Science.gov

Sample records for abca1 atp-binding cassette

  1. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  2. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  3. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  4. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  5. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  6. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  7. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  8. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  9. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  10. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  11. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  12. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  13. The effects of ABCG5/G8 polymorphisms on HDL-cholesterol concentrations depend on ABCA1 genetic variants in the Boston Puerto Rican health study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background and aims: ATP-binding cassette transporters G5/G8 (ABCG5/G8) are associated with HDL-C concentrations. To assess whether the effect of ABCG5/G8 genetic variants on HDL-C concentrations is dependent on ATP-binding cassette transporters A1 (ABCA1), we studied potential interactions between ...

  14. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  15. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  16. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  17. Optimization of Rutaecarpine as ABCA1 Up-Regulator for Treating Atherosclerosis

    PubMed Central

    2014-01-01

    ATP-binding cassette transporter A1 (ABCA1) is a key transporter and receptor in promoting cholesterol efflux, and increasing the expression level of ABCA1 is antiatherogenic. In our previous study, rutaecarpine (RUT) was found to protect ApoE–/– mice from developing atherosclerosis through preferentially up-regulating ABCA1 expression. In the present work, a series of RUT derivatives were synthesized and examined as ABCA1 expression up-regulators. Compounds CD1, CD6, and BCD1–2 were found to possess the most potential activity as antiatherosclerotic agents among all compounds tested. PMID:25147608

  18. The effect of ABCG5/G8 polymorphisms on plasma HDL cholesterol levels depends on the ABCA1 gene variation in the Boston Puerto Rican Health Study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: ATP-binding cassette transporters G5/G8 have shown an association with HDL-C. One of the most likely mechanisms to explain those associations is through ABCA1. Objective: To assess whether the effect of ABCG5/G8 polymorphisms on HDL-C is dependent on ABCA1, we studied potential interacti...

  19. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  20. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  1. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  2. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  3. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  4. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  5. Quercetin up-regulates expressions of peroxisome proliferator-activated receptor γ, liver X receptor α, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.

    PubMed

    Lee, Seung-Min; Moon, Jiyoung; Cho, Yoonsu; Chung, Ji Hyung; Shin, Min-Jeong

    2013-02-01

    Cholesterol-laden macrophages trigger accumulation of foam cells and increase the risk of developing atherosclerosis. We hypothesized that quercetin could lower the content of cholesterol in macrophages by regulating the expression of the ATP binding cassette transporter A1 (ABCA1) gene in differentiated human acute monocyte leukemia cell line (THP-1) cells and thereby reducing the chance of forming foam cells. Quercetin, in concentrations up to 30 μM, was not cytotoxic to differentiated THP-1 cells. Quercetin up-regulated both ABCA1 messenger RNA and protein expression in differentiated THP-1 cells, and its maximum effects were demonstrated at 0.3 μM for 4 to 8 hours in incubation. In addition, quercetin increased protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) within 2 hours of treatment. Because PPARγ and LXRα are important transcriptional factors for ABCA1, quercetin-induced up-regulation of ABCA1 may be mediated by increased expression levels of the PPARγ and LXRα genes. Furthermore, quercetin-enhanced cholesterol efflux from differentiated THP-1 cells to both high-density lipoprotein (HDL) and apolipoprotein A1. Quercetin at the dose of 0.15 μM elevated the cholesterol efflux only for HDL. At the dose of 0.3 μM, quercetin demonstrated effects both on HDL and apolipoprotein A1. Our data demonstrated that quercetin increased the expressions of PPARγ, LXRα, and ABCA1 genes and cholesterol efflux from THP-1 macrophages. Quercetin-induced expression of PPARγ and LXRα might subsequently affect up-regulation of their target gene ABCA1. Taken together, ingestion of quercetin or quercetin-rich foods could be an effective way to improve cholesterol efflux from macrophages, which would contribute to lowering the risk of atherosclerosis.

  6. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na

    2016-01-01

    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through the modulation of miR-33 and ABCA1-mediated cholesterol efflux from macrophages. The results showed that treatment of the statins up-regulated miR-33 expression, but down-regulated ABCA1 mRNA levels in RAW264.7 cells and bone marrow-derived macrophages. Statin-mediated ABCA1 regulation occurs at the post-transcriptional level through targeting of the 3′-UTR of the ABCA1 transcript by miR-33. Additionally, we found significant down-regulation of ABCA1 protein expression in macrophages treated with statins. Finally, we showed that high glucose and statin treatment significantly suppressed cholesterol efflux from macrophages. These findings have highlighted the complexity of statins, which may exert detrimental effects on metabolic abnormalities through regulation of miR-33 target genes. PMID:27139226

  7. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  8. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  9. Association of ABCA1 with syntaxin 13 and flotillin-1 and enhanced phagocytosis in tangier cells.

    PubMed

    Bared, Salim Maa; Buechler, Christa; Boettcher, Alfred; Dayoub, Rania; Sigruener, Alexander; Grandl, Margot; Rudolph, Christian; Dada, Ashraf; Schmitz, Gerd

    2004-12-01

    The ATP-binding cassette transporter A1 (ABCA1) facilitates the cellular release of cholesterol and choline-phospholipids to apolipoprotein A-I (apoA-I) and several studies indicate that vesicular transport is associated with ABCA1 function. Syntaxins play a major role in vesicular fusion and have also been demonstrated to interact with members of the ABC-transporter family. Therefore, we focused on the identification of syntaxins that directly interact with ABCA1. The expression of syntaxins and ABCA1 in cultured human monocytes during M-CSF differentiation and cholesterol loading was investigated and syntaxins 3, 6, and 13 were found induced in foam cells together with ABCA1. Immunoprecipitation experiments revealed a direct association of syntaxin 13 and full-length ABCA1, whereas syntaxin 3 and 6 failed to interact with ABCA1. The colocalization of ABCA1 and syntaxin 13 was also shown by immunofluorescence microscopy. Silencing of syntaxin 13 by small interfering RNA (siRNA) led to reduced ABCA1 protein levels and hence to a significant decrease in apoA-I-dependent choline-phospholipid efflux. ABCA1 is localized in Lubrol WX-insoluble raft microdomains in macrophages and syntaxin 13 and flotillin-1 were also detected in these detergent resistant microdomains along with ABCA1. Syntaxin 13, flotillin-1, and ABCA1 were identified as phagosomal proteins, indicating the involvement of the phagosomal compartment in ABCA1-mediated lipid efflux. In addition, the uptake of latex phagobeads by fibroblasts with mutated ABCA1 was enhanced when compared with control cells and the recombinant expression of functional ABCA1 normalized the phagocytosis rate in Tangier fibroblasts. It is concluded that ABCA1 forms a complex with syntaxin 13 and flotillin-1, residing at the plasma membrane and in phagosomes that are partially located in raft microdomains.

  10. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  11. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  12. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  13. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  14. The role of ATP binding cassette transporters in tissue defense and organ regeneration.

    PubMed

    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde

    2009-01-01

    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  15. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  16. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  17. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  18. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  19. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  20. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  1. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  2. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  3. Lysine residues of ABCA1 are required for the interaction with apoA-I.

    PubMed

    Nagao, Kohjiro; Kimura, Yasuhisa; Ueda, Kazumitsu

    2012-03-01

    ATP-binding cassette protein A1 (ABCA1) plays a pivotal role in cholesterol homeostasis by generating high-density lipoprotein (HDL). Apolipoprotein A-I (apoA-I), a lipid acceptor for ABCA1, reportedly interacts with ABCA1. However, it has also been proposed that apoA-I interacts with ABCA1-generated special domains on the plasma membrane, but apart from ABCA1, and solubilizes membrane lipids. To determine the importance of the apoA-I-ABCA1 interaction in HDL formation, the electrostatic interaction between apoA-I and ABCA1, which mediates the interaction between apoB100 in low-density lipoprotein particles (LDL) and LDL receptor, was analyzed. The apoA-I binding to ABCA1 and the cross-linking between them were inhibited by the highly charged molecules heparin and poly-L-lysine. Treating cells with membrane impermeable reagents that specifically react with primary amino groups abolished the interaction between apoA-I and ABCA1. However, these reagents did not affect the characteristic tight ATP binding to ABCA1. These results suggest that lysine residues in the extracellular domains of ABCA1 contribute to the interaction with apoA-I. The electrostatic interaction between ABCA1 and apoA-I is predicted to be the first step in HDL formation. This article is part of a Special Issue entitled Advances in high density lipoprotein formation and metabolism: a tribute to John F. Oram (1945-2010).

  4. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  5. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  6. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  7. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  8. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-05-07

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have therefore investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies therefore reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages. This article is protected by copyright. All rights reserved.

  9. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-09-01

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have, therefore, investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies, therefore, reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages.

  10. Cholesterol transport via ABCA1: new insights from solid-phase binding assay.

    PubMed

    Reboul, Emmanuelle; Dyka, Frank M; Quazi, Faraz; Molday, Robert S

    2013-04-01

    It is now well established that the ATP-binding cassette transporter A1 (ABCA1) plays a pivotal role in HDL metabolism, reverse cholesterol transport and net efflux of cellular cholesterol and phospholipids. We aimed to resolve some uncertainties related to the putative function of ABCA1 as a mediator of lipid transport by using a methodology developed in the laboratory to isolate a protein and study its interactions with other compounds. ABCA1 was tagged with the 1D4 peptide at the C terminus and expressed in human HEK 293 cells. Preliminary experiments showed that the tag modified neither the protein expression/localization within the cells nor the ability of ABCA1 to promote cholesterol cellular efflux to apolipoprotein A-I. ABCA1-1D4 was then purified and reconstituted in liposomes. ABCA1 displayed an ATPase activity in phospholipid liposomes that was significantly decreased by cholesterol. Finally, interactions with either cholesterol or apolipoprotein A-I were assessed by binding experiments with protein immobilized on an immunoaffinity matrix. Solid-phase binding assays showed no direct binding of cholesterol or apolipoprotein A-I to ABCA1. Overall, our data support the hypothesis that ABCA1 is able to mediate the transport of cholesterol from cells without direct interaction and that apo A-I primarily binds to membrane surface or accessory protein(s).

  11. Differential regulation of ABCA1 and macrophage cholesterol efflux by elaidic and oleic acids.

    PubMed

    Shao, Fei; Ford, David A

    2013-08-01

    Trans fatty acid consumption is associated with an increased risk of coronary heart disease. This increased risk has been attributed to decreased levels of HDL cholesterol and increased levels of LDL cholesterol. However, the mechanism by which trans fatty acid modulates cholesterol transit remains poorly defined. ATP-binding cassette transporter A1 (ABCA1)-mediated macrophage cholesterol efflux is the rate-limiting step initiating apolipoprotein A-I lipidation. In this study, elaidic acid, the most abundant trans fatty acid in partially hydrogenated vegetable oil, was shown to stabilize macrophage ABCA1 protein levels in comparison to that of its cis fatty acid isomer, oleic acid. The mechanism responsible for the disparate effects of oleic and elaidic acid on ABCA1 levels was through accelerated ABCA1 protein degradation in cells treated with oleic acid. In contrast, no apparent differences were observed in ABCA1 mRNA levels, and only minor changes were observed in Liver X receptor/Retinoic X receptor promoter activity in cells treated with elaidic and oleic acid. Efflux of both tracers and cholesterol mass revealed that elaidic acid slightly increased ABCA1-mediated cholesterol efflux, while oleic acid led to decreased ABCA1-mediated efflux. In conclusion, these studies show that cis and trans structural differences in 18 carbon n-9 monoenoic fatty acids variably impact cholesterol efflux through disparate effects on ABCA1 protein degradation.

  12. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  13. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  14. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  15. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  16. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  17. Ligand, receptor, and cell type-dependent regulation of ABCA1 and ABCG1 mRNA in prostate cancer epithelial cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent evidence suggests that the liver X receptor (LXR) is a potential anti-cancer target in prostate carcinoma. There is little characterization, however, of how the two major isoforms LXRa or LXRß regulate the LXR-responsive genes ATP-binding cassette sub-family A 1 (ABCA1) and sub-family member ...

  18. Piperine inhibits ABCA1 degradation and promotes cholesterol efflux from THP-1-derived macrophages

    PubMed Central

    Wang, Limei; Palme, Veronika; Rotter, Susanne; Schilcher, Nicole; Cukaj, Malsor; Wang, Dongdong; Ladurner, Angela; Heiss, Elke H.; Stangl, Herbert; Dirsch, Verena M.; Atanasov, Atanas G.

    2017-01-01

    Scope Increased macrophage cholesterol efflux (ChE) is considered to have anti-atherosclerotic effect counteracting cardiovascular disease. The principle pungent ingredient of the fruits of Piper nigrum, piperine, is identified in this study as a ChE inducer in THP-1-derived macrophages, and mechanisms underlying this effect are explored. Methods and results Without affecting cell viability, piperine concentration-dependently enhances ChE in THP-1-derived macrophages from 25 to 100 μM. The expression level of the key cholesterol transporter protein ATP-binding cassette transporter A1 (ABCA1) is significantly upregulated by piperine, as revealed by western blot analyses. However, two other ChE-mediating transporter proteins, ATP-binding cassette transporter G1 (ABCG1) and scavenger receptor class B member 1 (SR-B1), remain unaffected. Piperine exerts no influence on ABCA1 mRNA levels, but significantly inhibits the degradation of ABCA1, as evident by an increased half-life of the protein in the presence of cycloheximide. Furthermore, it is found that piperine likely interferes with the calpain-mediated ABCA1 degradation pathway and exhibits significant inhibition of calpain activity. Conclusion Our findings suggest that piperine promotes ChE in THP-1-derived macrophages by upregulation of ABCA1, which might be mediated by inhibition of calpain activity. This novel bioactivity makes the dietary constituent piperine a good candidate to be further explored for therapeutic or preventive applications in the context of atherosclerosis. PMID:27862930

  19. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.

    PubMed

    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da

    2013-02-01

    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  20. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  1. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  2. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  3. ABCA1 Deficiency Affects Basal Cognitive Deficits and Dendritic Density in Mice

    PubMed Central

    Fitz, Nicholas F.; Carter, Alexis Y.; Tapias, Victor; Castranio, Emilie L.; Kodali, Ravindra; Lefterov, Iliya; Koldamova, Radosveta

    2017-01-01

    ATP-binding cassette transporter A1 (ABCA1) mediates cholesterol efflux to lipid-free apolipoproteins and regulates the generation of high density lipoproteins. Previously, we have shown that lack of Abca1 significantly increases amyloid deposition and cognitive deficits in Alzheimer’s disease model mice expressing human amyloid-β protein precursor (APP). The goal of this study was to determine if ABCA1 plays a role in memory deficits caused by amyloid-β (Aβ) oligomers and examine neurite architecture of pyramidal hippocampal neurons. Our results confirm previous findings that Abca1 deficiency significantly impairs spatial memory acquisition and retention in the Morris water maze and long-term memory in novel object recognition of APP transgenic mice at a stage of early amyloid pathology. Neither test demonstrated a significant difference between Abca1ko and wild-type (WT) mice. We also examined the effect of intra-hippocampal infused Aβ oligomers on cognitive performance of Abca1ko mice, compared to control infusion of scrambled Aβ peptide. Age-matched WT mice undergoing the same infusions were also used as controls. In this model system, we found a statistically significant difference between WT and Abca1ko mice infused with scrambled Aβ, suggesting that Abca1ko mice are vulnerable to the effect of mild stresses. Moreover, examination of neurite architecture in the hippocampi revealed a significant decrease in neurite length, number of neurite segments, and branches in Abca1ko mice when compared to WT mice. We conclude that mice lacking ABCA1 have basal cognitive deficits that prevent them from coping with additional stressors, which is in part due to impairment of neurite morphology in the hippocampus. PMID:28106559

  4. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  5. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  6. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  7. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  8. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  9. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  10. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  11. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  12. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  13. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  14. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  15. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  16. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  17. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  18. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  19. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  20. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  1. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  2. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  3. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  4. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  5. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  6. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  7. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  8. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  9. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  10. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  11. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.

    PubMed

    Han, B; Zhang, J-T

    2004-01-01

    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  12. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  13. Functional rescue of mutant ABCA1 proteins by sodium 4-phenylbutyrate[S

    PubMed Central

    Sorrenson, Brie; Suetani, Rachel J.; Williams, Michael J. A.; Bickley, Vivienne M.; George, Peter M.; Jones, Gregory T.; McCormick, Sally P. A.

    2013-01-01

    Mutations in the ATP-binding cassette transporter A1 (ABCA1) are a major cause of decreased HDL cholesterol (HDL-C), which infers an increased risk of cardiovascular disease (CVD). Many ABCA1 mutants show impaired localization to the plasma membrane. The aim of this study was to investigate whether the chemical chaperone, sodium 4-phenylbutyrate (4-PBA) could improve cellular localization and function of ABCA1 mutants. Nine different ABCA1 mutants (p.A594T, p.I659V, p.R1068H, p.T1512M, p.Y1767D, p.N1800H, p.R2004K, p.A2028V, p.Q2239N) expressed in HEK293 cells, displaying different degrees of mislocalization to the plasma membrane and discrete impacts on cholesterol efflux, were subject to treatment with 4-PBA. Treatment restored localization to the plasma membrane and increased cholesterol efflux function for the majority of mutants. Treatment with 4-PBA also increased ABCA1 protein expression in all transfected cell lines. In fibroblast cells obtained from low HDL-C subjects expressing two of the ABCA1 mutants (p.R1068H and p.N1800H), 4-PBA increased cholesterol efflux without any increase in ABCA1 expression. Our study is the first to investigate the effect of the chemical chaperone, 4-PBA on ABCA1 and shows that it is capable of restoring plasma membrane localization and enhancing the cholesterol efflux function of mutant ABCA1s both in vitro and ex vivo. These results suggest 4-PBA may warrant further investigation as a potential therapy for increasing cholesterol efflux and HDL-C levels. PMID:23087442

  14. An ABCA1 truncation shows no dominant negative effect in a familial hypoalphalipoproteinemia pedigree with three ABCA1 mutations

    SciTech Connect

    Sorrenson, Brie; Suetani, Rachel J.; Bickley, Vivienne M.; George, Peter M.; Williams, Michael J.A.; Scott, Russell S.; McCormick, Sally P.A.

    2011-06-10

    Highlights: {yields} Characterisation of an ABCA1 truncation mutant, C978fsX988, in a pedigree with three ABCA1 mutations. {yields} Functional analysis of C978fsX988 in patient fibroblasts and HEK 293 cells shows no cholesterol efflux function. {yields} Allele-specific quantification shows C978fsX988 not expressed at mRNA level in fibroblasts. {yields} Unlike other ABCA1 truncations, C978fsX988 mutant shows no dominant negative effect at mRNA or protein level. -- Abstract: The ATP binding cassette transporter (ABCA1) A1 is a key determinant of circulating high density lipoprotein cholesterol (HDL-C) levels. Mutations in ABCA1 are a major genetic contributor to low HDL-C levels within the general population. Following the finding of three different ABCA1 mutations, p.C978fsX988, p.T1512M and p.N1800H in a subject with hypoalphalipoproteinemia, we aimed to establish whether the p.C978fsX988 truncation exerted a dominant negative effect on the full-length ABCA1 alleles within family members as has been reported for other ABCA1 truncations. Characterisation of the p.C978fsX988 mutant in transfected HEK 293 cells showed it to be expressed as a GFP fusion protein but lacking in cholesterol efflux function. This was in keeping with results from cholesterol efflux assays in the fibroblasts of p.C978fsX988 carriers which also showed impaired efflux. Allele- specific quantification of p.C978fsX988 mRNA and analysis of ABCA1 protein levels in the fibroblasts of p.C978fsX988 heterozygotes showed negligible levels of mRNA and protein expression. There was no evidence of a dominant negative effect on wildtype or p.N1800H protein levels. We conclude that in the case of the p.C978fsX988 truncated mutant a lack of expression precludes it from having a dominant negative effect.

  15. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  16. Genetic variants in ABCA1 promoter affect transcription activity and plasma HDL level in pigs.

    PubMed

    Dang, Xiao-yong; Chu, Wei-wei; Shi, Heng-chuan; Yu, Shi-gang; Han, Hai-yin; Gu, Shu-Hua; Chen, Jie

    2015-01-25

    Excess accumulation of cholesterol in plasma may result in coronary artery disease. Numerous studies have demonstrated that ATP-binding cassette protein A1 (ABCA1) mediates the efflux of cholesterol and phospholipids to apolipoproteins, a process necessary for plasma high density lipoprotein (HDL) formation. Higher plasma levels of HDL are associated with lower risk for cardiovascular disease. Studies of human disease and animal models had shown that an increased hepatic ABCA1 activity relates to an enhanced plasma HDL level. In this study, we hypothesized that functional mutations in the ABCA1 promoter in pigs may affect gene transcription activity, and consequently the HDL level in plasma. The promoter region of ABCA1 was comparatively scanned by direct sequencing with pool DNA of high- and low-HDL groups (n=30 for each group). Two polymorphisms, c. - 608A>G and c. - 418T>A, were revealed with reverse allele distribution in the two groups. The two polymorphisms were completely linked and formed only G-A or A-T haplotypes when genotyped in a larger population (n=526). Furthermore, we found that the G-A/G-A genotype was associated with higher HDL and ABCA1 mRNA level than A-T/A-T genotype. Luciferase assay also revealed that G-A haplotype promoter had higher activity than A-T haplotype. Single-nucleotide mutant assay showed that c.-418T>A was the causal mutation for ABCA1 transcription activity alteration. Conclusively, we identified two completely linked SNPs in porcine ABCA1 promoter region which have influence on the plasma HDL level by altering ABCA1 gene transcriptional activity.

  17. miR-758 regulates cholesterol efflux through post-transcriptional repression of ABCA1

    PubMed Central

    Ramirez, Cristina M.; Dávalos, Alberto; Goedeke, Leigh; Salerno, Alessandro G.; Warrier, Nikhil; Cirera-Salinas, Daniel; Suárez, Yajaira; Fernández-Hernando, Carlos

    2012-01-01

    Objective The ATP-binding cassette transporter A1 (ABCA1) is a major regulator of macrophage cholesterol efflux and protects cells from excess intracellular cholesterol accumulation, however the mechanism involved in posttranscriptional regulation of ABCA1 is poorly understood. We previously showed miR-33 was one regulator. Here we investigated the potential contribution of other microRNAs (miRNAs) to post-transcriptionally regulate ABCA1 and macrophage cholesterol efflux. Methods and Results We performed a bioinformatic analaysis for identifying miRNA target prediction sites in ABCA1 gene and an unbiased genome-wide screen to identify miRNAs modulated by cholesterol excess in mouse peritoneal macrophages. Quantitative real-time RT-PCR confirmed that miR-758 is repressed in cholesterol-loaded macrophages. Under physiological conditions, high dietary fat excess in mice repressed mir-758 both in peritoneal macrophages and, to a lesser extent in the liver. In mouse and human cells in vitro, miR-758 repressed the expression of ABCA1 and conversely the inhibition of this miRNA by using anti-miR-758 increased ABCA1 expression. In mouse cells, mir-758 reduced cellular cholesterol efflux to apoA1 and anti-miR-758 increased it. miR-758 directly targets the 3′UTR of Abca1 as assessed by 3′UTR luciferase reporter assays. Interestingly, miR-758 is highly expressed in the brain where also target several genes involved in neurological functions including SLC38A1, NTM, EPHA7 and MYT1L. Conclusion We identified miR-758 as a novel miRNA that post-transcriptionally controls ABCA1 levels in different cells and regulates macrophage cellular cholesterol efflux to apoA1, opening new avenues to increase apoA1 and raise HDL levels. PMID:21885853

  18. Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2011-01-01

    Background Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0

  19. Urotensin II increases foam cell formation by repressing ABCA1 expression through the ERK/NF-κB pathway in THP-1 macrophages

    SciTech Connect

    Wang, Yan; Wu, Jian-Feng; Tang, Yan-Yan; Zhang, Min; Li, Yuan; Chen, Kong; Zeng, Meng-Ya; Yao, Feng; Xie, Wei; Zheng, Xi-Long; Zeng, Gao-Feng; Tang, Chao-Ke

    2014-10-03

    Highlights: • U II reduces cholesterol efflux in THP-1 macrophages. • U II decreases the expression of ABCA1. • Inhibition of the ERK/NF-κB pathway reduces U II effects on ABCA1 expression and cholesterol efflux. - Abstract: Objective: Foam cell formation in the arterial wall plays a key role in the development of atherosclerosis. Recent studies showed that Urotensin II (U II) is involved in the pathogenesis of atherosclerosis. Here we examined the effects of human U II on ATP-binding cassette transporter A1 (ABCA1) expression and the underlying mechanism in THP-1 macrophages. Methods and results: Cultured THP-1 macrophages were treated with U II, followed by measuring the intracellular lipid contents, cholesterol efflux and ABCA1 levels. The results showed that U II dramatically decreased ABCA1 levels and impaired cholesterol efflux. However, the effects of U II on ABCA1 protein expression and cellular cholesterol efflux were partially reversed by inhibition of extracellular signal regulated kinase 1/2 (ERK1/2) and nuclear factor kappa B (NF-κB) activity, suggesting the potential roles of ERK1/2 and NF-κB in ABCA1 expression, respectively. Conclusion: Our current data indicate that U II may have promoting effects on the progression of atherosclerosis, likely through suppressing ABCA1 expression via activation of the ERK/NF-κB pathway and reducing cholesterol efflux to promote macrophage foam cell formation.

  20. Phytosterols reduce cholesterol absorption by inhibition of 27-hydroxycholesterol generation, liver X receptor α activation, and expression of the basolateral sterol exporter ATP-binding cassette A1 in Caco-2 enterocytes.

    PubMed

    Brauner, Reinhard; Johannes, Christian; Ploessl, Florian; Bracher, Franz; Lorenz, Reinhard L

    2012-06-01

    Phytosterol-enriched foods are increasingly marketed to lower cholesterol levels and atherosclerosis in the general population. Phytosterols reduce cholesterol absorption, but the molecular mechanism is controversial. We therefore investigated the phytosterol effects on cholesterol metabolism in human enterocyte, hepatocyte, and macrophage models relevant for sterol absorption, reverse transport, and excretion. Isomolar sitosterol (50 μmol/L) was less effectively taken up by enterocytes than cholesterol but suppressed apical cholesterol uptake by 50% (P < 0.01) and basolateral secretion by two-thirds (P < 0.01) whether added in micelles or ethanol or complexed to cyclodextrin. In contrast, enterocytes handled nanomolar (3)H-sitosterol similarly to cholesterol. Enterocytes selectively oxidized all sterols to 27-hydroxy- and 27-carboxy-sterols. Conversion rates were much lower for sitosterol (0.05 ± 0.02 nmol/mg protein) and campesterol (0.48 ± 0.10) compared with cholesterol (3.73 ± 0.60) (P < 0.001). 27-Hydroxycholesterol (27OH-C) activated liver-X-receptor alpha (LXRα) (P < 0.01) and stimulated ATP-binding cassette transporter (ABC) A1 expression (P < 0.001) and basolateral systemic cholesterol secretion from enterocytes (P < 0.05). In co-incubations, phytosterols inhibited 27OH-C generation by sterol 27-hydroxylase (P < 0.001) and reduced LXRα-mediated ABCA1 expression (P < 0.01) and basolateral systemic cholesterol secretion. In contrast, ABCG8 transcription and apical sterol resecretion was unchanged by LXRα activation in human enterocytes. Exogenous LXRα agonists reverted sterol selectivity and phytosterol cholesterol interaction. Due to constitutive apical expression of ABCG5/G8 and LXRα-enhanced basolateral expression of ABCA1 in enterocytes, interference of phytosterols with the generation of the dominating LXRα-agonist 27OH-C blocks the self-priming component of cholesterol absorption. This local LXRα antagonism of dietary phytosterols

  1. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  2. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  3. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  4. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  5. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  6. Acetylsalicylic acid, aging and coronary artery disease are associated with ABCA1 DNA methylation in men

    PubMed Central

    2014-01-01

    Background Previous studies have suggested that DNA methylation contributes to coronary artery disease (CAD) risk variability. DNA hypermethylation at the ATP-binding cassette transporter A1 (ABCA1) gene, an important modulator of high-density lipoprotein cholesterol and reverse cholesterol transport, has been previously associated with plasma lipid levels, aging and CAD, but the association with CAD has yet to be replicated. Results ABCA1 DNA methylation levels were measured in leucocytes of 88 men using bis-pyrosequencing. We first showed that DNA methylation at the ABCA1 gene promoter locus is associated with aging and CAD occurrence in men (P < 0.05). The latter association is stronger among older men with CAD (≥61 years old; n = 19), who showed at least 4.7% higher ABCA1 DNA methylation levels as compared to younger men with CAD (<61 years old; n = 19) or men without CAD (n = 50; P < 0.001). Higher ABCA1 DNA methylation levels in older men were also associated with higher total cholesterol (r = 0.34, P = 0.03), low-density lipoprotein cholesterol (r = 0.32, P = 0.04) and triglyceride levels (r = 0.26, P = 0.09). Furthermore, we showed that acetylsalicylic acid therapy is associated with 3.6% lower ABCA1 DNA methylation levels (P = 0.006), independent of aging and CAD status of patients. Conclusions This study provides new evidence that the ABCA1 epigenetic profile is associated with CAD and aging, and highlights that epigenetic modifications might be a significant molecular mechanism involved in the pathophysiological processes associated with CAD. Acetylsalicylic acid treatment for CAD prevention might involve epigenetic mechanisms. PMID:25093045

  7. Proteomic Analysis of ABCA1-Null Macrophages Reveals a Role for Stomatin-Like Protein-2 in Raft Composition and Toll-Like Receptor Signaling*

    PubMed Central

    Chowdhury, Saiful M.; Zhu, Xuewei; Aloor, Jim J.; Azzam, Kathleen M.; Gabor, Kristin A.; Ge, William; Addo, Kezia A.; Tomer, Kenneth B.; Parks, John S.; Fessler, Michael B.

    2015-01-01

    Lipid raft membrane microdomains organize signaling by many prototypical receptors, including the Toll-like receptors (TLRs) of the innate immune system. Raft-localization of proteins is widely thought to be regulated by raft cholesterol levels, but this is largely on the basis of studies that have manipulated cell cholesterol using crude and poorly specific chemical tools, such as β-cyclodextrins. To date, there has been no proteome-scale investigation of whether endogenous regulators of intracellular cholesterol trafficking, such as the ATP binding cassette (ABC)A1 lipid efflux transporter, regulate targeting of proteins to rafts. Abca1−/− macrophages have cholesterol-laden rafts that have been reported to contain increased levels of select proteins, including TLR4, the lipopolysaccharide receptor. Here, using quantitative proteomic profiling, we identified 383 proteins in raft isolates from Abca1+/+ and Abca1−/− macrophages. ABCA1 deletion induced wide-ranging changes to the raft proteome. Remarkably, many of these changes were similar to those seen in Abca1+/+ macrophages after lipopolysaccharide exposure. Stomatin-like protein (SLP)-2, a member of the stomatin-prohibitin-flotillin-HflK/C family of membrane scaffolding proteins, was robustly and specifically increased in Abca1−/− rafts. Pursuing SLP-2 function, we found that rafts of SLP-2-silenced macrophages had markedly abnormal composition. SLP-2 silencing did not compromise ABCA1-dependent cholesterol efflux but reduced macrophage responsiveness to multiple TLR ligands. This was associated with reduced raft levels of the TLR co-receptor, CD14, and defective lipopolysaccharide-induced recruitment of the common TLR adaptor, MyD88, to rafts. Taken together, we show that the lipid transporter ABCA1 regulates the protein repertoire of rafts and identify SLP-2 as an ABCA1-dependent regulator of raft composition and of the innate immune response. PMID:25910759

  8. ABCA1 gene variants regulate postprandial lipid metabolism in healthy men

    PubMed Central

    Delgado-Lista, Javier; Perez-Martinez, Pablo; Perez-Jimenez, Francisco; Garcia-Rios, Antonio; Fuentes, Francisco; Marin, Carmen; Gómez-Luna, Purificación; Camargo, Antonio; Parnell, Laurence D; Ordovas, Jose Maria; Lopez-Miranda, Jose

    2010-01-01

    Objective Genetic variants of ABCA1, an ATP-binding cassette (ABC) transporter, have been linked to altered atherosclerosis progression and fasting lipid concentration, mainly high density lipoproteins (HDL) and Apolipoprotein A1 (APOA1), but results from different studies have been inconsistent. Methods and results In order to further characterize the effects of ABCA1 variants in human postprandial lipid metabolism, we studied the influence of three single nucleotide polymorphisms (SNPs) [i27943 (rs2575875); i48168 (rs4149272); R219K (rs2230806)] in the postprandial lipemia of 88 normolipidemic young men, who were given a fatty meal. For i27943 and i48168 SNPs, fasting and postprandial values of APOA1 were higher, and postprandial lipemia was much lower in homozygotes for the major alleles, for total triglycerides in plasma, and large-triglyceride rich lipoproteins (TRL) triglycerides. These persons also showed higher APOA1/APOB ratio. Major allele homozygotes for i48168 and i27943 showed additionally higher HDL and lower postprandial Apolipoprotein B (ApoB). Conclusions Our work shows that major allele homozygotes for ABCA1 SNPs i27943 and i48168 have a lower postprandial response as compared to minor allele carriers. This finding may further characterize the role of ABCA1 in lipid metabolism. PMID:20185793

  9. Quercetin-3-O-glucuronide induces ABCA1 expression by LXRα activation in murine macrophages

    SciTech Connect

    Ohara, Kazuaki; Wakabayashi, Hideyuki; Taniguchi, Yoshimasa; Shindo, Kazutoshi; Yajima, Hiroaki; Yoshida, Aruto

    2013-11-29

    Highlights: •The major circulating quercetin metabolite (Q3GA) activated LXRα. •Q3GA induced ABCA1 via LXRα activation in macrophages. •Nelumbo nucifera leaf extracts contained quercetin glycosides. •N. nucifera leaf extract feeding elevated HDLC in mice. -- Abstract: Reverse cholesterol transport (RCT) removes excess cholesterol from macrophages to prevent atherosclerosis. ATP-binding cassette, subfamily A, member 1 (ABCA1) is a crucial cholesterol transporter involved in RCT to produce high density lipoprotein-cholesterol (HDLC), and is transcriptionally regulated by liver X receptor alpha (LXRα), a nuclear receptor. Quercetin is a widely distributed flavonoid in edible plants which prevented atherosclerosis in an animal model. We found that quercetin-3-O-glucuronide (Q3GA), a major quercetin metabolite after absorption from the digestive tract, enhanced ABCA1 expression, in vitro, via LXRα in macrophages. In addition, leaf extracts of a traditional Asian edible plant, Nelumbo nucifera (NNE), which contained abundant amounts of quercetin glycosides, significantly elevated plasma HDLC in mice. We are the first to present experimental evidence that Q3GA induced ABCA1 in macrophages, and to provide an alternative explanation to previous studies on arteriosclerosis prevention by quercetin.

  10. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  11. Expression and Biological Activity of ABCA1 in Alveolar Epithelial Cells

    PubMed Central

    Bates, Sandra R.; Tao, Jian-Qin; Yu, Kevin J.; Borok, Zea; Crandall, Edward D.; Collins, Heidi L.; Rothblat, George H.

    2008-01-01

    The mechanisms used by alveolar type I pneumocytes for maintenance of the lipid homeostasis necessary to sustain these large squamous cells are unknown. The processes may involve the ATP-binding cassette transporter A1 (ABCA1), a transport protein shown to be crucial in apolipoprotein A-I (apoA-I)–mediated mobilization of cellular cholesterol and phospholipid. Immunohistochemical data demonstrated the presence of ABCA1 in lung type I and type II cells and in cultured pneumocytes. Type II cells isolated from rat lungs and cultured for 5 days in 10% serum trans-differentiated toward cells with a type I–like phenotype which reacted with the type I cell–specific monoclonal antibody VIIIB2. Upon incubation of the type I–like pneumocytes with agents that up-regulate the ABCA1 gene (9-cis-retinoic acid [9cRA] and 22-hydroxycholesterol [22-OH, 9cRA/22-OH]), ABCA1 protein levels were enhanced to maximum levels after 8 to 16 hours and remained elevated for 24 hours. In the presence of apoA-I and 9cRA/22-OH, efflux of radioactive phospholipid and cholesterol from pneumocytes was stimulated 3- to 20-fold, respectively, over controls. Lipid efflux was inhibited by Probucol. Sucrose density gradient analysis of the media from stimulated cells incubated with apoA-I identified heterogeneous lipid particles that isolated at a density between 1.063 and 1.210 g/ml, with low or high apoA-I content. Thus, pneumocytes with markers for the type I phenotype contained functional ABCA1 protein, released lipid to apoA-I protein, and were capable of producing particles resembling nascent high-density lipoprotein, indicating an important role for ABCA1 in the maintenance of lung lipid homeostasis. PMID:17884990

  12. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  13. Liver X receptor agonist treatment significantly affects phenotype and transcriptome of APOE3 and APOE4 Abca1 haplo-deficient mice

    PubMed Central

    Fitz, Nicholas F.; Mounier, Anais; Wolfe, Cody M.; Nam, Kyong Nyon; Reeves, Valerie L.; Kamboh, Hafsa; Koldamova, Radosveta

    2017-01-01

    ATP-binding cassette transporter A1 (ABCA1) controls cholesterol and phospholipid efflux to lipid-poor apolipoprotein E (APOE) and is transcriptionally controlled by Liver X receptors (LXRs) and Retinoic X Receptors (RXRs). In APP transgenic mice, lack of Abca1 increased Aβ deposition and cognitive deficits. Abca1 haplo-deficiency in mice expressing human APOE isoforms, increased level of Aβ oligomers and worsened memory deficits, preferentially in APOE4 mice. In contrast upregulation of Abca1 by LXR/RXR agonists significantly ameliorated pathological phenotype of those mice. The goal of this study was to examine the effect of LXR agonist T0901317 (T0) on the phenotype and brain transcriptome of APP/E3 and APP/E4 Abca1 haplo-deficient (APP/E3/Abca1+/- and APP/E4/Abca1+/-) mice. Our data demonstrate that activated LXRs/RXR ameliorated APOE4-driven pathological phenotype and significantly affected brain transcriptome. We show that in mice expressing either APOE isoform, T0 treatment increased mRNA level of genes known to affect brain APOE lipidation such as Abca1 and Abcg1. In both APP/E3/Abca1+/- and APP/E4/Abca1+/- mice, the application of LXR agonist significantly increased ABCA1 protein level accompanied by an increased APOE lipidation, and was associated with restoration of APOE4 cognitive deficits, reduced levels of Aβ oligomers, but unchanged amyloid load. Finally, using Gene set enrichment analysis we show a significant APOE isoform specific response to LXR agonist treatment: Gene Ontology categories “Microtubule Based Process” and “Synapse Organization” were differentially affected in T0-treated APP/E4/Abca1+/- mice. Altogether, the results are suggesting that treatment of APP/E4/Abca1+/- mice with LXR agonist T0 ameliorates APOE4-induced AD-like pathology and therefore targeting the LXR-ABCA1-APOE regulatory axis could be effective as a potential therapeutic approach in AD patients, carriers of APOEε4. PMID:28241068

  14. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  15. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  16. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  17. ER stress is associated with reduced ABCA-1 protein levels in macrophages treated with advanced glycated albumin - reversal by a chemical chaperone.

    PubMed

    Castilho, Gabriela; Okuda, Ligia S; Pinto, Raphael S; Iborra, Rodgiro T; Nakandakare, Edna R; Santos, Celio X; Laurindo, Francisco R; Passarelli, Marisa

    2012-07-01

    ATP-binding cassette transporter A1 mediates the export of excess cholesterol from macrophages, contributing to the prevention of atherosclerosis. Advanced glycated albumin (AGE-alb) is prevalent in diabetes mellitus and is associated with the development of atherosclerosis. Independently of changes in ABCA-1 mRNA levels, AGE-alb induces oxidative stress and reduces ABCA-1 protein levels, which leads to macrophage lipid accumulation. These metabolic conditions are known to elicit endoplasmic reticulum (ER) stress. We sought to determine if AGE-alb induces ER stress and unfolded protein response (UPR) in macrophages and how disturbances to the ER could affect ABCA-1 content and cholesterol efflux in macrophages. AGE-alb induced a time-dependent increase in ER stress and UPR markers. ABCA-1 content and cellular cholesterol efflux were reduced by 33% and 47%, respectively, in macrophages treated with AGE-alb, and both were restored by treatment with 4-phenyl butyric acid (a chemical chaperone that alleviates ER stress), but not MG132 (a proteasome inhibitor). Tunicamycin, a classical ER stress inductor, also impaired ABCA-1 expression and cholesterol efflux (showing a decrease of 61% and 82%, respectively), confirming the deleterious effect of ER stress in macrophage cholesterol accumulation. Glycoxidation induces macrophage ER stress, which relates to the reduction in ABCA-1 and in reverse cholesterol transport, endorsing the adverse effect of macrophage ER stress in atherosclerosis. Thus, chemical chaperones that alleviate ER stress may represent a useful tool for the prevention and treatment of atherosclerosis in diabetes.

  18. Inhibition of ABCA1 Protein Expression and Cholesterol Efflux by TNF α in MLO-Y4 Osteocytes.

    PubMed

    Wehmeier, Kent R; Kurban, William; Chandrasekharan, Chandrikha; Onstead-Haas, Luisa; Mooradian, Arshag D; Haas, Michael J

    2016-06-01

    Hip fracture and myocardial infarction cause significant morbidity and mortality. In vivo studies raising serum cholesterol levels as well as pro-inflammatory cytokines such as TNF α manifest bone loss and atherosclerotic vascular disease, suggesting that abnormalities of cholesterol transport may contribute to osteoporosis. We used the mouse osteocyte cell line (MLO-Y4) to investigate the effects of TNF α on the expression of cholesterol acceptor proteins such as apolipoprotein A-I (apo A-I) and apolipoprotein E (apo E), as well as on the cholesterol transporters ATP-binding cassette-1 (ABCA1), scavenger receptor class B type 1 (SRB1), and cluster of differentiation 36 (CD36). MLO-Y4 cells do not express apo A-I or apo E; however, they do express all three cholesterol transporters (ABCA1, SRB1, and CD36). Treatment of MLO-Y4 cells with TNF α had no effect on SRB1, CD36, and osteocalcin levels; however, TNF α reduced ABCA1 protein levels in a dose-dependent manner and cholesterol efflux to apo A-I. Interestingly, TNF α treatment increased ABCA1 promoter activity and ABCA1 mRNA levels, and increased liver X receptor α protein expression, but had no effect on retinoid X receptor α and retinoic acid receptor α levels. Pharmacological inhibition of p38 mitogen-activated protein (MAP) kinase, but not c-jun-N-terminal kinase 1 or mitogen-activated protein kinase (MEK), restored ABCA1 protein levels in TNF α-treated cells. These results suggest that pro-inflammatory cytokines regulate cholesterol metabolism in osteocytes in part by suppressing ABCA1 levels post-translationally in a p38 MAP kinase-dependent manner.

  19. Expression of ATP-Binding Cassette Transporters B1 and C1 after Severe Traumatic Brain Injury in Humans

    PubMed Central

    Willyerd, F. Anthony; Empey, Philip E.; Philbrick, Ashley; Ikonomovic, Milos D.; Puccio, Ava M.; Kochanek, Patrick M.; Okonkwo, David O.

    2016-01-01

    Abstract Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI) on ABCC1 and ABCB1 expression in humans is unknown. We hypothesized that ABCC1 and ABCB1 expression would be altered in brain tissue from patients acutely after severe TBI. Archived TBI samples (n=10) from our Brain Trauma Research Center and control samples (n=7) from our Alzheimer Disease Research Center were obtained under Institutional Review Board approval. Protein was extracted from fresh frozen cortical brain tissue for Western blot analysis and sections were obtained from fixed cortical tissue for immunohistochemistry. Relative abundance of ABCC1 was increased in samples from TBI versus controls (2.8±2.5 fold; p=0.005). ABCC1 immunohistochemistry was consistent with Western blot data, with increased immunoreactivity in cerebral blood vessel walls, as well as cells with the morphological appearance of neurons and glia in TBI versus controls. Relative abundance of ABCB1 was similar between TBI and controls (p=0.76), and ABCB1 immunoreactivity was primarily associated with cerebral blood vessels in both groups. These human data show that TBI increases ABCC1 expression in the brain, consistent with possible implications for both patients receiving pharmacological inhibitors and/or substrates of ABCC1 after TBI. PMID:25891836

  20. ApoA-I enhances generation of HDL-like lipoproteins through interaction between ABCA1 and phospholipase Cγ in rat astrocytes.

    PubMed

    Ito, Jin-ichi; Nagayasu, Yuko; Kheirollah, Alireza; Abe-Dohmae, Sumiko; Yokoyama, Shinji

    2011-12-01

    In the previous paper, we reported that apolipoprotein (apo) A-I enhances generation of HDL-like lipoproteins in rat astrocytes to be accompanied with both increase in tyrosine phosphorylation of phospholipase Cγ (PL-Cγ) and PL-Cγ translocation to cytosolic lipid-protein particles (CLPP) fraction. In this paper, we studied the interaction between apoA-I and ATP-binding cassette transporter A1 (ABCA1) to relate with PL-Cγ function for generation of HDL-like lipoproteins in the apoA-I-stimulated astrocytes. ABCA1 co-migrated with exogenous apoA-I with apparent molecular weight over 260kDa on SDS-PAGE when rat astrocytes were treated with apoA-I and then with a cross-linker, BS3. The solubilized ABCA1 of rat astrocytes was associated with the apoA-I-immobilized Affi-Gel 15. An LXR agonist, To901317, increased the cellular level of ABCA1, association of apoA-I with ABCA1 and apoA-I-mediated lipid release in rat astrocytoma GA-1/Mock cells where ABCA1 expression at baseline is very low. PL-Cγ was co-isolated by apoA-I-immobilized Affi-Gel 15 and co-immunoprecipitated by anti-ABCA1 antibody along with ABCA1 from the solubilized membrane fraction of rat astrocytes. The SiRNA of ABCA1 suppressed not only the PL-Cγ binding to ABCA1 but also the tyrosine phosphorylation of PL-Cγ. A PL-C inhibitor, U73122, prevented generation of apoA-I-mediated HDL-like lipoproteins in rat astrocytes. To901317 increased the association of PL-Cγ with ABCA1 in GA-1/Mock cells dependently on the increase of cellular level of ABCA1 without changing that of PL-Cγ. These findings suggest that the exogenous apoA-I augments the interaction between PL-Cγ and ABCA1 to stimulate tyrosine phosphorylation and activation of PL-Cγ for generation of HDL-like lipoproteins in astrocytes.

  1. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  2. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.

    2017-01-01

    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  3. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  4. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  5. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  6. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  7. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  8. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  9. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  10. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  11. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  12. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  13. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  14. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  15. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  16. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  17. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  18. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions

    2009-01-01

    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  19. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  20. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  1. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  2. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  3. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  4. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  5. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  6. Lactobacillus acidophilus K301 Inhibits Atherogenesis via Induction of 24 (S), 25-Epoxycholesterol-Mediated ABCA1 and ABCG1 Production and Cholesterol Efflux in Macrophages.

    PubMed

    Hong, Yi-Fan; Kim, Hangeun; Kim, Hye Sun; Park, Woo Jung; Kim, Joo-Yun; Chung, Dae Kyun

    2016-01-01

    Lactobacillus acidophilus species are well-known probiotics with the beneficial activity of regulating cholesterol levels. In this study, we showed that L. acidophilus K301 reduced the level of cholesterol through reverse transport in macrophages. L. acidophilus K301 upregulated the mRNA and protein levels of genes such as ATP-binding cassette A1 (ABCA1) and ATP-binding cassette G1 (ABCG1) under the control of liver X receptor (LXR), resulting in increased apoA-I-dependent cholesterol efflux in phorbol 12-myristate 13-acetate (PMA)-differentiated THP-1 cells. L. acidophilus K301 induced both ABCA1 and ABCG1 through the endogenous LXR agonist 24(S), 25-epoxcycholesterol, which is synthesized by intracellular cholesterol synthetic pathways. In vivo studies using L. acidophilus K301-treated ApoE-/- mice showed reduced accumulation of lipoproteins in the arterial lumen. The inhibitory effects of L. acidophilus K301 on accumulation of lipoprotein in atherosclerotic plaques were mediated by the induction of squalene reductase (SQLE) and oxidosqualene cyclase (OSC) and resulted in ABCA1-mediated cholesterol efflux. Taken together, our findings revealed that Lactobacillus acidophilus K301 regulates the expression of genes related to cholesterol reverse transport via the induction of endogenous LXR agonist, suggesting the therapeutic potential of Lactobacillus acidophilus K301 as an anti-atherosclerotic agent.

  7. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  8. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  9. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  10. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  11. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  12. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  13. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  14. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  15. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  16. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  17. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  18. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  19. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  20. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  1. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  2. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  3. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  4. ABCA1, ABCG1, and ABCG4 are distributed to distinct membrane meso-domains and disturb detergent-resistant domains on the plasma membrane.

    PubMed

    Sano, Osamu; Ito, Shiho; Kato, Reiko; Shimizu, Yuji; Kobayashi, Aya; Kimura, Yasuhisa; Kioka, Noriyuki; Hanada, Kentaro; Ueda, Kazumitsu; Matsuo, Michinori

    2014-01-01

    ATP-binding cassette A1 (ABCA1), ABCG1, and ABCG4 are lipid transporters that mediate the efflux of cholesterol from cells. To analyze the characteristics of these lipid transporters, we examined and compared their distributions and lipid efflux activity on the plasma membrane. The efflux of cholesterol mediated by ABCA1 and ABCG1, but not ABCG4, was affected by a reduction of cellular sphingomyelin levels. Detergent solubility and gradient density ultracentrifugation assays indicated that ABCA1, ABCG1, and ABCG4 were distributed to domains that were solubilized by Triton X-100 and Brij 96, resistant to Triton X-100 and Brij 96, and solubilized by Triton X-100 but resistant to Brij 96, respectively. Furthermore, ABCG1, but not ABCG4, was colocalized with flotillin-1 on the plasma membrane. The amounts of cholesterol extracted by methyl-β-cyclodextrin were increased by ABCA1, ABCG1, or ABCG4, suggesting that cholesterol in non-raft domains was increased. Furthermore, ABCG1 and ABCG4 disturbed the localization of caveolin-1 to the detergent-resistant domains and the binding of cholera toxin subunit B to the plasma membrane. These results suggest that ABCA1, ABCG1, and ABCG4 are localized to distinct membrane meso-domains and disturb the meso-domain structures by reorganizing lipids on the plasma membrane; collectively, these observations may explain the different substrate profiles and lipid efflux roles of these transporters.

  5. 22(R)-hydroxycholesterol and pioglitazone synergistically decrease cholesterol ester via the PPARγ–LXRα–ABCA1 pathway in cholesterosis of the gallbladder

    SciTech Connect

    Wang, Jing-Min Wang, Dong Tan, Yu-Yan Zhao, Gang Ji, Zhen-Ling

    2014-04-25

    Highlights: • Cholesterosis is a metabolic disease characterized by excessive lipid droplets. • Lipid droplet efflux is mediated by the ABCA1 transporter. • 22(R)-hydroxycholesterol can activate LXRα and up-regulate ABCA1. • Pioglitazone up-regulates ABCA1 in a PPARγ–LXRα–ABCA1-dependent manner. • 22(R)-hydroxycholesterol and pioglitazone synergistically decrease lipid droplets. - Abstract: Cholesterosis is a disease of cholesterol metabolism characterized by the presence of excessive lipid droplets in the cytoplasm. These lipid droplets are mainly composed of cholesterol esters derived from free cholesterol. The removal of excess cholesterol from gallbladder epithelial cells (GBECs) is very important for the maintenance of intracellular cholesterol homeostasis and the preservation of gallbladder function. Several lines of evidence have indicated that the activation of either peroxisome proliferator-activated receptor gamma (PPARγ) or liver X receptor α (LXRα) relates to cholesterol efflux. While pioglitazone can regulate the activation of PPARγ, 22(R)-hydroxycholesterol can activate LXRα and is a metabolic intermediate in the biosynthesis of steroid hormones. However, the effect of 22(R)-hydroxycholesterol in combination with pioglitazone on cholesterosis of the gallbladder is unclear. GBECs were treated with pioglitazone, 22(R)-hydroxycholesterol or PPARγ siRNA followed by Western blot analysis for ATP-binding cassette transporter A1 (ABCA1), PPARγ and LXRα. Cholesterol efflux to apoA-I was determined, and Oil Red O staining was performed to monitor variations in lipid levels in treated GBECs. Our data showed that 22(R)-hydroxycholesterol can modestly up-regulate LXRα while simultaneously increasing ABCA1 by 56%. The combination of 22(R)-hydroxycholesterol and pioglitazone resulted in a 3.64-fold increase in ABCA1 expression and a high rate of cholesterol efflux. Oil Red O staining showed an obvious reduction in the lipid droplets

  6. Betulin attenuates atherosclerosis in apoE−/− mice by up-regulating ABCA1 and ABCG1

    PubMed Central

    Gui, Yu-zhou; Yan, Hong; Gao, Fei; Xi, Cong; Li, Hui-hui; Wang, Yi-ping

    2016-01-01

    Aim: Betulin is a pentacyclic triterpenoid isolated from the bark of yellow and white birch trees with anti-cancer and anti-malaria activities. In this study we examined the effects of betulin on atherosclerosis in apoE−/− mice and the underlying mechanisms. Methods: Murine macrophage RAW264.7 cells and human monocyte-derived THP-1 cells were tested. Foam cell formation was detected with Oil Red O staining. Cholesterol efflux was assessed using [3H]-cholesterol efflux assay. The expression of ATP-binding cassette transporter A1 and G1 (ABCA1 and ABCG1) was examined using RT-PCR and Western-blotting. The ABCA1 promoter activity was evaluated using luciferase activity assay. Male apoE−/− mice fed on a high-fat-diet (HFD), and received betulin (20 and 40 mg·kg−1·d−1, ig) for 12 weeks. The macrophage content and ABCA1 expression in the aortic sinuses were evaluated with immunofluorescence staining. The hepatic, intestinal and fecal cholesterol were also analyzed in the mice. Results: In RAW264.7 cells, betulin (0.1–2.5 μg/mL) dose-dependently ameliorated oxLDL-induced cholesterol accumulation and enhanced cholesterol efflux. In both RAW264.7 and THP-1 cells, betulin increased the expression of ABCA1 and ABCG1 via suppressing the transcriptional repressors sterol-responsive element-binding proteins (SREBPs) that bound to E-box motifs in ABCA1 promoter, whereas E-box binding site mutation markedly attenuated betulin-induced ABCA1 promoter activity. In HFD-fed apoE−/− mice, betulin administration significantly reduced lesions in en face aortas and aortic sinuses. Furthermore, betulin administration significantly increased ABCA1 expression and suppressed macrophage positive areas in the aortic sinuses. Moreover, betulin administration improved plasma lipid profiles and enhanced fecal cholesterol excretion in the mice. Conclusion: Betulin attenuates atherosclerosis in apoE−/− mice by promoting cholesterol efflux in macrophages. PMID:27374487

  7. LXR driven induction of HDL-cholesterol is independent of intestinal cholesterol absorption and ABCA1 protein expression.

    PubMed

    Kannisto, Kristina; Gåfvels, Mats; Jiang, Zhao-Yan; Slätis, Katharina; Hu, Xiaoli; Jorns, Carl; Steffensen, Knut R; Eggertsen, Gösta

    2014-01-01

    We investigated whether: (1) liver X receptor (LXR)-driven induction of high-density lipoprotein cholesterol (HDL-C) and other LXR-mediated effects on cholesterol metabolism depend on intestinal cholesterol absorption; and (2) combined treatment with the LXR agonist GW3965 and the cholesterol absorption inhibitor ezetimibe results in synergistic effects on cholesterol metabolism that could be beneficial for treatment of atherosclerosis. Mice were fed 0.2 % cholesterol and treated with GW3965+ezetimibe, GW3965 or ezetimibe. GW3965+ezetimibe treatment elevated serum HDL-C and Apolipoprotein (Apo) AI, effectively reduced the intestinal cholesterol absorption and increased the excretion of faecal neutral sterols. No changes in intestinal ATP-binding cassette (ABC) A1 or ABCG5 protein expression were observed, despite increased mRNA expression, while hepatic ABCA1 was slightly reduced. The combined treatment caused a pronounced down-regulation of intestinal Niemann-Pick C1-like 1 (NPC1L1) and reduced hepatic and intestinal cholesterol levels. GW3965 did not affect the intestinal cholesterol absorption, but increased serum HDL-C and ApoAI levels. GW3965 also increased Apoa1 mRNA levels in primary mouse hepatocytes and HEPA1-6 cells. Ezetimibe reduced the intestinal cholesterol absorption, ABCA1 and ABCG5, but did not affect the serum HDL-C or ApoAI levels. Thus, the LXR-driven induction of HDL-C and ApoAI was independent of the intestinal cholesterol absorption and increased expression of intestinal or hepatic ABCA1 was not required. Inhibited influx of cholesterol via NPC1L1 and/or low levels of intracellular cholesterol prevented post-transcriptional expression of intestinal ABCA1 and ABCG5, despite increased mRNA levels. Combined LXR activation and blocked intestinal cholesterol absorption induced effective faecal elimination of cholesterol.

  8. Poly(ADP-ribose) Polymerase 1 Represses Liver X Receptor-mediated ABCA1 Expression and Cholesterol Efflux in Macrophages.

    PubMed

    Shrestha, Elina; Hussein, Maryem A; Savas, Jeffery N; Ouimet, Mireille; Barrett, Tessa J; Leone, Sarah; Yates, John R; Moore, Kathryn J; Fisher, Edward A; Garabedian, Michael J

    2016-05-20

    Liver X receptors (LXR) are oxysterol-activated nuclear receptors that play a central role in reverse cholesterol transport through up-regulation of ATP-binding cassette transporters (ABCA1 and ABCG1) that mediate cellular cholesterol efflux. Mouse models of atherosclerosis exhibit reduced atherosclerosis and enhanced regression of established plaques upon LXR activation. However, the coregulatory factors that affect LXR-dependent gene activation in macrophages remain to be elucidated. To identify novel regulators of LXR that modulate its activity, we used affinity purification and mass spectrometry to analyze nuclear LXRα complexes and identified poly(ADP-ribose) polymerase-1 (PARP-1) as an LXR-associated factor. In fact, PARP-1 interacted with both LXRα and LXRβ. Both depletion of PARP-1 and inhibition of PARP-1 activity augmented LXR ligand-induced ABCA1 expression in the RAW 264.7 macrophage line and primary bone marrow-derived macrophages but did not affect LXR-dependent expression of other target genes, ABCG1 and SREBP-1c. Chromatin immunoprecipitation experiments confirmed PARP-1 recruitment at the LXR response element in the promoter of the ABCA1 gene. Further, we demonstrated that LXR is poly(ADP-ribosyl)ated by PARP-1, a potential mechanism by which PARP-1 influences LXR function. Importantly, the PARP inhibitor 3-aminobenzamide enhanced macrophage ABCA1-mediated cholesterol efflux to the lipid-poor apolipoprotein AI. These findings shed light on the important role of PARP-1 on LXR-regulated lipid homeostasis. Understanding the interplay between PARP-1 and LXR may provide insights into developing novel therapeutics for treating atherosclerosis.

  9. Mifepristone treatment results in differential regulation of glycerolipid biosynthesis in baby hamster kidney cells expressing a mifepristone-inducible ABCA1.

    PubMed

    Hauff, Kristin D; Mitchell, Ryan W; Xu, Fred Y; Dembinski, Thomas; Mymin, David; Zha, Xiaohui; Choy, Patrick C; Hatch, Grant M

    2011-09-01

    ATP binding cassette A1 (ABCA1) transports cholesterol, phospholipids and lipophilic molecules to and across cellular membranes. We examined if ABCA1 expression altered cellular de novo glycerolipid biosynthesis in growing Baby hamster kidney (BHK) cells. Mock BHK cells or cells expressing a mifepristone-inducible ABCA1 (ABCA1) were incubated plus or minus mifepristone and then with [(3)H]serine or [(3)H]inositol or [(3)H]ethanolamine or [methyl-(3)H]choline or [(3)H]glycerol or [(14)C]oleate and radioactivity incorporated into glycerolipids determined. Mifepristone did not affect [1,3-(3)H]glycerol or [(14)C]oleate or [(3)H]ethanolamine or [methyl-(3)H]choline uptake in BHK cells. In contrast, [(3)H]glycerol and [(14)C]oleate incorporated into phosphatidylserine (PtdSer) were elevated 2.4-fold (p < 0.05) and 54% (p < 0.05), respectively, upon ABCA1 induction confirming increased PtdSer biosynthesis from these precursors. However, mifepristone inhibited [(3)H]serine uptake and incorporation into PtdSer indicating that PtdSer synthesis from serine in BHK cells is dependent on serine uptake. Mifepristone stimulated [(3)H]inositol uptake in mock and ABCA1 cells but not its incorporation into phosphatidylinositol indicating that its synthesis from inositol is independent of inositol uptake in BHK cells. [(3)H]glycerol and [(14)C]oleate incorporated into triacylglycerol were reduced and into diacylglycerol elevated only in mifepristone-induced ABCA1 expressing cells due to a decrease in diacylglycerol acyltransferase-1 (DGAT-1) activity. The presence of trichostatin A, a class I and II histone deacetylase inhibitor, reversed the ABCA1-mediated reduction in DGAT-1 activity but did not affect DGAT-1 mRNA expression. Thus, mifepristone has diverse effects on de novo glycerolipid synthesis. We suggest that caution should be exercised when using mifepristone-inducible systems for studies of glycerolipid metabolism in cells expressing glucocorticoid responsive receptors.

  10. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  11. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  12. Cystathionine γ-lyase(CSE)/hydrogen sulfide system is regulated by miR-216a and influences cholesterol efflux in macrophages via the PI3K/AKT/ABCA1 pathway.

    PubMed

    Gong, Duo; Cheng, Hai-peng; Xie, Wei; Zhang, Min; Liu, Dan; Lan, Gang; Huang, Chong; Zhao, Zhen-wang; Chen, Ling-yan; Yao, Feng; Tan, Yu-lin; Li, Liang; Xia, Xiao-dan; Zheng, Xi-long; Wang, Zong-bao; Tang, Chao-ke

    2016-01-29

    This study was designed to evaluate whether CSE/H2S system, which is regulated by miR-216a, regulated ABCA1-mediated cholesterol efflux and cholesterol contents in THP-1 macrophages-derived foam cells. Our qPCR and western blotting results showed that CSE/H2S significantly up-regulated the expression of ATP-binding cassette transporter A1 (ABCA1) mRNA and protein via PI3K/AKT pathway in foam cells derived from human THP-1 macrophages. The miR-216a directly targeted 3' untranslated region of CSE. It significantly reduced CSE and ABCA1 expression, and also decreased the phosphorylation of PI3K and AKT. Additionally, cholesterol efflux decreased, and cholesterol levels increased in THP-1 macrophage-derived foam cells in response to treatment with miR-216a. Our study demonstrates that CSE/H2S system is regulated by miR-216a, and regulates ABCA1-mediated cholesterol efflux and cholesterol levels through the PI3K/AKT pathway.

  13. Effect of compounds affecting ABCA1 expression and CETP activity on the HDL pathway involved in intestinal absorption of lutein and zeaxanthin.

    PubMed

    Niesor, Eric J; Chaput, Evelyne; Mary, Jean-Luc; Staempfli, Andreas; Topp, Andreas; Stauffer, Andrea; Wang, Haiyan; Durrwell, Alexandre

    2014-12-01

    The antioxidant xanthophylls lutein and zeaxanthin are absorbed from the diet in a process involving lipoprotein formation. Selective mechanisms exist for their intestinal uptake and tissue-selective distribution, but these are poorly understood. We investigated the role of high-density lipoprotein (HDL), apolipoprotein (apo) A1 and ATP-binding cassette transporter (ABC) A1 in intestinal uptake of lutein in a human polarized intestinal cell culture and a hamster model. Animals received dietary lutein and zeaxanthin and either a liver X receptor (LXR) agonist or statin, which up- or down-regulate intestinal ABCA1 expression, respectively. The role of HDL was studied following treatment with the cholesteryl ester transfer protein (CETP) modulator dalcetrapib or the CETP inhibitor anacetrapib. In vitro, intestinal ABCA1 at the basolateral surface of enterocytes transferred lutein and zeaxanthin to apoA1, not to mature HDL. In hamsters, plasma lutein and zeaxanthin levels were markedly increased with the LXR agonist and decreased with simvastatin. Dalcetrapib, but not anacetrapib, increased plasma and liver lutein and zeaxanthin levels. ABCA1 expression and apoA1 acceptor activity are important initial steps in intestinal uptake and maintenance of lutein and zeaxanthin levels by an HDL-dependent pathway. Their absorption may be improved by physiological and pharmacological interventions affecting HDL metabolism.

  14. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  15. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  16. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  17. Effects of a fixed-intensity of endurance training and pistacia atlantica supplementation on ATP-binding cassette G4 expression

    PubMed Central

    2013-01-01

    Background Adenosine triphosphate-cassette binding protein (ABC) type G is considered as a part of reverse cholesterol transport (RCT) process in modification and metabolism of plasma and tissue cholesterol. This study aims to evaluate the effect of endurance training with or without Pistacia atlantica (Baneh) supplementation on the female rat tissues ABC type G expression and its correlation with plasma high-density lipoprotein cholesterol (HDL-C) concentration. Methods Twenty Wistar rats (six to eight weeks old, 125–135 g weight) were arbitrarily allocated into training (n = 10) and control (n = 10) groups and further divided into saline-control (n = 5), saline-training (n = 5), Baneh-control (n = 5), and Baneh-training (n = 5). The training groups were given exercise on a motor-driven treadmill at 25 m/min (0% grade) for 60 min/day, 5 days/week for eight weeks. The rats were fed orally with Baneh extract and saline for six weeks. Seventy-two hours after the last training session, the rats were sacrificed and their tissues were excised for tissues ABCG4 expression which was detected by Real-time PCR method. Results The ABCG4 gene expressions were significantly higher in liver (P = 02), small intestine (P = 06), and visceral fat tissues (P = 04) of the trained rats compared to the tissues of the control rats, but were lower in Baneh treated rats (liver P = 045, small intestine P = 06 and visceral fat P = 004) with lower HDL-C concentrations (P = 008). Conclusions The Baneh administration lowered tissues ABCG4 expression and plasma HDL-C concentrations while endurance training increased the expression in female rat tissues. PMID:24267473

  18. The bovine ATP-binding cassette transporter ABCG2 Tyr581Ser single-nucleotide polymorphism increases milk secretion of the fluoroquinolone danofloxacin.

    PubMed

    Otero, Jon A; Real, Rebeca; de la Fuente, Álvaro; Prieto, Julio G; Marqués, Margarita; Álvarez, Ana I; Merino, Gracia

    2013-03-01

    The bovine adenosine triphosphate-binding cassette transporter G2 (ABCG2/breast cancer resistance protein) polymorphism Tyr581Ser (Y581S) has recently been shown to increase in vitro transepithelial transport of antibiotics. Since this transporter has been extensively related to the active secretion of drugs into milk, the potential in vivo effect of this polymorphism on secretion of xenobiotics in livestock could have striking consequences for milk production, the dairy industry, and public health. Our purpose was to study the in vivo effect of this polymorphism on the secretion of danofloxacin, a widely used veterinary antibiotic, into milk. Danofloxacin (1.25 mg/kg) was administered to six Y/Y 581 homozygous and six Y/S 581 heterozygous lactating cows, and plasma and milk samples were collected and analyzed by high-performance liquid chromatography. No differences were found in the pharmacokinetic parameters of danofloxacin in plasma between the two groups of animals. In contrast, Y/S heterozygous cows showed a 2-fold increase in danofloxacin levels in milk. In addition, the pharmacokinetic elimination parameters, mean residence time and elimination half-life, were significantly lower in the milk of the animals carrying the Y/S polymorphism. These in vivo results are in agreement with our previously published in vitro data, which showed a greater capacity of the S581 variant in accumulation assays, and demonstrate, for the first time, an important effect of the Y581S single-nucleotide polymorphism on antibiotic secretion into cow milk. These findings could be extended to other ABCG2 substrates, and may be relevant for the treatment of mastitis and for the design of accurate and novel strategies to handle milk residues.

  19. Salvianolic acid B accelerated ABCA1-dependent cholesterol efflux by targeting PPAR-γ and LXRα

    SciTech Connect

    Yue, Jianmei; Li, Bo; Jing, Qingping; Guan, Qingbo

    2015-07-03

    Objectives: Cholesterol efflux has been thought to be the main and basic mechanism by which free cholesterol is transferred from extra hepatic cells to the liver or intestine for excretion. Salvianolic acid B (Sal B) has been widely used for the prevention and treatment of atherosclerotic diseases. Here, we sought to investigate the effects of Sal B on the cholesterol efflux in THP-1 macrophages. Methods: After PMA-stimulated THP-1 cells were exposed to 50 mg/L of oxLDL and [{sup 3}H] cholesterol (1.0 μCi/mL) for another 24 h, the effect of Sal B on cholesterol efflux was evaluated in the presence of apoA-1, HDL{sub 2} or HDL{sub 3}. The expression of ATP binding cassette transporter A1 (ABCA1), peroxisome proliferator-activated receptor-gamma (PPAR-γ), and liver X receptor-alpha (LXRα) was detected both at protein and mRNA levels in THP-1 cells after the stimulation of Sal B. Meanwhile, specific inhibition of PPAR-γ and LXRα were performed to investigate the mechanism. Results: The results showed that Sal B significantly accelerated apoA-I- and HDL-mediated cholesterol efflux in both dose- and time-dependent manners. Meanwhile, Sal B treatment also enhanced the expression of ABCA1 at both mRNA and protein levels. Then the data demonstrated that Sal B increased the expression of PPAR-γ and LXRα. And the application of specific agonists and inhibitors of further confirmed that Sal exert the function through PPAR-γ and LXRα. Conclusion: These results demonstrate that Sal B promotes cholesterol efflux in THP-1 macrophages through ABCA1/PPAR-γ/LXRα pathway. - Highlights: • Sal B promotes the expression of ABCA1. • Sal B promotes cholesterol efflux in macrophages. • Sal B promotes the expression of ABCA1 and cholesterol efflux through PPAR-γ/LXRα signaling pathway.

  20. A common variant in the ABCA1 gene is associated with a lower risk for premature coronary heart disease in familial hypercholesterolaemia

    PubMed Central

    Cenarro, A; Artieda, M; Castillo, S; Mozas, P; Reyes, G; Tejedor, D; Alonso, R; Mata, P; Pocovi, M; Civeira, F

    2003-01-01

    Familial hypercholesterolaemia (FH) is a common autosomal codominant hereditary disease caused by defects in the LDL receptor (LDLR) gene, and one of the most common characteristics of affected subjects is premature coronary heart disease (CHD). In heterozygous FH patients, the clinical expression of FH is highly variable in terms of the severity of hypercholesterolaemia and the age of onset and severity of CHD. Identification of mutations in the ATP binding cassette transporter 1 (ABCA1) gene in patients with Tangier disease, who exhibit reduced HDL cholesterol and apolipoprotein A1 concentrations and premature coronary atherosclerosis, has led us to hypothesise that ABCA1 could play a key role in the onset of premature CHD in FH. In order to know if the presence of the R219K variant in the ABCA1 gene could be a protective factor for premature CHD in FH, we have determined the presence of this genetic variant by amplification by PCR and restriction analysis in a group of 374 FH subjects, with and without premature CHD. The K allele of the R219K variant was significantly more frequent in FH subjects without premature CHD (0.32, 95% CI 0.27 to 0.37) than in FH subjects with premature CHD (0.25, 95% CI 0.21 to 0.29) (p<0.05), suggesting that the genetic variant R219K in ABCA1 could influence the development and progression of atherosclerosis in FH subjects. Moreover, the K allele of the R219K polymorphism seems to modify CHD risk without important modification of plasma HDL-C levels, and it appears to be more protective for smokers than non-smokers. PMID:12624133

  1. Impact of android overweight or obesity and insulin resistance on basal and postprandial SR-BI and ABCA1-mediated serum cholesterol efflux capacities.

    PubMed

    Attia, Nesrine; Fournier, Natalie; Vedie, Benoît; Cambillau, Michèle; Beaune, Philippe; Ziegler, Olivier; Grynberg, Alain; Paul, Jean-Louis; Guerci, Bruno

    2010-04-01

    Since android overweight/obesity and insulin resistance are independent risk factors for cardiovascular disease, we investigated their impact on basal and postprandial scavenger receptor BI (SR-BI) and ATP binding cassette transporter A1 (ABCA1)-mediated serum cholesterol efflux. Twelve android overweight to obese and 9 normal weight controls women underwent body composition analysis by dual energy X-ray absorptiometry, a euglycemic hyperinsulinemic clamp, and an oral fat load with blood sampling at initial time (T0), 4h (T4) and 10h (T10) after the fat load. Serum lipids and HDL-parameters, capacities of serum to promote cholesterol efflux from SR-BI expressing Fu5AH hepatoma cells or from ABCA1-expressing J774 macrophages and to abilities of serum to induce a net removal of cholesterol from macrophage foam cells were measured at T0, T4 and T10. Sera from overweight/obese exhibited moderately decreased SR-BI-mediated cholesterol efflux capacities, in accordance with reduced HDL concentrations, but importantly increased ABCA1-mediated cholesterol efflux and increased cholesterol extraction capacities over the postprandial period, partly related to higher prebeta-HDL concentrations. In multiple regression analyses, android obesity-related parameters and HDL-PL or prebeta-HDL levels remained the only independent correlates for SR-BI or ABCA1-dependent fractional cholesterol efflux while only prebeta-HDL levels remained correlated to cholesterol extraction capacities. Our results suggest that android overweight/obesity may not result in an impaired cholesterol efflux capacity.

  2. Inducer exclusion in Firmicutes: Insights into the regulation of a carbohydrate ATP binding cassette transporter from Lactobacillus casei BL23 by the signal transducing protein P-Ser46-HPr.

    PubMed

    Homburg, Constanze; Bommer, Martin; Wuttge, Steven; Hobe, Carolin; Beck, Sebastian; Dobbek, Holger; Deutscher, Josef; Licht, Anke; Schneider, Erwin

    2017-03-30

    Catabolite repression is a mechanism that enables bacteria to control carbon utilization. As part of this global regulatory network, components of the phosphoenolpyruvate:carbohydrate phosphotransferase system inhibit the uptake of less favourable sugars when a preferred carbon source such as glucose is available. This process is termed inducer exclusion. In bacteria belonging to the phylum Firmicutes, HPr, phosphorylated at serine 46 (P-Ser46-HPr) is the key player but its mode of action is elusive. To address this question at the level of purified protein components, we have chosen a homolog of the E. coli maltose/maltodextrin ATP-binding cassette transporter from Lactobacillus casei (MalE1-MalF1G1K12 ) as a model system. We show that the solute binding protein, MalE1, binds linear and cyclic maltodextrins but not maltose. Crystal structures of MalE1 complexed with these sugars provide a clue why maltose is not a substrate. P-Ser46-HPr inhibited MalE1/maltotetraose-stimulated ATPase activity of the transporter incorporated in proteoliposomes. Furthermore, cross-linking experiments revealed that P-Ser46-HPr contacts the nucleotide-binding subunit, MalK1, in proximity to the Walker A motif. However, P-Ser46-HPr did not block binding of ATP to MalK1. Together, our findings provide first biochemical evidence that P-Ser-HPr arrests the transport cycle by preventing ATP hydrolysis at the MalK1 subunits of the transporter. This article is protected by copyright. All rights reserved.

  3. Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.

    PubMed

    Merino, Gracia; Real, Rebeca; Baro, Marta F; Gonzalez-Lobato, Lucia; Prieto, Julio G; Alvarez, Ana I; Marques, Margarita M

    2009-01-01

    ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.

  4. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  5. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  6. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    PubMed

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus.

  7. Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line

    PubMed Central

    BENABBOU, NADIA; MIRSHAHI, PEZHMAN; CADILLON, MÉLODIE; SORIA, JEANNETTE; THERWATH, AMU; MIRSHAHI, MASSOUD

    2013-01-01

    Interaction between tumor cells and their microenvironment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy. PMID:23857432

  8. Pharmacophore modeling of nilotinib as an inhibitor of ATP-binding cassette drug transporters and BCR-ABL kinase using a three-dimensional quantitative structure-activity relationship approach.

    PubMed

    Shukla, Suneet; Kouanda, Abdul; Silverton, Latoya; Talele, Tanaji T; Ambudkar, Suresh V

    2014-07-07

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure-activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [(125)I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  9. Pharmacophore Modeling of Nilotinib as an Inhibitor of ATP-Binding Cassette Drug Transporters and BCR-ABL Kinase Using a Three-Dimensional Quantitative Structure–Activity Relationship Approach

    PubMed Central

    2015-01-01

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure–activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [125I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  10. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer

    PubMed Central

    KONG, QINGNUAN; HAN, ZENGLEI; ZUO, XIAOLI; WEI, HONGJUN; HUANG, WEIQING

    2016-01-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  11. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer.

    PubMed

    Kong, Qingnuan; Han, Zenglei; Zuo, Xiaoli; Wei, Hongjun; Huang, Weiqing

    2016-05-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  12. Evaluation of Adenosine Triphosphate-Binding Cassette Transporter A1 (ABCA1) R219K and C-Reactive Protein Gene (CRP) +1059G/C Gene Polymorphisms in Susceptibility to Coronary Heart Disease.

    PubMed

    Li, Jing-Fang; Peng, Dian-Ying; Ling, Mei; Yin, Yong

    2016-08-25

    BACKGROUND This meta-analysis investigated the correlation of ABCA1 R219K and C-Reactive Protein Gene (CRP) +1059G/C gene polymorphisms with susceptibility to coronary heart disease (CHD). MATERIAL AND METHODS We searched PubMed, Springer link, Wiley, EBSCO, Ovid, Wanfang database, VIP database, and China National Knowledge Infrastructure (CNKI) databases to retrieve published studies by keyword. Searches were filtered using our stringent inclusion and exclusion criteria. Resultant high-quality data collected from the final selected studies were analyzed using Comprehensive Meta-analysis 2.0 software. Eleven case-control studies involving 3053 CHD patients and 3403 healthy controls met our inclusion criteria. Seven studies were conducted in Asian populations, 3 studies were done in Caucasian populations, and 1 was in an African population. RESULTS Our major finding was that ABCA1 R219K polymorphism increased susceptibility to CHD in allele model (OR=0.729, 95% CI=0.559~0.949, P=0.019) and dominant model (OR=0.698, 95% CI=0.507~0.961, P=0.027). By contrast, we were unable to find any significant association between the CRP +1059G/C polymorphism and susceptibility to CHD (allele model: OR=1.170, 95% CI=0.782~1.751, P=0.444; dominant model: OR=1.175, 95% CI=0.768~1.797, P=0.457). CONCLUSIONS This meta-analysis provides convincing evidence that polymorphism of ABCA1 R219K is associated with susceptibility to CHD while the CRP +1059G/C polymorphism appears to have no correlation with susceptibility to CHD.

  13. Evaluation of Adenosine Triphosphate-Binding Cassette Transporter A1 (ABCA1) R219K and C-Reactive Protein Gene (CRP) +1059G/C Gene Polymorphisms in Susceptibility to Coronary Heart Disease

    PubMed Central

    Li, Jing-Fang; Peng, Dian-Ying; Ling, Mei; Yin, Yong

    2016-01-01

    Background This meta-analysis investigated the correlation of ABCA1 R219K and CRP +1059G/C gene polymorphisms with susceptibility to coronary heart disease (CHD). Material/Methods We searched PubMed, Springer link, Wiley, EBSCO, Ovid, Wanfang database, VIP database, and China National Knowledge Infrastructure (CNKI) databases to retrieve published studies by keyword. Searches were filtered using our stringent inclusion and exclusion criteria. Resultant high-quality data collected from the final selected studies were analyzed using Comprehensive Meta-analysis 2.0 software. Eleven case-control studies involving 3053 CHD patients and 3403 healthy controls met our inclusion criteria. Seven studies were conducted in Asian populations, 3 studies were done in Caucasian populations, and 1 was in an African population. Results Our major finding was that ABCA1 R219K polymorphism increased susceptibility to CHD in allele model (OR=0.729, 95% CI=0.559~0.949, P=0.019) and dominant model (OR=0.698, 95% CI=0.507~0.961, P=0.027). By contrast, we were unable to find any significant association between the CRP +1059G/C polymorphism and susceptibility to CHD (allele model: OR=1.170, 95% CI=0.782~1.751, P=0.444; dominant model: OR=1.175, 95% CI=0.768~1.797, P=0.457). Conclusions This meta-analysis provides convincing evidence that polymorphism of ABCA1 R219K is associated with susceptibility to CHD while the CRP +1059G/C polymorphism appears to have no correlation with susceptibility to CHD. PMID:27560308

  14. 13-hydroxy linoleic acid increases expression of the cholesterol transporters ABCA1, ABCG1 and SR-BI and stimulates apoA-I-dependent cholesterol efflux in RAW264.7 macrophages

    PubMed Central

    2011-01-01

    Background Synthetic activators of peroxisome proliferator-activated receptors (PPARs) stimulate cholesterol removal from macrophages through PPAR-dependent up-regulation of liver × receptor α (LXRα) and subsequent induction of cholesterol exporters such as ATP-binding cassette transporter A1 (ABCA1) and scavenger receptor class B type 1 (SR-BI). The present study aimed to test the hypothesis that the hydroxylated derivative of linoleic acid (LA), 13-HODE, which is a natural PPAR agonist, has similar effects in RAW264.7 macrophages. Methods RAW264.7 macrophages were treated without (control) or with LA or 13-HODE in the presence and absence of PPARα or PPARγ antagonists and determined protein levels of LXRα, ABCA1, ABCG1, SR-BI, PPARα and PPARγ and apolipoprotein A-I mediated lipid efflux. Results Treatment of RAW264.7 cells with 13-HODE increased PPAR-transactivation activity and protein concentrations of LXRα, ABCA1, ABCG1 and SR-BI when compared to control treatment (P < 0.05). In addition, 13-HODE enhanced cholesterol concentration in the medium but decreased cellular cholesterol concentration during incubation of cells with the extracellular lipid acceptor apolipoprotein A-I (P < 0.05). Pre-treatment of cells with a selective PPARα or PPARγ antagonist completely abolished the effects of 13-HODE on cholesterol efflux and protein levels of genes investigated. In contrast to 13-HODE, LA had no effect on either of these parameters compared to control cells. Conclusion 13-HODE induces cholesterol efflux from macrophages via the PPAR-LXRα-ABCA1/SR-BI-pathway. PMID:22129452

  15. Effects of pomegranate peel polyphenols on lipid accumulation and cholesterol metabolic transformation in L-02 human hepatic cells via the PPARγ-ABCA1/CYP7A1 pathway.

    PubMed

    Lv, Ou; Wang, Lifang; Li, Jianke; Ma, Qianqian; Zhao, Wei

    2016-12-07

    To study the effect of pomegranate peel polyphenols on lipid accumulation and cholesterol metabolic transformation in human hepatic cells, purified pomegranate peel polyphenols (PPPs), their main component, punicalagin (PC), and the metabolite of PC, pomegranate ellagic acid (PEA), were chosen as the polyphenols to be tested. At the same time the human hepatocyte cell line L-02 was selected as the experimental cell and a model of steatotic L-02 hepatocytes in vitro was constructed in this paper. The results showed that PPPs, PC and PEA in different concentrations could decrease the total cholesterol (TC) content and increase the total bile acid (TBA) content, and so possess a lipid-lowering effect. The order of the lipid-lowering effect from strong to weak is PEA > PPPs > PC. The relative mRNA expression of peroxisome proliferator-activated receptor γ (PPARγ), ATP-binding cassette transporter A1 (ABCA1) and cholesterol 7α hydroxylase (CYP7A1) was up-regulated by PPPs, PC and PEA in a dose-dependent manner. The effect on the relative mRNA expression can be listed in descending order as: PEA > PPPs > PC. Similar results were found in a western blot analysis. The PPARγ protein, ABCA1 protein and CYP7A1 protein were up-regulated in L-02 cells treated with the three tested polyphenols. All the results indicated that PPPs, PC and PEA could regulate upstream the expression of PPARγ, ABCA1 and CYP7A1, both at transcript and protein levels, to activate the PPARγ-ABCA1/CYP7A1 cell signaling pathway and enhance cholesterol metabolism in L-02 cells. Therefore, PPPs, as a kind of natural material, may be paid more attention in the prevention and treatment of diseases related to excessive cholesterol accumulation.

  16. HDL and CER-001 Inverse-Dose Dependent Inhibition of Atherosclerotic Plaque Formation in apoE-/- Mice: Evidence of ABCA1 Down-Regulation

    PubMed Central

    Tardy, Claudine; Goffinet, Marine; Boubekeur, Nadia; Cholez, Guy; Ackermann, Rose; Sy, Gavin; Keyserling, Constance; Lalwani, Narendra; Paolini, John F.; Dasseux, Jean-Louis; Barbaras, Ronald; Baron, Rudi

    2015-01-01

    Objective CER-001 is a novel engineered HDL-mimetic comprised of recombinant human apoA-I and charged phospholipids that was designed to mimic the beneficial properties of nascent pre-ß HDL. In this study, we have evaluated the dose-dependent regulation of ABCA1 expression in vitro and in vivo in the presence of CER-001 and native HDL (HDL3). Methods and Results CER-001 induced cholesterol efflux from J774 macrophages in a dose-dependent manner similar to natural HDL. A strong down-regulation of the ATP-binding cassette A1 (ABCA1) transporter mRNA (- 50%) as well as the ABCA1 membrane protein expression (- 50%) was observed at higher doses of CER-001 and HDL3 compared to non-lipidated apoA-I. In vivo, in an apoE-/- mouse “flow cessation model,” in which the left carotid artery was ligatured to induce local inflammation, the inhibition of atherosclerotic plaque burden progression in response to a dose-range of every-other-day CER-001 or HDL in the presence of a high-fat diet for two weeks was assessed. We observed a U-shaped dose-response curve: inhibition of the plaque total cholesterol content increased with increasing doses of CER-001 or HDL3 up to a maximum inhibition (- 51%) at 5 mg/kg; however, as the dose was increased above this threshold, a progressively less pronounced inhibition of progression was observed, reaching a complete absence of inhibition of progression at doses of 20 mg/kg and over. ABCA1 protein expression in the same atherosclerotic plaque was decreased by-45% and-68% at 50 mg/kg for CER-001 and HDL respectively. Conversely, a-12% and 0% decrease in ABCA1 protein expression was observed at the 5 mg/kg dose for CER-001 and HDL respectively. Conclusions These data demonstrate that high doses of HDL and CER-001 are less effective at slowing progression of atherosclerotic plaque in apoE-/- mice compared to lower doses, following a U-shaped dose-response curve. A potential mechanism for this phenomenon is supported by the observation that

  17. High glucose upregulates BACE1-mediated Aβ production through ROS-dependent HIF-1α and LXRα/ABCA1-regulated lipid raft reorganization in SK-N-MC cells

    PubMed Central

    Lee, Hyun Jik; Ryu, Jung Min; Jung, Young Hyun; Lee, Sei-Jung; Kim, Jeong Yeon; Lee, Sang Hun; Hwang, In Koo; Seong, Je Kyung; Han, Ho Jae

    2016-01-01

    There is an accumulation of evidence indicating that the risk of Alzheimer’s disease is associated with diabetes mellitus, an indicator of high glucose concentrations in blood plasma. This study investigated the effect of high glucose on BACE1 expression and amyloidogenesis in vivo, and we present details of the mechanism associated with those effects. Our results, using ZLC and ZDF rat models, showed that ZDF rats have high levels of amyloid-beta (Aβ), phosphorylated tau, BACE1, and APP-C99. In vitro result with mouse hippocampal neuron and SK-N-MC, high glucose stimulated Aβ secretion and apoptosis in a dose-dependent manner. In addition, high glucose increased BACE1 and APP-C99 expressions, which were reversed by a reactive oxygen species (ROS) scavenger. Indeed, high glucose increased intracellular ROS levels and HIF-1α expression, associated with regulation of BACE1 and Liver X Receptor α (LXRα). In addition, high glucose induced ATP-binding cassette transporter A1 (ABCA1) down-regulation, was associated with LXR-induced lipid raft reorganization and BACE1 localization on the lipid raft. Furthermore, silencing of BACE1 expression was shown to regulate Aβ secretion and apoptosis of SK-N-MC. In conclusion, high glucose upregulates BACE1 expression and activity through HIF-1α and LXRα/ABCA1-regulated lipid raft reorganization, leading to Aβ production and apoptosis of SK-N-MC. PMID:27829662

  18. High glucose upregulates BACE1-mediated Aβ production through ROS-dependent HIF-1α and LXRα/ABCA1-regulated lipid raft reorganization in SK-N-MC cells.

    PubMed

    Lee, Hyun Jik; Ryu, Jung Min; Jung, Young Hyun; Lee, Sei-Jung; Kim, Jeong Yeon; Lee, Sang Hun; Hwang, In Koo; Seong, Je Kyung; Han, Ho Jae

    2016-11-10

    There is an accumulation of evidence indicating that the risk of Alzheimer's disease is associated with diabetes mellitus, an indicator of high glucose concentrations in blood plasma. This study investigated the effect of high glucose on BACE1 expression and amyloidogenesis in vivo, and we present details of the mechanism associated with those effects. Our results, using ZLC and ZDF rat models, showed that ZDF rats have high levels of amyloid-beta (Aβ), phosphorylated tau, BACE1, and APP-C99. In vitro result with mouse hippocampal neuron and SK-N-MC, high glucose stimulated Aβ secretion and apoptosis in a dose-dependent manner. In addition, high glucose increased BACE1 and APP-C99 expressions, which were reversed by a reactive oxygen species (ROS) scavenger. Indeed, high glucose increased intracellular ROS levels and HIF-1α expression, associated with regulation of BACE1 and Liver X Receptor α (LXRα). In addition, high glucose induced ATP-binding cassette transporter A1 (ABCA1) down-regulation, was associated with LXR-induced lipid raft reorganization and BACE1 localization on the lipid raft. Furthermore, silencing of BACE1 expression was shown to regulate Aβ secretion and apoptosis of SK-N-MC. In conclusion, high glucose upregulates BACE1 expression and activity through HIF-1α and LXRα/ABCA1-regulated lipid raft reorganization, leading to Aβ production and apoptosis of SK-N-MC.

  19. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  20. Effect of garlic extract on some serum biochemical parameters and expression of npc1l1, abca1, abcg5 and abcg8 genes in the intestine of hypercholesterolemic mice.

    PubMed

    Mohammadi, Abbas; Bazrafshani, Mohamad Reza; Oshaghi, Ebrahim Abbasi

    2013-12-01

    Some compounds in the garlic inhibit cholesterol synthesis, resulting in lowering of serum cholesterol and triglycerides and increase in HDL level. However, the mechanism of this specific effect is not fully understood. In the small intestine, ATP-binding cassette transporters G5, G8 and A1 (ABCG5, ABCG8 and ABCA1), as well as Niemann-Pick C1 like 1 (NPC1L1) protein have important roles in cholesterol metabolism. In this study, we evaluated the beneficial effect of aqueous extract of garlic on lipid profile and also expression of npc1l1, abca1, abcg5 and abcg8 genes in the intestine of N-Marry mice fed a high cholesterol diet as a possible mechanism of garlic effect. Twenty-four mice were randomly divided into three groups: Group 1: hypercholesterolmic (received chow + 2% cholesterol + 0.5% cholic acid); Group 2: garlic (received chow + 4% (w/w) garlic extract + 2% cholesterol + 0.5% cholic acid); and Group 3: received chow only. After one month, mice were anesthetized and blood was collected from their heart. The jejunum was removed, washed with PBS and entrocytes were scraped and used for the experiments. Serum lipids were measured enzymatically and expression of mRNA levels for the above-mentioned proteins was determined by semi-quantitative RT-PCR. Garlic extract significantly reduced serum lipids (p < 0.05), compared with the hypercholesterolemic group. Expression of the intestinal npc1l1 was significantly decreased (p < 0.01) in the garlic group, compared with the chow group, while abcg5 (p < 0.01), abcg8 (p < 0.01) and abca1 (p < 0.05) expressions were significantly increased. In conclusion, this study reveals a possible mechanism for the beneficial effects of the garlic in lowering serum lipids by decreasing the intestinal lipid absorption and increasing excretion of cholesterol back into the intestinal lumen.

  1. Common Pesticide, Dichlorodiphenyltrichloroethane (DDT), Increases Amyloid-β Levels by Impairing the Function of ABCA1 and IDE: Implication for Alzheimer's Disease.

    PubMed

    Li, Gongbo; Kim, Chaeyoung; Kim, Jaekwang; Yoon, Hyejin; Zhou, Huadong; Kim, Jungsu

    2015-01-01

    While early-onset familial Alzheimer's disease (AD) is caused by a genetic mutation, the vast majority of late-onset AD is likely caused by the combination of genetic and environmental factors. Unlike genetic studies, potential environmental factors affecting AD pathogenesis have not yet been thoroughly investigated. Among environmental factors, pesticides seem to be one of critical environmental contributors to late-onset AD. Recent studies reported that the serum and brains of AD patients have dramatically higher levels of a metabolite of dichlorodiphenyltrichloroethane (DDT). While these epidemiological studies provided initial clues to the environmental risks potentially contributing to disease pathogenesis, a functional approach is required to determine whether they actually have a causal role in disease development. In our study, we addressed this critical knowledge gap by investigating possible mechanisms by which DDT affects amyloid-β (Aβ) levels. We treated H4-AβPPswe or H4 cells with DDT to analyze its effect on Aβ metabolism using Aβ production, clearance, and degradation assays. We found that DDT significantly increased the levels of amyloid-β protein precursor (AβPP) and β-site AβPP-cleaving enzyme1 (BACE1), affecting Aβ synthesis pathway in H4-AβPPswe cells. Additionally, DDT impaired the clearance and extracellular degradation of Aβ peptides. Most importantly, we identified for the first time that ATP-binding cassette transporter A1 (ABCA1) and insulin-degrading enzyme (IDE) are the downstream target genes adversely affected by DDT. Our findings provide insight into the molecular mechanisms by which DDT exposure may increase the risk of AD, and it further supports that ABCA1 and IDE may be potential therapeutic targets.

  2. A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans.

    PubMed

    Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D; Granados-Silvestre, Ma de Angeles; Montufar-Robles, Isela; Tito-Alvarez, Ana M; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A; Lisker, Ruben; Moises, Regina S; Menjivar, Marta; Salzano, Francisco M; Knowler, William C; Bortolini, M Cátira; Hayden, Michael R; Baier, Leslie J; Canizales-Quinteros, Samuel

    2010-07-15

    It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 x 10(-11)) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations.

  3. A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans

    PubMed Central

    Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K.; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D.; de Ángeles Granados-Silvestre, Ma; Montufar-Robles, Isela; Tito-Alvarez, Ana M.; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P.; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L.; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Lisker, Ruben; Moises, Regina S.; Menjivar, Marta; Salzano, Francisco M.; Knowler, William C.; Bortolini, M. Cátira; Hayden, Michael R.; Baier, Leslie J.; Canizales-Quinteros, Samuel

    2010-01-01

    It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 × 10−11) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations. PMID:20418488

  4. Increased ABCA1 activity protects against atherosclerosis.

    PubMed

    Singaraja, Roshni R; Fievet, Catherine; Castro, Graciela; James, Erick R; Hennuyer, Nathalie; Clee, Susanne M; Bissada, Nagat; Choy, Jonathan C; Fruchart, Jean-Charles; McManus, Bruce M; Staels, Bart; Hayden, Michael R

    2002-07-01

    The ABC transporter ABCA1 plays a key role in the first steps of the reverse cholesterol transport pathway by mediating lipid efflux from macrophages. Previously, it was demonstrated that human ABCA1 overexpression in vivo in transgenic mice results in a mild elevation of plasma HDL levels and increased efflux of cholesterol from macrophages. In this study, we determined the effect of overexpression of ABCA1 on atherosclerosis development. Human ABCA1 transgenic mice (BAC(+)) were crossed with ApoE(-/-) mice, a strain that spontaneously develop atherosclerotic lesions. BAC(+)ApoE(-/-) mice developed dramatically smaller, less-complex lesions as compared with their ApoE(-/-) counterparts. In addition, there was increased efflux of cholesterol from macrophages isolated from the BAC(+)ApoE(-/-) mice. Although the increase in plasma HDL cholesterol levels was small, HDL particles from BAC(+)ApoE(-/-) mice were significantly better acceptors of cholesterol. Lipid analysis of HDL particles from BAC(+)ApoE(-/-) mice revealed an increase in phospholipid levels, which was correlated significantly with their ability to enhance cholesterol efflux.

  5. [Overexpression of NHE1 suppresses ABCA1 protein expression via increasing calpain activity in RAW264.7 cells].

    PubMed

    Mo, Xiangang; Wang, Lan; Guo, Jing; Hong, Wei; Long, Shiqi; Zhang, Li; Xiang, Ning; Yang, Juan

    2017-01-01

    Objective To investigate the effect of over-expressed Na(+)/H(+) exchanger 1 (NHE1) on the protein expression of adenosine three phosphate binding cassette transporter A1 (ABCA1) in RAW264.7 cells. Methods RAW264.7 cells were infected with the adenoviral vector encoding NHE1-EGFP (AdNHE1). The infected RAW264.7 cells were subjected to Western blot analysis for NHE1-EGFP fusion protein. The subcellular localization of NHE1-EGFP fusion protein was observed by confocal laser scanning microscopy. NHE1 activity was measured by the method of pH recovery in response to an acute acid pulse. Furthermore, Western blotting was performed to determine ABCA1 protein levels and calpain activity in NHE1-overexpressing RAW264.7 cells. The effect of calpain inhibitor N-acetyl-L-leucyl-L-leucyl-L-norleucinal (ALLN) on ABCA1 protein levels in the presence of TO-901317 was examined by Western blotting. Results NHE1-EGFP fusion protein was highly expressed and localized in cytoplasm and cell membrane of RAW264.7 cells infected with AdNHE1. NHE1-EGFP fusion protein reduced ABCA1 protein expression and increased calpain activity. The calpain inhibitor ALLN blocked the decrease of ABCA1 protein expression. Conclusion Overexpressed NHE1 suppresses the expression of ABCA1 protein via increasing the calpain activity in RAW264.7 cells.

  6. MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting β-catenin and ATP-binding cassette, subfamily G, member 2.

    PubMed

    Kang, Dong Woo; Yang, Eun Sun; Noh, Yu Na; Hwang, Won Chan; Jo, Se-Young; Suh, Young-Ah; Park, Won Sang; Choi, Kang-Yell; Min, Do Sik

    2017-04-01

    Infection with Helicobacter pylori is closely linked to an increased risk of gastric cancer. Although cytotoxin-associated gene A (CagA), a major virulence factor of H. pylori, is known to be a causal factor for gastric carcinogenesis, the molecular link between CagA and gastric cancer-initiating cell (CIC)-like properties remains elusive. Here, we demonstrate that CagA is required for increased expression of β-catenin and its target CIC markers via downregulation of microRNA (miR)-320a and miR-4496. CagA promoted gastric CIC properties and was responsible for chemoresistance. miR-320a and miR-4496 attenuated the in vitro self-renewal and tumour-initiating capacity of CagA-expressing CICs by targeting β-catenin. Moreover, miR-320a and miR-4496 decreased CagA-induced chemoresistance by targeting ATP-binding cassette, subfamily G, member 2 (ABCG2) at the transcriptional and post-transcriptional levels, respectively. Combination therapy with 5-fluorouracil and miR-320a/miR-4496 suppressed gastric tumourigenesis and metastatic potential in an orthotopic mouse model, probably via suppression of CagA-induced CIC properties and chemoresistance. Our results provide novel evidence that CIC properties, chemoresistance and tumourigenesis associated with H. pylori are linked to CagA-induced upregulation of β-catenin and ABCG2. These data provide novel insights into the molecular mechanisms of CagA-induced carcinogenisis and the therapeutic potential of of miR-320a and miR-4496. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  7. Differential Effects of apoE4 and Activation of ABCA1 on Brain and Plasma Lipoproteins

    PubMed Central

    Harats, Dror; Shaish, Aviv; Levkovitz, Hana; Bielicki, John K.; Johansson, Jan O.; Michaelson, Daniel M.

    2016-01-01

    Apolipoprotein E4 (apoE4), the leading genetic risk factor for Alzheimer's disease (AD), is less lipidated compared to the most common and AD-benign allele, apoE3. We have recently shown that i.p. injections of the ATP-binding cassette A1 (ABCA1) agonist peptide CS-6253 to apoE mice reverse the hypolipidation of apoE4 and the associated brain pathology and behavioral deficits. While in the brain apoE is the main cholesterol transporter, in the periphery apoE and apoA-I both serve as the major cholesterol transporters. We presently investigated the extent to which apoE genotype and CS-6253 treatment to apoE3 and apoE4-targeted replacement mice affects the plasma levels and lipid particle distribution of apoE, and those of plasma and brain apoA-I and apoJ. This revealed that plasma levels of apoE4 were lower and eluted faster following FPLC than plasma apoE3. Treatment with CS-6253 increased the levels of plasma apoE4 and rendered the elution profile of apoE4 similar to that of apoE3. Similarly, the levels of plasma apoA-I were lower in the apoE4 mice compared to apoE3 mice, and this effect was partially reversed by CS-6253. Conversely, the levels of apoA-I in the brain which were higher in the apoE4 mice, were unaffected by CS-6253. The plasma levels of apoJ were higher in apoE4 mice than apoE3 mice and this effect was abolished by CS-6253. Similar but less pronounced effects were obtained in the brain. In conclusion, these results suggest that apoE4 affects the levels of apoA-I and apoJ and that the anti-apoE4 beneficial effects of CS-6253 may be related to both central and peripheral mechanisms. PMID:27824936

  8. Silymarin Constituents Enhance ABCA1 Expression in THP-1 Macrophages

    PubMed Central

    Wang, Limei; Rotter, Susanne; Ladurner, Angela; Heiss, Elke H.; Oberlies, Nicholas H.; Dirsch, Verena M.; Atanasov, Atanas G.

    2016-01-01

    Silymarin is a hepatoprotective mixture of flavonolignans and flavonoids extracted from the seeds of milk thistle (Silybum marianum L. Gaertn). This study investigates the effect of major bioactive constituents from silymarin, silybin A, silybin B, isosilybin A, isosilybin B, silydianin, silychristin, isosilychristin, and taxifolin, on the expression of ABCA1, an important cholesterol efflux transporter, in THP-1-derived macrophages. Four of the studied compounds, isosilybin A, silybin B, silychristin and isosilychristin, were found to significantly induce ABCA1 protein expression without affecting cell viability. Moreover, isosilybin A, a partial PPARγ agonist, was found to promote cholesterol efflux from THP-1 macrophages in a concentration-dependent manner. These findings first show ABCA1 protein up-regulating activity of active constituents of silymarin and provide new avenues for their further study in the context of cardiovascular disease. PMID:26729088

  9. Carotenoid transport is decreased and expression of the lipid transporters SR-BI, NPC1L1, and ABCA1 is downregulated in Caco-2 cells treated with ezetimibe.

    PubMed

    During, Alexandrine; Dawson, Harry D; Harrison, Earl H

    2005-10-01

    Data suggest that intestinal carotenoid absorption is a facilitated process. The present study was conducted to determine whether carotenoids and cholesterol share common pathways (transporters) for their intestinal absorption. Differentiated Caco-2 cells on membranes were incubated (16 h) with a carotenoid (1 micromol/L) with or without ezetimibe (EZ; Zetia, an inhibitor of cholesterol transport), and with or without antibodies against the receptors, cluster determinant 36 (CD36) and scavenger receptor class B, type I (SR-BI). Carotenoid transport in Caco-2 cells (cellular uptake + secretion) was decreased by EZ (10 mg/L) as follows: beta-carotene approximately alpha-carotene (50% inhibition) > beta-cryptoxanthin approximately lycopene (20%) > lutein:zeaxanthin (1:1) (7%). EZ reduced cholesterol transport by 31%, but not retinol transport. beta-Carotene transport was also inhibited by anti-SR-BI, but not by anti-CD36. The inhibitory effects of EZ and anti-SR-BI on beta-carotene transport were additive, indicating that they may have different targets. Finally, differentiated Caco-2 cells treated with EZ showed a significant decrease in mRNA expression for the surface receptors SR-BI, Niemann-Pick type C1 Like 1 protein (NPC1L1), and ATP-binding cassette transporter, subfamily A (ABCA1) and for the nuclear receptors retinoid acid receptor (RAR)gamma, sterol-regulatory element binding proteins (SREBP)-1 and -2, and liver X receptor (LXR)beta as assessed by real-time PCR analysis. The data indicate that 1) EZ is an inhibitor of carotenoid transport, an effect that decreases with increasing polarity of the carotenoid molecule, 2) SR-BI is involved in carotenoid transport, and 3) EZ may act, not only by interacting physically with cholesterol transporters as previously suggested, but also by downregulating expression of these proteins. The cellular uptake and efflux of carotenoids, like that of cholesterol, likely involve more than one transporter.

  10. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  11. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  12. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  13. Apoptotic cells trigger a membrane-initiated pathway to increase ABCA1

    PubMed Central

    Fond, Aaron M.; Lee, Chang Sup; Schulman, Ira G.; Kiss, Robert S.; Ravichandran, Kodi S.

    2015-01-01

    Macrophages clear millions of apoptotic cells daily and, during this process, take up large quantities of cholesterol. The membrane transporter ABCA1 is a key player in cholesterol efflux from macrophages and has been shown via human genetic studies to provide protection against cardiovascular disease. How the apoptotic cell clearance process is linked to macrophage ABCA1 expression is not known. Here, we identified a plasma membrane–initiated signaling pathway that drives a rapid upregulation of ABCA1 mRNA and protein. This pathway involves the phagocytic receptor brain-specific angiogenesis inhibitor 1 (BAI1), which recognizes phosphatidylserine on apoptotic cells, and the intracellular signaling intermediates engulfment cell motility 1 (ELMO1) and Rac1, as ABCA1 induction was attenuated in primary macrophages from mice lacking these molecules. Moreover, this apoptotic cell–initiated pathway functioned independently of the liver X receptor (LXR) sterol–sensing machinery that is known to regulate ABCA1 expression and cholesterol efflux. When placed on a high-fat diet, mice lacking BAI1 had increased numbers of apoptotic cells in their aortic roots, which correlated with altered lipid profiles. In contrast, macrophages from engineered mice with transgenic BAI1 overexpression showed greater ABCA1 induction in response to apoptotic cells compared with those from control animals. Collectively, these data identify a membrane-initiated pathway that is triggered by apoptotic cells to enhance ABCA1 within engulfing phagocytes and with functional consequences in vivo. PMID:26075824

  14. LXR Agonism Upregulates the Macrophage ABCA1/Syntrophin Protein Complex That Can Bind ApoA-I and Stabilized ABCA1 Protein, but Complex Loss Does Not Inhibit Lipid Efflux.

    PubMed

    Tamehiro, Norimasa; Park, Min Hi; Hawxhurst, Victoria; Nagpal, Kamalpreet; Adams, Marv E; Zannis, Vassilis I; Golenbock, Douglas T; Fitzgerald, Michael L

    2015-11-24

    Macrophage ABCA1 effluxes lipid and has anti-inflammatory activity. The syntrophins, which are cytoplasmic PDZ protein scaffolding factors, can bind ABCA1 and modulate its activity. However, many of the data assessing the function of the ABCA1-syntrophin interaction are based on overexpression in nonmacrophage cells. To assess endogenous complex function in macrophages, we derived immortalized macrophages from Abca1(+/+) and Abca1(-/-) mice and show their phenotype recapitulates primary macrophages. Abca1(+/+) lines express the CD11B and F4/80 macrophage markers and markedly upregulate cholesterol efflux in response to LXR nuclear hormone agonists. In contrast, immortalized Abca1(-/-) macrophages show no efflux to apoA-I. In response to LPS, Abca1(-/-) macrophages display pro-inflammatory changes, including an increased level of expression of cell surface CD14, and 11-26-fold higher levels of IL-6 and IL-12 mRNA. Given recapitulation of phenotype, we show with these lines that the ABCA1-syntrophin protein complex is upregulated by LXR agonists and can bind apoA-I. Moreover, in immortalized macrophages, combined α1/β2-syntrophin loss modulated ABCA1 cell surface levels and induced pro-inflammatory gene expression. However, loss of all three syntrophin isoforms known to bind ABCA1 did not impair lipid efflux in immortalized or primary macrophages. Thus, the ABCA1-syntrophin protein complex is not essential for ABCA1 macrophage lipid efflux but does directly interact with apoA-I and can modulate the pool of cell surface ABCA1 stabilized by apoA-I.

  15. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  16. ABCA12 regulates ABCA1-dependent cholesterol efflux from macrophages and the development of atherosclerosis.

    PubMed

    Fu, Ying; Mukhamedova, Nigora; Ip, Sally; D'Souza, Wilissa; Henley, Katya J; DiTommaso, Tia; Kesani, Rajitha; Ditiatkovski, Michael; Jones, Lynelle; Lane, Rachael M; Jennings, Garry; Smyth, Ian M; Kile, Benjamin T; Sviridov, Dmitri

    2013-08-06

    ABCA12 is involved in the transport of ceramides in skin, but it may play a wider role in lipid metabolism. We show that, in Abca12-deficient macrophages, cholesterol efflux failed to respond to activation with LXR agonists. Abca12 deficiency caused a reduction in the abundance of Abca1, Abcg1, and Lxrβ. Overexpression of Lxrβ reversed the effects. Mechanistically, Abca12 deficiency did not affect expression of genes involved in cholesterol metabolism. Instead, a physical association between Abca1, Abca12, and Lxrβ proteins was established. Abca12 deficiency enhanced interaction between Abca1 and Lxrβ and the degradation of Abca1. Overexpression of ABCA12 in HeLa-ABCA1 cells increased the abundance and stability of ABCA1. Abca12 deficiency caused an accumulation of cholesterol in macrophages and the formation of foam cells, impaired reverse cholesterol transport in vivo, and increased the development of atherosclerosis in irradiated Apoe(-/-) mice reconstituted with Apoe(-/-)Abca12(-/-) bone marrow. Thus, ABCA12 regulates the cellular cholesterol metabolism via an LXRβ-dependent posttranscriptional mechanism.

  17. ATP-binding cassette G5/G8 deficiency causes hypertriglyceridemia by affecting multiple metabolic pathways.

    PubMed

    Méndez-González, Jesús; Julve, Josep; Rotllan, Noemí; Llaverias, Gemma; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2011-12-01

    Mutations in ABCG5 or ABCG8 transporters are responsible for sitosterolemia, an autosomal recessive disease characterized by the accumulation of plant sterols. The aim of this study was to investigate the effects of ABCG5 and ABCG8 deficiency on TG metabolism in mice. Experiments were carried out in wild-type (G5/G8+/+) mice, mice heterozygous for ABCG5 and ABCG8 deficiency (G5/G8+/-) and ABCG5/G8-deficient (G5/G8-/-) mice fed a chow diet. Plasma TG were 2.6 and 4.3-fold higher in fasted G5/G8+/- and G5/G8-/- mice, respectively, than in G5/G8+/+ mice. Postprandial TG were 5-fold higher in G5/G8-/- mice. TG metabolism studies indicate that: first, the fractional catabolic rate was significantly lower in G5/G8+/- (1.3-fold) and G5/G8-/- mice (1.5-fold) compared to G5/G8+/+ and postheparin plasma lipoprotein lipase activities were significantly lower in G5/G8+/- (1.8-fold) and G5/G8-/- mice (5.4-fold) than in G5/G8+/+. Second, liver TG secretion was 1.3-fold higher in G5/G8+/- and G5/G8-/- than in G5/G8+/+ mice and this was associated with an increase in liver LXR, FAS, ACAC and CD36 gene expression. Third, TG intestinal secretion, determined after an oral fat gavage of glycerol tri[9,10(n)-(3)H] oleate, was 5.8-fold higher in G5/G8-/- than in G5/G8+/+ mice. Also, the HOMA index was 2.6-fold higher in G5/G8-/- than in G5/G8+/+ mice, reflecting a degree of insulin resistance. In conclusion, ABCG5/G8 deficiency in mice fed a chow diet markedly raises TG levels by impairing TG catabolism and by increasing liver and intestinal TG secretion.

  18. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De

    2013-01-01

    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  19. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong

    2015-01-01

    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  20. ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena.

    PubMed

    Ning, YingZhi; Dang, Huai; Liu, GuangLong; Xiong, Jie; Yuan, DongXia; Feng, LiFang; Miao, Wei

    2015-03-01

    The reuse of dichlorodiphenyltrichloroethane (DDT) as an indoor residual spray was permitted by the World Health Organization in 2007, and approximately 14 countries still use DDT to control disease vectors. The extensive exposure of insects to DDT has resulted in the emergence of DDT resistance, especially in mosquitoes, and the mechanism for this resistance in mosquitoes has been widely reported. Spraying can also introduce DDT directly into surface water, and DDT can subsequently accumulate in microorganisms, but the mechanism for the resistance to DDT degradation in microorganisms is unclear. Using whole-genome microarray analysis, we detected an abcb15 gene that was up-regulated in a specific manner by DDT treatment in T. thermophile. The deduced ABCB15 peptide sequence had two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) to form the structure TMD-NBD-TMD-NBD, and each NBD contained three conserved motifs: Walker-A, C-loop, and Walker-B, which indicated the T. thermophila abcb15 was a typical ABC transporter gene. The expression of ABCB15 fused with a C-terminal green fluorescent protein was found to be on the periphery of the cell, suggesting that ABCB15 was a membrane pump protein. In addition, cells with abcb15 partially knocked down (abcb15-KD) grew slower than wild-type cells in the presence of 256 mg L(-1) DDT, indicating the tolerance of abcb15-KD strain to DDT exposure was decreased. Thus, we suggest that in Tetrahymena, the membrane pump protein encoded by ABCT gene abcb15 can enhance the tolerance to DDT and protect cells from this exogenous toxin by efficiently pumping it to the extracellular space.

  1. ATP alone triggers the outward facing conformation of the maltose ATP-binding cassette transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-02-01

    The maltose transporter MalFGK(2) is a study prototype for ABC importers. During catalysis, the MalFG membrane domain alternates between inward and outward facing conformations when the MalK dimer closes and hydrolyzes ATP. Because a rapid ATP hydrolysis depends on MalE and maltose, it has been proposed that closed liganded MalE facilitates the transition to the outward facing conformation. Here we find that, in contrast to the expected, ATP is sufficient for the closure of MalK and for the conversion of MalFG to the outward facing state. The outward facing transporter binds MalE with nanomolar affinity, yet neither MalE nor maltose is necessary or facilitates the transition. Thus, the rapid hydrolysis of ATP observed in the presence of MalE and maltose is not because closed liganded MalE accelerates the formation of the outward facing conformation. These findings have fundamental implications for the description of the transport reaction.

  2. Asymptomatic individuals with high HDL-C levels overexpress ABCA1 and ABCG1 and present miR-33a dysregulation in peripheral blood mononuclear cells.

    PubMed

    Scherrer, D Z; Zago, V H S; Parra, E S; Avansini, S; Panzoldo, N B; Alexandre, F; Baracat, J; Nakandakare, E R; Quintão, E C R; de Faria, E C

    2015-10-01

    Considering the growing knowledge and perspectives on microRNAs (miRNAs) that control high-density lipoprotein cholesterol (HDL-C) levels and metabolism, this study aimed at evaluating whether hsa-miR-33a and hsa-miR-128a are differentially expressed in peripheral blood mononuclear cells from asymptomatic individuals with low and high HDL-C, as well as at investigating the potential relationships with ATP binding cassete transporter A1 (ABCA1) expression, cholesterol efflux capacity and other parameters related with reverse cholesterol transport. In addition, the associations with cardiovascular risk were investigated by carotid-intima media thickness (cIMT). Asymptomatic volunteers of both genders (n=51) were classified according to HDL-C (mg/dL) in hypoalphalipoproteinemics (hypo, HDL-C ≤3 9), hyperalphalipoproteinemics (hyper, HDL-C ≥ 68) and controls (CTL, HDL-C ≥ 40<68). cIMT, lipids, lipoproteins, HDL size and volume, C reactive protein and insulin were determined, as well as the activities of several proteins and enzymes related to HDL metabolism. In a subgroup of 19 volunteers the cellular cholesterol efflux and HDL composition were determined. Total RNA was extracted from peripheral blood mononuclear cells for relative quantification experiments. Hypo volunteers presented significantly higher levels of triglycerides, VLDL-C and insulin; in addition, HDL size and volume decreased when compared with CTL and hyper. Regarding gene expression analysis, the hyper group presented a decrease of 72% in hsa-miR-33a and higher mRNA expression of ABCA1 and ABCG1 when compared with CTL. No significant differences in hsa-miR-128a expression, cholesterol efflux, cIMT or plaques were found. Further studies are necessary to elucidate the mechanisms underlying the complex miRNA network, regulating cellular cholesterol homeostasis in humans and its clinical repercussions.

  3. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  4. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  5. Dysregulation of cholesterol homeostasis in human prostate cancer through loss of ABCA1

    PubMed Central

    Lee, Byron H.; Taylor, Margaret G.; Robinet, Peggy; Smith, Jonathan D.; Schweitzer, Jessica; Sehayek, Ephraim; Falzarano, Sara M.; Magi-Galluzzi, Cristina; Klein, Eric A.; Ting, Angela H.

    2012-01-01

    Recent epidemiologic data show that low serum cholesterol level as well as statin use is associated with a decreased risk of developing aggressive or advanced prostate cancer, suggesting a role for cholesterol in aggressive prostate cancer development. Intracellular cholesterol promotes prostate cancer progression as a substrate for de novo androgen synthesis and through regulation of AKT signaling. By performing next-generation sequencing-based DNA methylome analysis, we have discovered marked hypermethylation at the promoter of the major cellular cholesterol efflux transporter, ABCA1, in LNCaP prostate cancer cells. ABCA1 promoter hypermethylation renders the promoter unresponsive to trans-activation and leads to elevated cholesterol levels in LNCaP. ABCA1 promoter hypermethylation is enriched in intermediate to high grade prostate cancers and not detectable in benign prostate. Remarkably, ABCA1 down-regulation is evident in all prostate cancers examined, and expression levels are inversely correlated with Gleason grade. Our results suggest cancer-specific ABCA1 hypermethylation and loss of protein expression direct high intracellular cholesterol levels and hence contribute to an environment conducive to tumor progression. PMID:23233737

  6. Smooth Muscle Cell Foam Cell Formation, Apolipoproteins, and ABCA1 in Intracranial Aneurysms: Implications for Lipid Accumulation as a Promoter of Aneurysm Wall Rupture.

    PubMed

    Ollikainen, Eliisa; Tulamo, Riikka; Lehti, Satu; Lee-Rueckert, Miriam; Hernesniemi, Juha; Niemelä, Mika; Ylä-Herttuala, Seppo; Kovanen, Petri T; Frösen, Juhana

    2016-07-01

    Saccular intracranial aneurysm (sIA) aneurysm causes intracranial hemorrhages that are associated with high mortality. Lipid accumulation and chronic inflammation occur in the sIA wall. A major mechanism for lipid clearance from arteries is adenosine triphosphate-binding cassette A1 (ABCA1)-mediated lipid efflux from foam cells to apolipoprotein A-I (apoA-I). We investigated the association of wall degeneration, inflammation, and lipid-related parameters in tissue samples of 16 unruptured and 20 ruptured sIAs using histology and immunohistochemistry. Intracellular lipid accumulation was associated with wall remodeling (p = 0.005) and rupture (p = 0.020). Foam cell formation was observed in smooth muscle cells, in addition to CD68- and CD163-positive macrophages. Macrophage infiltration correlated with intracellular lipid accumulation and apolipoproteins, including apoA-I. ApoA-I correlated with markers of lipid accumulation and wall degeneration (p = 0.01). ApoA-I-positive staining colocalized with ABCA1-positive cells particularly in sIAs with high number of smooth muscle cells (p = 0.003); absence of such colocalization was associated with wall degeneration (p = 0.017). Known clinical risk factors for sIA rupture correlated inversely with apoA-I. We conclude that lipid accumulation associates with sIA wall degeneration and risk of rupture, possibly via formation of foam cells and subsequent loss of mural cells. Reduced removal of lipids from the sIA wall via ABCA1-apoA-I pathway may contribute to this process.

  7. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  8. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  9. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  10. ABCA1 gene variants regulate posprandial lipid metabolism in healthy men

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Genetic variants of ABCA1, a member of a large family of conserved transmembrane proteins, have been linked to altered atherosclerosis progression and fasting lipid concentration, mainly HDL and Apolipoprotein A, but results from different studies have been inconsistent. Methods and res...

  11. ABCA1-dependent sterol release: sterol molecule specificity and potential membrane domain for HDL biogenesis

    PubMed Central

    Yamauchi, Yoshio; Yokoyama, Shinji; Chang, Ta-Yuan

    2016-01-01

    Mammalian cells synthesize various sterol molecules, including the C30 sterol, lanosterol, as cholesterol precursors in the endoplasmic reticulum. The build-up of precursor sterols, including lanosterol, displays cellular toxicity. Precursor sterols are found in plasma HDL. How these structurally different sterols are released from cells is poorly understood. Here, we show that newly synthesized precursor sterols arriving at the plasma membrane (PM) are removed by extracellular apoA-I in a manner dependent on ABCA1, a key macromolecule for HDL biogenesis. Analysis of sterol molecules by GC-MS and tracing the fate of radiolabeled acetate-derived sterols in normal and mutant Niemann-Pick type C cells reveal that ABCA1 prefers newly synthesized sterols, especially lanosterol, as the substrates before they are internalized from the PM. We also show that ABCA1 resides in a cholesterol-rich membrane domain resistant to the mild detergent, Brij 98. Blocking ACAT activity increases the cholesterol contents of this domain. Newly synthesized C29/C30 sterols are transiently enriched within this domain, but rapidly disappear from this domain with a half-life of less than 1 h. Our work shows that substantial amounts of precursor sterols are transported to a certain PM domain and are removed by the ABCA1-dependent pathway. PMID:26497474

  12. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  13. Amphipathic polyproline peptides stimulate cholesterol efflux by the ABCA1 transporter.

    PubMed

    Sviridov, D O; Drake, S K; Freeman, L A; Remaley, A T

    2016-03-18

    ApoA-I mimetics are short synthetic peptides that contain an amphipathic α-helix and stimulate cholesterol efflux by the ABCA1 transporter in a detergent-like extraction mechanism. We investigated the use of amphipathic peptides with a polypro helix for stimulating cholesterol efflux by ABCA1. Polypro peptides were synthesized with modified prolines, containing either a hydrophobic phenyl group (Prop) or a polar N-acetylgalactosamine (Prog) attached to the pyrrolidine ring and were designated as either PP-2, 3, 4, or 5, depending on the number of 3 amino acid repeat units (Prop-Prog-Prop). Based on molecular modeling, these peptides were predicted to be relatively rigid and to bind to a phospholipid bilayer. By CD spectroscopy, PP peptides formed a Type-II polypro helix in an aqueous solution. PP-2 was inactive in promoting cholesterol efflux, but peptides with more than 2 repeat units were active. PP-4 showed a similar Vmax as a much longer amphipathic α-helical peptide, containing 37 amino acids, but had a Km that was approximately 20-fold lower. PP peptides were specific in that they did not stimulate cholesterol efflux from cells not expressing ABCA1 and were also non-cytotoxic. Addition of PP-3, 4 and 5 to serum promoted the formation of smaller size HDL species (7 nM) and increased its capacity for ABCA1-dependent cholesterol efflux by approximately 20-35% (p < 0.05). Because of their relatively small size and increased potency, amphipathic peptides with a polypro helix may represent an alternative structural motif for the development of apoA-I mimetic peptides.

  14. Hormonal modulators of glial ABCA1 and apoE levels[S

    PubMed Central

    Fan, Jianjia; Shimizu, Yoko; Chan, Jeniffer; Wilkinson, Anna; Ito, Ayaka; Tontonoz, Peter; Dullaghan, Edie; Galea, Liisa A. M.; Pfeifer, Tom; Wellington, Cheryl L.

    2013-01-01

    Apolipoprotein E (apoE) is the major lipid carrier in the central nervous system. As apoE plays a major role in the pathogenesis of Alzheimer disease (AD) and also mediates repair pathways after several forms of acute brain injury, modulating the expression, secretion, or function of apoE may provide potential therapeutic approaches for several neurological disorders. Here we show that progesterone and a synthetic progestin, lynestrenol, significantly induce apoE secretion from human CCF-STTG1 astrocytoma cells, whereas estrogens and the progesterone metabolite allopregnanolone have negligible effects. Intriguingly, lynestrenol also increases expression of the cholesterol transporter ABCA1 in CCF-STTG1 astrocytoma cells, primary murine glia, and immortalized murine astrocytes that express human apoE3. The progesterone receptor inhibitor RU486 attenuates the effect of progestins on apoE expression in CCF-STTG1 astrocytoma cells but has no effect on ABCA1 expression in all glial cell models tested, suggesting that the progesterone receptor (PR) may participate in apoE but does not affect ABCA1 regulation.These results suggest that selective reproductive steroid hormones have the potential to influence glial lipid homeostasis through liver X receptor-dependent and progesterone receptor-dependent pathways. PMID:23999864

  15. Helix stabilization of amphipathic peptides by hydrocarbon stapling increases cholesterol efflux by the ABCA1 transporter.

    PubMed

    Sviridov, D O; Ikpot, I Z; Stonik, J; Drake, S K; Amar, M; Osei-Hwedieh, D O; Piszczek, G; Turner, S; Remaley, A T

    2011-07-08

    Apolipoprotein mimetic peptides are short amphipathic peptides that efflux cholesterol from cells by the ABCA1 transporter and are being investigated as therapeutic agents for cardiovascular disease. We examined the role of helix stabilization of these peptides in cholesterol efflux. A 23-amino acid long peptide (Ac-VLEDSFKVSFLSALEEYTKKLNTQ-NH2) based on the last helix of apoA-I (A10) was synthesized, as well as two variants, S1A10 and S2A10, in which the third and fourth and third and fifth turn of each peptide, respectively, were covalently joined by hydrocarbon staples. By CD spectroscopy, the stapled variants at 24 °C were more helical in aqueous buffer than A10 (A10 17%, S1A10 62%, S2A10 97%). S1A10 and S2A10 unlike A10 were resistant to proteolysis by pepsin and chymotrypsin. S1A10 and S2A10 showed more than a 10-fold increase in cholesterol efflux by the ABCA1 transporter compared to A10. In summary, hydrocarbon stapling of amphipathic peptides increases their helicity, makes them resistant to proteolysis and enhances their ability to promote cholesterol efflux by the ABCA1 transporter, indicating that this peptide modification may be useful in the development of apolipoprotein mimetic peptides.

  16. Cholesterol Transporters ABCA1 and ABCG1 Gene Expression in Peripheral Blood Mononuclear Cells in Patients with Metabolic Syndrome

    PubMed Central

    Tavoosi, Zahra; Moradi-Sardareh, Hemen; Saidijam, Massoud; Yadegarazari, Reza; Borzuei, Shiva; Soltanian, Alireza; Goodarzi, Mohammad Taghi

    2015-01-01

    ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran) during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75%) compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P < 0.05). Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression. PMID:26788366

  17. Lipid abnormalities in alpha/beta2-syntrophin null mice are independent from ABCA1

    PubMed Central

    Hebel, Tobias; Eisinger, Kristina; Neumeier, Markus; Rein-Fischboeck, Lisa; Pohl, Rebekka; Meier, Elisabeth M.; Boettcher, Alfred; Froehner, Stanley C.; Adams, Marvin E.; Liebisch, Gerhard; Krautbauer, Sabrina; Buechler, Christa

    2015-01-01

    The syntrophins alpha (SNTA) and beta 2 (SNTB2) are molecular adaptor proteins shown to stabilize ABCA1, an essential regulator of HDL cholesterol. Furthermore, SNTB2 is involved in glucose stimulated insulin release. Hyperglycemia and dyslipidemia are characteristic features of the metabolic syndrome, a serious public health problem with rising prevalence. Therefore, it is important to understand the role of the syntrophins herein. Mice deficient for both syntrophins (SNTA/B2−/−) have normal insulin and glucose tolerance, hepatic ABCA1 protein and cholesterol. When challenged with a HFD, wild type and SNTA/B2−/− mice have similar weight gain, adiposity, serum and liver triglycerides. Hepatic ABCA1, serum insulin and insulin sensitivity are normal while glucose tolerance is impaired. Liver cholesterol is reduced, and expression of SREBP2 and HMG-CoA-R is increased in the knockout mice. Scavenger receptor-BI (SR-BI) protein is strongly diminished in the liver of SNTA/B2−/− mice while SR-BI binding protein NHERF1 is not changed and PDZK1 is even induced. Knock-down of SNTA, SNTB2 or both has no effect on hepatocyte SR-BI and PDZK1 proteins. Further, SR-BI levels are not reduced in brown adipose tissue of SNTA/B2−/− mice excluding that syntrophins directly stabilize SR-BI. SR-BI stability is regulated by MAPK and phosphorylated ERK2 is induced in the liver of the knock-out mice. Blockage of ERK activity upregulates hepatocyte SR-BI showing that increased MAPK activity contributes to low SR-BI. Sphingomyelin which is well described to regulate cholesterol metabolism is reduced in the liver and serum of the knock-out mice while the size of serum lipoproteins is not affected. Current data exclude a major function of these syntrophins in ABCA1 activity and insulin release but suggest a role in regulating glucose uptake, ERK and SR-BI levels, and sphingomyelin metabolism in obesity. PMID:25625330

  18. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  19. LXRs link metabolism to inflammation through Abca1-dependent regulation of membrane composition and TLR signaling

    PubMed Central

    Ito, Ayaka; Hong, Cynthia; Rong, Xin; Zhu, Xuewei; Tarling, Elizabeth J; Hedde, Per Niklas; Gratton, Enrico; Parks, John; Tontonoz, Peter

    2015-01-01

    The liver X receptors (LXRs) are transcriptional regulators of lipid homeostasis that also have potent anti-inflammatory effects. The molecular basis for their anti-inflammatory effects is incompletely understood, but has been proposed to involve the indirect tethering of LXRs to inflammatory gene promoters. Here we demonstrate that the ability of LXRs to repress inflammatory gene expression in cells and mice derives primarily from their ability to regulate lipid metabolism through transcriptional activation and can occur in the absence of SUMOylation. Moreover, we identify the putative lipid transporter Abca1 as a critical mediator of LXR's anti-inflammatory effects. Activation of LXR inhibits signaling from TLRs 2, 4 and 9 to their downstream NF-κB and MAPK effectors through Abca1-dependent changes in membrane lipid organization that disrupt the recruitment of MyD88 and TRAF6. These data suggest that a common mechanism-direct transcriptional activation-underlies the dual biological functions of LXRs in metabolism and inflammation. DOI: http://dx.doi.org/10.7554/eLife.08009.001 PMID:26173179

  20. Plasma Membrane Profiling Reveals Upregulation of ABCA1 by Infected Macrophages Leading to Restriction of Mycobacterial Growth

    PubMed Central

    Long, Jing; Basu Roy, Robindra; Zhang, Yanjia J.; Antrobus, Robin; Du, Yuxian; Smith, Duncan L.; Weekes, Michael P.; Javid, Babak

    2016-01-01

    The plasma membrane represents a critical interface between the internal and extracellular environments, and harbors multiple proteins key receptors and transporters that play important roles in restriction of intracellular infection. We applied plasma membrane profiling, a technique that combines quantitative mass spectrometry with selective cell surface aminooxy-biotinylation, to Bacille Calmette–Guérin (BCG)-infected THP-1 macrophages. We quantified 559 PM proteins in BCG-infected THP-1 cells. One significantly upregulated cell-surface protein was the cholesterol transporter ABCA1. We showed that ABCA1 was upregulated on the macrophage cell-surface following infection with pathogenic mycobacteria and knockdown of ABCA1 resulted in increased mycobacterial survival within macrophages, suggesting that it may be a novel mycobacterial host-restriction factor. PMID:27462310

  1. Cassette Books.

    ERIC Educational Resources Information Center

    Library of Congress, Washington, DC. National Library Service for the Blind and Physically Handicapped.

    This catalog lists cassette books produced by the National Library Service for the Blind and Physically Handicapped during 1989. Books are listed alphabetically within subject categories under nonfiction and fiction headings. Nonfiction categories include: animals and wildlife, the arts, bestsellers, biography, blindness and physical handicaps,…

  2. Do ATP-binding cassette transporters cause pharmacoresistance in epilepsy? Problems and approaches in determining which antiepileptic drugs are affected.

    PubMed

    Löscher, Wolfgang; Luna-Tortós, Carlos; Römermann, Kerstin; Fedrowitz, Maren

    2011-01-01

    Resistance to multiple antiepileptic drugs (AEDs) is a common problem in epilepsy, affecting at least 30% of patients. One prominent hypothesis to explain this resistance suggests an inadequate penetration or excess efflux of AEDs across the blood - brain barrier (BBB) as a result of overexpressed efflux transporters such as P-glycoprotein (Pgp), the encoded product of the multidrug resistance- 1 (MDR1, ABCB1) gene. Pgp and MDR1 are markedly increased in epileptogenic brain tissue of patients with AED-resistant partial epilepsy and following seizures in rodent models of partial epilepsy. In rodent models, AED-resistant rats exhibit higher Pgp levels than responsive animals; increased Pgp expression is associated with lower brain levels of AEDs; and, most importantly, co-administration of Pgp inhibitors reverses AED resistance. Thus, it is reasonable to conclude that Pgp plays a significant role in mediating resistance to AEDs in rodent models of epilepsy - however, whether this phenomenon extends to at least some human refractory epilepsy remains unclear, particularly because it is still a matter of debate which AEDs, if any, are transported by human Pgp. The difficulty in determining which AEDs are substrates of human Pgp is mainly a consequence of the fact that AEDs are highly permeable compounds, which are not easily identified as Pgp substrates in in vitro models of the BBB, such as monolayer (Transwell(®)) efflux assays. By using a modified assay (concentration equilibrium transport assay; CETA), which minimizes the influence of high transcellular permeability, two groups have recently demonstrated that several major AEDs are transported by human Pgp. Importantly, it was demonstrated in these studies that Pgp-mediated transport highly depends on the AED concentration and may not be identified if concentrations below or above the therapeutic range are used. In addition to the efflux transporters, seizure-induced alterations in BBB integrity and activity of drug metabolizing enzymes (CYPs) affect the brain uptake of AEDs. For translating these findings to the clinical arena, in vivo imaging studies using positron emission tomography (PET) with (11)C-labelled AEDs in epileptic patients are under way.

  3. Linoleic acid suppresses cholesterol efflux and ATP-binding cassette transporters in murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus (T2DM) are at increased risk of developing cardiovascular disease (CVD), possibly associated with elevated plasma free fatty acid concentrations. Paradoxically, evidence suggests that unsaturated, compared to saturated fatty acids, suppress macrophage chole...

  4. Heterocyclic cyclohexanone monocarbonyl analogs of curcumin can inhibit the activity of ATP-binding cassette transporters in cancer multidrug resistance.

    PubMed

    Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W

    2015-02-01

    Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR.

  5. Gene expression profiling of transporters in the solute carrier and ATP-binding cassette superfamilies in human eye substructures.

    PubMed

    Dahlin, Amber; Geier, Ethan; Stocker, Sophie L; Cropp, Cheryl D; Grigorenko, Elena; Bloomer, Michele; Siegenthaler, Julie; Xu, Lu; Basile, Anthony S; Tang-Liu, Diane D-S; Giacomini, Kathleen M

    2013-02-04

    The barrier epithelia of the cornea and retina control drug and nutrient access to various compartments of the human eye. While ocular transporters are likely to play a critical role in homeostasis and drug delivery, little is known about their expression, localization and function. In this study, the mRNA expression levels of 445 transporters, metabolic enzymes, transcription factors and nuclear receptors were profiled in five regions of the human eye: cornea, iris, ciliary body, choroid and retina. Through RNA expression profiling and immunohistochemistry, several transporters were identified as putative targets for drug transport in ocular tissues. Our analysis identified SLC22A7 (OAT2), a carrier for the antiviral drug acyclovir, in the corneal epithelium, in addition to ABCG2 (BCRP), an important xenobiotic efflux pump, in retinal nerve fibers and the retinal pigment epithelium. Collectively, our results provide an understanding of the transporters that serve to maintain ocular homeostasis and which may be potential targets for drug delivery to deep compartments of the eye.

  6. Regulation and expression of the ATP-binding cassette transporter ABCG2 in human embryonic stem cells.

    PubMed

    Padmanabhan, Raji; Chen, Kevin G; Gillet, Jean-Pierre; Handley, Misty; Mallon, Barbara S; Hamilton, Rebecca S; Park, Kyeyoon; Varma, Sudhir; Mehaffey, Michele G; Robey, Pamela G; McKay, Ronald D G; Gottesman, Michael M

    2012-10-01

    The expression and function of several multidrug transporters (including ABCB1 and ABCG2) have been studied in human cancer cells and in mouse and human adult stem cells. However, the expression of ABCG2 in human embryonic stem cells (hESCs) remains unclear. Limited and contradictory results in the literature from two research groups have raised questions regarding its expression and function. In this study, we used quantitative real-time PCR, Northern blots, whole genome RNA sequencing, Western blots, and immunofluorescence microscopy to study ABCG2 expression in hESCs. We found that full-length ABCG2 mRNA transcripts are expressed in undifferentiated hESC lines. However, ABCG2 protein was undetectable even under embryoid body differentiation or cytotoxic drug induction. Moreover, surface ABCG2 protein was coexpressed with the differentiation marker stage-specific embryonic antigen-1 of hESCs, following constant BMP-4 signaling at days 4 and 6. This expression was tightly correlated with the downregulation of two microRNAs (miRNAs) (i.e., hsa-miR-519c and hsa-miR-520h). Transfection of miRNA mimics and inhibitors of these two miRNAs confirmed their direct involvement in the regulation ABCG2 translation. Our findings clarify the controversy regarding the expression of the ABCG2 gene and also provide new insights into translational control of the expression of membrane transporter mRNAs by miRNAs in hESCs.

  7. Probabilistic orthology analysis of the ATP-binding cassette transporters: implications for the development of multiple drug resistance phenotype.

    PubMed

    Fisher, Ciaran; Coleman, Tanya; Plant, Nick

    2012-07-01

    Drug transporters are rapidly becoming recognized as central to determining a chemical's fate within the body. This action is a double-edged sword, protecting the body from toxicants, but also potentially leading to reduced clinical efficacy of drugs through multiple drug resistance phenotype. To examine the interrelationship of this superfamily, we have constructed phylogenetic trees over an extended evolutionary distance representing each of the seven subfamilies. In addition, using protein sequences from species important in the design and evaluation of novel chemicals, namely human, macaque, rat, mouse, and dog, we have undertaken probabilistic orthology analysis to examine speciation probabilities within this phylogeny. These data allow us to accurately predict orthologous sequences across these species, an important confirmatory step with implications for cross-species extrapolation of data during drug safety testing. Finally, we present the first complete phylogeny for subfamilies within humans constructed using the entire coding sequences, at both the DNA and protein levels. We demonstrate for the first time that genes associated with the multiple drug resistance phenotype cluster separately from other genes within the same subfamily, suggestive of a conserved, fundamental, difference in these proteins. Such work may help guide future studies on the mechanisms underlying multiple drug resistance as well as the development of novel therapeutic approaches to mitigate against its development.

  8. Enhancement of avermectin and ivermectin production by overexpression of the maltose ATP-binding cassette transporter in Streptomyces avermitilis.

    PubMed

    Li, Meng; Chen, Zhi; Zhang, Xuan; Song, Yuan; Wen, Ying; Li, Jilun

    2010-12-01

    We investigated the function of maltose ABC transporter system encoded by malEFG-a and the effect of its overexpression on antibiotic production in Streptomyces avermitilis. A malEFG-a deletion mutant was unable to grow in a minimal medium with maltose as sole carbon source and produce avermectin. Maltose utilization and avermectin production were restored by introduction of a single copy of malEFG-a. RT-PCR analysis showed that the expression of malE-a was induced by maltose, and was strongly repressed by glucose. When multi-copy, integrative malEFG-a gene expression vectors were introduced into wild-type strain ATCC31267 and ivermectin-producer OI-31, antibiotic production increased by 2.6- to 3.3-fold and the time required for fermentation decreased by about 10%. The overexpression of malEFG-a improved the utilization rate of starch, and thereby enhanced avermectin production. Such an approach would be useful for the improvement of commercial antibiotic production using starch as the main carbon source in the fermentation process.

  9. A Novel Mutation in ABCA1 Gene Causing Tangier Disease in an Italian Family with Uncommon Neurological Presentation

    PubMed Central

    Ceccanti, Marco; Cambieri, Chiara; Frasca, Vittorio; Onesti, Emanuela; Biasiotta, Antonella; Giordano, Carla; Bruno, Sabina M.; Testino, Giancarlo; Lucarelli, Marco; Arca, Marcello; Inghilleri, Maurizio

    2016-01-01

    Tangier disease is an autosomal recessive disorder characterized by severe reduction in high-density lipoprotein cholesterol and peripheral lipid storage. We describe a family with c.5094C > A p.Tyr1698* mutation in the ABCA1 gene, clinically characterized by syringomyelic-like anesthesia, demyelinating multineuropathy, and reduction in intraepidermal small fibers innervation. In the proband patient, cardiac involvement determined a myocardial infarction; lipid storage was demonstrated in gut, cornea, and aortic wall. The reported ABCA1 mutation has never been described before in a Tangier family. PMID:27853448

  10. Analysis of ABCA1 and Cholesterol Efflux in HIV-Infected Cells.

    PubMed

    Mukhamedova, Nigora; Brichacek, Beda; Darwish, Christina; Popratiloff, Anastas; Sviridov, Dmitri; Bukrinsky, Michael

    2016-01-01

    Cholesterol is an essential component of the cellular membranes and, by extension, of the HIV envelope membrane, which is derived from the host cell plasma membrane. Depletion of the cellular cholesterol has an inhibitory effect on HIV assembly, reduces infectivity of the produced virions, and makes the cell less susceptible to HIV infection. It is not surprising that the virus has evolved to gain access to cellular proteins regulating cholesterol metabolism. One of the key mechanisms used by HIV to maintain high levels of cholesterol in infected cells is Nef-mediated inhibition of cholesterol efflux and the cholesterol transporter responsible for this process, ABCA1. In this chapter, we describe methods to investigate these effects of HIV-1 infection.

  11. Quercetin increases macrophage cholesterol efflux to inhibit foam cell formation through activating PPARγ-ABCA1 pathway.

    PubMed

    Sun, Liqiang; Li, En; Wang, Feng; Wang, Tao; Qin, Zhiping; Niu, Shaohui; Qiu, Chunguang

    2015-01-01

    The accumulation of cholesterol in macrophages could induce the formation of foam cells and increase the risk of developing atherosclerosis. We wonder if quercetin, one of flavonoids with anti-inflammation functions in different cell types, could elevate the development of foam cells formation in atherosclerosis. We treated foam cells derived from oxLDL induced THP-1 cells with quercetin, and evaluated the foam cells formation, cholesterol content and apoptosis of the cells. We found that quercetin induced the expression of ABCA1 in differentiated THP-1 cells, and increased the cholesterol efflux from THP-1 cell derived foam cells. Eventually, cholesterol level and the formation of foam cell derived from THP-1 cells decreased after quercetin treatment. In addition, quercetin activated PPARγ-LXRα pathway to upregulate ABCA1 expression through increasing protein level of PPARγ and its transcriptional activity. Inhibition of PPARγ activity by siRNA knockdown or the addition of chemical inhibitor, GW9662, abolished quercetin induced ABCA1 expression and cholesterol efflux in THP-1 derived macrophages. Our data demonstrated that quercetin increased cholesterol efflux from macrophages through upregulating the expressions of PPARγ and ABCA1. Taken together, increasing uptake of quercetin or quercetin-rich foods would be an effective way to lower the risk of atherosclerosis.

  12. Quercetin increases macrophage cholesterol efflux to inhibit foam cell formation through activating PPARγ-ABCA1 pathway

    PubMed Central

    Sun, Liqiang; Li, En; Wang, Feng; Wang, Tao; Qin, Zhiping; Niu, Shaohui; Qiu, Chunguang

    2015-01-01

    The accumulation of cholesterol in macrophages could induce the formation of foam cells and increase the risk of developing atherosclerosis. We wonder if quercetin, one of flavonoids with anti-inflammation functions in different cell types, could elevate the development of foam cells formation in atherosclerosis. We treated foam cells derived from oxLDL induced THP-1 cells with quercetin, and evaluated the foam cells formation, cholesterol content and apoptosis of the cells. We found that quercetin induced the expression of ABCA1 in differentiated THP-1 cells, and increased the cholesterol efflux from THP-1 cell derived foam cells. Eventually, cholesterol level and the formation of foam cell derived from THP-1 cells decreased after quercetin treatment. In addition, quercetin activated PPARγ-LXRα pathway to upregulate ABCA1 expression through increasing protein level of PPARγ and its transcriptional activity. Inhibition of PPARγ activity by siRNA knockdown or the addition of chemical inhibitor, GW9662, abolished quercetin induced ABCA1 expression and cholesterol efflux in THP-1 derived macrophages. Our data demonstrated that quercetin increased cholesterol efflux from macrophages through upregulating the expressions of PPARγ and ABCA1. Taken together, increasing uptake of quercetin or quercetin-rich foods would be an effective way to lower the risk of atherosclerosis. PMID:26617799

  13. Multi-Layer Identification of Highly-Potent ABCA1 Up-Regulators Targeting LXRβ Using Multiple QSAR Modeling, Structural Similarity Analysis, and Molecular Docking.

    PubMed

    Chen, Meimei; Yang, Fafu; Kang, Jie; Yang, Xuemei; Lai, Xinmei; Gao, Yuxing

    2016-11-29

    In this study, in silico approaches, including multiple QSAR modeling, structural similarity analysis, and molecular docking, were applied to develop QSAR classification models as a fast screening tool for identifying highly-potent ABCA1 up-regulators targeting LXRβ based on a series of new flavonoids. Initially, four modeling approaches, including linear discriminant analysis, support vector machine, radial basis function neural network, and classification and regression trees, were applied to construct different QSAR classification models. The statistics results indicated that these four kinds of QSAR models were powerful tools for screening highly potent ABCA1 up-regulators. Then, a consensus QSAR model was developed by combining the predictions from these four models. To discover new ABCA1 up-regulators at maximum accuracy, the compounds in the ZINC database that fulfilled the requirement of structural similarity of 0.7 compared to known potent ABCA1 up-regulator were subjected to the consensus QSAR model, which led to the discovery of 50 compounds. Finally, they were docked into the LXRβ binding site to understand their role in up-regulating ABCA1 expression. The excellent binding modes and docking scores of 10 hit compounds suggested they were highly-potent ABCA1 up-regulators targeting LXRβ. Overall, this study provided an effective strategy to discover highly potent ABCA1 up-regulators.

  14. Increased cellular free cholesterol in macrophage-specific Abca1 knock-out mice enhances pro-inflammatory response of macrophages.

    PubMed

    Zhu, Xuewei; Lee, Ji-Young; Timmins, Jenelle M; Brown, J Mark; Boudyguina, Elena; Mulya, Anny; Gebre, Abraham K; Willingham, Mark C; Hiltbold, Elizabeth M; Mishra, Nilamadhab; Maeda, Nobuyo; Parks, John S

    2008-08-22

    Macrophage-specific Abca1 knock-out (Abca1(-)(M)(/-)(M)) mice were generated to determine the role of macrophage ABCA1 expression in plasma lipoprotein concentrations and the innate immune response of macrophages. Plasma lipid and lipoprotein concentrations in chow-fed Abca1(-)(M)(/-)(M) and wild-type (WT) mice were indistinguishable. Compared with WT macrophages, Abca1(-)(M)(/-)(M) macrophages had a >95% reduction in ABCA1 protein, failed to efflux lipid to apoA-I, and had a significant increase in free cholesterol (FC) and membrane lipid rafts without induction of endoplasmic reticulum stress. Lipopolysaccharide (LPS)-treated Abca1(-)(M)(/-)(M) macrophages exhibited enhanced expression of pro-inflammatory cytokines and increased activation of the NF-kappaB and MAPK pathways, which could be diminished by silencing MyD88 or by chemical inhibition of NF-kappaB or MAPK. In vivo LPS injection also resulted in a higher pro-inflammatory response in Abca1(-)(M)(/-)(M) mice compared with WT mice. Furthermore, cholesterol depletion of macrophages with methyl-beta-cyclodextrin normalized FC content between the two genotypes and their response to LPS; cholesterol repletion of macrophages resulted in increased cellular FC accumulation and enhanced cellular response to LPS. Our results suggest that macrophage ABCA1 expression may protect against atherosclerosis by facilitating the net removal of excess lipid from macrophages and dampening pro-inflammatory MyD88-dependent signaling pathways by reduction of cell membrane FC and lipid raft content.

  15. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  16. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.

    PubMed

    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M

    2001-12-01

    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  17. Difference in expression patterns of placental cholesterol transporters, ABCA1 and SR-BI, in Meishan and Yorkshire pigs with different placental efficiency

    PubMed Central

    Hong, Linjun; Xu, Xiangdong; Huang, Ji; Lei, Minggang; Xu, Dequan; Zhao, Shuhong; Yu, Mei

    2016-01-01

    Cholesterol is a key cell membrane component and precursor of steroid hormones. The maternal cholesterol is an important exogenous cholesterol source for the developing embryos and its transportation is mediated by ABCA1 and SR-BI. Here we reported that during the peri-implantation period in pigs, ABCA1 was expressed by uterine luminal epithelium (LE) and interestingly, its expression was more abundantly in LE on mesometrial side of uterus. However, SR-BI was expressed primarily by LE, glandular epithelial cells (GE) and trophoblast cells (Tr). During the placentation period, the expression levels of ABCA1 and SR-BI proteins at epithelial bilayer and placental areolae were significantly higher in Chinese Meishan pigs compared to Yorkshire pigs. Consisitently, mRNA levels of HMGCR, the rate-limiting enzyme for cholesterol synthesis, were significantly higher in Meishan placentas than in Yorkshire placentas. Our findings revealed the routes of transplacental cholesterol transport mediated by ABCA1 and SR-BI in pigs and indicated that ABCA1 related pathway may participate in anchoring the conceptus to the mesometrial side of uterus. Additionally, an ABCA1 dependent compensatory mechanism related to the placental efficiency in response to the smaller placenta size in Meishan pigs was suggested. PMID:26852751

  18. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  19. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  20. EEPD1 Is a Novel LXR Target Gene in Macrophages Which Regulates ABCA1 Abundance and Cholesterol Efflux

    PubMed Central

    Nelson, Jessica Kristine; Koenis, Duco Steven; Scheij, Saskia; Cook, Emma Clare Laura; Moeton, Martina; Santos, Ana; Lobaccaro, Jean-Marc Adolphe; Baron, Silvere

    2017-01-01

    Objective— The sterol-responsive nuclear receptors, liver X receptors α (LXRα, NR1H3) and β (LXRβ, NR1H2), are key determinants of cellular cholesterol homeostasis. LXRs are activated under conditions of high cellular sterol load and induce expression of the cholesterol efflux transporters ABCA1 and ABCG1 to promote efflux of excess cellular cholesterol. However, the full set of genes that contribute to LXR-stimulated cholesterol efflux is unknown, and their identification is the objective of this study. Approach and Results— We systematically compared the global transcriptional response of macrophages to distinct classes of LXR ligands. This allowed us to identify both common and ligand-specific transcriptional responses in macrophages. Among these, we identified endonuclease–exonuclease–phosphatase family domain containing 1 (EEPD1/KIAA1706) as a direct transcriptional target of LXRs in human and murine macrophages. EEPD1 specifically localizes to the plasma membrane owing to the presence of a myristoylation site in its N terminus. Accordingly, the first 10 amino acids of EEPD1 are sufficient to confer plasma membrane localization in the context of a chimeric protein with GFP. Functionally, we report that silencing expression of EEPD1 blunts maximal LXR-stimulated Apo AI-dependent efflux and demonstrate that this is the result of reduced abundance of ABCA1 protein in human and murine macrophages. Conclusions— In this study, we identify EEPD1 as a novel LXR-regulated gene in macrophages and propose that it promotes cellular cholesterol efflux by controlling cellular levels and activity of ABCA1. PMID:28082258

  1. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  2. Video Cartridges and Cassettes.

    ERIC Educational Resources Information Center

    Kletter, Richard C.; Hudson, Heather

    The economic and social significance of video cassettes (viewer-controlled playback system) is explored in this report. The potential effect of video cassettes on industrial training, education, libraries, and television is analyzed in conjunction with the anticipated hardware developments. The entire video cassette industry is reviewed firm by…

  3. Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma

    PubMed Central

    Fogarty, Rhys; Sharma, Shiwani; Hewitt, Alex W.; Martin, Sarah; Law, Matthew H.; Cremin, Katie; Bailey, Jessica N. Cooke; Loomis, Stephanie J.; Pasquale, Louis R.; Haines, Jonathan L.; Hauser, Michael A.; Viswanathan, Ananth C.; McGuffin, Peter; Topouzis, Fotis; Foster, Paul J.; Graham, Stuart L; Casson, Robert J; Chehade, Mark; White, Andrew J; Zhou, Tiger; Souzeau, Emmanuelle; Landers, John; Fitzgerald, Jude T; Klebe, Sonja; Ruddle, Jonathan B; Goldberg, Ivan; Healey, Paul R; Mills, Richard A.; Wang, Jie Jin; Montgomery, Grant W.; Martin, Nicholas G.; Radford-Smith, Graham; Whiteman, David C.; Brown, Matthew A.; Wiggs, Janey L.; Mackey, David A; Mitchell, Paul; MacGregor, Stuart; Craig, Jamie E.

    2014-01-01

    Primary open-angle glaucoma (POAG) is a major cause of irreversible blindness worldwide. We performed a genome-wide association study in an Australian discovery cohort comprising 1,155 advanced POAG cases and 1,992 controls. Association of the top SNPs from the discovery stage was investigated in two Australian replication cohorts (total 932 cases, 6,862 controls) and two US replication cohorts (total 2,616 cases, 2,634 controls). Meta-analysis of all cohorts revealed three novel loci associated with development of POAG. These loci are located upstream of ABCA1 (rs2472493 [G] OR=1.31, P= 2.1 × 10−19), within AFAP1 (rs4619890 [G] OR=1.20, P= 7.0 × 10−10) and within GMDS (rs11969985 [G] OR=1.31, and P= 7.7 × 10−10). Using RT-PCR and immunolabelling, we also showed that these genes are expressed within human retina, optic nerve and trabecular meshwork and that ABCA1 and AFAP1 are also expressed in retinal ganglion cells. PMID:25173105

  4. Group X Secretory Phospholipase A2 Negatively Regulates ABCA1 and ABCG1 expression and cholesterol efflux in macrophages

    PubMed Central

    Shridas, Preetha; Bailey, William M; Gizard, Florence; Oslund, Rob C; Gelb, Michael H; Bruemmer, Dennis; Webb, Nancy R

    2010-01-01

    Objectives Group X secretory phospholipase A2 (GX sPLA2) potently hydrolyzes plasma membranes to generate lysophospholipids and free fatty acids and has been implicated in inflammatory diseases including atherosclerosis. Here we identify a novel role for GX sPLA2 in modulating ABCA1 and ABCG1 expression and hence macrophage cholesterol efflux. Methods and Results Overexpression or exogenous addition of GX sPLA2 significantly reduced ABCA1 and ABCG1 expression in J774 macrophage-like cells, whereas GX sPLA2 deficiency in mouse peritoneal macrophages (MPMs) was associated with enhanced expression. Altered ABC transporter expression led to reduced cholesterol efflux in GX sPLA2 overexpressing J774 cells, and increased efflux in GX sPLA2-deficient MPMs. Gene regulation was dependent on GX sPLA2 catalytic activity, mimicked by arachidonic acid, abrogated when LXRα/β expression was suppressed, and partially reversed by the LXR agonist T0901317. Reporter assays indicated that GX sPLA2 suppresses the ability of LXR to trans-activate its promoters through a mechanism involving the C-terminal portion of LXR spanning the ligand binding domain. Conclusions GX sPLA2 modulates gene expression in macrophages by generating lipolytic products that suppress LXR activation. GX sPLA2 may play a previously unrecognized role in atherosclerotic lipid accumulation by negatively regulating genes critical for cellular cholesterol efflux. PMID:20844270

  5. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  6. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  7. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  8. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  9. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  10. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  11. Correction of Apolipoprotein A-I-mediated Lipid Efflux and High Density Lipoprotein Particle Formation in Human Niemann-Pick Type C Disease Fibroblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Impaired cell cholesterol trafficking in Niemann-Pick type C (NPC) disease results in the first known instance of impaired regulation of the ATP-binding cassette transporter A1 (ABCA1), a lipid transporter mediating the rate-limiting step in high density lipoprotein (HDL) formation, as a cause of lo...

  12. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  13. Novel Apo E-Derived ABCA1 Agonist Peptide (CS-6253) Promotes Reverse Cholesterol Transport and Induces Formation of preβ-1 HDL In Vitro.

    PubMed

    Hafiane, Anouar; Bielicki, John K; Johansson, Jan O; Genest, Jacques

    2015-01-01

    Apolipoprotein (apo) mimetic peptides replicate some aspects of HDL function. We have previously reported the effects of compound ATI-5261 on its ability to replicate many functions of native apo A-I in the process of HDL biogenesis. ATI-5261 induced muscle toxicity in wild type C57Bl/6 mice, increased CPK, ALT and AST and increase in triglyceride (Tg) levels. Aromatic phenylalanine residues on the non-polar face of ATI-5261, together with positively charged arginine residues at the lipid-water interface were responsible for these effects. This information was used to create a novel analog (CS-6253) that was non-toxic. We evaluated this peptide designed from the carboxyl terminus of apo E, in its ability to mimic apo A-I functionality. Our data shows that the lipidated particles generated by incubating cells overexpressing ABCA1 with lipid free CS-6253 enhances the rate of ABCA1 lipid efflux with high affinity interactions with native ABCA1 oligomeric forms and plasma membrane micro-domains. Interaction between ABCA1 and lipid free CS-6253 resulted in formation of nascent HDL-CS-6253 particles that are actively remodeled in plasma. Mature HDL-CS-6253 particles deliver cholesterol to liver cells via SR-BI in-vitro. CS-6253 significantly increases cholesterol efflux in murine macrophages and in human THP-1 macrophage-derived foam cells expressing ABCA1. Addition of CS-6253 to plasma dose-dependently displaced apo A-I from α-HDL particles and led to de novo formation of preβ-1 HDL that stimulates ABCA1 dependent cholesterol efflux efficiently. When incubated with human plasma CS-6253 was also found to bind with HDL and LDL and promoted the transfer of cholesterol from HDL to LDL predominantly. Our data shows that CS-6253 mimics apo A-I in its ability to promote ABCA1-mediated formation of nascent HDL particles, and enhances formation of preβ-1 HDL with increase in the cycling of apo A-I between the preβ and α-HDL particles in-vitro. These mechanisms are

  14. Novel apo E-derived ABCA1 agonist peptide (CS-6253) promotes reverse cholesterol transport and induces formation of preβ-1 HDL in vitro

    DOE PAGES

    Hafiane, Anouar; Bielicki, John K.; Johansson, Jan O.; ...

    2015-07-24

    Apolipoprotein (apo) mimetic peptides replicate some aspects of HDL function. We have previously reported the effects of compound ATI-5261 on its ability to replicate many functions of native apo A-I in the process of HDL biogenesis. ATI-5261 induced muscle toxicity in wild type C57Bl/6 mice, increased CPK, ALT and AST and increase in triglyceride (Tg) levels. Aromatic phenylalanine residues on the non-polar face of ATI-5261, together with positively charged arginine residues at the lipid-water interface were responsible for these effects. This information was used to create a novel analog (CS-6253) that was non-toxic. We evaluated this peptide designed from themore » carboxyl terminus of apo E, in its ability to mimic apo A-I functionality. Our data shows that the lipidated particles generated by incubating cells overexpressing ABCA1 with lipid free CS-6253 enhances the rate of ABCA1 lipid efflux with high affinity interactions with native ABCA1 oligomeric forms and plasma membrane micro-domains. Interaction between ABCA1 and lipid free CS-6253 resulted in formation of nascent HDL-CS-6253 particles that are actively remodeled in plasma. Mature HDL-CS-6253 particles deliver cholesterol to liver cells via SR-BI in-vitro. CS-6253 significantly increases cholesterol efflux in murine macrophages and in human THP-1 macrophage-derived foam cells expressing ABCA1. Addition of CS-6253 to plasma dose-dependently displaced apo A-I from α-HDL particles and led to de novo formation of preβ-1 HDL that stimulates ABCA1 dependent cholesterol efflux efficiently. When incubated with human plasma CS-6253 was also found to bind with HDL and LDL and promoted the transfer of cholesterol from HDL to LDL predominantly. Our data shows that CS-6253 mimics apo A-I in its ability to promote ABCA1-mediated formation of nascent HDL particles, and enhances formation of preβ-1 HDL with increase in the cycling of apo A-I between the preβ and α-HDL particles in-vitro. These mechanisms are

  15. Eicosapentaenoic acid membrane incorporation impairs ABCA1-dependent cholesterol efflux via a protein kinase A signaling pathway in primary human macrophages.

    PubMed

    Fournier, Natalie; Tardivel, Sylviane; Benoist, Jean-François; Vedie, Benoît; Rousseau-Ralliard, Delphine; Nowak, Maxime; Allaoui, Fatima; Paul, Jean-Louis

    2016-04-01

    A diet rich in n-3/n-6 polyunsaturated fatty acids (PUFAs) is cardioprotective. Dietary PUFAs affect the cellular phospholipids composition, which may influence the function of membrane proteins. We investigated the impact of the membrane incorporation of several PUFAs on ABCA1-mediated cholesterol efflux, a key antiatherogenic pathway. Arachidonic acid (AA) (C20:4 n-6) and docosahexaenoic acid (DHA) (C22:6 n-3) decreased or increased cholesterol efflux from J774 mouse macrophages, respectively, whereas they had no effect on efflux from human monocyte-derived macrophages (HMDM). Importantly, eicosapentaenoic acid (EPA) (C20:5 n-3) induced a dose-dependent reduction of ABCA1 functionality in both cellular models (-28% for 70μM of EPA in HMDM), without any alterations in ABCA1 expression. These results show that PUFA membrane incorporation does not have the same consequences on cholesterol efflux from mouse and human macrophages. The EPA-treated HMDM exhibited strong phospholipid composition changes, with high levels of both EPA and its elongation product docosapentaenoic acid (DPA) (C22:5 n-3), which is associated with a decreased level of AA. In HMDM, EPA reduced the ATPase activity of the membrane transporter. Moreover, the activation of adenylate cyclase by forskolin and the inhibition of cAMP phosphodiesterase by isobutylmethylxanthine restored ABCA1 cholesterol efflux in EPA-treated human macrophages. In conclusion, EPA membrane incorporation reduces ABCA1 functionality in mouse macrophages as well as in primary human macrophages and this effect seems to be PKA-dependent in human macrophages.

  16. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  17. Activity-Based Proteomics Reveals Heterogeneous Kinome and ATP-Binding Proteome Responses to MEK Inhibition in KRAS Mutant Lung Cancer.

    PubMed

    Kim, Jae-Young; Stewart, Paul A; Borne, Adam L; Fang, Bin; Welsh, Eric A; Chen, Yian Ann; Eschrich, Steven A; Koomen, John M; Haura, Eric B

    2016-06-01

    One way cancer cells can escape from targeted agents is through their ability to evade drug effects by rapidly rewiring signaling networks. Many protein classes, such as kinases and metabolic enzymes, are regulated by ATP binding and hydrolysis. We hypothesized that a system-level profiling of drug-induced alterations in ATP-binding proteomes could offer novel insights into adaptive responses. Here, we mapped global ATP-binding proteomes perturbed by two clinical MEK inhibitors, AZD6244 and MEK162, in KRAS mutant lung cancer cells as a model system harnessing a desthiobiotin-ATP probe coupled with LC-MS/MS. We observed strikingly unique ATP-binding proteome responses to MEK inhibition, which revealed heterogeneous drug-induced pathway signatures in each cell line. We also identified diverse kinome responses, indicating each cell adapts to MEK inhibition in unique ways. Despite the heterogeneity of kinome responses, decreased probe labeling of mitotic kinases and an increase of kinases linked to autophagy were identified to be common responses. Taken together, our study revealed a diversity of adaptive ATP-binding proteome and kinome responses to MEK inhibition in KRAS mutant lung cancer cells, and our study further demonstrated the utility of our approach to identify potential candidates of targetable ATP-binding enzymes involved in adaptive resistance and to develop rational drug combinations.

  18. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.

    PubMed

    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M

    2012-02-17

    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  19. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.

    PubMed

    Chang, C H; Yu, Z N; Song, D L

    1992-10-01

    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  20. ApoA-I induces S1P release from endothelial cells through ABCA1 and SR-BI in a positive feedback manner.

    PubMed

    Liu, Xing; Ren, Kun; Suo, Rong; Xiong, Sheng-Lin; Zhang, Qing-Hai; Mo, Zhong-Cheng; Tang, Zhen-Li; Jiang, Yue; Peng, Xiao-Shan; Yi, Guang-Hui

    2016-12-01

    Sphingosine-1-phosphate (S1P), which has emerged as a pivotal signaling mediator that participates in the regulation of multiple cellular processes, is derived from various cells, including vascular endothelial cells. S1P accumulates in lipoproteins, especially HDL, and the majority of free plasma S1P is bound to HDL. We hypothesized that HDL-associated S1P is released through mechanisms associated with the HDL maturation process. ApoA-I, a major HDL apolipoprotein, is a critical factor for nascent HDL formation and lipid trafficking via ABCA1. Moreover, apoA-I is capable of promoting bidirectional lipid movement through SR-BI. In the present study, we confirmed that apoA-I can facilitate the production and release of S1P by HUVECs. Furthermore, we demonstrated that ERK1/2 and SphK activation induced by apoA-I is involved in the release of S1P from HUVECs. Inhibitor and siRNA experiments showed that ABCA1 and SR-BI are required for S1P release and ERK1/2 phosphorylation induced by apoA-I. However, the effects triggered by apoA-I were not suppressed by inhibiting ABCA1/JAK2 or the SR-BI/Src pathway. S1P released due to apoA-I activation can stimulate the (ERK1/2)/SphK1 pathway through S1PR (S1P receptor) 1/3. These results indicated that apoA-I not only promotes S1P release through ABCA1 and SR-BI but also indirectly activates the (ERK1/2)/SphK1 pathway by releasing S1P to trigger their receptors. In conclusion, we suggest that release of S1P induced by apoA-I from endothelial cells through ABCA1 and SR-BI is a self-positive-feedback process: apoA-I-(ABCA1 and SR-BI)-(S1P release)-S1PR-ERK1/2-SphK1-(S1P production)-(more S1P release induced by apoA-I).

  1. Variants in the ATP-Binding Cassette Transporter (ABCA7), Apolipoprotein E ε4, and the Risk of Late-Onset Alzheimer Disease in African Americans

    PubMed Central

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Mayeux, Richard

    2013-01-01

    Importance Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. Objective To identify genetic loci associated with late-onset Alzheimer disease in African Americans. Design, Setting, and Participants The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance–weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Main Outcomes and Measures Presence of Alzheimer disease according to standardized criteria. Results Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10–9), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8

  2. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP

    PubMed Central

    Lempers, Vincent J. C.; van den Heuvel, Jeroen J. M. W.; Russel, Frans G. M.; Aarnoutse, Rob E.; Burger, David M.; Koenderink, Jan B.

    2016-01-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro. Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs. PMID:27001813

  3. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP.

    PubMed

    Lempers, Vincent J C; van den Heuvel, Jeroen J M W; Russel, Frans G M; Aarnoutse, Rob E; Burger, David M; Brüggemann, Roger J; Koenderink, Jan B

    2016-06-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs.

  4. Construction of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette (ABC) transporters and analysis of their growth under stress conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Listeria monocytogenes is a foodborne pathogen that is difficult to eliminate since it can survive under multiple stress conditions such as low pH and low temperature. Understanding its survival under stress conditions is important to control this pathogen in food. ABC transporters have been shown...

  5. Up-regulation of ATP-binding cassette transporters in the THP-1 human macrophage cell line by the antichagasic benznidazole

    PubMed Central

    Perdomo, Virginia G; Rigalli, Juan P; Luquita, Marcelo G; Pellegrino, José M; Ruiz, María Laura; Catania, Viviana A

    2016-01-01

    The effect of benznidazole (BZL) on the expression and activity of P-glycoprotein (P-gp, ABCB1) and multidrug resistance-associated protein 2 (MRP2, ABCC2), the two major transporters of endogenous and exogenous compounds, was evaluated in differentiated THP-1 cells. BZL induced P-gp and MRP2 proteins in a concentration-dependent manner. The increase in mRNA levels of both transporters suggests transcriptional regulation. P-gp and MRP2 activities correlated with increased protein levels. BZL intracellular accumulation was significantly lower in BZL-pre-treated cells than in control cells. PSC833 (a P-gp inhibitor) increased the intracellular BZL concentration in both pre-treated and control cells, confirming P-gp participation in BZL efflux. PMID:27783718

  6. ATP Binding Cassette Transporter ABCA7 Regulates NKT Cell Development and Function by Controlling CD1d Expression and Lipid Raft Content

    PubMed Central

    Nowyhed, Heba N.; Chandra, Shilpi; Kiosses, William; Marcovecchio, Paola; Andary, Farah; Zhao, Meng; Fitzgerald, Michael L.; Kronenberg, Mitchell; Hedrick, Catherine C.

    2017-01-01

    ABCA7 is an ABC transporter expressed on the plasma membrane, and actively exports phospholipid complexes from the cytoplasmic to the exocytoplasmic leaflet of membranes. Invariant NKT (iNKT) cells are a subpopulation of T lymphocytes that recognize glycolipid antigens in the context of CD1d-mediated antigen presentation. In this study, we demonstrate that ABCA7 regulates the development of NKT cells in a cell-extrinsic manner. We found that in Abca7−/− mice there is reduced expression of CD1d accompanied by an alteration in lipid raft content on the plasma membrane of thymocytes and antigen presenting cells. Together, these alterations caused by absence of ABCA7 negatively affect NKT cell development and function. PMID:28091533

  7. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  8. An ABCA1-independent pathway for recycling a poorly lipidated 8.1 nm apolipoprotein E particle from glia

    PubMed Central

    Fan, Jianjia; Stukas, Sophie; Wong, Charmaine; Chan, Jennifer; May, Sharon; DeValle, Nicole; Hirsch-Reinshagen, Veronica; Wilkinson, Anna; Oda, Michael N.; Wellington, Cheryl L.

    2011-01-01

    Lipid transport in the brain is coordinated by glial-derived lipoproteins that contain apolipoprotein E (apoE) as their primary protein. Here we show that apoE is secreted from wild-type (WT) primary murine mixed glia as nascent lipoprotein subspecies ranging from 7.5 to 17 nm in diameter. Negative-staining electron microscropy (EM) revealed rouleaux, suggesting a discoidal structure. Potassium bromide (KBr) density gradient ultracentrifugation showed that all subspecies, except an 8.1 nm particle, were lipidated. Glia lacking the cholesterol transporter ABCA1 secreted only 8.1 nm particles, which were poorly lipidated and nondiscoidal but could accept lipids to form the full repertoire of WT apoE particles. Receptor-associated-protein (RAP)-mediated inhibition of apoE receptor function blocked appearance of the 8.1 nm species, suggesting that this particle may arise through apoE recycling. Selective deletion of the LDL receptor (LDLR) reduced the level of 8.1 nm particle production by approximately 90%, suggesting that apoE is preferentially recycled through the LDLR. Finally, apoA-I stimulated secretion of 8.1 nm particles in a dose-dependent manner. These results suggest that nascent glial apoE lipoproteins are secreted through multiple pathways and that a greater understanding of these mechanisms may be relevant to several neurological disorders. PMID:21705806

  9. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.

    PubMed

    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik

    2013-05-03

    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  10. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.

    2002-01-01

    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  11. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  12. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl

    2015-01-01

    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  13. The ABCA1 Gene R230C Variant Is Associated with Decreased Risk of Premature Coronary Artery Disease: The Genetics of Atherosclerotic Disease (GEA) Study

    PubMed Central

    Villarreal-Molina, Teresa; Posadas-Romero, Carlos; Romero-Hidalgo, Sandra; Antúnez-Argüelles, Erika; Bautista-Grande, Araceli; Vargas-Alarcón, Gilberto; Kimura-Hayama, Eric; Canizales-Quinteros, Samuel; Juárez-Rojas, Juan Gabriel; Posadas-Sánchez, Rosalinda; Cardoso-Saldaña, Guillermo; Medina-Urrutia, Aída; González-Salazar, María del Carmen; Martínez-Alvarado, Rocío; Jorge-Galarza, Esteban; Carnevale, Alessandra

    2012-01-01

    Background ABCA1 genetic variation is known to play a role in HDL-C levels and various studies have also implicated ABCA1 variation in cardiovascular risk. The functional ABCA1/R230C variant is frequent in the Mexican population and has been consistently associated with low HDL-C concentrations. Although it has been associated with other cardiovascular risk factors such as obesity and type 2 diabetes mellitus, it is not known whether it is associated with coronary artery disease (CAD). Aim The purpose of the study was to analyze whether the ABCA1/R230C variant is associated with premature CAD in a case-control association study (GEA or Genetics of Atherosclerotic Disease), and to explore whether BMI modulates the effect of the C230 allele on other metabolic traits using a population-based design. Results The C230 allele was significantly associated with both lower HDL-C levels and a lower risk of premature CAD as compared to controls (OR = 0.566; Padd = 1.499×10−5). In addition, BMI modulated the effect of R230C on body fat distribution, as the correlation between BMI and visceral to subcutaneous adipose tissue (a metric of the propensity to store fat viscerally as compared to subcutaneously) was negative in RR homozygous individuals, but positive in premenopausal women bearing the C230 allele, with a statistically significant interaction (P = 0.005). BMI-R230C interaction was also significant for triglyceride levels in women regardless of their menopausal status (P = 0.036). Conclusion This is the first study assessing the effect of the R230C/ABCA1 variant in remature CAD. C230 was associated with both decreased HDL-C levels and a lower risk of premature CAD, and gender-specific BMI-R230C interactions were observed for different metabolic traits. These interactions may help explain inconsistencies in associations, and underscore the need to further analyze interactions of this functional and frequent variant with diet, exercise and other

  14. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.

    PubMed

    Milgrom, Yakov M

    2010-10-01

    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  15. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1.

    PubMed

    Singaraja, R R; Bocher, V; James, E R; Clee, S M; Zhang, L H; Leavitt, B R; Tan, B; Brooks-Wilson, A; Kwok, A; Bissada, N; Yang, Y Z; Liu, G; Tafuri, S R; Fievet, C; Wellington, C L; Staels, B; Hayden, M R

    2001-09-07

    By using BAC transgenic mice, we have shown that increased human ABCA1 protein expression results in a significant increase in cholesterol efflux in different tissues and marked elevation in high density lipoprotein (HDL)-cholesterol levels associated with increases in apoAI and apoAII. Three novel ABCA1 transcripts containing three different transcription initiation sites that utilize sequences in intron 1 have been identified. In BAC transgenic mice there is an increased expression of ABCA1 protein, but the distribution of the ABCA1 product in different cells remains similar to wild type mice. An internal promoter in human intron 1 containing liver X response elements is functional in vivo and directly contributes to regulation of the human ABCA1 gene in multiple tissues and to raised HDL cholesterol, apoAI, and apoAII levels. A highly significant relationship between raised protein levels, increased efflux, and level of HDL elevation is evident. These data provide proof of the principle that increased human ABCA1 efflux activity is associated with an increase in HDL levels in vivo.

  16. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang

    2015-01-01

    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  17. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  18. Automated cassette-to-cassette substrate handling system

    SciTech Connect

    Kraus, Joseph Arthur; Boyer, Jeremy James; Mack, Joseph; DeChellis, Michael; Koo, Michael

    2014-03-18

    An automated cassette-to-cassette substrate handling system includes a cassette storage module for storing a plurality of substrates in cassettes before and after processing. A substrate carrier storage module stores a plurality of substrate carriers. A substrate carrier loading/unloading module loads substrates from the cassette storage module onto the plurality of substrate carriers and unloads substrates from the plurality of substrate carriers to the cassette storage module. A transport mechanism transports the plurality of substrates between the cassette storage module and the plurality of substrate carriers and transports the plurality of substrate carriers between the substrate carrier loading/unloading module and a processing chamber. A vision system recognizes recesses in the plurality of substrate carriers corresponding to empty substrate positions in the substrate carrier. A processor receives data from the vision system and instructs the transport mechanism to transport substrates to positions on the substrate carrier in response to the received data.

  19. miR-27b inhibits LDLR and ABCA1 expression but does not influence plasma and hepatic lipid levels in mice

    PubMed Central

    Goedeke, Leigh; Rotllan, Noemi; Ramírez, Cristina M.; Aranda, Juan F.; Canfrán-Duque, Alberto; Araldi, Elisa; Fernández-Hernando, Ana; Langhi, Cedric; de Cabo, Rafael; Baldán, Ángel; Suárez, Yajaira; Fernández-Hernando, Carlos

    2015-01-01

    Rationale Recently, there has been significant interest in the therapeutic administration of miRNA mimics and inhibitors to treat cardiovascular disease. In particular, miR-27b has emerged as a regulatory hub in cholesterol and lipid metabolism and potential therapeutic target for treating atherosclerosis. Despite this, the impact of miR-27b on lipid levels in vivo remains to be determined. As such, here we set out to further characterize the role of miR-27b in regulating cholesterol metabolism in vitro and to determine the effect of miR-27b overexpression and inhibition on circulating and hepatic lipids in mice. Methods and Results Our results identify miR-27b as an important regulator of LDLR activity in human and mouse hepatic cells through direct targeting of LDLR and LDLRAP1. In addition, we report that modulation of miR-27b expression affects ABCA1 protein levels and cellular cholesterol efflux to ApoA1 in human hepatic Huh7 cells. Overexpression of pre-miR-27b in the livers of wild-type mice using AAV8 vectors increased pre-miR-27b levels 50–fold and reduced hepatic ABCA1 and LDLR expression by 50% and 20%, respectively, without changing circulating and hepatic cholesterol and triglycerides. To determine the effect of endogenous miR-27b on circulating lipids, wild-type mice were fed a Western diet for one month and injected with 5 mg/kg of LNA control or LNA anti-miR-27b oligonucleotides. Following two weeks of treatment, the expression of ABCA1 and LDLR were increased by 10–20% in the liver, demonstrating effective inhibition of miR-27b function. Intriguingly, no differences in circulating and hepatic lipids were observed between treatment groups. Conclusions The results presented here provide evidence that short-term modulation of miR-27b expression in wild-type mice regulates hepatic LDLR and ABCA1 expression but does not influence plasma and hepatic lipid levels. PMID:26520906

  20. Protective Effects of Platycodin D on Lipopolysaccharide-Induced Acute Lung Injury by Activating LXRα–ABCA1 Signaling Pathway

    PubMed Central

    Hu, Xiaoyu; Fu, Yunhe; Lu, Xiaojie; Zhang, Zecai; Zhang, Wenlong; Cao, Yongguo; Zhang, Naisheng

    2017-01-01

    The purpose of this study was to investigate the protective effects of platycodin D (PLD) on lipopolysaccharide (LPS)-induced acute lung injury (ALI) and clarify the possible mechanism. An LPS-induced ALI model was used to confirm the anti-inflammatory activity of PLD in vivo. The A549 lung epithelial cells were used to investigate the molecular mechanism and targets of PLD in vitro. In vivo, the results showed that PLD significantly attenuated lung histopathologic changes, myeloperoxidase activity, and pro-inflammatory cytokines levels, including TNF-α, IL-1β, and IL-6. In vitro, PLD inhibited LPS-induced IL-6 and IL-8 production in LPS-stimulated A549 lung epithelial cells. Western blot analysis showed that PLD suppressed LPS-induced NF-κB and IRF3 activation. Moreover, PLD did not act though affecting the expression of TLR4. We also showed that PLD disrupted the formation of lipid rafts by depleting cholesterol and prevented LPS-induced TLR4 trafficking to lipid rafts, thereby blocking LPS-induced inflammatory response. Finally, PLD activated LXRα–ABCA1-dependent cholesterol efflux. Knockdown of LXRα abrogated the anti-inflammatory effects of PLD. The anti-inflammatory effects of PLD was associated with upregulation of the LXRα–ABCA1 pathway, which resulted in disrupting lipid rafts by depleting cholesterol and reducing translocation of TLR4 to lipid rafts. PMID:28096801

  1. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong

    2016-12-01

    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  2. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  3. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-01-01

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  4. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.

    1987-06-01

    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  5. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2

    PubMed Central

    LI, QIONGYU; WANG, XIANGFENG; SHEN, ALING; ZHANG, YUCHEN; CHEN, YOUQIN; SFERRA, THOMAS J.; LIN, JIUMAO; PENG, JUN

    2015-01-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC. PMID:26640560

  6. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2.

    PubMed

    Li, Qiongyu; Wang, Xiangfeng; Shen, Aling; Zhang, Yuchen; Chen, Youqin; Sferra, Thomas J; Lin, Jiumao; Peng, Jun

    2015-11-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC.

  7. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.

    PubMed

    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S

    1995-05-10

    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  8. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central

    1986-01-01

    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  9. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.

    2014-01-01

    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  10. Heart ABCA1 and PPAR- α Genes Expression Responses in Male rats: Effects of High Intensity Treadmill Running Training and Aqueous Extraction of Black Crataegus-Pentaegyna

    PubMed Central

    Ghanbari-Niaki, Abbass; Ghanbari-Abarghooi, Safieyh; Rahbarizadeh, Fatemeh; Zare-Kookandeh, Navabeh; Gholizadeh, Monireh; Roudbari, Fatemeh; Zare-Kookandeh, Asghar

    2013-01-01

    Introduction: Heart as a high metabolic and aerobic tissue is consuming lipid as a fuel for its energy provision at rest during light and moderate exercise, except when lactate level is higher in blood circulation. It has been shown that any type of regular exercise and crataegus species would improve cardiovascular function and minimizes several risk factors via stimulating lipid metabolism by acting on enzymes and genes expression such as ABCA1 and PPAR α which are involving in this process. Materials and Methods: Twenty Wistar male rats (4-6 weeks old, 140-173 g weight) were used. Animals were randomly classified into training (n = 10) and control (n = 10) groups and then divided into saline-control (SC), saline-training (ST), Crataegus-Pentaegyna -control (CPC), and Crataegus-Pentaegyna -training (CPT) groups. Training groups have performed a high-intensity running program (at 34 m/min (0% grade), 60 min/day, 5 days/week) on a motor-driven treadmill for eight weeks. Animals were orally fed with Crataegus-Pentaegyna extraction (500mg/kg) and saline solution for six weeks. Seventy- two hours after the last training session, rats were sacrificed, hearts were excised, cleaned and immediately frozen in liquid nitrogen and stored at -80 °C until RNA extraction. Plasma also was collected for plasma variable measurements. Statistical analysis was performed using a two way analysis of variance, and significance was accepted at P < 0.05. Results: A non-significant (P < 0.4, P < 0.79, respectively) increase in ABCA1 and PPAR α genes expression was accompanied by a significant (P < 0.01, P < 0.04, P < 0.04, respectively) reduction in TC, TG, and VLDL-C levels in Crataegus-Pentaegyna groups. Conclusions: Our findings show that a high intensity treadmill running was able to express ABCA1 and PPAR α in rat heart. Data also possibly indicate that the Crataeguse-Pentaegyna supplementation solely could mimic training effect on the mentioned genes and lipid profiles via

  11. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.

    PubMed

    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

    2014-01-01

    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  12. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-01-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  13. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  14. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  15. Novel apo E-derived ABCA1 agonist peptide (CS-6253) promotes reverse cholesterol transport and induces formation of preβ-1 HDL in vitro

    SciTech Connect

    Hafiane, Anouar; Bielicki, John K.; Johansson, Jan O.; Genest, Jacques; Zhu, Xuewei

    2015-07-24

    Apolipoprotein (apo) mimetic peptides replicate some aspects of HDL function. We have previously reported the effects of compound ATI-5261 on its ability to replicate many functions of native apo A-I in the process of HDL biogenesis. ATI-5261 induced muscle toxicity in wild type C57Bl/6 mice, increased CPK, ALT and AST and increase in triglyceride (Tg) levels. Aromatic phenylalanine residues on the non-polar face of ATI-5261, together with positively charged arginine residues at the lipid-water interface were responsible for these effects. This information was used to create a novel analog (CS-6253) that was non-toxic. We evaluated this peptide designed from the carboxyl terminus of apo E, in its ability to mimic apo A-I functionality. Our data shows that the lipidated particles generated by incubating cells overexpressing ABCA1 with lipid free CS-6253 enhances the rate of ABCA1 lipid efflux with high affinity interactions with native ABCA1 oligomeric forms and plasma membrane micro-domains. Interaction between ABCA1 and lipid free CS-6253 resulted in formation of nascent HDL-CS-6253 particles that are actively remodeled in plasma. Mature HDL-CS-6253 particles deliver cholesterol to liver cells via SR-BI in-vitro. CS-6253 significantly increases cholesterol efflux in murine macrophages and in human THP-1 macrophage-derived foam cells expressing ABCA1. Addition of CS-6253 to plasma dose-dependently displaced apo A-I from α-HDL particles and led to de novo formation of preβ-1 HDL that stimulates ABCA1 dependent cholesterol efflux efficiently. When incubated with human plasma CS-6253 was also found to bind with HDL and LDL and promoted the transfer of cholesterol from HDL to LDL predominantly. Our data shows that CS-6253 mimics apo A-I in its ability to promote ABCA1-mediated formation of nascent HDL particles, and enhances formation of preβ-1 HDL with increase in the cycling of apo A-I between the preβ and α-HDL particles in-vitro. These

  16. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar

    2015-01-01

    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  17. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  18. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-02-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  19. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    PubMed

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  20. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés

    2014-01-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  1. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-01-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  2. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.

    PubMed

    Knight, K L; Hess, R M; McEntee, K

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  3. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  4. ATP–Binding Cassette Transporter Structure Changes Detected by Intramolecular Fluorescence Energy Transfer for High-Throughput Screening

    PubMed Central

    Iram, Surtaj H.; Gruber, Simon J.; Raguimova, Olga N.; Thomas, David D.

    2015-01-01

    Multidrug resistance protein 1 (MRP1) actively transports a wide variety of drugs out of cells. To quantify MRP1 structural dynamics, we engineered a “two-color MRP1” construct by fusing green fluorescent protein (GFP) and TagRFP to MRP1 nucleotide–binding domains NBD1 and NBD2, respectively. The recombinant MRP1 protein expressed and trafficked normally to the plasma membrane. Two-color MRP1 transport activity was normal, as shown by vesicular transport of [3H]17β-estradiol-17-β-(d-glucuronide) and doxorubicin efflux in AAV-293 cells. We quantified fluorescence resonance energy transfer (FRET) from GFP to TagRFP as an index of NBD conformational changes. Our results show that ATP binding induces a large-amplitude conformational change that brings the NBDs into closer proximity. FRET was further increased by substrate in the presence of ATP but not by substrate alone. The data suggest that substrate binding is required to achieve a fully closed and compact structure. ATP analogs bind MRP1 with reduced apparent affinity, inducing a partially closed conformation. The results demonstrate the utility of the two-color MRP1 construct for investigating ATP-binding cassette transporter structural dynamics, and it holds great promise for high-throughput screening of chemical libraries for unknown activators, inhibitors, or transportable substrates of MRP1. PMID:25924616

  5. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.

    PubMed

    Schmidt, S L; Pautz, A L; Burgers, P M

    2001-09-14

    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  6. Sensitivity of a renal K+ channel (ROMK2) to the inhibitory sulfonylurea compound glibenclamide is enhanced by coexpression with the ATP-binding cassette transporter cystic fibrosis transmembrane regulator.

    PubMed Central

    McNicholas, C M; Guggino, W B; Schwiebert, E M; Hebert, S C; Giebisch, G; Egan, M E

    1996-01-01

    We demonstrate here that coexpression of ROMK2, an inwardly rectifying ATP-sensitive renal K+ channel (IKATP) with cystic fibrosis transmembrane regulator (CFTR) significantly enhances the sensitivity of ROMK2 to the sulfonylurea compound glibenclamide. When expressed alone, ROMK2 is relatively insensitive to glibenclamide. The interaction between ROMK2, CFTR, and glibenclamide is modulated by altering the phosphorylation state of either ROMK2, CFTR, or an associated protein, as exogenous MgATP and the catalytic subunit of protein kinase A significantly attenuate the inhibitory effect of glibenclamide on ROMK2. Thus CFTR, which has been demonstrated to interact with both Na+ and Cl- channels in airway epithelium, modulates the function of renal ROMK2 K+ channels. PMID:8755607

  7. AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

    PubMed Central

    Gaillard, Stéphane; Jacquet, Hélène; Vavasseur, Alain; Leonhardt, Nathalie; Forestier, Cyrille

    2008-01-01

    Background ABC proteins constitute one of the largest families of transporters found in all living organisms. In Arabidopsis thaliana, 120 genes encoding ABC transporters have been identified. Here, the characterization of one member of the MRP subclass, AtMRP6, is described. Results This gene, located on chromosome 3, is bordered by AtMRP3 and AtMRP7. Using real-time quantitative PCR (RT-Q-PCR) and the GUS reporter gene, we found that this gene is essentially expressed during early seedling development, in the apical meristem and at initiation point of secondary roots, especially in xylem-opposite pericycle cells where lateral roots initiate. The level of expression of AtMRP6 in response to various stresses was explored and a significant up-regulation after cadmium (Cd) treatment was detected. Among the three T-DNA insertion lines available from the Salk Institute library, two knock-out mutants, Atmrp6.1 and Atmrp6.2 were invalidated for the AtMRP6 gene. In the presence of Cd, development of leaves was more affected in the mutants than wild-type plants, whereas root elongation and ramification was comparable. Conclusion The position of AtMRP6 on chromosome 3, flanked by two other MRP genes, (all of which being induced by Cd) suggests that AtMRP6 is part of a cluster involved in metal tolerance, although additional functions in planta cannot be discarded. PMID:18307782

  8. The Carboxy-Terminal Region of apoA-I is Required for the ABCA1-Dependent Formation of α-HDL but not preβ-HDL Particles In Vivo

    PubMed Central

    Chroni, Angeliki; Koukos, Georgios; Duka, Adelina; Zannis, Vassilis I.

    2008-01-01

    ABCA1-mediated lipid efflux to lipid poor apoA-I results in the gradual lipidation of apoA-I. This leads to the formation of discoidal HDL which are subsequently converted to spherical HDL by the action of LCAT. We have investigated the effect of point mutations and deletions in the carboxy-terminal region of apoA-I on the biogenesis of HDL using adenovirus-mediated gene transfer in apoA-I deficient mice. It was found that the plasma HDL levels were greatly reduced in mice expressing the carboxy-terminal deletion mutants apoA-I[Δ(185-243)] and apoA-I[Δ(220-243)], shown previously to diminish the ABCA1-mediated lipid efflux. The HDL levels were normal in mice expressing the WT apoA-I, the apoA-I[Δ(232-243)] deletion mutant or the apoA-I[E191A/H193A/K195A] point mutant, which promote normal ABCA1-mediated lipid efflux. Electron microscopy and two-dimensional gel electrophoresis showed that the apoA-I[Δ(185-243)] and apoA-I[Δ(220-243)] mutants formed mainly preβ-HDL particles and few spherical particles enriched in apoE, while WT apoA-I, apoA-I[Δ(232-243)] and apoA-I[E191A/H193A/K195A] formed spherical α-HDL particles. The findings establish that a) deletions that eliminate the 220-231 region of apoA-I prevent the synthesis of α-HDL, but allow the synthesis of preβ-HDL particles in vivo, b) the amino-terminal segment 1-184 of apoA-I can promote synthesis of preβ-HDL type particles in an ABCA1-independent process and c) the charged residues in the 191-195 region of apoA-I do not influence the biogenesis of HDL. PMID:17447731

  9. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm

    2017-01-01

    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  10. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.

    PubMed

    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min

    2014-08-01

    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  11. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M

    1989-01-01

    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  12. RAGE Suppresses ABCG1-Mediated Macrophage Cholesterol Efflux in Diabetes

    PubMed Central

    Daffu, Gurdip; Shen, Xiaoping; Senatus, Laura; Thiagarajan, Devi; Abedini, Andisheh; Hurtado del Pozo, Carmen; Rosario, Rosa; Song, Fei; Friedman, Richard A.; Ramasamy, Ravichandran

    2015-01-01

    Diabetes exacerbates cardiovascular disease, at least in part through suppression of macrophage cholesterol efflux and levels of the cholesterol transporters ATP binding cassette transporter A1 (ABCA1) and ABCG1. The receptor for advanced glycation end products (RAGE) is highly expressed in human and murine diabetic atherosclerotic plaques, particularly in macrophages. We tested the hypothesis that RAGE suppresses macrophage cholesterol efflux and probed the mechanisms by which RAGE downregulates ABCA1 and ABCG1. Macrophage cholesterol efflux to apolipoprotein A1 and HDL and reverse cholesterol transport to plasma, liver, and feces were reduced in diabetic macrophages through RAGE. In vitro, RAGE ligands suppressed ABCG1 and ABCA1 promoter luciferase activity and transcription of ABCG1 and ABCA1 through peroxisome proliferator–activated receptor-γ (PPARG)–responsive promoter elements but not through liver X receptor elements. Plasma levels of HDL were reduced in diabetic mice in a RAGE-dependent manner. Laser capture microdissected CD68+ macrophages from atherosclerotic plaques of Ldlr−/− mice devoid of Ager (RAGE) displayed higher levels of Abca1, Abcg1, and Pparg mRNA transcripts versus Ager-expressing Ldlr−/− mice independently of glycemia or plasma levels of total cholesterol and triglycerides. Antagonism of RAGE may fill an important therapeutic gap in the treatment of diabetic macrovascular complications. PMID:26253613

  13. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.

    PubMed

    Shimojo, M; Sakakibara, R; Ishiguro, M

    1993-07-01

    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  14. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming

    2016-01-01

    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  15. Whatever happened to cassette-dosing pharmacokinetics?

    PubMed

    Manitpisitkul, Prasarn; White, Ronald E

    2004-08-01

    Cassette dosing is a procedure that is used for rapidly assessing the pharmacokinetics of a series of discovery drug candidates by dosing a mixture of compounds rather than a single compound. Cassette dosing has advantages and disadvantages associated with its use, which leads to controversy about how and if it should be used. To assess the current practices of the pharmaceutical industry regarding cassette dosing, a survey of several pharmaceutical companies was conducted. Analysis of the survey revealed that opinion on this subject is divided within the pharmaceutical industry. In addition, it was determined that approximately only a half of those companies that perform in vivo pharmacokinetic screening use cassette dosing for this purpose.

  16. Cassette for handling banknotes or the like

    DOEpatents

    Lundblad, Leif

    1981-08-11

    A cassette for banknotes and like valuable articles is provided with a displaceable lid (6) and locking means (10) for latching the lid of the cassette when the cassette is located outside a housing (25) in which it is intended to be placed. An operating means (8) is arranged to co-act with the locking means and with a latching element (15). The latching element is arranged to be released in dependence upon a pre-set program. A signal circuit is arranged to send a code signal to a detector circuit (23) when electrical contact elements on the cassette and the housing co-act with one another, which detector circuit, when the signal coincides with the signal program in the detector circuit, causes a signal to be sent for moving the latching means to a non-latching position.

  17. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.

    PubMed

    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S

    1988-05-17

    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  18. ABC proteins protect the human body and maintain optimal health.

    PubMed

    Ueda, Kazumitsu

    2011-01-01

    Human MDR1, a multi-drug transporter gene, was isolated as the first of the eukaryote ATP Binding Cassette (ABC) proteins from a multidrug-resistant carcinoma cell line in 1986. To date, over 25 years, many ABC proteins have been found to play important physiological roles by transporting hydrophobic compounds. Defects in their functions cause various diseases, indicating that endogenous hydrophobic compounds, as well as water-soluble compounds, are properly transported by transmembrane proteins. MDR1 transports a large number of structurally unrelated drugs and is involved in their pharmacokinetics, and thus is a key factor in drug interaction. ABCA1, an ABC protein, eliminates excess cholesterol in peripheral cells by generating HDL. Because ABCA1 is a key molecule in cholesterol homeostasis, its function and expression are highly regulated. Eukaryote ABC proteins function on the body surface facing the outside and in organ pathways to adapt to the extracellular environment and protect the body to maintain optimal health.

  19. Miniaturized technology for DNA typing: cassette PCR.

    PubMed

    Manage, Dammika P; Pilarski, Linda M

    2015-01-01

    With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.

  20. Local TNF causes NFATc1-dependent cholesterol-mediated podocyte injury

    PubMed Central

    Pedigo, Christopher E.; Ducasa, Gloria Michelle; Leclercq, Farah; Sloan, Alexis; Hashmi, Tahreem; Molina-David, Judith; Ge, Mengyuan; Lassenius, Mariann I.; Groop, Per-Henrik; Kretzler, Matthias; Martini, Sebastian; Reich, Heather; Wahl, Patricia; Ghiggeri, GianMarco; Burke, George W.; Kretz, Oliver; Huber, Tobias B.; Mendez, Armando J.; Merscher, Sandra

    2016-01-01

    High levels of circulating TNF and its receptors, TNFR1 and TNFR2, predict the progression of diabetic kidney disease (DKD), but their contribution to organ damage in DKD remains largely unknown. Here, we investigated the function of local and systemic TNF in podocyte injury. We cultured human podocytes with sera collected from DKD patients, who displayed elevated TNF levels, and focal segmental glomerulosclerosis (FSGS) patients, whose TNF levels resembled those of healthy patients. Exogenous TNF administration or local TNF expression was equally sufficient to cause free cholesterol–dependent apoptosis in podocytes by acting through a dual mechanism that required a reduction in ATP-binding cassette transporter A1–mediated (ABCA1-mediated) cholesterol efflux and reduced cholesterol esterification by sterol-O-acyltransferase 1 (SOAT1). TNF-induced albuminuria was aggravated in mice with podocyte-specific ABCA1 deficiency and was partially prevented by cholesterol depletion with cyclodextrin. TNF-stimulated free cholesterol–dependent apoptosis in podocytes was mediated by nuclear factor of activated T cells 1 (NFATc1). ABCA1 overexpression or cholesterol depletion was sufficient to reduce albuminuria in mice with podocyte-specific NFATc1 activation. Our data implicate an NFATc1/ABCA1-dependent mechanism in which local TNF is sufficient to cause free cholesterol–dependent podocyte injury irrespective of TNF, TNFR1, or TNFR2 serum levels. PMID:27482889

  1. In vitro characterization and endocrine regulation of cholesterol and phospholipid transport in the mammary gland.

    PubMed

    Ontsouka, Corneille Edgar; Huang, Xiao; Aliyev, Eldar; Albrecht, Christiane

    2017-01-05

    Cell-based studies previously showed that the ATP-binding cassette transporter A1 (ABCA1) transfers cholesterol across mammary epithelial cells (MEC). Data for phospholipid transport are lacking, and it is unclear from which cellular source the transported cholesterol stems, whether this transport activates signaling pathways, and how lactogenic hormones regulate it. To clarify these aspects, lipid transport and expressional analyses were performed in bovine primary (bMEC) and/or immortalized (MAC-T) MEC cultures. Lipid efflux and ABCA1, ABCG1 and liver X receptorα mRNA levels were higher in MAC-T than bMEC. In MAC-T, the transported cholesterol originated mainly from the plasma membrane. ABCA1 dependent cholesterol efflux was higher than phosphatidylcholine efflux, was suppressed by probucol (ABCA1 inhibitor), AG490 (janus kinase-2 inhibitor), PD98059 (mitogen activated protein kinase kinase inhibitor) and pretreatment with β-cyclodextrin (lowering membrane cholesterol). Insulin was the only hormone significantly increasing cholesterol efflux. In conclusion, this study gives novel mechanistic and regulatory insights into the transport of cholesterol and phospholipids in MEC.

  2. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  3. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  4. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  5. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  6. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  7. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  8. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  9. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  10. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  11. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  12. Expression, localization, and functional model of cholesterol transporters in lactating and nonlactating mammary tissues of murine, bovine, and human origin.

    PubMed

    Mani, Orlando; Körner, Meike; Sorensen, Martin T; Sejrsen, Kristen; Wotzkow, Carlos; Ontsouka, Corneille E; Friis, Robert R; Bruckmaier, Rupert M; Albrecht, Christiane

    2010-08-01

    Members of the ATP-binding cassette (ABC) transporters play a pivotal role in cellular lipid efflux. To identify candidate cholesterol transporters implicated in lipid homeostasis and mammary gland (MG) physiology, we compared expression and localization of ABCA1, ABCG1, and ABCA7 and their regulatory genes in mammary tissues of different species during the pregnancy-lactation cycle. Murine and bovine mammary glands (MGs) were investigated during different functional stages. The abundance of mRNAs was determined by quantitative RT-PCR. Furthermore, transporter proteins were localized in murine, bovine, and human MGs by immunohistochemistry. In the murine MG, ABCA1 mRNA abundance was elevated during nonlactating compared with lactating stages, whereas ABCA7 and ABCA1 mRNA profiles were not altered. In the bovine MG, ABCA1, ABCG1, and ABCA7 mRNAs abundances were increased during nonlactating stages compared with lactation. Furthermore, associations between mRNA levels of transporters and their regulatory genes LXRalpha, PPARgamma, and SREBPs were found. ABCA1, ABCG1, and ABCA7 proteins were localized in glandular MG epithelial cells (MEC) during lactation, whereas during nonlactating stages, depending on species, the proteins showed distinct localization patterns in MEC and adipocytes. Our results demonstrate that ABCA1, ABCG1, and ABCA7 are differentially expressed between lactation and nonlactating stages and in association with regulatory genes. Combined expression and localization data suggest that the selected cholesterol transporters are universal MG transporters involved in transport and storage of cholesterol and in lipid homeostasis of MEC. Because of the species-specific expression patterns of transporters in mammary tissue, mechanisms of cholesterol homeostasis seem to be differentially regulated between species.

  13. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.

    2014-10-02

    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  14. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.

    PubMed

    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G

    2013-02-07

    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  15. Opposing effects of Apoe/Apoa1 double deletion on amyloid-β pathology and cognitive performance in APP mice

    PubMed Central

    Fitz, Nicholas F.; Tapias, Victor; Cronican, Andrea A.; Castranio, Emilie L.; Saleem, Muzamil; Carter, Alexis Y.; Lefterova, Martina

    2015-01-01

    See Corona and Landreth (doi:10.1093/awv300) for a scientific commentary on this article. ATP binding cassette transporter A1 (encoded by ABCA1) regulates cholesterol efflux from cells to apolipoproteins A-I and E (ApoA-I and APOE; encoded by APOA1 and APOE, respectively) and the generation of high density lipoproteins. In Abca1 knockout mice (Abca1ko), high density lipoproteins and ApoA-I are virtually lacking, and total APOE and APOE-containing lipoproteins in brain substantially decreased. As the ε4 allele of APOE is the major genetic risk factor for late-onset Alzheimer’s disease, ABCA1 role as a modifier of APOE lipidation is of significance for this disease. Reportedly, Abca1 deficiency in mice expressing human APP accelerates amyloid deposition and behaviour deficits. We used APP/PS1dE9 mice crossed to Apoe and Apoa1 knockout mice to generate Apoe/Apoa1 double-knockout mice. We hypothesized that Apoe/Apoa1 double-knockout mice would mimic the phenotype of APP/Abca1ko mice in regards to amyloid plaques and cognitive deficits. Amyloid pathology, peripheral lipoprotein metabolism, cognitive deficits and dendritic morphology of Apoe/Apoa1 double-knockout mice were compared to APP/Abca1ko, APP/PS1dE9, and single Apoa1 and Apoe knockouts. Contrary to our prediction, the results demonstrate that double deletion of Apoe and Apoa1 ameliorated the amyloid pathology, including amyloid plaques and soluble amyloid. In double knockout mice we show that 125I-amyloid-β microinjected into the central nervous system cleared at a rate twice faster compared to Abca1 knockout mice. We tested the effect of Apoe, Apoa1 or Abca1 deficiency on spreading of exogenous amyloid-β seeds injected into the brain of young pre-depositing APP mice. The results show that lack of Abca1 augments dissemination of exogenous amyloid significantly more than the lack of Apoe. In the periphery, Apoe/Apoa1 double-knockout mice exhibited substantial atherosclerosis and very high levels of low

  16. Effects of DHA Supplementation on Vascular Function, Telomerase Activity in PBMC, Expression of Inflammatory Cytokines, and PPARγ-LXRα-ABCA1 Pathway in Patients With Type 2 Diabetes Mellitus: Study Protocol for Randomized Controlled Clinical Trial.

    PubMed

    Toupchian, Omid; Sotoudeh, Gity; Mansoori, Anahita; Djalali, Mahmoud; Keshavarz, Seyyed Ali; Nasli-Esfahani, Ensieh; Alvandi, Ehsan; Koohdani, Fariba

    2016-07-01

    Docosahexaenoic acid (DHA), as an omega-3 fatty acid, in a natural ligand of peroxisome proliferator-activated receptors (PPARs). Regarding the combinative effects of Nutrigenomics and Nutrigenetics and due to the lack of in vivo studies conducted using natural ligands of PPARs, we aimed to evaluate the effects of DHA supplementation on vascular function, telomerase activity, and PPARγ-LXRα-ABCA1 pathway, in patients with type 2 diabetes mellitus (T2DM), based on the Pro12Ala polymorphism in PPARγ encoding gene. 72 T2DM patients (36 dominant and 36 recessive allele carriers), aged 30-70, with body mass index of 18.5 to 35 kg/m2, will be participated in this double blind randomized controlled trial. In each group, stratification will be performed based on sex and age and participants will be randomly assigned to receive 2.4 g/day DHA or placebo (paraffin) for 8 weeks. PPARγ genotyping will be carried out using PCR-RFLP method; Telomerase activity will be estimated by PCR-ELISA TRAP assay; mRNA expression levels of target genes will be assessed using real time PCR. Serum levels of ADMA, sCD163 and adiponectin, will be measured using ELISA commercial kits. The present study is designed in order to help T2DM patients to modify their health conditions based on their genetic backgrounds, and to recommend the proper food ingredients as the natural agonists for PPARs in order to prevent and treat metabolic abnormalities of the disease.

  17. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCMO1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    PubMed Central

    2013-01-01

    Background In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body weight. We used a linear regression model. Selected genes corresponded to folate metabolism, vitamins B-12, A, and E, and cholesterol pathways or lipid metabolism. Methods Extracted DNA from both the Sacramento and Beltsville populations was analyzed using an allele discrimination assay with a MALDI-TOF mass spectrometry platform. The adjusted phenotype, y, was HDL levels adjusted for gender and body weight only statistical analyses were performed using the genotype association and regression modules from the SNP Variation Suite v7. Results Statistically significant SNP (where P values were adjusted for false discovery rate) included: CETP (rs7499892 and rs5882); SLC46A1 (rs37514694; rs739439); SLC19A1 (rs3788199); CD36 (rs3211956); BCMO1 (rs6564851), APOA5 (rs662799), and ABCA1 (rs4149267). Many prior association trends of the SNP with HDL were replicated in our cross-validation study. Significantly, the association of SNP in folate transporters (SLC46A1 rs37514694 and rs739439; SLC19A1 rs3788199) with HDL was identified in our study. Conclusions Given recent literature on the role of niacin in the biogenesis of HDL, focus on status and metabolism of B-vitamins and metabolites of eccentric cleavage of β-carotene with lipid metabolism is exciting for future study. PMID:23656756

  18. A Cassette Based System for Hydrogen Storage and Delivery

    SciTech Connect

    Britton Wayne E.

    2006-11-29

    A hydrogen storage system is described and evaluated. This is based upon a cassette, that is a container for managing hydrogen storage materials. The container is designed to be safe, modular, adaptable to different chemistries, inexpensive, and transportable. A second module receives the cassette and provides the necessary infrastructure to deliver hydrogen from the cassette according to enduser requirements. The modular concept has a number of advantages over approaches that are all in one stand alone systems. The advantages of a cassette based system are discussed, along with results from model and laboratory testing.

  19. Finger-Actuated, Self-Contained Immunoassay Cassettes

    PubMed Central

    Qiu, Xianbo; Thompson, Jason A.; Chen, Zongyuan; Liu, Changchun; Chen, Dafeng; Ramprasad, Sudhir; Mauk, Michael G.; Ongagna, Serge; Barber, Cheryl; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L.A.M.; Bau, Haim H.

    2010-01-01

    The building blocks for an inexpensive, disposable, luminescence-based microfluidic immunoassay cassette are described, and their integration in a point-of-care diagnostic system is demonstrated. Fluid motion in the cassette is driven by depressing finger-actuated pouches. All reagents needed for the immunoassay can be stored in the cassette in liquid form. Prior to use, the cassette consists of two separate parts. A top storage component contains pouches, sealed storage chambers, a metering chamber, and needle seats. The bottom processing component contains connection needles, a mixing chamber, and a detection chamber with immobilized proteins. Subsequent to sample introduction, the storage and processing components are mated. The needles form hydraulic connections between the two parts and, in some cases, close valves. The pouches are then actuated sequentially to induce flow of various reagents and facilitate process operations. The cassette is compatible with different detection modalities. Both a cassette with immunochromatographic-based detection and a cassette with microbead-based detection were constructed and evaluated. The immunochromatographic cassette was used to detect antibodies to HIV in saliva samples. The bead-based cassette was used to detect the proinflammatory chemokine IL-8. The experimental data demonstrates good repeatability and reasonable sensitivity. PMID:19597994

  20. Interleukin-10 increases reverse cholesterol transport in macrophages through its bidirectional interaction with liver X receptor α

    SciTech Connect

    Halvorsen, Bente; Holm, Sverre; Yndestad, Arne; Scholz, Hanne; Sagen, Ellen Lund; Nebb, Hilde; Holven, Kirsten B.; Dahl, Tuva B.; Aukrust, Pål

    2014-08-08

    Highlights: • IL-10 promotes reverse cholesterol efflux from lipid loaded macrophages. • IL-10 increases the expression of ABCA-1 and ABCG-1. • IL-10 exhibits cross-talk with the nuclear receptor LXRα. - Abstract: Interleukin (IL)-10 is a prototypical anti-inflammatory cytokine that has been shown to attenuate atherosclerosis development. In addition to its anti-inflammatory properties, the anti-atherogenic effect of IL-10 has recently also been suggested to reflect a complex effect of IL-10 on lipid metabolism in macrophages. In the present study we examined the effects of IL-10 on cholesterol efflux mechanism in lipid-loaded THP-1 macrophages. Our main findings were: (i) IL-10 significantly enhanced cholesterol efflux induced by fetal-calf serum, high-density lipoprotein (HDL){sub 2} and apolipoprotein A-1. (ii) The IL-10-mediated effects on cholesterol efflux were accompanied by an increased IL-10-mediated expression of the ATP-binding cassette transporters ABCA1 and ABCG1, that was further enhanced when the cells were co-activated with the liver X receptor (LXR)α agonist (22R)-hydroxycholesterol. (iii) The effect of LXRα activation on the IL-10-mediated effects on the ATP-binding cassette transporters seems to include enhancing effects on the IL-10 receptor 1 (IL10R1) expression and interaction with STAT-3 signaling. (iv) These enhancing effects on ABCA1 and ABCG1 was not seen when the cells were stimulated with the IL-10 family members IL-22 and IL-24. This study suggests that the anti-atherogenic properties of IL-10 may include enhancing effects on cholesterol efflux mechanism that involves cross-talk with LXRα activation.

  1. Characterization of a multiple endogenously expressed adenosine triphosphate-binding cassette transporters using nuclear and cellular membrane affinity chromatography columns.

    PubMed

    Habicht, K-L; Singh, N S; Khadeer, M A; Shimmo, R; Wainer, I W; Moaddel, R

    2014-04-25

    Glioblastoma multiforme is an aggressive form of human astrocytoma, with poor prognosis due to multi-drug resistance to a number of anticancer drugs. The observed multi-drug resistance is primarily due to the efflux activity of ATP-Binding Cassette (ABC) efflux transporters such as Pgp, MRP1 and BCRP. The expression of these transporters has been demonstrated in nuclear and cellular membranes of the LN-229 human glioblastoma cell line. Nuclear membrane and cellular membrane fragments from LN-229 cells were immobilized on the IAM stationary phase to create nuclear and cellular membrane affinity chromatography columns, (NMAC(LN-229)) and (CMAC(LN-229)), respectively. Pgp, MRP1 and BCRP transporters co-immobilized on both columns were characterized and compared by establishing the binding affinities for estrone-3-sulfate (3.8 vs. 3.7μM), verapamil (0.6 vs. 0.7μM) and prazosin (0.099 vs. 0.033μM) on each column and no significant differences were observed. Since the marker ligands had overlapping selectivities, the selective characterization of each transporter was carried out by saturation of the binding sites of the non-targeted transporters. The addition of verapamil (Pgp and MRP1 substrate) to the mobile phase allowed the comparative screening of eight compounds at the nuclear and cellular BCRP using etoposide as the marker ligand. AZT increased the retention of etoposide (+15%), a positive allosteric interaction, on the CMAC(LN-229) column and decreased it (-5%) on the NMAC(LN-229), while the opposite effect was produced by rhodamine. The results indicate that there are differences between the cellular and nuclear membrane expressed BCRP and that NMAC and CMAC columns can be used to probe these differences.

  2. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.

    PubMed

    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R

    2015-09-01

    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  3. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    PubMed

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  4. Cell lipid metabolism modulators 2-bromopalmitate, D609, monensin, U18666A and probucol shift discoidal HDL formation to the smaller-sized particles: implications for the mechanism of HDL assembly.

    PubMed

    Quach, Duyen; Vitali, Cecilia; La, Fiona M; Xiao, Angel X; Millar, John S; Tang, Chongren; Rader, Daniel J; Phillips, Michael C; Lyssenko, Nicholas N

    2016-12-01

    ATP-binding cassette transporter A1 (ABCA1) mediates formation of disc-shaped high-density lipoprotein (HDL) from cell lipid and lipid-free apolipoprotein A-I (apo A-I). Discoidal HDL particles are heterogeneous in physicochemical characteristics for reasons that are understood incompletely. Discoidal lipoprotein particles similar in characteristics and heterogeneity to cell-formed discoidal HDL can be reconstituted from purified lipids and apo A-I by cell-free, physicochemical methods. The heterogeneity of reconstituted HDL (rHDL) is sensitive to the lipid composition of the starting lipid/apo A-I mixture. To determine whether the heterogeneity of cell-formed HDL is similarly sensitive to changes in cell lipids, we investigated four compounds that have well-established effects on cell lipid metabolism and ABCA1-mediated cell cholesterol efflux. 2-Bromopalmitate, D609, monensin and U18666A decreased formation of the larger-sized, but dramatically increased formation of the smaller-sized HDL. 2-Bromopalmitate did not appear to affect ABCA1 activity, subcellular localization or oligomerization, but induced dissolution of the cholesterol-phospholipid complexes in the plasma membrane. Arachidonic and linoleic acids shifted HDL formation to the smaller-sized species. Tangier disease mutations and inhibitors of ABCA1 activity wheat germ agglutinin and AG 490 reduced formation of both larger-sized and smaller-sized HDL. The effect of probucol was similar to the effect of 2-bromopalmitate. Taking rHDL formation as a paradigm, we propose that ABCA1 mutations and activity inhibitors reduce the amount of cell lipid available for HDL formation, and the compounds in the 2-bromopalmitate group and the polyunsaturated fatty acids change cell lipid composition from one that favors formation of the larger-sized HDL particles to one that favors formation of the smaller-sized species.

  5. Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway

    SciTech Connect

    Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing

    2013-11-15

    Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α.

  6. Inhibition of soluble epoxide hydrolase in mice promotes reverse cholesterol transport and regression of atherosclerosis.

    PubMed

    Shen, Li; Peng, Hongchun; Peng, Ran; Fan, Qingsong; Zhao, Shuiping; Xu, Danyan; Morisseau, Christophe; Chiamvimonvat, Nipavan; Hammock, Bruce D

    2015-04-01

    Adipose tissue is the body largest free cholesterol reservoir and abundantly expresses ATP binding cassette transporter A1 (ABCA1), which maintains plasma high-density lipoprotein (HDL) levels. HDLs have a protective role in atherosclerosis by mediating reverse cholesterol transport (RCT). Soluble epoxide hydrolase (sEH) is a cytosolic enzyme whose inhibition has various beneficial effects on cardiovascular disease. The sEH is highly expressed in adipocytes, and it converts epoxyeicosatrienoic acids (EETs) into less bioactive dihydroxyeicosatrienoic acids. We previously showed that increasing EETs levels with a sEH inhibitor (sEHI) (t-AUCB) resulted in elevated ABCA1 expression and promoted ABCA1-mediated cholesterol efflux from 3T3-L1 adipocytes. The present study investigates the impacts of t-AUCB in mice deficient for the low density lipoprotein (LDL) receptor (Ldlr(-/-) mice) with established atherosclerotic plaques. The sEH inhibitor delivered in vivo for 4 weeks decreased the activity of sEH in adipose tissue, enhanced ABCA1 expression and cholesterol efflux from adipose depots, and consequently increased HDL levels. Furthermore, t-AUCB enhanced RCT to the plasma, liver, bile and feces. It also showed the reduction of plasma LDL-C levels. Consistently, t-AUCB-treated mice showed reductions in the size of atherosclerotic plaques. These studies establish that raising adipose ABCA1 expression, cholesterol efflux, and plasma HDL levels with t-AUCB treatment promotes RCT, decreasing LDL-C and atherosclerosis regression, suggesting that sEH inhibition may be a promising strategy to treat atherosclerotic vascular disease.

  7. Apparatus and method for loading and unloading multiple digital tape cassettes utilizing a removable magazine

    DOEpatents

    Lindenmeyer, C.W.

    1993-01-26

    An apparatus and method to automate the handling of multiple digital tape cassettes for processing by commercially available cassette tape readers and recorders. A removable magazine rack stores a plurality of tape cassettes, and cooperates with a shuttle device that automatically inserts and removes cassettes from the magazine to the reader and vice-versa. Photocells are used to identify and index to the desired tape cassette. The apparatus allows digital information stored on multiple cassettes to be processed without significant operator intervention.

  8. Apparatus and method for loading and unloading multiple digital tape cassettes utilizing a removable magazine

    DOEpatents

    Lindenmeyer, Carl W.

    1993-01-01

    An apparatus and method to automate the handling of multiple digital tape cassettes for processing by commercially available cassette tape readers and recorders. A removable magazine rack stores a plurality of tape cassettes, and cooperates with a shuttle device that automatically inserts and removes cassettes from the magazine to the reader and vice-versa. Photocells are used to identify and index to the desired tape cassette. The apparatus allows digital information stored on multiple cassettes to be processed without significant operator intervention.

  9. Diabetes susceptibility in Mayas: Evidence for the involvement of polymorphisms in HHEX, HNF4α, KCNJ11, PPARγ, CDKN2A/2B, SLC30A8, CDC123/CAMK1D, TCF7L2, ABCA1 and SLC16A11 genes.

    PubMed

    Lara-Riegos, J C; Ortiz-López, M G; Peña-Espinoza, B I; Montúfar-Robles, I; Peña-Rico, M A; Sánchez-Pozos, K; Granados-Silvestre, M A; Menjivar, M

    2015-07-01

    Association of type 2 diabetes (T2D) with common variants in HHEX, HNF4α, KCNJ11, PPARγ, CDKN2A/2B, SLC30A8, CDC123/CAMK1D, TCF7L2, ABCA1 and SLC16A11 genes have been reported, mainly in populations of European and Asian ancestry and to a lesser extent in Latin Americans. Thus, we aimed to investigate the contribution of rs1111875 (HHEX), rs1800961 (HNF4α), rs5219 (KCNJ11), rs1801282 (PPARγ), rs10811661 (CDKN2A/2B), rs13266634 (SLC30A8), rs12779790 (CDC123/CAMK1D), rs7903146 (TCF7L2), rs9282541 (ABCA1) and rs13342692 (SLC16A11) polymorphisms in the genetic background of Maya population to associate their susceptibility to develop T2D. This is one of the first studies designed specifically to investigate the inherited component of T2D in the indigenous population of Mexico. SNPs were genotyped by allelic discrimination method in 575 unrelated Maya individuals. Two SNPs rs10811661 and rs928254 were significantly associated with T2D after adjusting for BMI; rs10811661 in a recessive and rs9282541 in a dominant model. Additionally, we found phenotypical alterations associated with genetic variants: HDL to rs9282541 and insulin to rs13342692. In conclusion, these findings support an association of genetic polymorphisms to develop T2D in Maya population.

  10. Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway.

    PubMed

    Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing

    2013-11-15

    Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α.

  11. Effects of ellagic acid-rich extract of pomegranates peel on regulation of cholesterol metabolism and its molecular mechanism in hamsters.

    PubMed

    Liu, Run; Li, Jianke; Cheng, Yujiang; Huo, Tianbo; Xue, Jiayi; Liu, Yingli; Liu, Jianshu; Chen, Xiping

    2015-03-01

    The study investigated the effect of pomegranates ellagic acid (PEA) on blood cholesterol and investigated its effects on LXR/RXR/PPAR-ABCA1 nuclear receptors-signaling pathways of cholesterol metabolism on molecular level in hamsters. In this experiment, hamsters were randomly divided into two groups: the first group (NG, n = 9) was always fed the normal diet, whereas the other group (HFG, n = 45) was fed a high fat diet during the first 4 weeks and then fed the normal diet for the last 4 weeks. In HFG, which was divided into five groups (n = 9) during the last 4 weeks, three groups were treated with PEA at 44 mg per kg bw, 88 mg per kg bw and 177 mg per kg bw, one group was treated with simvastatin at 1.77 mg per kg bw, and one was given sterile double-distilled water. The data validated that PEA dose-dependently decreased plasma total cholesterol and triglyceride level accompanied by a greater excretion of fecal bile acid. The result of RT-PCR revealed that PEA up-regulated liver X receptor (LXRα), peroxisome proliferator-activated receptor α (PPARα), peroxisome proliferator-activated receptor γ (PPARγ) and their downstream gene ATP-binding cassette transporter A1 (ABCA1), with no effect on retinoid X receptor (RXRα). PEA promoted cholesterol removal by enhancing fecal bile acid and up-regulation of the two pathways, LXR/PPAR-ABCA1. Moreover, PEA was stronger than simvastatin in some aspects.

  12. High-Density Lipoprotein-Mediated Transcellular Cholesterol Transport in Mouse Aortic Endothelial Cells

    PubMed Central

    Miao, LiXia; Okoro, Emmanuel U.; Cao, ZhiJan; Yang, Hong; Motley-Johnson, Evangeline; Guo, Zhongmao

    2015-01-01

    Accumulation of unesterified cholesterol-rich lipid vesicles in the subendothelial space contributes to atherogenesis. Transport of cholesterol from the subendothelial intima back to the circulating blood inhibits atherosclerosis development; however, the mechanism for this process has not been fully defined. Using cultured mouse aortic endothelial cells (MAECs), we observed that unesterified cholesterol can be transported across the endothelial cell monolayer from the basolateral to the apical compartment. Administration of high-density lipoprotein (HDL) or apolipoprotein AI (apoAI) to the apical compartment enhanced transendothelial cholesterol transport in a concentration-dependent manner. Knockdown of ATP-binding cassette transporter G1 (ABCG1) or scavenger receptor class B type I (SR-B1), or inhibition of SR-B1 diminished HDL-induced transendothelial cholesterol transport; while knockdown of ABCA1 reduced apoAI-mediated cholesterol transport. HDL enhanced phosphorylation of phosphatidylinositol 3-kinase (PI3K) and Akt in MAECs. However, inhibition PI3K or Akt did not reduce HDL-induced transendothelial cholesterol transport. These results suggest that HDL enhances transendothelial cholesterol transport by activation of a mechanism involving ABCA1, ABCA1 and SR-B1 but not involving PI3K and Akt. PMID:26255968

  13. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.

    PubMed

    Rajendran, S; Jezewska, M J; Bujalowski, W

    2000-11-10

    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  14. Replicative resolution of integron cassette insertion

    PubMed Central

    Loot, Céline; Ducos-Galand, Magaly; Escudero, José Antonio; Bouvier, Marie; Mazel, Didier

    2012-01-01

    Site-specific recombination catalyzed by tyrosine recombinases follows a common pathway consisting of two consecutive strand exchanges. The first strand exchange generates a Holliday junction (HJ), which is resolved by a second strand exchange. In integrons, attC sites recombine as folded single-stranded substrates. Only one of the two attC site strands, the bottom one, is efficiently bound and cleaved by the integrase during the insertion of gene cassettes at the double-stranded attI site. Due to the asymmetry of this complex, a second strand exchange on the attC bottom strand (bs) would form linearized abortive recombination products. We had proposed that HJ resolution would rely on an uncharacterized mechanism, probably replication. Using an attC site carried on a plasmid with each strand specifically tagged, we followed the destiny of each strand after recombination. We demonstrated that only one strand, the one carrying the attC bs, is exchanged. Furthermore, we show that the recombination products contain the attC site bs and its entire de novo synthesized complementary strand. Therefore, we demonstrate the replicative resolution of single-strand recombination in integrons and rule out the involvement of a second strand exchange of any kind in the attC × attI reaction. PMID:22740653

  15. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.

    PubMed

    Schäfer, R; Reiser, G

    1997-07-01

    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  16. Excisable cassettes: new tools for functional analysis of Streptomyces genomes.

    PubMed

    Raynal, Alain; Karray, Fatma; Tuphile, Karine; Darbon-Rongère, Emmanuelle; Pernodet, Jean-Luc

    2006-07-01

    The functional analysis of microbial genomes often requires gene inactivation. We constructed a set of cassettes consisting of single antibiotic resistance genes flanked by the attL and attR sites resulting from site-specific integration of the Streptomyces pSAM2 element. These cassettes can easily be used to inactivate genes by in-frame deletion in Streptomyces by a three-step strategy. In the first step, in Escherichia coli, the cassette is inserted into a cloned copy of the gene to be inactivated. In the second step, the gene is replaced by homologous recombination in Streptomyces, allowing substitution of the wild-type target gene with its inactivated counterpart. In the third step, the cassette can be removed by expression of the pSAM2 genes xis and int. The resulting strains are marker-free and contain an "attB-like" sequence of 33, 34, or 35 bp with no stop codon if the cassette is correctly chosen. Thus, a gene can be disrupted by creating an in-frame deletion, avoiding polar effects if downstream genes are cotranscribed with the target gene. A set of cassettes was constructed to contain a hygromycin or gentamicin resistance gene flanked by the attL and attR sites. The initial constructions carrying convenient cloning sites allow the insertion of any other marker gene. We tested insertion and excision by inserting a cassette into orf3, the third gene of an operon involved in spiramycin biosynthesis. We verified that the cassette exerted a polar effect on the transcription of downstream genes but that, after excision, complementation with orf3 alone restored spiramycin production.

  17. Excisable Cassettes: New Tools for Functional Analysis of Streptomyces Genomes

    PubMed Central

    Raynal, Alain; Karray, Fatma; Tuphile, Karine; Darbon-Rongère, Emmanuelle; Pernodet, Jean-Luc

    2006-01-01

    The functional analysis of microbial genomes often requires gene inactivation. We constructed a set of cassettes consisting of single antibiotic resistance genes flanked by the attL and attR sites resulting from site-specific integration of the Streptomyces pSAM2 element. These cassettes can easily be used to inactivate genes by in-frame deletion in Streptomyces by a three-step strategy. In the first step, in Escherichia coli, the cassette is inserted into a cloned copy of the gene to be inactivated. In the second step, the gene is replaced by homologous recombination in Streptomyces, allowing substitution of the wild-type target gene with its inactivated counterpart. In the third step, the cassette can be removed by expression of the pSAM2 genes xis and int. The resulting strains are marker-free and contain an “attB-like” sequence of 33, 34, or 35 bp with no stop codon if the cassette is correctly chosen. Thus, a gene can be disrupted by creating an in-frame deletion, avoiding polar effects if downstream genes are cotranscribed with the target gene. A set of cassettes was constructed to contain a hygromycin or gentamicin resistance gene flanked by the attL and attR sites. The initial constructions carrying convenient cloning sites allow the insertion of any other marker gene. We tested insertion and excision by inserting a cassette into orf3, the third gene of an operon involved in spiramycin biosynthesis. We verified that the cassette exerted a polar effect on the transcription of downstream genes but that, after excision, complementation with orf3 alone restored spiramycin production. PMID:16820478

  18. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.

    PubMed

    Li, Yuebin; Ruby, John; Wu, Hui

    2015-07-01

    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  19. A Portable Analyzer for Pouch-Actuated, Immunoassay Cassettes

    PubMed Central

    Qiu, Xianbo; Liu, Changchun; Mauk, Michael G.; Hart, Robert W.; Chen, Dafeng; Qiu, Jing; Kientz, Terry; Fiene, Jonathan; Bau, Haim H.

    2011-01-01

    A portable, small footprint, light, general purpose analyzer (processor) to control the flow in immunoassay cassettes and to facilitate the detection of test results is described. The durable analyzer accepts disposable cassettes that contain pouches and reaction chambers for various unit operations such as hydration of dry reagents, stirring, and incubation. The analyzer includes individually controlled, linear actuators to compress the pouches in the cassette, which facilitates the pumping and mixing of sample and reagents, and to close diaphragm-based valves for flow control. The same types of actuators are used to compress pouches and actuate valves. The analyzer also houses a compact OEM scanner/reader to excite fluorescence and detect emission from labels. The analyzer is hydraulically isolated from the cassette, reducing the possibility of cross-contamination. The analyzer facilitates programmable, automated execution of a sequence of operations such as pumping and valving in a timely fashion, reducing the level of expertise required from the operator and the possibility for errors. The analyzer’s design is modular and expandable to accommodate cassettes of various complexities and additional functionalities. In this paper, the utility of the analyzer has been demonstrated with the execution of a simple, consecutive, lateral flow assay of a model biological system and the test results were detected with up converting phosphor labels that are excited at infrared frequencies and emit in the visible spectrum. PMID:22125359

  20. Apolipoprotein E metabolism and functions in brain and its role in Alzheimer's disease

    PubMed Central

    Liao, Fan; Yoon, Hyejin; Kim, Jungsu

    2017-01-01

    Purpose of review APOE4 genotype is the strongest genetic risk factor for Alzheimer's disease. Prevailing evidence suggests that amyloid β plays a critical role in Alzheimer's disease. The objective of this article is to review the recent findings about the metabolism of apolipoprotein E (ApoE) and amyloid β and other possible mechanisms by which ApoE contributes to the pathogenesis of Alzheimer's disease. Recent findings ApoE isoforms have differential effects on amyloid β metabolism. Recent studies demonstrated that ApoE-interacting proteins, such as ATP-binding cassette A1 (ABCA1) and LDL receptor, may be promising therapeutic targets for Alzheimer's disease treatment. Activation of liver X receptor and retinoid X receptor pathway induces ABCA1 and other genes, leading to amyloid β clearance. Inhibition of the negative regulators of ABCA1, such as microRNA-33, also induces ABCA1 and decreases the levels of ApoE and amyloid β. In addition, genetic inactivation of an E3 ubiquitin ligase, myosin regulatory light chain interacting protein, increases LDL receptor levels and inhibits amyloid accumulation. Although amyloid β-dependent pathways have been extensively investigated, there have been several recent studies linking ApoE with vascular function, neuroinflammation, metabolism, synaptic plasticity, and transcriptional regulation. For example, ApoE was identified as a ligand for a microglial receptor, TREM2, and studies suggested that ApoE may affect the TREM2-mediated microglial phagocytosis. Summary Emerging data suggest that ApoE affects several amyloid β-independent pathways. These underexplored pathways may provide new insights into Alzheimer's disease pathogenesis. However, it will be important to determine to what extent each mechanism contributes to the pathogenesis of Alzheimer's disease. PMID:27922847

  1. Convergent Signaling Pathways Controlled by LRP1 (Receptor-related Protein 1) Cytoplasmic and Extracellular Domains Limit Cellular Cholesterol Accumulation.

    PubMed

    El Asmar, Zeina; Terrand, Jérome; Jenty, Marion; Host, Lionel; Mlih, Mohamed; Zerr, Aurélie; Justiniano, Hélène; Matz, Rachel L; Boudier, Christian; Scholler, Estelle; Garnier, Jean-Marie; Bertaccini, Diego; Thiersé, Danièle; Schaeffer, Christine; Van Dorsselaer, Alain; Herz, Joachim; Bruban, Véronique; Boucher, Philippe

    2016-03-04

    The low density lipoprotein receptor-related protein 1 (LRP1) is a ubiquitously expressed cell surface receptor that protects from intracellular cholesterol accumulation. However, the underlying mechanisms are unknown. Here we show that the extracellular (α) chain of LRP1 mediates TGFβ-induced enhancement of Wnt5a, which limits intracellular cholesterol accumulation by inhibiting cholesterol biosynthesis and by promoting cholesterol export. Moreover, we demonstrate that the cytoplasmic (β) chain of LRP1 suffices to limit cholesterol accumulation in LRP1(-/-) cells. Through binding of Erk2 to the second of its carboxyl-terminal NPXY motifs, LRP1 β-chain positively regulates the expression of ATP binding cassette transporter A1 (ABCA1) and of neutral cholesterol ester hydrolase (NCEH1). These results highlight the unexpected functions of LRP1 and the canonical Wnt5a pathway and new therapeutic potential in cholesterol-associated disorders including cardiovascular diseases.

  2. [Role of the ABC transporters A1 and G1, key reverse cholesterol transport proteins, in atherosclerosis].

    PubMed

    Demina, E P; Miroshnikova, V V; Schwarzman, A L

    2016-01-01

    Atherosclerosis is one of the most common causes of death worldwide. Epidemiology studies firmly established an inverse relationship between atherogenesis and distorted lipid metabolism, in particular, higher levels of total cholesterol, an accumulation of CH-laden macrophages (foam cells), and lower plasma levels of antiatherogenic high density lipoprotein (HDL). It is believed that the reverse cholesterol transport, a process that removes excess cholesterol from peripheral tissues/cells including macrophages to circulating HDL, is one of the main mechanisms responsible for anti-atherogenic properties of HDL. The key proteins of reverse cholesterol transport-ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1)-mediate the cholesterol efflux from macrophages and prevent their transformation into foam cells. This review focuses on the role of ABC transporters A1 and G1 in the pathogenesis of atherosclerosis.

  3. Development and physiological regulation of intestinal lipid absorption. III. Intestinal transporters and cholesterol absorption.

    PubMed

    Hui, David Y; Labonté, Eric D; Howles, Philip N

    2008-04-01

    Intestinal cholesterol absorption is modulated by transport proteins in enterocytes. Cholesterol uptake from intestinal lumen requires several proteins on apical brush-border membranes, including Niemann-Pick C1-like 1 (NPC1L1), scavenger receptor B-I, and CD36, whereas two ATP-binding cassette half transporters, ABCG5 and ABCG8, on apical membranes work together for cholesterol efflux back to the intestinal lumen to limit cholesterol absorption. NPC1L1 is essential for cholesterol absorption, but its function as a cell surface transporter or an intracellular cholesterol transport protein needs clarification. Another ATP transporter, ABCA1, is present in the basolateral membrane to mediate HDL secretion from enterocytes.

  4. Self-Paced Physics [Talking Book Cassette Tapes].

    ERIC Educational Resources Information Center

    New York Inst. of Tech., Old Westbury.

    As one of three audiovisual media in the U. S. Naval Academy Self-Paced Physics Course, 16 cassette tapes relating to lectures of mechanics, electricity, and magnetism are prepared for enriching and supplementary purposes. The material is designed to be used in combination with the talking book where illustrations, formulas, behavioral objectives,…

  5. Directory of Spoken-Voice Audio-Cassettes, 1972.

    ERIC Educational Resources Information Center

    McKee, Gerald, Ed.

    Most listings in this catalog, which draws on many sources of production and is not a guide to one company's output, are for programs of college or adult level interest, with the exception of the "Careers" listings, geared toward high school students. The catalog also has lists of producers of children's cassettes and those designed for school…

  6. Cassette Braille: A New Communication Tool for Blind People.

    ERIC Educational Resources Information Center

    Doorlag, Deanne M.; Doorlag, Donald H.

    1983-01-01

    The VersaBraille System, which incorporates cassettes with braille, has been successfully implemented in the San Diego Unified School District. Preliminary results indicate that the system promoted reading and writing rates and was more easily and quietly operated than the mechanical brailler. Users rated the system positively. (Author/CL)

  7. The Real World French Cassette Program. Script Book.

    ERIC Educational Resources Information Center

    Sternburg, Sheldon G.; Sammarco, Anthony M., Jr.

    This dual cassette package, accompanied by a script book, is designed to give students listening practice in French, particularly for regional differences of pronunciation and for variety in idiomatic constructions. The program may be integrated with texts used in intermediate and advanced levels of instruction. The announcements, jingles, and…

  8. The Real World Spanish Cassette Program. Script Book.

    ERIC Educational Resources Information Center

    Sternburg, Sheldon G.

    This dual cassette program, accompanied by a script book, is designed to give students listening practice in Spanish, particularly for regional differences of pronunciation and for variety in idiomatic construction. The program may be integrated with texts used in intermediate and advanced levels of instruction. The announcements, jingles, and…

  9. Reaching Out: The Role of Audio Cassette Communication in Rural Development. Occasional Paper 19.

    ERIC Educational Resources Information Center

    Adhikarya, Ronny; Colle, Royal D.

    This report describes the state-of-the-art of audio cassette technology (ACT) and reports findings from field tests, case studies, and pilot projects in several countries which demonstrate the potential of audio cassettes as a medium for communicating with rural people. Specific guidance is also offered on how a project can use cassettes as a…

  10. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  11. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  12. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  13. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  14. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  15. Patterns of Availability and Use of Audiotape Cassettes in Special Libraries. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Hughes, J. M., II

    1975-01-01

    The availability and use of audiotape cassettes is studied in terms of user requirements. The following factors were examined: how special libraries utilize audiotape cassettes; who the users of the medium are; how the libraries acquire and maintain their collection; and opinions of librarians as to the value of the audiotape cassette as a medium for dissemination of information.

  16. Expression of antibiotic resistance genes in the integrated cassettes of integrons.

    PubMed Central

    Collis, C M; Hall, R M

    1995-01-01

    Plasmids containing cloned integron fragments which differ only with respect to either the sequence of the promoter(s) or the number and order of inserted cassettes were used to examine the expression of resistance genes encoded in integron-associated gene cassettes. All transcripts detected commenced at the common promoter P(ant), and alterations in the sequence of P(ant) affected the level of resistance expressed by cassette genes. When both P(ant) and the secondary promoter P2 were present, transcription from both promoters was detected. When more than one cassette was present, the position of the cassette in the array influenced the level of antibiotic resistance expressed by the cassette gene. In all cases, the resistance level was highest when the gene was in the first cassette, i.e., closest to P(ant), and was reduced to different extents by the presence of individual upstream cassettes. In Northern (RNA) blots, multiple discrete transcripts originating at P(ant) were detected, and only the longer transcripts contained the distal genes. Together, these data suggest that premature transcription termination occurs within the cassettes. The most abundant transcripts appeared to contain one or more complete cassettes, and is possible that the 59-base elements found at the end of the cassettes (3' to the coding region) not only function as recombination sites but may also function as transcription terminators. PMID:7695299

  17. A simplified erythromycin resistance cassette for Treponema denticola mutagenesis

    PubMed Central

    Goetting-Minesky, M. Paula; Fenno, J. Christopher

    2010-01-01

    The primary selectable marker for genetic studies of Treponema denticola is a hybrid gene cassette containing both ermF and ermAM (ermB) genes. ErmB functions in Escherichia coli, while ErmF has been assumed to confer resistance in T. denticola. We demonstrate here that ErmB is sufficient for erythromycin selection in T. denticola and that the native ermB promoter drives ErmB expression. PMID:20691222

  18. Cassette less SOFC stack and method of assembly

    DOEpatents

    Meinhardt, Kerry D

    2014-11-18

    A cassette less SOFC assembly and a method for creating such an assembly. The SOFC stack is characterized by an electrically isolated stack current path which allows welded interconnection between frame portions of the stack. In one embodiment electrically isolating a current path comprises the step of sealing a interconnect plate to a interconnect plate frame with an insulating seal. This enables the current path portion to be isolated from the structural frame an enables the cell frame to be welded together.

  19. Existence of a low-affinity ATP-binding site in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles: evidence from binding of 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP and -[3H]ATP.

    PubMed

    Suzuki, H; Kubota, T; Kubo, K; Kanazawa, T

    1990-07-31

    ATP-binding sites in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles were titrated with 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP (TNP-AMP) or -[3H]ATP (TNP-ATP) in the absence of Ca2+ at pH 7.0 and 0 degrees C by using a centrifugation procedure. In some measurements, the bound TNP-nucleotides were chased with ATP. The data were analyzed by best-fit computer programs as well as by Scatchard plots. The results showed the existence of 1 mol of TNP-AMP binding sites with high affinity (Kd = 7.62 nM) per mole of phosphorylatable sites. The affinity of these sites for ATP (Kd = 10.1 microM) agreed with that of catalytic sites for ATP in the absence of Ca2+. The results further showed the existence of 2 mol of TNP-ATP binding sites with uniform affinity (Kd = 156 nM) per mole of phosphorylatable sites. Half of the bound TNP-ATP was fully chased by low concentrations of ATP. The affinity of this class of the sites for ATP (Kd = 8.9 microM) again agreed with that of catalytic sites for ATP. The other half of the bound TNP-ATP was fully chased only by much higher concentrations of ATP. Thus, the affinity of this class of the sites for ATP (Kd = 791 microM) was much lower than that of catalytic sites for ATP. Similar measurements were performed with sarcoplasmic reticulum vesicles pretreated by N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)ethylenediamine. Although the affinities for TNP-ATP and for ATP were appreciably altered by this pretreatment, the results were essentially the same as those obtained with native vesicles.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Cassettes for solid-oxide fuel cell stacks and methods of making the same

    SciTech Connect

    Weil, K. Scott; Meinhardt, Kerry D; Sprenkle, Vincent L

    2012-10-23

    Solid-oxide fuel cell (SOFC) stack assembly designs are consistently investigated to develop an assembly that provides optimal performance, and durability, within desired cost parameters. A new design includes a repeat unit having a SOFC cassette and being characterized by a three-component construct. The three components include an oxidation-resistant, metal window frame hermetically joined to an electrolyte layer of a multi-layer, anode-supported ceramic cell and a pre-cassette including a separator plate having a plurality of vias that provide electrical contact between an anode-side collector within the pre-cassette and a cathode-side current collector of an adjacent cell. The third component is a cathode-side seal, which includes a standoff that supports a cathode channel spacing between each of the cassettes in a stack. Cassettes are formed by joining the pre-cassette and the window frame.

  1. High-density lipoprotein-mediated transcellular cholesterol transport in mouse aortic endothelial cells.

    PubMed

    Miao, LiXia; Okoro, Emmanuel U; Cao, ZhiJan; Yang, Hong; Motley-Johnson, Evangeline; Guo, Zhongmao

    2015-09-18

    Accumulation of unesterified cholesterol-rich lipid vesicles in the subendothelial space contributes to atherogenesis. Transport of cholesterol from the subendothelial intima back to the circulating blood inhibits atherosclerosis development; however, the mechanism for this process has not been fully defined. Using cultured mouse aortic endothelial cells (MAECs), we observed that unesterified cholesterol can be transported across the endothelial cell monolayer from the basolateral to the apical compartment. Administration of high-density lipoprotein (HDL) or apolipoprotein AI (apoAI) to the apical compartment enhanced transendothelial cholesterol transport in a concentration-dependent manner. Knockdown of ATP-binding cassette transporter G1 (ABCG1) or scavenger receptor class B type I (SR-B1), or inhibition of SR-B1 diminished HDL-induced transendothelial cholesterol transport; while knockdown of ABCA1 reduced apoAI-mediated cholesterol transport. HDL enhanced phosphorylation of phosphatidylinositol 3-kinase (PI3K) and Akt in MAECs. However, inhibition of PI3K or Akt did not reduce HDL-induced transendothelial cholesterol transport. These results suggest that HDL enhances transendothelial cholesterol transport by activation of a mechanism involving ABCA1, ABCG1 and SR-B1 but not involving PI3K and Akt.

  2. Control of Angiogenesis by AIBP-mediated Cholesterol Efflux

    PubMed Central

    Fang, Longhou; Choi, Soo-Ho; Baek, Ji Sun; Liu, Chao; Almazan, Felicidad; Ulrich, Florian; Wiesner, Philipp; Taleb, Adam; Deer, Elena; Pattison, Jennifer; Torres-Vázquez, Jesús; Li, Andrew C.; Miller, Yury I.

    2013-01-01

    Cholesterol is a structural component of the cell, indispensable for normal cellular function, but its excess often leads to abnormal proliferation, migration, inflammatory responses and/or cell death. To prevent cholesterol overload, ATP-binding cassette (ABC) transporters mediate cholesterol efflux from the cells to apolipoprotein A-I (ApoA-I) and to the ApoA-I-containing high-density lipoprotein (HDL)1-3. Maintaining efficient cholesterol efflux is essential for normal cellular function4-6. However, the role of cholesterol efflux in angiogenesis and the identity of its local regulators are poorly understood. Here we show that ApoA-I binding protein (AIBP) accelerates cholesterol efflux from endothelial cells (EC) to HDL and thereby regulates angiogenesis. AIBP/HDL-mediated cholesterol depletion reduces lipid rafts, interferes with VEGFR2 dimerization and signaling, and inhibits VEGF-induced angiogenesis in vitro and mouse aortic neovascularization ex vivo. Remarkably, Aibp regulates the membrane lipid order in embryonic zebrafish vasculature and functions as a non-cell autonomous regulator of zebrafish angiogenesis. Aibp knockdown results in dysregulated sprouting/branching angiogenesis, while forced Aibp expression inhibits angiogenesis. Dysregulated angiogenesis is phenocopied in Abca1/Abcg1-deficient embryos, and cholesterol levels are increased in Aibp-deficient and Abca1/Abcg1-deficient embryos. Our findings demonstrate that secreted AIBP positively regulates cholesterol efflux from EC and that effective cholesterol efflux is critical for proper angiogenesis. PMID:23719382

  3. Cyclodextrin Protects Podocytes in Diabetic Kidney Disease

    PubMed Central

    Merscher-Gomez, Sandra; Guzman, Johanna; Pedigo, Christopher E.; Lehto, Markku; Aguillon-Prada, Robier; Mendez, Armando; Lassenius, Mariann I.; Forsblom, Carol; Yoo, TaeHyun; Villarreal, Rodrigo; Maiguel, Dony; Johnson, Kevin; Goldberg, Ronald; Nair, Viji; Randolph, Ann; Kretzler, Matthias; Nelson, Robert G.; Burke, George W.; Groop, Per-Henrik; Fornoni, Alessia

    2013-01-01

    Diabetic kidney disease (DKD) remains the most common cause of end-stage kidney disease despite multifactorial intervention. We demonstrated that increased cholesterol in association with downregulation of ATP-binding cassette transporter ABCA1 occurs in normal human podocytes exposed to the sera of patients with type 1 diabetes and albuminuria (DKD+) when compared with diabetic patients with normoalbuminuria (DKD−) and similar duration of diabetes and lipid profile. Glomerular downregulation of ABCA1 was confirmed in biopsies from patients with early DKD (n = 70) when compared with normal living donors (n = 32). Induction of cholesterol efflux with cyclodextrin (CD) but not inhibition of cholesterol synthesis with simvastatin prevented podocyte injury observed in vitro after exposure to patient sera. Subcutaneous administration of CD to diabetic BTBR (black and tan, brachiuric) ob/ob mice was safe and reduced albuminuria, mesangial expansion, kidney weight, and cortical cholesterol content. This was followed by an improvement of fasting insulin, blood glucose, body weight, and glucose tolerance in vivo and improved glucose-stimulated insulin release in human islets in vitro. Our data suggest that impaired reverse cholesterol transport characterizes clinical and experimental DKD and negatively influences podocyte function. Treatment with CD is safe and effective in preserving podocyte function in vitro and in vivo and may improve the metabolic control of diabetes. PMID:23835338

  4. Elevated expression of liver X receptor alpha (LXRα) in myocardium of streptozotocin-induced diabetic rats.

    PubMed

    Cheng, Yongxia; Liu, Guibo; Pan, Qian; Guo, Sufen; Yang, Xianghong

    2011-12-01

    The present study was designed to investigate the myocardial expression of liver X receptor alpha (LXRα) in a streptozotocin (STZ)-induced diabetic rat model. Immunohistochemical staining, quantitative real-time RT-PCR, and Western blot analysis were used to determine the expression of LXRα in the myocardium of STZ-induced diabetic rats. The myocardial expression of LXRα target genes, long-chain acyl-CoA synthetase 3 (ACSL3), fatty acid transporter protein (FAT/CD36), ATP-binding cassette transporter A1 (ABCA1), and ABCG1 were also detected. Bisulfite sequencing analysis was employed to examine the methylation status of the CpG island at the LXRα promoter region in the myocardium of STZ-induced diabetic rats. We found that LXRα mRNA and protein expression in the left ventricles, right ventricles, and atria of diabetic rats were gradually increased during the progression of diabetic cardiomyopathy (DCM). The mRNA expression levels of ACSL3 and FAT/CD36 and the protein expression levels of ABCA1 and ABCG1 were also markedly increased in different heart chambers of diabetic rats. Moreover, there was a significant difference in the methylation status of LXRα gene between the ventricles of control and diabetic rats (P < 0.05). Our findings suggest that elevated expression of LXRα may be involved in the progression of DCM, and demethylation of LXRα is likely to be responsible for its increased expression in myocardial tissues.

  5. Signal transduction pathways provide opportunities to enhance HDL and apoAI-dependent reverse cholesterol transport.

    PubMed

    Mulay, Vishwaroop; Wood, Peta; Rentero, Carles; Enrich, Carlos; Grewal, Thomas

    2012-02-01

    Binding of High Density Lipoprotein (HDL) and its major apolipoprotein A-I (apoA-I) to cell surface receptors is believed to initiate a plethora of signaling cascades that promote atheroprotective cell behavior, including the removal of excess cholesterol from lipid-loaded macrophages. More specifically, HDL and apoA-I binding to scavenger receptor BI (SR-BI) and ATP-binding cassette (ABC) transporter A1 has been shown to activate protein kinase A and C (PKA, PKC), Rac/Rho GTPases, Janus Kinase 2 (JAK2), calmodulin as well as mitogen-activated protein kinases (MAPK). Some of these signaling events upregulate mobilization of cholesterol from cellular pools, while others promote efflux pathways through increased expression, stability, and cell surface localization of SR-BI and ABCA1. This review aims to summarize the current knowledge of HDL- and apoA-I -induced signal transduction pathways that are linked to cholesterol efflux and discusses the underlying mechanisms that could couple ligand binding to SR-BI and ABCA1 with signaling and cholesterol export. Additional focus is given on the potential of pharmacological intervention to modulate the activity of signaling cascades for the inhibition or regression of cholesterol accumulation in atherosclerotic lesions.

  6. Protection against cerebral malaria by the low-molecular-weight thiol pantethine

    PubMed Central

    Penet, Marie-France; Abou-Hamdan, Mhamad; Coltel, Nicolas; Cornille, Emilie; Grau, Georges E.; de Reggi, Max; Gharib, Bouchra

    2008-01-01

    We report that administration of the low-molecular-weight thiol pantethine prevented the cerebral syndrome in Plasmodium berghei ANKA-infected mice. The protection was associated with an impairment of the host response to the infection, with in particular a decrease of circulating microparticles and preservation of the blood–brain barrier integrity. Parasite development was unaffected. Pantethine modulated one of the early steps of the inflammation–coagulation cascade, i.e., the transbilayer translocation of phosphatidylserine at the cell surface that we demonstrated on red blood cells and platelets. In this, pantethine mimicked the inactivation of the ATP-binding-cassette transporter A1 (ABCA1), which also prevents the cerebral syndrome in this malaria model. However, pantethine acts through a different pathway, because ABCA1 activity was unaffected by the treatment. The mechanisms of pantethine action were investigated, using the intact molecule and its constituents. The disulfide group (oxidized form) is necessary to lower the platelet response to activation by thrombin and collagen. Thio-sensitive mechanisms are also involved in the impairment of microparticle release by TNF-activated endothelial cells. In isolated cells, the effects were obtained by cystamine that lacks the pantothenic moiety of the molecule; however, the complete molecule is necessary to protect against cerebral malaria. Pantethine is well tolerated, and it has already been administered in other contexts to man with limited side effects. Therefore, trials of pantethine treatment in adjunctive therapy for severe malaria are warranted. PMID:18195363

  7. Is this charred material from a VHS video cassette?

    NASA Astrophysics Data System (ADS)

    Fruchtenicht, Tara; Blackledge, Robert D.; Williams, Teresa R.

    2010-06-01

    At his residence, a victim in a double homicide had installed a home-built video surveillance system. The suspects either knew of or discovered this system and removed it. In a backyard at a location associated with the suspects was a barrel used for burning trash. Could charred debris recovered from a metal bowl found among the contents of the barrel be the remains of a VHS video cassette? A positive answer to the question was obtained through a combination of optical microscopy, Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), and Energy Dispersive Spectroscopy (EDS).

  8. Chromosome inversions, adaptive cassettes and the evolution of species' ranges.

    PubMed

    Kirkpatrick, Mark; Barrett, Brian

    2015-05-01

    A chromosome inversion can spread when it captures locally adapted alleles or when it is introduced into a species by hybridization with adapted alleles that were previously absent. We present a model that shows how both processes can cause a species range to expand. Introgression of an inversion that carries novel, locally adapted alleles is a particularly powerful mechanism for range expansion. The model supports the earlier proposal that introgression of an inversion triggered a large range expansion of a malaria mosquito. These results suggest a role for inversions as cassettes of genes that can accelerate adaptation by crossing species boundaries, rather than protecting genomes from introgression.

  9. Versatile gene cassette plasmids to facilitate the construction of generalized and specialized cloning vectors.

    PubMed

    Mongkolsuk, S; Vattanaviboon, P; Rabibhadana, S; Kiatpapan, P

    1993-02-14

    We have built a series of useful gene cassette plasmids to facilitate the construction of generalized and specialized cloning vectors. The gene cassettes consist of two promoter-less genes, cat and gus, a selectable marker gene (tet) and an IncP mob sequence. All of these genes in the cassette vectors are flanked by many unique restriction sites to facilitate their use in the construction of cloning vectors.

  10. Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces.

    PubMed

    Blondelet-Rouault, M H; Weiser, J; Lebrihi, A; Branny, P; Pernodet, J L

    1997-05-06

    Three antibiotic resistance gene cassettes, derived from the omega interposon (Prentki and Krisch (1984) Gene 29, 303-313) were constructed. These cassettes carry different antibiotic resistance genes, conferring resistance to geneticin, hygromycin or viomycin, flanked by short inverted repeats containing transcription and translation termination signals and synthetic polylinkers. These cassettes were designated omega aac, omega hyg and omega vph. Resistance phenotypes conferred by these constructions are selectable in E. coli and Streptomyces. These cassettes can be used for insertional mutagenesis or for vector construction.

  11. Screening Foodstuffs for Class 1 Integrons and Gene Cassettes.

    PubMed

    Waldron, Liette S; Gillings, Michael R

    2015-06-19

    Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major factor in the spread of diverse resistance mechanisms. Amongst the DNA elements facilitating lateral transfer, the class 1 integrons have largely been responsible for spreading antibiotic resistance determinants amongst Gram negative pathogens. In total, these integrons have acquired and disseminated over 130 different antibiotic resistance genes. With continued antibiotic use, class 1 integrons have become ubiquitous in commensals and pathogens of humans and their domesticated animals. As a consequence, they can now be found in all human waste streams, where they continue to acquire new genes, and have the potential to cycle back into humans via the food chain. This protocol details a streamlined approach for detecting class 1 integrons and their associated resistance gene cassettes in foodstuffs, using culturing and PCR. Using this protocol, researchers should be able to: collect and prepare samples to make enriched cultures and screen for class 1 integrons; isolate single bacterial colonies to identify integron-positive isolates; identify bacterial species that contain class 1 integrons; and characterize these integrons and their associated gene cassettes.

  12. Staphylococcal cassette chromosome mec-like element in Macrococcus caseolyticus.

    PubMed

    Tsubakishita, Sae; Kuwahara-Arai, Kyoko; Baba, Tadashi; Hiramatsu, Keiichi

    2010-04-01

    Macrococcus is a bacterial genus that is closely related to Staphylococcus, which typically is isolated from animal skin and products. The genome analysis of multidrug-resistant Macrococcus caseolyticus strain JCSC5402, isolated from chicken, previously led to the identification of plasmid pMCCL2, which carries a transposon containing an unusual form of the Macrococcus mec gene complex (mecA(m)-mecR1(m)-mecI(m)-blaZ(m)). In M. caseolyticus strain JCSC7096, this mec transposon containing the mec gene complex (designated Tn6045 in this study) was found integrated downstream of orfX on the chromosome. Tn6045 of JCSC7096 was bracketed by the direct repeat sequences (DR) specifically recognized by cassette chromosome recombinase (CCR). A non-mecA-containing staphylococcal cassette chromosome (SCC) element, designated SCC(7096), was integrated next to the mec transposon and separated from the latter by a DR. Nested PCR experiments showed that the mec transposon not only was excised singly but also coexcised with SCC(7096) from the chromosome at the DRs. The coexcised elements formed the extrachromosomal closed circular DNA of the SCCmec-like element. SCCmec is known to be the mobile element conveying methicillin (meticillin) resistance in staphylococci. However, its origin has been unknown. Our observation revealed a potential mechanism of the generation of a new SCCmec-like element in M. caseolyticus, a commensal bacterium of food animals.

  13. Effect of vildagliptin and pravastatin combination on cholesterol efflux in adipocytes.

    PubMed

    Mostafa, Ahmed M; Hamdy, Nadia M; Abdel-Rahman, Sherif Z; El-Mesallamy, Hala O

    2016-07-01

    Many reports suggested that some statins are almost ineffective in reducing triglycerides or enhancing HDL-C plasma levels, although statin treatment was still efficacious in reducing LDL-C. In diabetic dyslipidemic patients, it may therefore be necessary to use a combination therapy with other drugs to achieve either LDL-C- and triglyceride-lowering or HDL-C-enhancing goals. Such ineffectiveness of statins can be attributed to their effect on the liver X receptor (LXR) which regulates the expression of the ATP-binding cassette (ABC) transporters ABCA1 and ABCG1. A decrease in the expression of these transporters eventually leads to decreased cholesterol efflux from peripheral tissues leading to low levels of HDL-C. Although manipulating the LXR pathway may complement the effects of statins, LXR synthetic ligands as T091317 have shown significant hypertriglyceridemic action which limits their use. We recently found that the antidiabetic drug vildagliptin stimulates LXR expression leading to increased ABCB1/ABCG1 expression which improves cholesterol efflux from adipocytes. Therefore, a combination of vildagliptin and statin may provide a solution without the hypertriglyceridemic action observed with LXR agonist. We hypothesize that a combination of vildagliptin and pravastatin will improve cholesterol efflux in adipocytes. Statin-treated 3T3-L1 adipocytes were treated with vildagliptin, and the expression of LXR-ABCA1/ABCG1 cascade and the cholesterol efflux were then determined. Our data indicate that a combination of vildagliptin and pravastatin significantly induces the expression of LXR-ABCA1/ABCG1 cascade and improves cholesterol efflux (P > 0.05) in adipocytes. Our data may explain, at least in part, the improvement in HDL-C levels observed in patients receiving both medications. © 2016 IUBMB Life, 68(7):535-543, 2016.

  14. Alpinetin enhances cholesterol efflux and inhibits lipid accumulation in oxidized low-density lipoprotein-loaded human macrophages.

    PubMed

    Jiang, Zhengming; Sang, Haiqiang; Fu, Xin; Liang, Ying; Li, Ling

    2015-01-01

    Alpinetin is a natural flavonoid abundantly present in the ginger family. Here, we investigated the effect of alpinetin on cholesterol efflux and lipid accumulation in oxidized low-density lipoprotein (ox-LDL)-treated THP-1 macrophages and human peripheral blood monocyte-derived macrophages (HMDMs). After exposing THP-1 macrophages to alpinetin, cholesterol efflux was determined by liquid scintillator. The mRNA and protein levels of peroxisome proliferator-activated receptor gamma (PPAR-γ), liver X receptor alpha (LXR-α), ATP-binding cassette transporter A1 (ABCA1), and ABCG1 and scavenger receptor class B member 1 were determined by reverse-transcriptase PCR (RT-PCR) and Western blot analysis, respectively. Alpinetin promoted apolipoprotein A-I- and high-density-lipoprotein-mediated cholesterol efflux and elevated PPAR-γ and LXR-α mRNA and protein expression in a dose-dependent fashion in ox-LDL-treated THP-1 macrophages and HMDMs. Small interfering RNA-mediated silencing of PPAR-γ or LXR-α dose dependently reversed alpinetin-increased cholesterol efflux in THP-1 macrophages, indicating the involvement of PPAR-γ and LXR-α in alpinetin-promoted cholesterol efflux. Alpinetin inhibited ox-LDL-induced lipid accumulation and enhanced the expression of ABCA1 and ABCG1 mRNA and protein, which was reversed by specific knockdown of PPAR-γ or LXR-α. Taken together, our results reveal that alpinetin exhibits positive effects on cholesterol efflux and inhibits ox-LDL-induced lipid accumulation, which might be through PPAR-γ/LXR-α/ABCA1/ABCG1 pathway.

  15. Vitamin E Secretion by Caco-2 Monolayers to APOA1, but Not to HDL, Is Vitamer Selective12

    PubMed Central

    Nicod, Nathalie; Parker, Robert S.

    2013-01-01

    The aim of this study was to characterize the pathways of basolateral secretion of common dietary tocopherols from polarized Caco-2 monolayers, a model of intestinal absorption. Given differences in structure and physical properties, we hypothesized that secretion may differ between different forms of vitamin E, thus potentially contribute to the selectivity seen in vivo. Monolayers were incubated apically and simultaneously with 10 μmol/L α-, γ-, and δ-tocopherol (1:1:1) in lipid micelles. Treatment with the microsomal triglyceride transfer protein inhibitor BMS201038 revealed that the triglyceride-rich particle secretory pathway (apolipoprotein B–dependent pathway) accounted for ∼80% of total tocopherol secretion, without selectivity among the three forms of vitamin E. Apolipoprotein B–independent secretion of tocopherols (and cholesterol) was greatly enhanced by the liver X receptor agonist T0901317. T0901317 induced ATP-binding cassette transporter A1 (ABCA1) protein expression and basolateral secretion of tocopherols to apolipoprotein A1. ABCA1-dependent secretion demonstrated vitamer selectivity such that efficiency of secretion of α- and γ-tocopherols exceeded that of δ-tocopherol. Basal addition of HDL stimulated vitamin E secretion but without selectivity among the three forms, whereas LDL had no effect. Basal addition of scavenger receptor class B member I (SR-BI) blocking antibody, which inhibits the interaction between SR-BI and HDL, increased basal accumulation of all tocopherols, demonstrating a role for SR-BI in cellular re-uptake of secreted vitamin E. These findings demonstrated that vitamin E and cholesterol utilize common pathways of secretion and that secretion via the ABCA1 pathway favors certain forms of vitamin E. PMID:23946344

  16. Pitavastatin Differentially Modulates MicroRNA-Associated Cholesterol Transport Proteins in Macrophages

    PubMed Central

    Moran, George; Sun, Tao; Gotto, Antonio M.; Hajjar, David P.

    2016-01-01

    There is emerging evidence identifying microRNAs (miRNAs) as mediators of statin-induced cholesterol efflux, notably through the ATP-binding cassette transporter A1 (ABCA1) in macrophages. The objective of this study was to assess the impact of an HMG-CoA reductase inhibitor, pitavastatin, on macrophage miRNAs in the presence and absence of oxidized-LDL, a hallmark of a pro-atherogenic milieu. Treatment of human THP-1 cells with pitavastatin prevented the oxLDL-mediated suppression of miR-33a, -33b and -758 mRNA in these cells, an effect which was not uniquely attributable to induction of SREBP2. Induction of ABCA1 mRNA and protein by oxLDL was inhibited (30%) by pitavastatin, while oxLDL or pitavastatin alone significantly induced and repressed ABCA1 expression, respectively. These findings are consistent with previous reports in macrophages. miRNA profiling was also performed using a miRNA array. We identified specific miRNAs which were up-regulated (122) and down-regulated (107) in THP-1 cells treated with oxLDL plus pitavastatin versus oxLDL alone, indicating distinct regulatory networks in these cells. Moreover, several of the differentially expressed miRNAs identified are functionally associated with cholesterol trafficking (six miRNAs in cells treated with oxLDL versus oxLDL plus pitavastatin). Our findings indicate that pitavastatin can differentially modulate miRNA in the presence of oxLDL; and, our results provide evidence that the net effect on cholesterol homeostasis is mediated by a network of miRNAs. PMID:27415822

  17. Effects of Tanshinone IIA on the modulation of miR-33a and the SREBP-2/Pcsk9 signaling pathway in hyperlipidemic rats

    PubMed Central

    JIA, LIANQUN; SONG, NAN; YANG, GUANLIN; MA, YIXIN; LI, XUETAO; LU, REN; CAO, HUIMIN; ZHANG, NI; ZHU, MEILIN; WANG, JUNYAN; LENG, XUE; CAO, YUAN; DU, YING; XU, YUE

    2016-01-01

    Tanshinone IIA is the active compound isolated from Salvia miltiorrhiza bunge, which is a traditional Chinese medicine known as Danshen. The aim of the present study was to assess the effect of Tanshinone IIA on the regulation of lipid metabolism in the livers of hyperlipidemic rats and the underlying molecular events. An in vivo model of hyperlipidemia was established in rats, with the animals receiving a daily dose of Tanshinone IIA. The serum lipid profiles were analyzed using an automatic biochemical analyzer, and the histopathological alterations and lipid deposition in liver tissue were assessed using hematoxylin and eosin staining, and oil red O staining, respectively. The mRNA expression levels of microRNA (miR)-33a, ATP-binding cassette transporter (ABC)A1, ABCG1, sterol regulatory element-binding protein 2 (SREBP-2), proprotein convertase subtilisin/kexin type 9 (Pcsk9) and low-density lipoprotein receptor (LDL-R) in liver tissues were measured using reverse transcription-quantitative polymerase chain reaction, and the protein expression levels of ABCA1, ABCG1, SREBP-2, Pcsk9, and LDL-R were analyzed using western blotting. Tanshinone IIA reduced lipid deposition and improved histopathology in the rat liver tissue, however, did not alter the lipid profile in rat serum. In addition, Tanshinone IIA treatment suppressed the expression of miR-33a, whereas the protein expression levels of ABCA1, SREBP-2, Pcsk9 in addition to LDL-R mRNA and protein were upregulated. In conclusion, the present study indicated that Tanshinone IIA attenuated lipid deposition in the livers of hyperlipidemic rats and modulated the expression of miR-33a and SREBP-2/Pcsk9 signaling pathway proteins. PMID:27082100

  18. Identification of a Chrysanthemic Ester as an Apolipoprotein E Inducer in Astrocytes

    PubMed Central

    Zhao, Wenchen; Shimizu, Yoko; Pfeifer, Tom A.; Tak, Jun-Hyung; Isman, Murray B.; Van den Hoven, Bernard; Duggan, Mark E.; Wood, Michael W.; Wellington, Cheryl L.

    2016-01-01

    The apolipoprotein E (APOE) gene is the most highly associated susceptibility locus for late onset Alzheimer’s Disease (AD), and augmenting the beneficial physiological functions of apoE is a proposed therapeutic strategy. In a high throughput phenotypic screen for small molecules that enhance apoE secretion from human CCF-STTG1 astrocytoma cells, we show the chrysanthemic ester 82879 robustly increases expressed apoE up to 9.4-fold and secreted apoE up to 6-fold and is associated with increased total cholesterol in conditioned media. Compound 82879 is unique as structural analogues, including pyrethroid esters, show no effect on apoE expression or secretion. 82879 also stimulates liver x receptor (LXR) target genes including ATP binding cassette A1 (ABCA1), LXRα and inducible degrader of low density lipoprotein receptor (IDOL) at both mRNA and protein levels. In particular, the lipid transporter ABCA1 was increased by up to 10.6-fold upon 82879 treatment. The findings from CCF-STTG1 cells were confirmed in primary human astrocytes from three donors, where increased apoE and ABCA1 was observed along with elevated secretion of high-density lipoprotein (HDL)-like apoE particles. Nuclear receptor transactivation assays revealed modest direct LXR agonism by compound 82879, yet 10 μM of 82879 significantly upregulated apoE mRNA in mouse embryonic fibroblasts (MEFs) depleted of both LXRα and LXRβ, demonstrating that 82879 can also induce apoE expression independent of LXR transactivation. By contrast, deletion of LXRs in MEFs completely blocked mRNA changes in ABCA1 even at 10 μM of 82879, indicating the ability of 82879 to stimulate ABCA1 expression is entirely dependent on LXR transactivation. Taken together, compound 82879 is a novel chrysanthemic ester capable of modulating apoE secretion as well as apoE-associated lipid metabolic pathways in astrocytes, which is structurally and mechanistically distinct from known LXR agonists. PMID:27598782

  19. Motion Pictures and Video Cassettes 1971. AV-USA Supplement 2.

    ERIC Educational Resources Information Center

    Hope, Thomas W.

    The financial status of the motion picture and of the video cassette industry in 1970 are reviewed. Based on production rates and income of these industries, trends are discovered. Figures on local origination of television programing and commercials are also included. The section on video cassettes includes the following information: the current…

  20. Natural transformation with synthetic gene cassettes: new tools for integron research and biotechnology.

    PubMed

    Gestal, Alicia M; Liew, Elissa F; Coleman, Nicholas V

    2011-12-01

    Integrons are genetic elements that can capture and express genes packaged as gene cassettes. Here we report new methods that allow integrons to be studied and manipulated in their native bacterial hosts. Synthetic gene cassettes encoding gentamicin resistance (aadB) and green fluorescence (gfp), or lactose metabolism (lacZY), were made by PCR and self-ligation, converted to large tandem arrays by multiple displacement amplification, and introduced into Escherichia coli or Pseudomonas stutzeri strains via electroporation or natural transformation. Recombinants (Gm(R) or Lac(+)) were obtained at frequencies ranging from 10(1) to 10(6) c.f.u. (µg DNA)(-1). Cassettes were integrated by site-specific recombination at the integron attI site in nearly all cases examined (370/384), including both promoterless and promoter-containing cassettes. Fluorometric analysis of gfp-containing recombinants revealed that expression levels from the integron-associated promoter P(C) were five- to 10-fold higher in the plasmid-borne integron In3 compared with the P. stutzeri chromosomal integrons. Integration of lacZY cassettes into P. stutzeri integrons allowed the bacteria to grow on lactose, and the lacZY gene cassette was stably maintained in the absence of selection. This study is believed to be the first to show natural transformation by gene cassettes, and integron-mediated capture of catabolic gene cassettes.

  1. Cassette Sound Filmstrip Viewers -- Evaluations of Nine Machines. An In Depth Report

    ERIC Educational Resources Information Center

    Educational Product Report, 1974

    1974-01-01

    In evaluating cassette sound filmstrip viewers, many criteria are the same as those applied to cassette recorders in Educational Product Report; v7 n5 Nov '73 and silent filmstrip viewers in Educational Product Report; v6 n5 Feb '73. These criteria cover output power; frequency response; tape speed accuracy including drift, wow, and flutter; and…

  2. Syntheses, photophysical properties, and application of through-bond energy-transfer cassettes for biotechnology.

    PubMed

    Jiao, Guan-Sheng; Thoresen, Lars H; Kim, Taeg Gyum; Haaland, Wade C; Gao, Feng; Topp, Michael R; Hochstrasser, Robin M; Metzker, Michael L; Burgess, Kevin

    2006-10-16

    We have designed fluorescent "through-bond energy-transfer cassettes" that can harvest energy of a relatively short wavelength (e.g., 490 nm), and emit it at appreciably longer wavelengths without significant loss of intensity. Probes of this type could be particularly useful in biotechnology for multiplexing experiments in which several different outputs are to be observed from a single excitation source. Cassettes 1-4 were designed, prepared, and studied as model systems to achieve this end. They were synthesized through convergent routes that feature coupling of specially prepared fluorescein- and rhodamine-derived fragments. The four cassettes were shown to emit strongly, with highly efficient energy transfer. Their emission maxima cover a broad range of wavelengths (broader than the four dye cassettes currently used for most high-throughput DNA sequencing), and they exhibit faster energy-transfer rates than a similar through-space energy-transfer cassette. Specifically, energy-transfer rates in these cassettes is around 6-7 ps, in contrast to a similar through-space energy-transfer system shown to have a decay time of around 35 ps. Moreover, the cassettes are considerably more stable to photobleaching than fluorescein, even though they each contain fluorescein-derived donors. This was confirmed by bulk fluorescent measurements, and in single-molecule-detection studies. Modification of a commercial automated DNA-sequencing apparatus to detect the emissions of these four energy-transfer cassettes enabled single-color dye-primer sequencing.

  3. Integron-associated gene cassettes in Halifax Harbour: assessment of a mobile gene pool in marine sediments.

    PubMed

    Koenig, J E; Boucher, Yan; Charlebois, Robert L; Nesbø, Camilla; Zhaxybayeva, Olga; Bapteste, Eric; Spencer, Matthew; Joss, Michael J; Stokes, H W; Doolittle, W F

    2008-04-01

    The integron/gene cassette systems identified in bacteria comprise a class of genetic elements that allow adaptation by acquisition of gene cassettes. Integron gene cassettes have been shown to facilitate the spread of drug resistance in human pathogens but their role outside a clinical setting has not been explored extensively. We sequenced 2145 integron gene cassettes from four marine sediment samples taken from the vicinity of Halifax Nova Scotia, Canada, increasing the number of gene cassettes obtained from environmental microbial communities by 10-fold. Sequence analyses reveals that the majority of these cassettes encode novel proteins and that this study is consistent with previous claims of high cassette diversity as we estimate a Chao1 diversity index of approximately 3000 cassettes from these samples. The functional distribution of environmental cassettes recovered in this study, when compared with that of cassettes from the only other source with significant sampling (Vibrio genomes) suggests that alternate selection regimes might be acting on these two gene pools. The majority of cassettes recovered in this study encode novel, unknown proteins. In instances where we obtained multiple alleles of a novel protein we demonstrate that non-synonymous versus synonymous substitution rates ratios suggest relaxed selection. Cassette-encoded proteins with known homologues represent a variety of functions and prevalent among these are isochorismatases; proteins involved in iron scavenging. Phylogenetic analysis of these isochorismatases as well as of cassette-encoded acetyltransferases reveals a patchy distribution, suggesting multiple sources for the origin of these cassettes. Finally, the two most environmentally similar sample sites considered in this study display the greatest overlap of cassette types, consistent with the hypothesis that cassette genes encode adaptive proteins.

  4. Flipase-mediated cassette exchange in Sf9 insect cells for stable gene expression.

    PubMed

    Fernandes, Fabiana; Vidigal, João; Dias, Mafalda M; Prather, Kristala L J; Coroadinha, Ana S; Teixeira, Ana P; Alves, Paula M

    2012-11-01

    Site-specific DNA integration allows predictable heterologous gene expression and circumvents extensive clone screening. Herein, the establishment of a Flipase (Flp)-mediated cassette exchange system in Sf9 insect cells for targeted gene integration is described. A tagging cassette harboring a reporter dsRed gene was randomly introduced into the cell genome after screening different transfection protocols. Single-copy integration clones were then co-transfected with both Flp-containing plasmid and an EGFP-containing targeting cassette. Successful cassette exchange was suggested by emergence of G418-resistant green colonies and confirmed by PCR analysis, showing the absence of the tagging cassette and single integration of the targeting cassette in the same locus. Upon cassette exchange, uniform EGFP expression between clones derived from the same integration site was obtained. Moreover, the resulting cell clones exhibited the expression properties of the parental cell line. EGFP production titers over 40 mg/L were of the same order of magnitude as those achieved through baculovirus infection. This Sf9 master cell line constitutes a versatile and re-usable platform to produce multiple recombinant proteins for fundamental and applied research.

  5. Differences in Integron Cassette Excision Dynamics Shape a Trade-Off between Evolvability and Genetic Capacitance

    PubMed Central

    Loot, Céline; Nivina, Aleksandra; Cury, Jean; Escudero, José Antonio; Ducos-Galand, Magaly; Bikard, David; Rocha, Eduardo P. C.

    2017-01-01

    ABSTRACT Integrons ensure a rapid and “on demand” response to environmental stresses driving bacterial adaptation. They are able to capture, store, and reorder functional gene cassettes due to site-specific recombination catalyzed by their integrase. Integrons can be either sedentary and chromosomally located or mobile when they are associated with transposons and plasmids. They are respectively called sedentary chromosomal integrons (SCIs) and mobile integrons (MIs). MIs are key players in the dissemination of antibiotic resistance genes. Here, we used in silico and in vivo approaches to study cassette excision dynamics in MIs and SCIs. We show that the orientation of cassette arrays relative to replication influences attC site folding and cassette excision by placing the recombinogenic strands of attC sites on either the leading or lagging strand template. We also demonstrate that stability of attC sites and their propensity to form recombinogenic structures also regulate cassette excision. We observe that cassette excision dynamics driven by these factors differ between MIs and SCIs. Cassettes with high excision rates are more commonly found on MIs, which favors their dissemination relative to SCIs. This is especially true for SCIs carried in the Vibrio genus, where maintenance of large cassette arrays and vertical transmission are crucial to serve as a reservoir of adaptive functions. These results expand the repertoire of known processes regulating integron recombination that were previously established and demonstrate that, in terms of cassette dynamics, a subtle trade-off between evolvability and genetic capacitance has been established in bacteria. PMID:28351923

  6. The use of carbon fibre material in radiographic cassettes: estimation of the dose and contrast advantages.

    PubMed

    Dance, D R; Lester, S A; Carlsson, G A; Sandborg, M; Persliden, J

    1997-04-01

    A Monte Carlo simulation has been used to estimate the dose and contrast advantages of replacing radiographic cassette fronts fabricated from aluminium with cassette fronts fabricated from low atomic number material (carbon fibre). The simulation used a realistic imaging geometry and calculations were made both with and without an anti-scatter grid. Account was taken of the scatter generated in the cassette front and the effect of beam hardening on primary contrast. Dose and contrast were evaluated for a range of cassette front thicknesses and tube potentials (60-150 kV) as well as for four examinations representative of situations with varying amounts of scatter. The results with an anti-scatter grid show a clear dose and contrast advantage in all cases when an aluminium cassette front is replaced with a low attenuation cassette front. The contrast advantage is dependent upon the examination and is generally greater for imaging bony structures than for imaging soft tissue. If a 1.74 mm aluminium cassette front is compared with a 1.1 mm carbon fibre cassette front, then the dose advantages are 16%, 9%, 8% and 6% and the contrast advantages are 10%, 7%, 4% and 5% for the AP paediatric pelvis examination at 60 kV, the anteroposterior (AP) lumbar spine examination at 80 kV, the lateral lumbar spine examination at 100 kV and the posteroanterior (PA) chest examination at 150 kV, respectively. The results without an anti-scatter grid show an increased dose advantage when a low attenuation cassette front is used, but the contrast advantage is small and in some situations negative.

  7. Improved antibiotic resistance gene cassette for marker exchange mutagenesis in Ralstonia solanacearum and Burkholderia species.

    PubMed

    Um, Hae Young; Chung, Eunsook; Lee, Jai-Heon; Lee, Seon-Woo

    2011-04-01

    Marker exchange mutagenesis is a fundamental approach to understanding gene function at a molecular level in bacteria. New plasmids carrying a kanamycin resistance gene or a trimethoprim resistance gene were constructed to provide antibiotic resistance cassettes for marker exchange mutagenesis in Ralstonia solanacearum and many antibiotic-resistant Burkholderia spp. Insertion sequences present in the flanking sequences of the antibiotic resistance cassette were removed to prevent aberrant gene replacement and polar mutation during mutagenesis in wild-type bacteria. Plasmids provided in this study would be convenient for use in gene cassettes for gene replacement in other Gram-negative bacteria.

  8. Radiation exposure reduction by use of Kevlar cassettes in the neonatal nursery

    SciTech Connect

    Herman, M.W.; Mak, H.K.; Lachman, R.S.

    1987-05-01

    A study was performed to determine whether the use of Kevlar cassettes in the neonatal intensive care nursery would reduce radiation exposure to patients. The radiation dose to the neonates was measured by using thermoluminescent dosimeters. In addition, the attenuation of the Kevlar cassettes and the sensitivity of the film-screen combination were compared with the previously used system. The greatest radiation reduction using a mobile X-ray unit was 27%; based on sensitivity measurements, the theoretical reduction averaged 38%. The reduction in radiation exposure resulted from reduced attenuation by the Kevlar cassette.

  9. Radiation exposure reduction by use of Kevlar cassettes in the neonatal nursery.

    PubMed

    Herman, M W; Mak, H K; Lachman, R S

    1987-05-01

    A study was performed to determine whether the use of Kevlar cassettes in the neonatal intensive care nursery would reduce radiation exposure to patients. The radiation dose to the neonates was measured by using thermoluminescent dosimeters. In addition, the attenuation of the Kevlar cassettes and the sensitivity of the film-screen combination were compared with the previously used system. The greatest radiation reduction using a mobile X-ray unit was 27%; based on sensitivity measurements, the theoretical reduction averaged 38%. The reduction in radiation exposure resulted from reduced attenuation by the Kevlar cassette.

  10. How To Choose Audio and Video Tape and Cassettes That Best Fit Your Needs

    ERIC Educational Resources Information Center

    Smith, Judson

    1978-01-01

    An audiovisual consultant presents a guide to selecting suitable and cost effective tape and cassettes. He describes and illustrates physical properties of tapes and includes a list of manufacturers and suppliers. (MF)

  11. Novel integrons and gene cassettes from a Cascadian submarine gas-hydrate-bearing core.

    PubMed

    Elsaied, Hosam; Stokes, Hatch W; Yoshioka, Hideyoshi; Mitani, Yasuo; Maruyama, Akihiko

    2014-02-01

    To determine whether integrons are present in a submarine gas hydrate community, metagenomic DNA was extracted from a gas-hydrate-bearing core, 150 m below the seafloor, from the Cascadian Margin. Integrons and gene cassettes were recovered by PCR from metagenomic DNA and sequenced. Thirty-seven integron integrase phylotypes were identified. The phylotypes were diverse and included members with homology to integrases from Methylomonas methanica, Desulfuromonas acetoxidans, Thermodesulfatator indicus, and marine uncultured bacteria. The gene cassette composition, 153 gene cassettes, was dominated by two types of encoded putative proteins. The first of these was predicted oxidoreductases, such as iron/sulfur cluster-binding proteins. A second type was alkyl transferases. Some cassette proteins showed homologies with those from methane-related archaea. These observations suggest that integrons may assist in the adaptation of microbial communities in this environment.

  12. Bridging the Gap: Integrating Video and Audio Cassettes into Literature Programs.

    ERIC Educational Resources Information Center

    Avery, Kay Beth; Avery, Charles W.; Pace, Debra Partin

    1998-01-01

    Describes 12 practical activities that use video and audio cassettes to build bridges to printed texts, and thus ease students into analyzing complex ideas and into complex examinations of themes, symbols, and literary technique. (SR)

  13. Dispersal and regulation of an adaptive mutagenesis cassette in the bacteria domain

    PubMed Central

    Erill, Ivan; Campoy, Susana; Mazon, Gerard; Barbé, Jordi

    2006-01-01

    Recently, a multiple gene cassette with mutagenic translation synthesis activity was identified and shown to be under LexA regulation in several proteobacteria species. In this work, we have traced down instances of this multiple gene cassette across the bacteria domain. Phylogenetic analyses show that this cassette has undergone several reorganizations since its inception in the actinobacteria, and that it has dispersed across the bacterial domain through a combination of vertical inheritance, lateral gene transfer and duplication. In addition, our analyses show that LexA regulation of this multiple gene cassette is persistent in all the phyla in which it has been detected, and suggest that this regulation is prompted by the combined activity of two of its constituent genes: a polymerase V homolog and an alpha subunit of the DNA polymerase III. PMID:16407325

  14. Integron Gene Cassettes: A Repository of Novel Protein Folds with Distinct Interaction Sites

    PubMed Central

    Sureshan, Visaahini; Deshpande, Chandrika N.; Boucher, Yan; Koenig, Jeremy E.; Stokes, H. W.; Harrop, Stephen J.; Curmi, Paul M. G.; Mabbutt, Bridget C.

    2013-01-01

    Mobile gene cassettes captured within integron arrays encompass a vast and diverse pool of genetic novelty. In most cases, functional annotation of gene cassettes directly recovered by cassette-PCR is obscured by their characteristically high sequence novelty. This inhibits identification of those specific functions or biological features that might constitute preferential factors for lateral gene transfer via the integron system. A structural genomics approach incorporating x-ray crystallography has been utilised on a selection of cassettes to investigate evolutionary relationships hidden at the sequence level. Gene cassettes were accessed from marine sediments (pristine and contaminated sites), as well as a range of Vibrio spp. We present six crystal structures, a remarkably high proportion of our survey of soluble proteins, which were found to possess novel folds. These entirely new structures are diverse, encompassing all-α, α+β and α/β fold classes, and many contain clear binding pocket features for small molecule substrates. The new structures emphasise the large repertoire of protein families encoded within the integron cassette metagenome and which remain to be characterised. Oligomeric association is a notable recurring property common to these new integron-derived proteins. In some cases, the protein–protein contact sites utilised in homomeric assembly could instead form suitable contact points for heterogeneous regulator/activator proteins or domains. Such functional features are ideal for a flexible molecular componentry needed to ensure responsive and adaptive bacterial functions. PMID:23349695

  15. Evolutionary origin of the staphylococcal cassette chromosome mec (SCCmec).

    PubMed

    Rolo, Joana; Worning, Peder; Nielsen, Jesper Boye; Bowden, Rory; Bouchami, Ons; Damborg, Peter; Guardabassi, Luca; Perreten, Vincent; Tomasz, Alexander; Westh, Henrik; de Lencastre, Hermínia; Miragaia, Maria

    2017-04-03

    Several lines of evidence indicate that the most primitive staphylococcal species, the Staphylococcus sciuri group, were involved in the first stages of evolution of SCCmec - the genetic element carrying the β-lactam resistance gene mecA. However, many steps are still missing from this evolutionary history. In particular, it is not known how mecA was incorporated into the mobile element SCC prior to dissemination among Staphylococcus aureus and other pathogenic staphylococcal species.To gain insights into the possible contribution of several species of the Staphylococcussciuri group to the assembly of SCCmec, we sequenced the genomes of 106 isolates, comprising S. sciuri (n=76), Staphylococcus vitulinus (n=18) and Staphylococcus fleurettii (n=12) from animal and human sources, and characterized the native location of mecA and the SCC insertion site using a variety of comparative genomic approaches. Moreover, we performed a SNP analysis of the genomes, in order to understand SCCmec evolution in relation to phylogeny.We found that each of three species of the S. sciuri group contributed to the evolution of SCCmec: S. vitulinus and S. fleurettii to the assembly of the mec complex, and S. sciuri most likely provided the mobile element in which mecA was later incorporated. We hypothesize that an ancestral SCCmec III cassette (an element carried by one of the most epidemic methicillin-resistant S. aureus clones), originated in S. sciuri possibly by a recombination event in a human host or a human-created environment and later was transferred to S. aureus.

  16. Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Tardigrade, Hypsibius dujardini

    NASA Technical Reports Server (NTRS)

    Reinsch, Sigrid; Myers, Zachary Alan; DeSimone, Julia Carol; Freeman, John L.; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David

    2014-01-01

    The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. We performed ground testing to determine whether ARC EMCS seed cassettes could be adapted for use with tardigrades for future spaceflight experiments. Tardigrades (water bears) are small invertebrates that enter the tun state in response to desiccation or other environmental stresses. Tardigrade tuns have suspended metabolism and have been shown to be survive exposure to space vacuum, high pressure, temperature and other stresses. For spaceflight experiments using the EMCS, the organisms ideally must be able to survive desiccation and storage in the cassette at ambient temperature for several weeks prior to the initiation of the experiment by the infusion of water to the cassette during spaceflight. The ability of tardigrades to survive extremes by entering the tun state make them ideal candidates for growth experiments in the EMCS cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membrane contains dried growth medium. The goals of our study were to (1) determine whether tardigrades survive and reproduce on PES membranes, (2) develop a consistent method for dehydration of the tardigrades with high recovery rates upon rehydration, (3) to determine an appropriate food source for the tardigrades that can also be dehydrated/rehydrated and (4) successful mock rehydration experiment in cassettes with appropriate food source. We present results that show successful multigenerational growth of tardigrades on PES membranes with a variety of wet food sources. We have successfully performed a mock rehydration with tardigrades and at least one candidate food, protonema of the moss Polytrichum, that supports multigenerational growth and whose spores germinate quickly enough to match tardigrade feeding patterns post rehydration. Our results indicate that experiments on the ISS using the tardigrade, Hypsibius dujardini

  17. Interaction of methylation-related genetic variants with circulating fatty acids on plasma lipids: a meta-analysis of 7 studies and methylation analysis of 3 studies in the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium12

    PubMed Central

    Follis, Jack L; Smith, Caren E; Tanaka, Toshiko; Manichaikul, Ani W; Chu, Audrey Y; Samieri,