Science.gov

Sample records for abc transporter atp-binding

  1. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  2. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  3. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  4. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  5. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  6. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  7. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  8. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  9. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  10. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  11. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  12. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  13. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  14. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  15. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  16. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  17. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  18. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  19. Construction of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette (ABC) transporters and analysis of their growth under stress conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Listeria monocytogenes is a foodborne pathogen that is difficult to eliminate since it can survive under multiple stress conditions such as low pH and low temperature. Understanding its survival under stress conditions is important to control this pathogen in food. ABC transporters have been shown...

  20. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  1. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  2. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  3. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  4. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette TransporterabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  5. ABC transporters: bacterial exporters.

    PubMed Central

    Fath, M J; Kolter, R

    1993-01-01

    The ABC transporters (also called traffic ATPases) make up a large superfamily of proteins which share a common function and a common ATP-binding domain. ABC transporters are classified into three major groups: bacterial importers (the periplasmic permeases), eukaryotic transporters, and bacterial exporters. We present a comprehensive review of the bacterial ABC exporter group, which currently includes over 40 systems. The bacterial ABC exporter systems are functionally subdivided on the basis of the type of substrate that each translocates. We describe three main groups: protein exporters, peptide exporters, and systems that transport nonprotein substrates. Prototype exporters from each group are described in detail to illustrate our current understanding of this protein family. The prototype systems include the alpha-hemolysin, colicin V, and capsular polysaccharide exporters from Escherichia coli, the protease exporter from Erwinia chrysanthemi, and the glucan exporters from Agrobacterium tumefaciens and Rhizobium meliloti. Phylogenetic analysis of the ATP-binding domains from 29 bacterial ABC exporters indicates that the bacterial ABC exporters can be divided into two primary branches. One branch contains the transport systems where the ATP-binding domain and the membrane-spanning domain are present on the same polypeptide, and the other branch contains the systems where these domains are found on separate polypeptides. Differences in substrate specificity do not correlate with evolutionary relatedness. A complete survey of the known and putative bacterial ABC exporters is included at the end of the review. PMID:8302219

  6. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  7. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  8. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  9. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  10. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  11. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  12. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  13. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  14. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  15. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  16. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  17. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  18. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  19. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  20. The role of ATP binding cassette transporters in tissue defense and organ regeneration.

    PubMed

    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde

    2009-01-01

    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  1. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  2. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  3. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  4. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  5. Mitochondrial ABC transporters.

    PubMed

    Lill, R; Kispal, G

    2001-01-01

    In contrast to bacteria, mitochondria contain only a few ATP binding cassette (ABC) transporters in their inner membrane. The known mitochondrial ABC proteins fall into two major classes that, in the yeast Saccharomyces cerevisiae, are represented by the half-transporter Atm1p and the two closely homologous proteins Mdl1p and Mdl2p. In humans two Atm1p orthologues (ABC7 and MTABC3) and two proteins homologous to Mdll/2p have been localized to mitochondria. The Atm1p-like proteins perform an important function in mitochondrial iron homeostasis and in the maturation of Fe/S proteins in the cytosol. Mutations in ABC7 are causative of hereditary X-linked sideroblastic anemia and cerebellar ataxia (XLSA/A). MTABC3 may be a candidate gene for the lethal neonatal syndrome. The function of the mitochondrial Mdl1/2p-like proteins is not clear at present with the notable exception of murine ABC-me that may transport intermediates of heme biosynthesis from the matrix to the cytosol in erythroid tissues.

  6. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong

    2015-01-01

    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  7. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  8. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  9. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  10. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  11. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  12. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  13. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  14. ABC transporters in the CNS - an inventory.

    PubMed

    Hartz, A M S; Bauer, B

    2011-04-01

    In the present review we provide a summary of ATP-binding cassette (ABC) transporters in the central nervous system (CNS). Our review is focused on transporters of the ABC A, B, C, D, and G families that have been detected in the cells of the neurovascular unit/blood-brain barrier including brain capillary endothelial cells, pericytes, astrocytes, and neurons, as well as in other brain cells, such as microglia, oligodendrocytes, and choroid plexus epithelial cells. In this review, we provide an overview, organized by ABC family, of transporter expression, localization, and function. We summarize recent findings on ABC transporter regulation in the CNS and address the role of ABC transporters in CNS diseases including brain cancer, seizures/epilepsy, and Alzheimer's disease. Finally, we discuss new therapeutic strategies focused on ABC transporters in CNS disease.

  15. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  16. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  17. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  18. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  19. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  20. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  1. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  2. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  3. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  4. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  5. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  6. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  7. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  8. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  9. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  10. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De

    2013-01-01

    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  11. [ABC transporter proteins in multidrug resistance of microorganisms].

    PubMed

    Balková, K; Gbelská, Y

    2007-08-01

    The ABC (ATP binding cassette) transporter family includes membrane proteins that can transport a wide variety of substrates across biological membranes. These proteins play an essential role in the protection of cells from toxic compounds/metabolites. Their overexpression which leads to the development of multidrug resistance (MDR) in pathogens and enables cancer cells to survive chemotherapy is of major concern for human health. Mutations in ABC transporters are implicated in a number of Mendelian disorders such as cystic fibrosis, adrenoleukodystrophy and cholesterol and bile transport defects. In microbial cells, several homologues of human ABC transporters were identified. Their further molecular biological study can contribute to better understanding and treatment of MDR or diseases caused by dysfunction of ABC transporter proteins. A review is presented of the state of the art in ABC transporter proteins in both prokaryotic and eucaryotic cells. The role of microbial ABC transporters in the development of drug resistance is analyzed.

  12. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  13. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  14. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  15. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  16. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  17. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  18. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  19. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  20. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  1. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  2. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.

    PubMed

    Han, B; Zhang, J-T

    2004-01-01

    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  3. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  4. Regulation of ABC Transporters at the Blood-Brain Barrier

    PubMed Central

    Miller, David S.

    2015-01-01

    ATP Binding Cassette (ABC) transporters at the blood-brain barrier function as ATP-driven xenobiotic efflux pumps and limit delivery of small molecule drugs to the brain. Here I review recent progress in understanding the regulation of the expression and transport activity of these transporters and comment on how this new information might aid in improving drug delivery to the brain. PMID:25670036

  5. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  6. Identification and functional characterization of Penicillium marneffei pleiotropic drug resistance transporters ABC1 and ABC2.

    PubMed

    Panapruksachat, Siribun; Iwatani, Shun; Oura, Takahiro; Vanittanakom, Nongnuch; Chindamporn, Ariya; Niimi, Kyoko; Niimi, Masakazu; Lamping, Erwin; Cannon, Richard D; Kajiwara, Susumu

    2016-07-01

    Penicilliosis caused by the dimorphic fungus Penicillium marneffei is an endemic, AIDS-defining illness and, after tuberculosis and cryptococcosis, the third most common opportunistic infection of AIDS patients in tropical Southeast Asia. Untreated, patients have poor prognosis; however, primary amphotericin B treatment followed by prolonged itraconazole prophylaxis is effective. To identify ATP-binding cassette (ABC) transporters that may play a role in potential multidrug resistance of P. marneffei, we identified and classified all 46 P. marneffei ABC transporters from the genome sequence. PmABC1 and PmABC2 were most similar to the archetype Candida albicans multidrug efflux pump gene CDR1. P. marneffei Abc1p (PmAbc1p) was functionally expressed in Saccharomyces cerevisiae, although at rather low levels, and correctly localized to the plasma membrane, causing cells to be fourfold to eightfold more resistant to azoles and many other xenobiotics than untransformed cells. P. marneffei Abc2p (PmAbc2p) was expressed at similarly low levels, but it had no efflux activity and did not properly localize to the plasma membrane. Interestingly, PmAbc1p mislocalized and lost its transport activity when cells were shifted to 37 °C. We conclude that expression of PmAbc1p in S. cerevisiae confers resistance to several xenobiotics indicating that PmAbc1p may be a multidrug efflux pump.

  7. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  8. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  9. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  10. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  11. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  12. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  13. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  14. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  15. Plant ABC Transporters

    PubMed Central

    Kang, Joohyun; Park, Jiyoung; Choi, Hyunju; Burla, Bo; Kretzschmar, Tobias; Lee, Youngsook; Martinoia, Enrico

    2011-01-01

    ABC transporters constitute one of the largest protein families found in all living organisms. ABC transporters are driven by ATP hydrolysis and can act as exporters as well as importers. The plant genome encodes for more than 100 ABC transporters, largely exceeding that of other organisms. In Arabidopsis, only 22 out of 130 have been functionally analyzed. They are localized in most membranes of a plant cell such as the plasma membrane, the tonoplast, chloroplasts, mitochondria and peroxisomes and fulfill a multitude of functions. Originally identified as transporters involved in detoxification processes, they have later been shown to be required for organ growth, plant nutrition, plant development, response to abiotic stresses, pathogen resistance and the interaction of the plant with its environment. To fulfill these roles they exhibit different substrate specifies by e.g. depositing surface lipids, accumulating phytate in seeds, and transporting the phytohormones auxin and abscisic acid. The aim of this review is to give an insight into the functions of plant ABC transporters and to show their importance for plant development and survival. PMID:22303277

  16. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  17. ABC transporters in fish species: a review

    PubMed Central

    Ferreira, Marta; Costa, Joana; Reis-Henriques, Maria A.

    2014-01-01

    ATP-binding cassette (ABC) proteins were first recognized for their role in multidrug resistance (MDR) in chemotherapeutic treatments, which is a major impediment for the successful treatment of many forms of malignant tumors in humans. These proteins, highly conserved throughout vertebrate species, were later related to cellular detoxification and accounted as responsible for protecting aquatic organisms from xenobiotic insults in the so-called multixenobiotic resistance mechanism (MXR). In recent years, research on these proteins in aquatic species has highlighted their importance in the detoxification mechanisms in fish thus it is necessary to continue these studies. Several transporters have been pointed out as relevant in the ecotoxicological context associated to the transport of xenobiotics, such as P-glycoproteins (Pgps), multidrug-resistance-associated proteins (MRPs 1-5) and breast cancer resistance associated protein (BCRP). In mammals, several nuclear receptors have been identified as mediators of phase I and II metabolizing enzymes and ABC transporters. In aquatic species, knowledge on co-regulation of the detoxification mechanism is scarce and needs to be addressed. The interaction of emergent contaminants that can act as chemosensitizers, with ABC transporters in aquatic organisms can compromise detoxification processes and have population effects and should be studied in more detail. This review intends to summarize the recent advances in research on MXR mechanisms in fish species, focusing in (1) regulation and functioning of ABC proteins; (2) cooperation with phase I and II biotransformation enzymes; and (3) ecotoxicological relevance and information on emergent pollutants with ability to modulate ABC transporters expression and activity. Several lines of evidence are clearly suggesting the important role of these transporters in detoxification mechanisms and must be further investigated in fish to underlay the mechanism to consider their use as

  18. Transcriptome-based identification of ABC transporters in the western tarnished plant bug lygus hesperus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are a large superfamily of proteins that mediate diverse physiological functions by coupling ATP hydrolysis with substrate transport across lipid membranes. In insects, these proteins play roles in metabolism, development, eye pigmentation, and xenobiotic cle...

  19. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  20. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  1. ATP alone triggers the outward facing conformation of the maltose ATP-binding cassette transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-02-01

    The maltose transporter MalFGK(2) is a study prototype for ABC importers. During catalysis, the MalFG membrane domain alternates between inward and outward facing conformations when the MalK dimer closes and hydrolyzes ATP. Because a rapid ATP hydrolysis depends on MalE and maltose, it has been proposed that closed liganded MalE facilitates the transition to the outward facing conformation. Here we find that, in contrast to the expected, ATP is sufficient for the closure of MalK and for the conversion of MalFG to the outward facing state. The outward facing transporter binds MalE with nanomolar affinity, yet neither MalE nor maltose is necessary or facilitates the transition. Thus, the rapid hydrolysis of ATP observed in the presence of MalE and maltose is not because closed liganded MalE accelerates the formation of the outward facing conformation. These findings have fundamental implications for the description of the transport reaction.

  2. The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport.

    PubMed Central

    Schlösser, A; Kampers, T; Schrempf, H

    1997-01-01

    Streptomyces reticuli harbors an msiK gene which encodes a protein with an amino acid identify of 90% to a corresponding protein previously identified in Streptomyces lividans. Immunological studies revealed that S. lividans and S. reticuli synthesize their highest levels of MsiK during growth with cellobiose, but not with glucose. Moreover, moderate amounts of MsiK are produced by both species in the course of growth with maltose, melibiose, and xylose and by S. lividans in the presence of xylobiose and raffinose. In contrast, a recently identified cellobiose-binding protein and its distantly related homolog were only found if S. reticuli or S. lividans, respectively, was cultivated with cellobiose. Uptake of cellobiose and maltose was tested and ascertained for S. reticuli and S. lividans, but not for an msiK S. lividans mutant. However, transformants of this mutant carrying the S. reticuli or S. lividans msiK gene on a multicopy plasmid had regained the ability to transport both sugars. The data show that MsiK assists two ABC transport systems. PMID:9068663

  3. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  4. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  5. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  6. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  7. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  8. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  9. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  10. Coupled ATPase-adenylate kinase activity in ABC transporters

    PubMed Central

    Kaur, Hundeep; Lakatos-Karoly, Andrea; Vogel, Ramona; Nöll, Anne; Tampé, Robert; Glaubitz, Clemens

    2016-01-01

    ATP-binding cassette (ABC) transporters, a superfamily of integral membrane proteins, catalyse the translocation of substrates across the cellular membrane by ATP hydrolysis. Here we demonstrate by nucleotide turnover and binding studies based on 31P solid-state NMR spectroscopy that the ABC exporter and lipid A flippase MsbA can couple ATP hydrolysis to an adenylate kinase activity, where ADP is converted into AMP and ATP. Single-point mutations reveal that both ATPase and adenylate kinase mechanisms are associated with the same conserved motifs of the nucleotide-binding domain. Based on these results, we propose a model for the coupled ATPase-adenylate kinase mechanism, involving the canonical and an additional nucleotide-binding site. We extend these findings to other prokaryotic ABC exporters, namely LmrA and TmrAB, suggesting that the coupled activities are a general feature of ABC exporters. PMID:28004795

  11. ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena.

    PubMed

    Ning, YingZhi; Dang, Huai; Liu, GuangLong; Xiong, Jie; Yuan, DongXia; Feng, LiFang; Miao, Wei

    2015-03-01

    The reuse of dichlorodiphenyltrichloroethane (DDT) as an indoor residual spray was permitted by the World Health Organization in 2007, and approximately 14 countries still use DDT to control disease vectors. The extensive exposure of insects to DDT has resulted in the emergence of DDT resistance, especially in mosquitoes, and the mechanism for this resistance in mosquitoes has been widely reported. Spraying can also introduce DDT directly into surface water, and DDT can subsequently accumulate in microorganisms, but the mechanism for the resistance to DDT degradation in microorganisms is unclear. Using whole-genome microarray analysis, we detected an abcb15 gene that was up-regulated in a specific manner by DDT treatment in T. thermophile. The deduced ABCB15 peptide sequence had two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) to form the structure TMD-NBD-TMD-NBD, and each NBD contained three conserved motifs: Walker-A, C-loop, and Walker-B, which indicated the T. thermophila abcb15 was a typical ABC transporter gene. The expression of ABCB15 fused with a C-terminal green fluorescent protein was found to be on the periphery of the cell, suggesting that ABCB15 was a membrane pump protein. In addition, cells with abcb15 partially knocked down (abcb15-KD) grew slower than wild-type cells in the presence of 256 mg L(-1) DDT, indicating the tolerance of abcb15-KD strain to DDT exposure was decreased. Thus, we suggest that in Tetrahymena, the membrane pump protein encoded by ABCT gene abcb15 can enhance the tolerance to DDT and protect cells from this exogenous toxin by efficiently pumping it to the extracellular space.

  12. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  13. ABC transporters as multidrug resistance mechanisms and the development of chemosensitizers for their reversal

    PubMed Central

    Choi, Cheol-Hee

    2005-01-01

    One of the major problems related with anticancer chemotherapy is resistance against anticancer drugs. The ATP-binding cassette (ABC) transporters are a family of transporter proteins that are responsible for drug resistance and a low bioavailability of drugs by pumping a variety of drugs out cells at the expense of ATP hydrolysis. One strategy for reversal of the resistance of tumor cells expressing ABC transporters is combined use of anticancer drugs with chemosensitizers. In this review, the physiological functions and structures of ABC transporters, and the development of chemosensitizers are described focusing on well-known proteins including P-glycoprotein, multidrug resistance associated protein, and breast cancer resistance protein. PMID:16202168

  14. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  15. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  16. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  17. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  18. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  19. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  20. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael

    2009-01-01

    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  1. Exploring conformational equilibria of a heterodimeric ABC transporter

    PubMed Central

    Timachi, M Hadi; Hutter, Cedric AJ; Hohl, Michael; Assafa, Tufa; Böhm, Simon; Mittal, Anshumali; Seeger, Markus A; Bordignon, Enrica

    2017-01-01

    ABC exporters pump substrates across the membrane by coupling ATP-driven movements of nucleotide binding domains (NBDs) to the transmembrane domains (TMDs), which switch between inward- and outward-facing (IF, OF) orientations. DEER measurements on the heterodimeric ABC exporter TM287/288 from Thermotoga maritima, which contains a non-canonical ATP binding site, revealed that in the presence of nucleotides the transporter exists in an IF/OF equilibrium. While ATP binding was sufficient to partially populate the OF state, nucleotide trapping in the pre- or post-hydrolytic state was required for a pronounced conformational shift. At physiologically high temperatures and in the absence of nucleotides, the NBDs disengage asymmetrically while the conformation of the TMDs remains unchanged. Nucleotide binding at the degenerate ATP site prevents complete NBD separation, a molecular feature differentiating heterodimeric from homodimeric ABC exporters. Our data suggest hydrolysis-independent closure of the NBD dimer, which is further stabilized as the consensus site nucleotide is committed to hydrolysis. DOI: http://dx.doi.org/10.7554/eLife.20236.001 PMID:28051765

  2. A Drosophila ABC Transporter Regulates Lifespan

    PubMed Central

    Huang, He; Lu-Bo, Ying; Haddad, Gabriel G.

    2014-01-01

    MRP4 (multidrug resistance-associated protein 4) is a member of the MRP/ABCC subfamily of ATP-binding cassette (ABC) transporters that are essential for many cellular processes requiring the transport of substrates across cell membranes. Although MRP4 has been implicated as a detoxification protein by transport of structurally diverse endogenous and xenobiotic compounds, including antivirus and anticancer drugs, that usually induce oxidative stress in cells, its in vivo biological function remains unknown. In this study, we investigate the biological functions of a Drosophila homolog of human MRP4, dMRP4. We show that dMRP4 expression is elevated in response to oxidative stress (paraquat, hydrogen peroxide and hyperoxia) in Drosophila. Flies lacking dMRP4 have a shortened lifespan under both oxidative and normal conditions. Overexpression of dMRP4, on the other hand, is sufficient to increase oxidative stress resistance and extend lifespan. By genetic manipulations, we demonstrate that dMRP4 is required for JNK (c-Jun NH2-terminal kinase) activation during paraquat challenge and for basal transcription of some JNK target genes under normal condition. We show that impaired JNK signaling is an important cause for major defects associated with dMRP4 mutations, suggesting that dMRP4 regulates lifespan by modulating the expression of a set of genes related to both oxidative resistance and aging, at least in part, through JNK signaling. PMID:25474322

  3. Effluxing ABC Transporters in Human Corneal Epithelium

    PubMed Central

    Vellonen, Kati-Sisko; Mannermaa, Eliisa; Turner, Helen; Häkli, Marika; Wolosin, J. Mario; Tervo, Timo; Honkakoski, Paavo; Urtti, Arto

    2010-01-01

    ATP-binding cassette (ABC) transporters are able to efflux their substrate drugs from the cells. We compared expression of efflux proteins in normal human corneal epithelial tissue, primary human corneal epithelial cells (HCEpiC), and corneal epithelial cell culture model (HCE model) based on human immortal cell line. Expression of multidrug resistance protein 1 (MDR1), multidrug resistance-associated protein 1–6 (MRP1–6) and breast cancer resistance protein (BCRP) was studied using quantitative RT-PCR, Western blot, and immunohistochemistry. Only MRP1, MRP5, and BCRP were expressed in the freshly excised human corneal epithelial tissue. Expression of MRP1 and MRP5 was localized predominantly in the basal cells of the central cornea and limbus. Functional efflux activity was shown in the cell models, but they showed over-expression of most efflux transporters compared to that of normal corneal epithelium. In conclusion, MRP1, MRP5, and BCRP are expressed in the corneal epithelium, but MDR1, MRP2, MRP3, MRP4, and MRP6 are not significantly expressed. HCE cell model and commercially available primary cells deviate from this expression profile. PMID:19623615

  4. Human and Rat ABC Transporter Efflux of Bisphenol A and Bisphenol A Glucuronide: Interspecies Comparison and Implications for Pharmacokinetic Assessment

    EPA Science Inventory

    Significant interspecies differences exist between human and rodent with respect to absorption, distribution, and excretion of bisphenol A (BPA) and its primary metabolite, BPA-glucuronide (BPA-G). ATP-Binding Cassette (ABC) transporter enzymes play important roles in these physi...

  5. Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter

    NASA Astrophysics Data System (ADS)

    Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; Abele, Rupert; Gaudet, Rachelle; Tampé, Robert

    2014-11-01

    The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the conserved aspartate, which coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. Our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.

  6. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  7. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  8. Structural Dynamics of the Heterodimeric ABC Transporter TM287/288 Induced by ATP and Substrate Binding.

    PubMed

    Furuta, Tadaomi; Sato, Yukiko; Sakurai, Minoru

    2016-12-06

    TM287/288 is a heterodimeric ATP-binding cassette (ABC) transporter, which harnesses the energy of ATP binding and hydrolysis at the nucleotide-binding domains (NBDs) to transport a wide variety of molecules through the transmembrane domains (TMDs) by alternating inward- and outward-facing conformations. Here, we conducted multiple 100 ns molecular dynamics simulations of TM287/288 in different ATP- and substrate-bound states to elucidate the effects of ATP and substrate binding. As a result, the binding of two ATP molecules to the NBDs induced the formation of the consensus ATP-binding pocket (ABP2) or the NBD dimerization, whereas these processes did not occur in the presence of a single ATP molecule or when the protein was in its apo state. Moreover, binding of the substrate to the TMDs enhanced the formation of ABP2 through allosteric TMD-NBD communication. Furthermore, in the apo state, α-helical subdomains of the NBDs approached each other, acquiring a conformation with core half-pockets exposed to the solvent, appropriate for ATP binding. We propose a "core-exposed" model for this novel conformation found in the apo state of ABC transporters. These findings provide important insights into the structural dynamics of ABC transporters.

  9. Heterocyclic cyclohexanone monocarbonyl analogs of curcumin can inhibit the activity of ATP-binding cassette transporters in cancer multidrug resistance.

    PubMed

    Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W

    2015-02-01

    Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR.

  10. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  11. Pharmacophore modeling of nilotinib as an inhibitor of ATP-binding cassette drug transporters and BCR-ABL kinase using a three-dimensional quantitative structure-activity relationship approach.

    PubMed

    Shukla, Suneet; Kouanda, Abdul; Silverton, Latoya; Talele, Tanaji T; Ambudkar, Suresh V

    2014-07-07

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure-activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [(125)I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  12. Pharmacophore Modeling of Nilotinib as an Inhibitor of ATP-Binding Cassette Drug Transporters and BCR-ABL Kinase Using a Three-Dimensional Quantitative Structure–Activity Relationship Approach

    PubMed Central

    2015-01-01

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure–activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [125I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  13. A PhoPQ-Regulated ABC Transporter System Exports Tetracycline in Pseudomonas aeruginosa.

    PubMed

    Chen, Lin; Duan, Kangmin

    2016-05-01

    Pseudomonas aeruginosa is an important human pathogen whose infections are difficult to treat due to its high intrinsic resistance to many antibiotics. Here, we show that the disruption of PA4456, encoding the ATP binding component of a putative ATP-binding cassette (ABC) transporter, increased the bacterium's susceptible to tetracycline and other antibiotics or toxic chemicals. Fluorescence spectroscopy and antibiotic accumulation tests showed that the interruption of the ABC transporter caused increased intracellular accumulation of tetracycline, demonstrating a role of the ABC transporter in tetracycline expulsion. Site-directed mutagenesis proved that the conserved residues of E170 in the Walker B motif and H203 in the H-loop, which are important for ATP hydrolysis, were essential for the function of PA4456. Through a genome-wide search, the PhoPQ two-component system was identified as a regulator of the computationally predicted PA4456-4452 operon that encodes the ABC transporter system. A >5-fold increase of the expression of this operon was observed in the phoQ mutant. The results obtained also show that the expression of the phzA1B1C1D1E1 operon and the production of pyocyanin were significantly higher in the ABC transporter mutant, signifying a connection between the ABC transporter and pyocyanin production. These results indicated that the PhoPQ-regulated ABC transporter is associated with intrinsic resistance to antibiotics and other adverse compounds in P. aeruginosa, probably by extruding them out of the cell.

  14. Genetic identification of three ABC transporters as essential elements for nitrate respiration in Haloferax volcanii.

    PubMed Central

    Wanner, C; Soppa, J

    1999-01-01

    More than 40 nitrate respiration-deficient mutants of Haloferax volcanii belonging to three different phenotypic classes were isolated. All 15 mutants of the null phenotype were complemented with a genomic library of the wild type. Wild-type copies of mutated genes were recovered from complemented mutants using two different approaches. The DNA sequences of 13 isolated fragments were determined. Five fragments were found to overlap; therefore nine different genomic regions containing genes essential for nitrate respiration could be identified. Three genomic regions containing genes coding for subunits of ABC transporters were further characterized. In two cases, genes coding for an ATP-binding subunit and a permease subunit were clustered and overlapped by four nucleotides. The third gene for a permease subunit had no additional ABC transporter gene in proximity. One ABC transporter was found to be glucose specific. The mutant reveals that the ABC transporter solely mediates anaerobic glucose transport. Based on sequence similarity, the second ABC transporter is proposed to be molybdate specific, explaining its essential role in nitrate respiration. The third ABC transporter is proposed to be anion specific. Genome sequencing has shown that ABC transporters are widespread in Archaea. Nevertheless, this study represents only the second example of a functional characterization. PMID:10430572

  15. Expression of ATP-Binding Cassette Transporters B1 and C1 after Severe Traumatic Brain Injury in Humans

    PubMed Central

    Willyerd, F. Anthony; Empey, Philip E.; Philbrick, Ashley; Ikonomovic, Milos D.; Puccio, Ava M.; Kochanek, Patrick M.; Okonkwo, David O.

    2016-01-01

    Abstract Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI) on ABCC1 and ABCB1 expression in humans is unknown. We hypothesized that ABCC1 and ABCB1 expression would be altered in brain tissue from patients acutely after severe TBI. Archived TBI samples (n=10) from our Brain Trauma Research Center and control samples (n=7) from our Alzheimer Disease Research Center were obtained under Institutional Review Board approval. Protein was extracted from fresh frozen cortical brain tissue for Western blot analysis and sections were obtained from fixed cortical tissue for immunohistochemistry. Relative abundance of ABCC1 was increased in samples from TBI versus controls (2.8±2.5 fold; p=0.005). ABCC1 immunohistochemistry was consistent with Western blot data, with increased immunoreactivity in cerebral blood vessel walls, as well as cells with the morphological appearance of neurons and glia in TBI versus controls. Relative abundance of ABCB1 was similar between TBI and controls (p=0.76), and ABCB1 immunoreactivity was primarily associated with cerebral blood vessels in both groups. These human data show that TBI increases ABCC1 expression in the brain, consistent with possible implications for both patients receiving pharmacological inhibitors and/or substrates of ABCC1 after TBI. PMID:25891836

  16. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    NASA Astrophysics Data System (ADS)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter

  17. Research Progress on the Role of ABC Transporters in the Drug Resistance Mechanism of Intractable Epilepsy

    PubMed Central

    Xiong, Jie; Mao, Ding-an; Liu, Li-qun

    2015-01-01

    The pathogenesis of intractable epilepsy is not fully clear. In recent years, both animal and clinical trials have shown that the expression of ATP-binding cassette (ABC) transporters is increased in patients with intractable epilepsy; additionally, epileptic seizures can lead to an increase in the number of sites that express ABC transporters. These findings suggest that ABC transporters play an important role in the drug resistance mechanism of epilepsy. ABC transporters can perform the funcions of a drug efflux pump, which can reduce the effective drug concentration at epilepsy lesions by reducing the permeability of the blood brain barrier to antiepileptic drugs, thus causing resistance to antiepileptic drugs. Given the important role of ABC transporters in refractory epilepsy drug resistance, antiepileptic drugs that are not substrates of ABC transporters were used to obtain ABC transporter inhibitors with strong specificity, high safety, and few side effects, making them suitable for long-term use; therefore, these drugs can be used for future clinical treatment of intractable epilepsy. PMID:26491660

  18. The multidrug transporter Pdr5 on the 25th anniversary of its discovery: an important model for the study of asymmetric ABC transporters

    PubMed Central

    Golin, John; Ambudkar, Suresh V.

    2016-01-01

    Asymmetric ABC (ATP-binding cassette) transporters make up a significant proportion of this important superfamily of integral membrane proteins. These proteins contain one canonical (catalytic) ATP-binding site and a second atypical site with little enzymatic capability. The baker’s yeast (Saccharomyces cerevisiae) Pdr5 multidrug transporter is the founding member of the Pdr subfamily of asymmetric ABC transporters, which exist only in fungi and slime moulds. Because these organisms are of considerable medical and agricultural significance, Pdr5 has been studied extensively, as has its medically important homologue Cdr1 from Candida albicans. Genetic and biochemical analyses of Pdr5 have contributed important observations that are likely to be applicable to mammalian asymmetric ABC multidrug transporter proteins, including the basis of transporter promiscuity, the function of the non-catalytic deviant ATP-binding site, the most complete description of an in vivo transmission interface, and the recent discovery that Pdr5 is a molecular diode (one-way gate). In the present review, we discuss the observations made with Pdr5 and compare them with findings from clinically important asymmetric ABC transporters, such as CFTR (cystic fibrosis transmembrane conductance regulator), Cdr1 and Tap1/Tap2. PMID:25886173

  19. Tissue and developmental expression of a gene from Hessian fly encoding an ABC-active-transporter protein during interactions with wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report on the transcriptional patterns of a putative white (w) gene encoding an ABC-transporter protein during development in Hessian fly, Mayetiola destructor. The deduced amino acid sequence for the Hessian fly white showed 77 to 74% similarities to white/ATP-binding-cassette proteins and 57 t...

  20. Enhancement of avermectin and ivermectin production by overexpression of the maltose ATP-binding cassette transporter in Streptomyces avermitilis.

    PubMed

    Li, Meng; Chen, Zhi; Zhang, Xuan; Song, Yuan; Wen, Ying; Li, Jilun

    2010-12-01

    We investigated the function of maltose ABC transporter system encoded by malEFG-a and the effect of its overexpression on antibiotic production in Streptomyces avermitilis. A malEFG-a deletion mutant was unable to grow in a minimal medium with maltose as sole carbon source and produce avermectin. Maltose utilization and avermectin production were restored by introduction of a single copy of malEFG-a. RT-PCR analysis showed that the expression of malE-a was induced by maltose, and was strongly repressed by glucose. When multi-copy, integrative malEFG-a gene expression vectors were introduced into wild-type strain ATCC31267 and ivermectin-producer OI-31, antibiotic production increased by 2.6- to 3.3-fold and the time required for fermentation decreased by about 10%. The overexpression of malEFG-a improved the utilization rate of starch, and thereby enhanced avermectin production. Such an approach would be useful for the improvement of commercial antibiotic production using starch as the main carbon source in the fermentation process.

  1. Reversal of ABC drug transporter-mediated multidrug resistance in cancer cells: Evaluation of current strategies

    PubMed Central

    Wu, Chung-Pu; Calcagno, Anna Maria; Ambudkar, Suresh V.

    2008-01-01

    Overexpression of ATP-binding cassette (ABC) drug transporters that actively efflux a variety of amphipathic compounds can cause multidrug resistance (MDR) in cancer cells, which is a major obstacle in the success of cancer chemotherapy. The development of synthetic small molecule compounds or the identification of natural products that block ABC transporter-mediated efflux has been the conventional approach used to combat MDR. The strategy of using chemosensitizers, however, has not been successful in clinical cancer chemotherapy. Therefore, alternative approaches to identify or to synthesize compounds that can induce selective toxicity in cancer cells overexpressing one or more ABC transporters have been undertaken. This review summarizes the recent advances in identifying strategies to restore sensitivity to chemotherapeutics in multidrug resistant cancer cells. PMID:19079736

  2. The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox).

    PubMed

    Szakács, Gergely; Váradi, András; Ozvegy-Laczka, Csilla; Sarkadi, Balázs

    2008-05-01

    ATP binding cassette (ABC) drug transporters play an important role in cancer drug resistance, protection against xenobiotics, and in general in the passage of drugs through cellular and tissue barriers. This review explores how human ABC transporters modulate the pharmacological effects of various drugs, and how this predictable ADME-TOX modulation can be used during the process of drug discovery and development. We provide a description of the relevant human ABC drug transporters and review the models and assay systems that can be applied for the analysis of their expected drug interactions. The use of the in vitro, in vivo, in silico models, their combination, and the emerging clinical information are evaluated with respect to their potential application in early drug screening.

  3. Class C ABC transporters and Saccharomyces cerevisiae vacuole fusion

    PubMed Central

    Sasser, Terry L; Fratti, Rutilio A

    2014-01-01

    Membrane fusion is carried out by core machinery that is conserved throughout eukaryotes. This is comprised of Rab GTPases and their effectors, and SNARE proteins, which together are sufficient to drive the fusion of reconstituted proteoliposomes. However, an outer layer of factors that are specific to individual trafficking pathways in vivo regulates the spatial and temporal occurrence of fusion. The homotypic fusion of Saccharomyces cerevisiae vacuolar lysosomes utilizes a growing set of factors to regulate the fusion machinery that include members of the ATP binding cassette (ABC) transporter family. Yeast vacuoles have five class C ABC transporters that are known to transport a variety of toxins into the vacuole lumen as part of detoxifying the cell. We have found that ABCC transporters can also regulate vacuole fusion through novel mechanisms. For instance Ybt1 serves as negative regulator of fusion through its effects on vacuolar Ca2+ homeostasis. Additional studies showed that Ycf1 acts as a positive regulator by affecting the efficient recruitment of the SNARE Vam7. Finally, we discuss the potential interface between the translocation of lipids across the membrane bilayer, also known as lipid flipping, and the efficiency of fusion. PMID:25610719

  4. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  5. The High-Affinity E. Coli Methionine ABC Transporter: Structure And Allosteric Regulation

    SciTech Connect

    Kadaba, N.S.; Kaiser, J.T.; Johnson, E.; Lee, A.; Rees, D.C.

    2009-05-18

    The crystal structure of the high-affinity Escherichia coli MetNI methionine uptake transporter, a member of the adenosine triphosphate (ATP)-binding cassette (ABC) family, has been solved to 3.7 angstrom resolution. The overall architecture of MetNI reveals two copies of the adenosine triphosphatase (ATPase) MetN in complex with two copies of the transmembrane domain MetI, with the transporter adopting an inward-facing conformation exhibiting widely separated nucleotide binding domains. Each MetI subunit is organized around a core of five transmembrane helices that correspond to a subset of the helices observed in the larger membrane-spanning subunits of the molybdate (ModBC) and maltose (MalFGK) ABC transporters. In addition to the conserved nucleotide binding domain of the ABC family, MetN contains a carboxyl-terminal extension with a ferredoxin-like fold previously assigned to a conserved family of regulatory ligand-binding domains. These domains separate the nucleotide binding domains and would interfere with their association required for ATP binding and hydrolysis. Methionine binds to the dimerized carboxyl-terminal domain and is shown to inhibit ATPase activity. These observations are consistent with an allosteric regulatory mechanism operating at the level of transport activity, where increased intracellular levels of the transported ligand stabilize an inward-facing, ATPase-inactive state of MetNI to inhibit further ligand translocation into the cell.

  6. A Multidrug ABC Transporter with a Taste for Salt

    PubMed Central

    Gutmann, Daniel A. P.; Venter, Henrietta; Barrera, Nelson P.; Seeger, Markus A.; Woebking, Barbara; Matak-Vinkovic, Dijana; Balakrishnan, Lekshmy; Yao, Yao; U, Edmond C. Y.; Shilling, Richard A.; Robinson, Carol V.; Thorn, Peter; van Veen, Hendrik W.

    2009-01-01

    Background LmrA is a multidrug ATP-binding cassette (ABC) transporter from Lactococcus lactis with no known physiological substrate, which can transport a wide range of chemotherapeutic agents and toxins from the cell. The protein can functionally replace the human homologue ABCB1 (also termed multidrug resistance P-glycoprotein MDR1) in lung fibroblast cells. Even though LmrA mediates ATP-dependent transport, it can use the proton-motive force to transport substrates, such as ethidium bromide, across the membrane by a reversible, H+-dependent, secondary-active transport reaction. The mechanism and physiological context of this reaction are not known. Methodology/Principal Findings We examined ion transport by LmrA in electrophysiological experiments and in transport studies using radioactive ions and fluorescent ion-selective probes. Here we show that LmrA itself can transport NaCl by a similar secondary-active mechanism as observed for ethidium bromide, by mediating apparent H+-Na+-Cl− symport. Remarkably, LmrA activity significantly enhances survival of high-salt adapted lactococcal cells during ionic downshift. Conclusions/Significance The observations on H+-Na+-Cl− co-transport substantiate earlier suggestions of H+-coupled transport by LmrA, and indicate a novel link between the activity of LmrA and salt stress. Our findings demonstrate the relevance of investigations into the bioenergetics of substrate translocation by ABC transporters for our understanding of fundamental mechanisms in this superfamily. This study represents the first use of electrophysiological techniques to analyze substrate transport by a purified multidrug transporter. PMID:19593434

  7. Protein-mediated transbilayer movement of lipids in eukaryotes and prokaryotes: the relevance of ABC transporters.

    PubMed

    Tannert, Astrid; Pohl, Antje; Pomorski, Thomas; Herrmann, Andreas

    2003-09-01

    Lipid distribution across cellular membranes is regulated by specific membrane proteins controlling transbilayer movement of lipids. Flippases facilitate flip-flop of lipids and allow them to equilibrate between the two membrane leaflets independent of ATP. Distinct P-Type-ATPases transport specific lipids unidirectionally across the membrane at the expense of ATP. A group of ATP-dependent lipid transporters, the ATP-binding cassette (ABC) transporter family, was identified in studies originally related to multidrug resistance (MDR) in cancer cells. Meanwhile, lipid transport activity has been shown for full and half size ABC proteins in eukaryotic and prokaryotic cells. This activity may not only modify the organisation of lipids in membranes, but could also be of significant consequence for cell homeostasis. The various types of lipid movement mediating proteins and their cellular localisation in eukaryotes and prokaryotes are reviewed.

  8. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  9. Implicating ABC Transporters in Insecticide Resistance: Research Strategies and a Decision Framework.

    PubMed

    Gott, Ryan C; Kunkel, Grace R; Zobel, Emily S; Lovett, Brian R; Hawthorne, David J

    2017-02-28

    Pest insects damage crops, transmit diseases, and are household nuisances. Historically, they have been controlled with insecticides, but overuse often leads to resistance to one or more of these chemicals. Insects gain resistance to insecticides through behavioral, metabolic, genetic, and physical mechanisms. One frequently overlooked strategy is through the use of ATP-binding cassette (ABC) transporters. ABC transporters, present in all domains of life, perform natural excretory functions, thus the exploitation of these transporters to excrete insecticides and contribute to resistance is highly plausible. Previous work has implicated ABC transporters in some cases of insecticide resistance. Proposed herein is a framework meant as a formal guide for more easily incorporating the analysis of ABC transporters into existing resistance monitoring using suggested simple research methods. This framework functions as a simple decision tree and its utility is demonstrated using case examples. Determining a role for ABC transporters in insecticide resistance would help to shape future resistance management plans and guide the design of new insecticides.

  10. Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.

    PubMed

    Merino, Gracia; Real, Rebeca; Baro, Marta F; Gonzalez-Lobato, Lucia; Prieto, Julio G; Alvarez, Ana I; Marques, Margarita M

    2009-01-01

    ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.

  11. Tyrosine kinase inhibitors as modulators of ABC transporter-mediated drug resistance

    PubMed Central

    Shukla, Suneet; Chen, Zhe-Sheng; Ambudkar, Suresh V.

    2012-01-01

    Tyrosine kinases (TKs) are involved in key signaling events/pathways that regulate cancer cell proliferation, apoptosis, angiogenesis and metastasis. Deregulated activity of TKs has been implicated in several types of cancers. In recent years, tyrosine kinase inhibitors (TKIs) have been developed to inhibit specific kinases whose constitutive activity results in specific cancer types. These TKIs have been found to demonstrate effective anticancer activity and some of them have been approved by the Food and Drug Administration for clinical use or are in clinical trials. However, these targeted therapeutic agents are also transported by ATP-binding cassette (ABC) transporters, resulting in altered pharmacokinetics or development of resistance to these drugs in cancer patients. This review covers the recent findings on the interactions of clinically important TKIs with ABC drug transporters. Future research efforts in the development of novel TKIs with specific targets, seeking improved activity, should consider these underlying causes of resistance to TKIs in cancer cells. PMID:22325423

  12. Transcriptome-Based Identification of ABC Transporters in the Western Tarnished Plant Bug Lygus hesperus

    PubMed Central

    Hull, J. Joe; Chaney, Kendrick; Geib, Scott M.; Fabrick, Jeffrey A.; Brent, Colin S.; Walsh, Douglas; Lavine, Laura Corley

    2014-01-01

    ATP-binding cassette (ABC) transporters are a large superfamily of proteins that mediate diverse physiological functions by coupling ATP hydrolysis with substrate transport across lipid membranes. In insects, these proteins play roles in metabolism, development, eye pigmentation, and xenobiotic clearance. While ABC transporters have been extensively studied in vertebrates, less is known concerning this superfamily in insects, particularly hemipteran pests. We used RNA-Seq transcriptome sequencing to identify 65 putative ABC transporter sequences (including 36 full-length sequences) from the eight ABC subfamilies in the western tarnished plant bug (Lygus hesperus), a polyphagous agricultural pest. Phylogenetic analyses revealed clear orthologous relationships with ABC transporters linked to insecticide/xenobiotic clearance and indicated lineage specific expansion of the L. hesperus ABCG and ABCH subfamilies. The transcriptional profile of 13 LhABCs representative of the ABCA, ABCB, ABCC, ABCG, and ABCH subfamilies was examined across L. hesperus development and within sex-specific adult tissues. All of the transcripts were amplified from both reproductively immature and mature adults and all but LhABCA8 were expressed to some degree in eggs. Expression of LhABCA8 was spatially localized to the testis and temporally timed with male reproductive development, suggesting a potential role in sexual maturation and/or spermatozoa protection. Elevated expression of LhABCC5 in Malpighian tubules suggests a possible role in xenobiotic clearance. Our results provide the first transcriptome-wide analysis of ABC transporters in an agriculturally important hemipteran pest and, because ABC transporters are known to be important mediators of insecticidal resistance, will provide the basis for future biochemical and toxicological studies on the role of this protein family in insecticide resistance in Lygus species. PMID:25401762

  13. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP.

    PubMed

    Lempers, Vincent J C; van den Heuvel, Jeroen J M W; Russel, Frans G M; Aarnoutse, Rob E; Burger, David M; Brüggemann, Roger J; Koenderink, Jan B

    2016-06-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs.

  14. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  15. The ABC transporters in Candidatus Liberibacter asiaticus

    PubMed Central

    Li, Wenlin; Cong, Qian; Pei, Jimin; Kinch, Lisa N; Grishin, Nick V

    2012-01-01

    Candidatus Liberibacter asiaticus (Ca. L. asiaticus) is a Gram-negative bacterium and the pathogen of Citrus Greening disease (Huanglongbing, HLB). As a parasitic bacterium, Ca. L. asiaticus harbors ABC transporters that play important roles in exchanging chemical compounds between Ca. L. asiaticus and its host. Here, we analyzed all the ABC transporter-related proteins in Ca. L. asiaticus. We identified 14 ABC transporter systems and predicted their structures and substrate specificities. In-depth sequence and structure analysis including multiple sequence alignment, phylogenetic tree reconstruction, and structure comparison further support their function predictions. Our study shows that this bacterium could use these ABC transporters to import metabolites (amino acids and phosphates) and enzyme cofactors (choline, thiamine, iron, manganese, and zinc), resist to organic solvent, heavy metal, and lipid-like drugs, maintain the composition of the outer membrane (OM), and secrete virulence factors. Although the features of most ABC systems could be deduced from the abundant experimental data on their orthologs, we reported several novel observations within ABC system proteins. Moreover, we identified seven nontransport ABC systems that are likely involved in virulence gene expression regulation, transposon excision regulation, and DNA repair. Our analysis reveals several candidates for further studies to understand and control the disease, including the type I virulence factor secretion system and its substrate that are likely related to Ca. L. asiaticus pathogenicity and the ABC transporter systems responsible for bacterial OM biosynthesis that are good drug targets. PMID:22807026

  16. Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter

    DOE PAGES

    Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; ...

    2014-11-07

    The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the converved aspartate, whichmore » coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. As a result, our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.« less

  17. Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter

    SciTech Connect

    Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; Abele, Rupert; Gaudet, Rachelle; Tampé, Robert

    2014-11-07

    The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the converved aspartate, which coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. As a result, our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.

  18. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  19. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  20. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  1. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  2. Active transmembrane drug transport in microgravity: a validation study using an ABC transporter model.

    PubMed

    Vaquer, Sergi; Cuyàs, Elisabet; Rabadán, Arnau; González, Albert; Fenollosa, Felip; de la Torre, Rafael

    2014-01-01

    Microgravity has been shown to influence the expression of ABC (ATP-Binding Cassette) transporters in bacteria, fungi and mammals, but also to modify the activity of certain cellular components with structural and functional similarities to ABC transporters. Changes in activity of ABC transporters could lead to important metabolic disorders and undesired pharmacological effects during spaceflights. However, no current means exist to study the functionality of these transporters in microgravity. To this end, a Vesicular Transport Assay (®) (Solvo Biotechnology, Hungary) was adapted to evaluate multi-drug resistance-associated protein 2 (MRP2) trans-membrane estradiol-17-β-glucuronide (E17βG) transport activity, when activated by adenosine-tri-phosphate (ATP) during parabolic flights. Simple diffusion, ATP-independent transport and benzbromarone inhibition were also evaluated. A high accuracy engineering system was designed to perform, monitor and synchronize all procedures. Samples were analysed using a validated high sensitivity drug detection protocol. Experiments were performed in microgravity during parabolic flights, and compared to 1g on ground results using identical equipment and procedures in all cases. Our results revealed that sufficient equipment accuracy and analytical sensitivity were reached to detect transport activity in both gravitational conditions. Additionally, transport activity levels of on ground samples were within commercial transport standards, proving the validity of the methods and equipment used. MRP2 net transport activity was significantly reduced in microgravity, so was signal detected in simple diffusion samples. Ultra-structural changes induced by gravitational stress upon vesicle membranes or transporters could explain the current results, although alternative explanations are possible. Further research is needed to provide a conclusive answer in this regard. Nevertheless, the present validated technology opens new and

  3. Active transmembrane drug transport in microgravity: a validation study using an ABC transporter model

    PubMed Central

    Vaquer, Sergi; Cuyàs, Elisabet; Rabadán, Arnau; González, Albert; Fenollosa, Felip; de la Torre, Rafael

    2014-01-01

    Microgravity has been shown to influence the expression of ABC (ATP-Binding Cassette) transporters in bacteria, fungi and mammals, but also to modify the activity of certain cellular components with structural and functional similarities to ABC transporters. Changes in activity of ABC transporters could lead to important metabolic disorders and undesired pharmacological effects during spaceflights. However, no current means exist to study the functionality of these transporters in microgravity. To this end, a Vesicular Transport Assay ® (Solvo Biotechnology, Hungary) was adapted to evaluate multi-drug resistance-associated protein 2 (MRP2) trans-membrane estradiol-17-β-glucuronide (E17βG) transport activity, when activated by adenosine-tri-phosphate (ATP) during parabolic flights. Simple diffusion, ATP-independent transport and benzbromarone inhibition were also evaluated. A high accuracy engineering system was designed to perform, monitor and synchronize all procedures. Samples were analysed using a validated high sensitivity drug detection protocol. Experiments were performed in microgravity during parabolic flights, and compared to 1g on ground results using identical equipment and procedures in all cases. Our results revealed that sufficient equipment accuracy and analytical sensitivity were reached to detect transport activity in both gravitational conditions. Additionally, transport activity levels of on ground samples were within commercial transport standards, proving the validity of the methods and equipment used. MRP2 net transport activity was significantly reduced in microgravity, so was signal detected in simple diffusion samples. Ultra-structural changes induced by gravitational stress upon vesicle membranes or transporters could explain the current results, although alternative explanations are possible. Further research is needed to provide a conclusive answer in this regard. Nevertheless, the present validated technology opens new and

  4. Gene expression profiling of transporters in the solute carrier and ATP-binding cassette superfamilies in human eye substructures.

    PubMed

    Dahlin, Amber; Geier, Ethan; Stocker, Sophie L; Cropp, Cheryl D; Grigorenko, Elena; Bloomer, Michele; Siegenthaler, Julie; Xu, Lu; Basile, Anthony S; Tang-Liu, Diane D-S; Giacomini, Kathleen M

    2013-02-04

    The barrier epithelia of the cornea and retina control drug and nutrient access to various compartments of the human eye. While ocular transporters are likely to play a critical role in homeostasis and drug delivery, little is known about their expression, localization and function. In this study, the mRNA expression levels of 445 transporters, metabolic enzymes, transcription factors and nuclear receptors were profiled in five regions of the human eye: cornea, iris, ciliary body, choroid and retina. Through RNA expression profiling and immunohistochemistry, several transporters were identified as putative targets for drug transport in ocular tissues. Our analysis identified SLC22A7 (OAT2), a carrier for the antiviral drug acyclovir, in the corneal epithelium, in addition to ABCG2 (BCRP), an important xenobiotic efflux pump, in retinal nerve fibers and the retinal pigment epithelium. Collectively, our results provide an understanding of the transporters that serve to maintain ocular homeostasis and which may be potential targets for drug delivery to deep compartments of the eye.

  5. The Role of Eukaryotic and Prokaryotic ABC Transporter Family in Failure of Chemotherapy

    PubMed Central

    El-Awady, Raafat; Saleh, Ekram; Hashim, Amna; Soliman, Nehal; Dallah, Alaa; Elrasheed, Azza; Elakraa, Ghada

    2017-01-01

    Over the years chemotherapy failure has been a vital research topic as researchers have been striving to discover reasons behind it. The extensive studies carried out on chemotherapeutic agents confirm that resistance to chemotherapy is a major reason for treatment failure. “Resistance to chemotherapy,” however, is a comprehensive phrase that refers to a variety of different mechanisms in which ATP-binding cassette (ABC) mediated efflux dominates. The ABC is one of the largest gene superfamily of transporters among both eukaryotes and prokaryotes; it represents a variety of genes that code for proteins, which perform countless functions, including drug efflux – a natural process that protects cells from foreign chemicals. Up to date, chemotherapy failure due to ABC drug efflux is an active research topic that continuously provides further evidence on multiple drug resistance (MDR), aiding scientists in tackling and overcoming this issue. This review focuses on drug resistance by ABC efflux transporters in human, viral, parasitic, fungal and bacterial cells and highlights the importance of the MDR permeability glycoprotein being the mutual ABC transporter among all studied organisms. Current developments and future directions to overcome this problem are also discussed. PMID:28119610

  6. Interaction of BDE-47 and its Hydroxylated Metabolite 6-OH-BDE-47 with the Human ABC Efflux Transporters P-gp and BCRP: Considerations for Human Exposure and Risk Assessment

    EPA Science Inventory

    ATP binding cassette (ABC) transporters, including P-glycoprotein (P-gp; also known as MDR1, ABCB1) and breast cancer resistance protein (BCRP; also known as ABCG2), are membrane-bound proteins that mediate the cellular efflux of xenobiotics as an important defense against chemic...

  7. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  8. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  9. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  10. Do ATP-binding cassette transporters cause pharmacoresistance in epilepsy? Problems and approaches in determining which antiepileptic drugs are affected.

    PubMed

    Löscher, Wolfgang; Luna-Tortós, Carlos; Römermann, Kerstin; Fedrowitz, Maren

    2011-01-01

    Resistance to multiple antiepileptic drugs (AEDs) is a common problem in epilepsy, affecting at least 30% of patients. One prominent hypothesis to explain this resistance suggests an inadequate penetration or excess efflux of AEDs across the blood - brain barrier (BBB) as a result of overexpressed efflux transporters such as P-glycoprotein (Pgp), the encoded product of the multidrug resistance- 1 (MDR1, ABCB1) gene. Pgp and MDR1 are markedly increased in epileptogenic brain tissue of patients with AED-resistant partial epilepsy and following seizures in rodent models of partial epilepsy. In rodent models, AED-resistant rats exhibit higher Pgp levels than responsive animals; increased Pgp expression is associated with lower brain levels of AEDs; and, most importantly, co-administration of Pgp inhibitors reverses AED resistance. Thus, it is reasonable to conclude that Pgp plays a significant role in mediating resistance to AEDs in rodent models of epilepsy - however, whether this phenomenon extends to at least some human refractory epilepsy remains unclear, particularly because it is still a matter of debate which AEDs, if any, are transported by human Pgp. The difficulty in determining which AEDs are substrates of human Pgp is mainly a consequence of the fact that AEDs are highly permeable compounds, which are not easily identified as Pgp substrates in in vitro models of the BBB, such as monolayer (Transwell(®)) efflux assays. By using a modified assay (concentration equilibrium transport assay; CETA), which minimizes the influence of high transcellular permeability, two groups have recently demonstrated that several major AEDs are transported by human Pgp. Importantly, it was demonstrated in these studies that Pgp-mediated transport highly depends on the AED concentration and may not be identified if concentrations below or above the therapeutic range are used. In addition to the efflux transporters, seizure-induced alterations in BBB integrity and activity of

  11. ATP-dependent substrate transport by the ABC transporter MsbA is proton-coupled

    PubMed Central

    Singh, Himansha; Velamakanni, Saroj; Deery, Michael J.; Howard, Julie; Wei, Shen L.; van Veen, Hendrik W.

    2016-01-01

    ATP-binding cassette transporters mediate the transbilayer movement of a vast number of substrates in or out of cells in organisms ranging from bacteria to humans. Current alternating access models for ABC exporters including the multidrug and Lipid A transporter MsbA from Escherichia coli suggest a role for nucleotide as the fundamental source of free energy. These models involve cycling between conformations with inward- and outward-facing substrate-binding sites in response to engagement and hydrolysis of ATP at the nucleotide-binding domains. Here we report that MsbA also utilizes another major energy currency in the cell by coupling substrate transport to a transmembrane electrochemical proton gradient. The dependence of ATP-dependent transport on proton coupling, and the stimulation of MsbA-ATPase by the chemical proton gradient highlight the functional integration of both forms of metabolic energy. These findings introduce ion coupling as a new parameter in the mechanism of this homodimeric ABC transporter. PMID:27499013

  12. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP

    PubMed Central

    Lempers, Vincent J. C.; van den Heuvel, Jeroen J. M. W.; Russel, Frans G. M.; Aarnoutse, Rob E.; Burger, David M.; Koenderink, Jan B.

    2016-01-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro. Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs. PMID:27001813

  13. Structures of the Multidrug Transporter P-glycoprotein Reveal Asymmetric ATP Binding and the Mechanism of Polyspecificity.

    PubMed

    Esser, Lothar; Zhou, Fei; Pluchino, Kristen M; Shiloach, Joseph; Ma, Jichun; Tang, Wai-Kwan; Gutierrez, Camilo; Zhang, Alex; Shukla, Suneet; Madigan, James P; Zhou, Tongqing; Kwong, Peter D; Ambudkar, Suresh V; Gottesman, Michael M; Xia, Di

    2017-01-13

    P-glycoprotein (P-gp) is a polyspecific ATP-dependent transporter linked to multidrug resistance in cancer; it plays important roles in determining the pharmacokinetics of many drugs. Understanding the structural basis of P-gp, substrate polyspecificity has been hampered by its intrinsic flexibility, which is facilitated by a 75-residue linker that connects the two halves of P-gp. Here we constructed a mutant murine P-gp with a shortened linker to facilitate structural determination. Despite dramatic reduction in rhodamine 123 and calcein-AM transport, the linker-shortened mutant P-gp possesses basal ATPase activity and binds ATP only in its N-terminal nucleotide-binding domain. Nine independently determined structures of wild type, the linker mutant, and a methylated P-gp at up to 3.3 Å resolution display significant movements of individual transmembrane domain helices, which correlated with the opening and closing motion of the two halves of P-gp. The open-and-close motion alters the surface topology of P-gp within the drug-binding pocket, providing a mechanistic explanation for the polyspecificity of P-gp in substrate interactions.

  14. Structures of the Multidrug Transporter P-glycoprotein Reveal Asymmetric ATP Binding and the Mechanism of Polyspecificity*♦

    PubMed Central

    Esser, Lothar; Zhou, Fei; Pluchino, Kristen M.; Shiloach, Joseph; Ma, Jichun; Tang, Wai-kwan; Gutierrez, Camilo; Zhang, Alex; Shukla, Suneet; Madigan, James P.; Zhou, Tongqing; Kwong, Peter D.; Ambudkar, Suresh V.; Gottesman, Michael M.; Xia, Di

    2017-01-01

    P-glycoprotein (P-gp) is a polyspecific ATP-dependent transporter linked to multidrug resistance in cancer; it plays important roles in determining the pharmacokinetics of many drugs. Understanding the structural basis of P-gp, substrate polyspecificity has been hampered by its intrinsic flexibility, which is facilitated by a 75-residue linker that connects the two halves of P-gp. Here we constructed a mutant murine P-gp with a shortened linker to facilitate structural determination. Despite dramatic reduction in rhodamine 123 and calcein-AM transport, the linker-shortened mutant P-gp possesses basal ATPase activity and binds ATP only in its N-terminal nucleotide-binding domain. Nine independently determined structures of wild type, the linker mutant, and a methylated P-gp at up to 3.3 Å resolution display significant movements of individual transmembrane domain helices, which correlated with the opening and closing motion of the two halves of P-gp. The open-and-close motion alters the surface topology of P-gp within the drug-binding pocket, providing a mechanistic explanation for the polyspecificity of P-gp in substrate interactions. PMID:27864369

  15. Regulation and expression of the ATP-binding cassette transporter ABCG2 in human embryonic stem cells.

    PubMed

    Padmanabhan, Raji; Chen, Kevin G; Gillet, Jean-Pierre; Handley, Misty; Mallon, Barbara S; Hamilton, Rebecca S; Park, Kyeyoon; Varma, Sudhir; Mehaffey, Michele G; Robey, Pamela G; McKay, Ronald D G; Gottesman, Michael M

    2012-10-01

    The expression and function of several multidrug transporters (including ABCB1 and ABCG2) have been studied in human cancer cells and in mouse and human adult stem cells. However, the expression of ABCG2 in human embryonic stem cells (hESCs) remains unclear. Limited and contradictory results in the literature from two research groups have raised questions regarding its expression and function. In this study, we used quantitative real-time PCR, Northern blots, whole genome RNA sequencing, Western blots, and immunofluorescence microscopy to study ABCG2 expression in hESCs. We found that full-length ABCG2 mRNA transcripts are expressed in undifferentiated hESC lines. However, ABCG2 protein was undetectable even under embryoid body differentiation or cytotoxic drug induction. Moreover, surface ABCG2 protein was coexpressed with the differentiation marker stage-specific embryonic antigen-1 of hESCs, following constant BMP-4 signaling at days 4 and 6. This expression was tightly correlated with the downregulation of two microRNAs (miRNAs) (i.e., hsa-miR-519c and hsa-miR-520h). Transfection of miRNA mimics and inhibitors of these two miRNAs confirmed their direct involvement in the regulation ABCG2 translation. Our findings clarify the controversy regarding the expression of the ABCG2 gene and also provide new insights into translational control of the expression of membrane transporter mRNAs by miRNAs in hESCs.

  16. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  17. Probabilistic orthology analysis of the ATP-binding cassette transporters: implications for the development of multiple drug resistance phenotype.

    PubMed

    Fisher, Ciaran; Coleman, Tanya; Plant, Nick

    2012-07-01

    Drug transporters are rapidly becoming recognized as central to determining a chemical's fate within the body. This action is a double-edged sword, protecting the body from toxicants, but also potentially leading to reduced clinical efficacy of drugs through multiple drug resistance phenotype. To examine the interrelationship of this superfamily, we have constructed phylogenetic trees over an extended evolutionary distance representing each of the seven subfamilies. In addition, using protein sequences from species important in the design and evaluation of novel chemicals, namely human, macaque, rat, mouse, and dog, we have undertaken probabilistic orthology analysis to examine speciation probabilities within this phylogeny. These data allow us to accurately predict orthologous sequences across these species, an important confirmatory step with implications for cross-species extrapolation of data during drug safety testing. Finally, we present the first complete phylogeny for subfamilies within humans constructed using the entire coding sequences, at both the DNA and protein levels. We demonstrate for the first time that genes associated with the multiple drug resistance phenotype cluster separately from other genes within the same subfamily, suggestive of a conserved, fundamental, difference in these proteins. Such work may help guide future studies on the mechanisms underlying multiple drug resistance as well as the development of novel therapeutic approaches to mitigate against its development.

  18. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  19. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  20. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  1. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    NASA Astrophysics Data System (ADS)

    Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-06-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  2. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  3. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  4. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  5. The role of ABCG-type ABC transporters in phytohormone transport.

    PubMed

    Borghi, Lorenzo; Kang, Joohyun; Ko, Donghwi; Lee, Youngsook; Martinoia, Enrico

    2015-10-01

    Plant hormones (phytohormones) integrate endogenous and exogenous signals thus synchronizing plant growth with environmental and developmental changes. Similar to animals, phytohormones have distinct source and target tissues, hence controlled transport and focused targeting are required for their functions. Many evidences accumulated in the last years about the regulation of long-distance and directional transport of phytohormones. ATP-binding cassette (ABC) transporters turned out to play major roles in routing phytohormones not only in the plant body but also towards the outer environment. The ABCG-type proteins ABCG25 and ABCG40 are high affinity abscisic acid (ABA) transporters. ABCG14 is highly co-expressed with cytokinin biosynthesis and is the major root-to-shoot cytokinin transporter. Pleiotropic drug resistance1 (PDR1) from Petunia hybrida transports strigolactones (SLs) from the root tip to the plant shoot but also outside to the rhizosphere, where SLs are the main attractants to mycorrhizal fungi. Last but not least, ABCG36 and ABCG37 possibly play a dual role in coumarine and IBA transport.

  6. [Role of the ABC transporters A1 and G1, key reverse cholesterol transport proteins, in atherosclerosis].

    PubMed

    Demina, E P; Miroshnikova, V V; Schwarzman, A L

    2016-01-01

    Atherosclerosis is one of the most common causes of death worldwide. Epidemiology studies firmly established an inverse relationship between atherogenesis and distorted lipid metabolism, in particular, higher levels of total cholesterol, an accumulation of CH-laden macrophages (foam cells), and lower plasma levels of antiatherogenic high density lipoprotein (HDL). It is believed that the reverse cholesterol transport, a process that removes excess cholesterol from peripheral tissues/cells including macrophages to circulating HDL, is one of the main mechanisms responsible for anti-atherogenic properties of HDL. The key proteins of reverse cholesterol transport-ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1)-mediate the cholesterol efflux from macrophages and prevent their transformation into foam cells. This review focuses on the role of ABC transporters A1 and G1 in the pathogenesis of atherosclerosis.

  7. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  8. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  9. Cellodextrin and Laminaribiose ABC Transporters in Clostridium thermocellum▿

    PubMed Central

    Nataf, Yakir; Yaron, Sima; Stahl, Frank; Lamed, Raphael; Bayer, Edward A.; Scheper, Thomas-Helmut; Sonenshein, Abraham L.; Shoham, Yuval

    2009-01-01

    Clostridium thermocellum is an anaerobic thermophilic bacterium that grows efficiently on cellulosic biomass. This bacterium produces and secretes a highly active multienzyme complex, the cellulosome, that mediates the cell attachment to and hydrolysis of the crystalline cellulosic substrate. C. thermocellum can efficiently utilize only β-1,3 and β-1,4 glucans and prefers long cellodextrins. Since the bacterium can also produce ethanol, it is considered an attractive candidate for a consolidated fermentation process in which cellulose hydrolysis and ethanol fermentation occur in a single process. In this study, we have identified and characterized five sugar ABC transporter systems in C. thermocellum. The putative transporters were identified by sequence homology of the putative solute-binding lipoprotein to known sugar-binding proteins. Each of these systems is transcribed from a gene cluster, which includes an extracellular solute-binding protein, one or two integral membrane proteins, and, in most cases, an ATP-binding protein. The genes of the five solute-binding proteins were cloned, fused to His tags, overexpressed, and purified, and their abilities to interact with different sugars was examined by isothermal titration calorimetry. Three of the sugar-binding lipoproteins (CbpB to -D) interacted with different lengths of cellodextrins (G2 to G5), with disassociation constants in the micromolar range. One protein, CbpA, binds only cellotriose (G3), while another protein, Lbp (laminaribiose-binding protein) interacts with laminaribiose. The sugar specificity of the different binding lipoproteins is consistent with the observed substrate preference of C. thermocellum, in which cellodextrins (G3 to G5) are assimilated faster than cellobiose. PMID:18952792

  10. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.

    PubMed

    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da

    2013-02-01

    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  11. ABC transporters in CSCs membranes as a novel target for treating tumor relapse

    PubMed Central

    Zinzi, Laura; Contino, Marialessandra; Cantore, Mariangela; Capparelli, Elena; Leopoldo, Marcello; Colabufo, Nicola A.

    2014-01-01

    CSCs are responsible for the high rate of recurrence and chemoresistance of different types of cancer. The current antineoplastic agents able to inhibit bulk replicating cancer cells and radiation treatment are not efficacious toward CSCs since this subpopulation has several intrinsic mechanisms of resistance. Among these mechanisms, the expression of ATP-Binding Cassette (ABC) transporters family and the activation of different signaling pathways (such as Wnt/β-catenin signaling, Hedgehog, Notch, Akt/PKB) are reported. Therefore, considering ABC transporters expression on CSCs membranes, compounds able to modulate MDR could induce cytotoxicity in these cells disclosing an exciting and alternative strategy for targeting CSCs in tumor therapy. The next challenge in the cure of cancer relapse may be a multimodal strategy, an approach where specific CSCs targeting drugs exert simultaneously the ability to circumvent tumor drug resistance (ABC transporters modulation) and cytotoxic activity toward CSCs and the corresponding differentiated tumor cells. The efficacy of suggested multimodal strategy could be probed by using several scaffolds active toward MDR pumps on CSCs isolated by tumor specimens. PMID:25071581

  12. Toward Determining ATPase Mechanism in ABC Transporters: Development of the Reaction Path–Force Matching QM/MM Method

    PubMed Central

    Zhou, Y.; Ojeda-May, P.; Nagaraju, M.; Pu, J.

    2016-01-01

    Adenosine triphosphate (ATP)-binding cassette (ABC) transporters are ubiquitous ATP-dependent membrane proteins involved in translocations of a wide variety of substrates across cellular membranes. To understand the chemomechanical coupling mechanism as well as functional asymmetry in these systems, a quantitative description of how ABC transporters hydrolyze ATP is needed. Complementary to experimental approaches, computer simulations based on combined quantum mechanical and molecular mechanical (QM/MM) potentials have provided new insights into the catalytic mechanism in ABC transporters. Quantitatively reliable determination of the free energy requirement for enzymatic ATP hydrolysis, however, requires substantial statistical sampling on QM/MM potential. A case study shows that brute force sampling of ab initio QM/MM (AI/MM) potential energy surfaces is computationally impractical for enzyme simulations of ABC transporters. On the other hand, existing semiempirical QM/MM (SE/MM) methods, although affordable for free energy sampling, are unreliable for studying ATP hydrolysis. To close this gap, a multiscale QM/MM approach named reaction path–force matching (RP–FM) has been developed. In RP–FM, specific reaction parameters for a selected SE method are optimized against AI reference data along reaction paths by employing the force matching technique. The feasibility of the method is demonstrated for a proton transfer reaction in the gas phase and in solution. The RP–FM method may offer a general tool for simulating complex enzyme systems such as ABC transporters. PMID:27498639

  13. The yeast vacuolar ABC transporter Ybt1p regulates membrane fusion through Ca2+ transport modulation

    PubMed Central

    Sasser, Terry L.; Padolina, Mark; Fratti, Rutilio A.

    2013-01-01

    Ybt1p is a class C ABC transporter (ATP-binding cassette transporter) that is localized to the vacuole of Saccharomyces cerevisiae. Although Ybt1p was originally identified as a bile acid transporter, it has also been found to function in other capacities, including the translocation of phosphatidylcholine to the vacuole lumen, and the regulation of Ca2+ homoeostasis. In the present study we found that deletion of YBT1 enhanced in vitro homotypic vacuole fusion by up to 50 % relative to wild-type vacuoles. The increased vacuole fusion was not due to aberrant protein sorting of SNAREs (soluble N-ethylmaleimide-sensitive factor-attachment protein receptors) or recruitment of factors from the cytosol such as Ypt7p and the HOPS (homotypic fusion and vacuole protein sorting) tethering complex. In addition, ybt1Δ vacuoles displayed no observable differences in the formation of SNARE complexes, interactions between SNAREs and HOPS, or formation of vertex microdomains. However, the absence of Ybt1p caused significant changes in Ca2+ transport during fusion. One difference was the prolonged Ca2+ influx exhibited by ybt1Δ vacuoles at the start of the fusion reaction. We also observed a striking delay in SNARE-dependent Ca2+ efflux. As vacuole fusion can be inhibited by high Ca2+ concentrations, we suggest that the delayed efflux in ybt1Δ vacuoles leads to the enhanced SNARE function. PMID:22970809

  14. ATP Binding Cassette Transporter ABCA7 Regulates NKT Cell Development and Function by Controlling CD1d Expression and Lipid Raft Content

    PubMed Central

    Nowyhed, Heba N.; Chandra, Shilpi; Kiosses, William; Marcovecchio, Paola; Andary, Farah; Zhao, Meng; Fitzgerald, Michael L.; Kronenberg, Mitchell; Hedrick, Catherine C.

    2017-01-01

    ABCA7 is an ABC transporter expressed on the plasma membrane, and actively exports phospholipid complexes from the cytoplasmic to the exocytoplasmic leaflet of membranes. Invariant NKT (iNKT) cells are a subpopulation of T lymphocytes that recognize glycolipid antigens in the context of CD1d-mediated antigen presentation. In this study, we demonstrate that ABCA7 regulates the development of NKT cells in a cell-extrinsic manner. We found that in Abca7−/− mice there is reduced expression of CD1d accompanied by an alteration in lipid raft content on the plasma membrane of thymocytes and antigen presenting cells. Together, these alterations caused by absence of ABCA7 negatively affect NKT cell development and function. PMID:28091533

  15. ABC-transporters: implications on drug resistance from microorganisms to human cancers.

    PubMed

    Lage, Hermann

    2003-09-01

    Resistance to chemotherapy is a common clinical problem in patients with infectious diseases as well as in patients with cancer. During treatment of infections or malignant tumors, the drug targets of prokaryotic or eukaryotic microorganisms and neoplastic cells are often found to be refractory to a variety of drugs that have different structures and functions. This phenomenon has been termed multidrug resistance (MDR). The mechanisms leading to MDR are frequently caused by trans-membrane xenobiotic transport molecules belonging to the superfamily of ATP-binding cassette (ABC) transporters. There is an urgent need to understand the structure-function relationships of these efflux pumps that underlie their transport mechanism and drug selectivity. This knowledge may allow the rational design of new drugs that can inhibit or circumvent the activity of these MDR transport molecules. Furthermore, the development of such chemosensitizing agents would help us learn more about the physiological functions and substrates of these pump proteins. This review will discuss the current state of knowledge of the functional and structural similarities among ABC-transporters in prokaryotic and eukaryotic cells and their impact on MDR.

  16. Differential Contributions of Five ABC Transporters to Mutidrug Resistance, Antioxidion and Virulence of Beauveria bassiana, an Entomopathogenic Fungus

    PubMed Central

    Ying, Sheng-Hua; Feng, Ming-Guang

    2013-01-01

    Multidrug resistance (MDR) confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC) transporters, which were classified to the subfamilies ABC-B (Mdr1), ABC-C (Mrp1) and ABC-G (Pdr1, Pdr2 and Pdr5) and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control) strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H2O2 based on 22−41% and 10−31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi. PMID:23596534

  17. The Role of the Photoreceptor ABC Transporter ABCA4 in Lipid Transport and Stargardt Macular Degeneration

    PubMed Central

    Molday, Robert S.; Zhong, Ming; Quazi, Faraz

    2009-01-01

    ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders. PMID:19230850

  18. Antitubercular Agent Delamanid and Metabolites as Substrates and Inhibitors of ABC and Solute Carrier Transporters

    PubMed Central

    Shimokawa, Yoshihiko; Shibata, Masakazu; Hashizume, Kenta; Hamasako, Yusuke; Ohzone, Yoshihiro; Kashiyama, Eiji; Umehara, Ken

    2016-01-01

    Delamanid (Deltyba, OPC-67683) is the first approved drug in a novel class of nitro-dihydro-imidazooxazoles developed for the treatment of multidrug-resistant tuberculosis. Patients with tuberculosis require treatment with multiple drugs, several of which have known drug-drug interactions. Transporters regulate drug absorption, distribution, and excretion; therefore, the inhibition of transport by one agent may alter the pharmacokinetics of another, leading to unexpected adverse events. Therefore, it is important to understand how delamanid affects transport activity. In the present study, the potencies of delamanid and its main metabolites as the substrates and inhibitors of various transporters were evaluated in vitro. Delamanid was not transported by the efflux ATP-binding cassette (ABC) transporters P-glycoprotein (P-gp; MDR1/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), solute carrier (SLC) transporters, organic anion-transporting polypeptides, or organic cation transporter 1. Similarly, metabolite 1 (M1) was not a substrate for any of these transporters except P-gp. Delamanid showed no inhibitory effect on ABC transporters MDR1, BCRP, and bile salt export pump (BSEP; ABCB11), SLC transporters, or organic anion transporters. M1 and M2 inhibited P-gp- and BCRP-mediated transport but did so only at the 50% inhibitory concentrations (M1, 4.65 and 5.71 μmol/liter, respectively; M2, 7.80 and 6.02 μmol/liter, respectively), well above the corresponding maximum concentration in plasma values observed following the administration of multiple doses in clinical trials. M3 and M4 did not affect the activities of any of the transporters tested. These in vitro data suggest that delamanid is unlikely to have clinically relevant interactions with drugs for which absorption and disposition are mediated by this group of transporters. PMID:27021329

  19. Substrate binding by a bacterial ABC transporter involved in polysaccharide export

    SciTech Connect

    Cuthbertson, Leslie; Kimber, Matthew S.; Whitfield, Chris

    2008-04-02

    ATP-binding-cassette (ABC) transporters are responsible for the export of a wide variety of cell-surface glycoconjugates in both Gram-positive and Gram-negative bacteria. These include the O-antigenic polysaccharide (O-PS) portion of lipopolysaccharide, a crucial virulence determinant in Gram-negative pathogens. O-PSs are synthesized by one of two fundamentally different pathways. Escherichia coli O serotypes O8 and O9a provide the prototype systems for studying O-PS export via ABC transporters. The transporter is composed of the transmembrane component Wzm and the nucleotide-binding component Wzt. Although the N-terminal domain of Wzt is a conventional ABC protein, the C-terminal domain of Wzt (C-Wzt) is a unique structural element that determines the specificity of the transporter for either the O8 or O9a O-PS. We show here that the two domains of Wzt can function when expressed as separate polypeptides; both are essential for export. In vitro, C-Wzt binds its cognate O-PS by recognizing a residue located at the nonreducing end of the polymer. The crystal structure of C-WztO9a is reported here and reveals a {beta} sandwich with an immunoglobulin-like topology that contains the O-PS-binding pocket. Substrate interactions with nucleotide-binding domains have been demonstrated in an ABC exporter previously. However, to our knowledge substrate binding by a discrete, cytoplasmic accessory domain in an extended nucleotide-binding domain polypeptide has not previously been demonstrated. Elucidation of the substrate-recognition system involved in O-PS export provides insight into the mechanism that coordinates polymer biosynthesis, termination, and export.

  20. How to move an amphipathic molecule across a lipid bilayer: different mechanisms for different ABC transporters?

    PubMed Central

    Theodoulou, Frederica L.; Carrier, David J.; Schaedler, Theresia A.; Baldwin, Stephen A.; Baker, Alison

    2016-01-01

    Import of β-oxidation substrates into peroxisomes is mediated by ATP binding cassette (ABC) transporters belonging to subfamily D. In order to enter the β-oxidation pathway, fatty acids are activated by conversion to fatty acyl-CoA esters, a reaction which is catalysed by acyl-CoA synthetases (ACSs). Here, we present evidence for an unusual transport mechanism, in which fatty acyl-CoA substrates are accepted by ABC subclass D protein (ABCD) transporters, cleaved by the transporters during transit across the lipid bilayer to release CoA, and ultimately re-esterified in the peroxisome lumen by ACSs which interact with the transporter. We propose that this solves the biophysical problem of moving an amphipathic molecule across the peroxisomal membrane, since the intrinsic thioesterase activity of the transporter permits separate membrane translocation pathways for the hydrophobic fatty acid moiety and the polar CoA moiety. The cleavage/re-esterification mechanism also has the potential to control entry of disparate substrates into the β-oxidation pathway when coupled with distinct peroxisomal ACSs. A different solution to the movement of amphipathic molecules across a lipid bilayer is deployed by the bacterial lipid-linked oligosaccharide (LLO) flippase, PglK, in which the hydrophilic head group and the hydrophobic polyprenyl tail of the substrate are proposed to have distinct translocation pathways but are not chemically separated during transport. We discuss a speculative alternating access model for ABCD proteins based on the mammalian ABC transporter associated with antigen processing (TAP) and compare it to the novel mechanism suggested by the recent PglK crystal structures and biochemical data. PMID:27284041

  1. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  2. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants.

    PubMed

    Mentewab, Ayalew; Stewart, C Neal

    2005-09-01

    Selectable markers of bacterial origin such as the neomycin phosphotransferase type II gene, which can confer kanamycin resistance to transgenic plants, represent an invaluable tool for plant engineering. However, since all currently used antibiotic-resistance genes are of bacterial origin, there have been concerns about horizontal gene transfer from transgenic plants back to bacteria, which may result in antibiotic resistance. Here we characterize a plant gene, Atwbc19, the gene that encodes an Arabidopsis thaliana ATP binding cassette (ABC) transporter and confers antibiotic resistance to transgenic plants. The mechanism of resistance is novel, and the levels of resistance achieved are comparable to those attained through expression of bacterial antibiotic-resistance genes in transgenic tobacco using the CaMV 35S promoter. Because ABC transporters are endogenous to plants, the use of Atwbc19 as a selectable marker in transgenic plants may provide a practical alternative to current bacterial marker genes in terms of the risk for horizontal transfer of resistance genes.

  3. A Silent ABC Transporter Isolated from Streptomyces rochei F20 Induces Multidrug Resistance

    PubMed Central

    Fernández-Moreno, Miguel A.; Carbó, Lázaro; Cuesta, Trinidad; Vallín, Carlos; Malpartida, Francisco

    1998-01-01

    In the search for heterologous activators for actinorhodin production in Streptomyces lividans, 3.4 kb of DNA from Streptomyces rochei F20 (a streptothricin producer) were characterized. Subcloning experiments showed that the minimal DNA fragment required for activation was 0.4 kb in size. The activation is mediated by increasing the levels of transcription of the actII-ORF4 gene. Sequencing of the minimal activating fragment did not reveal any clues about its mechanism; nevertheless, it was shown to overlap the 3′ end of two convergent genes, one of whose translated products (ORF2) strongly resembles that of other genes belonging to the ABC transporter superfamily. Computer-assisted analysis of the 3.4-kb DNA sequence showed the 3′ terminus of an open reading frame (ORF), i.e., ORFA, and three complete ORFs (ORF1, ORF2, and ORFB). Searches in the databases with their respective gene products revealed similarities for ORF1 and ORF2 with ATP-binding proteins and transmembrane proteins, respectively, which are found in members of the ABC transporter superfamily. No similarities for ORFA and ORFB were found in the databases. Insertional inactivation of ORF1 and ORF2, their transcription analysis, and their cloning in heterologous hosts suggested that these genes were not expressed under our experimental conditions; however, cloning of ORF1 and ORF2 together (but not separately) under the control of an expressing promoter induced resistance to several chemically different drugs: oleandomycin, erythromycin, spiramycin, doxorubicin, and tetracycline. Thus, this genetic system, named msr, is a new bacterial multidrug ABC transporter. PMID:9696745

  4. A silent ABC transporter isolated from Streptomyces rochei F20 induces multidrug resistance.

    PubMed

    Fernández-Moreno, M A; Carbó, L; Cuesta, T; Vallín, C; Malpartida, F

    1998-08-01

    In the search for heterologous activators for actinorhodin production in Streptomyces lividans, 3.4 kb of DNA from Streptomyces rochei F20 (a streptothricin producer) were characterized. Subcloning experiments showed that the minimal DNA fragment required for activation was 0.4 kb in size. The activation is mediated by increasing the levels of transcription of the actII-ORF4 gene. Sequencing of the minimal activating fragment did not reveal any clues about its mechanism; nevertheless, it was shown to overlap the 3' end of two convergent genes, one of whose translated products (ORF2) strongly resembles that of other genes belonging to the ABC transporter superfamily. Computer-assisted analysis of the 3.4-kb DNA sequence showed the 3' terminus of an open reading frame (ORF), i.e., ORFA, and three complete ORFs (ORF1, ORF2, and ORFB). Searches in the databases with their respective gene products revealed similarities for ORF1 and ORF2 with ATP-binding proteins and transmembrane proteins, respectively, which are found in members of the ABC transporter superfamily. No similarities for ORFA and ORFB were found in the databases. Insertional inactivation of ORF1 and ORF2, their transcription analysis, and their cloning in heterologous hosts suggested that these genes were not expressed under our experimental conditions; however, cloning of ORF1 and ORF2 together (but not separately) under the control of an expressing promoter induced resistance to several chemically different drugs: oleandomycin, erythromycin, spiramycin, doxorubicin, and tetracycline. Thus, this genetic system, named msr, is a new bacterial multidrug ABC transporter.

  5. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  6. Hedgehog signaling regulates drug sensitivity by targeting ABC transporters ABCB1 and ABCG2 in epithelial ovarian cancer.

    PubMed

    Chen, Yi; Bieber, Marcia M; Teng, Nelson N H

    2014-08-01

    A major challenge of successful chemotherapy in ovarian cancer is overcoming intrinsic or acquired multi-drug resistance caused by active drug efflux mediated by ATP-binding cassette (ABC) transporters. Regulation of these transporters in ovarian cancer is poorly understood. We have found that abnormal expression of the hedgehog (Hh) signaling pathway transcription factor Gli1 is involved in the regulation of ABC transporters ABCB1 and ABCG2 in ovarian cancer. Hh is a known regulator of cancer cell proliferation and differentiation in several other types of invasive and metastatic malignancies. Our work has demonstrated that Gli1 is abnormally activated in a portion of ovarian cancers. Inhibition of Gli1 expression decreases ABCB1 and ABCG2 gene expression levels and enhances the response of ovarian cancer cells to certain chemotherapeutic drugs. The underlying mechanism is a direct association of Gli1 with a specific consensus sequence located in the promoter region of ABCB1 and ABCG2 genes. This study provides new understanding of ABC gene regulation by Hh signaling pathway, which may lead to the identification of new markers to detect and to anticipate ovarian cancer chemotherapy drug sensitivity.

  7. H-loop histidine catalyzes ATP hydrolysis in the E. coli ABC-transporter HlyB.

    PubMed

    Zhou, Yan; Ojeda-May, Pedro; Pu, Jingzhi

    2013-10-14

    Adenosine triphosphate (ATP)-binding cassette (ABC) transporters form a family of molecular motor proteins that couple ATP hydrolysis to substrate translocation across cell membranes. Each nucleotide binding domain of ABC-transporters contains a highly conserved H-loop histidine residue, whose precise mechanistic role in motor functions has remained elusive. By using combined quantum mechanical and molecular mechanical (QM/MM) calculations, we showed that the conserved H-loop residue H662 in E. coli HlyB, a bacterial ABC-transporter, can act first as a general acid and then as a general base to facilitate proton transfer in ATP hydrolysis. Without the assistance of H662, direct proton transfer from the lytic water to ATP results in a substantially higher barrier height. Our findings suggest that the essential function of the H-loop residue H662 is to provide a "chemical linchpin" that shuttles protons between reactants through a relay mechanism, thereby catalyzing ATP hydrolysis in HlyB.

  8. The ABC transporter ABC40 encodes a phenylacetic acid export system in Penicillium chrysogenum.

    PubMed

    Weber, Stefan S; Kovalchuk, Andriy; Bovenberg, Roel A L; Driessen, Arnold J M

    2012-11-01

    The filamentous fungus Penicillium chrysogenum is used for the industrial production of β-lactam antibiotics. The pathway for β-lactam biosynthesis has been resolved and involves the enzyme phenylacetic acid CoA ligase that is responsible for the CoA activation of the side chain precursor phenylacetic acid (PAA) that is used for the biosynthesis of penicillin G. To identify ABC transporters related to β-lactam biosynthesis, we analyzed the expression of all 48 ABC transporters present in the genome of P. chryso-genum when grown in the presence and absence of PAA. ABC40 is significantly upregulated when cells are grown or exposed to high levels of PAA. Although deletion of this transporter did not affect β-lactam biosynthesis, it resulted in a significant increase in sensitivity to PAA and other weak acids. It is concluded that ABC40 is involved in weak acid detoxification in P. chrysogenum including resistance to phenylacetic acid.

  9. Structure and function of the universal stress protein TeaD and its role in regulating the ectoine transporter TeaABC of Halomonas elongata DSM 2581(T).

    PubMed

    Schweikhard, Eva S; Kuhlmann, Sonja I; Kunte, Hans-Jörg; Grammann, Katrin; Ziegler, Christine M

    2010-03-16

    The halophilic bacterium Halomonas elongata takes up the compatible solute ectoine via the osmoregulated TRAP transporter TeaABC. A fourth orf (teaD) is located adjacent to the teaABC locus that encodes a putative universal stress protein (USP). By RT-PCR experiments we proved a cotranscription of teaD along with teaABC. Deletion of teaD resulted in an enhanced uptake for ectoine by the transporter TeaABC and hence a negative activity regulation of TeaABC by TeaD. A transcriptional regulation via DNA binding could be excluded. ATP binding to native TeaD was shown by HPLC, and the crystal structure of TeaD was solved in complex with ATP to a resolution of 1.9 A by molecular replacement. TeaD forms a dimer-dimer complex with one ATP molecule bound to each monomer, which has a Rossmann-like alpha/beta overall fold. Our results reveal an ATP-dependent oligomerization of TeaD, which might have a functional role in the regulatory mechanism of TeaD. USP-encoding orfs, which are located adjacent to genes encoding for TeaABC homologues, could be identified in several other organisms, and their physiological role in balancing the internal cellular ectoine pool is discussed.

  10. Enantioselective induction of a glutathione-S-transferase, a glutathione transporter and an ABC transporter in maize by Metolachlor and its (S)-isomer.

    PubMed

    Pang, Sen; Ran, Zhaojin; Liu, Zhiqian; Song, Xiaoyu; Duan, Liusheng; Li, Xuefeng; Wang, Chengju

    2012-01-01

    The metabolism of chiral herbicides in plants remains poorly understood. Glutathione conjugation reactions are one of the principal mechanisms that plants utilize to detoxify xenobiotics. The induction by rac- and S-metolachlor of the expression of three genes, ZmGST27, ZmGT1 and ZmMRP1, encoding respectively a glutathione-S-transferase, a glutathione transporter and an ATP-binding cassette (ABC) transporter was studied in maize. The results demonstrate that the inducing effect of rac- and S-metolachlor on the expression of ZmGST27 and ZmGT1 is comparable. However, the inducing effect of rac-metolachlor on ZmMRP1 expression is more pronounced than that of S-metolachlor. Furthermore, vanadate, an ABC transporter inhibitor, could greatly reduce the difference in herbicidal activity between rac- and S-metolachlor. These results suggest that the ABC transporters may preferentially transport conjugates of rac-metolachlor, leading to a faster metabolism of the latter. Through comparing the expression of ZmGST27, ZmMRP1 and ZmGT1 after treatment by rac- and S-metolachlor, we provide novel insights into the metabolic processes of chiral herbicides in plants.

  11. Enantioselective Induction of a Glutathione-S-Transferase, a Glutathione Transporter and an ABC Transporter in Maize by Metolachlor and Its (S)-Isomer

    PubMed Central

    Liu, Zhiqian; Song, Xiaoyu; Duan, Liusheng; Li, Xuefeng; Wang, Chengju

    2012-01-01

    The metabolism of chiral herbicides in plants remains poorly understood. Glutathione conjugation reactions are one of the principal mechanisms that plants utilize to detoxify xenobiotics. The induction by rac- and S-metolachlor of the expression of three genes, ZmGST27, ZmGT1 and ZmMRP1, encoding respectively a glutathione-S-transferase, a glutathione transporter and an ATP-binding cassette (ABC) transporter was studied in maize. The results demonstrate that the inducing effect of rac- and S-metolachlor on the expression of ZmGST27 and ZmGT1 is comparable. However, the inducing effect of rac-metolachlor on ZmMRP1 expression is more pronounced than that of S-metolachlor. Furthermore, vanadate, an ABC transporter inhibitor, could greatly reduce the difference in herbicidal activity between rac- and S-metolachlor. These results suggest that the ABC transporters may preferentially transport conjugates of rac-metolachlor, leading to a faster metabolism of the latter. Through comparing the expression of ZmGST27, ZmMRP1 and ZmGT1 after treatment by rac- and S-metolachlor, we provide novel insights into the metabolic processes of chiral herbicides in plants. PMID:23144728

  12. Variation and evolution of the ABC transporter genes ABCB1, ABCC1, ABCG2, ABCG5 and ABCG8: implication for pharmacogenetics and disease.

    PubMed

    Silverton, Latoya; Dean, Michael; Moitra, Karobi

    2011-01-01

    The ATP-binding cassette (ABC) transporter genes are ubiquitous in the genomes of all vertebrates. Some of these transporters play a key role in xenobiotic defense and are endowed with the capacity to efflux harmful toxic substances. A major role in the evolution of the vertebrate ABC genes is played by gene duplication. Multiple gene duplication and deletion events have been identified in ABC genes, resulting in either gene birth or gene death indicating that the process of gene evolution is still ongoing in this group of transporters. Additionally, polymorphisms in these genes are linked to variations in expression, function, drug disposition and drug response. Single nucleotide polymorphisms in the ABC genes may be considered as markers of individual risk for adverse drug reactions or susceptibility to complex diseases as they can uniquely influence the quality and quantity of gene product. As the ABC genes continue to evolve, globalization will yield additional migration and racial admixtures that will have far reaching implications for the pharmacogenetics of this unique family of transporters in the context of human health.

  13. A New ABC Half-Transporter in Leishmania major Is Involved in Resistance to Antimony

    PubMed Central

    Manzano, J. I.; García-Hernández, R.; Castanys, S.

    2013-01-01

    The characterization of ABCI4, a new intracellular ATP-binding cassette (ABC) half-transporter in Leishmania major, is described. We show that ABCI4 is involved in heavy metal export, thereby conferring resistance to Pentostam, to Sb(III), and to As(III) and Cd(II). Parasites overexpressing ABCI4 showed a lower mitochondrial toxic effect of antimony by decreasing reactive oxygen species production and maintained higher values of both the mitochondrial electrochemical potential and total ATP levels with respect to controls. The ABCI4 half-transporter forms homodimers as determined by a coimmunoprecipitation assay. A combination of subcellular localization studies under a confocal microscope and a surface biotinylation assay using parasites expressing green fluorescent protein- and FLAG-tagged ABCI4 suggests that the transporter presents a dual localization in both mitochondria and the plasma membrane. Parasites overexpressing ABCI4 present an increased replication in mouse peritoneal macrophages. We have determined that porphyrins are substrates for ABCI4. Consequently, the overexpression of ABCI4 confers resistance to some toxic porphyrins, such as zinc-protoporphyrin, due to the lower accumulation resulting from a significant efflux, as determined using the fluorescent zinc-mesoporphyrin, a validated heme analog. In addition, ABCI4 has a significant ability to efflux thiol after Sb(III) incubation, thus meaning that ABCI4 could be considered to be a potential thiol-X-pump that is able to recognize metal-conjugated thiols. In summary, we have shown that this new ABC transporter is involved in drug sensitivity to antimony and other compounds by efflux as conjugated thiol complexes. PMID:23716044

  14. The uncoupled ATPase activity of the ABC transporter BtuC2D2 leads to a hysteretic conformational change, conformational memory, and improved activity

    PubMed Central

    Livnat-Levanon, Nurit; I. Gilson, Amy; Ben-Tal, Nir; Lewinson, Oded

    2016-01-01

    ABC transporters comprise a large and ubiquitous family of proteins. From bacteria to man they translocate solutes at the expense of ATP hydrolysis. Unlike other enzymes that use ATP as an energy source, ABC transporters are notorious for having high levels of basal ATPase activity: they hydrolyze ATP also in the absence of their substrate. It is unknown what are the effects of such prolonged and constant activity on the stability and function of ABC transporters or any other enzyme. Here we report that prolonged ATP hydrolysis is beneficial to the ABC transporter BtuC2D2. Using ATPase assays, surface plasmon resonance interaction experiments, and transport assays we observe that the constantly active transporter remains stable and functional for much longer than the idle one. Remarkably, during extended activity the transporter undergoes a slow conformational change (hysteresis) and gradually attains a hyperactive state in which it is more active than it was to begin with. This phenomenon is different from stabilization of enzymes by ligand binding: the hyperactive state is only reached through ATP hydrolysis, and not ATP binding. BtuC2D2 displays a strong conformational memory for this excited state, and takes hours to return to its basal state after catalysis terminates. PMID:26905293

  15. Barley has two peroxisomal ABC transporters with multiple functions in β-oxidation

    PubMed Central

    Mendiondo, Guillermina M.; Medhurst, Anne; van Roermund, Carlo W.; Zhang, Xuebin; Devonshire, Jean; Scholefield, Duncan; Fernández, José; Axcell, Barry; Ramsay, Luke; Waterham, Hans R.; Waugh, Robbie; Theodoulou, Frederica L.; Holdsworth, Michael J.

    2014-01-01

    In oilseed plants, peroxisomal β-oxidation functions not only in lipid catabolism but also in jasmonate biosynthesis and metabolism of pro-auxins. Subfamily D ATP-binding cassette (ABC) transporters mediate import of β-oxidation substrates into the peroxisome, and the Arabidopsis ABCD protein, COMATOSE (CTS), is essential for this function. Here, the roles of peroxisomal ABCD transporters were investigated in barley, where the main storage compound is starch. Barley has two CTS homologues, designated HvABCD1 and HvABCD2, which are widely expressed and present in embryo and aleurone tissues during germination. Suppression of both genes in barley RNA interference (RNAi) lines indicated roles in metabolism of 2,4-dichlorophenoxybutyrate (2,4-DB) and indole butyric acid (IBA), jasmonate biosynthesis, and determination of grain size. Transformation of the Arabidopsis cts-1 null mutant with HvABCD1 and HvABCD2 confirmed these findings. HvABCD2 partially or completely complemented all tested phenotypes of cts-1. In contrast, HvABCD1 failed to complement the germination and establishment phenotypes of cts-1 but increased the sensitivity of hypocotyls to 100 μM IBA and partially complemented the seed size phenotype. HvABCD1 also partially complemented the yeast pxa1/pxa2Δ mutant for fatty acid β-oxidation. It is concluded that the core biochemical functions of peroxisomal ABC transporters are largely conserved between oilseeds and cereals but that their physiological roles and importance may differ. PMID:24913629

  16. Investigation of the quaternary structure of an ABC transporter in living cells using spectrally resolved resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Singh, Deo Raj

    Forster resonance energy transfer (FRET) has become an important tool to study proteins inside living cells. It has been used to explore membrane protein folding and dynamics, determine stoichiometry and geometry of protein complexes, and measure the distance between two molecules. In this dissertation, we use a method based on FRET and optical micro-spectroscopy (OptiMiS) technology, developed in our lab, to probe the structure of dynamic (as opposed to static) protein complexes in living cells. We use this method to determine the association stoichiometry and quaternary structure of an ABC transporter in living cells. Specifically, the transporter we investigate originates from the pathogen Pseudomonas aeruginosa, which is a Gram-negative bacterium with several virulence factors, lipopolysaccharides being one of them. This pathogen coexpresses two unique forms of lipopolysaccharides on its surface, the A- and B-bands. The A-band polysaccharides, synthesized in the cytoplasm, are translocated into the periplasm through an ATP-binding-cassette (ABC) transporter consisting of a transmembranar protein, Wzm, and a nucleotide-binding protein, Wzt. In P. aeruginosa, all of the biochemical studies of A-band LPS are concentrated on the stages of the synthesis and ligation of polysaccharides (PSs), leaving the export stage involving ABC transporter unexplored. The mode of PS export through ABC transporters is still unknown. This difficulty is due to the lack of information about sub-unit composition and structure of this bi-component ABC transporter. Using the FRET-OptiMiS combination method developed by our lab, we found that Wzt forms a rhombus-shaped homo-tetramer which becomes a square upon co-expression with Wzm, and that Wzm forms a square-shaped homo-tetramer both in the presence and absence of Wzt. Based on these results, we propose a structural model for the double-tetramer complex formed by the bi-component ABC transporter in living cells. An understanding of the

  17. ABC transporter functions as a pacemaker for sequestration of plant glucosides in leaf beetles

    PubMed Central

    Strauss, Anja S; Peters, Sven; Boland, Wilhelm; Burse, Antje

    2013-01-01

    Plant-herbivore interactions dominate the planet’s terrestrial ecology. When it comes to host–plant specialization, insects are among the most versatile evolutionary innovators, able to disarm multiple chemical plant defenses. Sequestration is a widespread strategy to detoxify noxious metabolites, frequently for the insect’s own benefit against predation. In this study, we describe the broad-spectrum ATP-binding cassette transporter CpMRP of the poplar leaf beetle, Chrysomela populi as the first candidate involved in the sequestration of phytochemicals in insects. CpMRP acts in the defensive glands of the larvae as a pacemaker for the irreversible shuttling of pre-selected metabolites from the hemolymph into defensive secretions. Silencing CpMRP in vivo creates a defenseless phenotype, indicating its role in the secretion process is crucial. In the defensive glands of related leaf beetle species, we identified sequences similar to CpMRP and assume therefore that exocrine gland-based defensive strategies, evolved by these insects to repel their enemies, rely on ABC transporters as a key element. DOI: http://dx.doi.org/10.7554/eLife.01096.001 PMID:24302568

  18. Co-Induction of a Glutathione-S-transferase, a Glutathione Transporter and an ABC Transporter in Maize by Xenobiotics

    PubMed Central

    Liu, Zhiqian; Song, Xiaoyu; Li, Xuefeng; Wang, Chengju

    2012-01-01

    Glutathione conjugation reactions are one of the principal mechanisms that plants utilize to detoxify xenobiotics. The induction by four herbicides (2,4-D, atrazine, metolachlor and primisulfuron) and a herbicide safener (dichlormid) on the expression of three genes, ZmGST27, ZmGT1 and ZmMRP1, encoding respectively a glutathione-S-transferase, a glutathione transporter and an ATP-binding cassette (ABC) transporter was studied in maize. The results demonstrate that the inducing effect on gene expression varies with both chemicals and genes. The expression of ZmGST27 and ZmMRP1 was up-regulated by all five compounds, whereas that of ZmGT1 was increased by atrazine, metolachlor, primisulfuron and dichlormid, but not by 2,4-D. For all chemicals, the inducing effect was first detected on ZmGST27. The finding that ZmGT1 is activated alongside ZmGST27 and ZmMRP1 suggests that glutathione transporters are an important component in the xenobiotic detoxification system of plants. PMID:22792398

  19. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  20. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  1. ABC transporter research: going strong 40 years on

    PubMed Central

    Theodoulou, Frederica L.; Kerr, Ian D.

    2015-01-01

    In most organisms, ABC transporters constitute one of the largest families of membrane proteins. In humans, their functions are diverse and underpin numerous key physiological processes, as well as being causative factors in a number of clinically relevant pathologies. Advances in our understanding of these diseases have come about through combinations of genetic and protein biochemical investigations of these transporters and the power of in vitro and in vivo investigations is helping to develop genotype–phenotype understanding. However, the importance of ABC transporter research goes far beyond human biology; microbial ABC transporters are of great interest in terms of understanding virulence and drug resistance and industrial biotechnology researchers are exploring the potential of prokaryotic ABC exporters to increase the capacity of synthetic biology systems. Plant ABC transporters play important roles in transport of hormones, xenobiotics, metals and secondary metabolites, pathogen responses and numerous aspects of development, all of which are important in the global food security area. For 3 days in Chester, this Biochemical Society Focused Meeting brought together researchers with diverse experimental approaches and with different fundamental questions, all of which are linked by the commonality of ABC transporters. PMID:26517919

  2. Functional Dependence between Septal Protein SepJ from Anabaena sp. Strain PCC 7120 and an Amino Acid ABC-Type Uptake Transporter

    PubMed Central

    Escudero, Leticia; Mariscal, Vicente

    2015-01-01

    ABSTRACT In the diazotrophic filaments of heterocyst-forming cyanobacteria, two different cell types, the CO2-fixing vegetative cells and the N2-fixing heterocysts, exchange nutrients, including some amino acids. In the model organism Anabaena sp. strain PCC 7120, the SepJ protein, composed of periplasmic and integral membrane (permease) sections, is located at the intercellular septa joining adjacent cells in the filament. The unicellular cyanobacterium Synechococcus elongatus strain PCC 7942 bears a gene, Synpcc7942_1024 (here designated dmeA), encoding a permease homologous to the SepJ permease domain. Synechococcus strains lacking dmeA or lacking dmeA and expressing Anabaena sepJ were constructed. The Synechococcus dmeA mutant showed a significant 22 to 32% decrease in the uptake of aspartate, glutamate, and glutamine, a phenotype that could be partially complemented by Anabaena sepJ. Synechococcus mutants of an ATP-binding-cassette (ABC)-type transporter for polar amino acids showed >98% decreased uptake of glutamate irrespective of the presence of dmeA or Anabaena sepJ in the same strain. Thus, Synechococcus DmeA or Anabaena SepJ is needed to observe full (or close to full) activity of the ABC transporter. An Anabaena sepJ deletion mutant was significantly impaired in glutamate and aspartate uptake, which also in this cyanobacterium requires the activity of an ABC-type transporter for polar amino acids. SepJ appears therefore to generally stimulate the activity of cyanobacterial ABC-type transporters for polar amino acids. Conversely, an Anabaena mutant of three ABC-type transporters for amino acids was impaired in the intercellular transfer of 5-carboxyfluorescein, a SepJ-related property. Our results unravel possible functional interactions in transport elements important for diazotrophic growth. IMPORTANCE Membrane transporters are essential for many aspects of cellular life, from uptake and export of substances in unicellular organisms to intercellular

  3. A Two-Component System Regulates the Expression of an ABC Transporter for Xylo-Oligosaccharides in Geobacillus stearothermophilus▿

    PubMed Central

    Shulami, Smadar; Zaide, Galia; Zolotnitsky, Gennady; Langut, Yael; Feld, Geoff; Sonenshein, Abraham L.; Shoham, Yuval

    2007-01-01

    Geobacillus stearothermophilus T-6 utilizes an extensive and highly regulated hemicellulolytic system. The genes comprising the xylanolytic system are clustered in a 39.7-kb chromosomal segment. This segment contains a 6-kb transcriptional unit (xynDCEFG) coding for a potential two-component system (xynDC) and an ATP-binding cassette (ABC) transport system (xynEFG). The xynD promoter region contains a 16-bp inverted repeat resembling the operator site for the xylose repressor, XylR. XylR was found to bind specifically to this sequence, and binding was efficiently prevented in vitro in the presence of xylose. The ABC transport system was shown to comprise an operon of three genes (xynEFG) that is transcribed from its own promoter. The nonphosphorylated fused response regulator, His6-XynC, bound to a 220-bp fragment corresponding to the xynE operator. DNase I footprinting analysis showed four protected zones that cover the −53 and the +34 regions and revealed direct repeat sequences of a GAAA-like motif. In vitro transcriptional assays and quantitative reverse transcription-PCR demonstrated that xynE transcription is activated 140-fold in the presence of 1.5 μM XynC. The His6-tagged sugar-binding lipoprotein (XynE) of the ABC transporter interacted with different xylosaccharides, as demonstrated by isothermal titration calorimetry. The change in the heat capacity of binding (ΔCp) for XynE with xylotriose suggests a stacking interaction in the binding site that can be provided by a single Trp residue and a sugar moiety. Taken together, our data show that XynEFG constitutes an ABC transport system for xylo-oligosaccharides and that its transcription is negatively regulated by XylR and activated by the response regulator XynC, which is part of a two-component sensing system. PMID:17142383

  4. ABC Transporter Required for Intercellular Transfer of Developmental Signals in a Heterocystous Cyanobacterium

    PubMed Central

    Videau, Patrick; Rivers, Orion S.; Higa, Kelly C.

    2015-01-01

    ABSTRACT In the filamentous cyanobacterium Anabaena, patS and hetN encode peptide-derived signals with many of the properties of morphogens. These signals regulate the formation of a periodic pattern of heterocysts by lateral inhibition of differentiation. Here we show that intercellular transfer of the patS- and hetN-dependent developmental signals from heterocysts to vegetative cells requires HetC, a predicted ATP-binding cassette transporter (ABC transporter). Relative to the wild type, in a hetC mutant differentiation resulted in a reduced number of heterocysts that were incapable of nitrogen fixation, but deletion of patS or hetN restored heterocyst number and function in a hetC background. These epistasis results suggest that HetC is necessary for conferring self-immunity to the inhibitors on differentiating cells. Nine hours after induction of differentiation, HetC was required for neither induction of transcription of patS nor intercellular transfer of the patS-encoded signal to neighboring cells. Conversely, in strains lacking HetC, the patS- and hetN-encoded signals were not transferred from heterocyst cells to adjacent vegetative cells. The results support a model in which the patS-dependent signal is initially transferred between vegetative cells in a HetC-independent fashion, but some time before morphological differentiation of heterocysts is complete, transfer of both signals transitions to a HetC-dependent process. IMPORTANCE How chemical cues that regulate pattern formation in multicellular organisms move from one cell to another is a central question in developmental biology. In this study, we show that an ABC transporter, HetC, is necessary for transport of two developmental signals between different types of cells in a filamentous cyanobacterium. ABC transporters are found in organisms as diverse as bacteria and humans and, as the name implies, are often involved in the transport of molecules across a cellular membrane. The activity of HetC was

  5. Lysophosphatidylinositol: a novel link between ABC transporters and G-protein-coupled receptors.

    PubMed

    Ruban, Emily L; Ferro, Riccardo; Arifin, Syamsul Ahmad; Falasca, Marco

    2014-10-01

    Lysophosphatidylinositol (LPI) is a well-known bioactive lipid that is able to activate signalling cascades relevant to cell proliferation, migration, survival and tumorigenesis. Our previous work suggested that LPI is involved in cancer progression since it can be released in the medium of Ras-transformed fibroblasts and can function as an autocrine modulator of cell growth. Different research groups have established that LPI is the specific and functional ligand for G-protein-coupled receptor 55 (GPR55) and that this GPR55-LPI axis is able to activate signalling cascades that are relevant for different cell functions. Work in our laboratory has recently unravelled an autocrine loop, by which LPI synthesized by cytosolic phospholipase A₂ (cPLA₂) is pumped out of the cell by ATP-binding cassette (ABC) transporter C1 (ABCC1)/multidrug resistance protein 1 (MRP1), initiating a signalling cascade downstream of GPR55. Our current work suggests that blockade of this pathway may represent a novel strategy to inhibit cancer cell proliferation.

  6. Up-regulation of ATP-binding cassette transporters in the THP-1 human macrophage cell line by the antichagasic benznidazole

    PubMed Central

    Perdomo, Virginia G; Rigalli, Juan P; Luquita, Marcelo G; Pellegrino, José M; Ruiz, María Laura; Catania, Viviana A

    2016-01-01

    The effect of benznidazole (BZL) on the expression and activity of P-glycoprotein (P-gp, ABCB1) and multidrug resistance-associated protein 2 (MRP2, ABCC2), the two major transporters of endogenous and exogenous compounds, was evaluated in differentiated THP-1 cells. BZL induced P-gp and MRP2 proteins in a concentration-dependent manner. The increase in mRNA levels of both transporters suggests transcriptional regulation. P-gp and MRP2 activities correlated with increased protein levels. BZL intracellular accumulation was significantly lower in BZL-pre-treated cells than in control cells. PSC833 (a P-gp inhibitor) increased the intracellular BZL concentration in both pre-treated and control cells, confirming P-gp participation in BZL efflux. PMID:27783718

  7. Inducer exclusion in Firmicutes: Insights into the regulation of a carbohydrate ATP binding cassette transporter from Lactobacillus casei BL23 by the signal transducing protein P-Ser46-HPr.

    PubMed

    Homburg, Constanze; Bommer, Martin; Wuttge, Steven; Hobe, Carolin; Beck, Sebastian; Dobbek, Holger; Deutscher, Josef; Licht, Anke; Schneider, Erwin

    2017-03-30

    Catabolite repression is a mechanism that enables bacteria to control carbon utilization. As part of this global regulatory network, components of the phosphoenolpyruvate:carbohydrate phosphotransferase system inhibit the uptake of less favourable sugars when a preferred carbon source such as glucose is available. This process is termed inducer exclusion. In bacteria belonging to the phylum Firmicutes, HPr, phosphorylated at serine 46 (P-Ser46-HPr) is the key player but its mode of action is elusive. To address this question at the level of purified protein components, we have chosen a homolog of the E. coli maltose/maltodextrin ATP-binding cassette transporter from Lactobacillus casei (MalE1-MalF1G1K12 ) as a model system. We show that the solute binding protein, MalE1, binds linear and cyclic maltodextrins but not maltose. Crystal structures of MalE1 complexed with these sugars provide a clue why maltose is not a substrate. P-Ser46-HPr inhibited MalE1/maltotetraose-stimulated ATPase activity of the transporter incorporated in proteoliposomes. Furthermore, cross-linking experiments revealed that P-Ser46-HPr contacts the nucleotide-binding subunit, MalK1, in proximity to the Walker A motif. However, P-Ser46-HPr did not block binding of ATP to MalK1. Together, our findings provide first biochemical evidence that P-Ser-HPr arrests the transport cycle by preventing ATP hydrolysis at the MalK1 subunits of the transporter. This article is protected by copyright. All rights reserved.

  8. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  9. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    PubMed Central

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind; Hansen, Axel Kornerup; Holmskov, Uffe; Stensballe, Allan; Vogel, Ulla

    2015-01-01

    AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1/Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes in relation to colitis was suggested by the animal studies. The finding that colitis was preceded by altered gut bacterial composition suggests that deletion of Abcb1 leads to fundamental changes of host-microbiota interaction. Also, high fat diet increases the frequency and severity of colitis in specific pathogen-free Abcb1 KO mice. The Abcb1 KO mice might thus serve as a model in which diet/environmental factors and microbes may be controlled and investigated in relation to intestinal inflammation. Potential molecular mechanisms include defective transport of inflammatory mediators and/or phospholipid translocation from one side to the other of the cell membrane lipid bilayer by ABC transporters affecting inflammatory response and/or function of tight junctions, phagocytosis and vesicle trafficking. Also, diet and microbes give rise to molecules which are potential substrates for the ABC transporters and which may additionally affect ABC transporter function through nuclear receptors and transcriptional regulation. Another critical role of ABCB1 was suggested by the finding that

  10. Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells

    SciTech Connect

    Fuchs, Dominik; Daniel, Volker; Sadeghi, Mahmoud; Opelz, Gerhard; Naujokat, Cord

    2010-04-16

    Leukemia stem cells are known to exhibit multidrug resistance by expression of ATP-binding cassette (ABC) transporters which constitute transmembrane proteins capable of exporting a wide variety of chemotherapeutic drugs from the cytosol. We show here that human promyeloblastic leukemia KG-1a cells exposed to the histone deacetylase inhibitor phenylbutyrate resemble many characteristics of leukemia stem cells, including expression of functional ABC transporters such as P-glycoprotein, BCRP and MRP8. Consequently, KG-1a cells display resistance to the induction of apoptosis by various chemotherapeutic drugs. Resistance to apoptosis induction by chemotherapeutic drugs can be reversed by cyclosporine A, which effectively inhibits the activity of P-glycoprotein and BCRP, thus demonstrating ABC transporter-mediated drug resistance in KG-1a cells. However, KG-1a are highly sensitive to apoptosis induction by salinomycin, a polyether ionophore antibiotic that has recently been shown to kill human breast cancer stem cell-like cells and to induce apoptosis in human cancer cells displaying multiple mechanisms of drug and apoptosis resistance. Whereas KG-1a cells can be adapted to proliferate in the presence of apoptosis-inducing concentrations of bortezomib and doxorubicin, salinomycin does not permit long-term adaptation of the cells to apoptosis-inducing concentrations. Thus, salinomycin should be regarded as a novel and effective agent for the elimination of leukemia stem cells and other tumor cells exhibiting ABC transporter-mediated multidrug resistance.

  11. The contribution of methionine to the stability of the Escherichia coli MetNIQ ABC transporter - substrate binding protein complex

    PubMed Central

    Nguyen, Phong T.; Li, Qi Wen; Kadaba, Neena S.; Lai, Jeffrey Y.; Yang, Janet G.; Rees, Douglas C.

    2015-01-01

    Despite the ubiquitous role of ATP Binding Cassette (ABC) importers in nutrient uptake, only the E. coli maltose and vitamin B12 ABC transporters have been structurally characterized in multiple conformations relevant to the alternating access transport mechanism. To complement our previous structure determination of the E. coli MetNI methionine importer in the inward facing conformation (Kadaba et al. (2008) Science 321, 250–253), we have explored conditions stabilizing the outward facing conformation. Using two variants, the Walker B E166Q mutation with ATP+EDTA to stabilize MetNI in the ATP-bound conformation and the N229A variant of the binding protein MetQ, shown in this work to disrupt methionine binding, a high affinity MetNIQ complex was formed with a dissociation constant measured to be 27 nM. Using wild type MetQ containing a co-purified methionine (for which the crystal structure is reported at 1.6 Å resolution), the dissociation constant for complex formation with MetNI is measured to be ~40-fold weaker, indicating that complex formation lowers the affinity of MetQ for methionine by this amount. Preparation of a stable MetNIQ complex is an essential step towards the crystallographic analysis of the outward facing conformation, a key intermediate in the uptake of methionine by this transport system. PMID:25803078

  12. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  13. The bovine ATP-binding cassette transporter ABCG2 Tyr581Ser single-nucleotide polymorphism increases milk secretion of the fluoroquinolone danofloxacin.

    PubMed

    Otero, Jon A; Real, Rebeca; de la Fuente, Álvaro; Prieto, Julio G; Marqués, Margarita; Álvarez, Ana I; Merino, Gracia

    2013-03-01

    The bovine adenosine triphosphate-binding cassette transporter G2 (ABCG2/breast cancer resistance protein) polymorphism Tyr581Ser (Y581S) has recently been shown to increase in vitro transepithelial transport of antibiotics. Since this transporter has been extensively related to the active secretion of drugs into milk, the potential in vivo effect of this polymorphism on secretion of xenobiotics in livestock could have striking consequences for milk production, the dairy industry, and public health. Our purpose was to study the in vivo effect of this polymorphism on the secretion of danofloxacin, a widely used veterinary antibiotic, into milk. Danofloxacin (1.25 mg/kg) was administered to six Y/Y 581 homozygous and six Y/S 581 heterozygous lactating cows, and plasma and milk samples were collected and analyzed by high-performance liquid chromatography. No differences were found in the pharmacokinetic parameters of danofloxacin in plasma between the two groups of animals. In contrast, Y/S heterozygous cows showed a 2-fold increase in danofloxacin levels in milk. In addition, the pharmacokinetic elimination parameters, mean residence time and elimination half-life, were significantly lower in the milk of the animals carrying the Y/S polymorphism. These in vivo results are in agreement with our previously published in vitro data, which showed a greater capacity of the S581 variant in accumulation assays, and demonstrate, for the first time, an important effect of the Y581S single-nucleotide polymorphism on antibiotic secretion into cow milk. These findings could be extended to other ABCG2 substrates, and may be relevant for the treatment of mastitis and for the design of accurate and novel strategies to handle milk residues.

  14. Enterococcus faecalis Uses a Phosphotransferase System Permease and a Host Colonization-Related ABC Transporter for Maltodextrin Uptake.

    PubMed

    Sauvageot, Nicolas; Mokhtari, Abdelhamid; Joyet, Philippe; Budin-Verneuil, Aurélie; Blancato, Víctor S; Repizo, Guillermo D; Henry, Céline; Pikis, Andreas; Thompson, John; Magni, Christian; Hartke, Axel; Deutscher, Josef

    2017-05-01

    Maltodextrin is a mixture of maltooligosaccharides, which are produced by the degradation of starch or glycogen. They are mostly composed of α-1,4- and some α-1,6-linked glucose residues. Genes presumed to code for the Enterococcus faecalis maltodextrin transporter were induced during enterococcal infection. We therefore carried out a detailed study of maltodextrin transport in this organism. Depending on their length (3 to 7 glucose residues), E. faecalis takes up maltodextrins either via MalT, a maltose-specific permease of the phosphoenolpyruvate (PEP):carbohydrate phosphotransferase system (PTS), or the ATP binding cassette (ABC) transporter MdxEFG-MsmX. Maltotriose, the smallest maltodextrin, is primarily transported by the PTS permease. A malT mutant therefore exhibits significantly reduced growth on maltose and maltotriose. The residual uptake of the trisaccharide is catalyzed by the ABC transporter, because a malT mdxF double mutant no longer grows on maltotriose. The trisaccharide arrives as maltotriose-6″-P in the cell. MapP, which dephosphorylates maltose-6'-P, also releases Pi from maltotriose-6″-P. Maltotetraose and longer maltodextrins are mainly (or exclusively) taken up via the ABC transporter, because inactivation of the membrane protein MdxF prevents growth on maltotetraose and longer maltodextrins up to at least maltoheptaose. E. faecalis also utilizes panose and isopanose, and we show for the first time, to our knowledge, that in contrast to maltotriose, its two isomers are primarily transported via the ABC transporter. We confirm that maltodextrin utilization via MdxEFG-MsmX affects the colonization capacity of E. faecalis, because inactivation of mdxF significantly reduced enterococcal colonization and/or survival in kidneys and liver of mice after intraperitoneal infection.IMPORTANCE Infections by enterococci, which are major health care-associated pathogens, are difficult to treat due to their increasing resistance to clinically

  15. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na

    2016-01-01

    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through the modulation of miR-33 and ABCA1-mediated cholesterol efflux from macrophages. The results showed that treatment of the statins up-regulated miR-33 expression, but down-regulated ABCA1 mRNA levels in RAW264.7 cells and bone marrow-derived macrophages. Statin-mediated ABCA1 regulation occurs at the post-transcriptional level through targeting of the 3′-UTR of the ABCA1 transcript by miR-33. Additionally, we found significant down-regulation of ABCA1 protein expression in macrophages treated with statins. Finally, we showed that high glucose and statin treatment significantly suppressed cholesterol efflux from macrophages. These findings have highlighted the complexity of statins, which may exert detrimental effects on metabolic abnormalities through regulation of miR-33 target genes. PMID:27139226

  16. The two-component system BfrAB regulates expression of ABC transporters in Streptococcus gordonii and Streptococcus sanguinis

    PubMed Central

    Zhang, Yongshu; Whiteley, Marvin; Kreth, Jens; Lei, Yu; Khammanivong, Ali; Evavold, Jamie N.; Fan, Jingyuan; Herzberg, Mark C.

    2009-01-01

    The putative two-component system BfrAB is involved in Streptococcus gordonii biofilm development. Here, we provide evidence that BfrAB regulates the expression of bfrCD and bfrEFG, which encode two ABC transporters, and bfrH, which encodes a CAAX amino-terminal protease family protein. BfrC and BfrE are ATP-binding proteins and BfrD, BfrF and BfrG are homologous membrane- spanning polypeptides. Similarly, BfrABss, the BfrAB homologous system in S. sanguinis controls the expression of two bfrCD-homologous operons (bfrCDss and bfrXYss), a bfrH-homologous gene (bfrH1ss) and another CAAX amino- terminal protease family protein gene (bfrH2ss). Furthermore, we demonstrate that the purified BfrA DNA-binding domain from S. gordonii binds to the promoter regions of bfrCD, bfrEFG, bfrH, bfrCDss, bfrXYss, and bfrH1ss in vitro. Finally, we show that the BfrA DNA-binding domain recognizes a conserved DNA motif with a consensuses sequence of TTTCTTTAGAAATATTTTAGAATT. These data suggest, therefore, that S. gordonii BfrAB could control biofilm formation by regulating multiple ABC-transporter systems. PMID:19118357

  17. Expression and splicing of ABC and SLC transporters in the human blood-brain barrier measured with RNAseq.

    PubMed

    Suhy, Adam M; Webb, Amy; Papp, Audrey C; Geier, Ethan G; Sadee, Wolfgang

    2017-02-07

    The blood-brain barrier (BBB) expresses numerous membrane transporters that supply needed nutrients to the central nervous system (CNS), consisting mostly of solute carriers (SLC transporters), or remove unwanted substrates via extrusion pumps through the action of ATP binding cassette (ABC) transporters. Previous work has identified many BBB transporters using hybridization arrays or qRT-PCR, using targeted probes. Here we have performed next-generation sequencing of the transcriptome (RNAseq) extracted from cerebral cortex tissues and brain microvessel endothelial cells (BMEC) obtained from two donors. The same RNA samples had previously been measured for transporter expression using qRT-PCR (Geier et al., 2013), yielding similar expression levels for overlapping mRNAs (R=0.66, p<0.001). RNAseq confirms a number of transporters highly enriched in BMECs (e.g., ABCB1, ABCG2, SLCO2B1, and SLC47A1), but also detects novel BMEC transporters. Multiple splice isoforms detected by RNAseq are either robustly enriched or depleted in BMECs, indicating differential RNA processing in the BBB. The Complete RNAseq data are publically available (GSE94064).

  18. Drosophila ABC Transporter DmHMT-1 Confers Tolerance to Cadmium.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Half molecule ATP-binding cassette transporters of the HMT1(heavy metal tolerance factor 1)subfamily are required for Cd2+ tolerance in Schizosaccharomyces pombe, Caenorhabditis elegans and Chlamydomonas reinhardtii, and have homologs in other species, including plants and humans. Based on studies i...

  19. Quercetin up-regulates expressions of peroxisome proliferator-activated receptor γ, liver X receptor α, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.

    PubMed

    Lee, Seung-Min; Moon, Jiyoung; Cho, Yoonsu; Chung, Ji Hyung; Shin, Min-Jeong

    2013-02-01

    Cholesterol-laden macrophages trigger accumulation of foam cells and increase the risk of developing atherosclerosis. We hypothesized that quercetin could lower the content of cholesterol in macrophages by regulating the expression of the ATP binding cassette transporter A1 (ABCA1) gene in differentiated human acute monocyte leukemia cell line (THP-1) cells and thereby reducing the chance of forming foam cells. Quercetin, in concentrations up to 30 μM, was not cytotoxic to differentiated THP-1 cells. Quercetin up-regulated both ABCA1 messenger RNA and protein expression in differentiated THP-1 cells, and its maximum effects were demonstrated at 0.3 μM for 4 to 8 hours in incubation. In addition, quercetin increased protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) within 2 hours of treatment. Because PPARγ and LXRα are important transcriptional factors for ABCA1, quercetin-induced up-regulation of ABCA1 may be mediated by increased expression levels of the PPARγ and LXRα genes. Furthermore, quercetin-enhanced cholesterol efflux from differentiated THP-1 cells to both high-density lipoprotein (HDL) and apolipoprotein A1. Quercetin at the dose of 0.15 μM elevated the cholesterol efflux only for HDL. At the dose of 0.3 μM, quercetin demonstrated effects both on HDL and apolipoprotein A1. Our data demonstrated that quercetin increased the expressions of PPARγ, LXRα, and ABCA1 genes and cholesterol efflux from THP-1 macrophages. Quercetin-induced expression of PPARγ and LXRα might subsequently affect up-regulation of their target gene ABCA1. Taken together, ingestion of quercetin or quercetin-rich foods could be an effective way to improve cholesterol efflux from macrophages, which would contribute to lowering the risk of atherosclerosis.

  20. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-05-07

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have therefore investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies therefore reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages. This article is protected by copyright. All rights reserved.

  1. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-09-01

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have, therefore, investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies, therefore, reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages.

  2. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    PubMed

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus.

  3. ABC transporters and the blood-brain barrier.

    PubMed

    Begley, David J

    2004-01-01

    The blood-brain barrier (BBB) and the blood-cerebrospinal fluid barrier (BCSFB) form a very effective barrier to the free diffusion of many polar solutes into the brain. Many metabolites that are polar have their brain entry facilitated by specific inwardly-directed transport mechanisms. In general the more lipid soluble a molecule or drug is, the more readily it will tend to partition into brain tissue. However, a very significant number of lipid soluble molecules, among them many useful therapeutic drugs have lower brain permeability than would be predicted from a determination of their lipid solubility. These molecules are substrates for the ABC efflux transporters which are present in the BBB and BCSB and the activity of these transporters very efficiently removes the drug from the CNS, thus limiting brain uptake. P-glycoprotein (Pgp) was the first of these ABC transporters to be described, followed by the multidrug resistance-associated proteins (MRP) and more recently breast cancer resistance protein (BCRP). All are expressed in the BBB and BCSFB and combine to reduce the brain penetration of many drugs. This phenomenon of "multidrug resistance" is a major hurdle when it comes to the delivery of therapeutics to the brain, not to mention the problem of cancer chemotherapy in general. Therefore, the development of strategies for bypassing the influence of these ABC transporters and for the design of effective drugs that are not substrates and the development of inhibitors for the ABC transporters becomes a high imperative for the pharmaceutical industry.

  4. Identification of TogMNAB, an ABC transporter which mediates the uptake of pectic oligomers in Erwinia chrysanthemi 3937.

    PubMed

    Hugouvieux-Cotte-Pattat, N; Blot, N; Reverchon, S

    2001-09-01

    The bacterium Erwinia chrysanthemi, which causes soft rot disease on various plants, is able to use pectin as a carbon source for growth. Knowledge of the critical step in pectin catabolism which allows the entry of pectic oligomers into the cells is scarce. We report here the first example of a transport system involved in the uptake of pectic oligomers. The TogMNAB transporter of E. chrysanthemi is a member of the ATP-binding cassette (ABC) superfamily. TogM and TogN are homologous to the inner membrane components, TogA exhibits the signature of ABC ATPases and TogB shows similarity with periplasmic ligand-binding proteins. The TogMNAB transporter is a new member of the carbohydrate uptake transporter-1 family (CUT1, TC no. 3.1.1), which is specialized in the transport of complex sugars. The four genes, togM, togN, togA and togB, are apparently co-transcribed in a large operon which also includes the pectate lyase gene pelW. The transcription of the tog operon is induced in the presence of pectic derivatives and is affected by catabolite repression. It is controlled by the KdgR repressor and the CRP activator. The TogMNAB system is able to provide Escherichia coli with the ability to transport oligogalacturonides. In E. chrysanthemi, the TogMNAB system seems to play a major role in switching on the induction of pectin catabolism. TogB also acts as a specific receptor for chemotaxis towards oligogalacturonides. The decreased capacity of maceration of a togM mutant indicates the importance of transport and/or attraction of oligogalacturonides for E. chrysanthemi pathogenicity.

  5. A rice ABC transporter, OsABCC1, reduces arsenic accumulation in the grain

    PubMed Central

    Song, Won-Yong; Yamaki, Tomohiro; Yamaji, Naoki; Ko, Donghwi; Jung, Ki-Hong; Fujii-Kashino, Miho; An, Gynheung; Martinoia, Enrico; Lee, Youngsook; Ma, Jian Feng

    2014-01-01

    Arsenic (As) is a chronic poison that causes severe skin lesions and cancer. Rice (Oryza sativa L.) is a major dietary source of As; therefore, reducing As accumulation in the rice grain and thereby diminishing the amount of As that enters the food chain is of critical importance. Here, we report that a member of the Oryza sativa C-type ATP-binding cassette (ABC) transporter (OsABCC) family, OsABCC1, is involved in the detoxification and reduction of As in rice grains. We found that OsABCC1 was expressed in many organs, including the roots, leaves, nodes, peduncle, and rachis. Expression was not affected when plants were exposed to low levels of As but was up-regulated in response to high levels of As. In both the basal nodes and upper nodes, which are connected to the panicle, OsABCC1 was localized to the phloem region of vascular bundles. Furthermore, OsABCC1 was localized to the tonoplast and conferred phytochelatin-dependent As resistance in yeast. Knockout of OsABCC1 in rice resulted in decreased tolerance to As, but did not affect cadmium toxicity. At the reproductive growth stage, the As content was higher in the nodes and in other tissues of wild-type rice than in those of OsABCC1 knockout mutants, but was significantly lower in the grain. Taken together, our results indicate that OsABCC1 limits As transport to the grains by sequestering As in the vacuoles of the phloem companion cells of the nodes in rice. PMID:25331872

  6. A rice ABC transporter, OsABCC1, reduces arsenic accumulation in the grain.

    PubMed

    Song, Won-Yong; Yamaki, Tomohiro; Yamaji, Naoki; Ko, Donghwi; Jung, Ki-Hong; Fujii-Kashino, Miho; An, Gynheung; Martinoia, Enrico; Lee, Youngsook; Ma, Jian Feng

    2014-11-04

    Arsenic (As) is a chronic poison that causes severe skin lesions and cancer. Rice (Oryza sativa L.) is a major dietary source of As; therefore, reducing As accumulation in the rice grain and thereby diminishing the amount of As that enters the food chain is of critical importance. Here, we report that a member of the Oryza sativa C-type ATP-binding cassette (ABC) transporter (OsABCC) family, OsABCC1, is involved in the detoxification and reduction of As in rice grains. We found that OsABCC1 was expressed in many organs, including the roots, leaves, nodes, peduncle, and rachis. Expression was not affected when plants were exposed to low levels of As but was up-regulated in response to high levels of As. In both the basal nodes and upper nodes, which are connected to the panicle, OsABCC1 was localized to the phloem region of vascular bundles. Furthermore, OsABCC1 was localized to the tonoplast and conferred phytochelatin-dependent As resistance in yeast. Knockout of OsABCC1 in rice resulted in decreased tolerance to As, but did not affect cadmium toxicity. At the reproductive growth stage, the As content was higher in the nodes and in other tissues of wild-type rice than in those of OsABCC1 knockout mutants, but was significantly lower in the grain. Taken together, our results indicate that OsABCC1 limits As transport to the grains by sequestering As in the vacuoles of the phloem companion cells of the nodes in rice.

  7. Role of ABC transporters in fluoropyrimidine-based chemotherapy response.

    PubMed

    Nies, Anne T; Magdy, Tarek; Schwab, Matthias; Zanger, Ulrich M

    2015-01-01

    Since over 50 years, 5-fluorouracil (5-FU) is in use as backbone of chemotherapy treatment regimens for a wide range of cancers including colon, breast, and head and neck carcinomas. However, drug resistance and severe toxicities such as mucositis, diarrhea, neutropenia, and vomiting in up to 40% of treated patients often lead to dose limitation or treatment discontinuation. Because the oral bioavailability of 5-FU is unpredictable and highly variable, 5-FU is commonly administered intravenously. To overcome medical complications and inconvenience associated with intravenous administration, the oral prodrugs capecitabine and tegafur have been developed. Both fluoropyrimidines are metabolically converted intracellularly to 5-FU, which then needs metabolic activation to exert its damaging activity on RNA and DNA. The low response rates of 10-15% of 5-FU monotherapy can be improved by combination regimens of infusional 5-FU and leucovorin together with oxaliplatin (FOLFOX) or irinotecan (FOLFIRI), thereby increasing response rates to 30-40%. The impact of metabolizing enzymes in the development of fluoropyrimidine toxicity and resistance has been studied in great detail. In addition, membrane drug transporters, which are critical determinants of intracellular drug concentrations, may play a role in occurrence of toxicity and development of resistance against fluoropyrimidine-based therapy as well. This review therefore summarizes current knowledge on the role of drug transporters with particular focus on ATP-binding cassette transporters in fluoropyrimidine-based chemotherapy response.

  8. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  9. The role of CAPS buffer in expanding the crystallization space of the nucleotide-binding domain of the ABC transporter haemolysin B from Escherichia coli.

    PubMed

    Zaitseva, Jelena; Holland, I Barry; Schmitt, Lutz

    2004-06-01

    Nucleotide-binding domains (NBDs), which are roughly 27 kDa in size, are conserved components of the large family of ABC (ATP-binding cassette) transporters, which includes importers and exporters. NBDs, or ABC-ATPases, supply energy for the translocation of a vast range of substrates across biological membranes. Despite their hydrophilic sequence, many NBDs readily associate in some way with membranes but demonstrate extreme instability in solution upon separation from the complete transporter. Conditions that stabilized the purified ABC domain of the Escherichia coli haemolysin A (HlyA) transporter were developed. This allowed the screening of unlimited crystallization conditions in the presence of different substrates, the performance of reproducible functional assays and the protection of 50 mg ml(-1) protein from precipitation on ice for months. As a result, it became possible to obtain crystals of HlyB-NBD in the presence of ADP and ATP that were suitable for X-ray analysis. Although the focus of these investigations was placed on HlyB-NBD, the strategy described here can be directly transferred to other proteins that display instability in solution.

  10. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  11. AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

    PubMed Central

    Gaillard, Stéphane; Jacquet, Hélène; Vavasseur, Alain; Leonhardt, Nathalie; Forestier, Cyrille

    2008-01-01

    Background ABC proteins constitute one of the largest families of transporters found in all living organisms. In Arabidopsis thaliana, 120 genes encoding ABC transporters have been identified. Here, the characterization of one member of the MRP subclass, AtMRP6, is described. Results This gene, located on chromosome 3, is bordered by AtMRP3 and AtMRP7. Using real-time quantitative PCR (RT-Q-PCR) and the GUS reporter gene, we found that this gene is essentially expressed during early seedling development, in the apical meristem and at initiation point of secondary roots, especially in xylem-opposite pericycle cells where lateral roots initiate. The level of expression of AtMRP6 in response to various stresses was explored and a significant up-regulation after cadmium (Cd) treatment was detected. Among the three T-DNA insertion lines available from the Salk Institute library, two knock-out mutants, Atmrp6.1 and Atmrp6.2 were invalidated for the AtMRP6 gene. In the presence of Cd, development of leaves was more affected in the mutants than wild-type plants, whereas root elongation and ramification was comparable. Conclusion The position of AtMRP6 on chromosome 3, flanked by two other MRP genes, (all of which being induced by Cd) suggests that AtMRP6 is part of a cluster involved in metal tolerance, although additional functions in planta cannot be discarded. PMID:18307782

  12. ABC Transporter Subfamily D: Distinct Differences in Behavior between ABCD1–3 and ABCD4 in Subcellular Localization, Function, and Human Disease

    PubMed Central

    2016-01-01

    ATP-binding cassette (ABC) transporters are one of the largest families of membrane-bound proteins and transport a wide variety of substrates across both extra- and intracellular membranes. They play a critical role in maintaining cellular homeostasis. To date, four ABC transporters belonging to subfamily D have been identified. ABCD1–3 and ABCD4 are localized to peroxisomes and lysosomes, respectively. ABCD1 and ABCD2 are involved in the transport of long and very long chain fatty acids (VLCFA) or their CoA-derivatives into peroxisomes with different substrate specificities, while ABCD3 is involved in the transport of branched chain acyl-CoA into peroxisomes. On the other hand, ABCD4 is deduced to take part in the transport of vitamin B12 from lysosomes into the cytosol. It is well known that the dysfunction of ABCD1 results in X-linked adrenoleukodystrophy, a severe neurodegenerative disease. Recently, it is reported that ABCD3 and ABCD4 are responsible for hepatosplenomegaly and vitamin B12 deficiency, respectively. In this review, the targeting mechanism and physiological functions of the ABCD transporters are summarized along with the related disease. PMID:27766264

  13. ABC proteins protect the human body and maintain optimal health.

    PubMed

    Ueda, Kazumitsu

    2011-01-01

    Human MDR1, a multi-drug transporter gene, was isolated as the first of the eukaryote ATP Binding Cassette (ABC) proteins from a multidrug-resistant carcinoma cell line in 1986. To date, over 25 years, many ABC proteins have been found to play important physiological roles by transporting hydrophobic compounds. Defects in their functions cause various diseases, indicating that endogenous hydrophobic compounds, as well as water-soluble compounds, are properly transported by transmembrane proteins. MDR1 transports a large number of structurally unrelated drugs and is involved in their pharmacokinetics, and thus is a key factor in drug interaction. ABCA1, an ABC protein, eliminates excess cholesterol in peripheral cells by generating HDL. Because ABCA1 is a key molecule in cholesterol homeostasis, its function and expression are highly regulated. Eukaryote ABC proteins function on the body surface facing the outside and in organ pathways to adapt to the extracellular environment and protect the body to maintain optimal health.

  14. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  15. Tonoplast-localized Abc2 Transporter Mediates Phytochelatin Accumulation in Vacuoles and Confers Cadmium Tolerance*

    PubMed Central

    Mendoza-Cózatl, David G.; Zhai, Zhiyang; Jobe, Timothy O.; Akmakjian, Garo Z.; Song, Won-Yong; Limbo, Oliver; Russell, Matthew R.; Kozlovskyy, Volodymyr I.; Martinoia, Enrico; Vatamaniuk, Olena K.; Russell, Paul; Schroeder, Julian I.

    2010-01-01

    Phytochelatins mediate tolerance to heavy metals in plants and some fungi by sequestering phytochelatin-metal complexes into vacuoles. To date, only Schizosaccharomyces pombe Hmt1 has been described as a phytochelatin transporter and attempts to identify orthologous phytochelatin transporters in plants and other organisms have failed. Furthermore, recent data indicate that the hmt1 mutant accumulates significant phytochelatin levels in vacuoles, suggesting that unidentified phytochelatin transporters exist in fungi. Here, we show that deletion of all vacuolar ABC transporters abolishes phytochelatin accumulation in S. pombe vacuoles and abrogates 35S-PC2 uptake into S. pombe microsomal vesicles. Systematic analysis of the entire S. pombe ABC transporter family identified Abc2 as a full-size ABC transporter (ABCC-type) that mediates phytochelatin transport into vacuoles. The S. pombe abc1 abc2 abc3 abc4 hmt1 quintuple and abc2 hmt1 double mutant show no detectable phytochelatins in vacuoles. Abc2 expression restores phytochelatin accumulation into vacuoles and suppresses the cadmium sensitivity of the abc quintuple mutant. A novel, unexpected, function of Hmt1 in GS-conjugate transport is also shown. In contrast to Hmt1, Abc2 orthologs are widely distributed among kingdoms and are proposed as the long-sought vacuolar phytochelatin transporters in plants and other organisms. PMID:20937798

  16. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    PubMed Central

    2008-01-01

    Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC) transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively) are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to have been horizontally

  17. Effect of costunolide and dehydrocostus lactone on cell cycle, apoptosis, and ABC transporter expression in human soft tissue sarcoma cells.

    PubMed

    Kretschmer, Nadine; Rinner, Beate; Stuendl, Nicole; Kaltenegger, Heike; Wolf, Elisabeth; Kunert, Olaf; Boechzelt, Herbert; Leithner, Andreas; Bauer, Rudolf; Lohberger, Birgit

    2012-11-01

    Human soft tissue sarcomas represent a rare group of malignant tumours that frequently exhibit chemotherapeutic resistance and increased metastatic potential following unsuccessful treatment. In this study, we investigated the effects of costunolide and dehydrocostus lactone, which have been isolated from Saussurea lappa using activity-guided isolation, on three soft tissue sarcoma cell lines of various origins. The effects on cell proliferation, cell cycle distribution, apoptosis induction, and ABC transporter expression were analysed. Both compounds inhibited cell viability dose- and time-dependently. IC50 values ranged from 6.2 µg/mL to 9.8 µg/mL. Cells treated with costunolide showed no changes in cell cycle, little in caspase 3/7 activity, and low levels of cleaved caspase-3 after 24 and 48 h. Dehydrocostus lactone caused a significant reduction of cells in the G1 phase and an increase of cells in the S and G2/M phase. Moreover, it led to enhanced caspase 3/7 activity, cleaved caspase-3, and cleaved PARP indicating apoptosis induction. In addition, the influence of costunolide and dehydrocostus lactone on the expression of ATP binding cassette transporters related to multidrug resistance (ABCB1/MDR1, ABCC1/MRP1, and ABCG2/BCRP1) was examined using real-time RT-PCR. The expressions of ABCB1/MDR1 and ABCG2/BCRP1 in liposarcoma and synovial sarcoma cells were significantly downregulated by dehydrocostus lactone. Our data demonstrate for the first time that dehydrocostus lactone affects cell viability, cell cycle distribution and ABC transporter expression in soft tissue sarcoma cell lines. Furthermore, it led to caspase 3/7 activity as well as caspase-3 and PARP cleavage, which are indicators of apoptosis. Therefore, this compound may be a promising lead candidate for the development of therapeutic agents against drug-resistant tumours.

  18. Secondary Metabolites from Plants Inhibiting ABC Transporters and Reversing Resistance of Cancer Cells and Microbes to Cytotoxic and Antimicrobial Agents

    PubMed Central

    Wink, Michael; Ashour, Mohamed L.; El-Readi, Mahmoud Zaki

    2012-01-01

    Fungal, bacterial, and cancer cells can develop resistance against antifungal, antibacterial, or anticancer agents. Mechanisms of resistance are complex and often multifactorial. Mechanisms include: (1) Activation of ATP-binding cassette (ABC) transporters, such as P-gp, which pump out lipophilic compounds that have entered a cell, (2) Activation of cytochrome p450 oxidases which can oxidize lipophilic agents to make them more hydrophilic and accessible for conjugation reaction with glucuronic acid, sulfate, or amino acids, and (3) Activation of glutathione transferase, which can conjugate xenobiotics. This review summarizes the evidence that secondary metabolites (SM) of plants, such as alkaloids, phenolics, and terpenoids can interfere with ABC transporters in cancer cells, parasites, bacteria, and fungi. Among the active natural products several lipophilic terpenoids [monoterpenes, diterpenes, triterpenes (including saponins), steroids (including cardiac glycosides), and tetraterpenes] but also some alkaloids (isoquinoline, protoberberine, quinoline, indole, monoterpene indole, and steroidal alkaloids) function probably as competitive inhibitors of P-gp, multiple resistance-associated protein 1, and Breast cancer resistance protein in cancer cells, or efflux pumps in bacteria (NorA) and fungi. More polar phenolics (phenolic acids, flavonoids, catechins, chalcones, xanthones, stilbenes, anthocyanins, tannins, anthraquinones, and naphthoquinones) directly inhibit proteins forming several hydrogen and ionic bonds and thus disturbing the 3D structure of the transporters. The natural products may be interesting in medicine or agriculture as they can enhance the activity of active chemotherapeutics or pesticides or even reverse multidrug resistance, at least partially, of adapted and resistant cells. If these SM are applied in combination with a cytotoxic or antimicrobial agent, they may reverse resistance in a synergistic fashion. PMID:22536197

  19. The Crystal Structure of the YknZ Extracellular Domain of ABC Transporter YknWXYZ from Bacillus amyloliquefaciens

    PubMed Central

    Wang, Lulu; Jiang, Rui; Jin, Xiaoling; Liu, Jing; Fan, Shengdi; Quan, Chun-Shan; Ha, Nam-Chul

    2016-01-01

    Bacillus possesses the peptide toxin Sporulation-Delaying Protein (SDP), which can kill cells within a biofilm to support continued growth, thereby delaying the onset of biofilm sporulation. The four-component transporter YknWXYZ acts as a major SDP efflux pump to protect cells against the endogenous SDP toxin, for which YknYZ is a non-canonical ATP-binding cassette (ABC)-type transporter. YknYZ consists of the following two components: (1) an individual protein (YknY) and (2) a respective permease (YknZ). To date, the crystal structure, molecular function, and mechanism of action of the integral membrane protein YknZ remain to be elucidated. In this study, to characterize the structural and biochemical roles of YknZ in the functional assembly of YknWXYZ, we predicted and overexpressed the YknZ extracellular domain. We determined the crystal structure of B. amyloliquefaciens YknZ at a resolution of 2.0 Å. The structure revealed that the YknZ extracellular region exhibits significant structural similarity with the MacB periplasmic domain, which is a non-canonical ABC-type transporter in the tripartite macrolide-specific efflux pump in Gram-negative bacteria. We also found that the YknZ extracellular domain can directly bind to an extracellular component of YknX. This structural and biochemical study provides insights into the assembly of YknWXYZ, which may be relevant to understanding cannibalistic peptide toxin resistance in Bacillus and controlling bacterial growth. PMID:27243566

  20. Gene expression analysis of ABC transporters in a resistant Cooperia oncophora isolate following in vivo and in vitro exposure to macrocyclic lactones.

    PubMed

    De Graef, J; Demeler, J; Skuce, P; Mitreva, M; Von Samson-Himmelstjerna, G; Vercruysse, J; Claerebout, E; Geldhof, P

    2013-04-01

    Members of the ATP-binding cassette (ABC) transporter family (P-glycoproteins, Half-transporters and Multidrug Resistant Proteins) potentially play a role in the development of anthelmintic resistance. The aim of this study was to investigate the possible involvement of ABC transporters in anthelmintic resistance in the bovine parasite, Cooperia oncophora. Partial sequences of 15 members of the ABC transporter protein family were identified, by mining a transcriptome dataset combined with a degenerate PCR approach. Reverse transcriptase PCR showed that most of the ABC transporters identified were constitutively transcribed throughout the life cycle of C. oncophora. Constitutive differences in gene transcript levels between a susceptible and resistant isolate were only observed for Con-haf-9 and Con-mrp-1 in eggs of the resistant isolate, while no differences were observed in L3 or the adult life stage. Analysis of resistant adult worms, collected from calves 14 days after treatment with either ivermectin or moxidectin, showed a significant 3- to 5-fold increase in the transcript levels of Con-pgp-11 compared to non-exposed worms. Interestingly, a 4-fold transcriptional up-regulation of Con-pgp-11 was also observed in L3 of the resistant isolate, after in vitro exposure to different concentrations of ivermectin, whereas this effect was not observed in exposed L3 of the susceptible isolate. The results suggest that the worms of this particular resistant isolate have acquired the ability to up-regulate Con-pgp-11 upon exposure to macrocyclic lactones. Further work is needed to understand the genetic basis underpinning this process and the functional role of PGP-11.

  1. Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2011-01-01

    Background Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0

  2. ABC transporters and NR4A1 identify a quiescent subset of tissue-resident memory T cells

    PubMed Central

    Boddupalli, Chandra Sekhar; Nair, Shiny; Gray, Simon M.; Nowyhed, Heba N.; Verma, Rakesh; Gibson, Joanna A.; Abraham, Clara; Narayan, Deepak; Vasquez, Juan; Hedrick, Catherine C.; Dhodapkar, Kavita M.; Kaech, Susan M.; Dhodapkar, Madhav V.

    2016-01-01

    Immune surveillance in tissues is mediated by a long-lived subset of tissue-resident memory T cells (Trm cells). A putative subset of tissue-resident long-lived stem cells is characterized by the ability to efflux Hoechst dyes and is referred to as side population (SP) cells. Here, we have characterized a subset of SP T cells (Tsp cells) that exhibit a quiescent (G0) phenotype in humans and mice. Human Trm cells in the gut and BM were enriched in Tsp cells that were predominantly in the G0 stage of the cell cycle. Moreover, in histone 2B-GFP mice, the 2B-GFP label was retained in Tsp cells, indicative of a slow-cycling phenotype. Human Tsp cells displayed a distinct gene-expression profile that was enriched for genes overexpressed in Trm cells. In mice, proteins encoded by Tsp signature genes, including nuclear receptor subfamily 4 group A member 1 (NR4A1) and ATP-binding cassette (ABC) transporters, influenced the function and differentiation of Trm cells. Responses to adoptive transfer of human Tsp cells into immune-deficient mice and plerixafor therapy suggested that human Tsp cell mobilization could be manipulated as a potential cellular therapy. These data identify a distinct subset of human T cells with a quiescent/slow-cycling phenotype, propensity for tissue enrichment, and potential to mobilize into circulation, which may be harnessed for adoptive cellular therapy. PMID:27617863

  3. Spin Labeling Studies of Transmembrane Signaling and Transport: Applications to Phototaxis, ABC Transporters and Symporters.

    PubMed

    Klare, Johann P; Steinhoff, Heinz-Jürgen

    2015-01-01

    Membrane proteins still represent a major challenge for structural biologists. This chapter will focus on the application of continuous wave and pulsed EPR spectroscopy on spin-labeled membrane proteins. Site-directed spin labeling EPR spectroscopy has evolved as a powerful tool to study the structure and dynamics of proteins, especially membrane proteins, as this method works largely independently of the size and complexity of the biological system under investigation. This chapter describes applications of this technique to three different systems: the archaeal photoreceptor/-transducer complex SRII/HtrII as an example for transmembrane signaling and two transport systems, the histidine ATP-binding cassette transporter HisQMP, and the sodium-proline symporter PutP.

  4. The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism.

    PubMed

    Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L

    2014-10-01

    Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter.

  5. Structure of a Type-1 Secretion System ABC Transporter.

    PubMed

    Morgan, Jacob L W; Acheson, Justin F; Zimmer, Jochen

    2017-03-07

    Type-1 secretion systems (T1SSs) represent a widespread mode of protein secretion across the cell envelope in Gram-negative bacteria. The T1SS is composed of an inner-membrane ABC transporter, a periplasmic membrane-fusion protein, and an outer-membrane porin. These three components assemble into a complex spanning both membranes and providing a conduit for the translocation of unfolded polypeptides. We show that ATP hydrolysis and assembly of the entire T1SS complex is necessary for protein secretion. Furthermore, we present a 3.15-Å crystal structure of AaPrtD, the ABC transporter found in the Aquifex aeolicus T1SS. The structure suggests a substrate entry window just above the transporter's nucleotide binding domains. In addition, highly kinked transmembrane helices, which frame a narrow channel not observed in canonical peptide transporters, are likely involved in substrate translocation. Overall, the AaPrtD structure supports a polypeptide transport mechanism distinct from alternating access.

  6. Optimized Purification of a Heterodimeric ABC Transporter in a Highly Stable Form Amenable to 2-D Crystallization

    PubMed Central

    Galián, Carmen; Manon, Florence; Dezi, Manuela; Torres, Cristina; Ebel, Christine; Lévy, Daniel; Jault, Jean-Michel

    2011-01-01

    Optimized protocols for achieving high-yield expression, purification and reconstitution of membrane proteins are required to study their structure and function. We previously reported high-level expression in Escherichia coli of active BmrC and BmrD proteins from Bacillus subtilis, previously named YheI and YheH. These proteins are half-transporters which belong to the ABC (ATP-Binding Cassette) superfamily and associate in vivo to form a functional transporter able to efflux drugs. In this report, high-yield purification and functional reconstitution were achieved for the heterodimer BmrC/BmrD. In contrast to other detergents more efficient for solubilizing the transporter, dodecyl-ß-D-maltoside (DDM) maintained it in a drug-sensitive and vanadate-sensitive ATPase-competent state after purification by affinity chromatography. High amounts of pure proteins were obtained which were shown either by analytical ultracentrifugation or gel filtration to form a monodisperse heterodimer in solution, which was notably stable for more than one month at 4°C. Functional reconstitution using different lipid compositions induced an 8-fold increase of the ATPase activity (kcat∼5 s−1). We further validated that the quality of the purified BmrC/BmrD heterodimer is suitable for structural analyses, as its reconstitution at high protein densities led to the formation of 2-D crystals. Electron microscopy of negatively stained crystals allowed the calculation of a projection map at 20 Å resolution revealing that BmrC/BmrD might assemble into oligomers in a lipidic environment. PMID:21602923

  7. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    PubMed

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods.

  8. Macrophage apolipoprotein A-I expression protects against atherosclerosis in ApoE-deficient mice and up-regulates ABC transporters.

    PubMed

    Su, Yan Ru; Ishiguro, Hiroyuki; Major, Amy S; Dove, Dwayne E; Zhang, Wenwu; Hasty, Alyssa H; Babaev, Vladimir R; Linton, MacRae F; Fazio, Sergio

    2003-10-01

    The antiatherogenic effect of high-density lipoprotein (HDL) and its major protein component apolipoprotein A-I (apoA-I) has been largely attributed to their key roles in reverse cholesterol transport (RCT) and cellular cholesterol efflux. Substantial evidence shows that overexpression of human apoA-I reduces atherosclerosis in animal models. However, it is uncertain whether this protection is due to an increase in plasma HDL level or to a local effect in the artery wall. To test the hypothesis that expression of human apoA-I in macrophages can promote RCT in the artery wall, we used a retroviral construct expressing human apoA-I cDNA (MFG-HAI) to transduce ApoE(-/-) bone marrow cells and then transplanted these cells into ApoE(-/-) mice with preexisting atherosclerosis. ApoE(-/-) mice reconstituted with MFG-HAI marrow had a significant reduction (30%) in atherosclerotic lesions in the proximal aorta compared to control mice that received marrow expressing MFG parental virus. Peritoneal macrophages isolated from MFG-HAI mice showed a four- to fivefold increase in mRNA expression levels of both ATP-binding cassette (ABC) A1 and ABCG1 compared to controls. Our data demonstrate that gene transfer-mediated expression of human apoA-I in macrophages can compensate in part for apoE deficiency and delay the progression of atherosclerotic lesions by stimulating ABC-dependent cholesterol efflux and RCT.

  9. Transition from reversible to irreversible attachment during biofilm formation by Pseudomonas fluorescens WCS365 requires an ABC transporter and a large secreted protein.

    PubMed

    Hinsa, Shannon M; Espinosa-Urgel, Manuel; Ramos, Juan L; O'Toole, George A

    2003-08-01

    We report the identification of an ATP-binding cassette (ABC) transporter and an associated large cell-surface protein that are required for biofilm formation by Pseudomonas fluorescens WCS365. The genes coding for these proteins are designated lap for large adhesion protein. The LapA protein, with a predicted molecular weight of approximately 900 kDa, is found to be loosely associated with the cell surface and present in the culture supernatant. The LapB, LapC and LapE proteins are predicted to be the cytoplasmic membrane-localized ATPase, membrane fusion protein and outer membrane protein component, respectively, of an ABC transporter. Consistent with this prediction, LapE, like other members of this family, is localized to the outer membrane. We propose that the lapEBC-encoded ABC transporter participates in the secretion of LapA, as strains with mutations in the lapEBC genes do not have detectable LapA associated with the cell surface or in the supernatant. The lap genes are conserved among environmental pseudomonads such as P. putida KT2440, P. fluorescens PfO1 and P. fluorescens WCS365, but are absent from pathogenic pseudomonads such as P. aeruginosa and P. syringae. The wild-type strain of P. fluorescens WCS365 and its lap mutant derivatives were assessed for their biofilm forming ability in static and flow systems. The lap mutant strains are impaired in an early step in biofilm formation and are unable to develop the mature biofilm structure seen for the wild-type bacterium. Time-lapse microscopy studies determined that the lap mutants are unable to progress from reversible (or transient) attachment to the irreversible attachment stage of biofilm development. The lap mutants were also found to be defective in attachment to quartz sand, an abiotic surface these organisms likely encounter in the environment.

  10. PET and SPECT Radiotracers to Assess Function and Expression of ABC Transporters in Vivo

    PubMed Central

    Mairinger, Severin; Erker, Thomas; Müller, Markus; Langer, Oliver

    2013-01-01

    Adenosine triphosphate-binding cassette (ABC) transporters, such as P-glycoprotein (Pgp, ABCB1), breast cancer resistance protein (BCRP, ABCG2) and multidrug resistance-associated proteins (MRPs) are expressed in high concentrations at various physiological barriers (e.g. blood-brain barrier, blood-testis barrier, blood-tumor barrier), where they impede the tissue accumulation of various drugs by active efflux transport. Changes in ABC transporter expression and function are thought to be implicated in various diseases, such as cancer, epilepsy, Alzheimer’s and Parkinson’s disease. The availability of a non-invasive imaging method which allows for measuring ABC transporter function or expression in vivo would be of great clinical use in that it could facilitate the identification of those patients that would benefit from treatment with ABC transporter modulating drugs. To date three different kinds of imaging probes have been described to measure ABC transporters in vivo: i) radiolabelled transporter substrates ii) radiolabelled transporter inhibitors and iii) radiolabelled prodrugs which are enzymatically converted into transporter substrates in the organ of interest (e.g. brain). The design of new imaging probes to visualize efflux transporters is inter alia complicated by the overlapping substrate recognition pattern of different ABC transporter types. The present article will describe currently available ABC transporter radiotracers for positron emission tomography (PET) and single-photon emission computed tomography (SPECT) and critically discuss strengths and limitations of individual probes and their potential clinical applications. PMID:21434859

  11. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  12. RNA-Seq Analysis of the Effect of Kanamycin and the ABC Transporter AtWBC19 on Arabidopsis thaliana Seedlings Reveals Changes in Metal Content

    PubMed Central

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna

    2014-01-01

    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake. PMID:25310285

  13. RNA-seq analysis of the effect of kanamycin and the ABC transporter AtWBC19 on Arabidopsis thaliana seedlings reveals changes in metal content.

    PubMed

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna

    2014-01-01

    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake.

  14. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein

    PubMed Central

    Tay, Wee Tek; Mahon, Rod J.; Heckel, David G.; Walsh, Thomas K.; Downes, Sharon; James, William J.; Lee, Sui-Fai; Reineke, Annette; Williams, Adam K.; Gordon, Karl H. J.

    2015-01-01

    The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton) expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests) to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC) marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC) transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the detailed mode

  15. MacB ABC transporter is a dimer whose ATPase activity and macrolide-binding capacity are regulated by the membrane fusion protein MacA.

    PubMed

    Lin, Hong Ting; Bavro, Vassiliy N; Barrera, Nelson P; Frankish, Helen M; Velamakanni, Saroj; van Veen, Hendrik W; Robinson, Carol V; Borges-Walmsley, M Inês; Walmsley, Adrian R

    2009-01-09

    Gram-negative bacteria utilize specialized machinery to translocate drugs and protein toxins across the inner and outer membranes, consisting of a tripartite complex composed of an inner membrane secondary or primary active transporter (IMP), a periplasmic membrane fusion protein, and an outer membrane channel. We have investigated the assembly and function of the MacAB/TolC system that confers resistance to macrolides in Escherichia coli. The membrane fusion protein MacA not only stabilizes the tripartite assembly by interacting with both the inner membrane protein MacB and the outer membrane protein TolC, but also has a role in regulating the function of MacB, apparently increasing its affinity for both erythromycin and ATP. Analysis of the kinetic behavior of ATP hydrolysis indicated that MacA promotes and stabilizes the ATP-binding form of the MacB transporter. For the first time, we have established unambiguously the dimeric nature of a noncanonic ABC transporter, MacB that has an N-terminal nucleotide binding domain, by means of nondissociating mass spectrometry, analytical ultracentrifugation, and atomic force microscopy. Structural studies of ABC transporters indicate that ATP is bound between a pair of nucleotide binding domains to stabilize a conformation in which the substrate-binding site is outward-facing. Consequently, our data suggest that in the presence of ATP the same conformation of MacB is promoted and stabilized by MacA. Thus, MacA would facilitate the delivery of drugs by MacB to TolC by enhancing the binding of drugs to it and inducing a conformation of MacB that is primed and competent for binding TolC. Our structural studies are an important first step in understanding how the tripartite complex is assembled.

  16. Characterization of Two ABC Transporters from Biocontrol and Phytopathogenic Fusarium oxysporus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ABC transporter genes from four strains of Fusarium oxysporum [two biocontrol and two phytopathogenic (f. sp. lycopersici Race 1) isolates] indicated that this gene is well conserved. However, sequences of promoter regions of FoABC1 differed between 8 phytopathogenic and 11 biocontrol strains of F....

  17. Preliminary time-of-flight neutron diffraction studies of Escherichia coli ABC transport receptor phosphate-binding protein at the Protein Crystallography Station

    PubMed Central

    Sippel, K. H.; Bacik, J.; Quiocho, F. A.; Fisher, S. Z.

    2014-01-01

    Inorganic phosphate is an essential molecule for all known life. Organisms have developed many mechanisms to ensure an adequate supply, even in low-phosphate conditions. In prokaryotes phosphate transport is instigated by the phosphate-binding protein (PBP), the initial receptor for the ATP-binding cassette (ABC) phosphate transporter. In the crystal structure of the PBP–phosphate complex, the phosphate is completely desolvated and sequestered in a deep cleft and is bound by 13 hydrogen bonds: 12 to protein NH and OH donor groups and one to a carboxylate acceptor group. The carboxylate plays a key recognition role by accepting a phosphate hydrogen. PBP phosphate affinity is relatively consistent across a broad pH range, indicating the capacity to bind monobasic (H2PO4 −) and dibasic (HPO4 2−) phosphate; however, the mechanism by which it might accommodate the second hydrogen of monobasic phosphate is unclear. To answer this question, neutron diffraction studies were initiated. Large single crystals with a volume of 8 mm3 were grown and subjected to hydrogen/deuterium exchange. A 2.5 Å resolution data set was collected on the Protein Crystallography Station at the Los Alamos Neutron Science Center. Initial refinement of the neutron data shows significant nuclear density, and refinement is ongoing. This is the first report of a neutron study from this superfamily. PMID:24915101

  18. The Half-Size ABC Transporter FOLDED PETALS 2/ABCG13 Is Involved in Petal Elongation through Narrow Spaces in Arabidopsis thaliana Floral Buds.

    PubMed

    Takeda, Seiji; Iwasaki, Akira; Tatematsu, Kiyoshi; Okada, Kiyotaka

    2014-08-15

    Flowers are vital for attracting pollinators to plants and in horticulture for humans. Petal morphogenesis is a central process of floral development. Petal development can be divided into three main processes: the establishment of organ identity in a concentric pattern, primordia initiation at fixed positions within a whorl, and morphogenesis, which includes petal elongation through the narrow spaces within the bud. Here, we show that the FOLDED PETALS 2 (FOP2) gene, encoding a member of the half-size ATP binding cassette (ABC) transporter family ABCG13, is involved in straight elongation of petals in Arabidopsis thaliana. In fop2 mutants, flowers open with folded petals, instead of straight-elongated ones found in the wild type. The epicuticular nanoridge structures are absent in many abaxial epidermal cells of fop2 petals, and surgical or genetic generation of space in young fop2 buds restores the straight elongation of petals, suggesting that the physical contact of sepals and petals causes the petal folding. Similar petal folding has been reported in the fop1 mutant, and the petals of fop2 fop1 double mutants resemble those of both the fop1 and fop2 single mutants, although the epidermal structure and permeability of the petal surface is more affected in fop2. Our results suggest that synthesis and transport of cutin or wax in growing petals play an important role for their smooth elongation through the narrow spaces of floral buds.

  19. The maltose ABC transporter: action of membrane lipids on the transporter stability, coupling and ATPase activity.

    PubMed

    Bao, Huan; Dalal, Kush; Wang, Victor; Rouiller, Isabelle; Duong, Franck

    2013-08-01

    The coupling between ATP hydrolysis and substrate transport remains a key question in the understanding of ABC-mediated transport. We show using the MalFGK2 complex reconstituted into nanodiscs, that membrane lipids participate directly to the coupling reaction by stabilizing the transporter in a low energy conformation. When surrounded by short acyl chain phospholipids, the transporter is unstable and hydrolyzes large amounts of ATP without inducing maltose. The presence of long acyl chain phospholipids stabilizes the conformational dynamics of the transporter, reduces its ATPase activity and restores dependence on maltose. Membrane lipids therefore play an essential allosteric function, they restrict the transporter ATPase activity to increase coupling to the substrate. In support to the notion, we show that increasing the conformational dynamics of MalFGK2 with mutations in MalF increases the transporter ATPase activity but decreases the maltose transport efficiency.

  20. Inhibition of the Human ABC Efflux Transporters P-gp and BCRP by the BDE-47 Hydroxylated Metabolite 6-OH-BDE-47: Considerations for Human Exposure.

    PubMed

    Marchitti, Satori A; Mazur, Christopher S; Dillingham, Caleb M; Rawat, Swati; Sharma, Anshika; Zastre, Jason; Kenneke, John F

    2017-01-01

    High body burdens of polybrominated diphenyl ethers (PBDEs) in infants and young children have led to increased concern over their potential impact on human development. PBDE exposure can alter the expression of genes involved in thyroid homeostasis, including those of ATP-binding cassette (ABC) transporters, which mediate cellular xenobiotic efflux. However, little information exists on how PBDEs interact with ABC transporters such as P-glycoprotein (P-gp) and breast cancer resistance protein (BCRP). The purpose of this study was to evaluate the interactions of 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) and its hydroxylated metabolite 6-OH-BDE-47 with P-gp and BCRP, using human MDR1- and BCRP-expressing membrane vesicles and stably transfected NIH-3T3-MDR1 and MDCK-BCRP cells. In P-gp membranes, BDE-47 did not affect P-gp activity; however, 6-OH-BDE-47 inhibited P-gp activity at low µM concentrations (IC50 = 11.7 µM). In BCRP membranes, BDE-47 inhibited BCRP activity; however, 6-OH-BDE-47 was a stronger inhibitor [IC50 = 45.9 µM (BDE-47) vs. IC50 = 9.4 µM (6-OH-BDE-47)]. Intracellular concentrations of known P-gp and BCRP substrates [((3)H)-paclitaxel and ((3)H)-prazosin, respectively] were significantly higher (indicating less efflux) in NIH-3T3-MDR1 and MDCK-BCRP cells in the presence of 6-OH-BDE-47, but not BDE-47. Collectively, our results indicate that the BDE-47 metabolite 6-OH-BDE-47 is an inhibitor of both P-gp and BCRP efflux activity. These findings suggest that some effects previously attributed to BDE-47 in biological systems may actually be due to 6-OH-BDE-47. Considerations for human exposure are discussed.

  1. Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.).

    PubMed

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-04-01

    Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella.

  2. Increased expression of the yeast multidrug resistance ABC transporter Pdr18 leads to increased ethanol tolerance and ethanol production in high gravity alcoholic fermentation

    PubMed Central

    2012-01-01

    Background The understanding of the molecular basis of yeast tolerance to ethanol may guide the design of rational strategies to increase process performance in industrial alcoholic fermentations. A set of 21 genes encoding multidrug transporters from the ATP-Binding Cassette (ABC) Superfamily and Major Facilitator Superfamily (MFS) in S. cerevisiae were scrutinized for a role in ethanol stress resistance. Results A yeast multidrug resistance ABC transporter encoded by the PDR18 gene, proposed to play a role in the incorporation of ergosterol in the yeast plasma membrane, was found to confer resistance to growth inhibitory concentrations of ethanol. PDR18 expression was seen to contribute to decreased 3 H-ethanol intracellular concentrations and decreased plasma membrane permeabilization of yeast cells challenged with inhibitory ethanol concentrations. Given the increased tolerance to ethanol of cells expressing PDR18, the final concentration of ethanol produced during high gravity alcoholic fermentation by yeast cells devoid of PDR18 was lower than the final ethanol concentration produced by the corresponding parental strain. Moreover, an engineered yeast strain in which the PDR18 promoter was replaced in the genome by the stronger PDR5 promoter, leading to increased PDR18 mRNA levels during alcoholic fermentation, was able to attain a 6 % higher ethanol concentration and a 17 % higher ethanol production yield than the parental strain. The improved fermentative performance of yeast cells over-expressing PDR18 was found to correlate with their increased ethanol tolerance and ability to restrain plasma membrane permeabilization induced throughout high gravity fermentation. Conclusions PDR18 gene over-expression increases yeast ethanol tolerance and fermentation performance leading to the production of highly inhibitory concentrations of ethanol. PDR18 overexpression in industrial yeast strains appears to be a promising approach to improve alcoholic

  3. The Predicted ABC Transporter AbcEDCBA Is Required for Type IV Secretion System Expression and Lysosomal Evasion by Brucella ovis

    PubMed Central

    Silva, Teane M. A.; Mol, Juliana P. S.; Winter, Maria G.; Atluri, Vidya; Xavier, Mariana N.; Pires, Simone F.; Paixão, Tatiane A.; Andrade, Hélida M.; Santos, Renato L.; Tsolis, Renee M.

    2014-01-01

    Brucella ovis is a major cause of reproductive failure in rams and it is one of the few well-described Brucella species that is not zoonotic. Previous work showed that a B. ovis mutant lacking a species-specific ABC transporterabcBA) was attenuated in mice and was unable to survive in macrophages. The aim of this study was to evaluate the role of this ABC transporter during intracellular survival of B. ovis. In HeLa cells, B. ovis WT was able to survive and replicate at later time point (48 hpi), whereas an ΔabcBA mutant was attenuated at 24 hpi. The reduced survival of the ΔabcBA mutant was associated with a decreased ability to exclude the lysosomal marker LAMP1 from its vacuolar membrane, suggesting a failure to establish a replicative niche. The ΔabcBA mutant showed a reduced abundance of the Type IV secretion system (T4SS) proteins VirB8 and VirB11 in both rich and acid media, when compared to WT B. ovis. However, mRNA levels of virB1, virB8, hutC, and vjbR were similar in both strains. These results support the notion that the ABC transporter encoded by abcEDCBA or its transported substrate acts at a post-transcriptional level to promote the optimal expression of the B. ovis T4SS within infected host cells. PMID:25474545

  4. Inhibition of ABC Transporters Abolishes Antimony Resistance in Leishmania Infection▿

    PubMed Central

    Mookerjee Basu, Jayati; Mookerjee, Ananda; Banerjee, Rajdeep; Saha, Manik; Singh, Subhankar; Naskar, Ksudiram; Tripathy, Gayetri; Sinha, Prabhat K.; Pandey, Krishna; Sundar, Shyam; Bimal, Sanjeev; Das, Pradip K.; Choudhuri, Soumitra K.; Roy, Syamal

    2008-01-01

    The emergence of antimony (Sb) resistance has jeopardized the treatment of visceral leishmaniasis in various countries. Previous studies have considered the part played by leishmanial parasites in antimony resistance, but the involvement of host factors in the clinical scenario remained to be investigated. Here we show that unlike infection with Sb-sensitive (Sbs) Leishmania donovani, infection with Sb-resistant (Sbr) L. donovani induces the upregulation of multidrug resistance-associated protein 1 (MRP1) and permeability glycoprotein (P-gp) in host cells, resulting in a nonaccumulation of intracellular Sb following treatment with sodium antimony gluconate (SAG) favoring parasite replication. The inhibition of MRP1 and P-gp with resistance-modifying agents such as lovastatin allows Sb accumulation and parasite killing within macrophages and offers protection in an animal model in which infection with Sbr L. donovani is otherwise lethal. The occurrence of a similar scenario in clinical cases is supported by the findings that unlike monocytes from SAG-sensitive kala-azar (KA) patients, monocytes from SAG-unresponsive KA patients overexpress P-gp and MRP1 and fail to accumulate Sb following in vitro SAG treatment unless pretreated with inhibitors of ABC transporters. Thus, the expression status of MRP1 and P-gp in blood monocytes may be used as a diagnostic marker for Sb resistance and the treatment strategy can be designed accordingly. Our results also indicate that lovastatin, which can inhibit both P-gp and MRP1, might be beneficial for reverting Sb resistance in leishmaniasis as well as drug resistance in other clinical situations, including cancer. PMID:18056276

  5. Learning the ABC of oral fungal drug resistance.

    PubMed

    Cannon, R D; Holmes, A R

    2015-12-01

    ATP-binding cassette (ABC) proteins are ubiquitous in prokaryotes and eukaryotes. They are involved in energy-dependent transport of molecules across membranes. ABC proteins are often promiscuous transporters that can translocate a variety of substrates. In oral fungi, especially in Candida species, they have been implicated as major contributors to the high-level azole resistance of clinical isolates from infections that do not respond to drug therapy. Although this is predominantly due to efflux of azoles from the cells, ABC proteins can contribute to fungal drug resistance in other ways as well. Cells in biofilms are notoriously resistant to antifungal agents. ABC proteins can contribute to this resistance through the efflux of drugs. Biofilms are complex communities of myriad microorganisms which, to survive in such a milieu, need to communicate with, and respond to, other microorganisms and their products. ABC proteins are involved in the secretion of fungal mating factors and quorum sensing molecules. These molecules affect biofilm structure and behavior that can result in increased drug resistance. Hence, ABC proteins make multiple contributions to oral fungal drug resistance through a variety of responses to environmental signals.

  6. The naphthoquinones, vitamin K3 and its structural analog plumbagin, are substrates of the multidrug resistance-linked ABC drug transporter ABCG2

    PubMed Central

    Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.

    2008-01-01

    Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone, but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). They inhibited the binding of [125I]-Iodoarylazidoprazosin (IAAP), a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC50 values of 7.3 and 22.6 μM, respectively, but had no effect on the binding of this photoaffinity analog to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of this transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared to the control cells, suggesting that they are substrates of this transporter. Collectively, these data demonstrate for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function. PMID:18065489

  7. ABCG15 encodes an ABC transporter protein, and is essential for post-meiotic anther and pollen exine development in rice.

    PubMed

    Qin, Peng; Tu, Bin; Wang, Yuping; Deng, Luchang; Quilichini, Teagen D; Li, Ting; Wang, Hui; Ma, Bingtian; Li, Shigui

    2013-01-01

    In flowering plants, anther and pollen development is critical for male reproductive success. The anther cuticle and pollen exine play an essential role, and in many cereals, such as rice, orbicules/ubisch bodies are also thought to be important for pollen development. The formation of the anther cuticle, exine and orbicules is associated with the biosynthesis and transport of wax, cutin and sporopollenin components. Recently, progress has been made in understanding the biosynthesis of sporopollenin and cutin components in Arabidopsis and rice, but less is known about the mechanisms by which they are transported to the sites of deposition. Here, we report that the rice ATP-binding cassette (ABC) transporter, ABCG15, is essential for post-meiotic anther and pollen development, and is proposed to play a role in the transport of rice anther cuticle and sporopollenin precursors. ABCG15 is highly expressed in the tapetum at the young microspore stage, and the abcg15 mutant exhibits small, white anthers lacking mature pollen, lipidic cuticle, orbicules and pollen exine. Gas chromatography-mass spectrometry (GC-MS) analysis of the abcg15 anther cuticle revealed significant reductions in a number of wax components and aliphatic cutin monomers. The expression level of genes involved in lipid metabolism in the abcg15 mutant was significantly different from their levels in the wild type, possibly due to perturbations in the homeostasis of anther lipid metabolism. Our study provides new insights for understanding the molecular mechanism of the formation of the anther cuticle, orbicules and pollen wall, as well as the machinery for lipid metabolism in rice anthers.

  8. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  9. Unidirectional Transport Mechanism in an ATP Dependent Exporter

    PubMed Central

    2017-01-01

    ATP-binding cassette (ABC) transporters use the energy of ATP binding and hydrolysis to move a large variety of compounds across biological membranes. P-glycoprotein, involved in multidrug resistance, is the most investigated eukaryotic family member. Although a large number of biochemical and structural approaches have provided important information, the conformational dynamics underlying the coupling between ATP binding/hydrolysis and allocrite transport remains elusive. To tackle this issue, we performed molecular dynamic simulations for different nucleotide occupancy states of Sav1866, a prokaryotic P-glycoprotein homologue. The simulations reveal an outward-closed conformation of the transmembrane domain that is stabilized by the binding of two ATP molecules. The hydrolysis of a single ATP leads the X-loop, a key motif of the ATP binding cassette, to interfere with the transmembrane domain and favor its outward-open conformation. Our findings provide a structural basis for the unidirectionality of transport in ABC exporters and suggest a ratio of one ATP hydrolyzed per transport cycle. PMID:28386603

  10. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  11. MiR-106b~25 cluster regulates multidrug resistance in an ABC transporter-independent manner via downregulation of EP300.

    PubMed

    Hu, Yunhui; Li, Kaiyong; Asaduzzaman, Muhammad; Cuella, Raquel; Shi, Hui; Raguz, Selina; Coombes, Raoul Charles; Zhou, Yuan; Yagüe, Ernesto

    2016-02-01

    MicroRNA (miR)-106b~25 cluster regulates bypass of doxorubicin and γ-radiation induced senescence by downregulation of the E-cadherin transcriptional activator EP300. We asked whether upregulation of miR-106~25 cluster generates cells with a truly multidrug resistant (MDR) phenotype and whether this is due to upregulation of the ATP-binding cassette (ABC) transporter P-glycoprotein. We used minimally transformed mammary epithelial breast cancer cells (MTMECs) in which the miR-106b~25 cluster was experimentally upregulated by lentiviral transfection or in which hairpins targeting either EP300 or E-cadherin mRNAs have been expressed with lentiviruses. We find that overexpression of miR-106b~25 cluster led to the generation of MDR MTMECs (resistant to etoposide, colchicine and paclitaxel). Paclitaxel resistance was also studied after experimental downregulation of EP300 or E-cadherin. However none of these cells overexpressed P-glycoprotein or where able to efflux a fluorescent derivative of paclitaxel, making this phenotype drug-transporter independent. Paclitaxel treatment in MTMECs led to an increase in early apoptotic cells (Annexin V-positive), activation of caspase-9 and increase in the proportion of cells at the G2/M phase of the cell cycle. However, MTMEC overexpressing miR-106b~25 cluster, or with EP300 or E-cadherin downregulated, showed less activation of apoptosis, caspase-9 and caspase-3/-7 activities. Thus, miR-106b~25 cluster controls transporter-independent MDR by apoptosis evasion via downregulation of EP300.

  12. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  13. Regulation of ABC transporters blood-brain barrier: the good, the bad, and the ugly.

    PubMed

    Miller, David S

    2015-01-01

    The brain capillary endothelial cells that constitute the blood-brain barrier express multiple ABC transport proteins on the luminal, blood-facing, plasma membrane. These transporters function as ATP-driven efflux pumps for xenobiotics and endogenous metabolites. High expression of these ABC transporters at the barrier is a major obstacle to the delivery of therapeutics, including chemotherapeutics, to the CNS. Here, I review the signals that alter ABC transporter expression and transport function with an emphasis on P-glycoprotein, Mrp2, and breast cancer resistance protein (BCRP), the efflux transporters for which we have the most detailed picture of regulation. Recent work shows that transporter protein expression can be upregulated in response to inflammatory and oxidative stress, therapeutic drugs, diet, and persistent environmental pollutants; as a consequence, drug delivery to the brain is reduced (potentially bad and ugly). In contrast, basal transport activity of P-glycoprotein and BCRP can be reduced through complex signaling pathways that involve events in and on the brain capillary endothelial cells. Targeting these signaling events provides opportunities to rapidly and reversibly increase brain accumulation of drugs that are substrates for the transporters (potentially good). The clinical usefulness of targeting signaling to reduce efflux transporter activity and improve drug delivery to the CNS remains to be established.

  14. The riboswitch regulates a thiamine pyrophosphate ABC transporter of the oral spirochete Treponema denticola.

    PubMed

    Bian, Jiang; Shen, Hongwu; Tu, Youbin; Yu, Aiming; Li, Chunhao

    2011-08-01

    Thiamine pyrophosphate (TPP), a biologically active form of thiamine (vitamin B₁), is an essential cofactor in all living systems. Microorganisms either synthesize TPP via de novo biosynthesis pathways or uptake exogenous thiamine from the environment via specific transporters. The oral spirochete Treponema denticola is an important pathogen that is associated with human periodontal diseases. It lacks a de novo TPP biosynthesis pathway and needs exogenous TPP for growth, suggesting that it may obtain exogenous TPP via a thiamine transporter. In this study, we identified a gene cluster that encodes a TPP ABC transporter which consists of a TPP-binding protein (TDE0143), a transmembrane permease (TDE0144), and a cytosolic ATPase (TDE0145). Transcriptional and translational analyses showed that the genes encoding these three proteins are cotranscribed and form an operon (tbpABC(Td)) that is initiated by a σ⁷⁰-like promoter. The expression level of this operon is negatively regulated by exogenous TPP and is mediated by a TPP-sensing riboswitch (Td(thi-)(box)). Genetic and biochemical studies revealed that the TDE0143 deletion mutant (T. denticola ΔtbpA) had a decreased ability to transport exogenous TPP, and the mutant failed to grow when exogenous TPP was insufficient. These results taken together indicate that the tbpABC(Td) operon encodes an ABC transporter that is required for the uptake of exogenous TPP and that the expression of this operon is regulated by a TPP-binding riboswitch via a feedback inhibition mechanism.

  15. Expression, purification and structural properties of ABC transporter ABCA4 and its individual domains

    PubMed Central

    Tsybovsky, Yaroslav; Palczewski, Krzysztof

    2014-01-01

    ABCA4 is a member of the A subfamily of ATP-binding cassette transporters that consists of large integral membrane proteins implicated in inherited human diseases. ABCA4 assists in the clearance of N-retinylidene-phosphatidylethanolamine, a potentially toxic by-product of the visual cycle formed in photoreceptors during light perception. Structural and functional studies of this protein have been hindered by its large size, membrane association, and domain complexity. Although mammalian, insect and bacterial systems have been used for expression of ABCA4 and its individual domains, the structural relevance of resulting proteins to the native transporter has yet to be established. We produced soluble domains of ABCA4 in E. coli and S. cerevisiae and the full-length transporter in HEK293 cells. Electron microscopy and size exclusion chromatography were used to assess the conformational homogeneity and structure of these proteins. We found that isolated ABCA4 domains formed large, heterogeneous oligomers cross-linked with non-specific disulphide bonds. Incomplete folding of cytoplasmic domain 2 was proposed based on fluorescence spectroscopy results. In contrast, full-length human ABCA4 produced in mammalian cells was found structurally equivalent to the native protein obtained from bovine photoreceptors. These findings offer recombinantly expressed full-length ABCA4 as an appropriate object for future detailed structural and functional characterization. PMID:24583180

  16. Structure of a Bacterial ABC Transporter Involved in the Import of an Acidic Polysaccharide Alginate.

    PubMed

    Maruyama, Yukie; Itoh, Takafumi; Kaneko, Ai; Nishitani, Yu; Mikami, Bunzo; Hashimoto, Wataru; Murata, Kousaku

    2015-09-01

    The acidic polysaccharide alginate represents a promising marine biomass for the microbial production of biofuels, although the molecular and structural characteristics of alginate transporters remain to be clarified. In Sphingomonas sp. A1, the ATP-binding cassette transporter AlgM1M2SS is responsible for the import of alginate across the cytoplasmic membrane. Here, we present the substrate-transport characteristics and quaternary structure of AlgM1M2SS. The addition of poly- or oligoalginate enhanced the ATPase activity of reconstituted AlgM1M2SS coupled with one of the periplasmic solute-binding proteins, AlgQ1 or AlgQ2. External fluorescence-labeled oligoalginates were specifically imported into AlgM1M2SS-containing proteoliposomes in the presence of AlgQ2, ATP, and Mg(2+). The crystal structure of AlgQ2-bound AlgM1M2SS adopts an inward-facing conformation. The interaction between AlgQ2 and AlgM1M2SS induces the formation of an alginate-binding tunnel-like structure accessible to the solvent. The translocation route inside the transmembrane domains contains charged residues suitable for the import of acidic saccharides.

  17. Water-mediated forces between the nucleotide binding domains generate the power stroke in an ABC transporter

    NASA Astrophysics Data System (ADS)

    Furukawa-Hagiya, Tomoka; Yoshida, Norio; Chiba, Shuntaro; Hayashi, Tomohiko; Furuta, Tadaomi; Sohma, Yoshiro; Sakurai, Minoru

    2014-11-01

    ATP binding cassette proteins shuttle a variety of molecules across cell membranes. The substrate transportation process is initiated by the ATP-driven dimerization of nucleotide binding domains (NBDs). Here, the integral-equation theory of liquids was applied to simulated NBD structures to analyze their dimerization process from the viewpoint of thermodynamics and the water-mediated interaction between the NBDs. It was found that a long-range hydration force of enthalpic origin drives the two NBDs to approach from a large separation. In the subsequent step, the water-mediated attraction of entropic origin brings about a structural adjustment between the two NBDs and their tighter contact.

  18. A wheat ABC transporter contributes to both grain formation and mycotoxin tolerance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Deoxynivalenol (DON) is a mycotoxin produced by Fusarium fungi which acts as a disease virulence factor, aiding fungal pathogenesis of cereals spikelets and spread of the economically important Fusarium head blight (FHB) disease. Previously, a fragment of a wheat ABC transporter gene was shown to be...

  19. Crystal structure of the maltose transporter in a pretranslocation intermediate state.

    PubMed

    Oldham, Michael L; Chen, Jue

    2011-06-03

    Adenosine triphosphate (ATP)-binding cassette (ABC) transporters convert chemical energy from ATP hydrolysis to mechanical work for substrate translocation. They function by alternating between two states, exposing the substrate-binding site to either side of the membrane. A key question that remains to be addressed is how substrates initiate the transport cycle. Using x-ray crystallography, we have captured the maltose transporter in an intermediate step between the inward- and outward-facing states. We show that interactions with substrate-loaded maltose-binding protein in the periplasm induce a partial closure of the MalK dimer in the cytoplasm. ATP binding to this conformation then promotes progression to the outward-facing state. These results, interpreted in light of biochemical and functional studies, provide a structural basis to understand allosteric communication in ABC transporters.

  20. Crystal Structure of the Maltose Transporter in a Pretranslocation Intermediate State

    SciTech Connect

    Oldham, Michael L.; Chen, Jue

    2011-08-25

    Adenosine triphosphate (ATP)-binding cassette (ABC) transporters convert chemical energy from ATP hydrolysis to mechanical work for substrate translocation. They function by alternating between two states, exposing the substrate-binding site to either side of the membrane. A key question that remains to be addressed is how substrates initiate the transport cycle. Using x-ray crystallography, we have captured the maltose transporter in an intermediate step between the inward- and outward-facing states. We show that interactions with substrate-loaded maltose-binding protein in the periplasm induce a partial closure of the MalK dimer in the cytoplasm. ATP binding to this conformation then promotes progression to the outward-facing state. These results, interpreted in light of biochemical and functional studies, provide a structural basis to understand allosteric communication in ABC transporters.

  1. Functional Interaction between the Cytoplasmic ABC Protein LptB and the Inner Membrane LptC Protein, Components of the Lipopolysaccharide Transport Machinery in Escherichia coli

    PubMed Central

    Martorana, Alessandra M.; Benedet, Mattia; Maccagni, Elisa A.; Sperandeo, Paola; Villa, Riccardo; Dehò, Gianni

    2016-01-01

    ABSTRACT The assembly of lipopolysaccharide (LPS) in the outer leaflet of the outer membrane (OM) requires the transenvelope Lpt (lipopolysaccharide transport) complex, made in Escherichia coli of seven essential proteins located in the inner membrane (IM) (LptBCFG), periplasm (LptA), and OM (LptDE). At the IM, LptBFG constitute an unusual ATP binding cassette (ABC) transporter, composed by the transmembrane LptFG proteins and the cytoplasmic LptB ATPase, which is thought to extract LPS from the IM and to provide the energy for its export across the periplasm to the cell surface. LptC is a small IM bitopic protein that binds to LptBFG and recruits LptA via its N- and C-terminal regions, and its role in LPS export is not completely understood. Here, we show that the expression level of lptB is a critical factor for suppressing lethality of deletions in the C-terminal region of LptC and the functioning of a hybrid Lpt machinery that carries Pa-LptC, the highly divergent LptC orthologue from Pseudomonas aeruginosa. We found that LptB overexpression stabilizes C-terminally truncated LptC mutant proteins, thereby allowing the formation of a sufficient amount of stable IM complexes to support growth. Moreover, the LptB level seems also critical for the assembly of IM complexes carrying Pa-LptC which is otherwise defective in interactions with the E. coli LptFG components. Overall, our data suggest that LptB and LptC functionally interact and support a model whereby LptB plays a key role in the assembly of the Lpt machinery. IMPORTANCE The asymmetric outer membrane (OM) of Gram-negative bacteria contains in its outer leaflet an unusual glycolipid, the lipopolysaccharide (LPS). LPS largely contributes to the peculiar permeability barrier properties of the OM that prevent the entry of many antibiotics, thus making Gram-negative pathogens difficult to treat. In Escherichia coli the LPS transporter (the Lpt machine) is made of seven essential proteins (LptABCDEFG) that form a

  2. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  3. Regulation of ABC Efflux Transporters at Blood-Brain Barrier in Health and Neurological Disorders

    PubMed Central

    Qosa, Hisham; Miller, David S.; Pasinelli, Piera; Trotti, Davide

    2015-01-01

    The strength of the blood-brain barrier (BBB) in providing protection to the central nervous system from exposure to circulating chemicals is maintained by tight junctions between endothelial cells and by a broad range of transporter proteins that regulate exchange between CNS and blood. The most important transporters that restrict the permeability of large number of toxins as well as therapeutic agents are the ABC transporters. Among them, P-gp, BCRP, MRP1 and MRP2 are the utmost studied. These efflux transporters are neuroprotective, limiting the brain entry of neurotoxins; however, they could also restrict the entry of many therapeutics and contribute to CNS pharmacoresistance. Characterization of several regulatory pathways that govern expression and activity of ABC efflux transporters in the endothelium of brain capillaries have led to an emerging consensus that these processes are complex and contain several cellular and molecular elements. Alterations in ABC efflux transporters expression and/or activity occur in several neurological diseases. Here, we review the signaling pathways that regulate expression and transport activity of P-gp, BCRP, MRP1 and MRP2 as well as how their expression/activity changes in neurological diseases. PMID:26187753

  4. Identification of Residues in the Lipopolysaccharide ABC Transporter That Coordinate ATPase Activity with Extractor Function

    PubMed Central

    Simpson, Brent W.; Owens, Tristan W.; Orabella, Matthew J.; Davis, Rebecca M.; May, Janine M.; Trauger, Sunia A.

    2016-01-01

    ABSTRACT The surface of most Gram-negative bacteria is covered with lipopolysaccharide (LPS), creating a permeability barrier against toxic molecules, including many antimicrobials. To assemble LPS on their surface, Gram-negative bacteria must extract newly synthesized LPS from the inner membrane, transport it across the aqueous periplasm, and translocate it across the outer membrane. The LptA to -G proteins assemble into a transenvelope complex that transports LPS from the inner membrane to the cell surface. The Lpt system powers LPS transport from the inner membrane by using a poorly characterized ATP-binding cassette system composed of the ATPase LptB and the transmembrane domains LptFG. Here, we characterize a cluster of residues in the groove region of LptB that is important for controlling LPS transport. We also provide the first functional characterization of LptFG and identify their coupling helices that interact with the LptB groove. Substitutions at conserved residues in these coupling helices compromise both the assembly and function of the LptB2FG complex. Defects in LPS transport conferred by alterations in the LptFG coupling helices can be rescued by changing a residue in LptB that is adjacent to functionally important residues in the groove region. This suppression is achieved by increasing the ATPase activity of the LptB2FG complex. Taken together, these data identify a specific binding site in LptB for the coupling helices of LptFG that is responsible for coupling of ATP hydrolysis by LptB with LptFG function to achieve LPS extraction. PMID:27795402

  5. Gene expression profiling of cytochromes P450, ABC transporters and their principal transcription factors in the amygdala and prefrontal cortex of alcoholics, smokers and drug-free controls by qRT-PCR.

    PubMed

    Toselli, Francesca; de Waziers, Isabelle; Dutheil, Mary; Vincent, Marc; Wilce, Peter A; Dodd, Peter R; Beaune, Philippe; Loriot, Marie-Anne; Gillam, Elizabeth M J

    2015-01-01

    1. Ethanol consumption and smoking alter the expression of certain drug-metabolizing enzymes and transporters, potentially influencing the tissue-specific effects of xenobiotics. 2. Amygdala (AMG) and prefrontal cortex (PFC) are brain regions that modulate the effects of alcohol and smoking, yet little is known about the expression of cytochrome P450 enzymes (P450s) and ATP-binding cassette (ABC) transporters in these tissues. 3. Here, we describe the first study on the expression of 19 P450s, their redox partners, three ABC transporters and four related transcription factors in the AMG and PFC of smokers and alcoholics by quantitative RT-PCR. 4. CYP1A1, CYP1B1, CYP2B6, CYP2C8, CYP2C18, CYP2D6, CYP2E1, CYP2J2, CYP2S1, CYP2U1, CYP4X1, CYP46, adrenodoxin and NADPH-P450 reductase, ABCB1, ABCG2, ABCA1, and transcription factors aryl hydrocarbon receptor AhR and proliferator-activated receptor α were quantified in both areas. CYP2A6, CYP2C9, CYP2C19, CYP3A4, CYP3A5, adrenodoxin reductase and the nuclear receptors pregnane X receptor and constitutive androstane receptor were detected but below the limit of quantification. CYP1A2 and CYP2W1 were not detected. 5. Adrenodoxin expression was elevated in all case groups over controls, and smokers showed a trend toward higher CYP1A1 and CYP1B1 expression. 6. Our study shows that most xenobiotic-metabolizing P450s and associated redox partners, transporters and transcription factors are expressed in human AMG and PFC.

  6. Estimation of Candida albicans ABC Transporter Behavior in Real-Time via Fluorescence

    PubMed Central

    Szczepaniak, Joanna; Łukaszewicz, Marcin; Krasowska, Anna

    2015-01-01

    We present a fluorometric method for determining ABC transporter activity in the pathogenic fungus C. albicans during different growth phases and in response to glucose. The carbocyanine dye diS-C3(3) was previously used to monitor plasma membrane potentials and test the influence of surface-active compounds in membrane polarization. We used diS-C3(3) to show changes in fluorescence kinetics that reflect changes in the activity of ABC transporters in C. albicans growth. Cdr1-GFP fluorescence, revealed that Cdr1p relocates to the inside of the cell after the early-log growth phase. Addition of glucose to the cell suspension resulted in Cdr1p transporter expression in the CDR2-knockout strain. We confirmed the diS-C3(3) results by standard RT-PCR and Western blotting. PMID:26696990

  7. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  8. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  9. A Putative Bacterial ABC Transporter Circumvents the Essentiality of Signal Peptidase

    PubMed Central

    Morisaki, J. Hiroshi; Smith, Peter A.; Date, Shailesh V.; Kajihara, Kimberly K.; Truong, Chau Linda; Modrusan, Zora; Yan, Donghong; Kang, Jing; Xu, Min; Shah, Ishita M.; Mintzer, Robert; Kofoed, Eric M.; Cheung, Tommy K.; Arnott, David; Koehler, Michael F. T.; Heise, Christopher E.; Brown, Eric J.

    2016-01-01

    ABSTRACT The type I signal peptidase of Staphylococcus aureus, SpsB, is an attractive antibacterial target because it is essential for viability and extracellularly accessible. We synthesized compound 103, a novel arylomycin-derived inhibitor of SpsB with significant potency against various clinical S. aureus strains (MIC of ~1 µg/ml). The predominant clinical strain USA300 developed spontaneous resistance to compound 103 with high frequency, resulting from single point mutations inside or immediately upstream of cro/cI, a homolog of the lambda phage transcriptional repressor cro. These cro/cI mutations led to marked (>50-fold) overexpression of three genes encoding a putative ABC transporter. Overexpression of this ABC transporter was both necessary and sufficient for resistance and, notably, circumvented the essentiality of SpsB during in vitro culture. Mutation of its predicted ATPase gene abolished resistance, suggesting a possible role for active transport; in these bacteria, resistance to compound 103 occurred with low frequency and through mutations in spsB. Bacteria overexpressing the ABC transporter and lacking SpsB were capable of secreting a subset of proteins that are normally cleaved by SpsB and instead were cleaved at a site distinct from the canonical signal peptide. These bacteria secreted reduced levels of virulence-associated proteins and were unable to establish infection in mice. This study reveals the mechanism of resistance to a novel arylomycin derivative and demonstrates that the nominal essentiality of the S. aureus signal peptidase can be circumvented by the upregulation of a putative ABC transporter in vitro but not in vivo. PMID:27601569

  10. Characterization of a novel domain ‘GATE’ in the ABC protein DrrA and its role in drug efflux by the DrrAB complex

    SciTech Connect

    Zhang, Han; Rahman, Sadia; Li, Wen; Fu, Guoxing; Kaur, Parjit

    2015-03-27

    A novel domain, GATE (Glycine-loop And Transducer Element), is identified in the ABC protein DrrA. This domain shows sequence and structural conservation among close homologs of DrrA as well as distantly-related ABC proteins. Among the highly conserved residues in this domain are three glycines, G215, G221 and G231, of which G215 was found to be critical for stable expression of the DrrAB complex. Other conserved residues, including E201, G221, K227 and G231, were found to be critical for the catalytic and transport functions of the DrrAB transporter. Structural analysis of both the previously published crystal structure of the DrrA homolog MalK and the modeled structure of DrrA showed that G215 makes close contacts with residues in and around the Walker A motif, suggesting that these interactions may be critical for maintaining the integrity of the ATP binding pocket as well as the complex. It is also shown that G215A or K227R mutation diminishes some of the atomic interactions essential for ATP catalysis and overall transport function. Therefore, based on both the biochemical and structural analyses, it is proposed that the GATE domain, located outside of the previously identified ATP binding and hydrolysis motifs, is an additional element involved in ATP catalysis. - Highlights: • A novel domain ‘GATE’ is identified in the ABC protein DrrA. • GATE shows high sequence and structural conservation among diverse ABC proteins. • GATE is located outside of the previously studied ATP binding and hydrolysis motifs. • Conserved GATE residues are critical for stability of DrrAB and for ATP catalysis.

  11. Discovery of an auto-regulation mechanism for the maltose ABC transporter MalFGK2.

    PubMed

    Bao, Huan; Duong, Franck

    2012-01-01

    The maltose transporter MalFGK(2), together with the substrate-binding protein MalE, is one of the best-characterized ABC transporters. In the conventional model, MalE captures maltose in the periplasm and delivers the sugar to the transporter. Here, using nanodiscs and proteoliposomes, we instead find that MalE is bound with high-affinity to MalFGK2 to facilitate the acquisition of the sugar. When the maltose concentration exceeds the transport capacity, MalE captures maltose and dissociates from the transporter. This mechanism explains why the transport rate is high when MalE has low affinity for maltose, and low when MalE has high affinity for maltose. Transporter-bound MalE facilitates the acquisition of the sugar at low concentrations, but also captures and dissociates from the transporter past a threshold maltose concentration. In vivo, this maltose-forced dissociation limits the rate of transport. Given the conservation of the substrate-binding proteins, this mode of allosteric regulation may be universal to ABC importers.

  12. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2

    PubMed Central

    LI, QIONGYU; WANG, XIANGFENG; SHEN, ALING; ZHANG, YUCHEN; CHEN, YOUQIN; SFERRA, THOMAS J.; LIN, JIUMAO; PENG, JUN

    2015-01-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC. PMID:26640560

  13. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2.

    PubMed

    Li, Qiongyu; Wang, Xiangfeng; Shen, Aling; Zhang, Yuchen; Chen, Youqin; Sferra, Thomas J; Lin, Jiumao; Peng, Jun

    2015-11-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC.

  14. Alzheimer's and ABC transporters--new opportunities for diagnostics and treatment.

    PubMed

    Pahnke, Jens; Langer, Oliver; Krohn, Markus

    2014-12-01

    Much has been said about the increasing number of demented patients and the main risk factor 'age'. Frustratingly, we do not know the precise pattern and all modulating factors that provoke the pathologic changes in the brains of affected elderly. We have to diagnose early to be able to stop the progression of diseases that irreversibly destroy brain substance. Familiar AD cases have mislead some researchers for almost 20 years, which has unfortunately narrowed the scientific understanding and has, thus, lead to insufficient funding of independent approaches. Therefore, basic researchers hardly have been able to develop causative treatments and clinicians still do not have access to prognostic and early diagnostic tools. During the recent years it became clear that insufficient Aβ export, physiologically facilitated by the ABC transporter superfamily at the brain's barriers, plays a fundamental role in disease initiation and progression. Furthermore, export mechanisms that are deficient in affected elderly are new targets for activation and, thus, treatment, but ideally also for prevention. In sporadic AD disturbed clearance of β-amyloid from the brain is so far the most important factor for its accumulation in the parenchyma and vessel walls. Here, we review findings about the contribution of ABC transporters and of the perivascular drainage/glymphatic system on β-amyloid clearance. We highlight their potential value for innovative early diagnostics using PET and describe recently described, effective ABC transporter-targeting agents as potential causative treatment for neurodegenerative proteopathies/dementias.

  15. Functional Characterization of Candida albicans ABC Transporter Cdr1p

    PubMed Central

    Shukla, Suneet; Saini, Preeti; Smriti; Jha, Sudhakar; Ambudkar, Suresh V.; Prasad, Rajendra

    2003-01-01

    In view of the importance of Candida drug resistance protein (Cdr1p) in azole resistance, we have characterized it by overexpressing it as a green fluorescent protein (GFP)-tagged fusion protein (Cdr1p-GFP). The overexpressed Cdr1p-GFP in Saccharomyces cerevisiae is shown to be specifically labeled with the photoaffinity analogs iodoarylazidoprazosin (IAAP) and azidopine, which have been used to characterize the drug-binding sites on mammalian drug-transporting P-glycoproteins. While nystatin could compete for the binding of IAAP, miconazole specifically competed for azidopine binding, suggesting that IAAP and azidopine bind to separate sites on Cdr1p. Cdr1p was subjected to site-directed mutational analysis. Among many mutant variants of Cdr1p, the phenotypes of F774A and ΔF774 were particularly interesting. The analysis of GFP-tagged mutant variants of Cdr1p revealed that a conserved F774, in predicted transmembrane segment 6, when changed to alanine showed increased binding of both photoaffinity analogues, while its deletion (ΔF774), as revealed by confocal microscopic analyses, led to mislocalization of the protein. The mislocalized ΔF774 mutant Cdr1p could be rescued to the plasma membrane as a functional transporter by growth in the presence of a Cdr1p substrate, cycloheximide. Our data for the first time show that the drug substrate-binding sites of Cdr1p exhibit striking similarities with those of mammalian drug-transporting P-glycoproteins and despite differences in topological organization, the transmembrane segment 6 in Cdr1p is also a major contributor to drug substrate-binding site(s). PMID:14665469

  16. eUnaG: a new ligand-inducible fluorescent reporter to detect drug transporter activity in live cells

    PubMed Central

    Yeh, Johannes T.-H.; Nam, Kwangho; Yeh, Joshua T.-H.; Perrimon, Norbert

    2017-01-01

    The absorption, distribution, metabolism and excretion (ADME) of metabolites and toxic organic solutes are orchestrated by the ATP-binding cassette (ABC) transporters and the organic solute carrier family (SLC) proteins. A large number of ABC and SLC transpoters exist; however, only a small number have been well characterized. To facilitate the analysis of these transporters, which is important for drug safety and physiological studies, we developed a sensitive genetically encoded bilirubin (BR)-inducible fluorescence sensor (eUnaG) to detect transporter-coupled influx/efflux of organic compounds. This sensor can be used in live cells to measure transporter activity, as excretion of BR depends on ABC and SLC transporters. Applying eUnaG in functional RNAi screens, we characterize l(2)03659 as a Drosophila multidrug resistant-associated ABC transporter. PMID:28176814

  17. Role of Nitrosomonas europaea NitABC iron transporter in the uptake of Fe3+-siderophore complexes.

    PubMed

    Vajrala, Neeraja; Sayavedra-Soto, Luis A; Bottomley, Peter J; Arp, Daniel J

    2010-11-01

    Nitrosomonas europaea has a single three-gene operon (nitABC) encoding an iron ABC transporter system (NitABC). Phylogenetic analysis clustered the subunit NitB with Fe(3+)-ABC transporter permease components from other organisms. The N. europaea strain deficient in nitB (nitB::kan) grew well in either Fe-replete or Fe-limited media and in Fe-limited medium containing the catecholate-type siderophore, enterobactin or the citrate-based dihydroxamate-type siderophore, aerobactin. However, the nitB::kan mutant strain was unable to grow in Fe-limited media containing either the hydroxamate-type siderophores, ferrioxamine and ferrichrome or the mixed-chelating type siderophore, pyoverdine. Exposure of N. europaea cells to a ferrichrome analog coupled to the fluorescent moiety naphthalic diimide (Fhu-NI) led to increase in fluorescence in the wild type but not in nitB::kan mutant cells. Spheroplasts prepared from N. europaea wild type exposed to Fhu-NI analog retained the fluorescence, while spheroplasts of the nitB::kan mutant were not fluorescent. NitABC transports intact Fe(3+)-ferrichrome complex into the cytoplasm and is an atypical ABC type iron transporter for Fe(3+) bound to ferrioxamine, ferrichrome or pyoverdine siderophores into the cytoplasm. The mechanisms to transport iron in either the Fe(3+) or Fe(2+) forms or Fe(3+) associated with enterobactin or aerobactin siderophores into the cell across the cytoplasmic membrane are as yet undetermined.

  18. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  19. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  20. Analysis of the inhibition potential of zosuquidar derivatives on selected bacterial and fungal ABC transporters.

    PubMed

    Infed, Nacera; Smits, Sander H J; Dittrich, Torsten; Braun, Manfred; Driessen, Arnold J M; Hanekop, Nils; Schmitt, Lutz

    2013-03-01

    The increasing number of multidrug-resistant pathogenic microorganisms is a serious public health issue. Among the multitude of mechanisms that lead to multidrug resistance, the active extrusion of toxic compounds, mediated by MDR efflux pumps, plays an important role. In our study we analyzed the inhibitory capability of 26 synthesized zosuquidar derivatives on three ABC-type MDR efflux pumps, namely Saccharomyces cerevisiae Pdr5 as well as Lactococcus lactis LmrA and LmrCD. For Pdr5, five compounds could be identified that inhibited rhodamine 6G transport more efficiently than zosuquidar. One of these is a compound with a new catechol acetal structure that might represent a new lead compound. Furthermore, the determination of IC(50) values for rhodamine 6G transport of Pdr5 with representative compounds reveals values between 0.3 and 0.9 μM. Thus the identified compounds are among the most potent inhibitors known for Pdr5. For the ABC-type efflux pumps LmrA and LmrCD from L. lactis, seven and three compounds, which inhibit the transport activity more than the lead compound zosuquidar, were found. Interestingly, transport inhibition for LmrCD was very specific, with a drastic reduction by one compound while its diastereomers showed hardly an effect. Thus, the present study reveals new potent inhibitors for the ABC-type MDR efflux pumps studied with the inhibitors of Pdr5 and LmrCD being of particular interest as these proteins are well known model systems for their homologs in pathogenic fungi and Gram-positive bacteria.

  1. Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design

    NASA Astrophysics Data System (ADS)

    Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi

    2005-10-01

    In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

  2. Evidence that Bacterial ABC-Type Transporter Imports Free EDTA for Metabolism

    SciTech Connect

    Zhang, Hua; Herman, Jacob P.; Bolton, Harvey; Zhang, Zhicheng; Clark, Sue B.; Xun, Luying

    2007-11-01

    Ethylenediaminetetraacetic acid (EDTA), a common chelating agent, is becoming a major organic pollutant in the form of metal-EDTA complexes in surface waters, partly due to its recalcitrance to biodegradation. Even an EDTA-degrading bacterium BNC1 does not degrade stable metal-EDTA complexes. An ABC-type transporter was identified for possible uptake of EDTA because the transporter genes and EDTA monooxygenase gene were expressed in a single operon in BNC1. The ABC-type transporter had a periplasmic binding protein (EppA) that should confer the substrate specificity for the transporter; therefore, EppA was produced in Escherichia coli,purified, and characterized. EppA was shown to bind free EDTA with a dissociation constant as low as 25 nM by using isothermal titration calorimetry. When unstable metal-EDTA complexes, e.g. MgEDTA2-, were added to the EppA solution, binding was also observed. However, experimental data and theoretical analysis only supported EppA binding of free EDTA. When stable metal-EDTA complexes, e.g. CuEDTA2-, are titrated into the EppA solution, no binding was observed. Since EDTA monooxygenase in the cytoplasm uses some of the stable metal-EDTA complexes as substrates, we suggest that the lack of EppA binding and EDTA uptake are responsible for the failure of BNC1 cells to degrade the stable complexes.

  3. An ABC Transporter Is Required for Secretion of Peptide Sex Pheromones in Enterococcus faecalis

    PubMed Central

    Varahan, Sriram; Harms, Nathan; Gilmore, Michael S.; Tomich, John M.

    2014-01-01

    ABSTRACT Enterococci are leading causes of hospital-acquired infection in the United States and continue to develop resistances to new antibiotics. Many Enterococcus faecalis isolates harbor pheromone-responsive plasmids that mediate horizontal transfer of even large blocks of chromosomal genes, resulting in hospital-adapted strains over a quarter of whose genomes consist of mobile elements. Pheromones to which the donor cells respond derive from lipoprotein signal peptides. Using a novel bacterial killing assay dependent on the presence of sex pheromones, we screened a transposon mutant library for functions that relate to the production and/or activity of the effector pheromone. Here we describe a previously uncharacterized, but well-conserved, ABC transporter that contributes to pheromone production. Using three distinct pheromone-dependent mating systems, we show that mutants defective in expressing this transporter display a 5- to 6-order-of-magnitude reduction in conjugation efficiency. In addition, we demonstrate that the ABC transporter mutant displays an altered biofilm architecture, with a significant reduction in biofilm biomass compared to that of its isogenic parent, suggesting that pheromone activity also influences biofilm development. The conservation of this peptide transporter across the Firmicutes suggests that it may also play an important role in cell-cell communication in other species within this important phylum. PMID:25249282

  4. The Heterodimeric ABC Transporter EfrCD Mediates Multidrug Efflux in Enterococcus faecalis

    PubMed Central

    Hürlimann, Lea M.; Corradi, Valentina; Hohl, Michael; Bloemberg, Guido V.; Tieleman, D. Peter

    2016-01-01

    Nosocomial infections with Enterococcus faecalis are an emerging health problem. However, drug efflux pumps contributing to intrinsic drug resistance are poorly studied in this Gram-positive pathogen. In this study, we functionally investigated seven heterodimeric ABC transporters of E. faecalis that are annotated as drug efflux pumps. Deletion of ef0789-ef0790 on the chromosome of E. faecalis resulted in increased susceptibility to daunorubicin, doxorubicin, ethidium, and Hoechst 33342, and the corresponding transporter was named EfrCD. Unexpectedly, the previously described heterodimeric multidrug ABC transporter EfrAB contributes marginally to drug efflux in the endogenous context of E. faecalis. In contrast, heterologous expression in Lactococcus lactis revealed that EfrAB, EfrCD, and the product of ef2226-ef2227 (EfrEF) mediate the efflux of fluorescent substrates and confer resistance to multiple dyes and drugs, including fluoroquinolones. Four of seven transporters failed to exhibit drug efflux activity for the set of drugs and dyes tested, even upon overexpression in L. lactis. Since all seven transporters were purified as heterodimers after overexpression in L. lactis, a lack of drug efflux activity is not attributed to poor expression or protein aggregation. Reconstitution of the purified multidrug transporters EfrAB, EfrCD, and EfrEF in proteoliposomes revealed functional coupling between ATP hydrolysis and drug binding. Our analysis creates an experimental basis for the accurate prediction of drug efflux transporters and indicates that many annotated multidrug efflux pumps might be incapable of drug transport and thus might fulfill other physiological functions in the cell. PMID:27381387

  5. Natural variation in an ABC transporter gene associated with seed size evolution in tomato species.

    PubMed

    Orsi, Cintia Hotta; Tanksley, Steven D

    2009-01-01

    Seed size is a key determinant of evolutionary fitness in plants and is a trait that often undergoes tremendous changes during crop domestication. Seed size is most often quantitatively inherited, and it has been shown that Sw4.1 is one of the most significant quantitative trait loci (QTLs) underlying the evolution of seed size in the genus Solanum-especially in species related to the cultivated tomato. Using a combination of genetic, developmental, molecular, and transgenic techniques, we have pinpointed the cause of the Sw4.1 QTL to a gene encoding an ABC transporter gene. This gene exerts its control on seed size, not through the maternal plant, but rather via gene expression in the developing zygote. Phenotypic effects of allelic variation at Sw4.1 are manifested early in seed development at stages corresponding to the rapid deposition of starch and lipids into the endospermic cells. Through synteny, we have identified the Arabidopsis Sw4.1 ortholog. Mutagenesis has revealed that this ortholog is associated with seed length variation and fatty acid deposition in seeds, raising the possibility that the ABC transporter may modulate seed size variation in other species. Transcription studies show that the ABC transporter gene is expressed not only in seeds, but also in other tissues (leaves and roots) and, thus, may perform functions in parts of the plants other than developing seeds. Cloning and characterization of the Sw4.1 QTL gives new insight into how plants change seed during evolution and may open future opportunities for modulating seed size in crop plants for human purposes.

  6. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  7. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  8. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  9. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  10. Sulfadiazine resistance in Toxoplasma gondii: no involvement of overexpression or polymorphisms in genes of therapeutic targets and ABC transporters

    PubMed Central

    Doliwa, Christelle; Escotte-Binet, Sandie; Aubert, Dominique; Sauvage, Virginie; Velard, Frédéric; Schmid, Aline; Villena, Isabelle

    2013-01-01

    Several treatment failures have been reported for the treatment of toxoplasmic encephalitis, chorioretinitis, and congenital toxoplasmosis. Recently we found three Toxoplasma gondii strains naturally resistant to sulfadiazine and we developed in vitro two sulfadiazine resistant strains, RH-RSDZ and ME-49-RSDZ, by gradual pressure. In Plasmodium, common mechanisms of drug resistance involve, among others, mutations and/or amplification within genes encoding the therapeutic targets dhps and dhfr and/or the ABC transporter genes family. To identify genotypic and/or phenotypic markers of resistance in T. gondii, we sequenced and analyzed the expression levels of therapeutic targets dhps and dhfr, three ABC genes, two Pgp, TgABC.B1 and TgABC.B2, and one MRP, TgABC.C1, on sensitive strains compared to sulfadiazine resistant strains. Neither polymorphism nor overexpression was identified. Contrary to Plasmodium, in which mutations and/or overexpression within gene targets and ABC transporters are involved in antimalarial resistance, T. gondii sulfadiazine resistance is not related to these toxoplasmic genes studied. PMID:23707894

  11. Sulfadiazine resistance in Toxoplasma gondii: no involvement of overexpression or polymorphisms in genes of therapeutic targets and ABC transporters.

    PubMed

    Doliwa, Christelle; Escotte-Binet, Sandie; Aubert, Dominique; Sauvage, Virginie; Velard, Frédéric; Schmid, Aline; Villena, Isabelle

    2013-01-01

    Several treatment failures have been reported for the treatment of toxoplasmic encephalitis, chorioretinitis, and congenital toxoplasmosis. Recently we found three Toxoplasma gondii strains naturally resistant to sulfadiazine and we developed in vitro two sulfadiazine resistant strains, RH-R(SDZ) and ME-49-R(SDZ), by gradual pressure. In Plasmodium, common mechanisms of drug resistance involve, among others, mutations and/or amplification within genes encoding the therapeutic targets dhps and dhfr and/or the ABC transporter genes family. To identify genotypic and/or phenotypic markers of resistance in T. gondii, we sequenced and analyzed the expression levels of therapeutic targets dhps and dhfr, three ABC genes, two Pgp, TgABC.B1 and TgABC.B2, and one MRP, TgABC.C1, on sensitive strains compared to sulfadiazine resistant strains. Neither polymorphism nor overexpression was identified. Contrary to Plasmodium, in which mutations and/or overexpression within gene targets and ABC transporters are involved in antimalarial resistance, T. gondii sulfadiazine resistance is not related to these toxoplasmic genes studied.

  12. Ospdr9, which encodes a PDR-type ABC transporter, is induced by heavy metals, hypoxic stress and redox perturbations in rice roots.

    PubMed

    Moons, Ann

    2003-10-23

    Little is known about the role of pleiotropic drug resistance (PDR)-type ATP-binding (ABC) proteins in plant responses to environmental stresses. We characterised ospdr9, which encodes a rice ABC protein with a reverse (ABC-TMS(6))(2) configuration. Polyethylene glycol and the heavy metals Cd (20 microM) and Zn (30 microM) rapidly and markedly induced ospdr9 in roots of rice seedlings. Hypoxic stress also induced ospdr9 in rice roots, salt stress induced ospdr9 at low levels but cold and heat shock had no effect. The plant growth regulator jasmonic acid, the auxin alpha-naphthalene acetic acid and the cytokinin 6-benzylaminopurine triggered ospdr9 expression. The antioxidants dithiothreitol and ascorbic acid rapidly and markedly induced ospdr9 in rice roots; the strong oxidant hydrogen peroxide also induced ospdr9 but at three times lower levels. The results suggested that redox changes may be involved in the abiotic stress response regulation of ospdr9 in rice roots.

  13. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  14. Effects of fluconazole on Candida glabrata biofilms and its relationship with ABC transporter gene expression.

    PubMed

    Fonseca, Elza; Silva, Sónia; Rodrigues, Célia Fortuna; Alves, Carlos Tiago; Azeredo, Joana; Henriques, Mariana

    2014-01-01

    Candida glabrata has emerged as the second most prevalent fungal pathogen and its ability to form biofilms has been considered one of the most important virulence factors, since biofilms present a high tolerance to antifungal agents used in fungal infection treatment. The mechanisms of biofilm tolerance to antifungal agents remain poorly understood. Thus, the aim of this study was to evaluate the effects of fluconazole (FLU) on the formation and control of C. glabrata biofilms and its relation with the expression of genes encoding for ABC transporters, CDR1, SNQ2, and PDR1. For that, minimal inhibitory concentration values for seven C. glabrata strains were determined and the effect of FLU against C. glabrata biofilms was evaluated by total biomass quantification and viable cell enumeration. Matrices from biofilms were analyzed in terms of protein, carbohydrate and DNA content. ABC transporter gene expression was analyzed for quantitative real-time PCR. In addition to the high amounts of proteins and carbohydrates detected in the extracellular matrices in the presence of FLU, this work showed that the overexpression of efflux pumps is a possible mechanism of biofilm tolerance to FLU and this phenomenon alters the structure of C. glabrata biofilms by creating cell clusters.

  15. Expression Patterns of ABC Transporter Genes in Fluconazole-Resistant Candida glabrata.

    PubMed

    Gohar, Atefeh Abdollahi; Badali, Hamid; Shokohi, Tahereh; Nabili, Mojtaba; Amirrajab, Nasrin; Moazeni, Maryam

    2017-04-01

    Clinical management of fungal diseases is compromised by the emergence of antifungal drug resistance in fungi, which leads to elimination of available drug classes as treatment options. An understanding of antifungal resistance at molecular level is, therefore, essential for the development of strategies to combat the resistance. This study presents the assessment of molecular mechanisms associated with fluconazole resistance in clinical Candida glabrata isolates originated from Iran. Taking seven distinct fluconazole-resistant C. glabrata isolates, real-time PCRs were performed to evaluate the alternations in the regulation of the genes involved in drug efflux including CgCDR1, CgCDR2, CgSNQ2, and CgERG11. Gain-of-function (GOF) mutations in CgPDR1 alleles were determined by DNA sequencing. Cross-resistance to fluconazole, itraconazole, and voriconazole was observed in 2.5 % of the isolates. In the present study, six amino acid substitutions were identified in CgPdr1, among which W297R, T588A, and F575L were previously reported, whereas D243N, H576Y, and P915R are novel. CgCDR1 overexpression was observed in 57.1 % of resistant isolates. However, CgCDR2 was not co-expressed with CgCDR1. CgSNQ2 was upregulated in 71.4 % of the cases. CgERG11 overexpression does not seem to be associated with azole resistance, except for isolates that exhibited azole cross-resistance. The pattern of efflux pump gene upregulation was associated with GOF mutations observed in CgPDR1. These results showed that drug efflux mediated by adenosine-5-triphosphate (ATP)-binding cassette transporters, especially CgSNQ2 and CgCDR1, is the predominant mechanism of fluconazole resistance in Iranian isolates of C. glabrata. Since some novel GOF mutations were found here, this study also calls for research aimed at investigating other new GOF mutations to reveal the comprehensive understanding about efflux-mediated resistance to azole antifungal agents.

  16. The ABC Transporter ABCG1 Is Required for Suberin Formation in Potato Tuber Periderm[W

    PubMed Central

    Landgraf, Ramona; Smolka, Ulrike; Altmann, Simone; Eschen-Lippold, Lennart; Senning, Melanie; Sonnewald, Sophia; Weigel, Benjamin; Frolova, Nadezhda; Strehmel, Nadine; Hause, Gerd; Scheel, Dierk; Böttcher, Christoph; Rosahl, Sabine

    2014-01-01

    The lipid biopolymer suberin plays a major role as a barrier both at plant-environment interfaces and in internal tissues, restricting water and nutrient transport. In potato (Solanum tuberosum), tuber integrity is dependent on suberized periderm. Using microarray analyses, we identified ABCG1, encoding an ABC transporter, as a gene responsive to the pathogen-associated molecular pattern Pep-13. Further analyses revealed that ABCG1 is expressed in roots and tuber periderm, as well as in wounded leaves. Transgenic ABCG1-RNAi potato plants with downregulated expression of ABCG1 display major alterations in both root and tuber morphology, whereas the aerial part of the ABCG1-RNAi plants appear normal. The tuber periderm and root exodermis show reduced suberin staining and disorganized cell layers. Metabolite analyses revealed reduction of esterified suberin components and hyperaccumulation of putative suberin precursors in the tuber periderm of RNA interference plants, suggesting that ABCG1 is required for the export of suberin components. PMID:25122151

  17. Cerebral ABC transporter-common mechanisms may modulate neurodegenerative diseases and depression in elderly subjects.

    PubMed

    Pahnke, Jens; Fröhlich, Christina; Paarmann, Kristin; Krohn, Markus; Bogdanovic, Nenad; Årsland, Dag; Winblad, Bengt

    2014-11-01

    In elderly subjects, depression and dementia often coincide but the actual reason is currently unknown. Does a causal link exist or is it just a reactive effect of the knowledge to suffer from dementia? The ABC transporter superfamily may represent a causal link between these mental disorders. Since the transporters ABCB1 and ABCC1 have been discovered as major β-amyloid-exporting molecules at the blood-brain barrier and ABCC1 was found to be directly activated by St. John's wort (SJW), depression and dementia certainly share an important pathophysiologic link. It was recognized that herbal anti-depressant formulations made from SJW are at least as effective for the treatment of unipolar depression in old age as classical pharmacotherapy, while having fewer side effects (Cochrane reports, 2008). SJW is known to activate various metabolizing and transport systems in the body, with cytochrome P450 enzymes and ABC transporters being most important. Does the treatment of depression in elderly subjects using pharmacological compounds or phytomedical extracts target a mechanism that also accounts for peptide storage in Alzheimer's disease and perhaps other proteopathies of the brain? In this review we summarize recent data that point to a common mechanism and present the first promising causal treatment results of demented elderly subjects with distinct SJW extracts. Insufficient trans-barrier clearance may indeed present a common problem in all the proteopathies of the brain where toxic peptides are deposited in a location-specific manner. Thus, activation of efflux molecules holds promise for future treatment of this large group of devastating disorders.

  18. ABC- and SLC-Transporters in Murine and Bovine Mammary Epithelium - Effects of Prochloraz

    PubMed Central

    Yagdiran, Yagmur; Oskarsson, Agneta; Knight, Christopher H.; Tallkvist, Jonas

    2016-01-01

    Some chemicals are ligands to efflux transporters which may result in high concentrations in milk. Limited knowledge is available on the influence of maternal exposure to chemicals on the expression and function of transporters in the lactating mammary gland. We determined gene expression of ABC and SLC transporters in murine mammary tissue of different gestation and lactation stages, in murine mammary cells (HC11) featuring resting and secreting phenotypes and in bovine mammary tissue and cells (BME-UV). Effects on transporter expression and function of the imidazole fungicide prochloraz, previously reported to influence BCRP in mammary cells, was investigated on transporter expression and function in the two cell lines. Transporters studied were BCRP, MDR1, MRP1, OATP1A5/OATP1A2, OCTN1 and OCT1. Gene expressions of BCRP and OCT1 in murine mammary glands were increased during gestation and lactation, whereas MDR1, MRP1, OATP1A5 and OCTN1 were decreased, compared to expressions in virgins. All transporters measured in mammary glands of mice were detected in bovine mammary tissue and in HC11 cells, while only MDR1 and MRP1 were detected in BME-UV cells. Prochloraz treatment induced MDR1 gene and protein expression in both differentiated HC11 and BME-UV cells and increased protein function in HC11 cells, resulting in decreased accumulation of the MDR1 substrate digoxin. In conclusion, our results demonstrate that murine (HC11) and bovine (BME-UV) mammary epithelial cells can be applied to characterize expression and function of transporters as well as effects of contaminants on the mammary transporters. An altered expression, induced by a drug or toxic chemical, on any of the transporters expressed in the mammary epithelial cells during lactation may modulate the well-balanced composition of nutrients and/or secretion of contaminants in milk with potential adverse effects on breast-fed infants and dairy consumers. PMID:27028005

  19. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  20. A Vector System for ABC Transporter-Mediated Secretion and Purification of Recombinant Proteins in Pseudomonas Species

    PubMed Central

    Ryu, Jaewook; Lee, Ukjin; Park, Jiye; Yoo, Do-Hyun

    2014-01-01

    Pseudomonas fluorescens is an efficient platform for recombinant protein production. P. fluorescens has an ABC transporter secreting endogenous thermostable lipase (TliA) and protease, which can be exploited to transport recombinant proteins across the cell membrane. In this study, the expression vector pDART was constructed by inserting tliDEF, genes encoding the ABC transporter, along with the construct of the lipase ABC transporter recognition domain (LARD), into pDSK519, a widely used shuttle vector. When the gene for the target protein was inserted into the vector, the C-terminally fused LARD allowed it to be secreted through the ABC transporter into the extracellular medium. After secretion of the fused target protein, the LARD containing a hydrophobic C terminus enabled its purification through hydrophobic interaction chromatography (HIC) using a methyl-Sepharose column. Alkaline phosphatase (AP) and green fluorescent protein (GFP) were used to validate the expression, export, and purification of target proteins by the pDART system. Both proteins were secreted into the extracellular medium in P. fluorescens. In particular, AP was secreted in several Pseudomonas species with its enzymatic activity in extracellular media. Furthermore, purification of the target protein using HIC yielded some degree of AP and GFP purification, where AP was purified to almost a single product. The pDART system will provide greater convenience for the secretory production and purification of recombinant proteins in Gram-negative bacteria, such as Pseudomonas species. PMID:25548043

  1. Interactions of retinoids with the ABC transporters P-glycoprotein and Breast Cancer Resistance Protein

    PubMed Central

    Tarapcsák, Szabolcs; Szalóki, Gábor; Telbisz, Ágnes; Gyöngy, Zsuzsanna; Matúz, Krisztina; Csősz, Éva; Nagy, Péter; Holb, Imre J.; Rühl, Ralph; Nagy, László; Szabó, Gábor; Goda, Katalin

    2017-01-01

    Retinoids – derivatives of vitamin A – are important cell permeant signaling molecules that regulate gene expression through activation of nuclear receptors. P-glycoprotein (Pgp) and ABCG2 are plasma membrane efflux transporters affecting the tissue distribution of numerous structurally unrelated lipophilic compounds. In the present work we aimed to study the interaction of the above ABC transporters with retinoid derivatives. We have found that 13-cis-retinoic acid, retinol and retinyl-acetate inhibited the Pgp and ABCG2 mediated substrate transport as well as the substrate stimulated ATPase activity of these transporters. Interestingly, 9-cis-retinoic acid and ATRA (all-trans retinoic acid), both are stereoisomers of 13-cis-retinoic acid, did not have any effect on the transporters’ activity. Our fluorescence anisotropy measurements revealed that 13-cis-retinoic acid, retinol and retinyl-acetate selectively increase the viscosity and packing density of the membrane. Thus, the mixed-type inhibition of both transporters by retinol and ABCG2 by 13-cis-retinoic acid may be the collective result of direct interactions of these retinoids with the substrate binding site(s) and of indirect interactions mediated by their membrane rigidifying effects. PMID:28145501

  2. Ectoine-induced proteins in Sinorhizobium meliloti include an Ectoine ABC-type transporter involved in osmoprotection and ectoine catabolism.

    PubMed

    Jebbar, Mohamed; Sohn-Bösser, Linda; Bremer, Erhard; Bernard, Théophile; Blanco, Carlos

    2005-02-01

    To understand the mechanisms of ectoine-induced osmoprotection in Sinorhizobium meliloti, a proteomic examination of S. meliloti cells grown in minimal medium supplemented with ectoine was undertaken. This revealed the induction of 10 proteins. The protein products of eight genes were identified by using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry. Five of these genes, with four other genes whose products were not detected on two-dimensional gels, belong to the same gene cluster, which is localized on the pSymB megaplasmid. Four of the nine genes encode the characteristic components of an ATP-binding cassette transporter that was named ehu, for ectoine/hydroxyectoine uptake. This transporter was encoded by four genes (ehuA, ehuB, ehuC, and ehuD) that formed an operon with another gene cluster that contains five genes, named eutABCDE for ectoine utilization. On the basis of sequence homologies, eutABCDE encode enzymes with putative and hypothetical functions in ectoine catabolism. Analysis of the properties of ehuA and eutA mutants suggests that S. meliloti possesses at least one additional ectoine catabolic pathway as well as a lower-affinity transport system for ectoine and hydroxyectoine. The expression of ehuB, as determined by measurements of UidA activity, was shown to be induced by ectoine and hydroxyectoine but not by glycine betaine or by high osmolality.

  3. An ABC transporter B family protein, ABCB19, is required for cytoplasmic streaming and gravitropism of the inflorescence stems.

    PubMed

    Okamoto, Keishi; Ueda, Haruko; Shimada, Tomoo; Tamura, Kentaro; Koumoto, Yasuko; Tasaka, Masao; Morita, Miyo Terao; Hara-Nishimura, Ikuko

    2016-01-01

    A significant feature of plant cells is the extensive motility of organelles and the cytosol, which was originally defined as cytoplasmic streaming. We suggested previously that a three-way interaction between plant-specific motor proteins myosin XIs, actin filaments, and the endoplasmic reticulum (ER) was responsible for cytoplasmic streaming. (1) Currently, however, there are no reports of molecular components for cytoplasmic streaming other than the actin-myosin-cytoskeleton and ER-related proteins. In the present study, we found that elongated cells of inflorescence stems of Arabidopsis thaliana exhibit vigorous cytoplasmic streaming. Statistical analysis showed that the maximal velocity of plastid movements is 7.26 µm/s, which is much faster than the previously reported velocities of organelles. Surprisingly, the maximal velocity of streaming in the inflorescence stem cells was significantly reduced to 1.11 µm/s in an Arabidopsis mutant, abcb19-101, which lacks ATP BINDING CASSETTE SUBFAMILY B19 (ABCB19) that mediates the polar transport of the phytohormone auxin together with PIN-FORMED (PIN) proteins. Polar auxin transport establishes the auxin concentration gradient essential for plant development and tropisms. Deficiency of ABCB19 activity eventually caused enhanced gravitropic responses of the inflorescence stems and abnormally flexed inflorescence stems. These results suggest that ABCB19-mediated auxin transport plays a role not only in tropism regulation, but also in cytoplasmic streaming.

  4. An ABC transporter controls export of a Drosophila germ cell attractant.

    PubMed

    Ricardo, Sara; Lehmann, Ruth

    2009-02-13

    Directed cell migration, which is critical for embryonic development, leukocyte trafficking, and cell metastasis, depends on chemoattraction. 3-hydroxy-3-methylglutaryl coenzyme A reductase regulates the production of an attractant for Drosophila germ cells that may itself be geranylated. Chemoattractants are commonly secreted through a classical, signal peptide-dependent pathway, but a geranyl-modified attractant would require an alternative pathway. In budding yeast, pheromones produced by a-cells are farnesylated and secreted in a signal peptide-independent manner, requiring the adenosine triphosphate-binding cassette (ABC) transporter Ste6p. Here we show that Drosophila germ cell migration uses a similar pathway, demonstrating that invertebrate germ cells, like yeast cells, are attracted to lipid-modified peptides. Components of this unconventional export pathway are highly conserved, suggesting that this pathway may control the production of similarly modified chemoattractants in organisms ranging from yeast to humans.

  5. Comparison of Cytotoxicity and Inhibition of Membrane ABC Transporters Induced by MWCNTs with Different Length and Functional Groups.

    PubMed

    Yu, Jing; Liu, Su; Wu, Bing; Shen, Zhuoyan; Cherr, Gary N; Zhang, Xu-Xiang; Li, Mei

    2016-04-05

    Experimental studies indicate that multiwalled carbon nanotubes (MWCNTs) have the potential to induce cytotoxicity. However, the reports are often inconsistent and even contradictory. Additionally, adverse effects of MWCNTs at low concentration are not well understood. In this study, we systemically compared adverse effects of six MWCNTs including pristine MWCNTs, hydroxyl-MWCNTs and carboxyl-MWCNTs of two different lengths (0.5-2 μm and 10-30 μm) on human hepatoma cell line HepG2. Results showed that MWCNTs induced cytotoxicity by increasing reactive oxygen species (ROS) generation and damaging cell function. Pristine short MWCNTs induced higher cytotoxicity than pristine long MWCNTs. Functionalization increased cytotoxicity of long MWCNTs, but reduced cytotoxicity of short MWCNTs. Further, our results indicated that the six MWCNTs, at nontoxic concentration, might not be environmentally safe as they inhibited ABC transporters' efflux capabilities. This inhibition was observed even at very low concentrations, which were 40-1000 times lower than their effective concentrations on cytotoxicity. The inhibition of ABC transporters significantly increased cytotoxicity of arsenic, a known substrate of ABC transporters, indicating a chemosensitizing effect of MWCNTs. Plasma membrane damage was likely the mechanism by which the six MWCNTs inhibited ABC transporter activity. This study provides insight into risk assessments of low levels of MWCNTs in the environment.

  6. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  7. Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk.

    PubMed

    Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko

    2013-11-04

    In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

  8. Structure of the nucleotide-binding domain of a dipeptide ABC transporter reveals a novel iron-sulfur cluster-binding domain.

    PubMed

    Li, Xiaolu; Zhuo, Wei; Yu, Jie; Ge, Jingpeng; Gu, Jinke; Feng, Yue; Yang, Maojun; Wang, Linfang; Wang, Na

    2013-02-01

    Dipeptide permease (Dpp), which belongs to an ABC transport system, imports peptides consisting of two or three L-amino acids from the matrix to the cytoplasm in microbes. Previous studies have indicated that haem competes with dipeptides to bind DppA in vitro and in vivo and that the Dpp system can also translocate haem. Here, the crystal structure of DppD, the nucleotide-binding domain (NBD) of the ABC-type dipeptide/oligopeptide/nickel-transport system from Thermoanaerobacter tengcongensis, bound with ATP, Mg(2+) and a [4Fe-4S] iron-sulfur cluster is reported. The N-terminal domain of DppD shares a similar structural fold with the NBDs of other ABC transporters. Interestingly, the C-terminal domain of DppD contains a [4Fe-4S] cluster. The UV-visible absorbance spectrum of DppD was consistent with the presence of a [4Fe-4S] cluster. A search with DALI revealed that the [4Fe-4S] cluster-binding domain is a novel structural fold. Structural analysis and comparisons with other ABC transporters revealed that this iron-sulfur cluster may act as a mediator in substrate (dipeptide or haem) binding by electron transfer and may regulate the transport process in Dpp ABC transport systems. The crystal structure provides a basis for understanding the properties of ABC transporters and will be helpful in investigating the functions of NBDs in the regulation of ABC transporter activity.

  9. The Absence of the Transcription Factor Yrr1p, Identified from Comparative Genome Profiling, Increased Vanillin Tolerance Due to Enhancements of ABC Transporters Expressing, rRNA Processing and Ribosome Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming

    2017-01-01

    Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae. In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7, several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741(yrr1Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1, and SNQ2, as well as the RNA helicase gene DBP2, increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to

  10. A subset of annular lipids is linked to the flippase activity of an ABC transporter.

    PubMed

    Bechara, Chérine; Nöll, Anne; Morgner, Nina; Degiacomi, Matteo T; Tampé, Robert; Robinson, Carol V

    2015-03-01

    Lipids are critical components of membranes that could affect the properties of membrane proteins, yet the precise compositions of lipids surrounding membrane-embedded protein complexes is often difficult to discern. Here we report that, for the heterodimeric ABC transporter TmrAB, the extent of delipidation can be controlled by timed exposure to detergent. We subsequently characterize the cohort of endogenous lipids that are extracted in contact with the membrane protein complex, and show that with prolonged delipidation the number of neutral lipids is reduced in favour of their negatively charged counterparts. We show that lipid A is retained by the transporter and that the extent of its binding decreases during the catalytic cycle, implying that lipid A release is linked to adenosine tri-phosphate hydrolysis. Together, these results enable us to propose that a subset of annular lipids is invariant in composition, with negatively charged lipids binding tightly to TmrAB, and imply a role for this exporter in glycolipid translocation.

  11. A subset of annular lipids is linked to the flippase activity of an ABC transporter

    NASA Astrophysics Data System (ADS)

    Bechara, Chérine; Nöll, Anne; Morgner, Nina; Degiacomi, Matteo T.; Tampé, Robert; Robinson, Carol V.

    2015-03-01

    Lipids are critical components of membranes that could affect the properties of membrane proteins, yet the precise compositions of lipids surrounding membrane-embedded protein complexes is often difficult to discern. Here we report that, for the heterodimeric ABC transporter TmrAB, the extent of delipidation can be controlled by timed exposure to detergent. We subsequently characterize the cohort of endogenous lipids that are extracted in contact with the membrane protein complex, and show that with prolonged delipidation the number of neutral lipids is reduced in favour of their negatively charged counterparts. We show that lipid A is retained by the transporter and that the extent of its binding decreases during the catalytic cycle, implying that lipid A release is linked to adenosine tri-phosphate hydrolysis. Together, these results enable us to propose that a subset of annular lipids is invariant in composition, with negatively charged lipids binding tightly to TmrAB, and imply a role for this exporter in glycolipid translocation.

  12. Arbuscular mycorrhiza affects nickel translocation and expression of ABC transporter and metallothionein genes in Festuca arundinacea.

    PubMed

    Shabani, Leila; Sabzalian, Mohammad R; Mostafavi pour, Sodabeh

    2016-01-01

    Mycorrhizal fungi are key microorganisms for enhancing phytoremediation of soils contaminated with heavy metals. In this study, the effects of the arbuscular mycorrhizal fungus (AMF) Funneliformis mosseae (=Glomus mosseae) on physiological and molecular mechanisms involved in the nickel (Ni) tolerance of tall fescue (Festuca arundinacea = Schedonorus arundinaceus) were investigated. Nickel addition had a pronounced negative effect on tall fescue growth and photosynthetic pigment contents, as well as on AMF colonization. Phosphorus content increased markedly in mycorrhizal plants (M) compared to non-inoculated (NM) ones. However, no significant difference was observed in root carbohydrate content between AMF-inoculated and non-inoculated plants. For both M and NM plants, Ni concentrations in shoots and roots increased according to the addition of the metal into soil, but inoculation with F. mosseae led to significantly lower Ni translocation from roots to the aboveground parts compared to non-inoculated plants. ABC transporter and metallothionein transcripts accumulated to considerably higher levels in tall fescue plants colonized by F. mosseae than in the corresponding non-mycorrhizal plants. These results highlight the importance of mycorrhizal colonization in alleviating Ni-induced stress by reducing Ni transport from roots to shoots of tall fescue plants.

  13. Molecular cloning and characterization of Crmdr1, a novel MDR-type ABC transporter gene from Catharanthus roseus.

    PubMed

    Jin, Hongbin; Liu, Donghui; Zuo, Kaijing; Gong, Yifu; Miao, Zhiqi; Chen, Yuhui; Ren, Weiwei; Sun, Xiaofen; Tang, Kexuan

    2007-08-01

    A novel gene encoding a MDR-like ABC transporter protein was cloned from Catharanthus roseus, a medicinal plant with more than 120 kinds of secondary metabolites, through rapid amplification of cDNA ends (RACE). This gene (named as Crmdr1; GenBank accession no.: DQ660356) had a total length of 4395 bp with an open reading frame of 3801 bp, and encoded a predicted polypeptide of 1266 amino acids with a molecular weight of 137.1 kDa. The CrMDR1 protein shared 59.8, 62.5, 60.0 and 58.2% identity with other MDR proteins isolated from Arabidopsis thaliana (AAD31576), Coptis japonica (CjMDR), Gossypium hirsutum (GhMDR) and Triticum aestivum (TaMDR) at amino acid level, respectively. Southern blot analysis showed that Crmdr1 was a low-copy gene. Expression pattern analysis revealed that Crmdr1 constitutively expressed in the root, stem and leaf, but with lower expression in leaf. The domains analysis showed that CrMDR1 protein possessed two transmembrane domains (TMDs) and two nucleotide binding domains (NBDs) arranging in "TMD1-NBD1-TMD2-NBD2" direction, which is consistent with other MDR transporters. Within NBDs three characteristic motifs common to all ABC transporters, "Walker A", "Walker B" and C motif, were found. These results indicate that CrMDR1 is a MDR-like ABC transporter protein that may be involved in the transport and accumulation of secondary metabolites.

  14. The human porphyrin transporter ABCB6 is dispensable for erythropoiesis but responsible for the new blood group system Langereis

    PubMed Central

    Helias, Virginie; Saison, Carole; Ballif, Bryan A.; Peyrard, Thierry; Takahashi, Junko; Takahashi, Hideo; Tanaka, Mitsunobu; Deybach, Jean-Charles; Puy, Hervé; Le Gall, Maude; Sureau, Camille; Pham, Bach-Nga; Le Pennec, Pierre-Yves; Tani, Yoshihiko; Cartron, Jean-Pierre; Arnaud, Lionel

    2013-01-01

    The human ATP-binding cassette (ABC) transporter ABCB6 has been described as a mitochondrial porphyrin transporter essential for heme biosynthesis1, but is also suspected to contribute to anticancer drug resistance2–4, as do other ABC transporters located at the plasma membrane. We identified ABCB6 as the carrier of the blood group antigen Lan on red blood cells, but also at the plasma membrane of hepatocellular carcinoma (HCC) cells, and established that ABCB6 actually encodes a new blood group system (Langereis, Lan). Targeted sequencing of ABCB6 in 12 unrelated individuals of the blood type Lan− identified 10 different ABCB6 null mutations. This is the first report of deficient alleles of this human ABC transporter gene. Surprisingly, Lan− (ABCB6−/−) individuals do not suffer any clinical consequences, albeit their deficiency in ABCB6 may place them at risk when defining drug dosage. PMID:22246506

  15. Moving out: from sterol transport to drug resistance - the ABCG subfamily of efflux pumps.

    PubMed

    Moitra, Karobi; Silverton, Latoya; Limpert, Katy; Im, Kate; Dean, Michael

    2011-01-01

    The ATP binding cassette (ABC) proteins are typically ATP-driven transmembrane pumps that have been evolutionarily conserved from bacteria to humans. In humans these transporters are subdivided into seven subfamilies, ranging from A to G. The ABCG subfamily of transporters is the primary focus of this review. This subfamily of proteins has been conserved throughout evolution and plays a central role in several cellular processes, such as sterol homeostasis and multidrug resistance. Functional polymorphisms/mutations in some of these G-subfamily transporters have clinical consequences in humans.

  16. Growth Hormone Receptor Knockdown Sensitizes Human Melanoma Cells to Chemotherapy by Attenuating Expression of ABC Drug Efflux Pumps.

    PubMed

    Basu, Reetobrata; Baumgaertel, Nicholas; Wu, Shiyong; Kopchick, John J

    2017-03-14

    Melanoma remains one of the most therapy-resistant forms of human cancer despite recent introductions of highly efficacious targeted therapies. The intrinsic therapy resistance of human melanoma is largely due to abundant expression of a repertoire of xenobiotic efflux pumps of the ATP-binding cassette (ABC) transporter family. Here, we report that GH action is a key mediator of chemotherapeutic resistance in human melanoma cells. We investigated multiple ABC efflux pumps (ABCB1, ABCB5, ABCB8, ABCC1, ABCC2, ABCG1, and ABCG2) reportedly associated with melanoma drug resistance in different human melanoma cells and tested the efficacy of five different anti-cancer compounds (cisplatin, doxorubicin, oridonin, paclitaxel, vemurafenib) with decreased GH action. We found that GH treatment of human melanoma cells upregulates expression of multiple ABC transporters and increases the EC50 of melanoma drug vemurafenib. Also, vemurafenib-resistant melanoma cells had upregulated levels of GH receptor (GHR) expression as well as ABC efflux pumps. GHR knockdown (KD) using siRNA in human melanoma cells treated with sub-EC50 doses of anti-tumor compounds resulted in significantly increased drug retention, decreased cell proliferation and increased drug efficacy, compared to mock-transfected controls. Our set of findings identify an unknown mechanism of GH regulation in mediating melanoma drug resistance and validates GHR as a unique therapeutic target for sensitizing highly therapy-resistant human melanoma cells to lower doses of anti-cancer drugs.

  17. Abc3-Mediated Efflux of an Endogenous Digoxin-like Steroidal Glycoside by Magnaporthe oryzae Is Necessary for Host Invasion during Blast Disease

    PubMed Central

    Patkar, Rajesh N.; Xue, Yang Kui; Shui, Guanghou; Wenk, Markus R.; Naqvi, Naweed I.

    2012-01-01

    Magnaporthe oryzae, which causes the devastating rice-blast disease, invades its host plants via a specialized infection structure called the appressorium. Previously, we showed that the ATP-Binding Cassette 3 transporter is necessary for appressorial function (host penetration) in M. oryzae. However, thus far, the molecular basis underlying impaired appressorial function in the abc3Δ remains elusive. We hypothesized that the abc3Δ appressoria accumulate excessive amounts of specific efflux substrate(s) of the Abc3 transporter in M. oryzae. We devised an innovative yeast-based strategy and identified Abc3 Transporter efflux Substrate (ATS) to be a digoxin-like endogenous steroidal glycoside that accumulates to inhibitory levels in M. oryzae abc3Δ appressoria. Exogenous ATS altered cell wall biogenesis and viability in wild-type Schizosaccharomyces pombe, but not in S. pombe expressing M. oryzae Abc3. We show that ATS associates with the Translation Elongation factor Tef2 in M. oryzae, and propose that ATS regulates ion homeostasis during pathogenesis. Excessive ATS accumulation, either intracellularly due to impaired efflux in the abc3Δ or when added exogenously to the wild type, renders M. oryzae nonpathogenic. Furthermore, we demonstrate that the host penetration defects in the abc3Δ are due to aberrant F-actin dynamics as a result of altered Tef2 function and/or ion homeostasis defects caused by excess accumulation of ATS therein. Rather surprisingly, excessive exogenous ATS or digoxin elicited the hypersensitive response in rice, even in the absence of the blast fungus. Lastly, reduced disease symptoms in the inoculated host plants in the presence of excessive digoxin suggest a potential use for such related steroidal glycosides in controlling rice-blast disease. PMID:22927822

  18. Role of ABC and Solute Carrier Transporters in the Placental Transport of Lamivudine

    PubMed Central

    Ceckova, Martina; Reznicek, Josef; Ptackova, Zuzana; Cerveny, Lukas; Müller, Fabian; Kacerovsky, Marian; Fromm, Martin F.; Glazier, Jocelyn D.

    2016-01-01

    Lamivudine is one of the antiretroviral drugs of choice for the prevention of mother-to-child transmission (MTCT) in HIV-positive women. In this study, we investigated the relevance of drug efflux transporters P-glycoprotein (P-gp) (MDR1 [ABCB1]), BCRP (ABCG2), MRP2 (ABCC2), and MATE1 (SLC47A1) for the transmembrane transport and transplacental transfer of lamivudine. We employed in vitro accumulation and transport experiments on MDCK cells overexpressing drug efflux transporters, in situ-perfused rat term placenta, and vesicular uptake in microvillous plasma membrane (MVM) vesicles isolated from human term placenta. MATE1 significantly accelerated lamivudine transport in MATE1-expressing MDCK cells, whereas no transporter-driven efflux of lamivudine was observed in MDCK-MDR1, MDCK-MRP2, and MDCK-BCRP monolayers. MATE1-mediated efflux of lamivudine appeared to be a low-affinity process (apparent Km of 4.21 mM and Vmax of 5.18 nmol/mg protein/min in MDCK-MATE1 cells). Consistent with in vitro transport studies, the transplacental clearance of lamivudine was not affected by P-gp, BCRP, or MRP2. However, lamivudine transfer across dually perfused rat placenta and the uptake of lamivudine into human placental MVM vesicles revealed pH dependency, indicating possible involvement of MATE1 in the fetal-to-maternal efflux of the drug. To conclude, placental transport of lamivudine does not seem to be affected by P-gp, MRP2, or BCRP, but a pH-dependent mechanism mediates transport of lamivudine in the fetal-to-maternal direction. We suggest that MATE1 might be, at least partly, responsible for this transport. PMID:27401571

  19. Interaction of ABC transport proteins with toxic metals at the level of gene and transport activity in the PLHC-1 fish cell line.

    PubMed

    Della Torre, Camilla; Zaja, Roko; Loncar, Jovica; Smital, Tvrtko; Focardi, Silvano; Corsi, Ilaria

    2012-06-25

    The aim of this study was to investigate the interaction of four toxic metals with ABC transport proteins in piscine cell line PLHC-1. Cells were exposed for 24 h to 0.01-1 μM of CdCl(2), HgCl(2), As(2)O(3), or K(2)Cr(2)O(7) and the expression of a series of ABC genes (abcb1, abcc1-4) was determined using qRT-PCR. Using the fluorescent model substrates calcein-AM and monochlorbimane we measured interaction of metals with the transport activity of ABC transporters. P-glycoprotein (P-gp) activity was measured in PLHC-1/dox (P-gp overexpressing cells) while activity and interactions of metals with MRPs was measured in PLHC-1/wt cells. After 24 h exposure, abcc2-4 genes were dose-dependently up-regulated by all metals, while abcb1 and abcc1 were less affected. Up-regulation of abcc2 was more pronounced, with up to 8-fold increase in expression. Abcc3 and abcc4 were moderately inducible by HgCl(2) with 3.3-fold and 2.2-fold, respectively. All metals caused a significant inhibition of both P-gp (2.9- to 4-fold vs. controls) and MRP (1.3- to 1.8-fold) transport activities. Modulation of ABC genes and transport activities was further investigated in PLHC-1/wt cells exposed to 1 μM HgCl(2) for 72 h and in Hg resistant cells selected by long term cultivation of PLHC-1/wt cells in increasing concentrations of HgCl(2). Exposure to HgCl(2) for 72 h induced MRP genes expression and efflux activity. The long term cultivation of PLHC-1/wt cells in HgCl(2), did not cause prolonged up-regulation of the tested abc genes but resulted in higher MRP transport activities as determined by the increased sensitivity of these cells to MK571 (MRP specific inhibitor). Results of the present study indicated specific interaction of metals with selected ABC transport proteins. Modulation of ABC transporters takes place at both transcriptional and functional level. An active involvement of efflux pumps in Hg clearance in fish is suggested.

  20. Identification and characterization of an iron ABC transporter operon in Gluconacetobacter diazotrophicus Pal 5.

    PubMed

    Urzúa, Lucia Soto; Vázquez-Candanedo, Ada P; Sánchez-Espíndola, Adriana; Ramírez, Carlos Ávila; Baca, Beatriz E

    2013-06-01

    Gluconacetobacter diazotrophicus is a nitrogen-fixing bacterium and endophyte of sugarcane. We have cloned and sequenced the genes coding for the components of the iron ABC-type acquisition system of G. diazotrophicus. Sequence analysis revealed three ORFs, (feuA, feuB, and feuC) organized as an operon and encoding polypeptides of 346 (38 kDa), 342 (34.2 kDa), and 240 (26 kDa) amino acids, respectively. The deduced translation products of the feu operon showed similarity with a periplasmic solute-binding protein (FeuA), permease (FeuB), and ATPase (FeuC) involved in Fe transport. The role of FeuB in the survival of G. diazotrophicus under iron depletion was evaluated by comparing the ability of wild-type and FeuB-Km(R) -mutant strains in a medium without iron supplementation and in a medium containing 2, 2'-dipyridyl (DP). Growth of the mutant was affected in the medium containing DP. The operon was expressed at higher levels in cells depleted for iron than in those that contained the metal. A decrease in nitrogenase activity was observed with the FeuB-Km(R) -mutant strain that with the wild-type under iron deficiency conditions, suggesting that the Feu operon play role in Fe nutrition of G. diazotrophicus.

  1. Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter

    PubMed Central

    Hohl, Michael; Hürlimann, Lea M.; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G.; Bordignon, Enrica; Seeger, Markus A.

    2014-01-01

    ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5′-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport. PMID:25030449

  2. Low levels of graphene and graphene oxide inhibit cellular xenobiotic defense system mediated by efflux transporters.

    PubMed

    Liu, Su; Jiang, Wei; Wu, Bing; Yu, Jing; Yu, Haiyan; Zhang, Xu-Xiang; Torres-Duarte, Cristina; Cherr, Gary N

    2016-01-01

    Low levels of graphene and graphene oxide (GO) are considered to be environmentally safe. In this study, we analyzed the potential effects of graphene and GO at relatively low concentrations on cellular xenobiotic defense system mediated by efflux transporters. The results showed that graphene (<0.5 μg/mL) and GO (<20 μg/mL) did not decrease cell viability, generate reactive oxygen species, or disrupt mitochondrial function. However, graphene and GO at the nontoxic concentrations could increase calcein-AM (CAM, an indicator of membrane ATP-binding cassette (ABC) transporter) activity) accumulation, indicating inhibition of ABC transporters' efflux capabilities. This inhibition was observed even at 0.005 μg/mL graphene and 0.05 μg/mL GO, which are 100 times and 400 times lower than their lowest toxic concentration from cytotoxicity experiments, respectively. The inhibition of ABC transporters significantly increased the toxicity of paraquat and arsenic, known substrates of ABC transporters. The inhibition of ABC transporters was found to be based on graphene and GO damaging the plasma membrane structure and fluidity, thus altering functions of transmembrane ABC transporters. This study demonstrates that low levels of graphene and GO are not environmentally safe since they can significantly make cell more susceptible to other xenobiotics, and this chemosensitizing activity should be considered in the risk assessment of graphene and GO.

  3. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  4. A petunia ABC protein controls strigolactone-dependent symbiotic signalling and branching.

    PubMed

    Kretzschmar, Tobias; Kohlen, Wouter; Sasse, Joelle; Borghi, Lorenzo; Schlegel, Markus; Bachelier, Julien B; Reinhardt, Didier; Bours, Ralph; Bouwmeester, Harro J; Martinoia, Enrico

    2012-03-07

    Strigolactones were originally identified as stimulators of the germination of root-parasitic weeds that pose a serious threat to resource-limited agriculture. They are mostly exuded from roots and function as signalling compounds in the initiation of arbuscular mycorrhizae, which are plant-fungus symbionts with a global effect on carbon and phosphate cycling. Recently, strigolactones were established to be phytohormones that regulate plant shoot architecture by inhibiting the outgrowth of axillary buds. Despite their importance, it is not known how strigolactones are transported. ATP-binding cassette (ABC) transporters, however, are known to have functions in phytohormone translocation. Here we show that the Petunia hybrida ABC transporter PDR1 has a key role in regulating the development of arbuscular mycorrhizae and axillary branches, by functioning as a cellular strigolactone exporter. P. hybrida pdr1 mutants are defective in strigolactone exudation from their roots, resulting in reduced symbiotic interactions. Above ground, pdr1 mutants have an enhanced branching phenotype, which is indicative of impaired strigolactone allocation. Overexpression of Petunia axillaris PDR1 in Arabidopsis thaliana results in increased tolerance to high concentrations of a synthetic strigolactone, consistent with increased export of strigolactones from the roots. PDR1 is the first known component in strigolactone transport, providing new opportunities for investigating and manipulating strigolactone-dependent processes.

  5. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  6. Identification of a meningococcal L-glutamate ABC transporter operon essential for growth in low-sodium environments.

    PubMed

    Monaco, Caterina; Talà, Adelfia; Spinosa, Maria Rita; Progida, Cinzia; De Nitto, Eleanna; Gaballo, Antonio; Bruni, Carmelo B; Bucci, Cecilia; Alifano, Pietro

    2006-03-01

    GdhR is a meningococcal transcriptional regulator that was previously shown to positively control the expression of gdhA, encoding the NADP-specific L-glutamate dehydrogenase (NADP-GDH), in response to the growth phase and/or to the carbon source. In this study we used reverse transcriptase-PCR-differential display (to identify additional GdhR-regulated genes. The results indicated that GdhR, in addition to NADP-GDH, controls the expression of a number of genes involved in glucose catabolism by the Entner-Doudoroff pathway and in l-glutamate import by an unknown ABC transport system. The genes encoding the putative periplasmic substrate-binding protein (NMB1963) and the permease (NMB1965) of the ABC transporter were genetically inactivated. Uptake experiments demonstrated an impairment of L-glutamate import in the NMB1965-defective mutant in the absence or in the presence of a low sodium ion concentration. In contrast, at a sodium ion concentration above 60 mM, the uptake defect disappeared, possibly because the activity of a sodium-driven secondary transporter became predominant. Indeed, the NMB1965-defective mutant was unable to grow at a low sodium ion concentration (<20 mM) in a chemically defined medium containing L-glutamate and four other amino acids that supported meningococcal growth, but it grew when the sodium ion concentration was raised to higher values (>60 mM). The same growth phenotype was observed in the NMB1963-defective mutant. Cell invasion and intracellular persistence assays and expression data during cell invasion provided evidence that the l-glutamate ABC transporter, tentatively named GltT, was critical for meningococcal adaptation in the low-sodium intracellular environment.

  7. 1.55 A structure of the ectoine binding protein TeaA of the osmoregulated TRAP-transporter TeaABC from Halomonas elongata.

    PubMed

    Kuhlmann, Sonja I; Terwisscha van Scheltinga, Anke C; Bienert, Ralf; Kunte, Hans-Jörg; Ziegler, Christine

    2008-09-09

    TeaABC from the moderate halophilic bacterium Halomonas elongata belongs to the tripartite ATP-independent periplasmic transporters (TRAP-T), a family of secondary transporters functioning in conjunction with periplasmic substrate binding proteins. TeaABC facilitates the uptake of the compatible solutes ectoine and hydroxyectoine that are accumulated in the cytoplasm under hyperosmotic stress to protect the cell from dehydration. TeaABC is the only known TRAP-T activated by osmotic stress. Currently, our knowledge on the osmoregulated compatible solute transporter is limited to ABC transporters or conventional secondary transporters. Therefore, this study presents the first detailed analysis of the molecular mechanisms underlying substrate recognition of the substrate binding protein of an osmoregulated TRAP-T. In the present study we were able to demonstrate by isothermal titration calorimetry measurements that TeaA is a high-affinity ectoine binding protein ( K d = 0.19 microM) that also has a significant but somewhat lower affinity to hydroxyectoine ( K d = 3.8 microM). Furthermore, we present the structure of TeaA in complex with ectoine at a resolution of 1.55 A and hydroxyectoine at a resolution of 1.80 A. Analysis of the TeaA binding pocket and comparison of its structure to other compatible solute binding proteins from ABC transporters reveal common principles in compatible solute binding but also significant differences like the solvent-mediated specific binding of ectoine to TeaA.

  8. Evaluation of current methods used to analyze the expression profiles of ABC transporters yields an improved drug-discovery database

    PubMed Central

    Orina, Josiah N.; Calcagno, Anna Maria; Wu, Chung-Pu; Varma, Sudhir; Shih, Joanna; Lin, Min; Eichler, Gabriel; Weinstein, John N.; Pommier, Yves; Ambudkar, Suresh V.; Gottesman, Michael M.; Gillet, Jean-Pierre

    2009-01-01

    The development of multidrug resistance (MDR) to chemotherapy remains a major challenge in the treatment of cancer. Resistance exists against every effective anti-cancer drug and can develop by multiple mechanisms. These mechanisms can act individually or synergistically, leading to multidrug resistance (MDR), in which the cell becomes resistant to a variety of structurally and mechanistically unrelated drugs in addition to the drug initially administered. Although extensive work has been done to characterize MDR mechanisms in vitro, the translation of this knowledge to the clinic has not been successful. Therefore, identifying genes and mechanisms critical to the development of MDR in vivo and establishing a reliable method for analyzing highly homologous genes from small amounts of tissue is fundamental to achieving any significant enhancement in our understanding of multidrug resistance mechanisms and could lead to treatments designed to circumvent it. In this study, we use a previously established database that allows the identification of lead compounds in the early stages of drug discovery that are not ABC transporter substrates. We believe this can serve as a model for appraising the accuracy and sensitivity of current methods used to analyze the expression profiles of ABC transporters. We found two platforms to be superior methods for the analysis of expression profiles of highly homologous gene superfamilies. This study also led to an improved database by revealing previously unidentified substrates for ABCB1, ABCC1 and ABCG2, transporters that contribute to multidrug resistance. PMID:19584229

  9. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.

    PubMed

    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M

    2001-12-01

    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  10. The abcEDCBA-Encoded ABC Transporter and the virB Operon-Encoded Type IV Secretion System of Brucella ovis Are Critical for Intracellular Trafficking and Survival in Ovine Monocyte-Derived Macrophages

    PubMed Central

    Macedo, Auricelio A.; Silva, Ana P. C.; Mol, Juliana P. S.; Costa, Luciana F.; Garcia, Luize N. N.; Araújo, Marcio S.; Martins Filho, Olindo A.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    Brucella ovis infection is associated with epididymitis, orchitis and infertility in rams. Most of the information available on B. ovis and host cell interaction has been generated using murine macrophages or epithelial cell lines, but the interaction between B. ovis and primary ovine macrophages has not been studied. The aim of this study was to evaluate the role of the B. ovis abcEDCBA-encoded ABC transporter and the virB operon-encoded Type IV Secretion System (T4SS) during intracellular survival of B. ovis in ovine peripheral blood monocyte-derived macrophages. ΔabcBA and ΔvirB2 mutant strains were unable to survive in the intracellular environment when compared to the WT B. ovis at 48 hours post infection (hpi). In addition, these mutant strains cannot exclude the lysosomal marker LAMP1 from its vacuolar membrane, and their vacuoles do not acquire the endoplasmic reticulum marker calreticulin, which takes place in the WT B. ovis containing vacuole. Higher levels of nitric oxide production were observed in macrophages infected with WT B. ovis at 48 hpi when compared to macrophages infected with the ΔabcBA or ΔvirB2 mutant strains. Conversely, higher levels of reactive oxygen species were detected in macrophages infected with the ΔabcBA or ΔvirB2 mutant strains at 48 hpi when compared to macrophages infected with the WT strain. Our results demonstrate that B. ovis is able to persist and multiply in ovine macrophages, while ΔabcBA and ΔvirB2 mutations prevent intracellular multiplication, favor phagolysosome fusion, and impair maturation of the B. ovis vacuole towards an endoplasmic reticulum-derived compartment. PMID:26366863

  11. The ABC transporter YejABEF is required for resistance to antimicrobial peptides and the virulence of Brucella melitensis

    PubMed Central

    Wang, Zhen; Bie, Pengfei; Cheng, Jie; Lu, Lin; Cui, Buyun; Wu, Qingmin

    2016-01-01

    The ability to resist the killing effects of host antimicrobial peptides (AMPs) plays a vital role in the virulence of pathogens. The Brucella melitensis NI genome has a gene cluster that encodes ABC transport. In this study, we constructed yejA1, yejA2, yejB, yejE, yejF, and whole yej operon deletion mutants, none of which exhibited discernible growth defect in TSB or minimal medium. Unlike their parental strain, the mutants showed a significantly increased sensitivity to acidic stress. The NIΔyejE and NIΔyejABEF mutants were also more sensitive than B. melitensis NI to polymyxin B, and the expression of yej operon genes was induced by polymyxin B. Moreover, cell and mouse infection assays indicated that NIΔyejE and NIΔyejABEF have restricted invasion and replication abilities inside macrophages and are rapidly cleared from the spleens of infected mice. These findings indicate that the ABC transporter YejABEF is required for the virulence of Brucella, suggesting that resistance to host antimicrobials is a key mechanism for Brucella to persistently survive in vivo. This study provided insights that led us to further investigate the potential correlation of AMP resistance with the mechanisms of immune escape and persistent infection by pathogens. PMID:27550726

  12. Alkylrhodamines enhance the toxicity of clotrimazole and benzalkonium chloride by interfering with yeast pleiotropic ABC-transporters.

    PubMed

    Knorre, Dmitry A; Besedina, Elizaveta; Karavaeva, Iuliia E; Smirnova, Ekaterina A; Markova, Olga V; Severin, Fedor F

    2016-06-01

    ABC-transporters with broad substrate specificity are responsible for pathogenic yeast resistance to antifungal compounds. Here we asked whether highly hydrophobic chemicals with delocalized positive charge can be used to overcome the resistance. Such molecules efficiently penetrate the plasma membrane and accumulate inside the cells. We reasoned that these properties can convert an active efflux of the compounds into a futile cycle thus interfering with the extrusion of the antibiotics. To test this, we studied the effects of several alkylated rhodamines on the drug resistance of yeast Saccharomyces cerevisiae We found that octylrhodamine synergetically increases toxicity of Pdr5p substrate-clotrimazole, while the others were less effective. Next, we compared the contributions of three major pleiotropic ABC-transporters (Pdr5p, Yor1p, Snq2p) on the accumulation of the alkylated rhodamines. While all of the tested compounds were extruded by Pdr5p, Yor1p and Snq2p showed narrower substrate specificity. Interestingly, among the tested alkylated rhodamines, inactivation of Pdr5p had the strongest effect on the accumulation of octylrhodamine inside the cells, which is consistent with the fact that clotrimazole is a substrate of Pdr5p. As alkylated rhodamines were shown to be non-toxic on mice, our study makes them potential components of pharmacological antifungal compositions.

  13. Function of the Caenorhabditis elegans ABC Transporter PGP-2 in the Biogenesis of a Lysosome-related Fat Storage Organelle

    PubMed Central

    Schroeder, Lena K.; Kremer, Susan; Kramer, Maxwell J.; Currie, Erin; Kwan, Elizabeth; Watts, Jennifer L.; Lawrenson, Andrea L.

    2007-01-01

    Caenorhabditis elegans gut granules are intestine specific lysosome-related organelles with birefringent and autofluorescent contents. We identified pgp-2, which encodes an ABC transporter, in screens for genes required for the proper formation of gut granules. pgp-2(−) embryos mislocalize birefringent material into the intestinal lumen and are lacking in acidified intestinal V-ATPase–containing compartments. Adults without pgp-2(+) function similarly lack organelles with gut granule characteristics. These cellular phenotypes indicate that pgp-2(−) animals are defective in gut granule biogenesis. Double mutant analysis suggests that pgp-2(+) functions in parallel with the AP-3 adaptor complex during gut granule formation. We find that pgp-2 is expressed in the intestine where it functions in gut granule biogenesis and that PGP-2 localizes to the gut granule membrane. These results support a direct role of an ABC transporter in regulating lysosome biogenesis. Previously, pgp-2(+) activity has been shown to be necessary for the accumulation of Nile Red–stained fat in C. elegans. We show that gut granules are sites of fat storage in C. elegans embryos and adults. Notably, levels of triacylglycerides are relatively normal in animals defective in the formation of gut granules. Our results provide an explanation for the loss of Nile Red–stained fat in pgp-2(−) animals as well as insight into the specialized function of this lysosome-related organelle. PMID:17202409

  14. The ABC transporter BcatrB from Botrytis cinerea exports camalexin and is a virulence factor on Arabidopsis thaliana.

    PubMed

    Stefanato, Francesca L; Abou-Mansour, Eliane; Buchala, Antony; Kretschmer, Matthias; Mosbach, Andreas; Hahn, Matthias; Bochet, Christian G; Métraux, Jean-Pierre; Schoonbeek, Henk-jan

    2009-05-01

    Arabidopsis thaliana is known to produce the phytoalexin camalexin in response to abiotic and biotic stress. Here we studied the mechanisms of tolerance to camalexin in the fungus Botrytis cinerea, a necrotrophic pathogen of A. thaliana. Exposure of B. cinerea to camalexin induces expression of BcatrB, an ABC transporter that functions in the efflux of fungitoxic compounds. B. cinerea inoculated on wild-type A. thaliana plants yields smaller lesions than on camalexin-deficient A. thaliana mutants. A B. cinerea strain lacking functional BcatrB is more sensitive to camalexin in vitro and less virulent on wild-type plants, but is still fully virulent on camalexin-deficient mutants. Pre-treatment of A. thaliana with UV-C leads to increased camalexin accumulation and substantial resistance to B. cinerea. UV-C-induced resistance was not seen in the camalexin-deficient mutants cyp79B2/B3, cyp71A13, pad3 or pad2, and was strongly reduced in ups1. Here we demonstrate that an ABC transporter is a virulence factor that increases tolerance of the pathogen towards a phytoalexin, and the complete restoration of virulence on host plants lacking this phytoalexin.

  15. The maltose ABC transporter in Lactococcus lactis facilitates high-level sensitivity to the circular bacteriocin garvicin ML.

    PubMed

    Gabrielsen, Christina; Brede, Dag A; Hernández, Pablo E; Nes, Ingolf F; Diep, Dzung B

    2012-06-01

    We generated and characterized a series of spontaneous mutants of Lactococcus lactis IL1403 with average 6- to 11-fold-lowered sensitivities to the circular bacteriocin garvicin ML (GarML). Carbohydrate fermentation assays highlighted changes in carbohydrate metabolism, specifically loss of the ability to metabolize starch and maltose, in these mutants. PCR and sequencing showed that a 13.5-kb chromosomal deletion encompassing 12 open reading frames, mainly involved in starch and maltose utilization, had spontaneously occurred in the GarML-resistant mutants. Growth experiments revealed a correlation between sensitivity to GarML and carbon catabolite repression (CCR); i.e., sensitivity to GarML increased significantly when wild-type cells were grown on maltose and galactose as sole carbohydrates, an effect which was alleviated by the presence of glucose. Among the genes deleted in the mutants were malEFG, which encode a CCR-regulated membrane-bound maltose ABC transporter. The complementation of mutants with these three genes recovered normal sensitivity to the bacteriocin, suggesting an essential role of the maltose ABC transporter in the antimicrobial activity of GarML. This notion was supported by the fact that the level of sensitivity to GarML was dose dependent, increasing with higher expression levels of malEFG over a 50-fold range. To our knowledge, this is the first time a specific protein complex has been demonstrated to be involved in sensitivity to a circular bacteriocin.

  16. The ABC transporter YejABEF is required for resistance to antimicrobial peptides and the virulence of Brucella melitensis.

    PubMed

    Wang, Zhen; Bie, Pengfei; Cheng, Jie; Lu, Lin; Cui, Buyun; Wu, Qingmin

    2016-08-23

    The ability to resist the killing effects of host antimicrobial peptides (AMPs) plays a vital role in the virulence of pathogens. The Brucella melitensis NI genome has a gene cluster that encodes ABC transport. In this study, we constructed yejA1, yejA2, yejB, yejE, yejF, and whole yej operon deletion mutants, none of which exhibited discernible growth defect in TSB or minimal medium. Unlike their parental strain, the mutants showed a significantly increased sensitivity to acidic stress. The NIΔyejE and NIΔyejABEF mutants were also more sensitive than B. melitensis NI to polymyxin B, and the expression of yej operon genes was induced by polymyxin B. Moreover, cell and mouse infection assays indicated that NIΔyejE and NIΔyejABEF have restricted invasion and replication abilities inside macrophages and are rapidly cleared from the spleens of infected mice. These findings indicate that the ABC transporter YejABEF is required for the virulence of Brucella, suggesting that resistance to host antimicrobials is a key mechanism for Brucella to persistently survive in vivo. This study provided insights that led us to further investigate the potential correlation of AMP resistance with the mechanisms of immune escape and persistent infection by pathogens.

  17. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  18. Hijacking membrane transporters for arsenic phytoextraction

    PubMed Central

    LeBlanc, Melissa S.; McKinney, Elizabeth C.; Meagher, Richard B.; Smith, Aaron P.

    2012-01-01

    Arsenic is a toxic metalloid and recognized carcinogen. Arsenate and arsenite are the most common arsenic species available for uptake by plants. As an inorganic phosphate (Pi) analog, arsenate is acquired by plant roots through endogenous Pi transport systems. Inside the cell, arsenate is reduced to the thiol-reactive form arsenite. Glutathione (GSH)-conjugates of arsenite may be extruded from the cell or sequestered in vacuoles by members of the ATP-binding cassette (ABC) family of transporters. In the present study we sought to enhance both plant arsenic uptake through Pi transporter overexpression, and plant arsenic tolerance through ABC transporter overexpression. We demonstrate that Arabidopsis thaliana plants overexpressing the high-affinity Pi transporter family members, AtPht1;1 or AtPht1;7, are hypersensitive to arsenate due to increased arsenate uptake. These plants do not exhibit increased sensitivity to arsenite. Co-overexpression of the yeast ABC transporter YCF1 in combination with AtPht1;1 or AtPht1;7 suppresses the arsenate-sensitive phenotype while further enhancing arsenic uptake. Taken together, our results support an arsenic transport mechanism in which arsenate uptake is increased through Pi transporter overexpression, and arsenic tolerance is enhanced through YCF1-mediated vacuolar sequestration. This work substantiates the viability of coupling enhanced uptake and vacuolar sequestration as a means for developing a prototypical engineered arsenic hyperaccumulator. PMID:23108027

  19. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  20. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  1. Conformational plasticity of the type I maltose ABC importer.

    PubMed

    Böhm, Simon; Licht, Anke; Wuttge, Steven; Schneider, Erwin; Bordignon, Enrica

    2013-04-02

    ATP-binding cassette (ABC) transporters couple the translocation of solutes across membranes to ATP hydrolysis. Crystal structures of the Escherichia coli maltose importer (MalFGK2) in complex with its substrate binding protein (MalE) provided unprecedented insights in the mechanism of substrate translocation, leaving the MalE-transporter interactions still poorly understood. Using pulsed EPR and cross-linking methods we investigated the effects of maltose and MalE on complex formation and correlated motions of the MalK2 nucleotide-binding domains (NBDs). We found that both substrate-free (open) and liganded (closed) MalE interact with the transporter with similar affinity in all nucleotide states. In the apo-state, binding of open MalE occurs via the N-lobe, leaving the C-lobe disordered, but upon maltose binding, closed MalE associates tighter to the transporter. In both cases the NBDs remain open. In the presence of ATP, the transporter binds both substrate-free and liganded MalE, both inducing the outward-facing conformation trapped in the crystal with open MalE at the periplasmic side and NBDs tightly closed. In contrast to ATP, ADP-Mg(2+) alone is sufficient to induce a semiopen conformation in the NBDs. In this nucleotide-driven state, the transporter binds both open and closed MalE with slightly different periplasmic configurations. We also found that dissociation of MalE is not a required step for substrate translocation since a supercomplex with MalE cross-linked to MalG retains the ability to hydrolyze ATP and to transport maltose. These features of MalE-MalFGK2 interactions highlight the conformational plasticity of the maltose importer, providing insights into the ATPase stimulation by unliganded MalE.

  2. Vibrio cholerae NspS, a homologue of ABC-type periplasmic solute binding proteins, facilitates transduction of polyamine signals independent of their transport

    PubMed Central

    Cockerell, Steven R.; Rutkovsky, Alex C.; Zayner, Josiah P.; Cooper, Rebecca E.; Porter, Lindsay R.; Pendergraft, Sam S.; Parker, Zach M.; McGinnis, Marcus W.

    2014-01-01

    The polyamines norspermidine and spermidine are among the environmental signals that regulate Vibrio cholerae biofilm formation. The effects of these polyamines are mediated by NspS, a member of the bacterial periplasmic solute binding protein superfamily. Almost all members of this superfamily characterized to date are components of ATP-binding cassette-type transporters involved in nutrient uptake. Consequently, in the current annotation of the V. cholerae genome, NspS has been assigned a function in transport. The objective of this study was to further characterize NspS and investigate its potential role in transport. Our results support a role for NspS in signal transduction in response to norspermidine and spermidine, but not their transport. In addition, we provide evidence that these polyamine signals are processed by c-di-GMP signalling networks in the cell. Furthermore, we present comparative genomics analyses which reveal the presence of NspS-like proteins in a variety of bacteria, suggesting that periplasmic ligand binding proteins may be widely utilized for sensory transduction. PMID:24530989

  3. An ABC transporter, OsABCG26, is required for anther cuticle and pollen exine formation and pollen-pistil interactions in rice.

    PubMed

    Chang, Zhenyi; Chen, Zhufeng; Yan, Wei; Xie, Gang; Lu, Jiawei; Wang, Na; Lu, Qiqing; Yao, Nan; Yang, Guangzhe; Xia, Jixing; Tang, Xiaoyan

    2016-12-01

    Wax, cutin and sporopollenin are essential components for the formation of the anther cuticle and the pollen exine, respectively. Their lipid precursors are synthesized by secretory tapetal cells and transported to the anther and microspore surface for deposition. However, the molecular mechanisms involved in the formation of the anther cuticle and pollen exine are poorly understood in rice. Here, we characterized a rice male sterile mutant osabcg26. Molecular cloning and sequence analysis revealed a point mutation in the gene encoding an ATP binding cassette transporter G26 (OsABCG26). OsABCG26 was specifically expressed in the anther and pistil. Cytological analysis revealed defects in tapetal cells, lipidic Ubisch bodies, pollen exine, and anther cuticle in the osabcg26 mutant. Expression of some key genes involved in lipid metabolism and transport, such as UDT1, WDA1, CYP704B2, OsABCG15, OsC4 and OsC6, was significantly altered in osabcg26 anther, possibly due to a disturbance in the homeostasis of anther lipid metabolism and transport. Additionally, wild-type pollen tubes showed a growth defect in osabcg26 pistils, leading to low seed setting in osabcg26 cross-pollinated with the wild-type pollen. These results indicated that OsABCG26 plays an important role in anther cuticle and pollen exine formation and pollen-pistil interactions in rice.

  4. Carbohydrate kinase (RhaK)-dependent ABC transport of rhamnose in Rhizobium leguminosarum demonstrates genetic separation of kinase and transport activities.

    PubMed

    Rivers, Damien; Oresnik, Ivan J

    2013-08-01

    In Rhizobium leguminosarum the ABC transporter responsible for rhamnose transport is dependent on RhaK, a sugar kinase that is necessary for the catabolism of rhamnose. This has led to a working hypothesis that RhaK has two biochemical functions: phosphorylation of its substrate and affecting the activity of the rhamnose ABC transporter. To address this hypothesis, a linker-scanning random mutagenesis of rhaK was carried out. Thirty-nine linker-scanning mutations were generated and mapped. Alleles were then systematically tested for their ability to physiologically complement kinase and transport activity in a strain carrying an rhaK mutation. The rhaK alleles generated could be divided into three classes: mutations that did not affect either kinase or transport activity, mutations that eliminated both transport and kinase activity, and mutations that affected transport activity but not kinase activity. Two genes of the last class (rhaK72 and rhaK73) were found to have similar biochemical phenotypes but manifested different physiological phenotypes. Whereas rhaK72 conferred a slow-growth phenotype when used to complement rhaK mutants, the rhaK73 allele did not complement the inability to use rhamnose as a sole carbon source. To provide insight to how these insertional variants might be affecting rhamnose transport and catabolism, structural models of RhaK were generated based on the crystal structure of related sugar kinases. Structural modeling suggests that both rhaK72 and rhaK73 affect surface-exposed residues in two distinct regions that are found on one face of the protein, suggesting that this protein's face may play a role in protein-protein interaction that affects rhamnose transport.

  5. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  6. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis

    PubMed Central

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S.; Bilalis, Dimitrios

    2016-01-01

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha−1) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance. PMID:27104532

  7. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis.

    PubMed

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S; Bilalis, Dimitrios

    2016-04-20

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha(-1)) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance.

  8. Phytosterols reduce cholesterol absorption by inhibition of 27-hydroxycholesterol generation, liver X receptor α activation, and expression of the basolateral sterol exporter ATP-binding cassette A1 in Caco-2 enterocytes.

    PubMed

    Brauner, Reinhard; Johannes, Christian; Ploessl, Florian; Bracher, Franz; Lorenz, Reinhard L

    2012-06-01

    Phytosterol-enriched foods are increasingly marketed to lower cholesterol levels and atherosclerosis in the general population. Phytosterols reduce cholesterol absorption, but the molecular mechanism is controversial. We therefore investigated the phytosterol effects on cholesterol metabolism in human enterocyte, hepatocyte, and macrophage models relevant for sterol absorption, reverse transport, and excretion. Isomolar sitosterol (50 μmol/L) was less effectively taken up by enterocytes than cholesterol but suppressed apical cholesterol uptake by 50% (P < 0.01) and basolateral secretion by two-thirds (P < 0.01) whether added in micelles or ethanol or complexed to cyclodextrin. In contrast, enterocytes handled nanomolar (3)H-sitosterol similarly to cholesterol. Enterocytes selectively oxidized all sterols to 27-hydroxy- and 27-carboxy-sterols. Conversion rates were much lower for sitosterol (0.05 ± 0.02 nmol/mg protein) and campesterol (0.48 ± 0.10) compared with cholesterol (3.73 ± 0.60) (P < 0.001). 27-Hydroxycholesterol (27OH-C) activated liver-X-receptor alpha (LXRα) (P < 0.01) and stimulated ATP-binding cassette transporter (ABC) A1 expression (P < 0.001) and basolateral systemic cholesterol secretion from enterocytes (P < 0.05). In co-incubations, phytosterols inhibited 27OH-C generation by sterol 27-hydroxylase (P < 0.001) and reduced LXRα-mediated ABCA1 expression (P < 0.01) and basolateral systemic cholesterol secretion. In contrast, ABCG8 transcription and apical sterol resecretion was unchanged by LXRα activation in human enterocytes. Exogenous LXRα agonists reverted sterol selectivity and phytosterol cholesterol interaction. Due to constitutive apical expression of ABCG5/G8 and LXRα-enhanced basolateral expression of ABCA1 in enterocytes, interference of phytosterols with the generation of the dominating LXRα-agonist 27OH-C blocks the self-priming component of cholesterol absorption. This local LXRα antagonism of dietary phytosterols

  9. Transporters in human platelets: physiologic function and impact for pharmacotherapy.

    PubMed

    Jedlitschky, Gabriele; Greinacher, Andreas; Kroemer, Heyo K

    2012-04-12

    Platelets store signaling molecules (eg, serotonin and ADP) within their granules. Transporters mediate accumulation of these molecules in platelet granules and, on platelet activation, their translocation across the plasma membrane. The balance between transporter-mediated uptake and elimination of signaling molecules and drugs in platelets determines their intracellular concentrations and effects. Several members of the 2 major transporter families, ATP-binding cassette (ABC) transporters and solute carriers (SLCs), have been identified in platelets. An example of an ABC transporter is MRP4 (ABCC4), which facilitates ADP accumulation in dense granules. MRP4 is a versatile transporter, and various additional functions have been proposed, notably lipid mediator release and a role in aspirin resistance. Several other ABC proteins have been detected in platelets with functions in glutathione and lipid homeostasis. The serotonin transporter (SERT, SLC6A4) in the platelet plasma membrane represents a well-characterized example of the SLC family. Moreover, recent experiments indicate expression of OATP2B1 (SLCO2B1), a high affinity transporter for certain statins, in platelets. Changes in transporter localization and expression can affect platelet function and drug sensitivity. This review summarizes available data on the physiologic and pharmacologic role of transporters in platelets.

  10. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  11. The expression of superoxide dismutase (SOD) and a putative ABC transporter permease is inversely correlated during biofilm formation in Listeria monocytogenes 4b G

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Little is known about the molecular basis of biofilm formation in Listeria monocytogenes. The superoxide dismutase (SOD) of the deletion mutant of lm.G_1771 gene, which encodes for a putative ABC_transporter permease, is highly expressed in biofilm. In this study, the sod gene deletion mutant delta ...

  12. Essential letters in the fungal alphabet: ABC and MFS transporters and their roles in survival and pathogenicity.

    PubMed

    Perlin, Michael H; Andrews, Jared; Toh, Su San

    2014-01-01

    Fungi depend heavily on their ability to exploit resources that may become available to them in their myriad of possible lifestyles. Whether this requires simple uptake of sugars as saprobes or competition for host-derived carbohydrates or peptides, fungi must rely on transporters that effectively allow the fungus to accumulate such nutrients from their environments. In other cases, fungi secrete compounds that facilitate their interactions with potential hosts and/or neutralize their competition. Finally, fungi that find themselves on the receiving end of insults, from hosts, competitors, or the overall environment are better served if they can get rid of such toxins or xenobiotics. In this chapter, we update studies on the most ubiquitous transporters, the ABC and MFS superfamilies. In addition, we discuss the importance of subsets of these proteins with particular relevance to plant pathogenic fungi. The availability of ever-increasing numbers of sequenced fungal genomes, combined with high-throughput methods for transcriptome analysis, provides insights previously inaccessible prior to the -omics era. As examples of such broader perspectives, we point to revelations about exploitive use of sugar transporters by plant pathogens, expansion of trichothecene efflux pumps in fungi that do not produce these mycotoxins, and the discovery of a fungal-specific oligopeptide transporter class that, so far, is overrepresented in the plant pathogenic fungi.

  13. The calcium channel blockers, 1,4-dihydropyridines, are substrates of the multidrug resistance-linked ABC drug transporter, ABCG2.

    PubMed

    Shukla, Suneet; Robey, Robert W; Bates, Susan E; Ambudkar, Suresh V

    2006-07-25

    The human ATP-binding cassette transporter, ABCG2, confers resistance to multiple chemotherapeutic agents and also affects the bioavailability of different drugs. [(125)I]Iodoarylazidoprazosin (IAAP) and [(3)H]azidopine were used for photoaffinity labeling of ABCG2 in this study. We show here for the first time that both of these photoaffinity analogues are transport substrates for ABCG2 and that [(3)H]azidopine can also be used to photolabel both wild-type R482-ABCG2 and mutant T482-ABCG2. We further used these assays to screen for potential substrates or modulators of ABCG2 and observed that 1,4-dihydropyridines such as nicardipine and nifedipine, which are clinically used as antihypertensive agents, inhibited the photolabeling of ABCG2 with [(125)I]IAAP and [(3)H]azidopine as well as the transport of these photoaffinity analogues by ABCG2. Furthermore, [(3)H]nitrendipine and bodipy-Fl-dihydropyridine accumulation assays showed that these compounds are transported by ABCG2. These dihydropyridines also inhibited the efflux of the known ABCG2 substrates, mitoxantrone and pheophorbide-a, from ABCG2-overexpressing cells, and nicardipine was more potent in inhibiting this transport. Both nicardipine and nifedipine stimulated the ATPase activity of ABCG2, and the nifedipine-stimulated activity was inhibited by fumitremorgin C, suggesting that these agents might interact at the same site on the transporter. In addition, nontoxic concentrations of dihydropyridines increased the sensitivity of ABCG2-expressing cells to mitoxantrone by 3-5-fold. In aggregate, results from the photoaffinity labeling and efflux assays using [(125)I]IAAP and [(3)H]azidopine demonstrate that 1,4-dihydropyridines are substrates of ABCG2 and that these photolabels can be used to screen new substrates and/or inhibitors of this transporter.

  14. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  15. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  16. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  17. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  18. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  19. Phase 0 and phase III transport in various organs: combined concept of phases in xenobiotic transport and metabolism.

    PubMed

    Döring, Barbara; Petzinger, Ernst

    2014-08-01

    The historical phasing concept of drug metabolism and elimination was introduced to comprise the two phases of metabolism: phase I metabolism for oxidations, reductions and hydrolyses, and phase II metabolism for synthesis. With this concept, biological membrane barriers obstructing the accessibility of metabolism sites in the cells for drugs were not considered. The concept of two phases was extended to a concept of four phases when drug transporters were detected that guided drugs and drug metabolites in and out of the cells. In particular, water soluble or charged drugs are virtually not able to overcome the phospholipid membrane barrier. Drug transporters belong to two main clusters of transporter families: the solute carrier (SLC) families and the ATP binding cassette (ABC) carriers. The ABC transporters comprise seven families with about 20 carriers involved in drug transport. All of them operate as pumps at the expense of ATP splitting. Embedded in the former phase concept, the term "phase III" was introduced by Ishikawa in 1992 for drug export by ABC efflux pumps. SLC comprise 52 families, from which many carriers are drug uptake transporters. Later on, this uptake process was referred to as the "phase 0 transport" of drugs. Transporters for xenobiotics in man and animal are most expressed in liver, but they are also present in extra-hepatic tissues such as in the kidney, the adrenal gland and lung. This review deals with the function of drug carriers in various organs and their impact on drug metabolism and elimination.

  20. Role of ABCB1, ABCG2, ABCC2 and ABCC5 transporters in placental passage of zidovudine.

    PubMed

    Neumanova, Zuzana; Cerveny, Lukas; Ceckova, Martina; Staud, Frantisek

    2016-01-01

    Zidovudine (AZT) is one of the most frequently used antiretroviral drugs in prevention of perinatal transmission of HIV. However, safety concerns on AZT use in pregnancy still persist as severe side effects are associated with AZT exposure in children. In our study we aimed to contribute to current knowledge on AZT transplacental transport and to evaluate potential involvement of the main human drug efflux ATP-binding cassette (ABC) transporters, p-glycoprotein (ABCB1), breast cancer resistance protein (ABCG2) and multidrug resistance-associated proteins 2 and 5 (ABCC2 and ABCC5) in the disposition of AZT between mother and fetus. In order to elucidate this issue we investigated the effect of selected ABC transporters on AZT transepithelial transport across MDCKII cell monolayers. In addition we used the in situ method of dually perfused rat term placenta to further study the role of ABC transporters in AZT transplacental transport. In vitro studies revealed significant effect of ABCB1 and ABCG2 on AZT transport which was subsequently confirmed also on organ level. Lamivudine, an antiretroviral agent commonly co-administered with AZT, did not affect ABC transporter-mediated AZT transfer.

  1. YehZYXW of Escherichia coli Is a Low-Affinity, Non-Osmoregulatory Betaine-Specific ABC Transporter.

    PubMed

    Lang, Shenhui; Cressatti, Marisa; Mendoza, Kris E; Coumoundouros, Chelsea N; Plater, Samantha M; Culham, Doreen E; Kimber, Matthew S; Wood, Janet M

    2015-09-22

    Transporter-mediated osmolyte accumulation stimulates the growth of Escherichia coli in high-osmolality environments. YehZYXW was predicted to be an osmoregulatory transporter because (1) osmotic and stationary phase induction of yehZYXW is mediated by RpoS, (2) the Yeh proteins are homologous to the components of known osmoregulatory ABC transporters (e.g., ProU of E. coli), and (3) YehZ models based on the structures of periplasmic betaine-binding proteins suggested that YehZ retains key betaine-binding residues. The betaines choline-O-sulfate, glycine betaine, and dimethylsulfoniopropionate bound YehZ and ProX with millimolar and micromolar affinities, respectively, as determined by equilibrium dialysis and isothermal titration calorimetry. The crystal structure of the YehZ apoprotein, determined at 1.5 Å resolution (PDB ID: 4WEP ), confirmed its similarity to other betaine-binding proteins. Small and nonpolar residues in the hinge region of YehZ (e.g., Gly223) pack more closely than the corresponding residues in ProX, stabilizing the apoprotein. Betaines bound YehZ-Gly223Ser an order of magnitude more tightly than YehZ, suggesting that weak substrate binding in YehZ is at least partially due to apo state stabilization. Neither ProX nor YehZ bound proline. Assays based on osmoprotection or proline auxotrophy failed to detect YehZYXW-mediated uptake of proline, betaines, or other osmolytes. However, transport assays revealed low-affinity glycine betaine uptake, mediated by YehZYXW, that was inhibited at high salinity. Thus, YehZYXW is a betaine transporter that shares substrate specificity, but not an osmoregulatory function, with homologues like E. coli ProU. Other work suggests that yehZYXW may be an antivirulence locus whose expression promotes persistent, asymptomatic bacterial infection.

  2. An Arabidopsis ABC Transporter Mediates Phosphate Deficiency-Induced Remodeling of Root Architecture by Modulating Iron Homeostasis in Roots.

    PubMed

    Dong, Jinsong; Piñeros, Miguel A; Li, Xiaoxuan; Yang, Haibing; Liu, Yu; Murphy, Angus S; Kochian, Leon V; Liu, Dong

    2017-02-13

    The remodeling of root architecture is a major developmental response of plants to phosphate (Pi) deficiency and is thought to enhance a plant's ability to forage for the available Pi in topsoil. The underlying mechanism controlling this response, however, is poorly understood. In this study, we identified an Arabidopsis mutant, hps10 (hypersensitive to Pi starvation 10), which is morphologically normal under Pi sufficient condition but shows increased inhibition of primary root growth and enhanced production of lateral roots under Pi deficiency. hps10 is a previously identified allele (als3-3) of the ALUMINUM SENSITIVE3 (ALS3) gene, which is involved in plant tolerance to aluminum toxicity. Our results show that ALS3 and its interacting protein AtSTAR1 form an ABC transporter complex in the tonoplast. This protein complex mediates a highly electrogenic transport in Xenopus oocytes. Under Pi deficiency, als3 accumulates higher levels of Fe(3+) in its roots than the wild type does. In Arabidopsis, LPR1 (LOW PHOSPHATE ROOT1) and LPR2 encode ferroxidases, which when mutated, reduce Fe(3+) accumulation in roots and cause root growth to be insensitive to Pi deficiency. Here, we provide compelling evidence showing that ALS3 cooperates with LPR1/2 to regulate Pi deficiency-induced remodeling of root architecture by modulating Fe homeostasis in roots.

  3. ABC transporters, CYP1A and GSTα gene transcription patterns in developing stages of the Nile tilapia (Oreochromis niloticus).

    PubMed

    Costa, Joana; Reis-Henriques, Maria Armanda; Castro, L Filipe C; Ferreira, Marta

    2012-09-15

    In fish, some ABC transporters are implicated in a multixenobiotic resistance (MXR) mechanism to deal with the presence of xenobiotics, by effluxing them, or their metabolites, from inside the cells. These efflux transporters have been considered an integral part of cellular detoxification pathways, acting in coordination with phase I and II detoxification enzymes. However, the full characterization of this detoxification system is still incomplete, especially during the developmental stages of aquatic organisms, which are particularly sensitive periods to the presence of anthropogenic contamination. The goal of this study was to evaluate the mRNA expression dynamics of putatively important MXR proteins (ABCB1b, ABCB11, ABCC1, ABCC2 and ABCG2a) and phase I (CYP1A) and II (GSTα) biotransformation enzymes, during the embryonic and larval developments of the specie Oreochromis niloticus (Nile tilapia). Our results showed that ABCB1b, ABCC1, CYP1A and GSTα transcripts are maternally transmitted. Transcripts for ABCB11, ABCC2 and ABCG2a were only detected after the pharyngula period, which precedes a highly sensitive stage in the embryonic development, the hatching. This study has shown, for the first time, very distinct expression patterns of genes encoding for proteins involved in protection mechanisms against pollutants during the development of Nile tilapia. Moreover, the temporal pattern of gene expression suggests that increased intrinsic protection levels are required at specific developmental stages.

  4. The ABC transporter ATR1 is necessary for efflux of the toxin cercosporin in the fungus Cercospora nicotianae.

    PubMed

    Amnuaykanjanasin, Alongkorn; Daub, Margaret E

    2009-02-01

    The Cercospora nicotianae mutant deficient for the CRG1 transcription factor has marked reductions in both resistance and biosynthesis of the toxin cercosporin. We cloned and sequenced full-length copies of two genes, ATR1 and CnCFP, previously identified from a subtractive library between the wild type (WT) and a crg1 mutant. ATR1 is an ABC transporter gene and has an open reading frame (ORF) of 4368bp with one intron. CnCFP encodes a MFS transporter with homology to Cercospora kikuchii CFP, previously implicated in cercosporin export, and has an ORF of 1975bp with three introns. Disruption of ATR1 indicated atr1-null mutants had dramatic reductions in cercosporin production (25% and 20% of WT levels) in solid and liquid cultures, respectively. The ATR1 disruptants also showed moderately higher sensitivity to cercosporin. Constitutive expression of ATR1 in the crg1 mutant restored cercosporin biosynthesis and moderately increased resistance. In contrast, CnCFP overexpression in the mutant did not restore toxin production, however, it moderately enhanced toxin resistance. The results together indicate ATR1 acts as a cercosporin efflux pump in this fungus and plays a partial role in resistance.

  5. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  6. ABC transporters P-gp and Bcrp do not limit the brain uptake of the novel antipsychotic and anticonvulsant drug cannabidiol in mice

    PubMed Central

    Brzozowska, Natalia; Li, Kong M.; Wang, Xiao Suo; Booth, Jessica; Stuart, Jordyn; McGregor, Iain S.

    2016-01-01

    Cannabidiol (CBD) is currently being investigated as a novel therapeutic for the treatment of CNS disorders like schizophrenia and epilepsy. ABC transporters such as P-glycoprotein (P-gp) and breast cancer resistance protein (Bcrp) mediate pharmacoresistance in these disorders. P-gp and Bcrp are expressed at the blood brain barrier (BBB) and reduce the brain uptake of substrate drugs including various antipsychotics and anticonvulsants. It is therefore important to assess whether CBD is prone to treatment resistance mediated by P-gp and Bcrp. Moreover, it has become common practice in the drug development of CNS agents to screen against ABC transporters to help isolate lead compounds with optimal pharmacokinetic properties. The current study aimed to assess whether P-gp and Bcrp impacts the brain transport of CBD by comparing CBD tissue concentrations in wild-type (WT) mice versus mice devoid of ABC transporter genes. P-gp knockout (Abcb1a/b−∕−), Bcrp knockout (Abcg2−∕−), combined P-gp/Bcrp knockout (Abcb1a/b−∕−Abcg2−∕−) and WT mice were injected with CBD, before brain and plasma samples were collected at various time-points. CBD results were compared with the positive control risperidone and 9-hydroxy risperidone, antipsychotic drugs that are established ABC transporter substrates. Brain and plasma concentrations of CBD were not greater in P-gp, Bcrp or P-gp/Bcrp knockout mice than WT mice. In comparison, the brain/plasma concentration ratios of risperidone and 9-hydroxy risperidone were profoundly higher in P-gp knockout mice than WT mice. These results suggest that CBD is not a substrate of P-gp or Bcrp and may be free from the complication of reduced brain uptake by these transporters. Such findings provide favorable evidence for the therapeutic development of CBD in the treatment of various CNS disorders. PMID:27257556

  7. Catalytic Mechanism of the Maltose Transporter Hydrolyzing ATP.

    PubMed

    Huang, Wenting; Liao, Jie-Lou

    2016-01-12

    We use quantum mechanical and molecular mechanical (QM/MM) simulations to study ATP hydrolysis catalyzed by the maltose transporter. This protein is a prototypical member of a large family that consists of ATP-binding cassette (ABC) transporters. The ABC proteins catalyze ATP hydrolysis to perform a variety of biological functions. Despite extensive research efforts, the precise molecular mechanism of ATP hydrolysis catalyzed by the ABC enzymes remains elusive. In this work, the reaction pathway for ATP hydrolysis in the maltose transporter is evaluated using a QM/MM implementation of the nudged elastic band method without presuming reaction coordinates. The potential of mean force along the reaction pathway is obtained with an activation free energy of 19.2 kcal/mol in agreement with experiments. The results demonstrate that the reaction proceeds via a dissociative-like pathway with a trigonal bipyramidal transition state in which the cleavage of the γ-phosphate P-O bond occurs and the O-H bond of the lytic water molecule is not yet broken. Our calculations clearly show that the Walker B glutamate as well as the switch histidine stabilizes the transition state via electrostatic interactions rather than serving as a catalytic base. The results are consistent with biochemical and structural experiments, providing novel insight into the molecular mechanism of ATP hydrolysis in the ABC proteins.

  8. Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6).

    PubMed

    Iliás, Attila; Urbán, Zsolt; Seidl, Thomas L; Le Saux, Olivier; Sinkó, Emese; Boyd, Charles D; Sarkadi, Balázs; Váradi, András

    2002-05-10

    Mutations in the ABCC6 (MRP6) gene cause pseudoxanthoma elasticum (PXE), a rare heritable disorder resulting in the calcification of elastic fibers. In the present study a cDNA encoding a full-length normal variant of ABCC6 was amplified from a human kidney cDNA library, and the protein was expressed in Sf9 insect cells. In isolated membranes ATP binding as well as ATP-dependent active transport by ABCC6 was demonstrated. We found that glutathione conjugates, including leukotriene C(4) and N-ethylmaleimide S-glutathione (NEM-GS), were actively transported by human ABCC6. Organic anions (probenecid, benzbromarone, indomethacin), known to interfere with glutathione conjugate transport of human ABCC1 and ABCC2, inhibited the ABCC6-mediated NEM-GS transport in a specific manner, indicating that ABCC6 has a unique substrate specificity. We have also expressed three missense mutant forms of ABCC6, which have recently been shown to cause PXE. MgATP binding was normal in these proteins; ATP-dependent NEM-GS or leukotriene C(4) transport, however, was abolished. Our data indicate that human ABCC6 is a primary active transporter for organic anions. In the three ABCC6 mutant forms examined, the loss of transport activity suggests that these mutations result in a PXE phenotype through a direct influence on the transport activity of this ABC transporter.

  9. Lyme Disease-Causing Borrelia Species Encode Multiple Lipoproteins Homologous to Peptide-Binding Proteins of ABC-Type Transporters

    PubMed Central

    Kornacki, Jon A.; Oliver, Donald B.

    1998-01-01

    To identify cell envelope proteins of Borrelia burgdorferi, the causative agent of Lyme disease, we constructed a library of B. burgdorferi genes fused to the Escherichia coli phoA gene, which expresses enzymatically active alkaline phosphatase. One such gene, oppA-1, encodes a predicted polypeptide with significant similarities to various peptide-binding proteins of ABC-type transporters. Immediately downstream of oppA-1 are two genes, oppA-2 and oppA-3, whose predicted polypeptide products show strong similarities in their amino acid sequences to OppA-1, including a sequence that resembles the most highly conserved region in peptide-binding proteins. By labeling with [3H]palmitate, OppA-1, OppA-2, and OppA-3 were shown to be lipoproteins. DNA hybridization analysis showed that the oppA-1 oppA-2 oppA-3 region is located on the linear chromosome of B. burgdorferi, and the genes are conserved among different Borrelia species that cause Lyme disease (B. burgdorferi, B. garinii, and B. afzelli), suggesting that all three homologous genes are important to the maintenance of Lyme disease spirochetes in one or more of their hosts. PMID:9712756

  10. Development, Maintenance, and Reversal of Multiple Drug Resistance: At the Crossroads of TFPI1, ABC Transporters, and HIF1α

    PubMed Central

    Arnason, Terra; Harkness, Troy

    2015-01-01

    Early detection and improved therapies for many cancers are enhancing survival rates. Although many cytotoxic therapies are approved for aggressive or metastatic cancer; response rates are low and acquisition of de novo resistance is virtually universal. For decades; chemotherapeutic treatments for cancer have included anthracyclines such as Doxorubicin (DOX); and its use in aggressive tumors appears to remain a viable option; but drug resistance arises against DOX; as for all other classes of compounds. Our recent work suggests the anticoagulant protein Tissue Factor Pathway Inhibitor 1α (TFPI1α) plays a role in driving the development of multiple drug resistance (MDR); but not maintenance; of the MDR state. Other factors; such as the ABC transporter drug efflux pumps MDR-1/P-gp (ABCB1) and BCRP (ABCG2); are required for MDR maintenance; as well as development. The patient population struggling with therapeutic resistance specifically requires novel treatment options to resensitize these tumor cells to therapy. In this review we discuss the development, maintenance, and reversal of MDR as three distinct phases of cancer biology. Possible means to exploit these stages to reverse MDR will be explored. Early molecular detection of MDR cancers before clinical failure has the potential to offer new approaches to fighting MDR cancer. PMID:26501324

  11. Efflux in the Oral Metagenome: The Discovery of a Novel Tetracycline and Tigecycline ABC Transporter

    PubMed Central

    Reynolds, Liam J.; Roberts, Adam P.; Anjum, Muna F.

    2016-01-01

    Antibiotic resistance in human bacterial pathogens and commensals is threatening our ability to treat infections and conduct common medical procedures. As novel antibiotics are discovered and marketed it is important that we understand how resistance to them may arise and know what environments may act as reservoirs for such resistance genes. In this study a tetracycline and tigecycline resistant clone was identified by screening a human saliva metagenomic library in Escherichia coli EPI300 on agar containing 5 μg/ml tetracycline. Sequencing of the DNA insert present within the tetracycline resistant clone revealed it to contain a 7,765 bp fragment harboring novel ABC half transporter genes, tetAB(60). Mutagenesis studies performed on these genes confirmed that they were responsible for the tetracycline and tigecycline resistance phenotypes. Growth studies performed using E. coli EPI300 clones that harbored either the wild type, the mutated, or none of these genes indicated that there was a fitness cost associated with presence of these genes, with the isolate harboring both genes exhibiting a significantly slower growth than control strains. Given the emergence of E. coli strains that are sensitive only to tigecycline and doxycycline it is concerning that such a resistance mechanism has been identified in the human oral cavity. PMID:27999567

  12. Inactivation of the ABC transporter ATPase gene in Brucella abortus strain 2308 attenuated the virulence of the bacteria.

    PubMed

    Zhang, Min; Han, Xiangan; Liu, Haiwen; Tian, Mingxing; Ding, Chan; Song, Jun; Sun, Xiaoqing; Liu, Zongping; Yu, Shengqing

    2013-06-28

    Brucella abortus is a Gram-negative, facultative intracellular bacterial pathogen of human and other animals. Brucella lipopolysaccharide has been identified as an important virulence factor. In this study, the ABC transporter ATPase gene (BAB1_0542) of B. abortus strain S2308 was inactivated by deleting a 446-bp fragment from the gene, thereby generating the mutant strain, S2308ΔATP. Real time PCR analysis confirmed the inactivation of this gene with no polar effect on the transcription of adjacent genes on the chromosome. The mutant was identified as a rough phenotype strain using heat agglutination test and crystal violet staining. The mutant strain had a different growth rate in Tryptic Soy Broth (TSB), compared to the wild type S2308 strain. Moreover, the mutant strain showed attenuated virulence in vitro and in vivo in RAW264.7 macrophages and Balb/c mice, respectively. Complementation of the mutant strain recovered the smooth phenotype of the bacteria and the complemented strain C2308ΔATP survived for more than four weeks in Balb/c mice, comparable to wild type strain S2308. Furthermore, immunization with the mutant strain protected mice from virulent strain challenge, which suggests the potential for the mutant strain S2308ΔATP as a future vaccine candidate. MHC I, MHC II and co-stimulatory molecule expression levels in mice following infection of S2308ΔATP and S2308 were also investigated.

  13. A novel gene amplification causes upregulation of the PatAB ABC transporter and fluoroquinolone resistance in Streptococcus pneumoniae.

    PubMed

    Baylay, Alison J; Ivens, Alasdair; Piddock, Laura J V

    2015-01-01

    Overexpression of the ABC transporter genes patA and patB confers efflux-mediated fluoroquinolone resistance in Streptococcus pneumoniae and is also linked to pneumococcal stress responses. Although upregulation of patAB has been observed in many laboratory mutants and clinical isolates, the regulatory mechanisms controlling expression of these genes are unknown. In this study, we aimed to identify the cause of high-level constitutive overexpression of patAB in M184, a multidrug-resistant mutant of S. pneumoniae R6. Using a whole-genome transformation and sequencing approach, we identified a novel duplication of a 9.2-kb region of the M184 genome which included the patAB genes. This duplication did not affect growth and was semistable with a low segregation rate. The expression levels of patAB in M184 were much higher than those that could be fully explained by doubling of the gene dosage alone, and inactivation of the first copy of patA had no effect on multidrug resistance. Using a green fluorescent protein reporter system, increased patAB expression was ascribed to transcriptional read-through from a tRNA gene upstream of the second copy of patAB. This is the first report of a large genomic duplication causing antibiotic resistance in S. pneumoniae and also of a genomic duplication causing antibiotic resistance by a promoter switching mechanism.

  14. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management.

    PubMed

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-09-03

    Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management.

  15. Development, Maintenance, and Reversal of Multiple Drug Resistance: At the Crossroads of TFPI1, ABC Transporters, and HIF1.

    PubMed

    Arnason, Terra; Harkness, Troy

    2015-10-16

    Early detection and improved therapies for many cancers are enhancing survival rates. Although many cytotoxic therapies are approved for aggressive or metastatic cancer; response rates are low and acquisition of de novo resistance is virtually universal. For decades; chemotherapeutic treatments for cancer have included anthracyclines such as Doxorubicin (DOX); and its use in aggressive tumors appears to remain a viable option; but drug resistance arises against DOX; as for all other classes of compounds. Our recent work suggests the anticoagulant protein Tissue Factor Pathway Inhibitor 1α (TFPI1α) plays a role in driving the development of multiple drug resistance (MDR); but not maintenance; of the MDR state. Other factors; such as the ABC transporter drug efflux pumps MDR-1/P-gp (ABCB1) and BCRP (ABCG2); are required for MDR maintenance; as well as development. The patient population struggling with therapeutic resistance specifically requires novel treatment options to resensitize these tumor cells to therapy. In this review we discuss the development, maintenance, and reversal of MDR as three distinct phases of cancer biology. Possible means to exploit these stages to reverse MDR will be explored. Early molecular detection of MDRcancers before clinical failure has the potential to offer new approaches to fightingMDRcancer.

  16. Crystal structure of the phosphate-binding protein (PBP-1) of an ABC-type phosphate transporter from Clostridium perfringens

    PubMed Central

    Gonzalez, Daniel; Richez, Magali; Bergonzi, Celine; Chabriere, Eric; Elias, Mikael

    2014-01-01

    Phosphate limitation is an important environmental stress that affects the metabolism of various organisms and, in particular, can trigger the virulence of numerous bacterial pathogens. Clostridium perfringens, a human pathogen, is one of the most common causes of enteritis necroticans, gas gangrene and food poisoning. Here, we focused on the high affinity phosphate-binding protein (PBP-1) of an ABC-type transporter, responsible for cellular phosphate uptake. We report the crystal structure (1.65 Å resolution) of the protein in complex with phosphate. Interestingly, PBP-1 does not form the short, low-barrier hydrogen bond with phosphate that is typical of previously characterized phosphate-binding proteins, but rather a canonical hydrogen bond. In its unique binding configuration, PBP-1 forms an unusually high number of hydrogen bonds (14) with the phosphate anion. Discrimination experiments reveal that PBP-1 is the least selective PBP characterised so far and is able to discriminate phosphate from its close competing anion, arsenate, by ~150-fold. PMID:25338617

  17. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management

    PubMed Central

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-01-01

    Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management. PMID:26333918

  18. An Arabidopsis thaliana ABC transporter that confers kanamycin resistance in transgenic plants does not endow resistance to Escherichia coli.

    PubMed

    Burris, Kellie; Mentewab, Ayalew; Ripp, Steven; Stewart, C Neal

    2008-03-01

    Concerns have been raised about potential horizontal gene transfer (HGT) of antibiotic resistance markers (ARMs) from transgenic plants to bacteria of medical and environmental importance. All ARMs used in transgenic plants have been bacterial in origin, but it has been recently shown that an Arabidopsis thaliana ABC transporter, Atwbc19, confers kanamycin resistance when overexpressed in transgenic plants. Atwbc19 was evaluated for its ability to transfer kanamycin resistance to Escherichia coli, a kanamycin-sensitive model bacterium, under simulated HGT, staged by subcloning Atwbc19 under the control of a bacterial promoter, genetically transforming to kanamycin-sensitive bacteria, and assessing if resistance was conferred as compared with bacteria harbouring nptII, the standard kanamycin resistance gene used to produce transgenic plants. NptII provided much greater resistance than Atwbc19 and was significantly different from the no-plasmid control at low concentrations. Atwbc19 was not significantly different from the no-plasmid control at higher concentrations. Even though HGT risks are considered low with nptII, Atwbc19 should have even lower risks, as its encoded protein is possibly mistargeted in bacteria.

  19. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  20. Identification of ABC transporter genes in gonad tissue of two Mediterranean sea urchin species: black, Arbacia lixula L., and rocky, Paracentrotus lividus L.

    PubMed

    Bošnjak, Ivana; Zaja, Roko; Klobučar, Roberta Sauerborn; Šver, Lidija; Franekić, Jasna; Smital, Tvrtko

    2013-10-01

    Multixenobiotic resistance (MXR) represents an important cellular detoxification mechanism in aquatic organisms as it provides them robustness toward natural and man-made contaminants. Several ABC transporters have major roles in the MXR phenotype - P-gp/ABCB1, MRP1-3/ABCC1-3 and BCRP/ABCG2. In this study, we identified the presence of ABC transporters involved in the MXR mechanism of Arbacia lixula and Paracentrotus lividus. AlABCB1/P-gp, AlABCC3/MRP3, AlABCC9/SUR-like and AlABCG-like transcripts were identified in A. lixula; and PlABCC1/P-gp, PlABCC3/MRP3, PlABCC5/MRP5, and PlABCC9/SUR-like transcripts in P. lividus. For each of the new partial sequences, we performed detailed phylogenetic and identity analysis as a first step toward full characterization and understanding of the ecotoxicological role of these ABC transporters.

  1. ABC AND SLC TRANSPORTER EXPRESSION AND POT SUBSTRATE CHRACTERIZATION ACROSS THE HUMAN CMEC/D3 BLOOD-BRAIN BARRIER CELL LINE

    PubMed Central

    Carl, Stephen M.; Lindley, David J.; Couraud, Pierre O.; Weksler, Babette B.; Romero, Ignacio; Mowery, Stephanie A.; Knipp, Gregory T.

    2010-01-01

    Purpose Initial studies indicate that the newly developed hCMEC/D3 cell line may prove to be a useful model for studying the physiology of the human blood-brain barrier (BBB) endothelium. The purpose of this study was to assess the mRNA expression of several ABC and SLC transporters, with an emphasis on the Proton-Coupled Oligopeptide Transporter Superfamily (POT) transporters in this immortalized BBB cell model. The transport kinetics of POT-substrates was also evaluated. Methods The hCMEC/D3 cell line was maintained in a modified EGM-2 medium in collagenated culture flasks and passaged every 3–4 days at approximately 85%–95% confluence. Messenger RNA (mRNA) expression of a variety of ABC and SLC transporters was evaluated using qRT-PCR arrays, while additional qRT-PCR primers were designed to assess the expression of POT members. The transport kinetics of mannitol and urea were utilized to quantitatively estimate the intercellular pore radius, while POT substrate transport was also determined to assess the suitability of the cell model from a drug screening perspective. Optimization of the cell line was attempted by culturing with on laminin and fibronectin enhanced collagen and in the presence of excess Ca2+. Results HCMEC/D3 cells express both hPHT1 and hPHT2, while litt