreatic ductal epithelial and human pancreatic stellate cells). In vivo, mice bearing subcutaneous tumor xenografts were generated using the PANC-1 cell line. Once tumors reached a size of ∼1–2 mm in diameter, the mice were injected intravenously with luciferase reporter vectors packaged in the either AAV-PTP or wild type AAV2 capsids. Luciferase expression was then monitored by bioluminescence imaging on days 3, 7, and 14 after vector injection. The results indicate that the AAV-PTP capsid displays a 37-fold preference for PANC-1 tumor xenographs over liver and other tissues; whereas the wild type AAV2 capsid displays a complementary preference for liver over tumors and other tissues. Together, these results establish proof-of-principle for the ability of PTP-modified AAV capsids to selectively target gene delivery to PDAC cells in vivo, which opens promising new avenues for the early detection, diagnosis, and treatment of pancreatic cancer. PMID:23616947

The FLIGHT Drosophila RNAi database

PubMed Central

Bursteinas, Borisas; Jain, Ekta; Gao, Qiong; Baum, Buzz; Zvelebil, Marketa

2010-01-01

FLIGHT (http://flight.icr.ac.uk/) is an online resource compiling data from high-throughput Drosophila in vivo and in vitro RNAi screens. FLIGHT includes details of RNAi reagents and their predicted off-target effects, alongside RNAi screen hits, scores and phenotypes, including images from high-content screens. The latest release of FLIGHT is designed to enable users to upload, analyze, integrate and share their own RNAi screens. Users can perform multiple normalizations, view quality control plots, detect and assign screen hits and compare hits from multiple screens using a variety of methods including hierarchical clustering. FLIGHT integrates RNAi screen data with microarray gene expression as well as genomic annotations and genetic/physical interaction datasets to provide a single interface for RNAi screen analysis and datamining in Drosophila. PMID:20855970

Sustained AAV9-mediated expression of a non-self protein in the CNS of non-human primates after immunomodulation

PubMed Central

Ramsingh, Arlene I.; Gray, Steven J.; Reilly, Andrew; Koday, Michael; Bratt, Debbie; Koday, Merika Treants; Murnane, Robert; Hu, Yuhui; Messer, Anne

2018-01-01

A critical issue in transgene delivery studies is immune reactivity to the transgene- encoded protein and its impact on sustained gene expression. Here, we test the hypothesis that immunomodulation by rapamycin can decrease immune reactivity after intrathecal AAV9 delivery of a transgene (GFP) in non-human primates, resulting in sustained GFP expression in the CNS. We show that rapamycin treatment clearly reduced the overall immunogenicity of the AAV9/GFP vector by lowering GFP- and AAV9-specific antibody responses, and decreasing T cell responses including cytokine and cytolytic effector responses. Spinal cord GFP protein expression was sustained for twelve weeks, with no toxicity. Immune correlates of robust transgene expression include negligible GFP-specific CD4 and CD8 T cell responses, absence of GFP-specific IFN-γ producing T cells, and absence of GFP-specific cytotoxic T cells, which support the hypothesis that decreased T cell reactivity results in sustained transgene expression. These data strongly support the use of modest doses of rapamycin to modulate immune responses for intrathecal gene therapies, and potentially a much wider range of viral vector-based therapeutics. PMID:29874260

Overcoming preexisting humoral immunity to AAV using capsid decoys.

PubMed

Mingozzi, Federico; Anguela, Xavier M; Pavani, Giulia; Chen, Yifeng; Davidson, Robert J; Hui, Daniel J; Yazicioglu, Mustafa; Elkouby, Liron; Hinderer, Christian J; Faella, Armida; Howard, Carolann; Tai, Alex; Podsakoff, Gregory M; Zhou, Shangzhen; Basner-Tschakarjan, Etiena; Wright, John Fraser; High, Katherine A

2013-07-17

Adeno-associated virus (AAV) vectors delivered through the systemic circulation successfully transduce various target tissues in animal models. However, similar attempts in humans have been hampered by the high prevalence of neutralizing antibodies to AAV, which completely block vector transduction. We show in both mouse and nonhuman primate models that addition of empty capsid to the final vector formulation can, in a dose-dependent manner, adsorb these antibodies, even at high titers, thus overcoming their inhibitory effect. To further enhance the safety of the approach, we mutated the receptor binding site of AAV2 to generate an empty capsid mutant that can adsorb antibodies but cannot enter a target cell. Our work suggests that optimizing the ratio of full/empty capsids in the final formulation of vector, based on a patient's anti-AAV titers, will maximize the efficacy of gene transfer after systemic vector delivery.

Overcoming Preexisting Humoral Immunity to AAV Using Capsid Decoys

PubMed Central

Anguela, Xavier M.; Pavani, Giulia; Chen, Yifeng; Davidson, Robert J.; Hui, Daniel J.; Yazicioglu, Mustafa; Elkouby, Liron; Hinderer, Christian J.; Faella, Armida; Howard, Carolann; Tai, Alex; Podsakoff, Gregory M.; Zhou, Shangzhen; Basner-Tschakarjan, Etiena; Wright, John Fraser

2014-01-01

Adeno-associated virus (AAV) vectors delivered through the systemic circulation successfully transduce various target tissues in animal models. However, similar attempts in humans have been hampered by the high prevalence of neutralizing antibodies to AAV, which completely block vector transduction. We show in both mouse and nonhuman primate models that addition of empty capsid to the final vector formulation can, in a dose-dependent manner, adsorb these antibodies, even at high titers, thus overcoming their inhibitory effect. To further enhance the safety of the approach, we mutated the receptor binding site of AAV2 to generate an empty capsid mutant that can adsorb antibodies but cannot enter a target cell. Our work suggests that optimizing the ratio of full/empty capsids in the final formulation of vector, based on a patient's anti-AAV titers, will maximize the efficacy of gene transfer after systemic vector delivery. PMID:23863832

Next-generation AAV vectors for clinical use: an ever-accelerating race.

PubMed

Weinmann, Jonas; Grimm, Dirk

2017-10-01

During the past five decades, it has become evident that Adeno-associated virus (AAV) represents one of the most potent, most versatile, and thus most auspicious platforms available for gene delivery into cells, animals and, ultimately, humans. Particularly attractive is the ease with which the viral capsid-the major determinant of virus-host interaction including cell specificity and antibody recognition-can be modified and optimized at will. This has motivated countless researchers to develop high-throughput technologies in which genetically engineered AAV capsid libraries are subjected to a vastly hastened emulation of natural evolution, with the aim to enrich novel synthetic AAV capsids displaying superior features for clinical application. While the power and potential of these forward genetics approaches is undisputed, they are also inherently challenging as success depends on a combination of library quality, fidelity, and complexity. Here, we will describe and discuss two original, very exciting strategies that have emerged over the last three years and that promise to alleviate at least some of these concerns, namely, (i) a reverse genetics approach termed "ancestral AAV sequence reconstruction," and (ii) AAV genome barcoding as a technology that can advance both, forward and reverse genetics stratagems. Notably, despite the conceptual differences of these two technologies, they pursue the same goal which is tailored acceleration of AAV evolution and thus winning the race for the next-generation AAV vectors for clinical use.

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

Effective delivery of large genes to the retina by dual AAV vectors

PubMed Central

Trapani, Ivana; Colella, Pasqualina; Sommella, Andrea; Iodice, Carolina; Cesi, Giulia; de Simone, Sonia; Marrocco, Elena; Rossi, Settimio; Giunti, Massimo; Palfi, Arpad; Farrar, Gwyneth J; Polishchuk, Roman; Auricchio, Alberto

2014-01-01

Retinal gene therapy with adeno-associated viral (AAV) vectors is safe and effective in humans. However, AAV's limited cargo capacity prevents its application to therapies of inherited retinal diseases due to mutations of genes over 5 kb, like Stargardt's disease (STGD) and Usher syndrome type IB (USH1B). Previous methods based on ‘forced’ packaging of large genes into AAV capsids may not be easily translated to the clinic due to the generation of genomes of heterogeneous size which raise safety concerns. Taking advantage of AAV's ability to concatemerize, we generated dual AAV vectors which reconstitute a large gene by either splicing (trans-splicing), homologous recombination (overlapping), or a combination of the two (hybrid). We found that dual trans-splicing and hybrid vectors transduce efficiently mouse and pig photoreceptors to levels that, albeit lower than those achieved with a single AAV, resulted in significant improvement of the retinal phenotype of mouse models of STGD and USH1B. Thus, dual AAV trans-splicing or hybrid vectors are an attractive strategy for gene therapy of retinal diseases that require delivery of large genes. PMID:24150896

Blood-brain barrier transport of non-viral gene and RNAi therapeutics.

PubMed

Boado, Ruben J

2007-09-01

The development of gene- and RNA interference (RNAi)-based therapeutics represents a challenge for the drug delivery field. The global brain distribution of DNA genes, as well as the targeting of specific regions of the brain, is even more complicated because conventional delivery systems, i.e. viruses, have poor diffusion in brain when injected in situ and do not cross the blood-brain barrier (BBB), which is only permeable to lipophilic molecules of less than 400 Da. Recent advances in the "Trojan Horse Liposome" (THL) technology applied to the transvascular non-viral gene therapy of brain disorders presents a promising solution to the DNA/RNAi delivery obstacle. The THL is comprised of immunoliposomes carrying either a gene for protein replacement or small hairpin RNA (shRNA) expression plasmids for RNAi effect, respectively. The THL is engineered with known lipids containing polyethyleneglycol (PEG), which stabilizes its structure in vivo in circulation. The tissue target specificity of THL is given by conjugation of approximately 1% of the PEG residues to peptidomimetic monoclonal antibodies (MAb) that bind to specific endogenous receptors (i.e. insulin and transferrin receptors) located on both the BBB and the brain cellular membranes, respectively. These MAbs mediate (a) receptor-mediated transcytosis of the THL complex through the BBB, (b) endocytosis into brain cells and (c) transport to the brain cell nuclear compartment. The present review presents an overview of the THL technology and its current application to gene therapy and RNAi, including experimental models of Parkinson's disease and brain tumors.

RNAi knockdown of rice SE5 gene is sensitive to the herbicide methyl viologen by the down-regulation of antioxidant defense.

PubMed

Xu, Sheng; Wang, Lijuan; Zhang, Bo; Han, Bin; Xie, Yanjie; Yang, Jie; Zhong, Weigong; Chen, Huiping; Wang, Ren; Wang, Ning; Cui, Weiti; Shen, Wenbiao

2012-09-01

Plant heme oxygenase (HO) catalyzes the oxygenation of heme to biliverdin, carbon monoxide (CO), and free iron (Fe(2+))-and Arabidopsis and rice (Oryza sativa) HOs are involved in light signaling. Here, we identified that the rice PHOTOPERIOD SENSITIVITY 5 (SE5) gene, which encoded a putative HO with high similarity to HO-1 from Arabidopsis (HY1), exhibited HO activity, and localized in the chloroplasts. Rice RNAi mutants silenced for SE5 were generated and displayed early flowering under long-day conditions, consistent with phenotypes of the null mutation in SE5 gene reported previously (se5 and s73). The herbicide methyl viologen (MV), which produces reactive oxygen species (ROS), was applied to determine whether SE5 regulates oxidative stress response. Compared with wild-type, SE5 RNAi transgenic plants aggravated seedling growth inhibition, chlorophyll loss and ROS overproduction, and decreased the transcripts of some representative antioxidative genes. By contrast, administration of exogenous CO partially rescued corresponding MV hypersensitivity in the SE5 RNAi plants. Alleviation of seed germination inhibition, chlorophyll loss and ROS overproduction, as well as the induction of antioxidant defense were further observed when SE5 or HY1 was overexpressed in transgenic Arabidopsis plants, indicating that SE5 may be useful for molecular breeding designed to improve plant tolerance to oxidative stress.

A genome-wide RNAi screen identifies novel targets of neratinib sensitivity leading to neratinib and paclitaxel combination drug treatments.

PubMed

Seyhan, Attila A; Varadarajan, Usha; Choe, Sung; Liu, Yan; McGraw, John; Woods, Matthew; Murray, Stuart; Eckert, Amy; Liu, Wei; Ryan, Terence E

2011-06-01

ErbB2 is frequently activated in tumors, and influences a wide array of cellular functions, including proliferation, apoptosis, cell motility and adhesion. HKI-272 (neratinib) is a small molecule pan-kinase inhibitor of the ErbB family of receptor tyrosine kinases, and shows strong antiproliferative activity in ErbB2-overexpressing breast cancer cells. We undertook a genome-wide pooled lentiviral RNAi screen to identify synthetic lethal or enhancer (synthetic modulator screen) genes that interact with neratinib in a human breast cancer cell line (SKBR-3). These genes upon knockdown would modulate cell viability in the presence of subeffective concentrations of neratinib. We discovered a diverse set of genes whose depletion selectively impaired or enhanced the viability of SKBR-3 cells in the presence of neratinib. We observed diverse pathways including EGFR, hypoxia, cAMP, and protein ubiquitination that, when co-treated with RNAi and neratinib, resulted in arrest of cell proliferation. Examining the changes of these genes and their protein products also led to a rationale for clinically relevant drug combination treatments. Treatment of cells with either paclitaxel or cytarabine in combination with neratinib resulted in a strong antiproliferative effect. The identification of novel mediators of cellular response to neratinib and the development of potential drug combination treatments have expanded our understanding of neratinib's mode-of-action for the development of more effective therapeutic regimens. Notably, our findings support a paclitaxel and neratinib phase III clinical trial in breast cancer patients.

RNAi-Mediated Gene Silencing in a Gonad Organ Culture to Study Sex Determination Mechanisms in Sea Turtle.

PubMed

Sifuentes-Romero, Itzel; Merchant-Larios, Horacio; Milton, Sarah L; Moreno-Mendoza, Norma; Díaz-Hernández, Verónica; García-Gasca, Alejandra

2013-06-07

The autosomal Sry-related gene, Sox9, encodes a transcription factor, which performs an important role in testis differentiation in mammals. In several reptiles, Sox9 is differentially expressed in gonads, showing a significant upregulation during the thermo-sensitive period (TSP) at the male-promoting temperature, consistent with the idea that SOX9 plays a central role in the male pathway. However, in spite of numerous studies, it remains unclear how SOX9 functions during this event. In the present work, we developed an RNAi-based method for silencing Sox9 in an in vitro gonad culture system for the sea turtle, Lepidochelys olivacea. Gonads were dissected as soon as the embryos entered the TSP and were maintained in organ culture. Transfection of siRNA resulted in the decrease of both Sox9 mRNA and protein. Furthermore, we found coordinated expression patterns for Sox9 and the anti-Müllerian hormone gene, Amh, suggesting that SOX9 could directly or indirectly regulate Amh expression, as it occurs in mammals. These results demonstrate an in vitro method to knockdown endogenous genes in gonads from a sea turtle, which represents a novel approach to investigate the roles of important genes involved in sex determination or differentiation pathways in species with temperature-dependent sex determination.

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

PubMed Central

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

Knockdown of Mediator Complex Subunit 19 Suppresses the Growth and Invasion of Prostate Cancer Cells

PubMed Central

Zhao, Hongwei; Lv, Wei; Chen, Jian; Wan, Fengchun; Liu, Dongfu; Gao, Zhenli; Wu, Jitao

2017-01-01

Prostate cancer (PCa) is one of the most common cancers in elderly men. Mediator Complex Subunit 19 (Med19) is overexpressed and plays promotional roles in many cancers. However, the roles of Med19 in PCa are still obscure. In this study, by using immunohistochemical staining, we found higher expression level of Med19 in PCa tissues than in adjacent benign prostate tissues. We then knocked down the Med19 expression in PCa cell lines LNCaP and PC3 by using lentivirus siRNA. Cell proliferation, anchor-independent growth, migration, and invasion were suppressed in Med19 knockdown PCa cells. In nude mice xenograft model, we found that Med19 knockdown PCa cells formed smaller tumors with lower proliferation index than did control cells. In the mechanism study, we found that Med19 could regulate genes involved in cell proliferation, cell cycle, and epithelial-mesenchymal transition, including P27, pAKT, pPI3K, IGF1R, E-Cadherin, N-Cadherin, Vimentin, ZEB2, Snail-1 and Snail-2. Targeting Med19 in PCa cells could inhibit the PCa growth and metastasis, and might be a therapeutic option for PCa in the future. PMID:28125713

The unique GGA clathrin adaptor of Drosophila melanogaster is not essential.

PubMed

Luan, Shan; Ilvarsonn, Anne M; Eissenberg, Joel C

2012-01-01

The Golgi-localized, γ-ear-containing, ARF binding proteins (GGAs) are a highly conserved family of monomeric clathrin adaptor proteins implicated in clathrin-mediated protein sorting between the trans-Golgi network and endosomes. GGA RNAi knockdowns in Drosophila have resulted in conflicting data concerning whether the Drosophila GGA (dGGA) is essential. The goal of this study was to define the null phenotype for the unique Drosophila GGA. We describe two independently derived dGGA mutations. Neither allele expresses detectable dGGA protein. Homozygous and hemizygous flies with each allele are viable and fertile. In contrast to a previous report using RNAi knockdown, GGA mutant flies show no evidence of age-dependent retinal degeneration or cathepsin missorting. Our results demonstrate that several of the previous RNAi knockdown phenotypes were the result of off-target effects. However, GGA null flies are hypersensitive to dietary chloroquine and to starvation, implicating GGA in lysosomal function and autophagy.

Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity

PubMed Central

Bayne, Elizabeth H.; White, Sharon A.; Kagansky, Alexander; Bijos, Dominika A.; Sanchez-Pulido, Luis; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Ponting, Chris P.; Rappsilber, Juri; Allshire, Robin C.

2010-01-01

Summary In fission yeast, RNAi directs heterochromatin formation at centromeres, telomeres, and the mating type locus. Noncoding RNAs transcribed from repeat elements generate siRNAs that are incorporated into the Argonaute-containing RITS complex and direct it to nascent homologous transcripts. This leads to recruitment of the CLRC complex, including the histone methyltransferase Clr4, promoting H3K9 methylation and heterochromatin formation. A key question is what mediates the recruitment of Clr4/CLRC to transcript-bound RITS. We have identified a LIM domain protein, Stc1, that is required for centromeric heterochromatin integrity. Our analyses show that Stc1 is specifically required to establish H3K9 methylation via RNAi, and interacts both with the RNAi effector Ago1, and with the chromatin-modifying CLRC complex. Moreover, tethering Stc1 to a euchromatic locus is sufficient to induce silencing and heterochromatin formation independently of RNAi. We conclude that Stc1 associates with RITS on centromeric transcripts and recruits CLRC, thereby coupling RNAi to chromatin modification. PMID:20211136

AAV2 production with optimized N/P ratio and PEI-mediated transfection results in low toxicity and high titer for in vitro and in vivo applications.

PubMed

Huang, Xinping; Hartley, Antja-Voy; Yin, Yishi; Herskowitz, Jeremy H; Lah, James J; Ressler, Kerry J

2013-11-01

The adeno-associated virus (AAV) is one of the most useful viral vectors for gene delivery for both in vivo and in vitro applications. A variety of methods have been established to produce and characterize recombinant AAV (rAAV) vectors; however most methods are quite cumbersome and obtaining consistently high titer can be problematic. This protocol describes a triple-plasmid co-transfection approach with 25 kDa linear polyethylenimine (PEI) in 293 T cells for the production of AAV serotype 2. Seventy-two hours post-transfection, supernatant and cells were harvested and purified by a discontinuous iodixanol density gradient ultracentrifugation, then dialyzed and concentrated with an Amicon 15 100,000 MWCO concentration unit. To optimize the protocol for AAV2 production using PEI, various N/P ratios and DNA amounts were compared. We found that an N/P ratio of 40 coupled with 1.05 μg DNA per ml of media (21 μg DNA/15 cm dish) was found to produce the highest yields for viral replication and assembly measured multiple ways. The infectious units, as determined by serial dilution, were between 1×10(8) and 2×10(9) IU/ml. The genomic titer of the viral stock was determined by qPCR and ranged from 2×10(12) to 6×10(13) VG/ml. These viral vectors showed high expression both in vivo within the brain and in vitro in cell culture. The use of linear 25 kDa polyethylenamine PEI as a transfection reagent is a simple, more cost-effective, and stable means of high-throughput production of high-titer AAV serotype 2. The use of PEI also eliminates the need to change cell medium post-transfection, lowering cost and workload, while producing high-titer, efficacious AAV2 vectors for routine gene transfer. Copyright © 2013 Elsevier B.V. All rights reserved.

AAV Gene Therapy for MPS1-associated Corneal Blindness.

PubMed

Vance, Melisa; Llanga, Telmo; Bennett, Will; Woodard, Kenton; Murlidharan, Giridhar; Chungfat, Neil; Asokan, Aravind; Gilger, Brian; Kurtzberg, Joanne; Samulski, R Jude; Hirsch, Matthew L

2016-02-22

Although cord blood transplantation has significantly extended the lifespan of mucopolysaccharidosis type 1 (MPS1) patients, over 95% manifest cornea clouding with about 50% progressing to blindness. As corneal transplants are met with high rejection rates in MPS1 children, there remains no treatment to prevent blindness or restore vision in MPS1 children. Since MPS1 is caused by mutations in idua, which encodes alpha-L-iduronidase, a gene addition strategy to prevent, and potentially reverse, MPS1-associated corneal blindness was investigated. Initially, a codon optimized idua cDNA expression cassette (opt-IDUA) was validated for IDUA production and function following adeno-associated virus (AAV) vector transduction of MPS1 patient fibroblasts. Then, an AAV serotype evaluation in human cornea explants identified an AAV8 and 9 chimeric capsid (8G9) as most efficient for transduction. AAV8G9-opt-IDUA administered to human corneas via intrastromal injection demonstrated widespread transduction, which included cells that naturally produce IDUA, and resulted in a >10-fold supraphysiological increase in IDUA activity. No significant apoptosis related to AAV vectors or IDUA was observed under any conditions in both human corneas and MPS1 patient fibroblasts. The collective preclinical data demonstrate safe and efficient IDUA delivery to human corneas, which may prevent and potentially reverse MPS1-associated cornea blindness.

AAV Gene Therapy for MPS1-associated Corneal Blindness

PubMed Central

Vance, Melisa; Llanga, Telmo; Bennett, Will; Woodard, Kenton; Murlidharan, Giridhar; Chungfat, Neil; Asokan, Aravind; Gilger, Brian; Kurtzberg, Joanne; Samulski, R. Jude; Hirsch, Matthew L.

2016-01-01

Although cord blood transplantation has significantly extended the lifespan of mucopolysaccharidosis type 1 (MPS1) patients, over 95% manifest cornea clouding with about 50% progressing to blindness. As corneal transplants are met with high rejection rates in MPS1 children, there remains no treatment to prevent blindness or restore vision in MPS1 children. Since MPS1 is caused by mutations in idua, which encodes alpha-L-iduronidase, a gene addition strategy to prevent, and potentially reverse, MPS1-associated corneal blindness was investigated. Initially, a codon optimized idua cDNA expression cassette (opt-IDUA) was validated for IDUA production and function following adeno-associated virus (AAV) vector transduction of MPS1 patient fibroblasts. Then, an AAV serotype evaluation in human cornea explants identified an AAV8 and 9 chimeric capsid (8G9) as most efficient for transduction. AAV8G9-opt-IDUA administered to human corneas via intrastromal injection demonstrated widespread transduction, which included cells that naturally produce IDUA, and resulted in a >10-fold supraphysiological increase in IDUA activity. No significant apoptosis related to AAV vectors or IDUA was observed under any conditions in both human corneas and MPS1 patient fibroblasts. The collective preclinical data demonstrate safe and efficient IDUA delivery to human corneas, which may prevent and potentially reverse MPS1-associated cornea blindness. PMID:26899286

RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem

PubMed Central

Arias, Renée S.; Dang, Phat M.; Sobolev, Victor S.

2015-01-01

The Food and Agriculture Organization of the United Nations estimates that 25% of the food crops in the world are contaminated with aflatoxins. That represents 100 million tons of food being destroyed or diverted to non-human consumption each year. Aflatoxins are powerful carcinogens normally accumulated by the fungi Aspergillus flavus and A. parasiticus in cereals, nuts, root crops and other agricultural products. Silencing of five aflatoxin-synthesis genes by RNA interference (RNAi) in peanut plants was used to control aflatoxin accumulation following inoculation with A. flavus. Previously, no method existed to analyze the effectiveness of RNAi in individual peanut transgenic events, as these usually produce few seeds, and traditional methods of large field experiments under aflatoxin-conducive conditions were not an option. In the field, the probability of finding naturally contaminated seeds is often 1/100 to 1/1,000. In addition, aflatoxin contamination is not uniformly distributed. Our method uses few seeds per transgenic event, with small pieces processed for real-time PCR (RT-PCR) or small RNA sequencing, and for analysis of aflatoxin accumulation by ultra-performance liquid chromatography (UPLC). RNAi-expressing peanut lines 288-72 and 288-74, showed up to 100% reduction (p≤0.01) in aflatoxin B1 and B2 compared to the control that accumulated up to 14,000 ng.g-1 of aflatoxin B1 when inoculated with aflatoxigenic A. flavus. As reference, the maximum total of aflatoxins allowable for human consumption in the United States is 20 ng.g-1. This protocol describes the application of RNAi-mediated control of aflatoxins in transgenic peanut seeds and methods for its evaluation. We believe that its application in breeding of peanut and other crops will bring rapid advancement in this important area of science, medicine and human nutrition, and will significantly contribute to the international effort to control aflatoxins, and potentially other mycotoxins in major

RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem.

PubMed

Arias, Renée S; Dang, Phat M; Sobolev, Victor S

2015-12-21

The Food and Agriculture Organization of the United Nations estimates that 25% of the food crops in the world are contaminated with aflatoxins. That represents 100 million tons of food being destroyed or diverted to non-human consumption each year. Aflatoxins are powerful carcinogens normally accumulated by the fungi Aspergillus flavus and A. parasiticus in cereals, nuts, root crops and other agricultural products. Silencing of five aflatoxin-synthesis genes by RNA interference (RNAi) in peanut plants was used to control aflatoxin accumulation following inoculation with A. flavus. Previously, no method existed to analyze the effectiveness of RNAi in individual peanut transgenic events, as these usually produce few seeds, and traditional methods of large field experiments under aflatoxin-conducive conditions were not an option. In the field, the probability of finding naturally contaminated seeds is often 1/100 to 1/1,000. In addition, aflatoxin contamination is not uniformly distributed. Our method uses few seeds per transgenic event, with small pieces processed for real-time PCR (RT-PCR) or small RNA sequencing, and for analysis of aflatoxin accumulation by ultra-performance liquid chromatography (UPLC). RNAi-expressing peanut lines 288-72 and 288-74, showed up to 100% reduction (p ≤ 0.01) in aflatoxin B1 and B2 compared to the control that accumulated up to 14,000 ng · g(-1) of aflatoxin B1 when inoculated with aflatoxigenic A. flavus. As reference, the maximum total of aflatoxins allowable for human consumption in the United States is 20 ng · g(-1). This protocol describes the application of RNAi-mediated control of aflatoxins in transgenic peanut seeds and methods for its evaluation. We believe that its application in breeding of peanut and other crops will bring rapid advancement in this important area of science, medicine and human nutrition, and will significantly contribute to the international effort to control aflatoxins, and potentially other

Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response.

PubMed

Manno, Catherine S; Pierce, Glenn F; Arruda, Valder R; Glader, Bertil; Ragni, Margaret; Rasko, John J; Rasko, John; Ozelo, Margareth C; Hoots, Keith; Blatt, Philip; Konkle, Barbara; Dake, Michael; Kaye, Robin; Razavi, Mahmood; Zajko, Albert; Zehnder, James; Rustagi, Pradip K; Nakai, Hiroyuki; Chew, Amy; Leonard, Debra; Wright, J Fraser; Lessard, Ruth R; Sommer, Jürg M; Tigges, Michael; Sabatino, Denise; Luk, Alvin; Jiang, Haiyan; Mingozzi, Federico; Couto, Linda; Ertl, Hildegund C; High, Katherine A; Kay, Mark A

2006-03-01

We have previously shown that a single portal vein infusion of a recombinant adeno-associated viral vector (rAAV) expressing canine Factor IX (F.IX) resulted in long-term expression of therapeutic levels of F.IX in dogs with severe hemophilia B. We carried out a phase 1/2 dose-escalation clinical study to extend this approach to humans with severe hemophilia B. rAAV-2 vector expressing human F.IX was infused through the hepatic artery into seven subjects. The data show that: (i) vector infusion at doses up to 2 x 10(12) vg/kg was not associated with acute or long-lasting toxicity; (ii) therapeutic levels of F.IX were achieved at the highest dose tested; (iii) duration of expression at therapeutic levels was limited to a period of approximately 8 weeks; (iv) a gradual decline in F.IX was accompanied by a transient asymptomatic elevation of liver transaminases that resolved without treatment. Further studies suggested that destruction of transduced hepatocytes by cell-mediated immunity targeting antigens of the AAV capsid caused both the decline in F.IX and the transient transaminitis. We conclude that rAAV-2 vectors can transduce human hepatocytes in vivo to result in therapeutically relevant levels of F.IX, but that future studies in humans may require immunomodulation to achieve long-term expression.

New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing.

PubMed

Koch, Aline; Kogel, Karl-Heinz

2014-09-01

RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Design and assembly of new non-viral RNAi delivery agents by microwave-assisted quaternization (MAQ) of tertiary amines

PubMed Central

Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.

2010-01-01

RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369

Environmental RNAi in herbivorous insects.

PubMed

Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R

2015-05-01

Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

si-RNA-mediated knockdown of PDLIM5 suppresses gastric cancer cell proliferation in vitro.

PubMed

Li, Yanliang; Gao, Yongsheng; Xu, Yue; Sun, Xianjun; Song, Xilin; Ma, Heng; Yang, Mingshan

2015-04-01

Gastric cancer is the second most prominent cause of cancer mortality in the world. This study was designed to identify the possible use of si-RNA-mediated PDLIM5 gene silencing as a therapeutic tool for gastric cancer. Expression levels of PDLIM5 were detected in several gastric cancer cell lines using Western blot and qRT-PCR. We found PDLIM5 is highly expressed in all cultured gastric cancer cell lines. Small interfering RNA (si-RNA) was then employed to knock down PDLIM5 expression in MGC80-3 gastric cancer cells. Knockdown of PDLIM5 significantly inhibited cell proliferation and colony formation. Moreover, the absence of PDLIM5 in MGC80-3 cells led to S phase cell cycle arrest and apoptosis. This study highlights the critical role of PDLIM5 in gastric cancer cell growth and suggests that si-RNA-mediated silencing of PDLIM5 might serve as a potential therapeutic approach for the treatment of gastric cancer. © 2014 John Wiley & Sons A/S.

Promise and problems associated with the use of recombinant AAV for the delivery of anti-HIV antibodies

PubMed Central

Fuchs, Sebastian P; Desrosiers, Ronald C

2016-01-01

Attempts to elicit antibodies with potent neutralizing activity against a broad range of human immunodeficiency virus (HIV) isolates have so far proven unsuccessful. Long-term delivery of monoclonal antibodies (mAbs) with such activity is a creative alternative that circumvents the need for an immune response and has the potential for creating a long-lasting sterilizing barrier against HIV. This approach is made possible by an incredible array of potent broadly neutralizing antibodies (bnAbs) that have been identified over the last several years. Recombinant adeno-associated virus (rAAV) vectors are ideally suited for long-term delivery for a variety of reasons. The only products made from rAAV are derived from the transgenes that are put into it; as long as those products are not viewed as foreign, expression from muscle tissue may continue for decades. Thus, use of rAAV to achieve long-term delivery of anti-HIV mAbs with potent neutralizing activity against a broad range of HIV-1 isolates is emerging as a promising concept for the prevention or treatment of HIV-1 infection in humans. Experiments in mice and monkeys that have demonstrated protective efficacy against AIDS virus infection have raised hopes for the promise of this approach. However, all published experiments in monkeys have encountered unwanted immune responses to the AAV-delivered antibody, and these immune responses appear to limit the levels of delivered antibody that can be achieved. In this review, we highlight the promise of rAAV-mediated antibody delivery for the prevention or treatment of HIV infection in humans, but we also discuss the obstacles that will need to be understood and solved in order for the promise of this approach to be realized. PMID:28197421

Towards the elements of successful insect RNAi.

PubMed

Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E

2013-12-01

RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.

Knockdown of a Rice Stelar Nitrate Transporter Alters Long-Distance Translocation But Not Root Influx1[W][OA

PubMed Central

Tang, Zhong; Fan, Xiaorong; Li, Qing; Feng, Huimin; Miller, Anthony J.; Shen, Qirong; Xu, Guohua

2012-01-01

Root nitrate uptake is well known to adjust to the plant’s nitrogen demand for growth. Long-distance transport and/or root storage pools are thought to provide negative feedback signals regulating root uptake. We have characterized a vascular specific nitrate transporter belonging to the high-affinity Nitrate Transporter2 (NRT2) family, OsNRT2.3a, in rice (Oryza sativa ssp. japonica ‘Nipponbare’). Localization analyses using protoplast expression, in planta promoter-β-glucuronidase assay, and in situ hybridization showed that OsNRT2.3a was located in the plasma membrane and mainly expressed in xylem parenchyma cells of the stele of nitrate-supplied roots. Knockdown expression of OsNRT2.3a by RNA interference (RNAi) had impaired xylem loading of nitrate and decreased plant growth at low (0.5 mm) nitrate supply. In comparison with the wild type, the RNAi lines contained both nitrate and total nitrogen significantly higher in the roots and lower in the shoots. The short-term [15N]NO3− influx (5 min) in entire roots and NO3− fluxes in root surfaces showed that the knockdown of OsNRT2.3a in comparison with the wild type did not affect nitrate uptake by roots. The RNAi plants showed no significant changes in the expression of some root nitrate transporters (OsNRT2.3b, OsNRT2.4, and OsNAR2.1), but transcripts for nia1 (nitrate reductase) had increased and OsNRT2.1 and OsNRT2.2 had decreased when the plants were supplied with nitrate. Taken together, the data demonstrate that OsNRT2.3a plays a key role in long-distance nitrate transport from root to shoot at low nitrate supply level in rice. PMID:23093362

Systemic injection of AAV9 carrying a periostin promoter targets gene expression to a myofibroblast-like lineage in mouse hearts after reperfused myocardial infarction.

PubMed

Piras, B A; Tian, Y; Xu, Y; Thomas, N A; O'Connor, D M; French, B A

2016-05-01

Adeno-associated virus (AAV) has been used to direct gene transfer to a variety of tissues, including heart, liver, skeletal muscle, brain, kidney and lung, but it has not previously been shown to effectively target fibroblasts in vivo, including cardiac fibroblasts. We constructed expression cassettes using a modified periostin promoter to drive gene expression in a cardiac myofibroblast-like lineage, with only occasional spillover into cardiomyocyte-like cells. We compared AAV serotypes 6 and 9 and found robust gene expression when the vectors were delivered by systemic injection after myocardial infarction (MI), with little expression in healthy, non-infarcted mice. AAV9 provided expression in a greater number of cells than AAV6, with reporter gene expression visible in the cardiac infarct and border zones from 5 to 62 days post MI, as assessed by luciferase and Cre-activated green fluorescent protein expression. Although common myofibroblast markers were expressed in low abundance, most of the targeted cells expressed myosin IIb, an embryonic form of smooth muscle myosin heavy chain that has previously been associated with myofibroblasts after reperfused MI. This study is the first to demonstrate AAV-mediated expression in a potentially novel myofibroblast-like lineage in mouse hearts post MI and may open new avenues of gene therapy to treat patients surviving MI.

Cell Cycle-Dependent Expression of Adeno-Associated Virus 2 (AAV2) Rep in Coinfections with Herpes Simplex Virus 1 (HSV-1) Gives Rise to a Mosaic of Cells Replicating either AAV2 or HSV-1

PubMed Central

Franzoso, Francesca D.; Seyffert, Michael; Vogel, Rebecca; Yakimovich, Artur; de Andrade Pereira, Bruna; Meier, Anita F.; Sutter, Sereina O.; Tobler, Kurt; Vogt, Bernd; Greber, Urs F.; Büning, Hildegard; Ackermann, Mathias

2017-01-01

ABSTRACT Adeno-associated virus 2 (AAV2) depends on the simultaneous presence of a helper virus such as herpes simplex virus 1 (HSV-1) for productive replication. At the same time, AAV2 efficiently blocks the replication of HSV-1, which would eventually limit its own replication by diminishing the helper virus reservoir. This discrepancy begs the question of how AAV2 and HSV-1 can coexist in a cell population. Here we show that in coinfected cultures, AAV2 DNA replication takes place almost exclusively in S/G2-phase cells, while HSV-1 DNA replication is restricted to G1 phase. Live microscopy revealed that not only wild-type AAV2 (wtAAV2) replication but also reporter gene expression from both single-stranded and double-stranded (self-complementary) recombinant AAV2 vectors preferentially occurs in S/G2-phase cells, suggesting that the preference for S/G2 phase is independent of the nature of the viral genome. Interestingly, however, a substantial proportion of S/G2-phase cells transduced by the double-stranded but not the single-stranded recombinant AAV2 vectors progressed through mitosis in the absence of the helper virus. We conclude that cell cycle-dependent AAV2 rep expression facilitates cell cycle-dependent AAV2 DNA replication and inhibits HSV-1 DNA replication. This may limit competition for cellular and viral helper factors and, hence, creates a biological niche for either virus to replicate. IMPORTANCE Adeno-associated virus 2 (AAV2) differs from most other viruses, as it requires not only a host cell for replication but also a helper virus such as an adenovirus or a herpesvirus. This situation inevitably leads to competition for cellular resources. AAV2 has been shown to efficiently inhibit the replication of helper viruses. Here we present a new facet of the interaction between AAV2 and one of its helper viruses, herpes simplex virus 1 (HSV-1). We observed that AAV2 rep gene expression is cell cycle dependent and gives rise to distinct time

RNAi Screening in Spodoptera frugiperda.

PubMed

Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

2016-01-01

RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

A Translational Pathway Toward a Clinical Trial Using the Second-Generation AAV Micro Dystrophin Vector

DTIC Science & Technology

2017-09-01

future experimental therapeutic studies in the canine model such as CRISPR -mediated gene editing, stem cell therapy, dystrophin-independent disease...There is no scientific/budget overlap with the current proposal.) CRISPR /Cas9-based gene editing for the correction of Duchenne muscular dystrophy...lab will perform in vivo gene delivery and functional outcome measurements in mice treated by AAV- CRISPR gene repair vectors and if needed will also

Evaluation of AAV-mediated Gene Therapy for Central Nervous System Disease in Canine Mucopolysaccharidosis VII

PubMed Central

Gurda, Brittney L; De Guilhem De Lataillade, Adrien; Bell, Peter; Zhu, Yanqing; Yu, Hongwei; Wang, Ping; Bagel, Jessica; Vite, Charles H; Sikora, Tracey; Hinderer, Christian; Calcedo, Roberto; Yox, Alexander D; Steet, Richard A; Ruane, Therese; O'Donnell, Patricia; Gao, Guangping; Wilson, James M; Casal, Margret; Ponder, Katherine P; Haskins, Mark E

2016-01-01

Mucopolysaccharidosis VII (MPS VII) is a lysosomal storage disease arising from mutations in β-d-glucuronidase (GUSB), which results in glycosaminoglycan (GAG) accumulation and a variety of clinical manifestations including neurological disease. Herein, MPS VII dogs were injected intravenously (i.v.) and/or intrathecally (i.t.) via the cisterna magna with AAV9 or AAVrh10 vectors carrying the canine GUSB cDNA. Although i.v. injection alone at 3 days of age resulted in normal cerebrospinal fluid (CSF) GUSB activity, brain tissue homogenates had only ~1 to 6% normal GUSB activity and continued to have elevated GAG storage. In contrast, i.t. injection at 3 weeks of age resulted in CSF GUSB activity 44-fold normal while brain tissue homogenates had >100% normal GUSB activity and reduced GAGs compared with untreated dogs. Markers for secondary storage and inflammation were eliminated in i.t.-treated dogs and reduced in i.v.-treated dogs compared with untreated dogs. Given that i.t.-treated dogs expressed higher levels of GUSB in the CNS tissues compared to those treated i.v., we conclude that i.t. injection of AAV9 or AAVrh10 vectors is more effective than i.v. injection alone in the large animal model of MPS VII. PMID:26447927

Systemic AAV8-Mediated Gene Therapy Drives Whole-Body Correction of Myotubular Myopathy in Dogs.

PubMed

Mack, David L; Poulard, Karine; Goddard, Melissa A; Latournerie, Virginie; Snyder, Jessica M; Grange, Robert W; Elverman, Matthew R; Denard, Jérôme; Veron, Philippe; Buscara, Laurine; Le Bec, Christine; Hogrel, Jean-Yves; Brezovec, Annie G; Meng, Hui; Yang, Lin; Liu, Fujun; O'Callaghan, Michael; Gopal, Nikhil; Kelly, Valerie E; Smith, Barbara K; Strande, Jennifer L; Mavilio, Fulvio; Beggs, Alan H; Mingozzi, Federico; Lawlor, Michael W; Buj-Bello, Ana; Childers, Martin K

2017-04-05

X-linked myotubular myopathy (XLMTM) results from MTM1 gene mutations and myotubularin deficiency. Most XLMTM patients develop severe muscle weakness leading to respiratory failure and death, typically within 2 years of age. Our objective was to evaluate the efficacy and safety of systemic gene therapy in the p.N155K canine model of XLMTM by performing a dose escalation study. A recombinant adeno-associated virus serotype 8 (rAAV8) vector expressing canine myotubularin (cMTM1) under the muscle-specific desmin promoter (rAAV8-cMTM1) was administered by simple peripheral venous infusion in XLMTM dogs at 10 weeks of age, when signs of the disease are already present. A comprehensive analysis of survival, limb strength, gait, respiratory function, neurological assessment, histology, vector biodistribution, transgene expression, and immune response was performed over a 9-month study period. Results indicate that systemic gene therapy was well tolerated, prolonged lifespan, and corrected the skeletal musculature throughout the body in a dose-dependent manner, defining an efficacious dose in this large-animal model of the disease. These results support the development of gene therapy clinical trials for XLMTM. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Evaluation of AAV-mediated Gene Therapy for Central Nervous System Disease in Canine Mucopolysaccharidosis VII.

PubMed

Gurda, Brittney L; De Guilhem De Lataillade, Adrien; Bell, Peter; Zhu, Yanqing; Yu, Hongwei; Wang, Ping; Bagel, Jessica; Vite, Charles H; Sikora, Tracey; Hinderer, Christian; Calcedo, Roberto; Yox, Alexander D; Steet, Richard A; Ruane, Therese; O'Donnell, Patricia; Gao, Guangping; Wilson, James M; Casal, Margret; Ponder, Katherine P; Haskins, Mark E

2016-02-01

Mucopolysaccharidosis VII (MPS VII) is a lysosomal storage disease arising from mutations in β-d-glucuronidase (GUSB), which results in glycosaminoglycan (GAG) accumulation and a variety of clinical manifestations including neurological disease. Herein, MPS VII dogs were injected intravenously (i.v.) and/or intrathecally (i.t.) via the cisterna magna with AAV9 or AAVrh10 vectors carrying the canine GUSB cDNA. Although i.v. injection alone at 3 days of age resulted in normal cerebrospinal fluid (CSF) GUSB activity, brain tissue homogenates had only ~1 to 6% normal GUSB activity and continued to have elevated GAG storage. In contrast, i.t. injection at 3 weeks of age resulted in CSF GUSB activity 44-fold normal while brain tissue homogenates had >100% normal GUSB activity and reduced GAGs compared with untreated dogs. Markers for secondary storage and inflammation were eliminated in i.t.-treated dogs and reduced in i.v.-treated dogs compared with untreated dogs. Given that i.t.-treated dogs expressed higher levels of GUSB in the CNS tissues compared to those treated i.v., we conclude that i.t. injection of AAV9 or AAVrh10 vectors is more effective than i.v. injection alone in the large animal model of MPS VII.

Bi-directional gap junction-mediated soma-germline communication is essential for spermatogenesis.

PubMed

Smendziuk, Christopher M; Messenberg, Anat; Vogl, A Wayne; Tanentzapf, Guy

2015-08-01

Soma-germline interactions play conserved essential roles in regulating cell proliferation, differentiation, patterning and homeostasis in the gonad. In the Drosophila testis, secreted signalling molecules of the JAK-STAT, Hedgehog, BMP and EGF pathways are used to mediate soma-germline communication. Here, we demonstrate that gap junctions may also mediate direct, bi-directional signalling between the soma and germ line. When gap junctions between the soma and germ line are disrupted, germline differentiation is blocked and germline stem cells are not maintained. In the soma, gap junctions are required to regulate proliferation and differentiation. Localization and RNAi-mediated knockdown studies reveal that gap junctions in the fly testis are heterotypic channels containing Zpg (Inx4) and Inx2 on the germ line and the soma side, respectively. Overall, our results show that bi-directional gap junction-mediated signalling is essential to coordinate the soma and germ line to ensure proper spermatogenesis in Drosophila. Moreover, we show that stem cell maintenance and differentiation in the testis are directed by gap junction-derived cues. © 2015. Published by The Company of Biologists Ltd.

Knockdown of nuclease activity in the gut enhances RNAi efficiency in the Colorado potato beetle, Leptinotarsa decemlineata, but not in the desert locust, Schistocerca gregaria.

PubMed

Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef

2017-02-01

The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

PubMed Central

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

PubMed

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

scAAV-Mediated IL-1Ra gene delivery for the Treatment of Osteoarthritis: Test of Efficacy in an Equine Model.

PubMed

Watson Levings, Rachael; Smith, Andrew D; Broome, Ted A; Rice, Brett L; Gibbs, Eric P; Myara, D Alex; Hyddmark, Viktoria; Nasri, Elham; Zarezadeh, Ali; Levings, Padraic P; Lu, Yuan; Dacanay, E Anthony; Foremny, Gregory B; Evans, Christopher H; Morton, Alison J; Winter, Mathew; Dark, Michael J; Nickerson, David M; Colahan, Patrick T; Ghivizzani, Steven Craig

2018-06-05

We are investigating self-complementary adeno-associated virus (scAAV) as a vector for intra-articular gene-delivery of IL-1Ra, and its therapeutic capacity in the treatment of osteoarthritis (OA). To model gene-transfer on a scale proportional to the human knee, a frequent site of OA incidence, we focused our studies on the joints of the equine forelimb. Using AAV2.5 capsid and equine IL-1Ra as a homologous transgene, we previously identified a functional ceiling dose of ~5 x 1012 viral genomes, which elevated the steady state levels of eqIL-1Ra in synovial fluids by more than 40-fold over endogenous production for at least 6 months. Here, using an osteochondral fragmentation model of early OA, we examined the functional capacity of scAAV.IL-1Ra gene-delivery in equine joints over a period of 12 weeks. In the disease model, transgenic eqIL-1Ra expression was several-fold higher than seen previously in healthy joints, and correlated directly with the severity of joint pathology at the time of treatment. Despite wide variation in expression, the steady-state eqIL-1Ra in synovial fluids exceeded that of IL-1 by > 400-fold in all animals, and a consistent treatment effect was observed. This included a 30-40% reduction in lameness and ~25% improvement in total joint pathology by both MRI and arthroscopic assessments, which included reduced joint effusion and synovitis, and improved repair of the osteochondral lesion. No vector-related increase in eqIL-1Ra levels in blood or urine was noted. Cumulatively our studies in the equine model indicate scAAV.IL-1Ra administration is reasonably safe and capable of sustained therapeutic IL-1Ra production intra-articularly in joints of human scale. This profile supports consideration for human testing in OA.

Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems

PubMed Central

Chan, Ken Y; Jang, Min J; Yoo, Bryan B; Greenbaum, Alon; Ravi, Namita; Wu, Wei-Li; Sánchez-Guardado, Luis; Lois, Carlos; Mazmanian, Sarkis K; Deverman, Benjamin E; Gradinaru, Viviana

2017-01-01

Adeno-associated viruses (AAVs) are commonly used for in vivo gene transfer. Nevertheless, AAVs that provide efficient transduction across specific organs or cell populations are needed. Here, we describe AAV-PHP.eB and AAV-PHP.S, capsids that efficiently transduce the central and peripheral nervous systems, respectively. In the adult mouse, intravenous administration of 1×1011 vector genomes (vg) of AAV-PHP.eB transduced 69% of cortical and 55% of striatal neurons, while 1×1012 vg AAV-PHP.S transduced 82% of dorsal root ganglion neurons, as well as cardiac and enteric neurons. The efficiency of these vectors facilitates robust co-transduction and stochastic, multicolor labeling for individual cell morphology studies. To support such efforts, we provide methods for labeling a tunable fraction of cells without compromising color diversity. Furthermore, when used with cell type-specific promoters, these AAVs provide targeted gene expression across the nervous system and enable efficient and versatile gene manipulation throughout the nervous system of transgenic and non-transgenic animals. PMID:28671695

Roles of OA1 octopamine receptor and Dop1 dopamine receptor in mediating appetitive and aversive reinforcement revealed by RNAi studies

PubMed Central

Awata, Hiroko; Wakuda, Ryo; Ishimaru, Yoshiyasu; Matsuoka, Yuji; Terao, Kanta; Katata, Satomi; Matsumoto, Yukihisa; Hamanaka, Yoshitaka; Noji, Sumihare; Mito, Taro; Mizunami, Makoto

2016-01-01

Revealing reinforcing mechanisms in associative learning is important for elucidation of brain mechanisms of behavior. In mammals, dopamine neurons are thought to mediate both appetitive and aversive reinforcement signals. Studies using transgenic fruit-flies suggested that dopamine neurons mediate both appetitive and aversive reinforcements, through the Dop1 dopamine receptor, but our studies using octopamine and dopamine receptor antagonists and using Dop1 knockout crickets suggested that octopamine neurons mediate appetitive reinforcement and dopamine neurons mediate aversive reinforcement in associative learning in crickets. To fully resolve this issue, we examined the effects of silencing of expression of genes that code the OA1 octopamine receptor and Dop1 and Dop2 dopamine receptors by RNAi in crickets. OA1-silenced crickets exhibited impairment in appetitive learning with water but not in aversive learning with sodium chloride solution, while Dop1-silenced crickets exhibited impairment in aversive learning but not in appetitive learning. Dop2-silenced crickets showed normal scores in both appetitive learning and aversive learning. The results indicate that octopamine neurons mediate appetitive reinforcement via OA1 and that dopamine neurons mediate aversive reinforcement via Dop1 in crickets, providing decisive evidence that neurotransmitters and receptors that mediate appetitive reinforcement indeed differ among different species of insects. PMID:27412401

Roles of OA1 octopamine receptor and Dop1 dopamine receptor in mediating appetitive and aversive reinforcement revealed by RNAi studies.

PubMed

Awata, Hiroko; Wakuda, Ryo; Ishimaru, Yoshiyasu; Matsuoka, Yuji; Terao, Kanta; Katata, Satomi; Matsumoto, Yukihisa; Hamanaka, Yoshitaka; Noji, Sumihare; Mito, Taro; Mizunami, Makoto

2016-07-14

Revealing reinforcing mechanisms in associative learning is important for elucidation of brain mechanisms of behavior. In mammals, dopamine neurons are thought to mediate both appetitive and aversive reinforcement signals. Studies using transgenic fruit-flies suggested that dopamine neurons mediate both appetitive and aversive reinforcements, through the Dop1 dopamine receptor, but our studies using octopamine and dopamine receptor antagonists and using Dop1 knockout crickets suggested that octopamine neurons mediate appetitive reinforcement and dopamine neurons mediate aversive reinforcement in associative learning in crickets. To fully resolve this issue, we examined the effects of silencing of expression of genes that code the OA1 octopamine receptor and Dop1 and Dop2 dopamine receptors by RNAi in crickets. OA1-silenced crickets exhibited impairment in appetitive learning with water but not in aversive learning with sodium chloride solution, while Dop1-silenced crickets exhibited impairment in aversive learning but not in appetitive learning. Dop2-silenced crickets showed normal scores in both appetitive learning and aversive learning. The results indicate that octopamine neurons mediate appetitive reinforcement via OA1 and that dopamine neurons mediate aversive reinforcement via Dop1 in crickets, providing decisive evidence that neurotransmitters and receptors that mediate appetitive reinforcement indeed differ among different species of insects.

AAV-PHP.B-Mediated Global-Scale Expression in the Mouse Nervous System Enables GBA1 Gene Therapy for Wide Protection from Synucleinopathy.

PubMed

Morabito, Giuseppe; Giannelli, Serena G; Ordazzo, Gabriele; Bido, Simone; Castoldi, Valerio; Indrigo, Marzia; Cabassi, Tommaso; Cattaneo, Stefano; Luoni, Mirko; Cancellieri, Cinzia; Sessa, Alessandro; Bacigaluppi, Marco; Taverna, Stefano; Leocani, Letizia; Lanciego, José L; Broccoli, Vania

2017-12-06

The lack of technology for direct global-scale targeting of the adult mouse nervous system has hindered research on brain processing and dysfunctions. Currently, gene transfer is normally achieved by intraparenchymal viral injections, but these injections target a restricted brain area. Herein, we demonstrated that intravenous delivery of adeno-associated virus (AAV)-PHP.B viral particles permeated and diffused throughout the neural parenchyma, targeting both the central and the peripheral nervous system in a global pattern. We then established multiple procedures of viral transduction to control gene expression or inactivate gene function exclusively in the adult nervous system and assessed the underlying behavioral effects. Building on these results, we established an effective gene therapy strategy to counteract the widespread accumulation of α-synuclein deposits throughout the forebrain in a mouse model of synucleinopathy. Transduction of A53T-SCNA transgenic mice with AAV-PHP.B-GBA1 restored physiological levels of the enzyme, reduced α-synuclein pathology, and produced significant behavioral recovery. Finally, we provided evidence that AAV-PHP.B brain penetration does not lead to evident dysfunctions in blood-brain barrier integrity or permeability. Altogether, the AAV-PHP.B viral platform enables non-invasive, widespread, and long-lasting global neural expression of therapeutic genes, such as GBA1, providing an invaluable approach to treat neurodegenerative diseases with diffuse brain pathology such as synucleinopathies. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Efficient mouse airway transduction following recombination between AAV vectors carrying parts of a larger gene.

PubMed

Halbert, Christine L; Allen, James M; Miller, A Dusty

2002-07-01

The small packaging capacity of adeno-associated virus (AAV) vectors limits the utility of this promising vector system for transfer of large genes. We explored the possibility that larger genes could be reconstituted following homologous recombination between AAV vectors carrying overlapping gene fragments. An alkaline phosphatase (AP) gene was split between two such AAV vectors (rec vectors) and packaged using AAV2 or AAV6 capsid proteins. Rec vectors having either capsid protein recombined to express AP in cultured cells at about 1-2% of the rate observed for an intact vector. Surprisingly, the AAV6 rec vectors transduced lung cells in mice almost as efficiently as did an intact vector, with 10% of airway epithelial cells, the target for treatment of cystic fibrosis (CF), being positive. Thus AAV rec vectors may be useful for diseases such as CF that require transfer of large genes.

In vivo RNAi: Today and Tomorrow

PubMed Central

Perrimon, Norbert; Ni, Jian-Quan; Perkins, Lizabeth

2010-01-01

SUMMARY RNA interference (RNAi) provides a powerful reverse genetics approach to analyze gene functions both in tissue culture and in vivo. Because of its widespread applicability and effectiveness it has become an essential part of the tool box kits of model organisms such as Caenorhabditis elegans, Drosophila, and the mouse. In addition, the use of RNAi in animals in which genetic tools are either poorly developed or nonexistent enables a myriad of fundamental questions to be asked. Here, we review the methods and applications of in vivo RNAi to characterize gene functions in model organisms and discuss their impact to the study of developmental as well as evolutionary questions. Further, we discuss the applications of RNAi technologies to crop improvement, pest control and RNAi therapeutics, thus providing an appreciation of the potential for phenomenal applications of RNAi to agriculture and medicine. PMID:20534712

The ANCA Vasculitis Questionnaire (AAV-PRO©)

ClinicalTrials.gov

2017-05-01

Eosinophilic Granulomatosis With Polyangiitis (Churg-Strauss) (EGPA); Churg-Strauss Syndrome (CSS); Granulomatosis With Polyangiitis (Wegener's) (GPA); Wegener Granulomatosis (WG); Microscopic Polyangiitis (MPA); ANCA-Associated Vasculitis (AAV); Vasculitis

Intramuscular Adeno-Associated Virus-Mediated Expression of Monoclonal Antibodies Provides 100% Protection Against Ebola Virus Infection in Mice.

PubMed

van Lieshout, Laura P; Soule, Geoff; Sorensen, Debra; Frost, Kathy L; He, Shihua; Tierney, Kevin; Safronetz, David; Booth, Stephanie A; Kobinger, Gary P; Qiu, Xiangguo; Wootton, Sarah K

2018-03-05

The 2013-2016 West Africa outbreak demonstrated the epidemic potential of Ebola virus and highlighted the need for counter strategies. Monoclonal antibody (mAb)-based therapies hold promise as treatment options for Ebola virus infections. However, production of clinical-grade mAbs is labor intensive, and immunity is short lived. Conversely, adeno-associated virus (AAV)-mediated mAb gene transfer provides the host with a genetic blueprint to manufacture mAbs in vivo, leading to steady release of antibody over many months. Here we demonstrate that AAV-mediated expression of nonneutralizing mAb 5D2 or 7C9 confers 100% protection against mouse-adapted Ebola virus infection, while neutralizing mAb 2G4 was 83% protective. A 2-component cocktail, AAV-2G4/AAV-5D2, provided complete protection when administered 7 days prior to challenge and was partially protective with a 3-day lead time. Finally, AAV-mAb therapies provided sustained protection from challenge 5 months following AAV administration. AAV-mAb may be a viable alternative strategy for vaccination against emerging infectious diseases.

Knockdown of Lmo7 inhibits chick myogenesis.

PubMed

Possidonio, Ana C B; Soares, Carolina P; Fontenele, Marcio; Morris, Eduardo R; Mouly, Vincent; Costa, Manoel L; Mermelstein, Claudia

2016-02-01

The multifunctional protein Lmo7 has been implicated in some aspects of myogenesis in mammals. Here we studied the distribution and expression of Lmo7 and the effects of Lmo7 knockdown in primary cultures of chick skeletal muscle cells. Lmo7 was localized within the nuclei of myoblasts and at the perinuclear region of myotubes. Knockdown of Lmo7 using siRNA specific to chick reduces the number and width of myotubes and the number of MyoD positive-myoblasts. Both Wnt3a enriched medium and Bio, activators of the Wnt/beta-catenin pathway, could rescue the effects of the Lmo7 knockdown suggesting a crosstalk between the Wnt/beta-catenin and Lmo7-mediated signaling pathways. Our data shows a role of Lmo7 during the initial events of chick skeletal myogenesis, particularly in myoblast survival. © 2016 Federation of European Biochemical Societies.

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts

PubMed Central

Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek

2015-01-01

Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398

Promyelocytic Leukemia Protein Is a Cell-Intrinsic Factor Inhibiting Parvovirus DNA Replication

PubMed Central

Mitchell, Angela M.; Hirsch, Matthew L.; Li, Chengwen

2014-01-01

Tripartite motif proteins are important viral restriction factors and affect processes ranging from uncoating to transcription to immune signaling. Specifically, the promyelocytic leukemia protein (TRIM19; also called PML) is a viral restriction factor inhibiting processes from uncoating to transcription to cell survival. Here we investigated PML's effect on adeno-associated virus (AAV), a parvovirus used for gene delivery. Although dependovirus (AAV) and autonomous parvovirus (minute virus of mice) replication centers can colocalize with PML, PML's functional effect on parvoviruses is unknown. Using PML knockout mice, we determined that PML knockout enhances recombinant AAV2 (rAAV2) transduction at a range of vector doses in both male and female mice. In fact, male and female PML knockout mice exhibited up to 56-fold and 28-fold increases in transduction, respectively. PML inhibited several rAAV serotypes, suggesting a conserved mechanism, and organ specificity correlated with PML expression. Mechanistically, PML inhibited rAAV second-strand DNA synthesis, precluding inhibition of self-complementary rAAV, and did not affect the prior steps in transduction. Furthermore, we confirmed the effect of human PML on rAAV transduction through small interfering RNA (siRNA)-mediated knockdown in HuH7 cells and determined that the highest level of inhibition was due to effects of PML isoform II (PMLII). Overexpression of PMLII resulted in inhibition of second-strand synthesis, vector production, and genome replication. Moreover, wild-type AAV2 production and infectivity were also inhibited by PMLII, demonstrating a PML interaction with wild-type AAV. These data have important implications for AAV-mediated gene therapy. Additionally, PMLII inhibition of AAV second-strand synthesis and replication, which are processes necessary for all parvoviruses, suggests implications for replication of other parvoviruses. PMID:24198403

Promyelocytic leukemia protein is a cell-intrinsic factor inhibiting parvovirus DNA replication.

PubMed

Mitchell, Angela M; Hirsch, Matthew L; Li, Chengwen; Samulski, R Jude

2014-01-01

Tripartite motif proteins are important viral restriction factors and affect processes ranging from uncoating to transcription to immune signaling. Specifically, the promyelocytic leukemia protein (TRIM19; also called PML) is a viral restriction factor inhibiting processes from uncoating to transcription to cell survival. Here we investigated PML's effect on adeno-associated virus (AAV), a parvovirus used for gene delivery. Although dependovirus (AAV) and autonomous parvovirus (minute virus of mice) replication centers can colocalize with PML, PML's functional effect on parvoviruses is unknown. Using PML knockout mice, we determined that PML knockout enhances recombinant AAV2 (rAAV2) transduction at a range of vector doses in both male and female mice. In fact, male and female PML knockout mice exhibited up to 56-fold and 28-fold increases in transduction, respectively. PML inhibited several rAAV serotypes, suggesting a conserved mechanism, and organ specificity correlated with PML expression. Mechanistically, PML inhibited rAAV second-strand DNA synthesis, precluding inhibition of self-complementary rAAV, and did not affect the prior steps in transduction. Furthermore, we confirmed the effect of human PML on rAAV transduction through small interfering RNA (siRNA)-mediated knockdown in HuH7 cells and determined that the highest level of inhibition was due to effects of PML isoform II (PMLII). Overexpression of PMLII resulted in inhibition of second-strand synthesis, vector production, and genome replication. Moreover, wild-type AAV2 production and infectivity were also inhibited by PMLII, demonstrating a PML interaction with wild-type AAV. These data have important implications for AAV-mediated gene therapy. Additionally, PMLII inhibition of AAV second-strand synthesis and replication, which are processes necessary for all parvoviruses, suggests implications for replication of other parvoviruses.

siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

PubMed

Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

2018-07-01

The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

RNAi pathways in Mucor: A tale of proteins, small RNAs and functional diversity.

PubMed

Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M

2016-05-01

The existence of an RNA-mediated silencing mechanism in the opportunistic fungal pathogen Mucor circinelloides was first described in the early 2000. Since then, Mucor has reached an outstanding position within the fungal kingdom as a model system to achieve a deeper understanding of regulation of endogenous functions by the RNA interference (RNAi) machinery. M. circinelloides combines diverse components of its RNAi machinery to carry out functions not only limited to the defense against invasive nucleic acids, but also to regulate expression of its own genes by producing different classes of endogenous small RNA molecules (esRNAs). The recent discovery of a novel RNase that participates in a new RNA degradation pathway adds more elements to the gene silencing-mediated regulation. This review focuses on esRNAs in M. circinelloides, the different pathways involved in their biogenesis, and their roles in regulating specific physiological and developmental processes in response to environmental signals, highlighting the complexity of silencing-mediated regulation in fungi. Copyright © 2015 Elsevier Inc. All rights reserved.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

PubMed Central

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis

PubMed Central

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-01-01

SUMMARY The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used human Ago2 minimal RISC system to purify Sjögren’s syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. PMID:22055194

Application of Mutated miR-206 Target Sites Enables Skeletal Muscle-specific Silencing of Transgene Expression of Cardiotropic AAV9 Vectors

PubMed Central

Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry

2013-01-01

Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498

The insect ecdysone receptor is a good potential target for RNAi-based pest control.

PubMed

Yu, Rong; Xu, Xinping; Liang, Yongkang; Tian, Honggang; Pan, Zhanqing; Jin, Shouheng; Wang, Na; Zhang, Wenqing

2014-01-01

RNA interference (RNAi) has great potential for use in insect pest control. However, some significant challenges must be overcome before RNAi-based pest control can become a reality. One challenge is the proper selection of a good target gene for RNAi. Here, we report that the insect ecdysone receptor (EcR) is a good potential target for RNAi-based pest control in the brown planthopper Nilaparvata lugens, a serious insect pest of rice plants. We demonstrated that the use of a 360 bp fragment (NlEcR-c) that is common between NlEcR-A and NlEcR-B for feeding RNAi experiments significantly decreased the relative mRNA expression levels of NlEcR compared with those in the dsGFP control. Feeding RNAi also resulted in a significant reduction in the number of offspring per pair of N. lugens. Consequently, a transgenic rice line expressing NlEcR dsRNA was constructed by Agrobacterium- mediated transformation. The results of qRT-PCR showed that the total copy number of the target gene in all transgenic rice lines was 2. Northern blot analysis showed that the small RNA of the hairpin dsNlEcR-c was successfully expressed in the transgenic rice lines. After newly hatched nymphs of N. lugens fed on the transgenic rice lines, effective RNAi was observed. The NlEcR expression levels in all lines examined were decreased significantly compared with the control. In all lines, the survival rate of the nymphs was nearly 90%, and the average number of offspring per pair in the treated groups was significantly less than that observed in the control, with a decrease of 44.18-66.27%. These findings support an RNAi-based pest control strategy and are also important for the management of rice insect pests.

RNAi-Based GluN3A Silencing Prevents and Reverses Disease Phenotypes Induced by Mutant huntingtin.

PubMed

Marco, Sonia; Murillo, Alvaro; Pérez-Otaño, Isabel

2018-06-15

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by expansion of a polyglutamine tract in the huntingtin protein. HD symptoms include severe motor, cognitive, and psychiatric impairments that result from dysfunction and later degeneration of medium-sized spiny neurons (MSNs) in the striatum. A key early pathogenic mechanism is dysregulated synaptic transmission due to enhanced surface expression of juvenile NMDA-type glutamate receptors containing GluN3A subunits, which trigger the aberrant pruning of synapses formed by cortical afferents onto MSNs. Here, we tested the therapeutic potential of silencing GluN3A expression in YAC128 mice, a well-established HD model. Recombinant adeno-associated viruses encoding a short-hairpin RNA against GluN3A (rAAV-shGluN3A) were generated, and the ability of different serotypes to transduce MSNs was compared. A single injection of rAAV9-shGluN3A into the striatum of 1-month-old mice drove potent (>90%) and long-lasting reductions of GluN3A expression in MSNs, prevented dendritic spine loss and improved motor performance in YAC128 mice. Later delivery, when spine pathology is already apparent, was also effective. Our data provide proof-of-concept for GluN3A silencing as a beneficial strategy to prevent or reverse corticostriatal disconnectivity and motor impairment in HD and support the use of RNAi-based or small-molecule approaches for harnessing this therapeutic potential. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Considering RNAi experimental design in parasitic helminths.

PubMed

Dalzell, Johnathan J; Warnock, Neil D; McVeigh, Paul; Marks, Nikki J; Mousley, Angela; Atkinson, Louise; Maule, Aaron G

2012-04-01

Almost a decade has passed since the first report of RNA interference (RNAi) in a parasitic helminth. Whilst much progress has been made with RNAi informing gene function studies in disparate nematode and flatworm parasites, substantial and seemingly prohibitive difficulties have been encountered in some species, hindering progress. An appraisal of current practices, trends and ideals of RNAi experimental design in parasitic helminths is both timely and necessary for a number of reasons: firstly, the increasing availability of parasitic helminth genome/transcriptome resources means there is a growing need for gene function tools such as RNAi; secondly, fundamental differences and unique challenges exist for parasite species which do not apply to model organisms; thirdly, the inherent variation in experimental design, and reported difficulties with reproducibility undermine confidence. Ideally, RNAi studies of gene function should adopt standardised experimental design to aid reproducibility, interpretation and comparative analyses. Although the huge variations in parasite biology and experimental endpoints make RNAi experimental design standardization difficult or impractical, we must strive to validate RNAi experimentation in helminth parasites. To aid this process we identify multiple approaches to RNAi experimental validation and highlight those which we deem to be critical for gene function studies in helminth parasites.

Treatment with Trehalose Prevents Behavioral and Neurochemical Deficits Produced in an AAV α-Synuclein Rat Model of Parkinson's Disease.

PubMed

He, Qing; Koprich, James B; Wang, Ying; Yu, Wen-bo; Xiao, Bao-guo; Brotchie, Jonathan M; Wang, Jian

2016-05-01

The accumulation of misfolded α-synuclein in dopamine (DA) neurons is believed to be of major importance in the pathogenesis of Parkinson's disease (PD). Animal models of PD, based on viral-vector-mediated over-expression of α-synuclein, have been developed and show evidence of dopaminergic toxicity, providing us a good tool to investigate potential therapies to interfere with α-synuclein-mediated pathology. An efficient disease-modifying therapeutic molecule should be able to interfere with the neurotoxicity of α-synuclein aggregation. Our study highlighted the ability of an autophagy enhancer, trehalose (at concentrations of 5 and 2% in drinking water), to protect against A53T α-synuclein-mediated DA degeneration in an adeno-associated virus serotype 1/2 (AAV1/2)-based rat model of PD. Behavioral tests and neurochemical analysis demonstrated a significant attenuation in α-synuclein-mediated deficits in motor asymmetry and DA neurodegeneration including impaired DA neuronal survival and DA turnover, as well as α-synuclein accumulation and aggregation in the nigrostriatal system by commencing 5 and 2% trehalose at the same time as delivery of AAV. Trehalose (0.5%) was ineffective on the above behavioral and neurochemical deficits. Further investigation showed that trehalose enhanced autophagy in the striatum by increasing formation of LC3-II. This study supports the concept of using trehalose as a novel therapeutic strategy that might prevent/reverse α-synuclein aggregation for the treatment of PD.

Direct and Retrograde Transduction of Nigral Neurons with AAV6, 8, and 9 and Intraneuronal Persistence of Viral Particles

PubMed Central

Aebischer, Patrick

2013-01-01

Abstract Recombinant adeno-associated viral (AAV) vectors of serotypes 6, 8, and 9 were characterized as tools for gene delivery to dopaminergic neurons in the substantia nigra for future gene therapeutic applications in Parkinson's disease. While vectors of all three serotypes transduced nigral dopaminergic neurons with equal efficiency when directly injected to the substantia nigra, AAV6 was clearly superior to AAV8 and AAV9 for retrograde transduction of nigral neurons after striatal delivery. For sequential transduction of nigral dopaminergic neurons, the combination of AAV9 with AAV6 proved to be more powerful than AAV8 with AAV6 or repeated AAV6 administration. Surprisingly, single-stranded viral genomes persisted in nigral dopaminergic neurons within cell bodies and axon terminals in the striatum, and intact assembled AAV capsid was enriched in nuclei of nigral neurons, 4 weeks after virus injections to the substantia nigra. 6-Hydroxydopamine (6-OHDA)–induced degeneration of dopaminergic neurons in the substantia nigra reduced the number of viral genomes in the striatum, in line with viral genome persistence in axon terminals. However, 6-OHDA–induced axonal degeneration did not induce any transsynaptic spread of AAV infection in the striatum. Therefore, the potential presence of viral particles in axons may not represent an important safety issue for AAV gene therapy applications in neurodegenerative diseases. PMID:23600720

Suppression of OsKu80 results in defects in developmental growth and increased telomere length in rice (Oryza sativa L.).

PubMed

Byun, Mi Young; Cui, Li Hua; Kim, Woo Taek

2015-12-25

The Ku70-Ku80 heterodimer plays a critical role in the maintenance of genomic stability in humans and yeasts. In this report, we identified and characterized OsKu80 in rice, a model monocot crop. OsKu80 forms a heterodimer with OsKu70 in yeast and plant cells, as demonstrated by yeast two-hybrid, in vivo co-immunoprecipitation, and bimolecular fluorescence complementation assays. RNAi-mediated knock-down T3 transgenic rice plants (Ubi:RNAi-OsKu80) displayed a retarded growth phenotype at the post-germination stage. In addition, the Ubi:RNAi-OsKu80 knock-down progeny exhibited noticeably increased telomere length as compared to wild-type rice. These results are discussed with the idea that OsKu80 plays a role in developmental growth and telomere length regulation in rice plants. Copyright © 2015 Elsevier Inc. All rights reserved.

An RNAi Screen To Identify Protein Phosphatases That Function Within the Drosophila Circadian Clock.

PubMed

Agrawal, Parul; Hardin, Paul E

2016-12-07

Circadian clocks in eukaryotes keep time via cell-autonomous transcriptional feedback loops. A well-characterized example of such a transcriptional feedback loop is in Drosophila, where CLOCK-CYCLE (CLK-CYC) complexes activate transcription of period (per) and timeless (tim) genes, rising levels of PER-TIM complexes feed-back to repress CLK-CYC activity, and degradation of PER and TIM permits the next cycle of CLK-CYC transcription. The timing of CLK-CYC activation and PER-TIM repression is regulated posttranslationally, in part through rhythmic phosphorylation of CLK, PER, and TIM. Previous behavioral screens identified several kinases that control CLK, PER, and TIM levels, subcellular localization, and/or activity, but two phosphatases that function within the clock were identified through the analysis of candidate genes from other pathways or model systems. To identify phosphatases that play a role in the clock, we screened clock cell-specific RNA interference (RNAi) knockdowns of all annotated protein phosphatases and protein phosphatase regulators in Drosophila for altered activity rhythms. This screen identified 19 protein phosphatases that lengthened or shortened the circadian period by ≥1 hr (p ≤ 0.05 compared to controls) or were arrhythmic. Additional RNAi lines, transposon inserts, overexpression, and loss-of-function mutants were tested to independently confirm these RNAi phenotypes. Based on genetic validation and molecular analysis, 15 viable protein phosphatases remain for future studies. These candidates are expected to reveal novel features of the circadian timekeeping mechanism in Drosophila that are likely to be conserved in all animals including humans. Copyright © 2016 Agrawal and Hardin.

A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia

PubMed Central

Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric

2014-01-01

In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163

High density recombinant AAV particles are competent vectors for in vivo transduction

USDA-ARS?s Scientific Manuscript database

Recombinant adeno-associated viral (rAAV) vectors have recently achieved clinical successes in human gene therapy. However, the commonly observed heavier particles found in AAV preparations have traditionally been ignored due to its low in vitro infectivity. In this study, we systemically compared t...

Asian citrus psyllid RNAi pathway - RNAi evidence

USDA-ARS?s Scientific Manuscript database

In silico analyses of the draft genome of Diaphorina citri, the Asian citrus psyllid, for genes within the Ribonucleic acid interference(RNAi), pathway was successful. The psyllid is the vector of the plant-infecting bacterium, Candidatus Liberibacter asiaticus (CLas), which is linked to citrus gree...

AAV9-based gene therapy partially ameliorates the clinical phenotype of a mouse model of Leigh syndrome

PubMed Central

Di Meo, I; Marchet, S; Lamperti, C; Zeviani, M; Viscomi, C

2017-01-01

Leigh syndrome (LS) is the most common infantile mitochondrial encephalopathy. No treatment is currently available for this condition. Mice lacking Ndufs4, encoding NADH: ubiquinone oxidoreductase iron-sulfur protein 4 (NDUFS4) recapitulates the main findings of complex I (cI)-related LS, including severe multisystemic cI deficiency and progressive neurodegeneration. In order to develop a gene therapy approach for LS, we used here an AAV2/9 vector carrying the human NDUFS4 coding sequence (hNDUFS4). We administered AAV2/9-hNDUFS4 by intravenous (IV) and/or intracerebroventricular (ICV) routes to either newborn or young Ndufs4−/− mice. We found that IV administration alone was only able to correct the cI deficiency in peripheral organs, whereas ICV administration partially corrected the deficiency in the brain. However, both treatments failed to improve the clinical phenotype or to prolong the lifespan of Ndufs4−/− mice. In contrast, combined IV and ICV treatments resulted, along with increased cI activity, in the amelioration of the rotarod performance and in a significant prolongation of the lifespan. Our results indicate that extraneurological organs have an important role in LS pathogenesis and provide an insight into current limitations of adeno-associated virus (AAV)-mediated gene therapy in multisystem disorders. These findings warrant future investigations to develop new vectors able to efficiently target multiple organs. PMID:28753212

AAV9-based gene therapy partially ameliorates the clinical phenotype of a mouse model of Leigh syndrome.

PubMed

Di Meo, I; Marchet, S; Lamperti, C; Zeviani, M; Viscomi, C

2017-10-01

Leigh syndrome (LS) is the most common infantile mitochondrial encephalopathy. No treatment is currently available for this condition. Mice lacking Ndufs4, encoding NADH: ubiquinone oxidoreductase iron-sulfur protein 4 (NDUFS4) recapitulates the main findings of complex I (cI)-related LS, including severe multisystemic cI deficiency and progressive neurodegeneration. In order to develop a gene therapy approach for LS, we used here an AAV2/9 vector carrying the human NDUFS4 coding sequence (hNDUFS4). We administered AAV2/9-hNDUFS4 by intravenous (IV) and/or intracerebroventricular (ICV) routes to either newborn or young Ndufs4 -/- mice. We found that IV administration alone was only able to correct the cI deficiency in peripheral organs, whereas ICV administration partially corrected the deficiency in the brain. However, both treatments failed to improve the clinical phenotype or to prolong the lifespan of Ndufs4 -/- mice. In contrast, combined IV and ICV treatments resulted, along with increased cI activity, in the amelioration of the rotarod performance and in a significant prolongation of the lifespan. Our results indicate that extraneurological organs have an important role in LS pathogenesis and provide an insight into current limitations of adeno-associated virus (AAV)-mediated gene therapy in multisystem disorders. These findings warrant future investigations to develop new vectors able to efficiently target multiple organs.

Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery.

PubMed

Gaj, Thomas; Staahl, Brett T; Rodrigues, Gonçalo M C; Limsirichai, Prajit; Ekman, Freja K; Doudna, Jennifer A; Schaffer, David V

2017-06-20

Realizing the full potential of genome editing requires the development of efficient and broadly applicable methods for delivering programmable nucleases and donor templates for homology-directed repair (HDR). The RNA-guided Cas9 endonuclease can be introduced into cells as a purified protein in complex with a single guide RNA (sgRNA). Such ribonucleoproteins (RNPs) can facilitate the high-fidelity introduction of single-base substitutions via HDR following co-delivery with a single-stranded DNA oligonucleotide. However, combining RNPs with transgene-containing donor templates for targeted gene addition has proven challenging, which in turn has limited the capabilities of the RNP-mediated genome editing toolbox. Here, we demonstrate that combining RNP delivery with naturally recombinogenic adeno-associated virus (AAV) donor vectors enables site-specific gene insertion by homology-directed genome editing. Compared to conventional plasmid-based expression vectors and donor templates, we show that combining RNP and AAV donor delivery increases the efficiency of gene addition by up to 12-fold, enabling the creation of lineage reporters that can be used to track the conversion of striatal neurons from human fibroblasts in real time. These results thus illustrate the potential for unifying nuclease protein delivery with AAV donor vectors for homology-directed genome editing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Silencing Genes in the Heart.

PubMed

Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

2017-01-01

Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

Tyrosine triple mutated AAV2-BDNF gene therapy in a rat model of transient IOP elevation

PubMed Central

Igarashi, Tsutomu; Kobayashi, Maika; Kameya, Shuhei; Fujimoto, Chiaki; Nakamoto, Kenji; Takahashi, Hisatomo; Igarashi, Toru; Miyake, Noriko; Iijima, Osamu; Hirai, Yukihiko; Shimada, Takashi; Okada, Takashi; Takahashi, Hiroshi

2016-01-01

Purpose We examined the neuroprotective effects of exogenous brain-derived neurotrophic factor (BDNF), which provides protection to retinal ganglion cells (RGCs) in rodents, in a model of transient intraocular pressure (IOP) elevation using a mutant (triple Y-F) self-complementary adeno-associated virus type 2 vector encoding BDNF (tm-scAAV2-BDNF). Methods The tm-scAAV2-BDNF or control vector encoding green fluorescent protein (GFP; tm-scAAV2-GFP) was intravitreally administered to rats, which were then divided into four groups: control, ischemia/reperfusion (I/R) injury only, I/R injury with tm-scAAV2-GFP, and tm-scAAV2-BDNF. I/R injury was then induced by transiently increasing IOP, after which the rats were euthanized to measure the inner retinal thickness and cell counts in the RGC layer. Results Intravitreous injection of tm-scAAV2-BDNF resulted in high levels of BDNF expression in the neural retina. Histological analysis showed that the inner retinal thickness and cell numbers in the RGC layer were preserved after transient IOP elevation in eyes treated with tm-scAAV2-BDNF but not in the other I/R groups. Significantly reduced glial fibrillary acidic protein (GFAP) immunostaining after I/R injury in the rats that received tm-scAAV2-BDNF indicated reduced retinal stress, and electroretinogram (ERG) analysis confirmed preservation of retinal function in the tm-scAAV2-BDNF group. Conclusions These results demonstrate the feasibility and effectiveness of neuroprotective gene therapy using tm-scAAV2-BDNF to protect the inner retina from transiently high intraocular pressure. An in vivo gene therapeutic approach to the clinical management of retinal diseases in conditions such as glaucoma, retinal artery occlusion, hypertensive retinopathy, and diabetic retinopathy thus appears feasible. PMID:27440998

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

PubMed

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-11-04

The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance

PubMed Central

Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L.; Abbas, Tarek; Larner, James M.

2017-01-01

Lung cancer resists radiation therapy, making it one of the deadliest forms of cancer. Here we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor p21 protein is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene (CDKN1A) in CHIP knockdown cells. Conversely, over-expression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone heat shock protein 70 (HSP70). These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity; thus, suggesting a novel strategy for the treatment of lung cancer. Implications The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. PMID:28232384

Gene transfer as a strategy to achieve permanent cardioprotection I: rAAV-mediated gene therapy with inducible nitric oxide synthase limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Wu, Wen-Jian; Ou, Qinghui; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Chen, Ning; Dawn, Buddhadeb; Luo, Li; O'Brien, Erin; Bolli, Roberto

2011-11-01

The ultimate goal of prophylactic gene therapy is to confer permanent protection against ischemia. Although gene therapy with inducible nitric oxide synthase (iNOS) is known to protect against myocardial infarction at 3 days and up to 2 months, the long-term effects on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the iNOS gene (rAAV/iNOS), which enables long-lasting transgene expression. The ability of rAAV/iNOS to direct the expression of functional iNOS protein was confirmed in COS-7 cells before in vivo gene transfer. Mice received injections in the anterior LV wall of rAAV/LacZ or rAAV/iNOS; 1 year later, they underwent a 30-min coronary occlusion (O) and 4 h of reperfusion (R). iNOS gene transfer resulted in elevated iNOS protein expression (+3-fold vs. the LacZ group, n = 6; P < 0.05) and iNOS activity (+4.4-fold vs. the LacZ group, n = 6; P < 0.05) 1 year later. Infarct size (% of risk region) was dramatically reduced at 1 year after iNOS gene transfer (13.5 ± 2.2%, n = 12, vs. 41.7 ± 2.9%, n = 10, in the LacZ group; P < 0.05). The infarct-sparing effect of iNOS gene therapy at 1 year was as powerful as that observed 24 h after ischemic preconditioning (six 4-min O/4-min R cycles) (19.3 ± 2.3%, n = 11; P < 0.05). Importantly, compared with the LacZ group (n = 11), iNOS gene transfer (n = 10) had no effect on LV dimensions or function for up to 1 year (at 1 year: FS 34.5 ± 2.0 vs. 34.6 ± 2.6%, EF 57.0 ± 2.0 vs. 59.7 ± 2.9%, LVEDD 4.3 ± 0.1 vs. 4.2 ± 0.2 mm, LVESD 2.8 ± 0.1 vs. 2.9 ± 0.2 mm) (echocardiography). These data demonstrate, for the first time, that rAAV-mediated iNOS gene transfer affords long-term, probably permanent (1 year), cardioprotection without adverse functional consequences, providing a strong rationale for further preclinical testing of prophylactic gene therapy.

DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

PubMed Central

LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

2012-01-01

Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte

Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

PubMed Central

Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

2012-01-01

Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

Flavivirus RNAi suppression: decoding non-coding RNA.

PubMed

Pijlman, Gorben P

2014-08-01

Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

PubMed

Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

2014-07-01

Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

Development of RNAi technology for targeted therapy--a track of siRNA based agents to RNAi therapeutics.

PubMed

Zhou, Yinjian; Zhang, Chunling; Liang, Wei

2014-11-10

RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.

An in vivo requirement for the mediator subunit med14 in the maintenance of stem cell populations.

PubMed

Burrows, Jeffrey T A; Pearson, Bret J; Scott, Ian C

2015-04-14

The Mediator complex has recently been shown to be a key player in the maintenance of embryonic and induced pluripotent stem cells. However, the in vivo consequences of loss of many Mediator subunits are unknown. We identified med14 as the gene affected in the zebrafish logelei (log) mutant, which displayed a morphological arrest by 2 days of development. Surprisingly, microarray analysis showed that transcription was not broadly affected in log mutants. Indeed, log cells transplanted into a wild-type environment were able to survive into adulthood. In planarians, RNAi knockdown demonstrated a requirement for med14 and many other Mediator components in adult stem cell maintenance and regeneration. Multiple stem/progenitor cell populations were observed to be reduced or absent in zebrafish med14 mutant embryos. Taken together, our results show a critical, evolutionarily conserved, in vivo function for Med14 (and Mediator) in stem cell maintenance, distinct from a general role in transcription. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The Role of Folate Transport in Antifolate Drug Action in Trypanosoma brucei*

PubMed Central

Dewar, Simon; Sienkiewicz, Natasha; Ong, Han B.; Wall, Richard J.; Horn, David

2016-01-01

The aim of this study was to identify and characterize mechanisms of resistance to antifolate drugs in African trypanosomes. Genome-wide RNAi library screens were undertaken in bloodstream form Trypanosoma brucei exposed to the antifolates methotrexate and raltitrexed. In conjunction with drug susceptibility and folate transport studies, RNAi knockdown was used to validate the functions of the putative folate transporters. The transport kinetics of folate and methotrexate were further characterized in whole cells. RNA interference target sequencing experiments identified a tandem array of genes encoding a folate transporter family, TbFT1–3, as major contributors to antifolate drug uptake. RNAi knockdown of TbFT1–3 substantially reduced folate transport into trypanosomes and reduced the parasite's susceptibly to the classical antifolates methotrexate and raltitrexed. In contrast, knockdown of TbFT1–3 increased susceptibly to the non-classical antifolates pyrimethamine and nolatrexed. Both folate and methotrexate transport were inhibited by classical antifolates but not by non-classical antifolates or biopterin. Thus, TbFT1–3 mediates the uptake of folate and classical antifolates in trypanosomes, and TbFT1–3 loss-of-function is a mechanism of antifolate drug resistance. PMID:27703008

Distinct RNAi Pathways in the Regulation of Physiology and Development in the Fungus Mucor circinelloides.

PubMed

Ruiz-Vázquez, Rosa M; Nicolás, Francisco E; Torres-Martínez, Santiago; Garre, Victoriano

2015-01-01

The basal fungus Mucor circinelloides has become, in recent years, a valuable model to study RNA-mediated gene silencing or RNA interference (RNAi). Serendipitously discovered in the late 1900s, the gene silencing in M. circinelloides is a landscape of consensus and dissents. Although similar to other classical fungal models in the basic design of the essential machinery that is responsible for silencing of gene expression, the existence of small RNA molecules of different sizes generated during this process and the presence of a mechanism that amplifies the silencing signal, give it a unique identity. In addition, M. circinelloides combines the components of RNAi machinery to carry out functions that not only limit themselves to the defense against foreign genetic material, but it uses some of these elements to regulate the expression of its own genes. Thus, different combinations of RNAi elements produce distinct classes of endogenous small RNAs (esRNAs) that regulate different physiological and developmental processes in response to environmental signals. The recent discovery of a new RNAi pathway involved in the specific degradation of endogenous mRNAs, using a novel RNase protein, adds one more element to the exciting puzzle of the gene silencing in M. circinelloides, in addition to providing hints about the evolutionary origin of the RNAi mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B

PubMed Central

Jackson, Kasey L.; Dayton, Robert D.; Deverman, Benjamin E.; Klein, Ronald L.

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats. PMID:27867348

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B.

PubMed

Jackson, Kasey L; Dayton, Robert D; Deverman, Benjamin E; Klein, Ronald L

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats.

Recombinant adeno-associated virus-delivered hypoxia-inducible stanniocalcin-1 expression effectively inhibits hypoxia-induced cell apoptosis in cardiomyocytes.

PubMed

Shi, Xin; Wang, Jianzhong; Qin, Yan

2014-12-01

Ischemia/hypoxia-induced oxidative stress is detrimental for the survival of cardiomyocytes and cardiac function. Stanniocalcin-1 (STC-1), a glycoprotein, has been found to play an inhibitory role in the production of reactive oxygen species (ROS). Here, we speculated that the overexpression of STC-1 might alleviate oxidative damage in cardiomyocytes under conditions of hypoxia. To control the expression of STC-1 in hypoxia, we constructed a recombinant adeno-associated virus (AAV) carrying the hypoxia-responsive element (HRE) to mediate hypoxia induction. Cardiomyocytes were infected with AAV-HRE-STC-1 and cultured in normoxic or hypoxic conditions, and STC-1 overexpression was only detected in hypoxic cultured cardiomyocytes by using quantitative real-time polymerase chain reaction and Western blot analysis. Using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, AAV-HRE-STC-1 infection was shown to significantly enhance cell survival under hypoxia. Hypoxia-induced cell apoptosis was inhibited by AAV-HRE-STC-1 infection by using the Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide apoptosis assay. Moreover, the proapoptotic protein Caspase-3 and anti-apoptotic protein Bcl-2, which were dysregulated by hypoxia, were reversed by AAV-HRE-STC-1 infection. AAV-HRE-STC-1-mediated STC-1 overexpression markedly inhibited ROS production in cardiomyocytes cultured under hypoxic conditions. AAV-HRE-STC-1 infection significantly upregulated uncoupled protein 3 (UCP3), whereas silencing of UCP3 blocked the inhibitory effect of AAV-HRE-STC-1 on ROS production. In contrast, AAV-HRE-STC-1 infection had no effect on UCP2, and knockdown of UCP2 did not block the inhibitory effect of AAV-HRE-STC-1 on ROS production in the cardiomyocytes cultured under hypoxic conditions. Taken together, STC1 activates antioxidant pathway in cardiomyocytes through the induction of UCP3, implying that AAV-HRE-STC-1 has potential in the treatment of ischemic

RNAi: a potential new class of therapeutic for human genetic disease.

PubMed

Seyhan, Attila A

2011-11-01

Dominant negative genetic disorders, in which a mutant allele of a gene causes disease in the presence of a second, normal copy, have been challenging since there is no cure and treatments are only to alleviate the symptoms. Current therapies involving pharmacological and biological drugs are not suitable to target mutant genes selectively due to structural indifference of the normal variant of their targets from the disease-causing mutant ones. In instances when the target contains single nucleotide polymorphism (SNP), whether it is an enzyme or structural or receptor protein are not ideal for treatment using conventional drugs due to their lack of selectivity. Therefore, there is a need to develop new approaches to accelerate targeting these previously inaccessible targets by classical therapeutics. Although there is a cooling trend by the pharmaceutical industry for the potential of RNA interference (RNAi), RNAi and other RNA targeting drugs (antisense, ribozyme, etc.) still hold their promise as the only drugs that provide an opportunity to target genes with SNP mutations found in dominant negative disorders, genes specific to pathogenic tumor cells, and genes that are critical for mediating the pathology of various other diseases. Because of its exquisite specificity and potency, RNAi has attracted a considerable interest as a new class of therapeutic for genetic diseases including amyotrophic lateral sclerosis, Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), spinocerebellar ataxia, dominant muscular dystrophies, and cancer. In this review, progress and challenges in developing RNAi therapeutics for genetic diseases will be discussed.

Effects of HBV Genetic Variability on RNAi Strategies

PubMed Central

Panjaworayan, Nattanan; Brown, Chris M.

2011-01-01

RNAi strategies present promising antiviral strategies against HBV. RNAi strategies require base pairing between short RNAi effectors and targets in the HBV pregenome or other RNAs. Natural variation in HBV genotypes, quasispecies variation, or mutations selected by the RNAi strategy could potentially make these strategies less effective. However, current and proposed antiviral strategies against HBV are being, or could be, designed to avoid this. This would involve simultaneous targeting of multiple regions of the genome, or regions in which variation or mutation is not tolerated. RNAi strategies against single genotypes or against variable regions of the genome would need to have significant other advantages to be part of robust therapies. PMID:21760994

Knockdown of estrogen receptor-α induces autophagy and inhibits antiestrogen-mediated unfolded protein response activation, promoting ROS-induced breast cancer cell death

PubMed Central

Cook, Katherine L.; Clarke, Pamela A. G.; Parmar, Jignesh; Hu, Rong; Schwartz-Roberts, Jessica L.; Abu-Asab, Mones; Wärri, Anni; Baumann, William T.; Clarke, Robert

2014-01-01

Approximately 70% of all newly diagnosed breast cancers express estrogen receptor (ER)-α. Although inhibiting ER action using targeted therapies such as fulvestrant (ICI) is often effective, later emergence of antiestrogen resistance limits clinical use. We used antiestrogen-sensitive and -resistant cells to determine the effect of antiestrogens/ERα on regulating autophagy and unfolded protein response (UPR) signaling. Knockdown of ERα significantly increased the sensitivity of LCC1 cells (sensitive) and also resensitized LCC9 cells (resistant) to antiestrogen drugs. Interestingly, ERα knockdown, but not ICI, reduced nuclear factor (erythroid-derived 2)-like (NRF)-2 (UPR-induced antioxidant protein) and increased cytosolic kelch-like ECH-associated protein (KEAP)-1 (NRF2 inhibitor), consistent with the observed increase in ROS production. Furthermore, autophagy induction by antiestrogens was prosurvival but did not prevent ERα knockdown–mediated death. We built a novel mathematical model to elucidate the interactions among UPR, autophagy, ER signaling, and ROS regulation of breast cancer cell survival. The experimentally validated mathematical model explains the counterintuitive result that knocking down the main target of ICI (ERα) increased the effectiveness of ICI. Specifically, the model indicated that ERα is no longer present in excess and that the effect on proliferation from further reductions in its level by ICI cannot be compensated for by increased autophagy. The stimulation of signaling that can confer resistance suggests that combining autophagy or UPR inhibitors with antiestrogens would reduce the development of resistance in some breast cancers.—Cook, K. L., Clarke, P. A. G., Parmar, J., Hu, R., Schwartz-Roberts, J. L., Abu-Asab, M., Wärri, A., Baumann, W. T., Clarke, R. Knockdown of estrogen receptor-α induces autophagy and inhibits antiestrogen-mediated unfolded protein response activation, promoting ROS-induced breast cancer cell death

Transmission bottlenecks and RNAi collectively influence tick-borne flavivirus evolution.

PubMed

Grubaugh, Nathan D; Rückert, Claudia; Armstrong, Philip M; Bransfield, Angela; Anderson, John F; Ebel, Gregory D; Brackney, Doug E

2016-07-01

Arthropod-borne RNA viruses exist within hosts as heterogeneous populations of viral variants and, as a result, possess great genetic plasticity. Understanding the micro-evolutionary forces shaping these viruses can provide insights into how they emerge, adapt, and persist in new and changing ecological niches. While considerable attention has been directed toward studying the population dynamics of mosquito-borne viruses, little is known about tick-borne virus populations. Therefore, using a mouse and Ixodes scapularis tick transmission model, we examined Powassan virus (POWV; Flaviviridae, Flavivirus ) populations in and between both the vertebrate host and arthropod vector. We found that genetic bottlenecks, RNAi-mediated diversification, and selective constraints collectively influence POWV evolution. Together, our data provide a mechanistic explanation for the slow, long-term evolutionary trends of POWV, and suggest that all arthropod-borne viruses encounter similar selective pressures at the molecular level (i.e. RNAi), yet evolve much differently due to their unique rates and modes of transmission.

Product-Related Impurities in Clinical-Grade Recombinant AAV Vectors: Characterization and Risk Assessment

PubMed Central

Wright, J. Fraser

2014-01-01

Adeno-associated virus (AAV)-based vectors expressing therapeutic genes continue to demonstrate great promise for the treatment of a wide variety of diseases and together with other gene transfer vectors represent an emerging new therapeutic paradigm comparable in potential impact on human health to that achieved by recombinant proteins and vaccines. A challenge for the current pipeline of AAV-based investigational products as they advance through clinical development is the identification, characterization and lot-to-lot control of the process- and product-related impurities present in even highly purified preparations. Especially challenging are AAV vector product-related impurities that closely resemble the vector itself and are, in some cases, without clear precedent in established biotherapeutic products. The determination of acceptable levels of these impurities in vectors prepared for human clinical product development, with the goal of new product licensure, requires careful risk and feasibility assessment. This review focuses primarily on the AAV product-related impurities that have been described in vectors prepared for clinical development. PMID:28548061

Assessment of tropism and effectiveness of new primate-derived hybrid recombinant AAV serotypes in the mouse and primate retina.

PubMed

Charbel Issa, Peter; De Silva, Samantha R; Lipinski, Daniel M; Singh, Mandeep S; Mouravlev, Alexandre; You, Qisheng; Barnard, Alun R; Hankins, Mark W; During, Matthew J; Maclaren, Robert E

2013-01-01

Adeno-associated viral vectors (AAV) have been shown to be safe in the treatment of retinal degenerations in clinical trials. Thus, improving the efficiency of viral gene delivery has become increasingly important to increase the success of clinical trials. In this study, structural domains of different rAAV serotypes isolated from primate brain were combined to create novel hybrid recombinant AAV serotypes, rAAV2/rec2 and rAAV2/rec3. The efficacy of these novel serotypes were assessed in wild type mice and in two models of retinal degeneration (the Abca4(-/-) mouse which is a model for Stargardt disease and in the Pde6b(rd1/rd1) mouse) in vivo, in primate tissue ex-vivo, and in the human-derived SH-SY5Y cell line, using an identical AAV2 expression cassette. We show that these novel hybrid serotypes can transduce retinal tissue in mice and primates efficiently, although no more than AAV2/2 and rAAV2/5 serotypes. Transduction efficiency appeared lower in the Abca4(-/-) mouse compared to wild type with all vectors tested, suggesting an effect of specific retinal diseases on the efficiency of gene delivery. Shuffling of AAV capsid domains may have clinical applications for patients who develop T-cell immune responses following AAV gene therapy, as specific peptide antigen sequences could be substituted using this technique prior to vector re-treatments.

Synergistic cardioprotective effects of rAAV9-CyclinA2 combined with fibrin glue in rats after myocardial infarction.

PubMed

Cao, Wen; Chang, Ya-Fei; Zhao, Ai-Chao; Chen, Bang-Dang; Liu, Fen; Ma, Yi-Tong; Ma, Xiang

2017-08-01

The present study aimed to investigate the protective effects of rAAV9-CyclinA2 combined with fibrin glue (FG) in vivo in rats after myocardial infarction (MI). Ninety male Sprague-Dawley rats were randomized into 6 groups (15 in each group): sham, MI, rAAV9-green fluorescent protein (GFP) + MI, rAAV9-CyclinA2 + MI, FG + MI, and rAAV9-CyclinA2 + FG + MI. Packed virus (5 × 10 11 vg/ml) in 150 µl of normal saline or FG was injected into the infarcted myocardium at five locations in rAAV9-GFP + MI, rAAV9-CyclinA2 + MI, and rAAV9-CyclinA2 + FG + MI groups. The sham, MI, and FG + MI groups were injected with an equal volume of normal saline or FG at the same sites. Five weeks after injection, echocardiography was performed to evaluate the left ventricular function. The expressions of CyclinA2, proliferating cell nuclear antigen (PCNA), and phospho-histone-H3 (H3P), vascular density, and infarct area were assessed by Western blot, immunohistochemistry, immunofluorescence, and Masson staining. As a result, the combination of rAAV9-CyclinA2 and FG increased ejection fraction and fractional shortening compared with FG or rAAV9-CyclinA2 alone. The expression level of CyclinA2 was significantly higher in the rAAV9-CyclinA2 + FG + MI group compared with the rAAV9-CyclinA2 + MI and FG + MI groups (70.1 ± 1.86% vs. 14.74 ± 2.02%, P < 0.01; or vs. 50.13 ± 3.80%; P < 0.01). A higher expression level of PCNA and H3P was found in the rAAV9-CyclinA2 + FG + MI group compared with other groups. Comparing with other experiment groups, collagen deposition and the infarct size significantly decreased in rAAV9-CyclinA2 + Fibrin + MI group. The vascular density was much higher in the rAAV9-CyclinA2 + FG + MI group compared with the rAAV9-CyclinA2 + MI group. We concluded that fibrin glue combined with rAAV9-CyclinA2 was found to be effective in cardiac remodeling and improving

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease

PubMed Central

SUN, LIJUN; HAO, YUEWEN; NIE, XIAOWEI; ZHANG, XUEXIN; YANG, GUANGXIAO; WANG, QUANYING

2012-01-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease.

PubMed

Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Zhang, Xuexin; Yang, Guangxiao; Wang, Quanying

2012-11-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the

Application of a haematopoetic progenitor cell-targeted adeno-associated viral (AAV) vector established by selection of an AAV random peptide library on a leukaemia cell line

PubMed Central

Stiefelhagen, Marius; Sellner, Leopold; Kleinschmidt, Jürgen A; Jauch, Anna; Laufs, Stephanie; Wenz, Frederik; Zeller, W Jens; Fruehauf, Stefan; Veldwijk, Marlon R

2008-01-01

Background For many promising target cells (e.g.: haematopoeitic progenitors), the susceptibility to standard adeno-associated viral (AAV) vectors is low. Advancements in vector development now allows the generation of target cell-selected AAV capsid mutants. Methods To determine its suitability, the method was applied on a chronic myelogenous leukaemia (CML) cell line (K562) to obtain a CML-targeted vector and the resulting vectors tested on leukaemia, non-leukaemia, primary human CML and CD34+ peripheral blood progenitor cells (PBPC); standard AAV2 and a random capsid mutant vector served as controls. Results Transduction of CML (BV173, EM3, K562 and Lama84) and AML (HL60 and KG1a) cell lines with the capsid mutants resulted in an up to 36-fold increase in CML transduction efficiency (K562: 2-fold, 60% ± 2% green fluorescent protein (GFP)+ cells; BV173: 9-fold, 37% ± 2% GFP+ cells; Lama84: 36-fold, 29% ± 2% GFP+ cells) compared to controls. For AML (KG1a, HL60) and one CML cell line (EM3), no significant transduction (<1% GFP+ cells) was observed for any vector. Although the capsid mutant clone was established on a cell line, proof-of-principle experiments using primary human cells were performed. For CML (3.2-fold, mutant: 1.75% ± 0.45% GFP+ cells, p = 0.03) and PBPC (3.5-fold, mutant: 4.21% ± 3.40% GFP+ cells) a moderate increase in gene transfer of the capsid mutant compared to control vectors was observed. Conclusion Using an AAV random peptide library on a CML cell line, we were able to generate a capsid mutant, which transduced CML cell lines and primary human haematopoietic progenitor cells with higher efficiency than standard recombinant AAV vectors. PMID:18789140

Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection

PubMed Central

Wooddell, Christine I; Rozema, David B; Hossbach, Markus; John, Matthias; Hamilton, Holly L; Chu, Qili; Hegge, Julia O; Klein, Jason J; Wakefield, Darren H; Oropeza, Claudia E; Deckert, Jochen; Roehl, Ingo; Jahn-Hofmann, Kerstin; Hadwiger, Philipp; Vornlocher, Hans-Peter; McLachlan, Alan; Lewis, David L

2013-01-01

RNA interference (RNAi)-based therapeutics have the potential to treat chronic hepatitis B virus (HBV) infection in a fundamentally different manner than current therapies. Using RNAi, it is possible to knock down expression of viral RNAs including the pregenomic RNA from which the replicative intermediates are derived, thus reducing viral load, and the viral proteins that result in disease and impact the immune system's ability to eliminate the virus. We previously described the use of polymer-based Dynamic PolyConjugate (DPC) for the targeted delivery of siRNAs to hepatocytes. Here, we first show in proof-of-concept studies that simple coinjection of a hepatocyte-targeted, N-acetylgalactosamine-conjugated melittin-like peptide (NAG-MLP) with a liver-tropic cholesterol-conjugated siRNA (chol-siRNA) targeting coagulation factor VII (F7) results in efficient F7 knockdown in mice and nonhuman primates without changes in clinical chemistry or induction of cytokines. Using transient and transgenic mouse models of HBV infection, we show that a single coinjection of NAG-MLP with potent chol-siRNAs targeting conserved HBV sequences resulted in multilog repression of viral RNA, proteins, and viral DNA with long duration of effect. These results suggest that coinjection of NAG-MLP and chol-siHBVs holds great promise as a new therapeutic for patients chronically infected with HBV. PMID:23439496

Regulation of P450-mediated permethrin resistance in Culex quinquefasciatus by the GPCR/Gαs/AC/cAMP/PKA signaling cascade.

PubMed

Li, Ting; Liu, Nannan

2017-12-01

This study explores the role of G-protein-coupled receptor-intracellular signaling in the development of P450-mediated insecticide resistance in mosquitoes, Culex quinquefasciatus , focusing on the essential function of the GPCRs and their downstream effectors of Gs alpha subunit protein (Gαs) and adenylyl cyclase (ACs) in P450-mediated insecticide resistance of Culex mosquitoes. Our RNAi-mediated functional study showed that knockdown of Gαs caused the decreased expression of the downstream effectors of ACs and PKAs in the GPCR signaling pathway and resistance P450 genes, whereas knockdown of ACs decreased the expression of PKAs and resistance P450 genes. Knockdown of either Gαs or ACs resulted in an increased susceptibility of mosquitoes to permethrin. These results add significantly to our understanding of the molecular basis of resistance P450 gene regulation through GPCR/Gαs/AC/cAMP-PKA signaling pathways in the insecticide resistance of mosquitoes. The temporal and spatial dynamic analyses of GPCRs, Gαs, ACs, PKAs, and P450s in two insecticide resistant mosquito strains revealed that all the GPCR signaling pathway components tested, namely GPCRs, Gαs, ACs and PKAs, were most highly expressed in the brain for both resistant strains, suggesting the role played by these genes in signaling transduction and regulation. The resistance P450 genes were mainly expressed in the brain, midgut and malpighian tubules (MTs), suggesting their critical function in the central nervous system and importance for detoxification. The temporal dynamics analysis for the gene expression showed a diverse expression profile during mosquito development, indicating their initially functional importance in response to exposure to insecticides during their life stages.

Emerging strategies for RNA interference (RNAi) applications in insects.

PubMed

Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

2015-01-01

RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

AAV-mediated delivery of the transcription factor XBP1s into the striatum reduces mutant Huntingtin aggregation in a mouse model of Huntington's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuleta, Amparo; Center for Molecular Studies of the Cell, Institute of Biomedical Sciences, University of Chile, Santiago; Vidal, Rene L.

2012-04-13

Highlights: Black-Right-Pointing-Pointer The contribution of ER stress to HD has not been directly addressed. Black-Right-Pointing-Pointer Expression of XBP1s using AAVs decreases Huntingtin aggregation in vivo. Black-Right-Pointing-Pointer We describe a new in vivo model of HD based on the expression of a large fragment of mHtt-RFP. -- Abstract: Huntington's disease (HD) is caused by mutations that expand a polyglutamine region in the amino-terminal domain of Huntingtin (Htt), leading to the accumulation of intracellular inclusions and progressive neurodegeneration. Recent reports indicate the engagement of endoplasmic reticulum (ER) stress responses in human HD post mortem samples and animal models of the disease. Adaptationmore » to ER stress is mediated by the activation of the unfolded protein response (UPR), an integrated signal transduction pathway that attenuates protein folding stress by controlling the expression of distinct transcription factors including X-Box binding protein 1 (XBP1). Here we targeted the expression of XBP1 on a novel viral-based model of HD. We delivered an active form of XBP1 locally into the striatum of adult mice using adeno-associated vectors (AAVs) and co-expressed this factor with a large fragment of mutant Htt as a fusion protein with RFP (Htt588{sup Q95}-mRFP) to directly visualize the accumulation of Htt inclusions in the brain. Using this approach, we observed a significant reduction in the accumulation of Htt588{sup Q95}-mRFP intracellular inclusion when XBP1 was co-expressed in the striatum. These results contrast with recent findings indicating a protective effect of XBP1 deficiency in neurodegeneration using knockout mice, and suggest a potential use of gene therapy strategies to manipulate the UPR in the context of HD.« less

The complete genomic sequence of egg drop syndrome virus strain AAV-2.

PubMed

Jin, Q; Zeng, L; Yang, F; Li, M; Hou, Y

1999-12-01

In the search for the genome of egg drop syndrome virus (EDSV-76) Chinese strain AAV-2, part of restriction endonuclease physical map is analyzed, the complete genomic library is organized. On basis of this, the complete genome nucleotide sequences (32 838 bp in length, including terminal structures) are determined. The data analysis shows: compared with the other Adenoviruses, strain AAV-2 has more disparity on genomic structure and the distribution of open reading frame (ORF). There are no clear E1, E3 and E4 regions in AAV-2 genome. Two segments located at both ends of genome (1.1 kb and 8.3 kb in length respectively) have no homology with the other adenovirus genomes. In addition, strain AAV-2 genome lacks ORFs encoding ElA, pV and pIX, which are common ORFs encoding early, lately proteins in Adenovirus. This reveals differences between EDSA-76, the sole standard strain of group III Avian Adenoviruses, and the other Avian Adenoviruses for the first time. It will help the search for Avian Adenovirus and will also help the search of all Adenoviruses.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed

The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance.

PubMed

Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L; Abbas, Tarek; Larner, James M

2017-06-01

Lung cancer resists radiotherapy, making it one of the deadliest forms of cancer. Here, we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically, ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor, p21 protein, is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene ( CDKN1A) in CHIP knockdown cells. Conversely, overexpression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone HSP70. These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity, thus suggesting a novel strategy for the treatment of lung cancer. Implications: The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. Mol Cancer Res; 15(6); 651-9. ©2017 AACR . ©2017 American Association for Cancer Research.

75 FR 55808 - Prospective Grant of Exclusive License: Development of AAV5 Based Therapeutics To Treat Human...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-14

.... Patent 6, 855, 314 entitled ``AAV5 Vector for Transducing Brain Cells and Lung Cells'' [HHS Ref. No. E... sale of AAV5 based therapeutic products to be delivered to the brain, eyes and liver for treatment of... vectors and particles. The specific brain cells that are targeted by AAV5 belong to both non-neuronal...

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Distribution of AAV-TK following intracranial convection-enhanced delivery into rats.

PubMed

Cunningham, J; Oiwa, Y; Nagy, D; Podsakoff, G; Colosi, P; Bankiewicz, K S

2000-01-01

Adeno-associated virus (AAV)-based vectors are being tested in animal models as viable treatments for glioma and neurodegenerative disease and could potentially be employed to target a variety of central nervous system disorders. The relationship between dose of injected vector and its resulting distribution in brain tissue has not been previously reported nor has the most efficient method of delivery been determined. Here we report that convection-enhanced delivery (CED) of 2.5 x 10(8), 2.5 x 10(9), or 2.5 x 10(10) particles of AAV-thymidine kinase (AAV-TK) into rat brain revealed a clear dose response. In the high-dose group, a volume of 300 mm3 of brain tissue was partially transduced. Results showed that infusion pump and subcutaneous osmotic pumps were both capable of delivering vector via CED and that total particle number was the most important determining factor in obtaining efficient expression. Results further showed differences in histopathology between the delivery groups. While administration of vector using infusion pump had relatively benign effects, the use of osmotic pumps resulted in notable toxicity to the surrounding brain tissue. To determine tissue distribution of vector following intracranial delivery, PCR analysis was performed on tissues from rats that received high doses of AAV-TK. Three weeks following CED, vector could be detected in both hemispheres of the brain, spinal cord, spleen, and kidney.

The adaptor molecule Nck localizes the WAVE complex to promote actin polymerization during CEACAM3-mediated phagocytosis of bacteria.

PubMed

Pils, Stefan; Kopp, Kathrin; Peterson, Lisa; Delgado Tascón, Julia; Nyffenegger-Jann, Naja J; Hauck, Christof R

2012-01-01

CEACAM3 is a granulocyte receptor mediating the opsonin-independent recognition and phagocytosis of human-restricted CEACAM-binding bacteria. CEACAM3 function depends on an intracellular immunoreceptor tyrosine-based activation motif (ITAM)-like sequence that is tyrosine phosphorylated by Src family kinases upon receptor engagement. The phosphorylated ITAM-like sequence triggers GTP-loading of Rac by directly associating with the guanine nucleotide exchange factor (GEF) Vav. Rac stimulation in turn is critical for actin cytoskeleton rearrangements that generate lamellipodial protrusions and lead to bacterial uptake. In our present study we provide biochemical and microscopic evidence that the adaptor proteins Nck1 and Nck2, but not CrkL, Grb2 or SLP-76, bind to tyrosine phosphorylated CEACAM3. The association is phosphorylation-dependent and requires the Nck SH2 domain. Overexpression of the isolated Nck1 SH2 domain, RNAi-mediated knock-down of Nck1, or genetic deletion of Nck1 and Nck2 interfere with CEACAM3-mediated bacterial internalization and with the formation of lamellipodial protrusions. Nck is constitutively associated with WAVE2 and directs the actin nucleation promoting WAVE complex to tyrosine phosphorylated CEACAM3. In turn, dominant-negative WAVE2 as well as shRNA-mediated knock-down of WAVE2 or the WAVE-complex component Nap1 reduce internalization of bacteria. Our results provide novel mechanistic insight into CEACAM3-initiated phagocytosis. We suggest that the CEACAM3 ITAM-like sequence is optimized to co-ordinate a minimal set of cellular factors needed to efficiently trigger actin-based lamellipodial protrusions and rapid pathogen engulfment.

RNAi drives nonreciprocal translocations at eroding chromosome ends to establish telomere-free linear chromosomes.

PubMed

Begnis, Martina; Apte, Manasi S; Masuda, Hirohisa; Jain, Devanshi; Wheeler, David Lee; Cooper, Julia Promisel

2018-04-01

The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI rDNA " chromosomes), it is dispensable for HAATI rDNA maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI rDNA genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device. © 2018 Begnis et al.; Published by Cold Spring Harbor Laboratory Press.

[siRNA-mediated tissue factor knockdown in porcine neonatal islet cell clusters in vitro].

PubMed

Ji, Ming; Yi, Shounan; Yu, Deling; Wang, Wei

2011-12-01

To determine the genetic modification on neonatal porcine islet cell clusters (NICC) by small interfering RNA (siRNA)-mediated tissue factor (TF) knockdown in vitro. Porcine NICC were transfected with 5 pairs of designed siRNA respectively or in different combinations with lipofectamine 2000. Transfected NICC were analyzed for TF gene by real-time PCR to select the siRNA which worked best. Meanwhile, the viability of NICC after the TF siRNA transfection was examined by FACS. The efficiency of TF gene and protein suppression was measured by real-time PCR and and FACS respectively. Real-time PCR and FACS showed that a 60% reduction in the TF gene expression and a 50% reduction in the protien level of TF on NICC were achieved by transfecting 3 pairs of selected siRNA. The siRNA transfection had no significant effect on the viability of NICC which was analyzed by FACS. The expression of TF on porcine NICC is efficiently suppressed by 3 pairs of designed siRNA in vitro.

Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests

PubMed Central

Gillet, François-Xavier; Garcia, Rayssa A.; Macedo, Leonardo L. P.; Albuquerque, Erika V. S.; Silva, Maria C. M.; Grossi-de-Sa, Maria F.

2017-01-01

Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil (Anthonomus grandis), we showed that the chimeric protein PTD-DRBD (peptide transduction domain—dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests. PMID:28503153

Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests.

PubMed

Gillet, François-Xavier; Garcia, Rayssa A; Macedo, Leonardo L P; Albuquerque, Erika V S; Silva, Maria C M; Grossi-de-Sa, Maria F

2017-01-01

Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil ( Anthonomus grandis ), we showed that the chimeric protein PTD-DRBD (peptide transduction domain-dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

RNAi-mediated resistance to whitefly (Bemisia tabaci) in genetically engineered lettuce (Lactuca sativa).

PubMed

Ibrahim, Abdulrazak B; Monteiro, Tatiane R; Cabral, Glaucia B; Aragão, Francisco J L

2017-10-01

RNA interference (RNAi)-based transgenic technologies have evolved as potent biochemical tools for silencing specific genes of plant pathogens and pests. The approach has been demonstrated to be useful in silencing genes in insect species. Here, we report on the successful construction of RNAi-based plasmid containing an interfering cassette designed to generate dsRNAs that target a novel v-ATPase transcript in whitefly (Bemisia tabaci), an important agricultural pest in tropical and sub-tropical regions. The presence of the transgene was confirmed in T 0 and T 1 generations of transgenic lettuce lines, segregating in a Mendelian fashion. Seven lines were infested with whiteflies and monitored over a period of 32 days. Analysis of mortality showed that within five days of feeding, insects on transgenic plants showed a mortality rate of 83.8-98.1%. In addition, a reduced number of eggs (95 fold less) was observed in flies feeding on transgenic lettuce plants than insects on control lines. Quantitative reverse transcription PCR showed decreased expression level of endogenous v-ATPase gene in whiteflies feeding on transgenic plants. This technology is a foundation for the production of whitefly-resistant commercial crops, improving agricultural sustainability and food security, reducing the use of more environmentally aggressive methods of pest control.

RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

PubMed

Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

2014-04-01

Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P < 0.001) and metacercariae (P < 0.01), resulting in a remarkable killing effect on C. sinensis adult worms (P < 0.01). Fluorescent Cy3-labeled dsRNA was mostly deposited in the uterus and vitellarium of adult worm and in the cyst wall of metacercaria. The present study is the first report of RNAi trials in C. sinensis, allowing further applications in identifying functional genes in C. sinensis.

Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

PubMed

Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

2018-06-01

The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

Rhox8 Ablation in the Sertoli Cells Using a Tissue-Specific RNAi Approach Results in Impaired Male Fertility in Mice1

PubMed Central

Welborn, Joshua P.; Davis, Matthew G.; Ebers, Steven D.; Stodden, Genna R.; Hayashi, Kanako; Cheatwood, Joseph L.; Rao, Manjeet K.; MacLean, James A.

2015-01-01

The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. PMID:25972016

Reliance of Wolbachia on High Rates of Host Proteolysis Revealed by a Genome-Wide RNAi Screen of Drosophila Cells.

PubMed

White, Pamela M; Serbus, Laura R; Debec, Alain; Codina, Adan; Bray, Walter; Guichet, Antoine; Lokey, R Scott; Sullivan, William

2017-04-01

Wolbachia are gram-negative, obligate, intracellular bacteria carried by a majority of insect species worldwide. Here we use a Wolbachia -infected Drosophila cell line and genome-wide RNA interference (RNAi) screening to identify host factors that influence Wolbachia titer. By screening an RNAi library targeting 15,699 transcribed host genes, we identified 36 candidate genes that dramatically reduced Wolbachia titer and 41 that increased Wolbachia titer. Host gene knockdowns that reduced Wolbachia titer spanned a broad array of biological pathways including genes that influenced mitochondrial function and lipid metabolism. In addition, knockdown of seven genes in the host ubiquitin and proteolysis pathways significantly reduced Wolbachia titer. To test the in vivo relevance of these results, we found that drug and mutant inhibition of proteolysis reduced levels of Wolbachia in the Drosophila oocyte. The presence of Wolbachia in either cell lines or oocytes dramatically alters the distribution and abundance of ubiquitinated proteins. Functional studies revealed that maintenance of Wolbachia titer relies on an intact host Endoplasmic Reticulum (ER)-associated protein degradation pathway (ERAD). Accordingly, electron microscopy studies demonstrated that Wolbachia is intimately associated with the host ER and dramatically alters the morphology of this organelle. Given Wolbachia lack essential amino acid biosynthetic pathways, the reliance of Wolbachia on high rates of host proteolysis via ubiquitination and the ERAD pathways may be a key mechanism for provisioning Wolbachia with amino acids. In addition, the reliance of Wolbachia on the ERAD pathway and disruption of ER morphology suggests a previously unsuspected mechanism for Wolbachia ' s potent ability to prevent RNA virus replication. Copyright © 2017 by the Genetics Society of America.

In vivo genome editing in animals using AAV-CRISPR system: applications to translational research of human disease

PubMed Central

Lau, Cia-Hin; Suh, Yousin

2017-01-01

Adeno-associated virus (AAV) has shown promising therapeutic efficacy with a good safety profile in a wide range of animal models and human clinical trials. With the advent of clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome-editing technologies, AAV provides one of the most suitable viral vectors to package, deliver, and express CRISPR components for targeted gene editing. Recent discoveries of smaller Cas9 orthologues have enabled the packaging of Cas9 nuclease and its chimeric guide RNA into a single AAV delivery vehicle for robust in vivo genome editing. Here, we discuss how the combined use of small Cas9 orthologues, tissue-specific minimal promoters, AAV serotypes, and different routes of administration has advanced the development of efficient and precise in vivo genome editing and comprehensively review the various AAV-CRISPR systems that have been effectively used in animals. We then discuss the clinical implications and potential strategies to overcome off-target effects, immunogenicity, and toxicity associated with CRISPR components and AAV delivery vehicles. Finally, we discuss ongoing non-viral-based ex vivo gene therapy clinical trials to underscore the current challenges and future prospects of CRISPR/Cas9 delivery for human therapeutics. PMID:29333255

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Polymers for Improving the In Vivo Transduction Efficiency of AAV2 Vectors

PubMed Central

Moulay, Gilles; Boutin, Sylvie; Masurier, Carole; Scherman, Daniel; Kichler, Antoine

2010-01-01

Background Adeno-associated virus has attracted great attention as vehicle for body-wide gene delivery. However, for the successful treatment of a disease such as Duchenne muscular dystrophy infusion of very large amounts of vectors is required. This not only raises questions about the technical feasibility of the large scale production but also about the overall safety of the approach. One way to overcome these problems would be to find strategies able to increase the in vivo efficiency. Methodology Here, we investigated whether polymers can act as adjuvants to increase the in vivo efficiency of AAV2. Our strategy consisted in the pre-injection of polymers before intravenous administration of mice with AAV2 encoding a murine secreted alkaline phosphatase (mSeAP). The transgene expression, vector biodistribution and tissue transduction were studied by quantification of the mSeAP protein and real time PCR. The injection of polyinosinic acid and polylysine resulted in an increase of plasmatic mSeAP of 2- and 12-fold, respectively. Interestingly, polyinosinic acid pre-injection significantly reduced the neutralizing antibody titer raised against AAV2. Conclusions Our results show that the pre-injection of polymers can improve the overall transduction efficiency of systemically administered AAV2 and reduce the humoral response against the capsid proteins. PMID:21203395

Intracranial AAV-IFN-β gene therapy eliminates invasive xenograft glioblastoma and improves survival in orthotopic syngeneic murine model.

PubMed

GuhaSarkar, Dwijit; Neiswender, James; Su, Qin; Gao, Guangping; Sena-Esteves, Miguel

2017-02-01

The highly invasive property of glioblastoma (GBM) cells and genetic heterogeneity are largely responsible for tumor recurrence after the current standard-of-care treatment and thus a direct cause of death. Previously, we have shown that intracranial interferon-beta (IFN-β) gene therapy by locally administered adeno-associated viral vectors (AAV) successfully treats noninvasive orthotopic glioblastoma models. Here, we extend these findings by testing this approach in invasive human GBM xenograft and syngeneic mouse models. First, we show that a single intracranial injection of AAV encoding human IFN-β eliminates invasive human GBM8 tumors and promotes long-term survival. Next, we screened five AAV-IFN-β vectors with different promoters to drive safe expression of mouse IFN-β in the brain in the context of syngeneic GL261 tumors. Two AAV-IFN-β vectors were excluded due to safety concerns, but therapeutic studies with the other three vectors showed extensive tumor cell death, activation of microglia surrounding the tumors, and a 56% increase in median survival of the animals treated with AAV/P2-Int-mIFN-β vector. We also assessed the therapeutic effect of combining AAV-IFN-β therapy with temozolomide (TMZ). As TMZ affects DNA replication, an event that is crucial for second-strand DNA synthesis of single-stranded AAV vectors before active transcription, we tested two TMZ treatment regimens. Treatment with TMZ prior to AAV-IFN-β abrogated any benefit from the latter, while the reverse order of treatment doubled the median survival compared to controls. These studies demonstrate the therapeutic potential of intracranial AAV-IFN-β therapy in a highly migratory GBM model as well as in a syngeneic mouse model and that combination with TMZ is likely to enhance its antitumor potency. © 2016 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

A survey of ex vivo/in vitro transduction efficiency of mammalian primary cells and cell lines with Nine natural adeno-associated virus (AAV1-9) and one engineered adeno-associated virus serotype.

PubMed

Ellis, Brian L; Hirsch, Matthew L; Barker, Jenny C; Connelly, Jon P; Steininger, Robert J; Porteus, Matthew H

2013-03-06

The ability to deliver a gene of interest into a specific cell type is an essential aspect of biomedical research. Viruses can be a useful tool for this delivery, particularly in difficult to transfect cell types. Adeno-associated virus (AAV) is a useful gene transfer vector because of its ability to mediate efficient gene transduction in numerous dividing and quiescent cell types, without inducing any known pathogenicity. There are now a number of natural for that designed AAV serotypes that each has a differential ability to infect a variety of cell types. Although transduction studies have been completed, the bulk of the studies have been done in vivo, and there has never been a comprehensive study of transduction ex vivo/in vitro. Each cell type was infected with each serotype at a multiplicity of infection of 100,000 viral genomes/cell and transduction was analyzed by flow cytometry + . We found that AAV1 and AAV6 have the greatest ability to transduce a wide range of cell types, however, for particular cell types, there are specific serotypes that provide optimal transduction. In this work, we describe the transduction efficiency of ten different AAV serotypes in thirty-four different mammalian cell lines and primary cell types. Although these results may not be universal due to numerous factors such as, culture conditions and/ or cell growth rates and cell heterogeneity, these results provide an important and unique resource for investigators who use AAV as an ex vivo gene delivery vector or who work with cells that are difficult to transfect.

The Assembly-Activating Protein Promotes Stability and Interactions between AAV's Viral Proteins to Nucleate Capsid Assembly.

PubMed

Maurer, Anna C; Pacouret, Simon; Cepeda Diaz, Ana Karla; Blake, Jessica; Andres-Mateos, Eva; Vandenberghe, Luk H

2018-05-08

The adeno-associated virus (AAV) vector is a preferred delivery platform for in vivo gene therapy. Natural and engineered variations of the AAV capsid affect a plurality of phenotypes relevant to gene therapy, including vector production and host tropism. Fundamental to these aspects is the mechanism of AAV capsid assembly. Here, the role of the viral co-factor assembly-activating protein (AAP) was evaluated in 12 naturally occurring AAVs and 9 putative ancestral capsid intermediates. The results demonstrate increased capsid protein stability and VP-VP interactions in the presence of AAP. The capsid's dependence on AAP can be partly overcome by strengthening interactions between monomers within the assembly, as illustrated by the transfer of a minimal motif defined by a phenotype-to-phylogeny mapping method. These findings suggest that the emergence of AAP within the Dependovirus genus relaxes structural constraints on AAV assembly in favor of increasing the degrees of freedom for the capsid to evolve. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Stacking up CRISPR against RNAi for therapeutic gene inhibition.

PubMed

Haussecker, Dirk

2016-09-01

Both RNA interference (RNAi) and clustered regularly-interspaced short palindromic repeats (CRISPR) technologies allow for the sequence-specific inhibition of gene function and therefore have the potential to be used as therapeutic modalities. By judging the current public and scientific journal interest, it would seem that CRISPR, by enabling clean, durable knockouts, will dominate therapeutic gene inhibition, also at the expense of RNAi. This review aims to look behind prevailing sentiments and to more clearly define the likely scope of the therapeutic applications of the more recently developed CRISPR technology and its relative strengths and weaknesses with regards to RNAi. It is found that largely because of their broadly overlapping delivery constraints, while CRISPR presents formidable competition for DNA-directed RNAi strategies, its impact on RNAi therapeutics triggered by synthetic oligonucleotides will likely be more moderate. Instead, RNAi and genome editing, and in particular CRISPR, are poised to jointly promote a further shift toward sequence-targeted precision medicines. © 2016 Federation of European Biochemical Societies.

RNAi KNOCKDOWN OF BmRab3 LED TO LARVA AND PUPA LETHALITY IN SILKWORM Bombyx mori L.

PubMed

Singh, Chabungbam Orville; Xin, Hu-hu; Chen, Rui-ting; Wang, Mei-xian; Liang, Shuang; Lu, Yan; Cai, Zi-zheng; Zhang, Deng-pan; Miao, Yun-gen

2015-06-01

Rab3 GTPases are known to play key a role in vesicular trafficking, and express highest in brain and endocrine tissues. In mammals, Rab3 GTPases are paralogs unlike in insect. In this study, we cloned Rab3 from the silk gland tissue of silkworm Bombyx mori, and identified it as BmRab3. Our in silico analysis indicated that BmRab3 is an isoform with a theoretical isoelectric point and molecular weight of 5.52 and 24.3 kDa, respectively. Further, BmRab3 showed the C-terminal hypervariability for GGT2 site but having two other putative guanine nucleotide exchange factor/GDP dissociation inhibitor interaction sites. Multiple alignment sequence indicated high similarities of BmRab3 with Rab3 isoforms of other species. The phylogeny tree showed BmRab3 clustered between the species of Tribolium castaneum and Aedes aegypti. Meanwhile, the expression analysis of BmRab3 showed the highest expression in middle silk glands (MSGs) than all other tissues in the third day of fifth-instar larva. Simultaneously, we showed the differential expression of BmRab3 in the early instar larva development, followed by higher expression in male than female pupae. In vivo dsRNA interference of BmRab3 reduced the expression of BmRab3 by 75% compared to the control in the MSGs in the first day. But as the worm grew to the third day, the difference of BmRab3 between knockdown and control was only about 10%. The knockdown later witnessed underdevelopment of the larvae and pharate pupae lethality in the overall development of silkworm B. mori L. © 2015 Wiley Periodicals, Inc.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

RNAi-Mediated Knockdown of Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate of Spodoptera litura (Fabricius)

PubMed Central

Hu, Meiying; Chen, Shaohua; Muhammad, Rizwan-ul-Haq; Dong, Xiaolin; Gong, Liang

2013-01-01

Deregulated reactive oxygen species (ROS) production can lead to the disruption of structural and functional integrity of cells as a consequence of reactive interaction between ROS and various biological components. Catalase (CAT) is a common enzyme existing in nearly all organisms exposed to oxygen, which decomposes harmful hydrogen peroxide, into water and oxygen. In this study, the full length sequence that encodes CAT-like protein from Spodoptera litura named siltCAT (GenBank accession number: JQ_663444) was cloned and characterized. Amino acid sequence alignment showed siltCAT shared relatively high conservation with other insect, especially the conserved residues which defined heme and NADPH orientation. Expression pattern analysis showed that siltCAT mRNA was mainly expressed in the fat body, midgut, cuticle and malpighian tube, and as well as over last instar larvae, pupa and adult stages. RNA interference was used to silence CAT gene in SL-1 cells and the fourth-instar stage of S. litura larvae respectively. Our results provided evidence that CAT knockdown induced ROS generation, cell cycle arrest and apoptosis in SL-1 cells. It also confirmed the decrease in survival rate because of increased ROS production in experimental groups injected with double-stranded RNA of CAT (dsCAT). This study implied that ROS scavenging by CAT is important for S. litura survival. PMID:23555693

Rhox8 Ablation in the Sertoli Cells Using a Tissue-Specific RNAi Approach Results in Impaired Male Fertility in Mice.

PubMed

Welborn, Joshua P; Davis, Matthew G; Ebers, Steven D; Stodden, Genna R; Hayashi, Kanako; Cheatwood, Joseph L; Rao, Manjeet K; MacLean, James A

2015-07-01

The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. © 2015 by the Society for the Study of Reproduction, Inc.

Differential Effects of Histone Acetyltransferase GCN5 or PCAF Knockdown on Urothelial Carcinoma Cells

PubMed Central

Koutsogiannouli, Evangelia A.; Hader, Christiane; Pinkerneil, Maria; Hoffmann, Michèle J.; Schulz, Wolfgang A.

2017-01-01

Disturbances in histone acetyltransferases (HATs) are common in cancers. In urothelial carcinoma (UC), p300 and CBP are often mutated, whereas the GNAT family HATs GCN5 and PCAF (General Control Nonderepressible 5, p300/CBP-Associated Factor) are often upregulated. Here, we explored the effects of specific siRNA-mediated knockdown of GCN5, PCAF or both in four UC cell lines (UCCs). Expression of various HATs and marker proteins was measured by qRT-PCR and western blot. Cellular effects of knockdowns were analyzed by flow cytometry and ATP-, caspase-, and colony forming-assays. GCN5 was regularly upregulated in UCCs, whereas PCAF was variable. Knockdown of GCN5 or both GNATs, but not of PCAF alone, diminished viability and inhibited clonogenic growth in 2/4 UCCs, inducing cell cycle changes and caspase-3/7 activity. PCAF knockdown elicited GCN5 mRNA upregulation. Double knockdown increased c-MYC and MDM2 (Mouse Double Minute 2) in most cell lines. In conclusion, GCN5 upregulation is especially common in UCCs. GCN5 knockdown impeded growth of specific UCCs, whereas PCAF knockdown elicited minor effects. The limited sensitivity towards GNAT knockdown and its variation between the cell lines might be due to compensatory effects including HAT, c-MYC and MDM2 upregulation. Our results predict that developing drugs targeting individual HATs for UC treatment may be challenging. PMID:28678170

Autonomously folded α-helical lockers promote RNAi*

NASA Astrophysics Data System (ADS)

Guyader, Christian P. E.; Lamarre, Baptiste; de Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

2016-10-01

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

Autonomously folded α-helical lockers promote RNAi*

PubMed Central

Guyader, Christian P. E.; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

2016-01-01

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi. PMID:27721465

Autonomously folded α-helical lockers promote RNAi.

PubMed

Guyader, Christian P E; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E; Slater, Nigel K; Ryadnov, Maxim G

2016-10-10

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

Suppression of RND3 activity by AES downregulation promotes cancer cell proliferation and invasion.

PubMed

Xia, Hongwei; Li, Mingxing; Chen, Liang; Leng, Weibing; Yuan, Dandan; Pang, Xiaohui; Chen, Liu; Li, Ronghui; Tang, Qiulin; Bi, Feng

2013-05-01

Amino-terminal enhancer of split (AES) is a member of the Groucho/TLE family. Although it has no DNA-binding site, AES can regulate transcriptional activity by interacting with transcriptional factors. Emerging evidence indicates that AES may play an important role in tumor metastasis, but the molecular mechanism is still poorly understood. In this study, we found that knockdown of AES by RNA interference (RNAi) downregulated RND3 expression at the mRNA and protein levels in MDA-MB-231 and HepG2, two cancer cell lines. Furthermore, luciferase assays showed that overexpression of AES significantly enhanced RND3 promoter activity. Moreover, inhibition of AES both in MDA-MB-231 and HepG2 cells by RNAi significantly promoted cell proliferation, cell cycle progression and invasion, consistent with the effects of RNAi-mediated RND3 knockdown in these cells. For the first time, data are presented showing that alteration of the malignant behavior of cancer cells by AES is related to RND3 regulation, and these findings also provide new insights into the mechanism of AES action in regulating tumor malignancy.

RNAi therapeutics for brain cancer: current advancements in RNAi delivery strategies.

PubMed

Malhotra, Meenakshi; Toulouse, André; Godinho, Bruno M D C; Mc Carthy, David John; Cryan, John F; O'Driscoll, Caitriona M

2015-10-01

Malignant primary brain tumors are aggressive cancerous cells that invade the surrounding tissues of the central nervous system. The current treatment options for malignant brain tumors are limited due to the inability to cross the blood-brain barrier. The advancements in current research has identified and characterized certain molecular markers that are essential for tumor survival, progression, metastasis and angiogenesis. These molecular markers have served as therapeutic targets for the RNAi based therapies, which enable site-specific silencing of the gene responsible for tumor proliferation. However, to bring about therapeutic success, an efficient delivery carrier that can cross the blood-brain barrier and reach the targeted site is essential. The current review focuses on the potential of targeted, non-viral and viral particles containing RNAi therapeutic molecules as delivery strategies specifically for brain tumors.

Enhancement of UVB radiation-mediated apoptosis by knockdown of cytosolic NADP+-dependent isocitrate dehydrogenase in HaCaT cells.

PubMed

Lee, Su Jeong; Park, Jeen-Woo

2014-04-01

Ultraviolet B (UVB) radiation induces the production of reactive oxygen species (ROS) that promote apoptotic cell death. We showed that cytosolic NADP+-dependent isocitrate dehydrogenase (IDPc) plays an essential role in the control of cellular redox balance and defense against oxidative damage, by supplying NADPH for antioxidant systems. In this study, we demonstrated that knockdown of IDPc expression by RNA interference enhances UVB-induced apoptosis of immortalized human HaCaT keratinocytes. This effect manifested as DNA fragmentation, changes in cellular redox status, mitochondrial dysfunction, and modulation of apoptotic marker expression. Based on our findings, we suggest that attenuation of IDPc expression may protect skin from UVB-mediated damage, by inducing the apoptosis of UV-damaged cells.

Effects of insecticides chlorpyrifos, emamectin benzoate and fipronil on Spodoptera litura might be mediated by OBPs and CSPs.

PubMed

Lin, X; Jiang, Y; Zhang, L; Cai, Y

2017-12-04

Spodoptera litura is a widespread polyphagous insect pest that can develop resistance and cross-resistance to insecticides, making it difficult to control. Insecticide exposure has previously been linked with induction of specific olfactory-related proteins, including some chemosensory proteins (CSPs) and odorant-binding proteins (OPBs), which may disrupt detection of environmental factors and reduce fitness. However, functional evidence supporting insecticide and OBPs/CSPs mediation remains unknown. Here we fed male S. litura moths with sucrose water containing one of three insecticides, chlorpyrifos, emamectin benzoate or fipronil, and used real-time quantitative polymerase chain reaction and RNAi to investigate OBPs and CSPs expression and their correlations with survival. Chlorpyrifos and emamectin benzoate increased expression of 78% of OBPs, plus 63 and 56% of CSP genes, respectively, indicating a major impact on these gene families. RNAi knockdown of SlituCSP18, followed by feeding with chlorpyrifos or fipronil, decreased survival rates of male moths significantly compared with controls. Survival rate also decreased significantly with the downregulation of SlituOBP9 followed by feeding with chlorpyrifos. Thus, although these three insecticides had different effects on OBP and CSP gene expression, we hypothesize that SlituOBPs and SlituCSPs might mediate their effects by increasing their expression levels to improve survival. Moreover, the differential response of S. litura male moths to the three insecticides indicated the potential specificity of chlorpyrifos affect SlituCSP18 and SlituOBP9 expression.

Long-Term Correction of Sandhoff Disease Following Intravenous Delivery of rAAV9 to Mouse Neonates

PubMed Central

Walia, Jagdeep S; Altaleb, Naderah; Bello, Alexander; Kruck, Christa; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Chowdhury, Biswajit; Hurlbut, David; Hemming, Richard; Kobinger, Gary P; Triggs-Raine, Barbara

2015-01-01

GM2 gangliosidoses are severe neurodegenerative disorders resulting from a deficiency in β-hexosaminidase A activity and lacking effective therapies. Using a Sandhoff disease (SD) mouse model (Hexb−/−) of the GM2 gangliosidoses, we tested the potential of systemically delivered adeno-associated virus 9 (AAV9) expressing Hexb cDNA to correct the neurological phenotype. Neonatal or adult SD and normal mice were intravenously injected with AAV9-HexB or –LacZ and monitored for serum β-hexosaminidase activity, motor function, and survival. Brain GM2 ganglioside, β-hexosaminidase activity, and inflammation were assessed at experimental week 43, or an earlier humane end point. SD mice injected with AAV9-LacZ died by 17 weeks of age, whereas all neonatal AAV9-HexB–treated SD mice survived until 43 weeks (P < 0.0001) with only three exhibiting neurological dysfunction. SD mice treated as adults with AAV9-HexB died between 17 and 35 weeks. Neonatal SD-HexB–treated mice had a significant increase in brain β-hexosaminidase activity, and a reduction in GM2 ganglioside storage and neuroinflammation compared to adult SD-HexB– and SD-LacZ–treated groups. However, at 43 weeks, 8 of 10 neonatal-HexB injected control and SD mice exhibited liver or lung tumors. This study demonstrates the potential for long-term correction of SD and other GM2 gangliosidoses through early rAAV9 based systemic gene therapy. PMID:25515709

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

Adenovirus-Associated Virus Vector–Mediated Gene Transfer in Hemophilia B

PubMed Central

Nathwani, Amit C.; Tuddenham, Edward G.D.; Rangarajan, Savita; Rosales, Cecilia; McIntosh, Jenny; Linch, David C.; Chowdary, Pratima; Riddell, Anne; Pie, Arnulfo Jaquilmac; Harrington, Chris; O’Beirne, James; Smith, Keith; Pasi, John; Glader, Bertil; Rustagi, Pradip; Ng, Catherine Y.C.; Kay, Mark A.; Zhou, Junfang; Spence, Yunyu; Morton, Christopher L.; Allay, James; Coleman, John; Sleep, Susan; Cunningham, John M.; Srivastava, Deokumar; Basner-Tschakarjan, Etiena; Mingozzi, Federico; High, Katherine A.; Gray, John T.; Reiss, Ulrike M.; Nienhuis, Arthur W.; Davidoff, Andrew M.

2012-01-01

BACKGROUND Hemophilia B, an X-linked disorder, is ideally suited for gene therapy. We investigated the use of a new gene therapy in patients with the disorder. METHODS We infused a single dose of a serotype-8–pseudotyped, self-complementary adenovirus-associated virus (AAV) vector expressing a codon-optimized human factor IX (FIX) transgene (scAAV2/8-LP1-hFIXco) in a peripheral vein in six patients with severe hemophilia B (FIX activity, <1% of normal values). Study participants were enrolled sequentially in one of three cohorts (given a high, intermediate, or low dose of vector), with two participants in each group. Vector was administered without immunosuppressive therapy, and participants were followed for 6 to 16 months. RESULTS AAV-mediated expression of FIX at 2 to 11% of normal levels was observed in all participants. Four of the six discontinued FIX prophylaxis and remained free of spontaneous hemorrhage; in the other two, the interval between prophylactic injections was increased. Of the two participants who received the high dose of vector, one had a transient, asymptomatic elevation of serum aminotransferase levels, which was associated with the detection of AAV8-capsid–specific T cells in the peripheral blood; the other had a slight increase in liver-enzyme levels, the cause of which was less clear. Each of these two participants received a short course of glucocorticoid therapy, which rapidly normalized aminotransferase levels and maintained FIX levels in the range of 3 to 11% of normal values. CONCLUSIONS Peripheral-vein infusion of scAAV2/8-LP1-hFIXco resulted in FIX transgene expression at levels sufficient to improve the bleeding phenotype, with few side effects. Although immune-mediated clearance of AAV-transduced hepatocytes remains a concern, this process may be controlled with a short course of glucocorticoids without loss of transgene expression. (Funded by the Medical Research Council and others; ClinicalTrials.gov number, NCT00979238

Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing.

PubMed

Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A

2013-08-01

Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

JNK signaling mediates EPHA2-dependent tumor cell proliferation, motility, and cancer stem cell-like properties in non-small cell lung cancer

PubMed Central

Song, Wenqiang; Ma, Yufang; Wang, Jialiang; Brantley-Sieders, Dana; Chen, Jin

2014-01-01

Recent genome-wide analyses in human lung cancer revealed that EPHA2 receptor tyrosine kinase is overexpressed in non-small cell lung cancer (NSCLC), and high levels of EPHA2 correlate with poor clinical outcome. However, the mechanistic basis for EPHA2-mediated tumor promotion in lung cancer remains poorly understood. Here we show that the JNK/c-JUN signaling mediates EPHA2-dependent tumor cell proliferation and motility. A screen of phospho-kinase arrays revealed a decrease in phospho-c-JUN levels in EPHA2 knockdown cells. Knockdown of EPHA2 inhibited p-JNK and p-c-JUN levels in approximately 50% of NSCLC lines tested. Treatment of parental cells with SP600125, a JNK inhibitor, recapitulated defects in EPHA2-deficient tumor cells; whereas constitutively activated JNK mutants were sufficient to rescue phenotypes. Knockdown of EPHA2 also inhibited tumor formation and progression in xenograft animal models in vivo. Furthermore, we investigated the role of EPHA2 in cancer stem-like cells. RNAi-mediated depletion of EPHA2 in multiple NSCLC lines decreased the ALDH positive cancer stem-like population and tumor spheroid formation in suspension. Depletion of EPHA2 in sorted ALDH positive populations markedly inhibited tumorigenicity in nude mice. Furthermore, analysis of a human lung cancer tissue microarray revealed a significant, positive association between EPHA2 and ALDH expression, indicating an important role for EPHA2 in human lung cancer stem-like cells. Collectively, these studies revealed a critical role of JNK signaling in EPHA2-dependent lung cancer cell proliferation and motility and a role for EPHA2 in cancer stem-like cell function, providing evidence for EPHA2 as a potential therapeutic target in NSCLC. PMID:24607842

AAV delivery of GRP78/BiP promotes adaptation of human RPE cell to ER stress.

PubMed

Ghaderi, Shima; Ahmadian, Shahin; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Samiei, Shahram; Kheitan, Samira; Pirmardan, Ehsan R

2018-02-01

Adeno associated virus (AAV)-mediated gene delivery of GRP78 (78 kDa glucose-regulated protein) attenuates the condition of endoplasmic reticulum (ER) stress and prevents apoptotic loss of photoreceptors in Retinitis pigmentosa (RP) rats. In the current study we overexpressed Grp78 with the help of AAV-2 in primary human retinal pigmented epithelium (hRPE) cell cultures and examined its effect on cell response to ER stress. The purpose of this work was studying potential stimulating effect of GRP78 on adaptation/pro-survival of hRPE cells under ER stress, as an in vitro model for RPE degeneration. To investigate the effect of Grp78 overexpression on unfolded protein response (UPR) markers under ER stress, hRPE primary cultures were transduced by recombinant virus rAAV/Grp78, and treated with ER stressor drug, tunicamycin. Expression changes of four UPR markers including GRP78, PERK, ATF6α, and GADD153/CHOP, were assessed by real-time PCR and western blotting. We found that GRP78 has a great contribution in modulation of UPR markers to favor adaptive response in ER-stressed hRPE cells. In fact, GRP78 overexpression affected adaptation and apoptotic phases of early UPR, through enhancement of two master regulators/ER stress sensors (PERK and ATF6α) and down-regulation of a key pro-apoptotic cascade activator (GADD153/CHOP). Together these findings demonstrate the promoting effect of GRP78 on adaptation/pro-survival of hRPE cells under ER stress. This protein with anti-apoptotic actions in the early UPR and important role in cell fate regulation, can be recruited as a useful candidate for future investigations of RPE degenerative diseases. © 2017 Wiley Periodicals, Inc.

Recent progress and considerations for AAV gene therapies targeting the central nervous system.

PubMed

Lykken, Erik Allen; Shyng, Charles; Edwards, Reginald James; Rozenberg, Alejandra; Gray, Steven James

2018-05-18

Neurodevelopmental disorders, as a class of diseases, have been particularly difficult to treat even when the underlying cause(s), such as genetic alterations, are understood. What treatments do exist are generally not curative and instead seek to improve quality of life for affected individuals. The advent of gene therapy via gene replacement offers the potential for transformative therapies to slow or even stop disease progression for current patients and perhaps minimize or prevent the appearance of symptoms in future patients. This review focuses on adeno-associated virus (AAV) gene therapies for diseases of the central nervous system. An overview of advances in AAV vector design for therapy is provided, along with a description of current strategies to develop AAV vectors with tailored tropism. Next, progress towards treatment of neurodegenerative diseases is presented at both the pre-clinical and clinical stages, focusing on a few select diseases to highlight broad categories of therapeutic parameters. Special considerations for more challenging cases are then discussed in addition to the immunological aspects of gene therapy. With the promising clinical trial results that have been observed for the latest AAV gene therapies and continued pre-clinical successes, the question is no longer whether a therapy can be developed for certain neurodevelopmental disorders, but rather, how quickly.

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

Widespread transduction of astrocytes and neurons in the mouse central nervous system after systemic delivery of a self-complementary AAV-PHP.B vector.

PubMed

Rincon, Melvin Y; de Vin, Filip; Duqué, Sandra I; Fripont, Shelly; Castaldo, Stephanie A; Bouhuijzen-Wenger, Jessica; Holt, Matthew G

2018-04-01

Until recently, adeno-associated virus 9 (AAV9) was considered the AAV serotype most effective in crossing the blood-brain barrier (BBB) and transducing cells of the central nervous system (CNS), following systemic injection. However, a newly engineered capsid, AAV-PHP.B, is reported to cross the BBB at even higher efficiency. We investigated how much we could boost CNS transgene expression by using AAV-PHP.B carrying a self-complementary (sc) genome. To allow comparison, 6 weeks old C57BL/6 mice received intravenous injections of scAAV2/9-GFP or scAAV2/PHP.B-GFP at equivalent doses. Three weeks postinjection, transgene expression was assessed in brain and spinal cord. We consistently observed more widespread CNS transduction and higher levels of transgene expression when using the scAAV2/PHP.B-GFP vector. In particular, we observed an unprecedented level of astrocyte transduction in the cortex, when using a ubiquitous CBA promoter. In comparison, neuronal transduction was much lower than previously reported. However, strong neuronal expression (including spinal motor neurons) was observed when the human synapsin promoter was used. These findings constitute the first reported use of an AAV-PHP.B capsid, encapsulating a scAAV genome, for gene transfer in adult mice. Our results underscore the potential of this AAV construct as a platform for safer and more efficacious gene therapy vectors for the CNS.

The Adaptor Molecule Nck Localizes the WAVE Complex to Promote Actin Polymerization during CEACAM3-Mediated Phagocytosis of Bacteria

PubMed Central

Delgado Tascón, Julia; Nyffenegger-Jann, Naja J.; Hauck, Christof R.

2012-01-01

Background CEACAM3 is a granulocyte receptor mediating the opsonin-independent recognition and phagocytosis of human-restricted CEACAM-binding bacteria. CEACAM3 function depends on an intracellular immunoreceptor tyrosine-based activation motif (ITAM)-like sequence that is tyrosine phosphorylated by Src family kinases upon receptor engagement. The phosphorylated ITAM-like sequence triggers GTP-loading of Rac by directly associating with the guanine nucleotide exchange factor (GEF) Vav. Rac stimulation in turn is critical for actin cytoskeleton rearrangements that generate lamellipodial protrusions and lead to bacterial uptake. Principal Findings In our present study we provide biochemical and microscopic evidence that the adaptor proteins Nck1 and Nck2, but not CrkL, Grb2 or SLP-76, bind to tyrosine phosphorylated CEACAM3. The association is phosphorylation-dependent and requires the Nck SH2 domain. Overexpression of the isolated Nck1 SH2 domain, RNAi-mediated knock-down of Nck1, or genetic deletion of Nck1 and Nck2 interfere with CEACAM3-mediated bacterial internalization and with the formation of lamellipodial protrusions. Nck is constitutively associated with WAVE2 and directs the actin nucleation promoting WAVE complex to tyrosine phosphorylated CEACAM3. In turn, dominant-negative WAVE2 as well as shRNA-mediated knock-down of WAVE2 or the WAVE-complex component Nap1 reduce internalization of bacteria. Conclusions Our results provide novel mechanistic insight into CEACAM3-initiated phagocytosis. We suggest that the CEACAM3 ITAM-like sequence is optimized to co-ordinate a minimal set of cellular factors needed to efficiently trigger actin-based lamellipodial protrusions and rapid pathogen engulfment. PMID:22448228

Adeno-associated virus-mediated expression of myostatin propeptide improves the growth of skeletal muscle and attenuates hyperglycemia in db/db mice.

PubMed

Jiang, J G; Shen, G F; Li, J; Qiao, C; Xiao, B; Yan, H; Wang, D W; Xiao, X

2017-03-01

Inhibition of myostatin, a negative growth modulator for muscle, can functionally enhance muscle mass and improve glucose and fat metabolism in myostatin propeptide (MPRO) transgenic mice. This study was to investigate whether myostatin inhibition by adeno-associated virus (AAV)-mediated gene delivery of MPRO could improve muscle mass and achieve therapeutic effects on glucose regulation and lipid metabolism in the db/db mice and the mechanisms involved in that process. Eight-week-old male db/db mice were administered saline, AAV-GFP and AAV-MPRO/Fc vectors and monitored random blood glucose levels and body weight for 36 weeks. Body weight gain was not different during follow-up among the groups, but AAV-MPRO/Fc vectors resulted high level of MPRO in the blood companied by an increase in skeletal muscle mass and muscle hypertrophy. In addition, AAV-MPRO/Fc-treated db/db mice showed significantly lower blood glucose and insulin levels and significantly increased glucose tolerance and insulin sensitivity compared with the control groups (P<0.05). Moreover, these mice exhibited lower triglyceride (TG) and free fatty acid (FFA) content in the skeletal muscle, although no difference was observed in fat pad weights and serum TG and FFA levels. Finally, AAV-MPRO/Fc-treated mice had enhanced insulin signaling in the skeletal muscle. These data suggest that AAV-mediated MPRO therapy may provide an important clue for potential clinical applications to prevent type II diabetes, and these studies confirm that MPRO is a therapeutic target for type II diabetes.

Chondrogenic Differentiation Processes in Human Bone Marrow Aspirates Seeded in Three-Dimensional Woven Poly(ε-Caprolactone) Scaffolds Enhanced by rAAV-Mediated SOX9 Gene Transfer.

PubMed

Venkatesan, Jagadeesh Kumar; Moutos, Franklin T; Rey-Rico, Ana; Estes, Bradley T; Frisch, Janina; Schmitt, Gertrud; Madry, Henning; Guilak, Farshid; Cucchiarini, Magali

2018-05-02

Combining gene therapy approaches with tissue engineering procedures is an active area of translational research for the effective treatment of articular cartilage lesions, especially to target chondrogenic progenitor cells such as those derived from the bone marrow. Here, we evaluated the effect of genetically modifying concentrated human mesenchymal stem cells from bone marrow to induce chondrogenesis by recombinant adeno-associated viral (rAAV) vector gene transfer of the sex-determining region Y-type high-mobility group box 9 (SOX9) factor upon seeding in three-dimensional (3D) woven poly(ε-caprolactone) (PCL) scaffolds that provide mechanical properties mimicking those of native articular cartilage. Prolonged, effective SOX9 expression was reported in the constructs for at least 21 days, the longest time point evaluated, leading to enhanced metabolic and chondrogenic activities relative to the control conditions (reporter lacZ gene transfer or absence of vector treatment) but without affecting the proliferative activities in the samples. The application of the rAAV SOX9 vector also prevented undesirable hypertrophic and terminal differentiation in the seeded concentrates. As bone marrow is readily accessible during surgery, such findings reveal the therapeutic potential of providing rAAV-modified marrow concentrates within 3D woven PCL scaffolds for repair of focal cartilage lesions.

RNAi-mediated gene silencing of WsSGTL1 in W.somnifera affects growth and glycosylation pattern

PubMed Central

Saema, Syed; Rahman, Laiq ur; Niranjan, Abhishek; Ahmad, Iffat Zareen; Misra, Pratibha

2015-01-01

Sterol glycosyltransferases (SGTs) belong to family 1 of glycosyltransferases (GTs) and are enzymes responsible for synthesis of sterol–glucosides (SGs) in many organisms. WsSGTL1 is a SGT of Withania somnifera that has been found associated with plasma membranes. However its biological function in W.somnifera is largely unknown. In the present study, we have demonstrated through RNAi silencing of WsSGTL1 gene that it performs glycosylation of withanolides and sterols resulting in glycowithanolides and glycosylated sterols respectively, and affects the growth and development of transgenic W.somnifera. For this, RNAi construct (pFGC1008-WsSGTL1) was made and genetic transformation was done by Agrobacterium tumefaciens. HPLC analysis depicts the reduction of withanoside V (the glycowithanolide of W.somnifera) and a large increase of withanolides (majorly withaferin A) content. Also, a significant decrease in level of glycosylated sterols has been observed. Hence, the obtained data provides an insight into the biological function of WsSGTL1 gene in W.somnifera. PMID:26357855

RNAi as a Routine Route Toward Breast Cancer Therapy

DTIC Science & Technology

2013-09-01

Award Number: W81XWH-08-1-0572 TITLE: RNAi as a Routine Route Toward Breast Cancer Therapy...To) 1 SEP 2012 - 31 AUG 2013 4. TITLE AND SUBTITLE RNAi as a Routine Route Toward Breast Cancer Therapy 5a. CONTRACT NUMBER...generation RNAi library and made that available to the breast cancer community. This resource has nearly 75,000 independent, sequence verified clones

Angiogenin in Parkinson Disease Models: Role of Akt Phosphorylation and Evaluation of AAV-Mediated Angiogenin Expression in MPTP Treated Mice

PubMed Central

Steidinger, Trent U.; Slone, Sunny R.; Ding, Huiping; Standaert, David G.; Yacoubian, Talene A.

2013-01-01

The angiogenic factor, angiogenin, has been recently linked to both Amyotrophic Lateral Sclerosis (ALS) and Parkinson Disease (PD). We have recently shown that endogenous angiogenin levels are dramatically reduced in an alpha-synuclein mouse model of PD and that exogenous angiogenin protects against cell loss in neurotoxin-based cellular models of PD. Here, we extend our studies to examine whether activation of the prosurvival Akt pathway is required for angiogenin's neuroprotective effects against 1-methyl-4-phenylpyridinium (MPP+), as observed in ALS models, and to test the effect of virally-mediated overexpression of angiogenin in an in vivo PD model. Using a dominant negative Akt construct, we demonstrate that inhibition of the Akt pathway does not reduce the protective effect of angiogenin against MPP+ toxicity in the dopaminergic SH-SY5Y cell line. Furthermore, an ALS-associated mutant of angiogenin, K40I, which fails to induce Akt phosphorylation, was similar to wildtype angiogenin in protection against MPP+. These results confirm previous work showing neuroprotective effects of angiogenin against MPP+, and indicate that Akt is not required for this protective effect. We also investigated whether adeno-associated viral serotype 2 (AAV2)-mediated overexpression of angiogenin protects against dopaminergic neuron loss in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model. We found that angiogenin overexpression using this approach does not reduce the MPTP-induced degeneration of dopaminergic cells in the substantia nigra, nor limit the depletion of dopamine and its metabolites in the striatum. Together, these findings extend the evidence for protective effects of angiogenin in vitro, but also suggest that further study of in vivo models is required to translate these effects into meaningful therapies. PMID:23409128

Enhancement of UVB radiation-mediated apoptosis by knockdown of cytosolic NADP+-dependent isocitrate dehydrogenase in HaCaT cells

PubMed Central

Lee, Su Jeong; Park, Jeen-Woo

2014-01-01

Ultraviolet B (UVB) radiation induces the production of reactive oxygen species (ROS) that promote apoptotic cell death. We showed that cytosolic NADP+-dependent isocitrate dehydrogenase (IDPc) plays an essential role in the control of cellular redox balance and defense against oxidative damage, by supplying NADPH for antioxidant systems. In this study, we demonstrated that knockdown of IDPc expression by RNA interference enhances UVB-induced apoptosis of immortalized human HaCaT keratinocytes. This effect manifested as DNA fragmentation, changes in cellular redox status, mitochondrial dysfunction, and modulation of apoptotic marker expression. Based on our findings, we suggest that attenuation of IDPc expression may protect skin from UVB-mediated damage, by inducing the apoptosis of UV-damaged cells. [BMB Reports 2014; 47(4): 209-214] PMID:24286310

Efficient CNS targeting in adult mice by intrathecal infusion of single-stranded AAV9-GFP for gene therapy of neurological disorders.

PubMed

Bey, K; Ciron, C; Dubreil, L; Deniaud, J; Ledevin, M; Cristini, J; Blouin, V; Aubourg, P; Colle, M-A

2017-05-01

Adeno-associated virus (AAV) gene therapy constitutes a powerful tool for the treatment of neurodegenerative diseases. While AAVs are generally administered systemically to newborns in preclinical studies of neurological disorders, in adults the maturity of the blood-brain barrier (BBB) must be considered when selecting the route of administration. Delivery of AAVs into the cerebrospinal fluid (CSF) represents an attractive approach to target the central nervous system (CNS) and bypass the BBB. In this study, we investigated the efficacy of intra-CSF delivery of a single-stranded (ss) AAV9-CAG-GFP vector in adult mice via intracisternal (iCist) or intralumbar (it-Lumb) administration. It-Lumb ssAAV9 delivery resulted in greater diffusion throughout the entire spinal cord and green fluorescent protein (GFP) expression mainly in the cerebellum, cortex and olfactory bulb. By contrast, iCist delivery led to strong GFP expression throughout the entire brain. Comparison of the transduction efficiency of ssAAV9-CAG-GFP versus ssAAV9-SYN1-GFP following it-Lumb administration revealed widespread and specific GFP expression in neurons and motoneurons of the spinal cord and brain when the neuron-specific synapsin 1 (SYN1) promoter was used. Our findings demonstrate that it-Lumb ssAAV9 delivery is a safe and highly efficient means of targeting the CNS in adult mice.

Automated microscopy for high-content RNAi screening

PubMed Central

2010-01-01

Fluorescence microscopy is one of the most powerful tools to investigate complex cellular processes such as cell division, cell motility, or intracellular trafficking. The availability of RNA interference (RNAi) technology and automated microscopy has opened the possibility to perform cellular imaging in functional genomics and other large-scale applications. Although imaging often dramatically increases the content of a screening assay, it poses new challenges to achieve accurate quantitative annotation and therefore needs to be carefully adjusted to the specific needs of individual screening applications. In this review, we discuss principles of assay design, large-scale RNAi, microscope automation, and computational data analysis. We highlight strategies for imaging-based RNAi screening adapted to different library and assay designs. PMID:20176920

Knockdown of an inflorescence meristem-specific cytokinin oxidase - OsCKX2 in rice reduces yield penalty under salinity stress condition.

PubMed

Joshi, Rohit; Sahoo, Khirod Kumar; Tripathi, Amit Kumar; Kumar, Ritesh; Gupta, Brijesh Kumar; Pareek, Ashwani; Singla-Pareek, Sneh Lata

2018-05-01

Cytokinins play a significant role in determining grain yield in plants. Cytokinin oxidases catalyse irreversible degradation of cytokinins and hence modulate cellular cytokinin levels. Here, we studied the role of an inflorescence meristem-specific rice cytokinin oxidase - OsCKX2 - in reducing yield penalty under salinity stress conditions. We utilized an RNAi-based approach to study the function of OsCKX2 in maintaining grain yield under salinity stress condition. Ultra-performance liquid chromatography-based estimation revealed a significant increase in cytokinins in the inflorescence meristem of OsCKX2-knockdown plants. To determine if there exists a correlation between OsCKX2 levels and yield under salinity stress condition, we assessed the growth, physiology and grain yield of OsCKX2-knockdown plants vis-à-vis the wild type. OsCKX2-knockdown plants showed better vegetative growth, higher relative water content and photosynthetic efficiency and reduced electrolyte leakage as compared with the wild type under salinity stress. Importantly, we found a negative correlation between OsCKX2 expression and plant productivity as evident by assessment of agronomical parameters such as panicle branching, filled grains per plant and harvest index both under control and salinity stress conditions. These results suggest that OsCKX2, via controlling cytokinin levels, regulates floral primordial activity modulating rice grain yield under normal as well as abiotic stress conditions. © 2017 John Wiley & Sons Ltd.

VPS36-Mediated plasma membrane protein turnover is critical for Arabidopsis root gravitropism.

PubMed

Hsu, Ya-Wen; Jauh, Guang-Yuh

2017-04-03

The gravitropic response is an evolutionary adaptation for plants to cope with the altered gravitational field. It involves reestablishing the distribution of the phytohormone auxin by differential degradation of auxin influx and efflux carriers. This process includes the endosomal sorting complexes required for transport (ESCRT) machinery to recognize ubiquitinated proteins and deliver them to vacuoles for degradation, as evidenced by vps36-1 mutants. Here, we generated RNAi knockdown plants of Vacuolar Protein Sorting 36 (VPS36) that could survive to adulthood. VPS36-induced RNAi plants showed PIN FORMED1 (PIN1) accumulation in the intracellular compartment, reduced root length and small stature, as observed in vps36-1 mutants. After gravistimulation, the roots of VPS36-induced RNAi plants did not show the bending observed in wild-type plants. The VPS36-containing ESCRT machinery may have a role in the gravitropic response possibly associated with the degradation of auxin transporters.

Targeting the undruggable: Advances and obstacles in current RNAi therapy

PubMed Central

Wu, Sherry Y.; Lopez-Berestein, Gabriel; Calin, George A.; Sood, Anil K.

2014-01-01

RNA interference (RNAi) therapeutics represents a rapidly emerging platform for personalized cancer treatment. Recent advances in delivery, target selection, and safety of RNAi cancer therapy provide unprecedented opportunities for clinical translation. Here, we discuss these advances and present strategies for making RNAi-based therapy a viable part of cancer management. PMID:24920658

Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione S-transferase

PubMed Central

2010-01-01

Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks

RNAi functionalized scaffold for scarless skin regeneration

PubMed Central

Liu, Xing; Ma, Lie; Gao, Changyou

2013-01-01

Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756

Genetic Tools for Self-Organizing Culture of Mouse Embryonic Stem Cells via Small Regulatory RNA-Mediated Technologies, CRISPR/Cas9, and Inducible RNAi.

PubMed

Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi

2017-01-01

Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.

OfftargetFinder: a web tool for species-specific RNAi design.

PubMed

Good, R T; Varghese, T; Golz, J F; Russell, D A; Papanicolaou, A; Edwards, O; Robin, C

2016-04-15

RNA interference (RNAi) technology is being developed as a weapon for pest insect control. To maximize the specificity that such an approach affords we have developed a bioinformatic web tool that searches the ever-growing arthropod transcriptome databases so that pest-specific RNAi sequences can be identified. This will help technology developers finesse the design of RNAi sequences and suggests which non-target species should be assessed in the risk assessment process. http://rnai.specifly.org crobin@unimelb.edu.au. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Steroid Receptor Coactivator-1 Knockdown Decreases Synaptic Plasticity and Impairs Spatial Memory in the Hippocampus of Mice.

PubMed

Bian, Chen; Huang, Yan; Zhu, Haitao; Zhao, Yangang; Zhao, Jikai; Zhang, Jiqiang

2018-05-01

Steroids have been demonstrated to play profound roles in the regulation of hippocampal function by acting on their receptors, which need coactivators for their transcriptional activities. Previous studies have shown that steroid receptor coactivator-1 (SRC-1) is the predominant coactivator in the hippocampus, but its exact role and the underlying mechanisms remain unclear. In this study, we constructed SRC-1 RNA interference (RNAi) lentiviruses, injected them into the hippocampus of male mice, and then examined the changes in the expression of selected synaptic proteins, CA1 synapse density, postsynaptic density (PSD) thickness, and in vivo long-term potentiation (LTP). Spatial learning and memory behavior changes were investigated using the Morris water maze. We then transfected the lentiviruses into cultured hippocampal cells and examined the changes in synaptic protein and phospho-cyclic AMP response element-binding protein (pCREB) expression. The in vivo results showed that SRC-1 knockdown significantly decreased the expression of synaptic proteins and CA1 synapse density as well as PSD thickness; SRC-1 knockdown also significantly impaired in vivo LTP and disrupted spatial learning and memory. The in vitro results showed that while the expression of synaptic proteins was significantly decreased by SRC-1 knockdown, pCREB expression was also significantly decreased. The above results suggest a pivotal role of SRC-1 in the regulation of hippocampal synaptic plasticity and spatial learning and memory, strongly indicating SRC-1 may serve as a novel therapeutic target for hippocampus-dependent memory disorders. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Fatty acids increase neuronal hypertrophy of Pten knockdown neurons

PubMed Central

Fricano, Catherine J.; DeSpenza, Tyrone; Frazel, Paul W.; Li, Meijie; O'Malley, A. James; Westbrook, Gary L.; Luikart, Bryan W.

2014-01-01

Phosphatase and tensin homolog (Pten) catalyzes the reverse reaction of PI3K by dephosphorylating PIP3 to PIP2. This negatively regulates downstream Akt/mTOR/S6 signaling resulting in decreased cellular growth and proliferation. Co-injection of a lentivirus knocking Pten down with a control lentivirus allows us to compare the effects of Pten knockdown between individual neurons within the same animal. We find that knockdown of Pten results in neuronal hypertrophy by 21 days post-injection. This neuronal hypertrophy is correlated with increased p-S6 and p-mTOR in individual neurons. We used this system to test whether an environmental factor that has been implicated in cellular hypertrophy could influence the severity of the Pten knockdown-induced hypertrophy. Implantation of mini-osmotic pumps delivering fatty acids results in increased neuronal hypertrophy and p-S6/p-mTOR staining. These hypertrophic effects were reversed in response to rapamycin treatment. However, we did not observe a similar increase in hypertrophy in response to dietary manipulations of fatty acids. Thus, we conclude that by driving growth signaling with fatty acids and knocking down a critical regulator of growth, Pten, we are able to observe an additive morphological phenotype of increased soma size mediated by the mTOR pathway. PMID:24795563

Beyond insects: current status, achievements and future perspectives of RNAi in mite pests.

PubMed

Niu, Jinzhi; Shen, Guangmao; Christiaens, Olivier; Smagghe, Guy; He, Lin; Wang, Jinjun

2018-05-11

Mites comprise a group of key agricultural pests on a wide range of crops. They cause harm through feeding on the plant and transferring dangerous pathogens, and the rapid evolution of pesticide resistance in mites highlights the need for novel control methods. Currently, RNA interference (RNAi) shows a great potential for insect pest control. Here, we review the literature associated with RNAi in mite pests. We discuss different target genes and RNAi efficiency in various mite species, a promising Varroa control program through RNAi, the synergy of RNAi with plant defense mechanisms and microorganisms, and the current understandings of systemic movement of dsRNA. Based on this, we can conclude that there is a clear potential for an RNAi-based mite control application but further research on several aspects is needed, including: (i) the factors influencing the RNAi efficiency, (ii) the mechanism of environmental RNAi and cross-kingdom dsRNA trafficking, (iii) the mechanism of possible systemic and parental RNAi, and (iv) non-target effects, specifically in predatory mites, should be considered during the RNAi target selection. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.

PubMed

Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi

2011-01-01

Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.

The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight

PubMed Central

Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi

2011-01-01

Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804

Involvement of Bim in Photofrin-mediated photodynamically induced apoptosis.

PubMed

Wang, Xianwang; He, Xiaobing; Hu, Shujuan; Sun, Anbang; Lu, Chengbiao

2015-01-01

Photodynamic therapy (PDT) is a promising noninvasive technique, which has been successfully applied to the treatment of human cancers. Studies have shown that the Bcl-2 family proteins play important roles in PDT-induced apoptosis. However, whether Bcl-2-interacting mediator of cell death (Bim) is involved in photodynamic treatment remains unknown. In this study, we attempt to determine the effect of Bim on Photofrin photodynamic treatment (PPT)-induced apoptosis in human lung adenocarcinoma ASTC-a-1 cells. The translocation of Bim/Bax of the cells were monitored by laser confocal scanning microscope. The levels of Bim protein and activated caspase-3 in cells were detected by western blot assay. Caspase-3 activities were measured by Caspase-3 Fluorogenic Substrate (Ac-DEVD-AFC) analysis. The induction of apoptosis was detected by Hoechst 33258 and PI staining as well as flow cytometry analysis. The effect of Bim on PPT-induced apoptosis was determined by RNAi. BimL translocated to mitochondria in response to PPT, similar to the downstream pro-apoptotic protein Bax activation. PPT increased the level of Bim and activated caspase-3 in cells and that knockdown of Bim by RNAi significantly protected against caspase-3 activity. PPT-induced apoptosis were suppressed in cells transfected with shRNA-Bim. We demonstrated the involvement of Bim in PPT-induced apoptosis in human ASTC-a-1 lung adenocarcinoma cells and suggested that enhancing Bim activity might be a potential strategy for treating human cancers. © 2015 S. Karger AG, Basel.

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

PubMed

Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

2015-01-29

Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi

PubMed Central

Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.

2015-01-01

SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455

Delivery of RNAi Therapeutics to the Airways-From Bench to Bedside.

PubMed

Qiu, Yingshan; Lam, Jenny K W; Leung, Susan W S; Liang, Wanling

2016-09-20

RNA interference (RNAi) is a potent and specific post-transcriptional gene silencing process. Since its discovery, tremendous efforts have been made to translate RNAi technology into therapeutic applications for the treatment of different human diseases including respiratory diseases, by manipulating the expression of disease-associated gene(s). Similar to other nucleic acid-based therapeutics, the major hurdle of RNAi therapy is delivery. Pulmonary delivery is a promising approach of delivering RNAi therapeutics directly to the airways for treating local conditions and minimizing systemic side effects. It is a non-invasive route of administration that is generally well accepted by patients. However, pulmonary drug delivery is a challenge as the lungs pose a series of anatomical, physiological and immunological barriers to drug delivery. Understanding these barriers is essential for the development an effective RNA delivery system. In this review, the different barriers to pulmonary drug delivery are introduced. The potential of RNAi molecules as new class of therapeutics, and the latest preclinical and clinical studies of using RNAi therapeutics in different respiratory conditions are discussed in details. We hope this review can provide some useful insights for moving inhaled RNAi therapeutics from bench to bedside.

Comparative analysis of RNAi screening technologies at genome-scale reveals an inherent processing inefficiency of the plasmid-based shRNA hairpin.

PubMed

Bhinder, Bhavneet; Shum, David; Djaballah, Hakim

2014-02-01

RNAi screening in combination with the genome-sequencing projects would constitute the Holy Grail of modern genetics; enabling discovery and validation towards a better understanding of fundamental biology leading to novel targets to combat disease. Hit discordance at inter-screen level together with the lack of reproducibility is emerging as the technology's main pitfalls. To examine some of the underlining factors leading to such discrepancies, we reasoned that perhaps there is an inherent difference in knockdown efficiency of the various RNAi technologies. For this purpose, we utilized the two most popular ones, chemically synthesized siRNA duplex and plasmid-based shRNA hairpin, in order to perform a head to head comparison. Using a previously developed gain-of-function assay probing modulators of the miRNA biogenesis pathway, we first executed on a siRNA screen against the Silencer Select V4.0 library (AMB) nominating 1,273, followed by an shRNA screen against the TRC1 library (TRC1) nominating 497 gene candidates. We observed a poor overlap of only 29 hits given that there are 15,068 overlapping genes between the two libraries; with DROSHA as the only common hit out of the seven known core miRNA biogenesis genes. Distinct genes interacting with the same biogenesis regulators were observed in both screens, with a dismal cross-network overlap of only 3 genes (DROSHA, TGFBR1, and DIS3). Taken together, our study demonstrates differential knockdown activities between the two technologies, possibly due to the inefficient intracellular processing and potential cell-type specificity determinants in generating intended targeting sequences for the plasmid-based shRNA hairpins; and suggests this observed inefficiency as potential culprit in addressing the lack of reproducibility.

F1 -ATP synthase α-subunit: a potential target for RNAi-mediated pest management of Locusta migratoria manilensis.

PubMed

Hu, Jun; Xia, Yuxian

2016-07-01

The migratory locust is one of the most destructive agricultural pests worldwide. ATP synthase (F0 F1 -ATPase) uses proton or sodium motive force to produce 90% of the cellular ATP, and the α-subunit of F1 -ATP synthase (ATP5A) is vital for F1 -ATP synthase. Here, we tested whether ATP5A could be a potential target for RNAi-mediated pest management of L. migratoria. Lm-ATP5A was cloned and characterised. Lm-ATP5A is expressed in all tissues. Injection of 100 ng of the double-stranded RNA of ATP5A (dsATP5A) knocked down the transcription of the target gene and caused mortality in 1.5-5 days. The Lm-ATP5A protein level, the oligomycin-sensitive ATP synthetic and hydrolytic activities and the ATP content were correspondingly reduced following dsATP5A injection. These findings demonstrated the essential roles of Lm-ATP5A in L. migratoria and identified it as a potential target for insect pest control. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR.

PubMed

D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard

2016-01-01

Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.