Aberrant TET1 Methylation Closely Associated with CpG Island Methylator Phenotype in Colorectal Cancer.

PubMed

Ichimura, Norihisa; Shinjo, Keiko; An, Byonggu; Shimizu, Yasuhiro; Yamao, Kenji; Ohka, Fumiharu; Katsushima, Keisuke; Hatanaka, Akira; Tojo, Masayuki; Yamamoto, Eiichiro; Suzuki, Hiromu; Ueda, Minoru; Kondo, Yutaka

2015-08-01

Inactivation of methylcytosine dioxygenase, ten-eleven translocation (TET) is known to be associated with aberrant DNA methylation in cancers. Tumors with a CpG island methylator phenotype (CIMP), a distinct subgroup with extensive DNA methylation, show characteristic features in the case of colorectal cancer. The relationship between TET inactivation and CIMP in colorectal cancers is not well understood. The expression level of TET family genes was compared between CIMP-positive (CIMP-P) and CIMP-negative (CIMP-N) colorectal cancers. Furthermore, DNA methylation profiling, including assessment of the TET1 gene, was assessed in colorectal cancers, as well as colon polyps. The TET1 was silenced by DNA methylation in a subset of colorectal cancers as well as cell lines, expression of which was reactivated by demethylating agent. TET1 methylation was more frequent in CIMP-P (23/55, 42%) than CIMP-N (2/113, 2%, P < 0.0001) colorectal cancers. This trend was also observed in colon polyps (CIMP-P, 16/40, 40%; CIMP-N, 2/24, 8%; P = 0.002), suggesting that TET1 methylation is an early event in CIMP tumorigenesis. TET1 methylation was significantly associated with BRAF mutation but not with hMLH1 methylation in the CIMP-P colorectal cancers. Colorectal cancers with TET1 methylation have a significantly greater number of DNA methylated genes and less pathological metastasis compared to those without TET1 methylation (P = 0.007 and 0.045, respectively). Our data suggest that TET1 methylation may contribute to the establishment of a unique pathway in respect to CIMP-mediated tumorigenesis, which may be incidental to hMLH1 methylation. In addition, our findings provide evidence that TET1 methylation may be a good biomarker for the prediction of metastasis in colorectal cancer. ©2015 American Association for Cancer Research.

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

PubMed

Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

2013-12-01

Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

PubMed Central

Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

2012-01-01

A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

PubMed

Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

2016-08-01

This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

PubMed

Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

2016-08-01

Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

Environment, diet and CpG island methylation: epigenetic signals in gastrointestinal neoplasia.

PubMed

Johnson, Ian T; Belshaw, Nigel J

2008-04-01

The epithelial surfaces of the mammalian alimentary tract are characterised by very high rates of cell proliferation and DNA synthesis, and in humans they are highly susceptible to cancer. The role of somatic mutations as drivers of carcinogenesis in the alimentary tract is well established, but the importance of gene silencing by epigenetic mechanisms is increasingly recognised. Methylation of CpG islands is an important component of the epigenetic code that regulates gene expression during development and normal cellular differentiation, and a number of genes are well known to become abnormally methylated during the development of tumours of the oesophagus, stomach and colorectum. Aberrant patterns of DNA methylation develop as a result of pathological processes such as chronic inflammation, and in response to various dietary factors, including imbalances in the supply of methyl donors, particularly folates, and exposure to DNA methyltransferase inhibitors, which include polyphenols and possibly isothiocyanates from plant foods. However the importance of these environmental interactions in human health and disease remains to be established. Recent moves to modify the exposure of human populations to folate, by mandatory supplementation of cereal foods, emphasise the importance of understanding the susceptibility of the human epigenome to dietary and other environmental effects.

CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

PubMed

Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

2015-01-01

There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

PubMed

Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

2011-09-23

Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

PubMed Central

Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

2000-01-01

Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

Association of the Colorectal CpG Island Methylator Phenotype with molecular features, risk factors and family history

PubMed Central

Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.

2015-01-01

Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051

Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

PubMed Central

Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

2013-01-01

Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

MMASS: an optimized array-based method for assessing CpG island methylation.

PubMed

Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

2006-01-01

We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.

A CpG island methylator phenotype of colorectal cancer that is contiguous with conventional adenomas, but not serrated polyps

PubMed Central

HOKAZONO, KOJI; UEKI, TAKASHI; NAGAYOSHI, KINUKO; NISHIOKA, YASUNOBU; HATAE, TATSUNOBU; KOGA, YUTAKA; HIRAHASHI, MINAKO; ODA, YOSHINAO; TANAKA, MASAO

2014-01-01

A subset of colorectal cancers (CRCs) harbor the CpG island methylator phenotype (CIMP), with concurrent multiple promoter hypermethylation of tumor-related genes. A serrated pathway in which CIMP is developed from serrated polyps is proposed. The present study characterized CIMP and morphologically examined precursor lesions of CIMP. In total, 104 CRCs treated between January 1996 and December 2004 were examined. Aberrant promoter methylation of 15 cancer-related genes was analyzed. CIMP status was classified according to the number of methylated genes and was correlated with the clinicopathological features, including the concomitant polyps in and around the tumors. The frequency of aberrant methylation in each CRC showed a bimodal pattern, and the CRCs were classified as CIMP-high (CIMP-H), CIMP-low (CIMP-L) and CIMP-negative (CIMP-N). CIMP-H was associated with aberrant methylation of MLH1 (P=0.005) and with an improved recurrence-free survival (RFS) rate following curative resection compared with CIMP-L/N (five-year RFS rate, 93.8 vs. 67.1%; P=0.044), while CIMP-N tumors were associated with frequent distant metastases at diagnosis (P=0.023). No concomitant serrated lesions were present in the tumors, whereas conventional adenoma was contiguous with 11 (10.6%) of 104 CRCs, including four CIMP-H CRCs. CIMP-H was classified in CRCs by a novel CIMP marker panel and the presence of concomitant tumors revealed that certain CIMP-H CRCs may have arisen from conventional adenomas. PMID:25289081

A CpG island methylator phenotype of colorectal cancer that is contiguous with conventional adenomas, but not serrated polyps.

PubMed

Hokazono, Koji; Ueki, Takashi; Nagayoshi, Kinuko; Nishioka, Yasunobu; Hatae, Tatsunobu; Koga, Yutaka; Hirahashi, Minako; Oda, Yoshinao; Tanaka, Masao

2014-11-01

A subset of colorectal cancers (CRCs) harbor the CpG island methylator phenotype (CIMP), with concurrent multiple promoter hypermethylation of tumor-related genes. A serrated pathway in which CIMP is developed from serrated polyps is proposed. The present study characterized CIMP and morphologically examined precursor lesions of CIMP. In total, 104 CRCs treated between January 1996 and December 2004 were examined. Aberrant promoter methylation of 15 cancer-related genes was analyzed. CIMP status was classified according to the number of methylated genes and was correlated with the clinicopathological features, including the concomitant polyps in and around the tumors. The frequency of aberrant methylation in each CRC showed a bimodal pattern, and the CRCs were classified as CIMP-high (CIMP-H), CIMP-low (CIMP-L) and CIMP-negative (CIMP-N). CIMP-H was associated with aberrant methylation of MLH1 (P=0.005) and with an improved recurrence-free survival (RFS) rate following curative resection compared with CIMP-L/N (five-year RFS rate, 93.8 vs. 67.1%; P=0.044), while CIMP-N tumors were associated with frequent distant metastases at diagnosis (P=0.023). No concomitant serrated lesions were present in the tumors, whereas conventional adenoma was contiguous with 11 (10.6%) of 104 CRCs, including four CIMP-H CRCs. CIMP-H was classified in CRCs by a novel CIMP marker panel and the presence of concomitant tumors revealed that certain CIMP-H CRCs may have arisen from conventional adenomas.

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Association of the colorectal CpG island methylator phenotype with molecular features, risk factors, and family history.

PubMed

Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D

2015-03-01

The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.

Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

PubMed

Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

2012-03-01

Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

PubMed Central

Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

2012-01-01

Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

PubMed

Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

2014-01-01

DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

PubMed Central

Savio, Andrea J.; Bapat, Bharati

2017-01-01

ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

PubMed

Savio, Andrea J; Bapat, Bharati

2017-06-03

The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

2003-08-15

The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

PubMed

Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

2007-10-01

Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

CpG island methylator phenotype in adenocarcinomas from the digestive tract: Methods, conclusions, and controversies

PubMed Central

Sánchez-Vega, Francisco; Gotea, Valer; Chen, Yun-Ching; Elnitski, Laura

2017-01-01

Over the last two decades, cancer-related alterations in DNA methylation that regulate transcription have been reported for a variety of tumors of the gastrointestinal tract. Due to its relevance for translational research, great emphasis has been placed on the analysis and molecular characterization of the CpG island methylator phenotype (CIMP), defined as widespread hypermethylation of CpG islands in clinically distinct subsets of cancer patients. Here, we present an overview of previous work in this field and also explore some open questions using cross-platform data for esophageal, gastric, and colorectal adenocarcinomas from The Cancer Genome Atlas. We provide a data-driven, pan-gastrointestinal stratification of individual samples based on CIMP status and we investigate correlations with oncogenic alterations, including somatic mutations and epigenetic silencing of tumor suppressor genes. Besides known events in CIMP such as BRAF V600E mutation, CDKN2A silencing or MLH1 inactivation, we discuss the potential role of emerging actors such as Wnt pathway deregulation through truncating mutations in RNF43 and epigenetic silencing of WIF1. Our results highlight the existence of molecular similarities that are superimposed over a larger backbone of tissue-specific features and can be exploited to reduce heterogeneity of response in clinical trials. PMID:28344746

Profiling CpG island field methylation in both morphologically normal and neoplastic human colonic mucosa.

PubMed

Belshaw, N J; Elliott, G O; Foxall, R J; Dainty, J R; Pal, N; Coupe, A; Garg, D; Bradburn, D M; Mathers, J C; Johnson, I T

2008-07-08

Aberrant CpG island (CGI) methylation occurs early in colorectal neoplasia. Quantitative methylation-specific PCR profiling applied to biopsies was used to quantify low levels of CGI methylation of 18 genes in the morphologically normal colonic mucosa of neoplasia-free subjects, adenomatous polyp patients, cancer patients and their tumours. Multivariate statistical analyses distinguished tumour from mucosa with a sensitivity of 78.9% and a specificity of 100% (P=3 x 10(-7)). In morphologically normal mucosa, age-dependent CGI methylation was observed for APC, AXIN2, DKK1, HPP1, N33, p16, SFRP1, SFRP2 and SFRP4 genes, and significant differences in CGI methylation levels were detected between groups. Multinomial logistic regression models based on the CGI methylation profiles from normal mucosa correctly identified 78.9% of cancer patients and 87.9% of non-cancer (neoplasia-free+polyp) patients (P=4.93 x 10(-7)) using APC, HPP1, p16, SFRP4, WIF1 and ESR1 methylation as the most informative variables. Similarly, CGI methylation of SFRP4, SFRP5 and WIF1 correctly identified 61.5% of polyp patients and 78.9% of neoplasia-free subjects (P=0.0167). The apparently normal mucosal field of patients presenting with neoplasia has evidently undergone significant epigenetic modification. Methylation of the genes selected by the models may play a role in the earliest stages of the development of colorectal neoplasia.

CpG island methylation of TMS1/ASC and CASP8 genes in cervical cancer

PubMed Central

2009-01-01

Background Gene silencing associated with aberrant methylation of promoter region CpG islands is an acquired epigenetic alteration that serves as an alternative to genetic defects in the inactivation of tumor suppressor and other genes in human cancers. Aims This study describes the methylation status of TMS1/ASC and CASP8 genes in cervical cancer. We also examined the prevalence of TMS1/ASC and CASP8 genes methylation in cervical cancer tissue and none - neo plastic samples in an effort to correlate with smoking habit and clinicopathological features. Method Target DNA was modified by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequently amplified by Methylation Specific (MS) PCR with primers specific for methylated versus unmethylated DNA. The PCR product was detected by gel electrophoresis and combined with the clinical records of patients. Results The methylation pattern of the TMS1/ASC and CASP8 genes in specimens of cervical cancer and adjacent normal tissues were detected [5/80 (6.2%), 3/80 (3.75%)-2/80 (2.5%), 1/80 (1.2%) respectively]. No statistical differences were seen in the extent of differentiation, invasion, pathological type and smoking habit between the methylated and unmethylated tissues (P > 0.05). Conclusion The present study conclude that the frequency of TMS1/ASC and CASP8 genes methylation in cervical cancer are rare (< 6%), and have no any critical role in development of cervical cancer. PMID:19258216

The CpG island methylator phenotype (CIMP) in colorectal cancer.

PubMed

Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza

2013-01-01

It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.

CpG Island Methylation in Colorectal Cancer: Past, Present and Future

PubMed Central

Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.

2011-01-01

The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209

The CpG island methylator phenotype (CIMP) in colorectal cancer

PubMed Central

Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh

2013-01-01

It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

PubMed Central

Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

2016-01-01

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

Association between folate levels and CpG island hypermethylation in normal colorectal mucosa

PubMed Central

Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.

2010-01-01

Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

PubMed Central

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-01

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

PubMed

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-15

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

Promoter CpG island methylation in ion transport mechanisms and associated dietary intakes jointly influence the risk of clear-cell renal cell cancer.

PubMed

Deckers, Ivette Ag; van Engeland, Manon; van den Brandt, Piet A; Van Neste, Leander; Soetekouw, Patricia Mmb; Aarts, Maureen Jb; Baldewijns, Marcella Mll; Keszei, András P; Schouten, Leo J

2017-04-01

Sodium intake, but not potassium or fluid intake, has been associated with higher renal cell cancer (RCC) risk. However, risk factors may differ by molecular subtypes of the tumour. In renal physiology, electrolyte and water homeostasis is facilitated by ion transport mechanisms (ITM). Aberrant regulation of ITM genes, for example by promoter CpG island methylation, may modify associations between sodium, potassium and fluid intake and RCC risk. We identified ARHGDIG , ATP1A1 , SCNN1B and SLC8A3 as ITM genes exhibiting RCC-specific promoter methylation and down-regulation. Methylation-specific polymerase chain reaction (PCR) was used to analyse promoter CpG island methylation in tumour DNA of 453 RCC cases from the Netherlands Cohort Study ( n = 120 852) after 20.3 years of follow-up. Diet was measured at baseline using food-frequency questionnaires. Cox regression analyses were restricted to clear-cell (cc)RCC ( n = 306) and stratified by tumours with no, low (1 gene) and high (≥ 2 genes) methylation. Sodium intake (high vs low) increased ccRCC risk particularly in tumours with a high methylation index: hazard ratio (HR) [95% confidence interval (CI)]: 2.04 (1.16-3.58), whereas heterogeneity across the methylation index was not significant ( P -heterogeneity = 0.26). Potassium intake was differentially associated with ccRCC risk ( P -heterogeneity = 0.008); the risk for high (vs low) potassium intake was low for unmethylated tumours [HR (95% CI): 0.60 (0.36-1.01)], but high for tumours with a high methylation index [HR (95% CI): 1.60 (0.96-2.65)]. Risks similarly differed for fluid intake, though not significantly ( P -heterogeneity = 0.54). Our findings suggest for the first time that dietary intakes are differentially associated with ccRCC risk according to molecular subtypes defined by ITM gene-specific promoter methylation. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

PubMed

Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

2016-08-19

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

PubMed Central

Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

2010-01-01

The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

PubMed Central

Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

2003-01-01

Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA

Evaluation of markers for CpG island methylator phenotype (CIMP) in colorectal cancer by a large population-based sample.

PubMed

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Kraft, Peter; Loda, Massimo; Fuchs, Charles S

2007-07-01

The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation is a distinct phenotype in colorectal cancer. However, a choice of markers for CIMP has been controversial. A recent extensive investigation has selected five methylation markers (CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1) as surrogate markers for epigenomic aberrations in tumor. The use of these markers as a CIMP-specific panel needs to be validated by an independent, large dataset. Using MethyLight assays on 920 colorectal cancers from two large prospective cohort studies, we quantified DNA methylation in eight CIMP-specific markers [the above five plus CDKN2A (p16), CRABP1, and MLH1]. A CIMP-high cutoff was set at > or = 6/8 or > or = 5/8 methylated promoters, based on tumor distribution and BRAF/KRAS mutation frequencies. All but two very specific markers [MLH1 (98% specific) and SOCS1 (93% specific)] demonstrated > or = 85% sensitivity and > or = 80% specificity, indicating overall good concordance in methylation patterns and good performance of these markers. Based on sensitivity, specificity, and false positives and negatives, the eight markers were ranked in order as: RUNX3, CACNA1G, IGF2, MLH1, NEUROG1, CRABP1, SOCS1, and CDKN2A. In conclusion, a panel of markers including at least RUNX3, CACNA1G, IGF2, and MLH1 can serve as a sensitive and specific marker panel for CIMP-high.

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study.

PubMed

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-11-22

Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study

PubMed Central

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-01-01

Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854

The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

PubMed Central

Nur, I; Pascale, E; Furano, A V

1988-01-01

Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

PubMed

Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

2016-01-01

Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Clinical Significance of MLH1 Methylation and CpG Island Methylator Phenotype as Prognostic Markers in Patients with Gastric Cancer

PubMed Central

Shigeyasu, Kunitoshi; Nagasaka, Takeshi; Mori, Yoshiko; Yokomichi, Naosuke; Kawai, Takashi; Fuji, Tomokazu; Kimura, Keisuke; Umeda, Yuzo; Kagawa, Shunsuke; Goel, Ajay; Fujiwara, Toshiyoshi

2015-01-01

Background To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown. Methods This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox’s proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS). Results By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088), better tumor differentiation (P = 0.0267) and CIMP-high and MLH1 3' methylated status (P = 0.0312). Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis. Conclusions CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer. PMID:26121593

Alterations of the spindle checkpoint pathway in clinicopathologically aggressive CpG island methylator phenotype clear cell renal cell carcinomas.

PubMed

Arai, Eri; Gotoh, Masahiro; Tian, Ying; Sakamoto, Hiromi; Ono, Masaya; Matsuda, Akio; Takahashi, Yoriko; Miyata, Sayaka; Totsuka, Hirohiko; Chiku, Suenori; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Matsumoto, Kenji; Yamada, Tesshi; Yoshida, Teruhiko; Kanai, Yae

2015-12-01

CpG-island methylator phenotype (CIMP)-positive clear cell renal cell carcinomas (RCCs) are characterized by accumulation of DNA hypermethylation of CpG islands, clinicopathological aggressiveness and poor patient outcome. The aim of this study was to clarify the molecular pathways participating in CIMP-positive renal carcinogenesis. Genome (whole-exome and copy number), transcriptome and proteome (two-dimensional image converted analysis of liquid chromatography-mass spectrometry) analyses were performed using tissue specimens of 87 CIMP-negative and 14 CIMP-positive clear cell RCCs and corresponding specimens of non-cancerous renal cortex. Genes encoding microtubule-associated proteins, such as DNAH2, DNAH5, DNAH10, RP1 and HAUS8, showed a 10% or higher incidence of genetic aberrations (non-synonymous single-nucleotide mutations and insertions/deletions) in CIMP-positive RCCs, whereas CIMP-negative RCCs lacked distinct genetic characteristics. MetaCore pathway analysis of CIMP-positive RCCs revealed that alterations of mRNA or protein expression were significantly accumulated in six pathways, all participating in the spindle checkpoint, including the "The metaphase checkpoint (p = 1.427 × 10(-6))," "Role of Anaphase Promoting Complex in cell cycle regulation (p = 7.444 × 10(-6))" and "Spindle assembly and chromosome separation (p = 9.260 × 10(-6))" pathways. Quantitative RT-PCR analysis revealed that mRNA expression levels for genes included in such pathways, i.e., AURKA, AURKB, BIRC5, BUB1, CDC20, NEK2 and SPC25, were significantly higher in CIMP-positive than in CIMP-negative RCCs. All CIMP-positive RCCs showed overexpression of Aurora kinases, AURKA and AURKB, and this overexpression was mainly attributable to increased copy number. These data suggest that abnormalities of the spindle checkpoint pathway participate in CIMP-positive renal carcinogenesis, and that AURKA and AURKB may be potential therapeutic targets in more aggressive CIMP-positive RCCs. �

Alterations of the spindle checkpoint pathway in clinicopathologically aggressive CpG island methylator phenotype clear cell renal cell carcinomas

PubMed Central

Arai, Eri; Gotoh, Masahiro; Tian, Ying; Sakamoto, Hiromi; Ono, Masaya; Matsuda, Akio; Takahashi, Yoriko; Miyata, Sayaka; Totsuka, Hirohiko; Chiku, Suenori; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Matsumoto, Kenji; Yamada, Tesshi; Yoshida, Teruhiko

2015-01-01

CpG‐island methylator phenotype (CIMP)‐positive clear cell renal cell carcinomas (RCCs) are characterized by accumulation of DNA hypermethylation of CpG islands, clinicopathological aggressiveness and poor patient outcome. The aim of this study was to clarify the molecular pathways participating in CIMP‐positive renal carcinogenesis. Genome (whole‐exome and copy number), transcriptome and proteome (two‐dimensional image converted analysis of liquid chromatography‐mass spectrometry) analyses were performed using tissue specimens of 87 CIMP‐negative and 14 CIMP‐positive clear cell RCCs and corresponding specimens of non‐cancerous renal cortex. Genes encoding microtubule‐associated proteins, such as DNAH2, DNAH5, DNAH10, RP1 and HAUS8, showed a 10% or higher incidence of genetic aberrations (non‐synonymous single‐nucleotide mutations and insertions/deletions) in CIMP‐positive RCCs, whereas CIMP‐negative RCCs lacked distinct genetic characteristics. MetaCore pathway analysis of CIMP‐positive RCCs revealed that alterations of mRNA or protein expression were significantly accumulated in six pathways, all participating in the spindle checkpoint, including the “The metaphase checkpoint (p = 1.427 × 10−6),” “Role of Anaphase Promoting Complex in cell cycle regulation (p = 7.444 × 10−6)” and “Spindle assembly and chromosome separation (p = 9.260 × 10−6)” pathways. Quantitative RT‐PCR analysis revealed that mRNA expression levels for genes included in such pathways, i.e., AURKA, AURKB, BIRC5, BUB1, CDC20, NEK2 and SPC25, were significantly higher in CIMP‐positive than in CIMP‐negative RCCs. All CIMP‐positive RCCs showed overexpression of Aurora kinases, AURKA and AURKB, and this overexpression was mainly attributable to increased copy number. These data suggest that abnormalities of the spindle checkpoint pathway participate in CIMP‐positive renal carcinogenesis, and that AURKA and AURKB may be potential

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

PubMed Central

Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

2014-01-01

BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

PubMed

Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

2017-06-02

Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

PubMed Central

Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

2017-01-01

Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

PubMed

Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

2015-01-01

The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered

Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.

PubMed

Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark

2013-08-15

A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

PubMed Central

Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

2013-01-01

Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Development of TRAIL Resistance by Radiation-Induced Hypermethylation of DR4 CpG Island in Recurrent Laryngeal Squamous Cell Carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok

2014-04-01

Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less

Glioma CpG island methylator phenotype (G-CIMP): biological and clinical implications.

PubMed

Malta, Tathiane M; de Souza, Camila F; Sabedot, Thais S; Silva, Tiago C; Mosella, Maritza S; Kalkanis, Steven N; Snyder, James; Castro, Ana Valeria B; Noushmehr, Houtan

2018-04-09

Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

PubMed

Lee, Seung-Tae; Wiemels, Joseph L

2016-02-18

The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas.

PubMed

Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

2014-05-01

CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

PubMed

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-07-25

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

PubMed Central

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-01-01

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas

PubMed Central

Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

2014-01-01

CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance. PMID:24518818

Aberrant Promoter Hypermethylation of RASSF Family Members in Merkel Cell Carcinoma

PubMed Central

Richter, Antje M.; Haag, Tanja; Walesch, Sara; Herrmann-Trost, Peter; Marsch, Wolfgang C.; Kutzner, Heinz; Helmbold, Peter; Dammann, Reinhard H.

2013-01-01

Merkel cell carcinoma (MCC) is one of the most aggressive cancers of the skin. RASSFs are a family of tumor suppressors that are frequently inactivated by promoter hypermethylation in various cancers. We studied CpG island promoter hypermethylation in MCC of RASSF2, RASSF5A, RASSF5C and RASSF10 by combined bisulfite restriction analysis (COBRA) in MCC samples and control tissue. We found RASSF2 to be methylated in three out of 43 (7%), RASSF5A in 17 out of 39 (44%, but also 43% in normal tissue), RASSF5C in two out of 26 (8%) and RASSF10 in 19 out of 84 (23%) of the cancer samples. No correlation between the methylation status of the analyzed RASSFs or between RASSF methylation and MCC characteristics (primary versus metastatic, Merkel cell polyoma virus infection, age, sex) was found. Our results show that RASSF2, RASSF5C and RASSF10 are aberrantly hypermethylated in MCC to a varying degree and this might contribute to Merkel cell carcinogenesis. PMID:24252868

Identification of the CIMP-like subtype and aberrant methylation of members of the chromosomal segregation and spindle assembly pathways in esophageal adenocarcinoma.

PubMed

Krause, Lutz; Nones, Katia; Loffler, Kelly A; Nancarrow, Derek; Oey, Harald; Tang, Yue Hang; Wayte, Nicola J; Patch, Ann Marie; Patel, Kalpana; Brosda, Sandra; Manning, Suzanne; Lampe, Guy; Clouston, Andrew; Thomas, Janine; Stoye, Jens; Hussey, Damian J; Watson, David I; Lord, Reginald V; Phillips, Wayne A; Gotley, David; Smithers, B Mark; Whiteman, David C; Hayward, Nicholas K; Grimmond, Sean M; Waddell, Nicola; Barbour, Andrew P

2016-04-01

The incidence of esophageal adenocarcinoma (EAC) has risen significantly over recent decades. Although survival has improved, cure rates remain poor, with <20% of patients surviving 5 years. This is the first study to explore methylome, transcriptome and ENCODE data to characterize the role of methylation in EAC. We investigate the genome-wide methylation profile of 250 samples including 125 EAC, 19 Barrett's esophagus (BE), 85 squamous esophagus and 21 normal stomach. Transcriptome data of 70 samples (48 EAC, 4 BE and 18 squamous esophagus) were used to identify changes in methylation associated with gene expression. BE and EAC showed similar methylation profiles, which differed from squamous tissue. Hypermethylated sites in EAC and BE were mainly located in CpG-rich promoters. A total of 18575 CpG sites associated with 5538 genes were differentially methylated, 63% of these genes showed significant correlation between methylation and mRNA expression levels. Pathways involved in tumorigenesis including cell adhesion, TGF and WNT signaling showed enrichment for genes aberrantly methylated. Genes involved in chromosomal segregation and spindle formation were aberrantly methylated. Given the recent evidence that chromothripsis may be a driver mechanism in EAC, the role of epigenetic perturbation of these pathways should be further investigated. The methylation profiles revealed two EAC subtypes, one associated with widespread CpG island hypermethylation overlapping H3K27me3 marks and binding sites of the Polycomb proteins. These subtypes were supported by an independent set of 89 esophageal cancer samples. The most hypermethylated tumors showed worse patient survival. © The Author 2016. Published by Oxford University Press.

Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

PubMed

Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

2015-10-13

The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

Supra-physiological folic acid concentrations induce aberrant DNA methylation in normal human cells in vitro.

PubMed

Charles, Michelle A; Johnson, Ian T; Belshaw, Nigel J

2012-07-01

The micronutrients folate and selenium may modulate DNA methylation patterns by affecting intracellular levels of the methyl donor S-adenosylmethionine (SAM) and/or the product of methylation reactions S-adenosylhomocysteine (SAH). WI-38 fibroblasts and FHC colon epithelial cells were cultured in the presence of two forms of folate or four forms of selenium at physiologically-relevant doses, and their effects on LINE-1 methylation, gene-specific CpG island (CGI) methylation and intracellular SAM:SAH were determined. At physiologically-relevant doses the forms of folate or selenium had no effect on LINE-1 or CGI methylation, nor on intracellular SAM:SAH. However the commercial cell culture media used for the selenium studies, containing supra-physiological concentrations of folic acid, induced LINE-1 hypomethylation, CGI hypermethylation and decreased intracellular SAM:SAH in both cell lines. We conclude that the exposure of normal human cells to supra-physiological folic acid concentrations present in commercial cell culture media perturbs the intracellular SAM:SAH ratio and induces aberrant DNA methylation.

CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

PubMed Central

Li, Xia; Hu, Fulan; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

Purpose. To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. Methods. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). Results. 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05–2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19–7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11–3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02–5.24; P = 0.04). Conclusion. CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients. PMID:25243122

CpG island methylator phenotype and prognosis of colorectal cancer in Northeast China.

PubMed

Li, Xia; Hu, Fulan; Wang, Yibaina; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05-2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19-7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11-3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02-5.24; P = 0.04). CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients.

Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

PubMed Central

Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

2008-01-01

This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

PubMed

Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

2007-08-01

This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

Heritable Transmission of Diabetic Metabolic Memory in Zebrafish Correlates With DNA Hypomethylation and Aberrant Gene Expression

PubMed Central

Olsen, Ansgar S.; Sarras, Michael P.; Leontovich, Alexey; Intine, Robert V.

2012-01-01

Metabolic memory (MM) is the phenomenon whereby diabetes complications persist and progress after glycemic recovery is achieved. Here, we present data showing that MM is heritable and that the transmission correlates with hyperglycemia-induced DNA hypomethylation and aberrant gene expression. Streptozocin was used to induce hyperglycemia in adult zebrafish, and then, following streptozocin withdrawal, a recovery phase was allowed to reestablish a euglycemic state. Blood glucose and serum insulin returned to physiological levels during the first 2 weeks of the recovery phase as a result of pancreatic β-cell regeneration. In contrast, caudal fin regeneration and skin wound healing remained impaired to the same extent as in diabetic fish, and this impairment was transmissible to daughter cell tissue. Daughter tissue that was never exposed to hyperglycemia, but was derived from tissue that was, did not accumulate AGEs or exhibit increased levels of oxidative stress. However, CpG island methylation and genome-wide microarray expression analyses revealed the persistence of hyperglycemia-induced global DNA hypomethylation that correlated with aberrant gene expression for a subset of loci in this daughter tissue. Collectively, the data presented here implicate the epigenetic mechanism of DNA methylation as a potential contributor to the MM phenomenon. PMID:22228713

DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

PubMed Central

Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

2017-01-01

The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

CpG Island Methylator Phenotype is Associated With Response to Adjuvant Irinotecan-Based Therapy for Stage 3 Colon Cancer

PubMed Central

Shiovitz, Stacey; Bertagnolli, Monica M.; Renfro, Lindsay A.; Nam, Eunmi; Foster, Nathan R.; Dzieciatkowski, Slavomir; Luo, Yanxin; Lao, Victoria Valinluck; Monnat, Raymond J.; Emond, Mary J.; Maizels, Nancy; Niedzwiecki, Donna; Goldberg, Richard M.; Saltz, Leonard B.; Venook, Alan; Warren, Robert S.; Grady, William M.

2014-01-01

BACKGROUND & AIMS The CpG island methylator phenotype (CIMP), defined by a high frequency of aberrantly methylated genes, is a characteristic of a subclass of colon tumors with distinct clinical and molecular features. Cohort studies have produced conflicting results on responses of CIMP-positive tumors to chemotherapy. We assessed the association between tumor CIMP status and survival of patients receiving adjuvant fluorouracil and leucovorin alone or with irinotecan (IFL) METHODS We analyzed data from patients with stage 3 colon adenocarcinoma randomly assigned to groups given fluorouracil and leucovorin or IFL following surgery, from April 1999 through April 2001. The primary endpoint of the trial was overall survival and the secondary endpoint was disease-free survival. DNA isolated from available tumor samples (n=615) was used to determine CIMP status based on methylation patterns at the CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1 loci. The effects of CIMP on survival were modeled using Kaplan-Meier and Cox proportional hazards; interactions with treatment and BRAF, KRAS, and mismatch repair (MMR) status were also investigated. RESULTS Of the tumor samples characterized for CIMP status, 145 were CIMP positive (23%). Patients with CIMP-positive tumors had shorter overall survival times than patients with CIMP-negative tumors (hazard ratio [HR]=1.36; 95% confidence interval [CI], 1.01–1.84). Treatment with IFL showed a trend toward increased overall survival for patients with CIMP-positive tumors, compared to treatment with fluorouracil and leucovorin (HR=0.62; 95% CI, 0.37–1.05; P=.07), but not for patients with CIMP-negative tumors (HR=1.38; 95% CI, 1.00–1.89; P=.049). In a 3-way interaction analysis, patients with CIMP-positive, MMR-intact tumors benefited most from the addition of irinotecan to fluorouracil and leucovorin therapy (for the interaction, P=.01). CIMP was more strongly associated with response to IFL than MMR status. Results for disease

CpG island methylator phenotype is associated with response to adjuvant irinotecan-based therapy for stage III colon cancer.

PubMed

Shiovitz, Stacey; Bertagnolli, Monica M; Renfro, Lindsay A; Nam, Eunmi; Foster, Nathan R; Dzieciatkowski, Slavomir; Luo, Yanxin; Lao, Victoria Valinluck; Monnat, Raymond J; Emond, Mary J; Maizels, Nancy; Niedzwiecki, Donna; Goldberg, Richard M; Saltz, Leonard B; Venook, Alan; Warren, Robert S; Grady, William M

2014-09-01

The CpG island methylator phenotype (CIMP), defined by a high frequency of aberrantly methylated genes, is a characteristic of a subclass of colon tumors with distinct clinical and molecular features. Cohort studies have produced conflicting results on responses of CIMP-positive tumors to chemotherapy. We assessed the association between tumor CIMP status and survival of patients receiving adjuvant fluorouracil and leucovorin alone or with irinotecan (IFL). We analyzed data from patients with stage III colon adenocarcinoma randomly assigned to groups given fluorouracil and leucovorin or IFL after surgery, from April 1999 through April 2001. The primary end point of the trial was overall survival and the secondary end point was disease-free survival. DNA isolated from available tumor samples (n = 615) was used to determine CIMP status based on methylation patterns at the CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1 loci. The effects of CIMP on survival were modeled using Kaplan-Meier and Cox proportional hazards; interactions with treatment and BRAF, KRAS, and mismatch repair (MMR) status were also investigated. Of the tumor samples characterized for CIMP status, 145 were CIMP positive (23%). Patients with CIMP-positive tumors had shorter overall survival times than patients with CIMP-negative tumors (hazard ratio = 1.36; 95% confidence interval: 1.01-1.84). Treatment with IFL showed a trend toward increased overall survival for patients with CIMP-positive tumors, compared with treatment with fluorouracil and leucovorin (hazard ratio = 0.62; 95% CI: 0.37-1.05; P = .07), but not for patients with CIMP-negative tumors (hazard ratio = 1.38; 95% CI: 1.00-1.89; P = .049). In a 3-way interaction analysis, patients with CIMP-positive, MMR-intact tumors benefited most from the addition of irinotecan to fluorouracil and leucovorin therapy (for the interaction, P = .01). CIMP was more strongly associated with response to IFL than MMR status. Results for disease

Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

PubMed

Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

2016-11-01

We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Profile analysis and prediction of tissue-specific CpG island methylation classes

PubMed Central

2009-01-01

Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

Phase II study of nab-paclitaxel in refractory small bowel adenocarcinoma and CpG island methylator phenotype (CIMP)-high colorectal cancer.

PubMed

Overman, M J; Adam, L; Raghav, K; Wang, J; Kee, B; Fogelman, D; Eng, C; Vilar, E; Shroff, R; Dasari, A; Wolff, R; Morris, J; Karunasena, E; Pisanic, R; Azad, N; Kopetz, S

2018-01-01

Hypermethylation of promoter CpG islands [CpG island methylator phenotype (CIMP)] represents a unique pathway for the development of colorectal cancer (CRC), characterized by lack of chromosomal instability and a low rate of adenomatous polyposis coli (APC) mutations, which have both been correlated with taxane resistance. Similarly, small bowel adenocarcinoma (SBA), a rare tumor, also has a low rate of APC mutations. This phase II study evaluated taxane sensitivity in SBA and CIMP-high CRC. The primary objective was Response Evaluation Criteria in Solid Tumors version 1.1 response rate. Eligibility included Eastern Cooperative Oncology Group performance status 0/1, refractory disease, and SBA or CIMP-high metastatic CRC. Nab-paclitaxel was initially administered at a dose of 260 mg/m2 every 3 weeks but was reduced to 220 mg/m2 owing to toxicity. A total of 21 patients with CIMP-high CRC and 13 with SBA were enrolled from November 2012 to October 2014. The efficacy-assessable population (patients who received at least three doses of the treatment) comprised 15 CIMP-high CRC patients and 10 SBA patients. Common grade 3 or 4 toxicities were fatigue (12%), neutropenia (9%), febrile neutropenia (9%), dehydration (6%), and thrombocytopenia (6%). No responses were seen in the CIMP-high CRC cohort and two partial responses were seen in the SBA cohort. Median progression-free survival was significantly greater in the SBA cohort than in the CIMP-high CRC cohort (3.2 months compared with 2.1 months, P = 0.03). Neither APC mutation status nor CHFR methylation status correlated with efficacy in the CIMP-high CRC cohort. In vivo testing of paclitaxel in an SBA patient-derived xenograft validated the activity of taxanes in this disease type. Although preclinical studies suggested taxane sensitivity was associated with chromosomal stability and wild-type APC, we found that nab-paclitaxel was inactive in CIMP-high metastatic CRC. Nab-paclitaxel may represent a novel

B vitamins, methionine and alcohol intake and risk of colon cancer in relation to BRAF mutation and CpG island methylator phenotype (CIMP).

PubMed

Schernhammer, Eva S; Giovannucci, Edward; Baba, Yoshifumi; Fuchs, Charles S; Ogino, Shuji

2011-01-01

One-carbon metabolism appears to play an important role in DNA methylation reaction. Evidence suggests that a low intake of B vitamins or high alcohol consumption increases colorectal cancer risk. How one-carbon nutrients affect the CpG island methylator phenotype (CIMP) or BRAF mutation status in colon cancer remains uncertain. Utilizing incident colon cancers in a large prospective cohort of women (the Nurses' Health Study), we determined BRAF status (N = 386) and CIMP status (N = 375) by 8 CIMP-specific markers [CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1], and 8 other CpG islands (CHFR, HIC1, IGFBP3, MGMT, MINT-1, MINT-31, p14, and WRN). We examined the relationship between intake of one-carbon nutrients and alcohol and colon cancer risk, by BRAF mutation or CIMP status. Higher folate intake was associated with a trend towards low risk of CIMP-low/0 tumors [total folate intake ≥400 µg/day vs. <200 µg/day; the multivariate relative risk = 0.73; 95% CI = 0.53-1.02], whereas total folate intake had no influence on CIMP-high tumor risks (P(heterogeneity) = 0.73). Neither vitamin B(6), methionine or alcohol intake appeared to differentially influence risks for CIMP-high and CIMP-low/0 tumors. Using the 16-marker CIMP panel did not substantially alter our results. B vitamins, methionine or alcohol intake did not affect colon cancer risk differentially by BRAF status. This molecular pathological epidemiology study suggests that low level intake of folate may be associated with an increased risk of CIMP-low/0 colon tumors, but not that of CIMP-high tumors. However, the difference between CIMP-high and CIMP-low/0 cancer risks was not statistically significant, and additional studies are necessary to confirm these observations.

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

PubMed Central

Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

2009-01-01

Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

CpG methylation of APC promoter 1A in sporadic and familial breast cancer patients.

PubMed

Debouki-Joudi, Saoussen; Trifa, Fatma; Khabir, Abdelmajid; Sellami-Boudawara, Tahia; Frikha, Mounir; Daoud, Jamel; Mokdad-Gargouri, Raja

2017-01-01

Tumour suppressor gene (TSG) silencing through promoter hypermethylation plays an important role in cancer initiation. The aim of this study was to assess the extent of methylation of APC gene promoter in 91 sporadic and 44 familial cases of Tunisian patients with breast cancer (BC) in. The frequency of APC promoter methylation is somewhat similar for sporadic and familial breast cancer cases, (52.1%, and 54.5% respectively). For sporadic breast cancer patients, there was a significant correlation of APC promoter hypermethylation with TNM stage (p = 0.024) and 3-year survival (p = 0.025). Regarding the hormonal status (HR), we found significant association between negativity to PR and unmethylated APC (p= 0.005) while ER and Her2/neu are not correlated. Moreover, unmethylated APC promoter is more frequent in tumours expressing at least one out the 3 proteins compared to triple negative cases (p= 0.053). On the other hand, aberrant methylation of APC was associated with tumour size (p = 0.036), lymph node (p = 0.028), distant metastasis (p = 0.031), and 3-year survival (p = 0.046) in the group of patients with familial breast cancer. Moreover, patients with sporadic breast cancer displaying the unmethylated profile have a significant prolonged overall survival compared to those with the methylated pattern of APC promoter (p log rank = 0.008). Epigenetic change at the CpG islands in the APC promoter was associated with the silence of its transcript and the loss of protein expression suggesting that this event is the main mechanism regulating the APC expression in breast cancer. In conclusion, our data showed that the loss of APC through aberrant methylation is associated with the aggressive behavior of both sporadic and familial breast cancer in Tunisian patients.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant

Are clinicopathological features of colorectal cancers with methylation in half of CpG island methylator phenotype panel markers different from those of CpG island methylator phenotype-high colorectal cancers?

PubMed

Bae, Jeong Mo; Rhee, Ye-Young; Kim, Kyung Ju; Wen, Xianyu; Song, Young Seok; Cho, Nam-Yun; Kim, Jung Ho; Kang, Gyeong Hoon

2016-01-01

CpG island methylator phenotype (CIMP)-high (CIMP-H) colorectal cancer (CRC) is defined when a tumor shows methylation at greater than or equal to 60% of CIMP panel markers. Although CRCs with methylation at 50% of panel markers are classified as CIMP-low/CIMP-0 tumors, little is known regarding the clinicopathological and molecular features of CRCs with methylation at 4/8 panel markers (4/8 methylated markers) and whether they are akin to CIMP-H or CIMP-low/CIMP-0 CRCs in terms of their clinicopathological or molecular features. A total of 1164 cases of surgically resected CRC were analyzed for their methylation status in 8 CIMP panel markers, and the frequencies of various clinicopathological and molecular features were compared between CRCs with 0/8, 1/8 to 3/8, 4/8, and 5/8 to 8/8 methylated markers. CRCs with 4/8 methylated markers were closer to CRCs with 5/8 to 8/8 methylated markers in terms of sex distribution, mucin production, serration, nodal metastasis, CK7 expression, CK20 loss, and CDX2 loss frequencies and overall survival rate. CRCs with methylation at 4/8 markers were closer to CRCs with 1/8 to 3/8 methylated markers in terms of less frequent right colon location and poor differentiation. CRCs with 4/8 methylated markers showed the shortest overall survival time compared with CRCs with 0/8, 1/8 to 3/8, 4/8, or 5/8 to 8/8 methylated markers. In terms of clinicopathological and molecular features, CRCs with 4/8 methylated markers appeared to be closer to CIMP-H than to CIMP-low/CIMP-0 and would thus be better classified as CIMP-H if the CRCs require classification into either CIMP-H or CIMP-low/CIMP-0. Copyright © 2015 Elsevier Inc. All rights reserved.

The role of the CpG island methylator phenotype on survival outcome in colon cancer.

PubMed

Kang, Ki Joo; Min, Byung Hoon; Ryu, Kyung Ju; Kim, Kyoung Mee; Chang, Dong Kyung; Kim, Jae J; Rhee, Jong Chul; Kim, Young Ho

2015-03-01

CpG island methylator phenotype (CIMP)- high colorectal cancers (CRCs) have distinct clinicopathologi-cal features from their CIMP-low/negative CRC counterparts. However, controversy exists regarding the prognosis of CRC according to the CIMP status. Therefore, this study examined the prognosis of Korean patients with colon cancer according to the CIMP status. Among a previous cohort pop-ulation with CRC, a total of 154 patients with colon cancer who had available tissue for DNA extraction were included in the study. CIMP-high was defined as ≥3/5 methylated mark-ers using the five-marker panel (CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1). CIMP-high and CIMP-low/neg-ative cancers were observed in 27 patients (17.5%) and 127 patients (82.5%), respectively. Multivariate analysis adjust-ing for age, gender, tumor location, tumor stage and CIMP and microsatellite instability (MSI) statuses indicated that CIMP-high colon cancers were associated with a significant increase in colon cancer-specific mortality (hazard ratio [HR], 3.23; 95% confidence interval [CI], 1.20 to 8.69; p=0.02). In microsatellite stable cancers, CIMP-high cancer had a poor survival outcome compared to CIMP-low/negative cancer (HR, 2.91; 95% CI, 1.02 to 8.27; p=0.04). Re-gardless of the MSI status, CIMP-high cancers had poor sur-vival outcomes in Korean patients. (Gut Liver, 2015;9202-207).

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

PubMed Central

Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

2017-01-01

Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Aberrant promoter hypermethylation of PBRM1, BAP1, SETD2, KDM6A and other chromatin-modifying genes is absent or rare in clear cell RCC

PubMed Central

Ibragimova, Ilsiya; Maradeo, Marie E.; Dulaimi, Essel; Cairns, Paul

2013-01-01

Recent sequencing studies of clear cell (conventional) renal cell carcinoma (ccRCC) have identified inactivating point mutations in the chromatin-modifying genes PBRM1, KDM6A/UTX, KDM5C/JARID1C, SETD2, MLL2 and BAP1. To investigate whether aberrant hypermethylation is a mechanism of inactivation of these tumor suppressor genes in ccRCC, we sequenced the promoter region within a bona fide CpG island of PBRM1, KDM6A, SETD2 and BAP1 in bisulfite-modified DNA of a representative series of 50 primary ccRCC, 4 normal renal parenchyma specimens and 5 RCC cell lines. We also interrogated the promoter methylation status of KDM5C and ARID1A in the Cancer Genome Atlas (TCGA) ccRCC Infinium data set. PBRM1, KDM6A, SETD2 and BAP1 were unmethylated in all tumor and normal specimens. KDM5C and ARID1A were unmethylated in the TCGA 219 ccRCC and 119 adjacent normal specimens. Aberrant promoter hypermethylation of PBRM1, BAP1 and the other chromatin-modifying genes examined here is therefore absent or rare in ccRCC. PMID:23644518

Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

PubMed Central

Vingron, Martin

2016-01-01

Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

Assessing CpG island methylator phenotype, 1p/19q codeletion, and MGMT promoter methylation from epigenome-wide data in the biomarker cohort of the NOA-04 trial

PubMed Central

Wiestler, Benedikt; Capper, David; Hovestadt, Volker; Sill, Martin; Jones, David T.W.; Hartmann, Christian; Felsberg, Joerg; Platten, Michael; Feiden, Wolfgang; Keyvani, Kathy; Pfister, Stefan M.; Wiestler, Otmar D.; Meyermann, Richard; Reifenberger, Guido; Pietsch, Thorsten; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

2014-01-01

Background Molecular biomarkers including isocitrate dehydrogenase 1 or 2 (IDH1/2) mutation, 1p/19q codeletion, and O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation may improve prognostication and guide treatment decisions for patients with World Health Organization (WHO) anaplastic gliomas. At present, each marker is individually tested by distinct assays. Illumina Infinium HumanMethylation450 BeadChip arrays (HM450) enable the determination of large-scale methylation profiles and genome-wide DNA copy number changes. Algorithms have been developed to detect the glioma CpG island methylator phenotype (G-CIMP) associated with IDH1/2 mutation, 1p/19q codeletion, and MGMT promoter methylation using a single assay. Methods Here, we retrospectively investigated the diagnostic and prognostic performance of these algorithms in comparison to individual marker testing and patient outcome in the biomarker cohort (n = 115 patients) of the NOA-04 trial. Results Concordance for IDH and 1p/19q status was very high: In 92% of samples, the HM450 and reference data agreed. In discordant samples, survival analysis by Kaplan-Meier and Cox regression analyses suggested a more accurate assessment of biological phenotype by the HM450 analysis. The HM450-derived MGMT-STP27 model to calculate MGMT promoter methylation probability revealed this aberration in a significantly higher fraction of samples than conventional methylation-specific PCR, with 87 of 91 G-CIMP tumors predicted as MGMT promoter-methylated. Pyrosequencing of discordant samples confirmed the HM450 assessment in 14 of 17 cases. Conclusions G-CIMP and 1p/19q codeletion are reliably detectable by HM450 analysis and are associated with prognosis in the NOA-04 trial. For MGMT, HM450 suggests promoter methylation in the vast majority of G-CIMP tumors, which is supported by pyrosequencing. PMID:25028501

CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers

PubMed Central

Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A.; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H.; Hektoen, Merete; Eknæs, Mette; Nesbakken, Arild; Lothe, Ragnhild A.

2017-01-01

The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5‐markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni‐ and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60‐74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31‐2.63] and 1.89 [1.34‐2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. PMID:28542846

Different definitions of CpG island methylator phenotype and outcomes of colorectal cancer: a systematic review.

PubMed

Jia, Min; Gao, Xu; Zhang, Yan; Hoffmeister, Michael; Brenner, Hermann

2016-01-01

Contradictory results were reported for the prognostic role of CpG island methylator phenotype (CIMP) among colorectal cancer (CRC) patients. Differences in the definitions of CIMP were the most common explanation for these discrepancies. The aim of this systematic review was to give an overview of the published studies on CRC prognosis according to the different definitions of CIMP. A systematic literature search was performed in MEDLINE and ISI Web of Science for articles published until 3 April 2015. Data extraction included information about the study population, the definition of CIMP, and investigated outcomes. Thirty-six studies were included in this systematic review. Among them, 30 studies reported the association of CIMP and CRC prognosis and 11 studies reported the association of CIMP with survival after CRC therapy. Overall, 16 different definitions of CIMP were identified. The majority of studies reported a poorer prognosis for patients with CIMP-positive (CIMP+)/CIMP-high (CIMP-H) CRC than with CIMP-negative (CIMP-)/CIMP-low (CIMP-L) CRC. Inconsistent results or varying effect strengths could not be explained by different CIMP definitions used. No consistent variation in response to specific therapies according to CIMP status was found. Comparative analyses of different CIMP panels in the same large study populations are needed to further clarify the role of CIMP definitions and to find out how methylation information can best be used to predict CRC prognosis and response to specific CRC therapies.

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Comparative methylome analysis in solid tumors reveals aberrant methylation at chromosome 6p in nasopharyngeal carcinoma.

PubMed

Dai, Wei; Cheung, Arthur Kwok Leung; Ko, Josephine Mun Yee; Cheng, Yue; Zheng, Hong; Ngan, Roger Kai Cheong; Ng, Wai Tong; Lee, Anne Wing Mui; Yau, Chun Chung; Lee, Victor Ho Fu; Lung, Maria Li

2015-07-01

Altered patterns of DNA methylation are key features of cancer. Nasopharyngeal carcinoma (NPC) has the highest incidence in Southern China. Aberrant methylation at the promoter region of tumor suppressors is frequently reported in NPC; however, genome-wide methylation changes have not been comprehensively investigated. Therefore, we systematically analyzed methylome data in 25 primary NPC tumors and nontumor counterparts using a high-throughput approach with the Illumina HumanMethylation450 BeadChip. Comparatively, we examined the methylome data of 11 types of solid tumors collected by The Cancer Genome Atlas (TCGA). In NPC, the hypermethylation pattern was more dominant than hypomethylation and the majority of de novo methylated loci were within or close to CpG islands in tumors. The comparative methylome analysis reveals hypermethylation at chromosome 6p21.3 frequently occurred in NPC (false discovery rate; FDR=1.33 × 10(-9) ), but was less obvious in other types of solid tumors except for prostate and Epstein-Barr virus (EBV)-positive gastric cancer (FDR<10(-3) ). Bisulfite pyrosequencing results further confirmed the aberrant methylation at 6p in an additional patient cohort. Evident enrichment of the repressive mark H3K27me3 and active mark H3K4me3 derived from human embryonic stem cells were found at these regions, indicating both DNA methylation and histone modification function together, leading to epigenetic deregulation in NPC. Our study highlights the importance of epigenetic deregulation in NPC. Polycomb Complex 2 (PRC2), responsible for H3K27 trimethylation, is a promising therapeutic target. A key genomic region on 6p with aberrant methylation was identified. This region contains several important genes having potential use as biomarkers for NPC detection. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Adverse prognostic impact of the CpG island methylator phenotype in metastatic colorectal cancer

PubMed Central

Cha, Yongjun; Kim, Kyung-Ju; Han, Sae-Won; Rhee, Ye Young; Bae, Jeong Mo; Wen, Xianyu; Cho, Nam-Yun; Lee, Dae-Won; Lee, Kyung-Hun; Kim, Tae-Yong; Oh, Do-Youn; Im, Seock-Ah; Bang, Yung-Jue; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You

2016-01-01

Background: The association between the CpG island methylator phenotype (CIMP) and clinical outcomes in metastatic colorectal cancer remains unclear. We investigated the prognostic impact of CIMP in patients with metastatic colorectal cancer treated with systemic chemotherapy. Methods: Eight CIMP-specific promoters (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1, CDKN2A, CRABP1, and MLH1) were examined. The CIMP status was determined by the number of methylated promoters as high (⩾5), low (1–4), and negative (0). Results: A total of 153 patients were included (men/women, 103/50; median age, 61 years; range, 22–80 years). The CIMP status was negative/low/high in 77/ 69/7 patients, respectively. Overall survival (OS) was significantly different among the three CIMP groups, with median values of 35.7, 22.2, and 9.77 months for the negative, low, and high groups, respectively (P<0.001). For patients treated with fluoropyrimidine and oxaliplatin first-line chemotherapy (N=128), OS and progression-free survival (PFS) were significantly different among the three CIMP groups; the median OS was 37.9, 23.8, and 6.77 months for the negative, low, and high groups, respectively (P<0.001), while the median PFS was 9.97, 7.87, and 1.83 months, respectively (P=0.002). Response rates were marginally different among the three CIMP groups (53.4% vs 45.1% vs 16.7%, respectively; P=0.107). For patients treated with fluoropyrimidine and irinotecan second-line chemotherapy (N=86), only OS showed a difference according to the CIMP status, with median values of 20.4, 13.4, and 2.90 months for the negative, low, and high groups, respectively (P<0.001). Conclusions: The CIMP status is a negative prognostic factor for patients with metastatic colorectal cancer treated with chemotherapy. PMID:27310704

Adverse prognostic impact of the CpG island methylator phenotype in metastatic colorectal cancer.

PubMed

Cha, Yongjun; Kim, Kyung-Ju; Han, Sae-Won; Rhee, Ye Young; Bae, Jeong Mo; Wen, Xianyu; Cho, Nam-Yun; Lee, Dae-Won; Lee, Kyung-Hun; Kim, Tae-Yong; Oh, Do-Youn; Im, Seock-Ah; Bang, Yung-Jue; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You

2016-07-12

The association between the CpG island methylator phenotype (CIMP) and clinical outcomes in metastatic colorectal cancer remains unclear. We investigated the prognostic impact of CIMP in patients with metastatic colorectal cancer treated with systemic chemotherapy. Eight CIMP-specific promoters (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1, CDKN2A, CRABP1, and MLH1) were examined. The CIMP status was determined by the number of methylated promoters as high (⩾5), low (1-4), and negative (0). A total of 153 patients were included (men/women, 103/50; median age, 61 years; range, 22-80 years). The CIMP status was negative/low/high in 77/ 69/7 patients, respectively. Overall survival (OS) was significantly different among the three CIMP groups, with median values of 35.7, 22.2, and 9.77 months for the negative, low, and high groups, respectively (P<0.001). For patients treated with fluoropyrimidine and oxaliplatin first-line chemotherapy (N=128), OS and progression-free survival (PFS) were significantly different among the three CIMP groups; the median OS was 37.9, 23.8, and 6.77 months for the negative, low, and high groups, respectively (P<0.001), while the median PFS was 9.97, 7.87, and 1.83 months, respectively (P=0.002). Response rates were marginally different among the three CIMP groups (53.4% vs 45.1% vs 16.7%, respectively; P=0.107). For patients treated with fluoropyrimidine and irinotecan second-line chemotherapy (N=86), only OS showed a difference according to the CIMP status, with median values of 20.4, 13.4, and 2.90 months for the negative, low, and high groups, respectively (P<0.001). The CIMP status is a negative prognostic factor for patients with metastatic colorectal cancer treated with chemotherapy.

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.

PubMed

Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D

2014-02-27

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.

Meta-analysis of the prognostic value of CpG island methylator phenotype in gastric cancer.

PubMed

Powell, A G M T; Soul, S; Christian, A; Lewis, W G

2018-01-01

CpG island methylator phenotype (CIMP) has been identified as a distinct molecular subtype of gastric cancer, yet associations with survival are conflicting. A meta-analysis was performed to estimate the prognostic significance of CIMP. Embase, MEDLINE, PubMed, PubMed Central and Cochrane databases were searched systematically for studies related to the association between CIMP and survival in patients undergoing potentially curative resection for gastric cancer. A total of 918 patients from ten studies were included, and the median proportion of tumours with CIMP-high (CIMP-H) status was 40·9 (range 4·8-63) per cent. Gene panels for assessing CIMP status varied between the studies. Pooled analysis suggested that specimens exhibiting CIMP-H were associated with poorer 5-year survival (odds ratio (OR) for death 1·48, 95 per cent c.i. 1·10 to 1·99; P = 0·009). Significant heterogeneity was observed between studies (I 2 = 88 per cent, P < 0·001). Subgroup analysis according to whether studies showed a tendency towards poor (5 studies) or improved (5) outcomes for patients with CIMP-H tumours, revealed that CIMP-H was associated with both poor (OR for death 8·15, 4·65 to 14·28, P < 0·001; heterogeneity I 2 = 52 per cent, P = 0·08) and improved (OR 0·42, 0·27 to 0·65; P < 0·001, heterogeneity I 2 = 0 per cent, P = 0·960) survival. There was heterogeneity in the gene panels used to identify CIMP, which may explain the survival differences. © 2018 BJS Society Ltd Published by John Wiley & Sons Ltd.

The CpG island methylator phenotype is concordant between primary colorectal carcinoma and matched distant metastases.

PubMed

Cohen, Stacey A; Yu, Ming; Baker, Kelsey; Redman, Mary; Wu, Chen; Heinzerling, Tai J; Wirtz, Ralph M; Charalambous, Elpida; Pentheroudakis, George; Kotoula, Vassiliki; Kalogeras, Konstantine T; Fountzilas, George; Grady, William M

2017-01-01

The CpG island methylator phenotype (CIMP) in stage III colon cancer (CRC) has been associated with improved survival after treatment with adjuvant irinotecan-based chemotherapy. In this analysis, we determine whether CIMP status in the primary CRC is concordant with the CIMP status of matched metastases in order to determine if assessment of CIMP status in the primary tumor can be used to predict CIMP status of metastatic disease, which is relevant for patient management as well as for understanding the biology of CIMP CRCs. We assessed the CIMP status of 70 pairs of primary CRC and matched metastases using a CRC-specific panel of five markers ( CACNA1G , IGF2 , NEUROG1 , RUNX3 , and SOCS1 ) where CIMP positive was defined as 3/5 positive markers at a percent methylated reference threshold of ≥10%. Concordance was compared using the Fisher's exact test and P  < 0.05 was considered significant. Sixty-nine of the pairs (98.6%) showed concordant CIMP status in the primary tumor and matched metastasis; five (7.0%) of the pairs were concordantly CIMP positive. Only one pair (1.4%) had divergent CIMP status, demonstrating CIMP positivity (4/5 markers positive) in the primary tumor, while the matched metastasis was CIMP negative (0 markers positive). CIMP status is generally concordant between primary CRCs and matched metastases. Thus, CIMP status in the primary tumor is maintained in matched metastases and can be used to inform CIMP-based therapy options for the metastases.

CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers.

PubMed

Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H; Hektoen, Merete; Eknaes, Mette; Nesbakken, Arild; Lothe, Ragnhild A; Lind, Guro E

2017-09-01

The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5-markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni- and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60-74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31-2.63] and 1.89 [1.34-2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG Pattern

Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts

PubMed Central

Doi, Akiko; Park, In-Hyun; Wen, Bo; Murakami, Peter; Aryee, Martin J; Irizarry, Rafael; Herb, Brian; Ladd-Acosta, Christine; Rho, Junsung; Loewer, Sabine; Miller, Justine; Schlaeger, Thorsten; Daley, George Q; Feinberg, Andrew P

2010-01-01

Induced pluripotent stem (iPS) cells are derived by epigenetic reprogramming, but their DNA methylation patterns have not yet been analyzed on a genome-wide scale. Here, we find substantial hypermethylation and hypomethylation of cytosine-phosphate-guanine (CpG) island shores in nine human iPS cell lines as compared to their parental fibroblasts. The differentially methylated regions (DMRs) in the reprogrammed cells (denoted R-DMRs) were significantly enriched in tissue-specific (T-DMRs; 2.6-fold, P < 10−4) and cancer-specific DMRs (C-DMRs; 3.6-fold, P < 10−4). Notably, even though the iPS cells are derived from fibroblasts, their R-DMRs can distinguish between normal brain, liver and spleen cells and between colon cancer and normal colon cells. Thus, many DMRs are broadly involved in tissue differentiation, epigenetic reprogramming and cancer. We observed colocalization of hypomethylated R-DMRs with hypermethylated C-DMRs and bivalent chromatin marks, and colocalization of hypermethylated R-DMRs with hypomethylated C-DMRs and the absence of bivalent marks, suggesting two mechanisms for epigenetic reprogramming in iPS cells and cancer. PMID:19881528

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

PubMed

Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

2015-12-21

Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

PubMed

Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

2014-07-01

We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

Unique patterns of CpG island methylation in inflammatory bowel disease-associated colorectal cancers

PubMed Central

Olaru, Alexandru V.; Cheng, Yulan; Agarwal, Rachana; Yang, Jian; David, Stefan; Abraham, John M.; Yu, Wayne; Lazarev, Mark; Brant, Steven R.; Marohn, Michael R.; Hutcheon, David F.; Harpaz, Noam; Meltzer, Stephen J.; Mori, Yuriko

2011-01-01

Objective CpG island (CGI) hypermethylation at discrete loci is a prevalent cancer-promoting abnormality in sporadic colorectal carcinomas (S-CRCs). We investigated genome-wide CGI methylation in inflammatory bowel disease (IBD)-associated CRCs (IBD-CRCs). Design Methylation microarray analyses were conducted on 7 IBD-CRCs, 17 S-CRCs, and 8 normal control colonic tissues from patients without CRC or IBD. CGI methylator phenotype (CIMP), a surrogate marker for widespread cancer-specific CGI hypermethylation, was examined in 30 IBD-CRCs and 43 S-CRCs. Results The genome-wide CGI methylation pattern of IBD-CRCs was CIMP status-dependent. Based on methylation array data profiling of all autosomal loci, CIMP+ IBD-CRCs grouped together with S-CRCs, while CIMP− IBD-CRCs grouped together with control tissues. CIMP− IBD-CRCs demonstrated less methylation than did age-matched CIMP− S-CRCs at all autosomal CGIs (z-score −0.17 vs. 0.09, p=3×10−3) and CRC-associated hypermethylation target CGIs (z-score −0.43 vs. 0.68, p=1×10-4). Age-associated hypermethylation target CGIs were significantly overrepresented in CGIs that were hypermethylated in S-CRCs (p=1×10−192), but not in CGIs that were hypermethylated in IBD-CRCs (p=0.11). In contrast, KRAS mutation prevalence were similar between IBD-CRCs and S-CRCs. Notably, CIMP+ prevalence was significantly higher in older than in younger IBD-CRC cases (4.2% vs. 50.0%, p=0.02), but not in S-CRC cases (16.7% vs. 9.7%, p=0.92). Conclusions Cancer-specific CGI hypermethylation and age-associated CGI hypermethylation are diminished in IBD-CRCs relative to S-CRCs, while KRAS mutation rate is comparable between these cancers. CGI hypermethylation appears to play only a minor role in IBD-associated carcinogenesis. We speculate that aging, rather than inflammation per se, promotes CIMP+ CRCs in IBD patients. PMID:21830278

Prognostic and Predictive Value of CpG Island Methylator Phenotype in Patients with Locally Advanced Nonmetastatic Sporadic Colorectal Cancer

PubMed Central

Long, Yadong; Xu, Ye; Guan, Zuqing; Lian, Peng; Peng, Junjie

2014-01-01

Purpose. In the present study, the prognostic significance of CpG island methylator phenotype (CIMP) in stage II/III sporadic colorectal cancer was evaluated using a five-gene panel. Methods. Fifty stage II/III colorectal cancer patients who received radical resection were included in this study. Promoter methylation of p14ARF, hMLH1, p16INK4a, MGMT, and MINT1 was determined by methylation specific polymerase chain reaction (MSP). CIMP positive was defined as hypermethylation of three or more of the five genes. Impact factors on disease-free survival (DFS) and overall survival (OS) were analyzed using Kaplan-Meier method (log-rank test) and adjusted Cox proportional hazards model. Results. Twenty-four percent (12/50) of patients were characterized as CIMP positive. Univariate analysis showed stage III (P = 0.049) and CIMP positive (P = 0.014) patients who had significantly inferior DFS. In Cox regression analysis, CIMP positive epigenotype was independently related with poor DFS with HR = 2.935 and 95% CI: 1.193–7.220 (P = 0.019). In patients with CIMP positive tumor, those receiving adjuvant chemotherapy had a poor DFS than those without adjuvant chemotherapy (P = 0.023). Conclusions. CIMP positive was significantly correlated with decreased DFS in stage II/III colorectal cancer. Patients with CIMP positive locally advanced sporadic colorectal cancers may not benefit from 5-fluorouracil based adjuvant chemotherapy. PMID:24822060

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

Aberrant methylation of RASSF1A is associated with poor survival in Tunisian breast cancer patients.

PubMed

Karray-Chouayekh, Sondes; Trifa, Fatma; Khabir, Abdelmajid; Boujelbane, Nouredine; Sellami-Boudawara, Tahia; Daoud, Jamel; Frikha, Mounir; Jlidi, Rachid; Gargouri, Ali; Mokdad-Gargouri, Raja

2010-02-01

Epigenetic gene silencing is one of the major causes of inactivation of tumor-suppressor genes in many human cancers. The aim of the present study was to determine the methylation status of the promoter region CpG islands of four cancer-related genes RASSF1A, RARbeta2, CDH1, and p16 ( INK4a ) in 78 breast cancer specimens and to evaluate whether the methylation status is associated with estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2/neu) together with the major clinico-pathological parameters. We showed that the methylation frequencies ranged from 19.6% (p16 ( INK4a )) to 87% (RASSF1A) in primary breast tumors of Tunisian patients. Aberrant methylation of RARbeta2 was observed in 66.6% of cases and associated with age at diagnosis (P = 0.043), while CDH1 was methylated in 47.4% of tumors and was correlated with tumor size (P = 0.013). RASSF1A presented the highest percentage of methylation (87%) and was strongly associated with poor survival (P = 0.014), with age (P = 0.048), and tumor stage (P = 0.033). Loss of ER and PR was strongly associated with GIII tumors (P = 0.000 and 0.037 respectively) while HER2/neu was associated with lymph node involvement (P = 0.026) and 5-year survival rate (P = 0.028). Our preliminary findings suggested that aberrant methylation of RASSF1A and RARbeta2 occurs frequently in Tunisian breast cancer patients compared with others. Furthermore, RASSF1A hypermethylation could be used as a potential marker of poor prognosis.

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy

PubMed Central

Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.

2014-01-01

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Evaluation of CpG Island Methylator Phenotype as a Biomarker in Colorectal Cancer Treated With Adjuvant Oxaliplatin.

PubMed

Cohen, Stacey A; Wu, Chen; Yu, Ming; Gourgioti, Georgia; Wirtz, Ralph; Raptou, Georgia; Gkakou, Chryssa; Kotoula, Vassiliki; Pentheroudakis, George; Papaxoinis, George; Karavasilis, Vasilios; Pectasides, Dimitrios; Kalogeras, Konstantine T; Fountzilas, George; Grady, William M

2016-06-01

The CpG island methylator phenotype (CIMP) is a promising biomarker for irinotecan/5-fluorouracil/leucovorin chemotherapy for stage III colon cancer. In the present study, we evaluated whether CIMP is a prognostic biomarker for standard-of-care oxaliplatin-based adjuvant therapy. The HE6C/05 trial randomized 441 patients with stage II-III colorectal adenocarcinoma to adjuvant XELOX (capecitabine, oxaliplatin) or modified FOLFOX6 (5-fluorouracil, leucovorin, oxaliplatin). The primary and secondary objectives were disease-free and overall survival, respectively. CIMP status was determined using the DNA methylation status of CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1. Cox models were used to assess the association of CIMP with survival. Of the 293 available tumors, 28 (9.6%) were CIMP(+). On univariate Cox regression analysis, no significant differences in survival were observed between individuals with CIMP(+) versus CIMP(-) tumors. CIMP(+) tumors were more likely to be right-sided and BRAF mutant (χ(2), P < .001). In the multivariate model, TNM stage II (vs. stage III) was associated with a reduced risk of relapse (hazard ratio [HR], 0.25; 95% confidence interval [CI], 0.11-0.55; Wald's P < .001), and a colon primary located on the left side and earlier TNM stage were associated with a reduced risk of death (HR, 0.48; 95% CI, 0.28-0.81; P = .006; and HR, 0.22; 95% CI, 0.10-0.49; P < .001, respectively). In the present exploratory analysis, CIMP did not appear to be a prognostic biomarker in oxaliplatin-treated patients with resected colorectal cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations

PubMed Central

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J.; Loda, Massimo; Fuchs, Charles S.

2006-01-01

The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as “CIMP-low”). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with ≥4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further. PMID:17065427

CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations.

PubMed

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-11-01

The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as "CIMP-low"). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with > or =4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further.

A 1.8-Mb YAC contig in Xp11.23: identification of CpG islands and physical mapping of CA repeats in a region of high gene density.

PubMed

Coleman, M P; Németh, A H; Campbell, L; Raut, C P; Weissenbach, J; Davies, K E

1994-05-15

The genes ARAF1, SYN1, TIMP, and PFC are clustered within 70 kb of one another, and, as reported in the accompanying paper (J. Knight et al., 1994, Genomics 21: 180-187), at least four more genes map within 400 kb: a cluster of Krüppel-type zinc finger genes (including ZNF21, ZNF41, and ZNF81) and ELK-1, a member of the ets oncogene superfamily. This gene-rich region is of particular interest because of the large number of disease genes mapping to Xp11.23: at least three eye diseases (retinitis pigmentosa type 2, congenital stationary night blindness CSNB1, and Aland Island eye disease), Wiskott-Aldrich syndrome, X-linked nephrolithiasis, and a translocation breakpoint associated with synovial sarcoma. We have constructed a 1.8-Mb YAC contig in this region, confirming the link between TIMP and OATL1 reported by Knight et al. (1994) and extending the map in the distal direction. To investigate the likelihood that more genes are located within this region, we have carried out detailed mapping of rare-cutter restriction sites in these YACs and identified seven CpG islands. At least six of these islands are located over 50 kb from any known gene locations, suggesting that the region contains at least this many as yet unidentified genes. We have also mapped the physical locations of six highly polymorphic CA repeats within the contig, thus integrating the physical, genetic, and transcriptional maps of the region and facilitating the mapping and identification of disease genes.(ABSTRACT TRUNCATED AT 250 WORDS)

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

PubMed Central

Maguire, S. M.; Phelps, S. M.

2017-01-01

DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

EG-09EPIGENETIC PROFILING REVEALS A CpG HYPERMETHYLATION PHENOTYPE (CIMP) ASSOCIATED WITH WORSE PROGRESSION-FREE SURVIVAL IN MENINGIOMA

PubMed Central

Olar, Adriana; Wani, Khalida; Mansouri, Alireza; Zadeh, Gelareh; Wilson, Charmaine; DeMonte, Franco; Fuller, Gregory; Jones, David; Pfister, Stefan; von Deimling, Andreas; Sulman, Erik; Aldape, Kenneth

2014-01-01

BACKGROUND: Methylation profiling of solid tumors has revealed biologic subtypes, often with clinical implications. Methylation profiles of meningioma and their clinical implications are not well understood. METHODS: Ninety-two meningioma samples (n = 44 test set and n = 48 validation set) were profiled using the Illumina HumanMethylation450 BeadChip. Unsupervised clustering and analyses for recurrence-free survival (RFS) were performed. RESULTS: Unsupervised clustering of the test set using approximately 900 highly variable markers identified two clearly defined methylation subgroups. One of the groups (n = 19) showed global hypermethylation of a set of markers, analogous to CpG island methylator phenotype (CIMP). These findings were reproducible in the validation set, with 18/48 samples showing the CIMP-positive phenotype. Importantly, of 347 highly variable markers common to both the test and validation set analyses, 107 defined CIMP in the test set and 94 defined CIMP in the validation set, with an overlap of 83 markers between the two datasets. This number is much greater than expected by chance indicating reproducibly of the hypermethylated markers that define CIMP in meningioma. With respect to clinical correlation, the 37 CIMP-positive cases displayed significantly shorter RFS compared to the 55 non-CIMP cases (hazard ratio 2.9, p = 0.013). In an effort to develop a preliminary outcome predictor, a 155-marker subset correlated with RFS was identified in the test dataset. When interrogated in the validation dataset, this 155-marker subset showed a statistical trend (p < 0.1) towards distinguishing survival groups. CONCLUSIONS: This study defines the existence of a CIMP phenotype in meningioma, which involves a substantial proportion (37/92, 40%) of samples with clinical implications. Ongoing work will expand this cohort and examine identification of additional biologic differences (mutational and DNA copy number analysis) to further characterize the aberrant

[Chromosome banding analysis of peripheral blood lymphocytes stimulated with IL2 and CpG oligonucleotide DSP30 in patients with chronic lymphocytic leukemia].

PubMed

Stěpanovská, K; Vaňková, G; Némethová, V; Tomášiková, L; Smuhařová, P; Divíšková, E; Vallová, V; Kuglík, P; Plevová, K; Oltová, A; Doubek, M; Pospíšilová, S; Mayer, J

2013-01-01

Chromosomal aberrations play an important role as prognostic factors in chronic lymphocytic leukemia (CLL). These aberrations are mostly detected by fluorescent in situ hybridization (FISH), as chromosomal banding analysis has been scarce due to low proliferative activity of malignant B-lymphocytes in vitro. In 2006, a new method using stimulation with IL-2 and CpG oligonucleotide DSP30 for metaphase generation in CLL was published [1]. The objective of our study was to verify the efficacy of stimulation and to evaluate if the method is suitable for routine diagnostics. In total, peripheral blood samples of 369 CLL patients were analyzed in parallel by chromosomal banding analysis and by FISH probes for 13q14, 11q22-23, CEP12 and 17p13. Out of 369 patients, 307 (83%) were successfully stimulated for metaphase generation. Chromosomal aberrations were detected in 243 (79%) out of 307 patients evaluated by chromosomal banding analysis. Other aberrations that are not included into standard FISH panel were detected in patients karyotypes, e.g. del(6q), del(14q), t(14;18)(q32;q21), t(11;14)(q13;q32) and t(18;22)(q21;q11). One hundred and three (42%) patients showed complex aberrant karyotype not detected by FISH analysis. Stimulation with IL-2 and oligonucleotide DSP30 is an efficient method how to induce proliferation of malignant B-lymphocytes and allows detection of a substantial number of chromosomal aberrations in addition to those detected by standard FISH panel. Using this method in routine diagnostics is helpful particularly in identification of patients with complex aberrant karyotype.

Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation

PubMed Central

2010-01-01

Background CpG island methylator phenotype (CIMP), in which multiple genes concordantly methylated, has been demonstrated to be associated with progression, recurrence, as well as overall survival in some types of cancer. Methods We examined the promoter methylation status of seven genes including P16, CDH1, GSTP1, DAPK, XAF1, SOCS1 and SYK in 65 cases of HCC treated with LT by methylation-specific PCR. CIMP+ was defined as having three or more genes that are concordantly methylated. The relationship between CIMP status and clinicopathological parameters, as well as tumor recurrence was further analyzed. Results CIMP+ was more frequent in HCC with AFP > 400 ng/ml than those with AFP ≤ 400 ng/ml (P = 0.017). In addition, patients with CIMP+ were prone to have multiple tumor numbers than those with CIMP- (P = 0.007). Patients with CIMP+ tumors had significantly worse recurrence-free survival (RFS) than patients with CIMP-tumors by Kaplan-Meier estimates (P = 0.004). Multivariate analysis also revealed that CIMP status might be a novel independent prognostic factor of RFS for HCC patients treated with LT (HR: 3.581; 95% CI: 1.473-8.710, P = 0.005). Conclusion Our results suggested that CIMP could serve as a new prognostic biomarker to predict the risk of tumor recurrence in HCC after transplantation. PMID:20678188

Isocitrate dehydrogenase 1 R132C mutation occurs exclusively in microsatellite stable colorectal cancers with the CpG island methylator phenotype.

PubMed

Whitehall, V L J; Dumenil, T D; McKeone, D M; Bond, C E; Bettington, M L; Buttenshaw, R L; Bowdler, L; Montgomery, G W; Wockner, L F; Leggett, B A

2014-11-01

The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features.

Aberrant DNA methylation associated with silencing BNIP3 gene expression in haematopoietic tumours

PubMed Central

Murai, M; Toyota, M; Satoh, A; Suzuki, H; Akino, K; Mita, H; Sasaki, Y; Ishida, T; Shen, L; Garcia-Manero, G; Issa, J-P J; Hinoda, Y; Tokino, T; Imai, K

2005-01-01

Hypoxia is a key factor contributing to the progression of human neoplasias and to the development of resistance to chemotherapy. BNIP3 is a proapoptotic member of the Bcl-2 protein family involved in hypoxia-induced cell death. We evaluated the expression and methylation status of BNIP3 gene to better understand the role of epigenetic alteration of its expression in haematopoietic tumours. Methylation of the region around the BNIP3 transcription start site was detected in four acute lymphocytic leukaemia, one multiple myeloma and one Burkitt lymphoma cell lines, and was closely associated with silencing the gene. That expression of BNIP3 was restored by treatment with 5-aza2′-deoxycytidine (5-aza-dC), a methyltransferase inhibitor, which confirmed the gene to be epigenetically inactivated by methylation. Notably, re-expression of BNIP3 using 5-aza2-dC also restored hypoxia-mediated cell death in methylated cell lines. Acetylation of histone H3 in the 5′ region of the gene, which was assessed using chromatin immunoprecipitation assays, correlated directly with gene expression and inversely with DNA methylation. Among primary tumours, methylation of BNIP3 was detected in five of 34 (15%) acute lymphocytic leukaemias, six of 35 (17%) acute myelogenous leukaemias and three of 14 (21%) multiple myelomas. These results suggest that aberrant DNA methylation of the 5′ CpG island and histone deacetylation play key roles in silencing BNIP3 expression in haematopoietic tumours. PMID:15756280

Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients

PubMed Central

Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P.; Iacobuzio-Donahue, Christine A.; Kerner, Zachary; Baylin, Stephen B.; Wolfgang, Christopher L.; Ahuja, Nita

2016-01-01

We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP−/MLH1-U, or CIMP−/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes. PMID:27880934

Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients.

PubMed

Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P; Iacobuzio-Donahue, Christine A; Kerner, Zachary; Baylin, Stephen B; Wolfgang, Christopher L; Ahuja, Nita

2016-12-27

We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP-/MLH1-U, or CIMP-/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes.

A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome

PubMed Central

Kelly, Andrew D.; Kroeger, Heike; Yamazaki, Jumpei; Taby, Rodolphe; Neumann, Frank; Yu, Sijia; Lee, Justin T.; Patel, Bela; Li, Yuesheng; He, Rong; Liang, Shoudan; Lu, Yue; Cesaroni, Matteo; Pierce, Sherry A.; Kornblau, Steven M.; Bueso-Ramos, Carlos E.; Ravandi, Farhad; Kantarjian, Hagop M.; Jelinek, Jaroslav; Issa, Jean-Pierre J.

2016-01-01

Genetic changes are infrequent in acute myeloid leukemia (AML) compared to other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation (DREAM) data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CIMP (A-CIMP+). A-CIMP was associated with longer overall survival (OS) in this dataset (median OS, years: A-CIMP+ = Not reached, A-CIMP− =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP+ =2.34, A-CIMP− =1.00; P=0.01). Hypermethylation in A-CIMP favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple datasets. We conclude that CIMP in AML cannot be explained solely by gene mutations (e.g. IDH1/2, TET2), and that curability in A-CIMP+ AML should be validated prospectively. PMID:28074068

A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome.

PubMed

Kelly, A D; Kroeger, H; Yamazaki, J; Taby, R; Neumann, F; Yu, S; Lee, J T; Patel, B; Li, Y; He, R; Liang, S; Lu, Y; Cesaroni, M; Pierce, S A; Kornblau, S M; Bueso-Ramos, C E; Ravandi, F; Kantarjian, H M; Jelinek, J; Issa, J-Pj

2017-10-01

Genetic changes are infrequent in acute myeloid leukemia (AML) compared with other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CGI methylator phenotype (CIMP) (A-CIMP + ). A-CIMP was associated with longer overall survival (OS) in this data set (median OS, years: A-CIMP + =not reached, CIMP - =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP + =2.34, A-CIMP - =1.00; P=0.01). Hypermethylation in A-CIMP + favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP + was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP + function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple data sets. We conclude that CIMP in AML cannot be explained solely by gene mutations (for example, IDH1/2, TET2), and that curability in A-CIMP + AML should be validated prospectively.

Correlation of beta-catenin localization with cyclooxygenase-2 expression and CpG island methylator phenotype (CIMP) in colorectal cancer.

PubMed

Kawasaki, Takako; Nosho, Katsuhiko; Ohnishi, Mutsuko; Suemoto, Yuko; Kirkner, Gregory J; Dehari, Reiko; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2007-07-01

The WNT/beta-catenin (CTNNB1) pathway is commonly activated in the carcinogenic process. Cross-talks between the WNT and cyclooxygenase-2 (COX-2 or PTGS2)/prostaglandin pathways have been suggested. The relationship between beta-catenin activation and microsatellite instability (MSI) in colorectal cancer has been controversial. The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer, which is associated with MSI-high. However, no study has examined the relationship between beta-catenin activation and CIMP status. Using 832 population-based colorectal cancer specimens, we assessed beta-catenin localization by immunohistochemistry. We quantified DNA methylation in eight CIMP-specific promoters [CACNA1G, CDKN2A(p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1] by real-time polymerase chain reaction (MethyLight). MSI-high, CIMP-high, and BRAF mutation were associated inversely with cytoplasmic and nuclear beta-catenin expressions (i.e., beta-catenin activation) and associated positively with membrane expression. The inverse relation between beta-catenin activation and CIMP was independent of MSI. COX-2 overexpression correlated with cytoplasmic beta-catenin expression (even after tumors were stratified by CIMP status), but did not correlate significantly with nuclear or membrane expression. In conclusion, beta-catenin activation is inversely associated with CIMP-high independent of MSI status. Cytoplasmic beta-catenin is associated with COX-2 overexpression, supporting the role of cytoplasmic beta-catenin in stabilizing PTGS2 (COX-2) mRNA.

The CpG Island in the Murine Foxl2 Proximal Promoter Is Differentially Methylated in Primary and Immortalized Cells

PubMed Central

Tran, Stella; Wang, Ying; Lamba, Pankaj; Zhou, Xiang; Boehm, Ulrich; Bernard, Daniel J.

2013-01-01

Forkhead box L2 (Foxl2), a member of the forkhead transcription factor family, plays important roles in pituitary follicle-stimulating hormone synthesis and in ovarian maintenance and function. Mutations in the human FOXL2 gene cause eyelid malformations and premature ovarian failure. FOXL2/Foxl2 is expressed in pituitary gonadotrope and thyrotrope cells, the perioptic mesenchyme of the developing eyelid, and ovarian granulosa cells. The mechanisms governing this cell-restricted expression have not been described. We mapped the Foxl2 transcriptional start site in immortalized murine gonadotrope-like cells, LβT2, by 5’ rapid amplification of cDNA ends and then PCR amplified approximately 1 kb of 5’ flanking sequence from murine genomic DNA. When ligated into a reporter plasmid, the proximal promoter conferred luciferase activity in both homologous (LβT2) and, unexpectedly, heterologous (NIH3T3) cells. In silico analyses identified a CpG island in the proximal promoter and 5’ untranslated region, suggesting that Foxl2 transcription might be regulated epigenetically. Indeed, pyrosequencing and quantitative analysis of DNA methylation using real-time PCR revealed Foxl2 proximal promoter hypomethylation in homologous compared to some, though not all, heterologous cell lines. The promoter was also hypomethylated in purified murine gonadotropes. In vitro promoter methylation completely silenced reporter activity in heterologous and homologous cells. Collectively, the data suggest that differential proximal promoter DNA methylation may contribute to cell-specific Foxl2 expression in some cellular contexts. However, gonadotrope-specific expression of the gene cannot be explained by promoter hypomethylation alone. PMID:24098544

The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

PubMed

Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

2017-01-01

Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing

Comparison of CpG island methylator phenotype (CIMP) frequency in colon cancer using different probe- and gene-specific scoring alternatives on recommended multi-gene panels.

PubMed

Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil

2014-01-01

In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.

Prognostic value of CpG island methylator phenotype among hepatocellular carcinoma patients: A systematic review and meta-analysis.

PubMed

Wang, Qian; Wang, Gang; Liu, Chaoxu; He, Xianli

2018-04-24

CpG island methylator phenotype (CIMP), characterized by multiple genes are concurrently methylated, has been reported to be associated with the prognosis of colorectal cancer. However, current studies have not explored the relationship between CIMP status with hepatocellular carcinoma (HCC) clinicopathological features. To assess these associations, we performed a comprehensive search of PubMed, EMBASE, and the Web of Science to identify all eligible studies. Publication bias was tested using Begg's and Egger's test. Seven studies that involved 568 HCC patients (379 CIMP+ and 189 CIMP-) were eligible for inclusion in our study. CIMP+ in HCC was significantly associated with distant metastasis (OR = 4.28, 95% CI = 2.57-7.10, P < 0.00001, heterogeneity = 0.888), TNM tumor stage IIII + IV (OR = 5.73, 95% CI = 3.70-8.88, P < 0.0001, heterogeneity = 0.449), cirrhosis (OR = 2.54, 95% CI = 1.33,4.83, P = 0.005, heterogeneity = 0.121) and a higher level of AFP (>300 ng/ml) than those with CIMP- (OR = 2.63, 95% CI = 1.79,3.89, P < 0.00001, heterogeneity = 0.432). Moreover, CIMP+ was associated with an unfavorable overall survival (OS) (HR = 3.02, 95% CI = 1.60-5.70, P < 0.001, heterogeneity = 0.251) and a disease-free survival (DFS) (HR = 2.80, 95% CI = 1.79-4.37, P < 0.001, heterogeneity = 0.603). CIMP is independently associated with significantly worse prognosis in HCC patients. Examination of CIMP status may be useful for identifying patients who are at higher risk for disease progression. Copyright © 2018 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

Factors affecting the persistence of drug-induced reprogramming of the cancer methylome

PubMed Central

Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.

2016-01-01

ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

Body Size, Physical Activity and Risk of Colorectal Cancer with or without the CpG Island Methylator Phenotype (CIMP)

PubMed Central

Hughes, Laura A. E.; Simons, Colinda C. J. M.; van den Brandt, Piet A.; Goldbohm, R. Alexandra; de Goeij, Anton F.; de Bruïne, Adriaan P.; van Engeland, Manon; Weijenberg, Matty P.

2011-01-01

Background We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Methods In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. Results BMI modeled per 5 kg/m2 increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01–1.43; non-CIMP HR: 1.14, 95%CI: 1.04–1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Conclusions Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes. PMID:21483668

Correlation of pathologic features with CpG island methylator phenotype (CIMP) by quantitative DNA methylation analysis in colorectal carcinoma.

PubMed

Ogino, Shuji; Odze, Robert D; Kawasaki, Takako; Brahmandam, Mohan; Kirkner, Gregory J; Laird, Peter W; Loda, Massimo; Fuchs, Charles S

2006-09-01

Extensive gene promoter methylation in colorectal carcinoma has been termed the CpG island methylator phenotype (CIMP). Previous studies on CIMP used primarily methylation-specific polymerase chain reaction (PCR), which, unfortunately, may detect low levels of methylation that has little or no biological significance. Utilizing quantitative real-time PCR (MethyLight), we measured DNA methylation in a panel of 5 CIMP-specific gene promoters (CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 459 colorectal carcinomas obtained from 2 large prospective cohort studies. CIMP was defined as tumors that showed methylation in >or=4/5 promoters. CIMP was significantly associated with the presence of mucinous or signet ring cell morphology, marked Crohn's-like lymphoid reaction, tumor infiltrating lymphocytes, marked peritumoral lymphocytic reaction, tumor necrosis, tumor cell sheeting, and poor differentiation. All these features have previously been associated with microsatellite instability (MSI). Therefore, we divided the 459 colorectal carcinomas into 6 subtypes, namely, MSI-high (MSI-H)/CIMP, MSI-H/non-CIMP, MSI-low (MSI-L)/CIMP, MSI-L/non-CIMP, microsatellite stable/CIMP, and micro satellite sstable/non-CIMP. Compared with MSI-H/non-CIMP, MSI-H/CIMP was associated with marked tumor infiltrating lymphocytes, tumor necrosis, sheeting, and poor differentiation (all P

MicroRNA-31 expression in relation to BRAF mutation, CpG island methylation and colorectal continuum in serrated lesions.

PubMed

Ito, Miki; Mitsuhashi, Kei; Igarashi, Hisayoshi; Nosho, Katsuhiko; Naito, Takafumi; Yoshii, Shinji; Takahashi, Hiroaki; Fujita, Masahiro; Sukawa, Yasutaka; Yamamoto, Eiichiro; Takahashi, Taiga; Adachi, Yasushi; Nojima, Masanori; Sasaki, Yasushi; Tokino, Takashi; Baba, Yoshifumi; Maruyama, Reo; Suzuki, Hiromu; Imai, Kohzoh; Yamamoto, Hiroyuki; Shinomura, Yasuhisa

2014-12-01

The CpG island methylator phenotype (CIMP) is a distinct form of epigenomic instability. Many CIMP-high colorectal cancers (CRCs) with BRAF mutation are considered to arise from serrated pathway. We recently reported that microRNA-31 (miR-31) is associated with BRAF mutation in colorectal tumors. Emerging new approaches have revealed gradual changes in BRAF mutation and CIMP-high throughout the colorectum in CRCs. Here, we attempted to identify a possible association between miR-31 and epigenetic features in serrated pathway, and hypothesized that miR-31 supports the "colorectal continuum" concept. We evaluated miR-31 expression, BRAF mutation and epigenetic features including CIMP status in 381 serrated lesions and 222 non-serrated adenomas and examined associations between them and tumor location (rectum; sigmoid, descending, transverse and ascending colon and cecum). A significant association was observed between high miR-31 expression and CIMP-high status in serrated lesions with BRAF mutation (p = 0.0001). In contrast, miR-31 was slightly but insignificantly associated with CIMP status in the cases with wild-type BRAF. miR-31 expression in sessile serrated adenomas (SSAs) with cytological dysplasia was higher than that in SSAs, whereas, no significant difference was observed between traditional serrated adenomas (TSAs) and TSAs with high-grade dysplasia. The frequency of miR-31, BRAF mutation CIMP-high and MLH1 methylation increased gradually from the rectum to cecum in serrated lesions. In conclusion, miR-31 expression was associated with CIMP-high status in serrated lesions with BRAF mutation. Our data also suggested that miR-31 plays an important role in SSA evolution and may be a molecule supporting the colorectal continuum. © 2014 UICC.

Body size, physical activity and risk of colorectal cancer with or without the CpG island methylator phenotype (CIMP).

PubMed

Hughes, Laura A E; Simons, Colinda C J M; van den Brandt, Piet A; Goldbohm, R Alexandra; de Goeij, Anton F; de Bruïne, Adriaan P; van Engeland, Manon; Weijenberg, Matty P

2011-04-05

We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. BMI modeled per 5 kg/m(2) increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01-1.43; non-CIMP HR: 1.14, 95%CI: 1.04-1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes.

Cooperative STAT/NF-κB signaling regulates lymphoma metabolic reprogramming and aberrant GOT2 expression.

PubMed

Feist, Maren; Schwarzfischer, Philipp; Heinrich, Paul; Sun, Xueni; Kemper, Judith; von Bonin, Frederike; Perez-Rubio, Paula; Taruttis, Franziska; Rehberg, Thorsten; Dettmer, Katja; Gronwald, Wolfram; Reinders, Jörg; Engelmann, Julia C; Dudek, Jan; Klapper, Wolfram; Trümper, Lorenz; Spang, Rainer; Oefner, Peter J; Kube, Dieter

2018-04-17

Knowledge of stromal factors that have a role in the transcriptional regulation of metabolic pathways aside from c-Myc is fundamental to improvements in lymphoma therapy. Using a MYC-inducible human B-cell line, we observed the cooperative activation of STAT3 and NF-κB by IL10 and CpG stimulation. We show that IL10 + CpG-mediated cell proliferation of MYC low cells depends on glutaminolysis. By 13 C- and 15 N-tracing of glutamine metabolism and metabolite rescue experiments, we demonstrate that GOT2 provides aspartate and nucleotides to cells with activated or aberrant Jak/STAT and NF-κB signaling. A model of GOT2 transcriptional regulation is proposed, in which the cooperative phosphorylation of STAT3 and direct joint binding of STAT3 and p65/NF-κB to the proximal GOT2 promoter are important. Furthermore, high aberrant GOT2 expression is prognostic in diffuse large B-cell lymphoma underscoring the current findings and importance of stromal factors in lymphoma biology.

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Prognostic value of CpG island methylator phenotype among colorectal cancer patients: a systematic review and meta-analysis

PubMed Central

Juo, Y. Y.; Johnston, F. M.; Zhang, D. Y.; Juo, H. H.; Wang, H.; Pappou, E. P.; Yu, T.; Easwaran, H.; Baylin, S.; van Engeland, M.; Ahuja, N.

2014-01-01

Background Divergent findings regarding the prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer (CRC) patients exist in current literature. We aim to review data from published studies in order to examine the association between CIMP and CRC prognosis. Materials and methods A comprehensive search for studies reporting disease-free survival (DFS), overall survival (OS), or cancer-specific mortality of CRC patients stratified by CIMP is carried out. Study findings are summarized descriptively and quantitatively, using adjusted hazard ratios (HRs) as summary statistics. Results Thirty-three studies reporting survival in 10 635 patients are included for review. Nineteen studies provide data suitable for meta-analysis. The definition of CIMP regarding gene panel, marker threshold, and laboratory method varies across studies. Pooled analysis shows that CIMP is significantly associated with shorter DFS (pooled HR estimate 1.45; 95% confidence interval (CI) 1.07–1.97, Q = 3.95, I2 = 0%) and OS (pooled HR estimate 1.43; 95% CI 1.18–1.73, Q = 4.03, I2 = 0%) among CRC patients irrespective of microsatellite instability (MSI) status. Subgroup analysis of microsatellite stable (MSS) CRC patients also shows significant association between shorter OS (pooled HR estimate 1.37; 95% CI 1.12–1.68, Q = 4.45, I2 = 33%) and CIMP. Seven studies have explored CIMP's value as a predictive factor on stage II and III CRC patient's DFS after receiving adjuvant 5-fluorouracil (5-FU) therapy: of these, four studies showed that adjuvant chemotherapy conferred a DFS benefit among CIMP(+) patients, one concluded to the contrary, and two found no significant correlation. Insufficient data was present for statistical synthesis of CIMP's predictive value among CRC patients receiving adjuvant 5-FU therapy. Conclusion CIMP is independently associated with significantly worse prognosis in CRC patients. However, CIMP's value as a predictive factor in assessing whether

5-Fluorouracil Adjuvant Chemotherapy Does Not Increase Survival in Patients with CpG Island Methylator Phenotype Colorectal Cancer

PubMed Central

Jover, Rodrigo; Nguyen, Thuy-Phuong; Pérez-Carbonell, Lucía; Zapater, Pedro; Payá, Artemio; Alenda, Cristina; Rojas, Estefanía; Cubiella, Joaquín; Balaguer, Francesc; Morillas, Juan D.; Clofent, Juan; Bujanda, Luis; Reñé, Josep M; Bessa, Xavier; Xicola, Rosa M.; Nicolás-Pérez, David; Castells, Antoni; Andreu, Montserrat; Llor, Xavier; Boland, C. Richard; Goel, Ajay

2011-01-01

Background & Aims 5-FU-based adjuvant chemotherapy does not increase survival times of patients with colorectal tumors with microsatellite instability. We determined the response of patients with colorectal tumors with the CpG island methylator phenotype (CIMP) to 5-FU-based therapy. Methods We analyzed a population-based cohort of 302 patients with colorectal cancer (CRC) for a median follow-up time of 50.7 months. CIMP status was determined by analysis of the CACNAG1, SOCS1, RUNX3, NEUROG1, and MLH1 promoters; tumors were considered to be CIMP-positive (CIMP+) if at least 3 promoters were methylated. Results Tumors from 29.5% (89/302) of patients were CIMP+; this did not influence disease-free survival (log rank=.26). Of tumors of TNM stages II–III (n=196), 32.7% were CIMP+. Among patients with CRC stages II–III who did not receive adjuvant 5-FU chemotherapy, those with CIMP+ tumors had longest times of disease-free survival (log rank=.04); patients with CIMP+ tumors who received chemotherapy had shorter times of disease-free survival (log rank=0.02). In patients with CIMP-negative tumors, adjuvant 5-FU chemotherapy significantly increased time of disease-free survival (log-rank=.00001). However, in patients with CIMP+ tumors, adjuvant 5-FU chemotherapy did not affect time of disease-free survival (log rank=.7). Multivariate analysis showed a significant, independent interaction between 5-FU treatment and CIMP status (hazard ratio [HR]=0.6; 95% confidence interval [CI], .5–.8). Among patients with CIMP+ tumors, adjuvant chemotherapy was not an independent predictor of outcome (HR=0.8; 95% CI, 0.3–2.0). In patients who did not receive adjuvant 5-FU chemotherapy, CIMP status was the only independent predictor of survival (HR=2.0; 95% CI, 1.1–3.8) Conclusion Patients with CIMP+ colorectal tumors do not benefit from 5-FU–based adjuvant chemotherapy. PMID:21185836

Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway

PubMed Central

Cho, Nam-Yun; Kang, Gyeong Hoon

2016-01-01

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps. PMID:26883113

Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway.

PubMed

Kim, Jung Ho; Bae, Jeong Mo; Cho, Nam-Yun; Kang, Gyeong Hoon

2016-03-22

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen

Increased Frequency of CpG Island Methylator Phenotype and CDH1 Methylation in a Gastric Cancer High-Risk Region of China1

PubMed Central

Zhang, Kai-Li; Sun, Yuan; Li, Yan; Liu, Ming; Qu, Bo; Cui, Shu-Hong; Kong, Qing-You; Chen, Xiao-Yan; Li, Hong; Liu, Jia

2008-01-01

This study aimed to profile the methylation statuses of CDH1/E-cadherin and five CpG island methylator phenotype (CIMP)-associated genes (p16, hMLH1, MINT1, MINT2, and MINT31) in gastric specimens of 47 Dalian long-term residents with and 31 without gastric cancers (GCs). CIMP patterns were classified as CIMP-H with over three methylated genes, CIMP-L with one to two methylated genes, and CIMP-N without methylation. Of 47 GC cases, 24 (51.1%) were CIMP-H, 18 (38.3%) were CIMP-L, and 5 (10.6%) were CIMP-N, whereas 5 of 21 (23.8%) premalignant lesions were CIMP-H and 15 (71.4%) were CIMP-L. CIMP-L was found in 75% (12/16) of GC-adjacent mucosa and in 38.7% (12/31) of mucosa from GC-free patients. CDH1 methylation occurred in 48.9% (23/47) of cancer, in 23.8% (5/21) of premalignant, and in 25% (4/16) of noncancerous tissues and was correlated with patients' age (P = .01), lymph node metastasis, and CIMP severity (P = .000–.028). Our results demonstrated that the frequencies of CIMP-H in Dalian GCs, CIMP-L, and p16 methylation in GC-adjacent tissues and in GC-free mucosa were much higher than those reported previously, indicating the elevated methylation pressure in this GC high-risk region. The close correlation between CDH1 methylation and CIMP severity suggests the necessity of their combination in GC prevention and earlier diagnosis. PMID:18607505

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Deregulation of RB1 expression by loss of imprinting in human hepatocellular carcinoma.

PubMed

Anwar, Sumadi Lukman; Krech, Till; Hasemeier, Britta; Schipper, Elisa; Schweitzer, Nora; Vogel, Arndt; Kreipe, Hans; Lehmann, Ulrich

2014-08-01

The tumour suppressor gene RB1 is frequently silenced in many different types of human cancer, including hepatocellular carcinoma (HCC). However, mutations of the RB1 gene are relatively rare in HCC. A systematic screen for the identification of imprinted genes deregulated in human HCC revealed that RB1 shows imprint abnormalities in a high proportion of primary patient samples. Altogether, 40% of the HCC specimens (16/40) showed hyper- or hypomethylation at the CpG island in intron 2 of the RB1 gene. Re-analysis of publicly available genome-wide DNA methylation data confirmed these findings in two independent HCC cohorts. Loss of correct DNA methylation patterns at the RB1 locus leads to the aberrant expression of an alternative RB1-E2B transcript, as measured by quantitative real-time PCR. Demethylation at the intron 2 CpG island by DNMT1 knock-down or aza-deoxycytidine (DAC) treatment stimulated expression of the RB1-E2B transcript, accompanied by diminished RB1 main transcript expression. No aberrant DNA methylation was found at the RB1 locus in hepatocellular adenoma (HCA, n = 10), focal nodular hyperplasia (FNH, n = 5) and their corresponding adjacent liver tissue specimens. Deregulated RB1 expression due to hyper- or hypomethylation in intron 2 of the RB1 gene is found in tumours without loss of heterozygosity and is associated with a decrease in overall survival (p = 0.032) if caused by hypermethylation of CpG85. This unequivocally demonstrates that loss of imprinting represents an important additional mechanism for RB1 pathway inactivation in human HCC, complementing well-described molecular defects. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

CpG island methylator phenotype is an independent predictor of survival after curative resection for colorectal cancer: A prospective cohort study.

PubMed

Kim, Chang Hyun; Huh, Jung Wook; Kim, Hyeong Rok; Kim, Young Jin

2017-08-01

The CpG island methylator phenotype (CIMP) is found in approximately 30% of colorectal cancer (CRC) cases. However, the role of CIMP status in predicting oncologic outcomes in curatively resected CRC is still unclear. Between January 2006 and December 2006, we retrospectively reviewed 157 consecutive patients who underwent curative surgery for CRC. Prognostic significance of CIMP status was evaluated using reverse transcriptase-polymerase chain reaction. CIMP-high (H) and CIMP-none/low (N/L) tumors were found in 50 cases (31.8%) and 107 cases (68.2%), respectively. CIMP-H tumors were significantly associated with female sex, colonic location, poorly/mucinous histologic type, higher T category, perineural invasion, and MSI-high status (P = 0.001). During a median of 64.5 months, tumor recurrence developed in 47 (29.9%) patients. The 5-year disease-free survival for CIMP-H and CIMP-N/L was 61.4% and 76.3% (P = 0.018). In addition, multivariate analysis showed that CIMP-H was also a significant prognostic factor (P = 0.042). When analysis was performed according to anatomical location, more marked survival differences were observed in patients with colon cancer (P = 0.026) than in patients with rectal cancer (P = 0.210). Similarly, the role of CIMP status as a prognostic indicator was more prominent in patients with stage I/II (P = 0.006) than in patients with stage III/IV CRC (P = 0.65). DNA methylation status can be considered as a useful predictor of survival after CRC surgery, particularly for patients with stage I/II disease or colon cancer. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

PubMed

Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

2006-07-01

The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

Cloning of the anhidrotic ectodermal dysplasia gene: Identification of cDNAs associated with CpG islands mapped near translocation breakpoint in two female patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, A.K.; Schlessinger, D.; Kere, J.

1994-09-01

The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less

Extramural vascular invasion and response to neoadjuvant chemoradiotherapy in rectal cancer: Influence of the CpG island methylator phenotype

PubMed Central

Williamson, Jeremy Stuart; Jones, Huw Geraint; Williams, Namor; Griffiths, Anthony Paul; Jenkins, Gareth; Beynon, John; Harris, Dean Anthony

2017-01-01

AIM To identify whether CpG island methylator phenotype (CIMP) is predictive of response to neoadjuvant chemoradiotherapy (NACRT) and outcomes in rectal cancer. METHODS Patients undergoing NACRT and surgical resection for rectal cancer in a tertiary referral centre between 2002-2011 were identified. Pre-treatment tumour biopsies were analysed for CIMP status (high, intermediate or low) using methylation specific PCR. KRAS and BRAF status were also determined using pyrosequencing analysis. Clinical information was extracted from case records and cancer services databases. Response to radiotherapy was measured by tumour regression scores determined upon histological examination of the resected specimen. The relationship between these molecular features, response to NACRT and oncological outcomes were analysed. RESULTS There were 160 patients analysed with a median follow-up time of 46.4 mo. Twenty-one (13%) patients demonstrated high levels of CIMP methylation (CIMP-H) and this was significantly associated with increased risk of extramural vascular invasion (EMVI) compared with CIMP-L [8/21 (38%) vs 15/99 (15%), P = 0.028]. CIMP status was not related to tumour regression after radiotherapy or survival, however EMVI was significantly associated with adverse survival (P < 0.001). Intermediate CIMP status was significantly associated with KRAS mutation (P = 0.01). There were 14 (9%) patients with a pathological complete response (pCR) compared to 116 (73%) patients having no or minimal regression after neoadjuvant chemoradiotherapy. Those patients with pCR had median survival of 106 mo compared to 65.8 mo with minimal regression, although this was not statistically significant (P = 0.26). Binary logistic regression analysis of the relationship between EMVI and other prognostic features revealed, EMVI positivity was associated with poor overall survival, advanced “T” stage and CIMP-H but not nodal status, age, sex, KRAS mutation status and presence of local or

Extramural vascular invasion and response to neoadjuvant chemoradiotherapy in rectal cancer: Influence of the CpG island methylator phenotype.

PubMed

Williamson, Jeremy Stuart; Jones, Huw Geraint; Williams, Namor; Griffiths, Anthony Paul; Jenkins, Gareth; Beynon, John; Harris, Dean Anthony

2017-05-15

To identify whether CpG island methylator phenotype (CIMP) is predictive of response to neoadjuvant chemoradiotherapy (NACRT) and outcomes in rectal cancer. Patients undergoing NACRT and surgical resection for rectal cancer in a tertiary referral centre between 2002-2011 were identified. Pre-treatment tumour biopsies were analysed for CIMP status (high, intermediate or low) using methylation specific PCR. KRAS and BRAF status were also determined using pyrosequencing analysis. Clinical information was extracted from case records and cancer services databases. Response to radiotherapy was measured by tumour regression scores determined upon histological examination of the resected specimen. The relationship between these molecular features, response to NACRT and oncological outcomes were analysed. There were 160 patients analysed with a median follow-up time of 46.4 mo. Twenty-one (13%) patients demonstrated high levels of CIMP methylation (CIMP-H) and this was significantly associated with increased risk of extramural vascular invasion (EMVI) compared with CIMP-L [8/21 (38%) vs 15/99 (15%), P = 0.028]. CIMP status was not related to tumour regression after radiotherapy or survival, however EMVI was significantly associated with adverse survival ( P < 0.001). Intermediate CIMP status was significantly associated with KRAS mutation ( P = 0.01). There were 14 (9%) patients with a pathological complete response (pCR) compared to 116 (73%) patients having no or minimal regression after neoadjuvant chemoradiotherapy. Those patients with pCR had median survival of 106 mo compared to 65.8 mo with minimal regression, although this was not statistically significant ( P = 0.26). Binary logistic regression analysis of the relationship between EMVI and other prognostic features revealed, EMVI positivity was associated with poor overall survival, advanced "T" stage and CIMP-H but not nodal status, age, sex, KRAS mutation status and presence of local or systemic recurrence. We

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Collaborations between CpG sites in DNA methylation

NASA Astrophysics Data System (ADS)

Song, You; Ren, Honglei; Lei, Jinzhi

2017-08-01

DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Prognostic value of CpG island methylator phenotype among colorectal cancer patients: a systematic review and meta-analysis.

PubMed

Juo, Y Y; Johnston, F M; Zhang, D Y; Juo, H H; Wang, H; Pappou, E P; Yu, T; Easwaran, H; Baylin, S; van Engeland, M; Ahuja, N

2014-12-01

Divergent findings regarding the prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer (CRC) patients exist in current literature. We aim to review data from published studies in order to examine the association between CIMP and CRC prognosis. A comprehensive search for studies reporting disease-free survival (DFS), overall survival (OS), or cancer-specific mortality of CRC patients stratified by CIMP is carried out. Study findings are summarized descriptively and quantitatively, using adjusted hazard ratios (HRs) as summary statistics. Thirty-three studies reporting survival in 10 635 patients are included for review. Nineteen studies provide data suitable for meta-analysis. The definition of CIMP regarding gene panel, marker threshold, and laboratory method varies across studies. Pooled analysis shows that CIMP is significantly associated with shorter DFS (pooled HR estimate 1.45; 95% confidence interval (CI) 1.07-1.97, Q = 3.95, I(2) = 0%) and OS (pooled HR estimate 1.43; 95% CI 1.18-1.73, Q = 4.03, I(2) = 0%) among CRC patients irrespective of microsatellite instability (MSI) status. Subgroup analysis of microsatellite stable (MSS) CRC patients also shows significant association between shorter OS (pooled HR estimate 1.37; 95% CI 1.12-1.68, Q = 4.45, I(2) = 33%) and CIMP. Seven studies have explored CIMP's value as a predictive factor on stage II and III CRC patient's DFS after receiving adjuvant 5-fluorouracil (5-FU) therapy: of these, four studies showed that adjuvant chemotherapy conferred a DFS benefit among CIMP(+) patients, one concluded to the contrary, and two found no significant correlation. Insufficient data was present for statistical synthesis of CIMP's predictive value among CRC patients receiving adjuvant 5-FU therapy. CIMP is independently associated with significantly worse prognosis in CRC patients. However, CIMP's value as a predictive factor in assessing whether adjuvant 5-FU therapy will confer additional survival

Aberrant methylation and associated transcriptional mobilization of Alu elements contributes to genomic instability in hypoxia.

PubMed

Pal, Arnab; Srivastava, Tapasya; Sharma, Manish K; Mehndiratta, Mohit; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad

2010-11-01

Hypoxia is an integral part of tumorigenesis and contributes extensively to the neoplastic phenotype including drug resistance and genomic instability. It has also been reported that hypoxia results in global demethylation. Because a majority of the cytosine-phosphate-guanine (CpG) islands are found within the repeat elements of DNA, and are usually methylated under normoxic conditions, we suggested that retrotransposable Alu or short interspersed nuclear elements (SINEs) which show altered methylation and associated changes of gene expression during hypoxia, could be associated with genomic instability. U87MG glioblastoma cells were cultured in 0.1% O₂ for 6 weeks and compared with cells cultured in 21% O₂ for the same duration. Real-time PCR analysis showed a significant increase in SINE and reverse transcriptase coding long interspersed nuclear element (LINE) transcripts during hypoxia. Sequencing of bisulphite treated DNA as well as the Combined Bisulfite Restriction Analysis (COBRA) assay showed that the SINE loci studied underwent significant hypomethylation though there was patchy hypermethylation at a few sites. The inter-alu PCR profile of DNA from cells cultured under 6-week hypoxia, its 4-week revert back to normoxia and 6-week normoxia showed several changes in the band pattern indicating increased alu mediated genomic alteration. Our results show that aberrant methylation leading to increased transcription of SINE and reverse transcriptase associated LINE elements could lead to increased genomic instability in hypoxia. This might be a cause of genetic heterogeneity in tumours especially in variegated hypoxic environment and lead to a development of foci of more aggressive tumour cells. © 2009 The Authors Journal compilation © 2010 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

PubMed Central

Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

2015-01-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

PubMed

Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

2015-08-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

dbCPG: A web resource for cancer predisposition genes.

PubMed

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-06-21

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

dbCPG: A web resource for cancer predisposition genes

PubMed Central

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-01-01

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

Molecular correlates with MGMT promoter methylation and silencing support CpG island methylator phenotype-low (CIMP-low) in colorectal cancer.

PubMed

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Suemoto, Yuko; Meyerhardt, Jeffrey A; Fuchs, Charles S

2007-11-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer. In contrast, a phenotype with less widespread promoter methylation (CIMP-low) has not been well characterised. O-6-methylguanine-DNA methyltransferase (MGMT) promoter methylation and silencing have been associated with G>A mutations and microsatellite instability-low (MSI-low). To examine molecular correlates with MGMT methylation/silencing in colorectal cancer. Utilising MethyLight technology, we quantified DNA methylation in MGMT and eight other markers (a CIMP-diagnostic panel; CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1) in 920 population-based colorectal cancers. Tumours with both MGMT methylation and loss were correlated positively with MSI-low (p = 0.02), CIMP-high (>or=6/8 methylated CIMP markers, p = 0.005), CIMP-low (1/8-5/8 methylated CIMP markers, p = 0.002, compared to CIMP-0 with 0/8 methylated markers), KRAS G>A mutation (p = 0.02), and inversely with 18q loss of heterozygosity (p = 0.0002). Tumours were classified into nine MSI/CIMP subtypes. Among the CIMP-low group, tumours with both MGMT methylation and loss were far more frequent in MSI-low tumours (67%, 12/18) than MSI-high tumours (5.6%, 1/18; p = 0.0003) and microsatellite stable (MSS) tumours (33%, 52/160; p = 0.008). However, no such relationship was observed among the CIMP-high or CIMP-0 groups. The relationship between MGMT methylation/silencing and MSI-low is limited to only CIMP-low tumours, supporting the suggestion that CIMP-low in colorectal cancer may be a different molecular phenotype from CIMP-high and CIMP-0. Our data support a molecular difference between MSI-low and MSS in colorectal cancer, and a possible link between CIMP-low, MSI-low, MGMT methylation/loss and KRAS mutation.

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

PubMed

Liu, Chengju; Chen, Qijun; Wang, Danwei

2011-06-01

This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

Multigene methylation analysis of ocular adnexal MALT lymphoma and their relationship to Chlamydophila psittaci infection and clinical characteristics in South Korea.

PubMed

Choung, Ho-Kyung; Kim, Young A; Lee, Min Joung; Kim, Namju; Khwarg, Sang In

2012-04-06

We investigated the aberrant promoter methylation status of known or suspected tumor suppressor genes in ocular adnexal lymphoma (OAL) and the possible association with clinical characteristics and Chlamydophila psittaci infection. Thirty-five cases of ocular adnexal mucosa-associated lymphoid tissue (MALT) lymphoma cases were examined for the methylation status of nine genes using methylation-specific PCR and for the detection of C. psittaci DNA using PCR. The medical records were reviewed retrospectively. Patient demographics, clinical characteristics including the response of the lymphoma to the therapy, and C. psittaci infection status were evaluated for possible association with methylation frequencies. CpG island methylation in nine genes was variously found as follows; DAPK (94.3%), ECAD (77.1%), MT1G (48.6%), THBS1 (37.1%), RAR-β (31.4%), p16 (20%), MGMT (5.7%), p14 (0%), and RASSF1A (0%). Methylation was not observed in any of 13 control cases. C. psittaci DNA was observed in 25 (75.8%) of 33 patients with available tumor tissues, and ECAD hypermethylation was significantly higher in C. psittaci-positive cases (P = 0.041). Promoter hypermethylation status was not correlated with clinical characteristics. Aberrant CpG island methylation of tumor suppressor genes is a frequent event in ocular adnexal MALT lymphoma. In particular, high frequencies of DAPK and ECAD methylation may be strongly correlated with ocular adnexal MALT lymphomagenesis in South Korea. Furthermore, ECAD hypermethylation is closely associated with C. psittaci infection, which may shed light on the mechanisms of bacterium-induced oncogenesis.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

CpG DNA: A pathogenic factor in systemic lupus erythematosus?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krieg, A.M.

1995-11-01

Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

Genetics and epigenetics of small bowel adenocarcinoma: the interactions of CIN, MSI, and CIMP.

PubMed

Warth, Arne; Kloor, Matthias; Schirmacher, Peter; Bläker, Hendrik

2011-04-01

Characterization of tumor genetics and epigenetics allows to stratify a tumor entity according to molecular pathways and may shed light on the interactions of different types of DNA alterations during tumorigenesis. Small intestinal adenocarcinoma is rare, and to date the interrelation of genomic instability and epigenetics has not been investigated in this tumor type. We therefore analyzed 37 primary small bowel carcinomas with known microsatellite instability and KRAS status for chromosomal instability using comparative genomic hybridization, for the presence of aberrant methylation (CpG island methylation phenotype) by methylation-specific polymerase chain reaction, and for BRAF mutations. Chromosomal instability was detected in 22 of 37 (59%) tumors (3 of 9 microsatellite instable, and 19 of 28 microsatellite stable carcinomas). Nine carcinomas (24%) were microsatellite and chromosomally stable. High-level DNA methylation was found in 16% of chromosomal instable tumors and in 44% of both microsatellite instable and microsatellite and chromosomally stable carcinomas. KRAS was mutated in 55, 0, and 10% of chromosomal instable, microsatellite instable, and microsatellite and chromosomally stable tumors, respectively whereas the frequencies of BRAF mutations were 6% for chromosomal instable and 22% for both microsatellite instable and microsatellite and chromosomally stable carcinomas. In conclusion, in this study we show that chromosomal instable carcinomas of the small intestine are distinguished from microsatellite instable and microsatellite and chromosomally stable tumors by a high frequency of KRAS mutations, low frequencies of CpG island methylation phenotype, and BRAF mutations. In microsatellite instable and microsatellite and chromosomally stable cancers, CpG island methylation phenotype and BRAF/KRAS mutations are similarly distributed, indicating common mechanisms of tumor initiation or progression in their molecular pathogenesis.

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers.

PubMed

Zhang, H; Li, X; Ge, L; Yang, J; Sun, J; Niu, Q

2015-02-01

To detect the blood genomic DNA methylation in coke oven workers and find a possible early screening index for occupational lung cancer, 74 coke oven workers as the exposed group and 47 water pump workers as the controls were surveyed, and urine samples and peripheral blood mononuclear cells (PBMCs) were collected. Airborne benzo[a]pyrene (B[a]P) levels in workplace and urinary 1-hydroxypyrene (1-OH-Py) levels were determined by high-performance liquid chromatography. DNA damage of PBMCs and the p14(ARK), p15(INK4b) and p16(INK4a) gene CpG island methylation in the promoter region were detected by comet assay and methylation-specific polymerase chain reaction techniques, respectively. Results show that compared with the controls, concentration of airborne B[a]Ps was elevated in the coke plant, and urinary 1-OH-Py's level and DNA olive tail moment in comet assay were significantly increased in the coke oven workers, and p14(ARK), p15(INK4b) and p16(INK4a) gene methylation rates were also significantly increased. With the working years and urinary 1-OH-Py's level, the rates of p14(ARK) and p16(INK4a) gene methylation were significantly increased while that of p15(INK4b) gene methylation displayed no statistical change. We conclude that PBMCs' p14(ARK) and p16(INK4a) gene methylation may be used for screening and warning lung cancer in coke oven workers. © The Author(s) 2015.

DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

PubMed

Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

2014-04-01

The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated

On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

PubMed Central

Amrollah, Elmira; Henaff, Patrick

2010-01-01

This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

Determination of aberration center of Ronchigram for automated aberration correctors in scanning transmission electron microscopy.

PubMed

Sannomiya, Takumi; Sawada, Hidetaka; Nakamichi, Tomohiro; Hosokawa, Fumio; Nakamura, Yoshio; Tanishiro, Yasumasa; Takayanagi, Kunio

2013-12-01

A generic method to determine the aberration center is established, which can be utilized for aberration calculation and axis alignment for aberration corrected electron microscopes. In this method, decentering induced secondary aberrations from inherent primary aberrations are minimized to find the appropriate axis center. The fitness function to find the optimal decentering vector for the axis was defined as a sum of decentering induced secondary aberrations with properly distributed weight values according to the aberration order. Since the appropriate decentering vector is determined from the aberration values calculated at an arbitrary center axis, only one aberration measurement is in principle required to find the center, resulting in /very fast center search. This approach was tested for the Ronchigram based aberration calculation method for aberration corrected scanning transmission electron microscopy. Both in simulation and in experiments, the center search was confirmed to work well although the convergence to find the best axis becomes slower with larger primary aberrations. Such aberration center determination is expected to fully automatize the aberration correction procedures, which used to require pre-alignment of experienced users. This approach is also applicable to automated aperture positioning. Copyright © 2013 Elsevier B.V. All rights reserved.

Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

PubMed

Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

2008-10-01

While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

PubMed

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

PubMed Central

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Aberrant DNA methylation of miR-219 promoter in long-term night shiftworkers.

PubMed

Shi, Fengqin; Chen, Xinyi; Fu, Alan; Hansen, Johnni; Stevens, Richard; Tjonneland, Anne; Vogel, Ulla B; Zheng, Tongzhang; Zhu, Yong

2013-07-01

The idea that shiftwork may be carcinogenic in humans has gained widespread attention since the pioneering work linking shiftwork to breast cancer over two decades ago. However, the biomolecular consequences of long-term shiftwork exposure have not been fully explored. In this study, we performed a genome-wide CpG island methylation assay of microRNA (miRNA) promoters in long-term night shiftworkers and day workers. This analysis indicated that 50 CpG loci corresponding to 31 miRNAs were differentially methylated in night shiftworkers compared to day workers, including the circadian-relevant miR-219, the expression of which has been implicated in several cancers. A genome-wide expression microarray assay was carried out in a miR-219-overexpressed MCF-7 breast cancer cell line, which identified 319 differentially expressed transcripts. The identified transcriptional targets were analyzed for network and functional interrelatedness using the Ingenuity Pathway Analysis (IPA) software. Overexpression of miR-219 in MCF-7 breast cancer cells resulted in accentuated expression of apoptosis- and proliferation-related anti-viral immunodulators of the Jak-STAT and NF-κβ pathways. These findings suggest that long-term night shiftwork exposure may lead to the methylation-dependent downregulation of miR-219, which may in turn lead to the downregulation of immunomediated antitumor activity and increased breast cancer risk. © 2013 Wiley Periodicals, Inc.

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

Subsets of microsatellite-unstable colorectal cancers exhibit discordance between the CpG island methylator phenotype and MLH1 methylation status.

PubMed

Kim, Jung H; Rhee, Ye-Y; Bae, Jeong-M; Kwon, Hyeong-J; Cho, Nam-Y; Kim, Mi J; Kang, Gyeong H

2013-07-01

Although the presence of MLH1 methylation in microsatellite-unstable colorectal cancer generally indicates involvement of the CpG island methylator phenotype (CIMP) in the development of the tumor, these two conditions do not always correlate. A minority of microsatellite-unstable colorectal cancers exhibit discordance between CIMP and MLH1 methylation statuses. However, the clinicopathological features of such microsatellite-unstable colorectal cancers with discrepant MLH1 methylation and CIMP statuses remain poorly studied. Microsatellite-unstable colorectal cancers (n=220) were analyzed for CIMP and MLH1 methylation statuses using the MethyLight assay. Based on the combinatorial CIMP and MLH1 methylation statuses, the microsatellite-unstable colorectal cancers were grouped into four subtypes (CIMP-high (CIMP-H) MLH1 methylation-positive (MLH1m+), CIMP-H MLH1 methylation-negative, CIMP-low/0 (CIMP-L/0) MLH1m+, and CIMP-L/0 MLH1 methylation-negative), which were compared in terms of their associations with clinicopathological and molecular features. The CIMP-L/0 MLH1 methylation-negative and CIMP-H MLH1m+ subtypes were predominant, comprising 63.6 and 24.1% of total microsatellite-unstable colorectal cancers, respectively. The discordant subtypes, CIMP-H MLH1 methylation-negative and CIMP-L/0 MLH1m+, were found in 5 and 7% of microsatellite-unstable colorectal cancers, respectively. The CIMP-H MLH1 methylation-negative subtype exhibited elevated incidence rates in male patients and was associated with larger tumor size, more frequent loss of MSH2 expression, increased frequency of KRAS mutation, and advanced cancer stage. The CIMP-L/0 MLH1m+ subtype was associated with onset at an earlier age, a predominance of MLH1 loss, and earlier cancer stage. None of the CIMP-L/0 MLH1m+ subtype patients succumbed to death during the follow-up. Our findings suggest that the discordant subtypes of colorectal cancers exhibit distinct clinicopathological and molecular features

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Orphan and gene related CpG Islands follow power-law-like distributions in several genomes: evidence of function-related and taxonomy-related modes of distribution.

PubMed

Tsiagkas, Giannis; Nikolaou, Christoforos; Almirantis, Yannis

2014-12-01

CpG Islands (CGIs) are compositionally defined short genomic stretches, which have been studied in the human, mouse, chicken and later in several other genomes. Initially, they were assigned the role of transcriptional regulation of protein-coding genes, especially the house-keeping ones, while more recently there is found evidence that they are involved in several other functions as well, which might include regulation of the expression of RNA genes, DNA replication etc. Here, an investigation of their distributional characteristics in a variety of genomes is undertaken for both whole CGI populations as well as for CGI subsets that lie away from known genes (gene-unrelated or "orphan" CGIs). In both cases power-law-like linearity in double logarithmic scale is found. An evolutionary model, initially put forward for the explanation of a similar pattern found in gene populations is implemented. It includes segmental duplication events and eliminations of most of the duplicated CGIs, while a moderate rate of non-duplicated CGI eliminations is also applied in some cases. Simulations reproduce all the main features of the observed inter-CGI chromosomal size distributions. Our results on power-law-like linearity found in orphan CGI populations suggest that the observed distributional pattern is independent of the analogous pattern that protein coding segments were reported to follow. The power-law-like patterns in the genomic distributions of CGIs described herein are found to be compatible with several other features of the composition, abundance or functional role of CGIs reported in the current literature across several genomes, on the basis of the proposed evolutionary model. Copyright © 2014 Elsevier Ltd. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

Interpreting Chromosome Aberration Spectra

NASA Technical Reports Server (NTRS)

Levy, Dan; Reeder, Christopher; Loucas, Bradford; Hlatky, Lynn; Chen, Allen; Cornforth, Michael; Sachs, Rainer

2007-01-01

Ionizing radiation can damage cells by breaking both strands of DNA in multiple locations, essentially cutting chromosomes into pieces. The cell has enzymatic mechanisms to repair such breaks; however, these mechanisms are imperfect and, in an exchange process, may produce a large-scale rearrangement of the genome, called a chromosome aberration. Chromosome aberrations are important in killing cells, during carcinogenesis, in characterizing repair/misrepair pathways, in retrospective radiation biodosimetry, and in a number of other ways. DNA staining techniques such as mFISH ( multicolor fluorescent in situ hybridization) provide a means for analyzing aberration spectra by examining observed final patterns. Unfortunately, an mFISH observed final pattern often does not uniquely determine the underlying exchange process. Further, resolution limitations in the painting protocol sometimes lead to apparently incomplete final patterns. We here describe an algorithm for systematically finding exchange processes consistent with any observed final pattern. This algorithm uses aberration multigraphs, a mathematical formalism that links the various aspects of aberration formation. By applying a measure to the space of consistent multigraphs, we will show how to generate model-specific distributions of aberration processes from mFISH experimental data. The approach is implemented by software freely available over the internet. As a sample application, we apply these algorithms to an aberration data set, obtaining a distribution of exchange cycle sizes, which serves to measure aberration complexity. Estimating complexity, in turn, helps indicate how damaging the aberrations are and may facilitate identification of radiation type in retrospective biodosimetry.

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Link between epigenomic alterations and genome-wide aberrant transcriptional response to allergen in dendritic cells conveying maternal asthma risk.

PubMed

Mikhaylova, Lyudmila; Zhang, Yiming; Kobzik, Lester; Fedulov, Alexey V

2013-01-01

We investigated the link between epigenome-wide methylation aberrations at birth and genomic transcriptional changes upon allergen sensitization that occur in the neonatal dendritic cells (DC) due to maternal asthma. We previously demonstrated that neonates of asthmatic mothers are born with a functional skew in splenic DCs that can be seen even in allergen-naïve pups and can convey allergy responses to normal recipients. However, minimal-to-no transcriptional or phenotypic changes were found to explain this alteration. Here we provide in-depth analysis of genome-wide DNA methylation profiles and RNA transcriptional (microarray) profiles before and after allergen sensitization. We identified differentially methylated and differentially expressed loci and performed manually-curated matching of methylation status of the key regulatory sequences (promoters and CpG islands) to expression of their respective transcripts before and after sensitization. We found that while allergen-naive DCs from asthma-at-risk neonates have minimal transcriptional change compared to controls, the methylation changes are extensive. The substantial transcriptional change only becomes evident upon allergen sensitization, when it occurs in multiple genes with the pre-existing epigenetic alterations. We demonstrate that maternal asthma leads to both hyper- and hypomethylation in neonatal DCs, and that both types of events at various loci significantly overlap with transcriptional responses to allergen. Pathway analysis indicates that approximately 1/2 of differentially expressed and differentially methylated genes directly interact in known networks involved in allergy and asthma processes. We conclude that congenital epigenetic changes in DCs are strongly linked to altered transcriptional responses to allergen and to early-life asthma origin. The findings are consistent with the emerging paradigm that asthma is a disease with underlying epigenetic changes.

Genome-Wide Methylome Analyses Reveal Novel Epigenetic Regulation Patterns in Schizophrenia and Bipolar Disorder

PubMed Central

Li, Yongsheng; Camarillo, Cynthia; Xu, Juan; Arana, Tania Bedard; Xiao, Yun; Zhao, Zheng; Chen, Hong; Ramirez, Mercedes; Zavala, Juan; Escamilla, Michael A.; Armas, Regina; Mendoza, Ricardo; Ontiveros, Alfonso; Nicolini, Humberto; Jerez Magaña, Alvaro Antonio; Rubin, Lewis P.; Li, Xia; Xu, Chun

2015-01-01

Schizophrenia (SZ) and bipolar disorder (BP) are complex genetic disorders. Their appearance is also likely informed by as yet only partially described epigenetic contributions. Using a sequencing-based method for genome-wide analysis, we quantitatively compared the blood DNA methylation landscapes in SZ and BP subjects to control, both in an understudied population, Hispanics along the US-Mexico border. Remarkably, we identified thousands of differentially methylated regions for SZ and BP preferentially located in promoters 3′-UTRs and 5′-UTRs of genes. Distinct patterns of aberrant methylation of promoter sequences were located surrounding transcription start sites. In these instances, aberrant methylation occurred in CpG islands (CGIs) as well as in flanking regions as well as in CGI sparse promoters. Pathway analysis of genes displaying these distinct aberrant promoter methylation patterns showed enhancement of epigenetic changes in numerous genes previously related to psychiatric disorders and neurodevelopment. Integration of gene expression data further suggests that in SZ aberrant promoter methylation is significantly associated with altered gene transcription. In particular, we found significant associations between (1) promoter CGIs hypermethylation with gene repression and (2) CGI 3′-shore hypomethylation with increased gene expression. Finally, we constructed a specific methylation analysis platform that facilitates viewing and comparing aberrant genome methylation in human neuropsychiatric disorders. PMID:25734057

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

PubMed

Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

2017-04-04

Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer1

PubMed Central

Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-01-01

Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091

Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E.

PubMed

Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

2014-08-01

DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P<0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872

Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E

PubMed Central

Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

2014-01-01

DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P < 0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872

Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

PubMed Central

Lee, Wei-Chung Allen; Nedivi, Elly

2011-01-01

cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

The CpG island methylator phenotype may confer a survival benefit in patients with stage II or III colorectal carcinomas receiving fluoropyrimidine-based adjuvant chemotherapy

PubMed Central

2011-01-01

Background Colorectal carcinoma (CRC) with CpG island methylator phenotype (CIMP) is recognized as a distinct subgroup of CRC, and CIMP status affects prognosis and response to chemotherapy. Identification of CIMP status in CRC is important for proper patient management. In Eastern countries, however, the clinicopathologic and molecular characteristics and prognosis of CRCs with CIMP are still unclear. Methods A total of 245 patients who underwent their first surgical resection for sporadic CRC were enrolled and CIMP status of the CRCs was determined using the quantitative MethyLight assay. The clinicopathologic and molecular characteristics were reviewed and compared according to CIMP status. In addition, the three-year recurrence-free survival (RFS) of 124 patients with stage II or stage III CRC was analyzed in order to assess the effectiveness of fluoropyrimidine-based adjuvant chemotherapy with respect to CIMP status. Results CIMP-high CRCs were identified in 34 cases (13.9%), and were significantly associated with proximal tumor location, poorly differentiated carcinoma, mucinous histology, and high frequencies of BRAF mutation, MGMT methylation, and MSI-high compared to CIMP-low/negative carcinomas. For patients with stage II or III CIMP-low/negative CRCs, no significant difference was found in RFS between those undergoing surgery alone and those receiving surgery with fluoropyrimidine-based adjuvant chemotherapy. However, for patients with CIMP-high CRCs, patients undergoing surgery with fluoropyrimidine-based adjuvant chemotherapy (n = 17; three-year RFS: 100%) showed significantly better RFS than patients treated with surgery alone (n = 7; three-year RFS: 71.4%) (P = 0.022). Conclusions Our results suggest that selected patients with CIMP-high CRC may benefit from fluoropyrimidine-based adjuvant chemotherapy with longer RFS. Further large scale-studies are required to confirm our results. PMID:21827707

Comprehensive analysis of CpG island methylator phenotype (CIMP)-high, -low, and -negative colorectal cancers based on protein marker expression and molecular features.

PubMed

Zlobec, Inti; Bihl, Michel; Foerster, Anja; Rufle, Alex; Lugli, Alessandro

2011-11-01

CpG island methylator phenotype (CIMP) is being investigated for its role in the molecular and prognostic classification of colorectal cancer patients but is also emerging as a factor with the potential to influence clinical decision-making. We report a comprehensive analysis of clinico-pathological and molecular features (KRAS, BRAF and microsatellite instability, MSI) as well as of selected tumour- and host-related protein markers characterizing CIMP-high (CIMP-H), -low, and -negative colorectal cancers. Immunohistochemical analysis for 48 protein markers and molecular analysis of CIMP (CIMP-H: ≥ 4/5 methylated genes), MSI (MSI-H: ≥ 2 instable genes), KRAS, and BRAF were performed on 337 colorectal cancers. Simple and multiple regression analysis and receiver operating characteristic (ROC) curve analysis were performed. CIMP-H was found in 24 cases (7.1%) and linked (p < 0.0001) to more proximal tumour location, BRAF mutation, MSI-H, MGMT methylation (p = 0.022), advanced pT classification (p = 0.03), mucinous histology (p = 0.069), and less frequent KRAS mutation (p = 0.067) compared to CIMP-low or -negative cases. Of the 48 protein markers, decreased levels of RKIP (p = 0.0056), EphB2 (p = 0.0045), CK20 (p = 0.002), and Cdx2 (p < 0.0001) and increased numbers of CD8+ intra-epithelial lymphocytes (p < 0.0001) were related to CIMP-H, independently of MSI status. In addition to the expected clinico-pathological and molecular associations, CIMP-H colorectal cancers are characterized by a loss of protein markers associated with differentiation, and metastasis suppression, and have increased CD8+ T-lymphocytes regardless of MSI status. In particular, Cdx2 loss seems to strongly predict CIMP-H in both microsatellite-stable (MSS) and MSI-H colorectal cancers. Cdx2 is proposed as a surrogate marker for CIMP-H. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

EG-05COMBINATION OF GENE COPY GAIN AND EPIGENETIC DEREGULATION ARE ASSOCIATED WITH THE ABERRANT EXPRESSION OF A STEM CELL RELATED HOX-SIGNATURE IN GLIOBLASTOMA

PubMed Central

Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika

2014-01-01

We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at

Immunoregulation of GVHD by triggering the innate immune system with CpG.

PubMed

Morecki, Shoshana; Slavin, Shimon

2009-08-01

Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

PubMed Central

Shen, Hong; Iwasaki, Akiko

2006-01-01

Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

PubMed Central

Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

2014-01-01

Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Prediction of epigenetically regulated genes in breast cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in

Prediction of epigenetically regulated genes in breast cancer cell lines.

PubMed

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

2010-06-04

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors

Mask-induced aberration in EUV lithography

NASA Astrophysics Data System (ADS)

Nakajima, Yumi; Sato, Takashi; Inanami, Ryoichi; Nakasugi, Tetsuro; Higashiki, Tatsuhiko

2009-04-01

We estimated aberrations using Zernike sensitivity analysis. We found the difference of the tolerated aberration with line direction for illumination. The tolerated aberration of perpendicular line for illumination is much smaller than that of parallel line. We consider this difference to be attributable to the mask 3D effect. We call it mask-induced aberration. In the case of the perpendicular line for illumination, there was a difference in CD between right line and left line without aberration. In this report, we discuss the possibility of pattern formation in NA 0.25 generation EUV lithography tool. In perpendicular pattern for EUV light, the dominant part of aberration is mask-induced aberration. In EUV lithography, pattern correction based on the mask topography effect will be more important.

Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

PubMed

Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

2016-12-01

For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Therapeutic modulation of epigenetic drivers of drug resistance in ovarian cancer

PubMed Central

Zeller, Constanze; Brown, Robert

2010-01-01

Epigenetic changes in tumours are associated not only with cancer development and progression, but also with resistance to chemotherapy. Aberrant DNA methylation at CpG islands and associated epigenetic silencing are observed during the acquisition of drug resistance. However, it remains unclear whether all of the observed changes are drivers of drug resistance, causally associated with response of tumours to chemotherapy, or are passenger events representing chance DNA methylation changes. Systematic approaches that link DNA methylation and expression with chemosensitivity will be required to identify key drivers. Such drivers will be important prognostic or predicitive biomarkers, both to existing chemotherapies, but also to epigenetic therapies used to modulate drug resistance. PMID:21789144

Camera processing with chromatic aberration.

PubMed

Korneliussen, Jan Tore; Hirakawa, Keigo

2014-10-01

Since the refractive index of materials commonly used for lens depends on the wavelengths of light, practical camera optics fail to converge light to a single point on an image plane. Known as chromatic aberration, this phenomenon distorts image details by introducing magnification error, defocus blur, and color fringes. Though achromatic and apochromatic lens designs reduce chromatic aberration to a degree, they are complex and expensive and they do not offer a perfect correction. In this paper, we propose a new postcapture processing scheme designed to overcome these problems computationally. Specifically, the proposed solution is comprised of chromatic aberration-tolerant demosaicking algorithm and post-demosaicking chromatic aberration correction. Experiments with simulated and real sensor data verify that the chromatic aberration is effectively corrected.

α-Synuclein Sequesters Dnmt1 from the Nucleus

PubMed Central

Desplats, Paula; Spencer, Brian; Coffee, Elizabeth; Patel, Pruthul; Michael, Sarah; Patrick, Christina; Adame, Anthony; Rockenstein, Edward; Masliah, Eliezer

2011-01-01

DNA methylation is a major epigenetic modification that regulates gene expression. Dnmt1, the maintenance DNA methylation enzyme, is abundantly expressed in the adult brain and is mainly located in the nuclear compartment, where it has access to chromatin. Hypomethylation of CpG islands at intron 1 of the SNCA gene has recently been reported to result in overexpression of α-synuclein in Parkinson disease (PD) and related disorders. We therefore investigated the mechanisms underlying altered DNA methylation in PD and dementia with Lewy bodies (DLB). We present evidence of reduction of nuclear Dnmt1 levels in human postmortem brain samples from PD and DLB patients as well as in the brains of α-synuclein transgenic mice models. Furthermore, sequestration of Dnmt1 in the cytoplasm results in global DNA hypomethylation in human and mouse brains, involving CpG islands upstream of SNCA, SEPW1, and PRKAR2A genes. We report that association of Dnmt1 and α-synuclein might mediate aberrant subcellular localization of Dnmt1. Nuclear Dnmt1 levels were partially rescued by overexpression of Dnmt1 in neuronal cell cultures and in α-synuclein transgenic mice brains. Our results underscore a novel mechanism for epigenetic dysregulation in Lewy body diseases, which might underlie the decrease in DNA methylation reported for PD and DLB. PMID:21296890

Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer.

PubMed

Marusa Borgonio-Cuadra, Veronica; Miranda-Duarte, Antonio; Rojas-Toledo, Xochitl; Garcia-Hernandez, Normand; Alfredo Sierra-Ramirez, Jose; Cardenas-Garcia, Maura; Elena Hernandez-Caballero, Marta

2018-01-01

Aberrant methylation of CpG islands in the promoter is a hallmark of cancer, leading to transcriptional silencing of tumor suppressor genes. The aim of this work was to evaluate the promoter methylation status of the DACT2 gene in breast cancer (BC) tissue and to analyze its possible effect on tumor type or grade. CpG island from the DACT2 promoter in region -240 to -14 from transcriptional start site (TSS) were obtained. Through the use of sodium bisulfite DNA conversion analysis, followed by detection with MSP (methylation specific PCR), we analyzed 79 BC and 15 adjacent healthy samples. T he c ases a nalyzed w ere i n s tage I ( 2.5%), I I (38%), or III (59.5%). The most frequent tumor type was invasive ductal carcinoma (71.4%). Methylation analysis comparing tumor tissues with adjacent non-cancerous tissues showed statistical significance. Methylation was observed in 32.9% (26/79) of the samples; no methylation was found in adjacent healthy tissue. DACT2 methylation was associated with tumor stage I-II (p=0.03) and stage III (p=0.004). An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

PubMed

Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

2006-04-01

Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

CpG Island Methylator Phenotype Positive Tumors in the Absence of MLH1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis

PubMed Central

Fu, Tao; Pappou, Emmanouil P.; Guzzetta, Angela A.; Jeschke, Jana; Kwak, Ruby; Dave, Pujan; Hooker, Craig M.; Morgan, Richard; Baylin, Stephen B.; Iacobuzio-Donahue, Christine A.; Wolfgang, Christopher L.; Ahuja, Nita

2012-01-01

Purpose Little information is available on genetic and epigenetic changes in duodenal adenocarcinomas. The purpose was to identify possible subsets of duodenal adenocarcinomas based on microsatellite instability (MSI), DNA methylation, mutations in the KRAS and BRAF genes, clinicopathologic features, and prognosis. Experimental Design Demographics, tumor characteristics and survival were available for 99 duodenal adenocarcinoma patients. Testing for KRAS and BRAF mutations, MSI, MLH1 methylation and CpG island methylator phenotype (CIMP) status was performed. A Cox proportional hazard model was built to predict survival. Results CIMP+ was detected in 27 of 99 (27.3%) duodenal adenocarcinomas, and was associated with MSI (P = 0.011) and MLH1 methylation (P < 0.001), but not with KRAS mutations (P = 0.114), as compared to CIMP− tumors. No BRAF V600E mutation was detected. Among the CIMP+ tumors, 15 (55.6%) were CIMP+/MLH1-unmethylated (MLH1-U). Kaplan-Meier analysis showed tumors classified by CIMP, CIMP/MLH1 methylation status or CIMP/MSI status could predict overall survival (OS; P = 0.047, 0.002, and 0.002, respectively), while CIMP/MLH1 methylation status could also predict time-to-recurrence (TTR; P = 0.016). In multivariate analysis, CIMP/MLH1 methylation status showed a significant prognostic value regarding both OS (P < 0.001) and TTR (P = 0.023). Patients with CIMP+/MLH1-U tumors had the worst OS and TTR. Conclusions Our results demonstrate existence of CIMP in duodenal adenocarcinomas. The combination of CIMP+/MLH1-U appears to be independently associated with poor prognosis in patients with duodenal adenocarcinomas. This study also suggests that BRAF mutations are not involved in duodenal tumorigenesis, MSI or CIMP development. PMID:22825585

Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

2012-05-01

Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

PubMed

McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

2017-03-28

Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA

Genetic and epigenetic alteration of the NF2 gene in sporadic meningiomas.

PubMed

Lomas, Jesus; Bello, M Josefa; Arjona, Dolores; Alonso, M Eva; Martinez-Glez, Victor; Lopez-Marin, Isabel; Amiñoso, Cinthia; de Campos, Jose M; Isla, Alberto; Vaquero, Jesus; Rey, Juan A

2005-03-01

The role of the NF2 gene in the development of meningiomas has recently been documented; inactivating mutations plus allelic loss at 22q, the site of this gene (at 22q12), have been identified in both sporadic and neurofibromatosis type 2-associated tumors. Although epigenetic inactivation through aberrant CpG island methylation of the NF2 5' flanking region has been documented in schwannoma (another NF2-associated neoplasm), data on participation of this epigenetic modification in meningiomas are not yet widely available. Using methylation-specific PCR (MSP) plus sequencing, we assessed the presence of aberrant promoter NF2 methylation in a series of 88 meningiomas (61 grade I, 24 grade II, and 3 grade III), in which the allelic constitution at 22q and the NF2 mutational status also were determined by RFLP/microsatellite and PCR-SSCP analyses. Chromosome 22 allelic loss, NF2 gene mutation, and aberrant NF2 promoter methylation were detected in 49%, 24%, and 26% of cases, respectively. Aberrant NF2 methylation with loss of heterozygosity (LOH) at 22q was found in five cases, and aberrant methylation with NF2 mutation in another; LOH 22q and the mutation were found in 16 samples. The aberrant methylation of the NF2 gene also was the sole alteration in 15 samples, most of which were from grade I tumors. These results indicate that aberrant NF2 hypermethylation may participate in the development of a significant proportion of sporadic meningiomas, primarily those of grade I.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

Correlations between corneal and total wavefront aberrations

NASA Astrophysics Data System (ADS)

Mrochen, Michael; Jankov, Mirko; Bueeler, Michael; Seiler, Theo

2002-06-01

Purpose: Corneal topography data expressed as corneal aberrations are frequently used to report corneal laser surgery results. However, the optical image quality at the retina depends on all optical elements of the eye such as the human lens. Thus, the aim of this study was to investigate the correlations between the corneal and total wavefront aberrations and to discuss the importance of corneal aberrations for representing corneal laser surgery results. Methods: Thirty three eyes of 22 myopic subjects were measured with a corneal topography system and a Tschernig-type wavefront analyzer after the pupils were dilated to at least 6 mm in diameter. All measurements were centered with respect to the line of sight. Corneal and total wavefront aberrations were calculated up to the 6th Zernike order in the same reference plane. Results: Statistically significant correlations (p < 0.05) between the corneal and total wavefront aberrations were found for the astigmatism (C3,C5) and all 3rd Zernike order coefficients such as coma (C7,C8). No statistically significant correlations were found for all 4th to 6th order Zernike coefficients except for the 5th order horizontal coma C18 (p equals 0.003). On average, all Zernike coefficients for the corneal aberrations were found to be larger compared to Zernike coefficients for the total wavefront aberrations. Conclusions: Corneal aberrations are only of limited use for representing the optical quality of the human eye after corneal laser surgery. This is due to the lack of correlation between corneal and total wavefront aberrations in most of the higher order aberrations. Besides this, the data present in this study yield towards an aberration balancing between corneal aberrations and the optical elements within the eye that reduces the aberration from the cornea by a certain degree. Consequently, ideal customized ablations have to take both, corneal and total wavefront aberrations, into consideration.

Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

PubMed

Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

2017-03-09

It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

OF TRYPANOSOMATIDS. ENDOTRANSFORMATIONS AND ABERRATIONS].

PubMed

Frolov, A O; Malysheva, M N; Kostygov, A Yu

2016-01-01

Endotransformations and aberrations of the life cycle in the evolutionary history of trypanosomatids (Kinetoplastea: Trypanosomatidae) are analyzed. We treat the term "endotransformations" as evolutionarily fixed changes of phases and/or developmental stages of parasites. By contrast, we treat aberrations as evolutionary unstable, periodically arising deformations of developmental phases of trypanosomatids, never leading to life cycle changes. Various examples of life cycle endotransformations and aberrations in representatives of the family Trypanosomatidae are discussed.

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

PubMed

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

PubMed Central

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

Identification and comparison of aberrant key regulatory networks in breast, colon, liver, lung, and stomach cancers through methylome database analysis.

PubMed

Kim, Byungtak; Kang, Seongeun; Jeong, Gookjoo; Park, Sung-Bin; Kim, Sun Jung

2014-01-01

Aberrant methylation of specific CpG sites at the promoter is widely responsible for genesis and development of various cancer types. Even though the microarray-based methylome analyzing techniques have contributed to the elucidation of the methylation change at the genome-wide level, the identification of key methylation markers or top regulatory networks appearing common in highly incident cancers through comparison analysis is still limited. In this study, we in silico performed the genome-wide methylation analysis on each 10 sets of normal and cancer pairs of five tissues: breast, colon, liver, lung, and stomach. The methylation array covers 27,578 CpG sites, corresponding to 14,495 genes, and significantly hypermethylated or hypomethylated genes in the cancer were collected (FDR adjusted p-value <0.05; methylation difference >0.3). Analysis of the dataset confirmed the methylation of previously known methylation markers and further identified novel methylation markers, such as GPX2, CLDN15, and KL. Cluster analysis using the methylome dataset resulted in a diagram with a bipartite mode distinguishing cancer cells from normal cells regardless of tissue types. The analysis further revealed that breast cancer was closest with lung cancer, whereas it was farthest from colon cancer. Pathway analysis identified that either the "cancer" related network or the "cancer" related bio-function appeared as the highest confidence in all the five cancers, whereas each cancer type represents its tissue-specific gene sets. Our results contribute toward understanding the essential abnormal epigenetic pathways involved in carcinogenesis. Further, the novel methylation markers could be applied to establish markers for cancer prognosis.

The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

PubMed Central

Robertson, Keith D.; Jones, Peter A.

1998-01-01

The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

Monochromatic ocular wave aberrations in young monkeys

PubMed Central

Ramamirtham, Ramkumar; Kee, Chea-su; Hung, Li-Fang; Qiao-Grider, Ying; Roorda, Austin; Smith, Earl L.

2006-01-01

High-order monochromatic aberrations could potentially influence vision-dependent refractive development in a variety of ways. As a first step in understanding the effects of wave aberration on refractive development, we characterized the maturational changes that take place in the high-order aberrations of infant rhesus monkey eyes. Specifically, we compared the monochromatic wave aberrations of infant and adolescent animals and measured the longitudinal changes in the high-order aberrations of infant monkeys during the early period when emmetropization takes place. Our main findings were that (1) adolescent monkey eyes have excellent optical quality, exhibiting total RMS errors that were slightly better than those for adult human eyes that have the same numerical aperture and (2) shortly after birth, infant rhesus monkeys exhibited relatively larger magnitudes of high-order aberrations predominately spherical aberration, coma, and trefoil, which decreased rapidly to assume adolescent values by about 200 days of age. The results demonstrate that rhesus monkey eyes are a good model for studying the contribution of individual ocular components to the eye’s overall aberration structure, the mechanisms responsible for the improvements in optical quality that occur during early ocular development, and the effects of high-order aberrations on ocular growth and emmetropization. PMID:16750549

FPGA implementation of a configurable neuromorphic CPG-based locomotion controller.

PubMed

Barron-Zambrano, Jose Hugo; Torres-Huitzil, Cesar

2013-09-01

Neuromorphic engineering is a discipline devoted to the design and development of computational hardware that mimics the characteristics and capabilities of neuro-biological systems. In recent years, neuromorphic hardware systems have been implemented using a hybrid approach incorporating digital hardware so as to provide flexibility and scalability at the cost of power efficiency and some biological realism. This paper proposes an FPGA-based neuromorphic-like embedded system on a chip to generate locomotion patterns of periodic rhythmic movements inspired by Central Pattern Generators (CPGs). The proposed implementation follows a top-down approach where modularity and hierarchy are two desirable features. The locomotion controller is based on CPG models to produce rhythmic locomotion patterns or gaits for legged robots such as quadrupeds and hexapods. The architecture is configurable and scalable for robots with either different morphologies or different degrees of freedom (DOFs). Experiments performed on a real robot are presented and discussed. The obtained results demonstrate that the CPG-based controller provides the necessary flexibility to generate different rhythmic patterns at run-time suitable for adaptable locomotion. Copyright © 2013 Elsevier Ltd. All rights reserved.

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

Iteration of ultrasound aberration correction methods

NASA Astrophysics Data System (ADS)

Maasoey, Svein-Erik; Angelsen, Bjoern; Varslot, Trond

2004-05-01

Aberration in ultrasound medical imaging is usually modeled by time-delay and amplitude variations concentrated on the transmitting/receiving array. This filter process is here denoted a TDA filter. The TDA filter is an approximation to the physical aberration process, which occurs over an extended part of the human body wall. Estimation of the TDA filter, and performing correction on transmit and receive, has proven difficult. It has yet to be shown that this method works adequately for severe aberration. Estimation of the TDA filter can be iterated by retransmitting a corrected signal and re-estimate until a convergence criterion is fulfilled (adaptive imaging). Two methods for estimating time-delay and amplitude variations in receive signals from random scatterers have been developed. One method correlates each element signal with a reference signal. The other method use eigenvalue decomposition of the receive cross-spectrum matrix, based upon a receive energy-maximizing criterion. Simulations of iterating aberration correction with a TDA filter have been investigated to study its convergence properties. A weak and strong human-body wall model generated aberration. Both emulated the human abdominal wall. Results after iteration improve aberration correction substantially, and both estimation methods converge, even for the case of strong aberration.

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

Down-regulation of p21 (CDKN1A/CIP1) is inversely associated with microsatellite instability and CpG island methylator phenotype (CIMP) in colorectal cancer.

PubMed

Ogino, S; Kawasaki, T; Kirkner, G J; Ogawa, A; Dorfman, I; Loda, M; Fuchs, C S

2006-10-01

p21 (CDKN1A/CIP1/WAF1), one of the cyclin-dependent kinase inhibitors, plays a key role in regulating the cell cycle and is transcriptionally regulated by p53. Down-regulation of p21 is caused by TP53 mutations in colorectal cancer. CpG island methylator phenotype (CIMP) appears to be a distinct subtype of colorectal cancer with concordant methylation of multiple gene promoters and is associated with a high degree of microsatellite instability (MSI-H) and BRAF mutations. However, no study to date has evaluated the relationship between p21 expression and CIMP in colorectal cancer. The purpose of this study was to examine the inter-relationships between p21, p53, CIMP, MSI and KRAS/BRAF status in colorectal cancer. We utilized 737 relatively unbiased samples of colorectal cancers from two large prospective cohort studies. Using quantitative real-time PCR (MethyLight), we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1 and NEUROG1]. CIMP-high (>or=4/5 methylated promoters) was diagnosed in 118 (16%) of the 737 tumours. We also assessed expression of p21 and p53 by immunohistochemistry. Among the 737 tumours, 371 (50%) showed p21 loss. Both p21 loss and p53 positivity were inversely associated with CIMP-high, MSI-H and BRAF mutations. The associations of p21 with these molecular features were still present after tumours were stratified by p53 status. In contrast, the associations of p53 positivity with the molecular features were no longer present after tumours were stratified by p21 status. When CIMP-high and non-CIMP-high tumours were stratified by MSI or KRAS/BRAF status, CIMP-high and MSI-H (but not BRAF mutations) were still inversely associated with p21 loss. In conclusion, down-regulation of p21 is inversely correlated with CIMP-high and MSI-H in colorectal cancer, independent of TP53 and BRAF status.

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.

2009-12-23

BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

PubMed

McCluskie, M J; Krieg, A M

2006-01-01

The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

[Monochromatic aberration in accommodation. Dynamic wavefront analysis].

PubMed

Fritzsch, M; Dawczynski, J; Jurkutat, S; Vollandt, R; Strobel, J

2011-06-01

Monochromatic aberrations may influence the visual acuity of the eye. They are not stable and can be affected by different factors. The subject of the following paper is the dynamic investigation of the changes in wavefront aberration with accommodation. Dynamic measurement of higher and lower order aberrations was performed with a WASCA Wavefront Analyzer (Carl-Zeiss-Meditec) and a specially constructed target device for aligning objects in far and near distances on 25 subjects aged from 15 to 27 years old. Wavefront aberrations showed some significant changes in accommodation. In addition to the characteristic sphere reaction accompanying miosis and changes in horizontal prism (Z(1) (1)) in the sense of a convergence movement of the eyeball also occurred. Furthermore defocus rose (Z(2) (0)) and astigmatism (Z(2) (-2)) changed. In higher-order aberrations a decrease in coma-like Zernike polynomials (Z(3) (-1), Z(3) (1)) was found. The most obvious change appeared in spherical aberration (Z(4) (0)) which increased and changed from positive to negative. In addition the secondary astigmatism (Z(4) (-2)) and quadrafoil (Z(4) (4)) rise also increased. The total root mean square (RMS), as well as the higher-order aberrations (RMS-HO) significantly increased in accommodation which is associated with a theoretical reduction of visual acuity. An analysis of the influence of pupil size on aberrations showed significant increases in defocus, spherical aberration, quadrafoil, RMS and RMS HO by increasing pupil diameter. By accommodation-associated miosis, the growing aberrations are partially compensated by focusing on near objects. Temporal analysis of the accommodation process with dynamic wavefront analysis revealed significant delays in pupil response and changing of prism in relation to the sphere reaction. In accommodation to near objects a discrete time ahead of third order aberrations in relation to the sphere response was found. Using dynamic wavefront measurement

Wavefront aberrations of x-ray dynamical diffraction beams.

PubMed

Liao, Keliang; Hong, Youli; Sheng, Weifan

2014-10-01

The effects of dynamical diffraction in x-ray diffractive optics with large numerical aperture render the wavefront aberrations difficult to describe using the aberration polynomials, yet knowledge of them plays an important role in a vast variety of scientific problems ranging from optical testing to adaptive optics. Although the diffraction theory of optical aberrations was established decades ago, its application in the area of x-ray dynamical diffraction theory (DDT) is still lacking. Here, we conduct a theoretical study on the aberration properties of x-ray dynamical diffraction beams. By treating the modulus of the complex envelope as the amplitude weight function in the orthogonalization procedure, we generalize the nonrecursive matrix method for the determination of orthonormal aberration polynomials, wherein Zernike DDT and Legendre DDT polynomials are proposed. As an example, we investigate the aberration evolution inside a tilted multilayer Laue lens. The corresponding Legendre DDT polynomials are obtained numerically, which represent balanced aberrations yielding minimum variance of the classical aberrations of an anamorphic optical system. The balancing of classical aberrations and their standard deviations are discussed. We also present the Strehl ratio of the primary and secondary balanced aberrations.

On the Definition of Aberration

NASA Astrophysics Data System (ADS)

Xu, Minghui; Wang, Guangli

2014-12-01

There was a groundbreaking step in the history of astronomy in 1728 when the effect of aberration was discovered by James Bradley (1693-1762). Recently, the solar acceleration, due to the variations in the aberrational effect of extragalactic sources caused by it, has been determined from VLBI observations with an uncertainty of about 0.5 mm{\\cdot}{s^{-1}}{\\cdot}{yr^{-1}} level. As a basic concept in astrometry with a nearly 300-year history, the definition of aberration, however, is still equivocal and discordant in the literature. It has been under continuing debate whether it depends on the relative motion between the observer and the observed source or only on the motion of the observer with respect to the frame of reference. In this paper, we will review the debate and the inconsistency in the definition of the aberration since the last century, and then discuss its definition in detail, which involves the discussions on the planetary aberration, the stellar aberration, the proper motion of an object during the travel time of light from the object to the observer, and the way of selecting the reference frame to express and distinguish the motions of the source and the observer. The aberration is essentially caused by the transformation between coordinate systems, and consequently quantified by the velocity of the observer with respect to the selected reference frame, independent of the motion of the source. Obviously, this nature is totally different from that of the definition given by the IAU WG NFA (Capitaine, 2007) in 2006, which is stated as, ``the apparent angular displacement of the observed position of a celestial object from its geometric position, caused by the finite velocity of light in combination with the motions of the observer and of the observed object.''

Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

PubMed

Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

2011-08-26

Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3.

PubMed

Yeung, Chi Lam Au; Tsang, Tsun Yee; Yau, Pak Lun; Kwok, Tim Tak

2017-02-14

Oncogenic protein E6 of human papillomavirus type 16 (HPV-16) is believed to involve in the aberrant methylation in cervical cancer as it upregulates DNA methyltransferase 1 (DNMT1) through tumor suppressor p53. In addition, DNA demethylating agent induces the expression of one of the HPV-16 E6 regulated microRNAs (miRs), miR-23b, in human cervical carcinoma SiHa cells. Thus, the importance of DNA methylation and miR-23b in HPV-16 E6 associated cervical cancer development is investigated. In the present study, however, it is found that miR-23b is not embedded in any typical CpG island. Nevertheless, a functional CpG island is predicted in the promoter region of C9orf3, the host gene of miR-23b, and is validated by methylation-specific PCR and bisulfite genomic sequencing analyses. Besides, c-MET is confirmed to be a target gene of miR-23b. Silencing of HPV-16 E6 is found to increase the expression of miR-23b, decrease the expression of c-MET and thus induce the apoptosis of SiHa cells through the c-MET downstream signaling pathway. Taken together, the tumor suppressive miR-23b is epigenetically inactivated through its host gene C9orf3 and this is probably a critical pathway during HPV-16 E6 associated cervical cancer development.

Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

PubMed

Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

2011-02-28

To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

Quantitative profiling of CpG island methylation in human stool for colorectal cancer detection.

PubMed

Elliott, Giles O; Johnson, Ian T; Scarll, Jane; Dainty, Jack; Williams, Elizabeth A; Garg, D; Coupe, Amanda; Bradburn, David M; Mathers, John C; Belshaw, Nigel J

2013-01-01

The aims of this study were to investigate the use of quantitative CGI methylation data from stool DNA to classify colon cancer patients and to relate stool CGI methylation levels to those found in corresponding tissue samples. We applied a quantitative methylation-specific PCR assay to determine CGI methylation levels of six genes, previously shown to be aberrantly methylated during colorectal carcinogenesis. Assays were performed on DNA from biopsies of "normal" mucosa and stool samples from 57 patients classified as disease-free, adenoma, or cancer by endoscopy, and in tumour tissue from cancer patients. Additionally, CGI methylation was analysed in stool DNA from an asymptomatic population of individuals covering a broad age range (mean = 47 ± 24 years) CGI methylation levels in stool DNA were significantly higher than in DNA from macroscopically normal mucosa, and a significant correlation between stool and mucosa was observed for ESR1 only. Multivariate statistical analyses using the methylation levels of each CGI in stool DNA as a continuous variable revealed a highly significant (p = 0.003) classification of cancer vs. non-cancer (adenoma + disease-free) patients (sensitivity = 65 %, specificity = 81 %). CGI methylation profiling of stool DNA successfully identified patients with cancer despite the methylation status of CGIs in stool DNA not generally reflecting those in DNA from the colonic mucosa.

Effect of monochromatic aberrations on photorefractive patterns

NASA Astrophysics Data System (ADS)

Campbell, Melanie C. W.; Bobier, W. R.; Roorda, A.

1995-08-01

Photorefractive methods have become popular in the measurement of refractive and accommodative states of infants and children owing to their photographic nature and rapid speed of measurement. As in the case of any method that measures the refractive state of the human eye, monochromatic aberrations will reduce the accuracy of the measurement. Monochromatic aberrations cannot be as easily predicted or controlled as chromatic aberrations during the measurement, and accordingly they will introduce measurement errors. This study defines this error or uncertainty by extending the existing paraxial optical analyses of coaxial and eccentric photorefraction. This new optical analysis predicts that, for the amounts of spherical aberration (SA) reported for the human eye, there will be a significant degree of measurement uncertainty introduced for all photorefractive methods. The dioptric amount of this uncertainty may exceed the maximum amount of SA present in the eye. The calculated effects on photorefractive measurement of a real eye with a mixture of spherical aberration and coma are shown to be significant. The ability, developed here, to predict photorefractive patterns corresponding to different amounts and types of monochromatic aberration may in the future lead to an extension of photorefractive methods to the dual measurement of refractive states and aberrations of individual eyes. aberration, retinal image quality,

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

CpG island methylator phenotype is associated with the efficacy of sequential oxaliplatin- and irinotecan-based chemotherapy and EGFR-related gene mutation in Japanese patients with metastatic colorectal cancer.

PubMed

Zhang, Xiaofei; Shimodaira, Hideki; Soeda, Hiroshi; Komine, Keigo; Takahashi, Hidekazu; Ouchi, Kota; Inoue, Masahiro; Takahashi, Masanobu; Takahashi, Shin; Ishioka, Chikashi

2016-12-01

The CpG island methylator phenotype (CIMP) with multiple promoter methylated loci has been observed in a subset of human colorectal cancer (CRC) cases. CIMP status, which is closely associated with specific clinicopathological and molecular characteristics, is considered a potential predictive biomarker for efficacy of cancer treatment. However, the relationship between the effect of standard chemotherapy, including cytotoxic drugs and anti-epidermal growth factor receptor (EGFR) antibodies, and CIMP status has not been elucidated. In 125 metastatic colorectal cancer (mCRC) patients, we investigated how clinical outcome of chemotherapy was related to CIMP status as detected by methylation-specific PCR (MSP) and to genetic status in five EGFR-related genes (KRAS, BRAF, PIK3CA, NRAS, and AKT1) as detected by direct sequencing. CIMP-positive status was significantly associated with proximal tumor location and peritoneum metastasis (all P values <0.05). The progression-free survival of patients with CIMP-positive tumors receiving sequential therapy with FOLFOX as the first-line treatment followed by irinotecan-based therapy as the second-line treatment (median = 6.6 months) was inferior to that of such patients receiving the reverse sequence (median = 15.2 months; P = 0.043). Furthermore, CIMP-positive tumors showed higher mutation frequencies for the five EGFR-related genes (74.1 %) than the CIMP-negative tumors did (50.0 %). Among the KRAS wild-type tumors, CIMP-positive tumors were associated with a worse clinical outcome than CIMP-negative tumors following anti-EGFR antibody therapy. Sequential FOLFOX followed by an irinotecan-based regimen is unfavorable in patients with CIMP-positive tumors. High frequencies of mutation in EGFR-related genes in CIMP-positive tumors may cause the lower response to anti-EGFR antibody therapy seen in patients with wild-type KRAS and CIMP-positive tumors.

Imaging characteristics of Zernike and annular polynomial aberrations.

PubMed

Mahajan, Virendra N; Díaz, José Antonio

2013-04-01

The general equations for the point-spread function (PSF) and optical transfer function (OTF) are given for any pupil shape, and they are applied to optical imaging systems with circular and annular pupils. The symmetry properties of the PSF, the real and imaginary parts of the OTF, and the modulation transfer function (MTF) of a system with a circular pupil aberrated by a Zernike circle polynomial aberration are derived. The interferograms and PSFs are illustrated for some typical polynomial aberrations with a sigma value of one wave, and 3D PSFs and MTFs are shown for 0.1 wave. The Strehl ratio is also calculated for polynomial aberrations with a sigma value of 0.1 wave, and shown to be well estimated from the sigma value. The numerical results are compared with the corresponding results in the literature. Because of the same angular dependence of the corresponding annular and circle polynomial aberrations, the symmetry properties of systems with annular pupils aberrated by an annular polynomial aberration are the same as those for a circular pupil aberrated by a corresponding circle polynomial aberration. They are also illustrated with numerical examples.

Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

PubMed Central

Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

2017-01-01

The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

Nodal aberration theory applied to freeform surfaces

NASA Astrophysics Data System (ADS)

Fuerschbach, Kyle; Rolland, Jannick P.; Thompson, Kevin P.

2014-12-01

When new three-dimensional packages are developed for imaging optical systems, the rotational symmetry of the optical system is often broken, changing its imaging behavior and making the optical performance worse. A method to restore the performance is to use freeform optical surfaces that compensate directly the aberrations introduced from tilting and decentering the optical surfaces. In order to effectively optimize the shape of a freeform surface to restore optical functionality, it is helpful to understand the aberration effect the surface may induce. Using nodal aberration theory the aberration fields induced by a freeform surface in an optical system are explored. These theoretical predications are experimentally validated with the design and implementation of an aberration generating telescope.

Corneal spherical aberration in Saudi population

PubMed Central

Al-Sayyari, Tarfah M.; Fawzy, Samah M.; Al-Saleh, Ahmed A.

2014-01-01

Purpose To find out the mean corneal spherical aberration and its changes with age in Saudi population. Setting AlHokama Eye Specialist Center, Riyadh, Saudi Arabia. Methods Three hundred (300) eyes of 185 Saudi subjects (97 men and 88 women), whose age ranged from 15 to 85 years old, with matched refractive errors, were divided into three groups according to their age, 100 for each. All the subjects were included in measuring the spherical aberration (SA) using pentacam HR (OCULUS, Germany) at the 6-mm optical zone. Results The mean corneal spherical aberration (CSA) of the fourth order (Z40) of the whole groups was 0.252 ± 0.1154 μm. Patients from 15 to 35 years old have root mean square (RMS) of CSA of 0.2068 ± 0.07151 μm, 0.2370 ± 0.08023 μm was the RMS of CSA of the patients from 35 to 50 years old, while those from 50 to 85 years old have a CSA-RMS of 0.31511 ± 0.1503 μm (P < 0.0001). A positive correlation was found between the spherical aberration (Z40) and the progress of age (r = 0.3429, P < 0.0001). The high order aberration (HOA) presented 28.1% of the total corneal aberrations. While the fourth order corneal spherical aberration constituted 57% of the HOA and 16% of the total aberration. The pupil diameter shows a negative correlation with the increase in age (P = 0.0012). Conclusion Our results showed a CSA (Z40) that is varied among the population, comparable to other studies, and significantly correlates to the progress of age. PMID:25278799

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma

PubMed Central

Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

2017-01-01

In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC. PMID:27926516

Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

PubMed

Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

2017-01-10

In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

Epigenetics and Colorectal Cancer

PubMed Central

Lao, Victoria Valinluck; Grady, William M.

2012-01-01

Colorectal cancer is a leading cause of cancer deaths in the world. It results from an accumulation of genetic and epigenetic changes in colon epithelial cells that transforms them into adenocarcinomas. There have been major advances in our understanding of cancer epigenetics over the last decade, particularly regarding aberrant DNA methylation. Assessment of the colon cancer epigenome has revealed that virtually all colorectal cancers have aberrantly methylated genes and the average colorectal cancer methylome has hundreds to thousands of abnormally methylated genes. As with gene mutations in the cancer genome, a subset of these methylated genes, called driver genes, is presumed to play a functional role in colorectal cancer. The assessment of methylated genes in colorectal cancers has also revealed a unique molecular subgroup of colorectal cancers called CpG Island Methylator Phenotype (CIMP) cancers; these tumors have a particularly high frequency of methylated genes. The advances in our understanding of aberrant methylation in colorectal cancer has led to epigenetic alterations being developed as clinical biomarkers for diagnostic, prognostic, and therapeutic applications. Progress in the assessment of epigenetic alterations in colorectal cancer and their clinical applications has shown that these alterations will be commonly used in the near future as molecular markers to direct the prevention and treatment of colorectal cancer. PMID:22009203

Transcranial phase aberration correction using beam simulations and MR-ARFI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vyas, Urvi, E-mail: urvi.vyas@gmail.com; Kaye, Elena; Pauly, Kim Butts

2014-03-15

Purpose: Transcranial magnetic resonance-guided focused ultrasound surgery is a noninvasive technique for causing selective tissue necrosis. Variations in density, thickness, and shape of the skull cause aberrations in the location and shape of the focal zone. In this paper, the authors propose a hybrid simulation-MR-ARFI technique to achieve aberration correction for transcranial MR-guided focused ultrasound surgery. The technique uses ultrasound beam propagation simulations with MR Acoustic Radiation Force Imaging (MR-ARFI) to correct skull-caused phase aberrations. Methods: Skull-based numerical aberrations were obtained from a MR-guided focused ultrasound patient treatment and were added to all elements of the InSightec conformal bone focusedmore » ultrasound surgery transducer during transmission. In the first experiment, the 1024 aberrations derived from a human skull were condensed into 16 aberrations by averaging over the transducer area of 64 elements. In the second experiment, all 1024 aberrations were applied to the transducer. The aberrated MR-ARFI images were used in the hybrid simulation-MR-ARFI technique to find 16 estimated aberrations. These estimated aberrations were subtracted from the original aberrations to result in the corrected images. Each aberration experiment (16-aberration and 1024-aberration) was repeated three times. Results: The corrected MR-ARFI image was compared to the aberrated image and the ideal image (image with zero aberrations) for each experiment. The hybrid simulation-MR-ARFI technique resulted in an average increase in focal MR-ARFI phase of 44% for the 16-aberration case and 52% for the 1024-aberration case, and recovered 83% and 39% of the ideal MR-ARFI phase for the 16-aberrations and 1024-aberration case, respectively. Conclusions: Using one MR-ARFI image and noa priori information about the applied phase aberrations, the hybrid simulation-MR-ARFI technique improved the maximum MR-ARFI phase of the beam's focus.« less

Anti-forensics of chromatic aberration

NASA Astrophysics Data System (ADS)

Mayer, Owen; Stamm, Matthew C.

2015-03-01

Over the past decade, a number of information forensic techniques have been developed to identify digital image manipulation and falsification. Recent research has shown, however, that an intelligent forger can use anti-forensic countermeasures to disguise their forgeries. In this paper, an anti-forensic technique is proposed to falsify the lateral chromatic aberration present in a digital image. Lateral chromatic aberration corresponds to the relative contraction or expansion between an image's color channels that occurs due to a lens's inability to focus all wavelengths of light on the same point. Previous work has used localized inconsistencies in an image's chromatic aberration to expose cut-and-paste image forgeries. The anti-forensic technique presented in this paper operates by estimating the expected lateral chromatic aberration at an image location, then removing deviations from this estimate caused by tampering or falsification. Experimental results are presented that demonstrate that our anti-forensic technique can be used to effectively disguise evidence of an image forgery.

A Evaluation of Optical Aberrations in Underwater Hologrammetry

NASA Astrophysics Data System (ADS)

Kilpatrick, J. M.

Available from UMI in association with The British Library. An iterative ray-trace procedure is developed in conjunction with semi-analytic expressions for spherical aberration, coma, and astigmatism in the reconstructed holographic images of underwater objects. An exact expression for the astigmatic difference is obtained, based on the geometry of the caustic for refraction. The geometrical characteristics of the aberrated images associated with axial and non-axial field positions are represented by ray intersection diagrams. A third order expression for the wavefront aberration introduced at a planar air/water boundary is given. The associated third order aberration coefficients are used to obtain analytic expressions for the aberrations observed in underwater hologrammetry. The results of the third order treatment are shown to give good agreement with the results obtained by geometrical ray tracing and by direct measurement on the reconstructed real image. The third order aberration coefficients are employed to estimate the limit of resolution in the presence of the aberrations associated with reconstruction in air. In concurrence with practical observations it is found that the estimated resolution is primarily limited by astigmatism. The limitations of the planar window in underwater imaging applications are outlined and various schemes are considered to effect a reduction in the extent of aberration. The analogous problems encountered in underwater photography are examined in order to establish the grounds for a common solution based on a conventional optical corrector. The performance of one such system, the Ivanoff Corrector, is investigated. The spherical aberration associated with axial image formation is evaluated. The equivalence of the third order wavefront aberration introduced at a planar air/water boundary to that introduced upon reconstruction by an appropriate wavelength change is shown to provide a basis for the compensation of aberrations in

Methyl-CpG island-associated genome signature tags

DOEpatents

Dunn, John J

2014-05-20

Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

PubMed

Xing, Jinyi; Kang, Li; Jiang, Yunliang

2011-03-01

Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

PubMed Central

Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

2000-01-01

Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

Aberrated laser beams in terms of Zernike polynomials

NASA Astrophysics Data System (ADS)

Alda, Javier; Alonso, Jose; Bernabeu, Eusebio

1996-11-01

The characterization of light beams has devoted a lot of attention in the past decade. Several formalisms have been presented to treat the problem of parameter invariance and characterization in the propagation of light beam along ideal, ABCD, optical systems. The hard and soft apertured optical systems have been treated too. Also some aberrations have been analyzed, but it has not appeared a formalism able to treat the problem as a whole. In this contribution we use a classical approach to describe the problem of aberrated, and therefore apertured, light beams. The wavefront aberration is included in a pure phase term expanded in terms of the Zernike polynomials. Then, we can use the relation between the lower order Zernike polynomia and the Seidel or third order aberrations. We analyze the astigmatism, the spherical aberration and the coma, and we show how higher order aberrations can be taken into account. We have calculated the divergence, and the radius of curvature of such aberrated beams and the influence of these aberrations in the quality of the light beam. Some numerical simulations have been done to illustrate the method.

Structural centrosome aberrations promote non-cell-autonomous invasiveness.

PubMed

Ganier, Olivier; Schnerch, Dominik; Oertle, Philipp; Lim, Roderick Yh; Plodinec, Marija; Nigg, Erich A

2018-05-02

Centrosomes are the main microtubule-organizing centers of animal cells. Although centrosome aberrations are common in tumors, their consequences remain subject to debate. Here, we studied the impact of structural centrosome aberrations, induced by deregulated expression of ninein-like protein (NLP), on epithelial spheres grown in Matrigel matrices. We demonstrate that NLP-induced structural centrosome aberrations trigger the escape ("budding") of living cells from epithelia. Remarkably, all cells disseminating into the matrix were undergoing mitosis. This invasive behavior reflects a novel mechanism that depends on the acquisition of two distinct properties. First, NLP-induced centrosome aberrations trigger a re-organization of the cytoskeleton, which stabilizes microtubules and weakens E-cadherin junctions during mitosis. Second, atomic force microscopy reveals that cells harboring these centrosome aberrations display increased stiffness. As a consequence, mitotic cells are pushed out of mosaic epithelia, particularly if they lack centrosome aberrations. We conclude that centrosome aberrations can trigger cell dissemination through a novel, non-cell-autonomous mechanism, raising the prospect that centrosome aberrations contribute to the dissemination of metastatic cells harboring normal centrosomes. © 2018 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

Whole eye wavefront aberrations in Mexican male subjects.

PubMed

Cantú, Roberto; Rosales, Marco A; Tepichín, Eduardo; Curioca, Andrée; Montes, Victor; Bonilla, Julio

2004-01-01

To analyze the characteristics, incidence, and appearance of wavefront aberrations in undilated, normal, unoperated eyes. Eighty-eight eyes of 44 healthy male Mexican subjects (mean age 25.32 years, range 18 to 36 yr) were divided into three groups based on uncorrected visual acuity of greater than or equal to 20/20, 20/30, or 20/40. UCVA measurements were obtained using an Acuity Max computer screen chart. Wavefront aberrations were measured with the Nidek OPD-Scan ARK 10000, Ver. 1.11b. All measurements were carried out at the same center by the same technician during a single session, following manufacturer instructions. Background illumination was 3 Lux. Wavefront aberration measurements for each group were statistically analyzed using StatView; an average eye was characterized and the resulting aberrations were simulated using MATLAB. We obtained wavefront aberration maps for the 20/20 undilated normal unoperated eyes for total, low, and high order aberration coefficients. Wavefront maps for right eyes were practically the same as those for left eyes. Higher aberrations did not contribute substantially to total wavefront analysis. Average aberrations of this "normal eye" will be used as criteria to decide the necessity of wavefront-guided ablation in our facilities. We will focus on the nearly zero average of high order aberrations in this normal whole eye as a reference to be matched.

Accommodation to wavefront vergence and chromatic aberration.

PubMed

Wang, Yinan; Kruger, Philip B; Li, James S; Lin, Peter L; Stark, Lawrence R

2011-05-01

Longitudinal chromatic aberration (LCA) provides a cue to accommodation with small pupils. However, large pupils increase monochromatic aberrations, which may obscure chromatic blur. In this study, we examined the effect of pupil size and LCA on accommodation. Accommodation was recorded by infrared optometer while observers (nine normal trichromats) viewed a sinusoidally moving Maltese cross target in a Badal stimulus system. There were two illumination conditions: white (3000 K; 20 cd/m) and monochromatic (550 nm with 10 nm bandwidth; 20 cd/m) and two artificial pupil conditions (3 and 5.7 mm). Separately, static measurements of wavefront aberration were made with the eye accommodating to targets between 0 and 4 D (COAS, Wavefront Sciences). Large individual differences in accommodation to wavefront vergence and to LCA are a hallmark of accommodation. LCA continues to provide a signal at large pupil sizes despite higher levels of monochromatic aberrations. Monochromatic aberrations may defend against chromatic blur at high spatial frequencies, but accommodation responds best to optical vergence and to LCA at 3 c/deg where blur from higher order aberrations is less.

Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

PubMed

Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

2016-11-14

This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

Sixth-order wave aberration theory of ultrawide-angle optical systems.

PubMed

Lu, Lijun; Cao, Yiqing

2017-10-20

In this paper, we develop sixth-order wave aberration theory of ultrawide-angle optical systems like fisheye lenses. Based on the concept and approach to develop wave aberration theory of plane-symmetric optical systems, we first derive the sixth-order intrinsic wave aberrations and the fifth-order ray aberrations; second, we present a method to calculate the pupil aberration of such kind of optical systems to develop the extrinsic aberrations; third, the relation of aperture-ray coordinates between adjacent optical surfaces is fitted with the second-order polynomial to improve the calculation accuracy of the wave aberrations of a fisheye lens with a large acceptance aperture. Finally, the resultant aberration expressions are applied to calculate the aberrations of two design examples of fisheye lenses; the calculation results are compared with the ray-tracing ones with Zemax software to validate the aberration expressions.

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

PubMed

Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

2009-12-21

A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding

Spherical aberrations of human astigmatic corneas.

PubMed

Zhao, Huawei; Dai, Guang-Ming; Chen, Li; Weeber, Henk A; Piers, Patricia A

2011-11-01

To evaluate whether the average spherical aberration of human astigmatic corneas is statistically equivalent to human nonastigmatic corneas. Spherical aberrations of 445 astigmatic corneas prior to laser vision correction were retrospectively investigated to determine Zernike coefficients for central corneal areas 6 mm in diameter using CTView (Sarver and Associates). Data were divided into groups according to cylinder power (0.01 to 0.25 diopters [D], 0.26 to 0.75 D, 0.76 to 1.06 D, 1.07 to 1.53 D, 1.54 to 2.00 D, and >2.00 D) and according to age by decade. Spherical aberrations were correlated with age and astigmatic power among groups and the entire population. Statistical analyses were conducted, and P<.05 was considered statistically significant. Mean patient age was 42.6±11 years. Astigmatic corneas had an average astigmatic power of 0.78±0.58 D and mean spherical aberration was 0.25±0.13 μm for the entire population and approximately the same (0.27 μm) for individual groups, ranging from 0.23 to 0.29 μm (P>.05 for all tested groups). Mean spherical aberration of astigmatic corneas was not correlated significantly with cylinder power or age (P>.05). Spherical aberrations are similar to those of nonastigmatic corneas, permitting the use of these additional data in the design of aspheric toric intra-ocular lenses. Copyright 2011, SLACK Incorporated.

Quantitative Evaluation of MMP-9 and TIMP-1 Promoter Methylation in Chronic Periodontitis.

PubMed

Li, Xiting; Lu, Jiaxuan; Teng, Wei; Zhao, Chuanjiang; Ye, Xiaolei

2018-03-01

In this study, we investigated the promoter DNA methylation (DNAm) status of the MMP-9 and TIMP-1 genes in patients with chronic periodontitis to evaluate disease progression. Using pyrosequencing technology, DNAm levels of MMP-9 and TIMP-1 CpG islands were measured in 88 chronic periodontitis patients and 15 healthy controls. We found a positive correlation between methylation levels of MMP-9 CpG islands and the severity of chronic periodontitis. Methylated CpG islands were also closely associated with the duration of chronic periodontitis. Moreover, female patients exhibited lower methylation levels of MMP-9 but higher methylation levels of TIMP-1 compared with male patients, and the methylation levels of TIMP-1 gradually decreased with age. The findings of gender disparity in the DNAm of MMP-9 and TIMP-1 genes provide novel insights into chronic periodontitis.

High order aberration and straylight evaluation after cataract surgery with implantation of an aspheric, aberration correcting monofocal intraocular lens

PubMed Central

Kretz, Florian T A; Tandogan, Tamer; Khoramnia, Ramin; Auffarth, Gerd U

2015-01-01

AIM To evaluate the quality of vision in respect to high order aberrations and straylight perception after implantation of an aspheric, aberration correcting, monofocal intraocular lens (IOL). METHODS Twenty-one patients (34 eyes) aged 50 to 83y underwent cataract surgery with implantation of an aspheric, aberration correcting IOL (Tecnis ZCB00, Abbott Medical Optics). Three months after surgery they were examined for uncorrected (UDVA) and corrected distance visual acuity (CDVA), contrast sensitivity (CS) under photopic and mesopic conditions with and without glare source, ocular high order aberrations (HOA, Zywave II) and retinal straylight (C-Quant). RESULTS Postoperatively, patients achieved a postoperative CDVA of 0.0 logMAR or better in 97.1% of eyes. Mean values of high order abberations were +0.02±0.27 (primary coma components) and -0.04±0.16 (spherical aberration term). Straylight values of the C-Quant were 1.35±0.44 log which is within normal range of age matched phakic patients. The CS measurements under mesopic and photopic conditions in combination with and without glare did not show any statistical significance in the patient group observed (P≥0.28). CONCLUSION The implantation of an aspherical aberration correcting monofocal IOL after cataract surgery resulted in very low residual higher order aberration (HOA) and normal straylight. PMID:26309872

Accommodation to Wavefront Vergence and Chromatic Aberration

PubMed Central

Wang, Yinan; Kruger, Philip B.; Li, James S.; Lin, Peter L.; Stark, Lawrence R.

2011-01-01

Purpose Longitudinal chromatic aberration (LCA) provides a cue to accommodation with small pupils. However, large pupils increase monochromatic aberrations, which may obscure chromatic blur. In the present study, we examined the effect of pupil size and LCA on accommodation. Methods Accommodation was recorded by infrared optometer while observers (nine normal trichromats) viewed a sinusoidally moving Maltese cross target in a Badal stimulus system. There were two illumination conditions: white (3000 K; 20 cd/m2) and monochromatic (550 nm with 10 nm bandwidth; 20 cd/m2) and two artificial pupil conditions (3 mm and 5.7 mm). Separately, static measurements of wavefront aberration were made with the eye accommodating to targets between 0 and 4 D (COAS, Wavefront Sciences). Results Large individual differences in accommodation to wavefront vergence and to LCA are a hallmark of accommodation. LCA continues to provide a signal at large pupil sizes despite higher levels of monochromatic aberrations. Conclusions Monochromatic aberrations may defend against chromatic blur at high spatial frequencies, but accommodation responds best to optical vergence and to LCA at 3 c/deg where blur from higher order aberrations is less. PMID:21317666

Comparison of Aberrations After Standard and Customized Refractive Surgery

NASA Astrophysics Data System (ADS)

Fang, L.; He, X.; Wang, Y.

2013-09-01

To detect possible differences in residual wavefront aberrations between standard and customized laser refractive surgery based onmathematical modeling, the residual optical aberrations after conventional and customized laser refractive surgery were compared accordingto the ablation profile with transition zone. The results indicated that ablation profile has a significant impact on the residual aberrations.The amount of residual aberrations for conventional correction is higher than that for customized correction. Additionally, the residualaberrations for high myopia eyes are markedly larger than those for moderate myopia eyes. For a 5 mm pupil, the main residual aberrationterm is coma and yet it is spherical aberration for a 7 mm pupil. When the pupil diameter is the same as optical zone or greater, themagnitudes of residual aberrations is obviously larger than that for a smaller pupil. In addition, the magnitudes of the residual fifth orsixth order aberrations are relatively large, especially secondary coma in a 6 mm pupil and secondary spherical aberration in a 7 mm pupil.Therefore, the customized ablation profile may be superior to the conventional correction even though the transition zone and treatmentdecentration are taken into account. However, the customized ablation profile will still induce significant amount of residual aberrations.

Tracking the Correlation Between CpG Island Methylator Phenotype and Other Molecular Features and Clinicopathological Features in Human Colorectal Cancers: A Systematic Review and Meta-Analysis.

PubMed

Zong, Liang; Abe, Masanobu; Ji, Jiafu; Zhu, Wei-Guo; Yu, Duonan

2016-03-10

The controversy of CpG island methylator phenotype (CIMP) in colorectal cancers (CRCs) persists, despite many studies that have been conducted on its correlation with molecular and clinicopathological features. To drive a more precise estimate of the strength of this postulated relationship, a meta-analysis was performed. A comprehensive search for studies reporting molecular and clinicopathological features of CRCs stratified by CIMP was performed within the PubMed, EMBASE, and Cochrane Library. CIMP was defined by either one of the three panels of gene-specific CIMP markers (Weisenberger panel, classic panel, or a mixture panel of the previous two) or the genome-wide DNA methylation profile. The associations of CIMP with outcome parameters were estimated using odds ratio (OR) or weighted mean difference (WMD) or hazard ratios (HRs) with 95% confidence interval (CI) for each study using a fixed effects or random effects model. A total of 29 studies involving 9,393 CRC patients were included for analysis. We observed more BRAF mutations (OR 34.87; 95% CI, 22.49-54.06) and microsatellite instability (MSI) (OR 12.85 95% CI, 8.84-18.68) in CIMP-positive vs. -negative CRCs, whereas KRAS mutations were less frequent (OR 0.47; 95% CI, 0.30-0.75). Subgroup analysis showed that only the genome-wide methylation profile-defined CIMP subset encompassed all BRAF-mutated CRCs. As expected, CIMP-positive CRCs displayed significant associations with female (OR 0.64; 95% CI, 0.56-0.72), older age at diagnosis (WMD 2.77; 95% CI, 1.15-4.38), proximal location (OR 6.91; 95% CI, 5.17-9.23), mucinous histology (OR 3.81; 95% CI, 2.93-4.95), and poor differentiation (OR 4.22; 95% CI, 2.52-7.08). Although CIMP did not show a correlation with tumor stage (OR 1.10; 95% CI, 0.82-1.46), it was associated with shorter overall survival (HR 1.73; 95% CI, 1.27-2.37). The meta-analysis highlights that CIMP-positive CRCs take their own molecular feature, especially overlapping with BRAF mutations

Sequential DNA methylation changes are associated with DNMT3B overexpression in colorectal neoplastic progression.

PubMed

Ibrahim, Ashraf E K; Arends, Mark J; Silva, Ana-Luisa; Wyllie, Andrew H; Greger, Liliana; Ito, Yoko; Vowler, Sarah L; Huang, Tim H-M; Tavaré, Simon; Murrell, Adele; Brenton, James D

2011-04-01

Although aberrant methylation of key genes in the progression of colorectal neoplasia has been reported, no model-based analysis of the incremental changes through the intermediate adenoma stage has been described. In addition, the biological drivers for these methylation changes have yet to be defined. Linear mixed-effects modelling was used in this study to understand the onset and patterns of the methylation changes of SFRP2, IGF2 DMR0, H19, LINE-1 and a CpG island methylator phenotype (CIMP) marker panel, and they were correlated with DNA methyltransferase 3B (DNMT3B) levels of expression in a sample set representative of colorectal neoplastic progression. Methylation of the above CpG islands was measured using quantitative pyrosequencing assays in 261 tissue samples. This included a prospective collection of 44 colectomy specimens with concurrent normal mucosa, adenoma and invasive cancer tissues. Tissue microarrays from a subset of 64 cases were used for immunohistochemical analysis of DNMT3B expression. It is shown that the onset and pattern of methylation changes during colorectal neoplastic progression are locus dependent. The CIMP marker RUNX3 was the earliest CpG island showing significant change, followed by the CIMP markers NEUROG1 and CACNA1G at the hyperplastic polyp stage. SFRP2 and IGF2 DMR0 showed significant methylation changes at the adenomatous polyp stage, followed by the CIMP markers CDKN2A and hMLH1 at the adenocarcinoma stage. DNMT3B levels of immunohistochemical expression increased significantly (p < 0.001) from normal to hyperplastic and from adenomatous polyps to carcinoma samples. DNMT3B expression correlated positively with SFRP2 methylation (r = 0.42, p < 0.001, 95% CI 0.25 to 0.56), but correlated negatively with IGF2 DMR0 methylation (r = 0.26, p = 0.01, 95% CI -0.45 to -0.05). A subset of the CIMP panel (NEUROG1, CACNA1G and CDKN2A) positively correlated with DNMT3B levels of expression (p < 0.05). Hierarchical epigenetic

Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

PubMed

Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

2002-10-01

We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status.

PubMed

Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E

2012-10-01

The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.

Theoretical investigation of aberrations upon ametropic human eyes

NASA Astrophysics Data System (ADS)

Tan, Bo; Chen, Ying-Ling; Lewis, J. W. L.; Baker, Kevin

2003-11-01

The human eye aberrations are important for visual acuity and ophthalmic diagnostics and surgical procedures. Reported monochromatic aberration data of the normal 20/20 human eyes are scarce. There exist even fewer reports of the relation between ametropic conditions and aberrations. We theoretically investigate the monochromatic and chromatic aberrations of human eyes for refractive errors of -10 to +10 diopters. Schematic human eye models are employed using optical design software for axial, index, and refractive types of ametropia.

Anterior Corneal, Posterior Corneal, and Lenticular Contributions to Ocular Aberrations.

PubMed

Atchison, David A; Suheimat, Marwan; Mathur, Ankit; Lister, Lucas J; Rozema, Jos

2016-10-01

To determine the corneal surfaces and lens contributions to ocular aberrations. There were 61 healthy participants with ages ranging from 20 to 55 years and refractions -8.25 diopters (D) to +3.25 D. Anterior and posterior corneal topographies were obtained with an Oculus Pentacam, and ocular aberrations were obtained with an iTrace aberrometer. Raytracing through models of corneas provided total corneal and surface component aberrations for 5-mm-diameter pupils. Lenticular contributions were given as differences between ocular and corneal aberrations. Theoretical raytracing investigated influence of object distance on aberrations. Apart from defocus, the highest aberration coefficients were horizontal astigmatism, horizontal coma, and spherical aberration. Most correlations between lenticular and ocular parameters were positive and significant, with compensation of total corneal aberrations by lenticular aberrations for 5/12 coefficients. Anterior corneal aberrations were approximately three times higher than posterior corneal aberrations and usually had opposite signs. Corneal topographic centers were displaced from aberrometer pupil centers by 0.32 ± 0.19 mm nasally and 0.02 ± 0.16 mm inferiorly; disregarding corneal decentration relative to pupil center was significant for oblique astigmatism, horizontal coma, and horizontal trefoil. An object at infinity, rather than at the image in the anterior cornea, gave incorrect aberration estimates of the posterior cornea. Corneal and lenticular aberration magnitudes are similar, and aberrations of the anterior corneal surface are approximately three times those of the posterior surface. Corneal decentration relative to pupil center has significant effects on oblique astigmatism, horizontal coma, and horizontal trefoil. When estimating component aberrations, it is important to use correct object/image conjugates and heights at surfaces.

Nodal aberration theory for wild-filed asymmetric optical systems

NASA Astrophysics Data System (ADS)

Chen, Yang; Cheng, Xuemin; Hao, Qun

2016-10-01

Nodal Aberration Theory (NAT) was used to calculate the zero field position in Full Field Display (FFD) for the given aberration term. Aiming at wide-filed non-rotational symmetric decentered optical systems, we have presented the nodal geography behavior of the family of third-order and fifth-order aberrations. Meanwhile, we have calculated the wavefront aberration expressions when one optical element in the system is tilted, which was not at the entrance pupil. By using a three-piece-cellphone lens example in optical design software CodeV, the nodal geography is testified under several situations; and the wavefront aberrations are calculated when the optical element is tilted. The properties of the nodal aberrations are analyzed by using Fringe Zernike coefficients, which are directly related with the wavefront aberration terms and usually obtained by real ray trace and wavefront surface fitting.

Aberration corrected STEM by means of diffraction gratings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linck, Martin; Ercius, Peter A.; Pierce, Jordan S.

In the past 15 years, the advent of aberration correction technology in electron microscopy has enabled materials analysis on the atomic scale. This is made possible by precise arrangements of multipole electrodes and magnetic solenoids to compensate the aberrations inherent to any focusing element of an electron microscope. In this paper, we describe an alternative method to correct for the spherical aberration of the objective lens in scanning transmission electron microscopy (STEM) using a passive, nanofabricated diffractive optical element. This holographic device is installed in the probe forming aperture of a conventional electron microscope and can be designed to removemore » arbitrarily complex aberrations from the electron's wave front. In this work, we show a proof-of-principle experiment that demonstrates successful correction of the spherical aberration in STEM by means of such a grating corrector (GCOR). Our GCOR enables us to record aberration-corrected high-resolution high-angle annular dark field (HAADF-) STEM images, although yet without advancement in probe current and resolution. Finally, improvements in this technology could provide an economical solution for aberration-corrected high-resolution STEM in certain use scenarios.« less

Aberration corrected STEM by means of diffraction gratings

DOE PAGES

Linck, Martin; Ercius, Peter A.; Pierce, Jordan S.; ...

2017-06-12

In the past 15 years, the advent of aberration correction technology in electron microscopy has enabled materials analysis on the atomic scale. This is made possible by precise arrangements of multipole electrodes and magnetic solenoids to compensate the aberrations inherent to any focusing element of an electron microscope. In this paper, we describe an alternative method to correct for the spherical aberration of the objective lens in scanning transmission electron microscopy (STEM) using a passive, nanofabricated diffractive optical element. This holographic device is installed in the probe forming aperture of a conventional electron microscope and can be designed to removemore » arbitrarily complex aberrations from the electron's wave front. In this work, we show a proof-of-principle experiment that demonstrates successful correction of the spherical aberration in STEM by means of such a grating corrector (GCOR). Our GCOR enables us to record aberration-corrected high-resolution high-angle annular dark field (HAADF-) STEM images, although yet without advancement in probe current and resolution. Finally, improvements in this technology could provide an economical solution for aberration-corrected high-resolution STEM in certain use scenarios.« less

Aberration correction for charged particle lithography

NASA Astrophysics Data System (ADS)

Munro, Eric; Zhu, Xieqing; Rouse, John A.; Liu, Haoning

2001-12-01

At present, the throughput of projection-type charge particle lithography systems, such as PREVAIL and SCALPEL, is limited primarily by the combined effects of field curvature in the projection lenses and Coulomb interaction in the particle beam. These are fundamental physical limitations, inherent in charged particle optics, so there seems little scope for significantly improving the design of such systems, using conventional rotationally symmetric electron lenses. This paper explores the possibility of overcoming the field aberrations of round electron lense, by using a novel aberration corrector, proposed by Professor H. Rose of University of Darmstadt, called a hexapole planator. In this scheme, a set of round lenses is first used to simultaneously correct distortion and coma. The hexapole planator is then used to correct the field curvature and astigmatism, and to create a negative spherical aberration. The size of the transfer lenses around the planator can then be adjusted to zero the residual spherical aberration. In a way, an electron optical projection system is obtained that is free of all primary geometrical aberrations. In this paper, the feasibility of this concept has been studied with a computer simulation. The simulations verify that this scheme can indeed work, for both electrostatic and magnetic projection systems. Two design studies have been carried out. The first is for an electrostatic system that could be used for ion beam lithography, and the second is for a magnetic projection system for electron beam lithography. In both cases, designs have been achieved in which all primary third-order geometrical aberrations are totally eliminated.

Aberration Compensation in Aplanatic Solid Immersion Lens Microscopy

DTIC Science & Technology

2013-11-08

model and ray tracing software ( Zemax ) to understand how much aberrations are in the system and how much can be compensated by the DM. Subsequently...aberration. Table 2 shows the Zemax simulation on this particular case. With aberration compensation, the finest resolvable group is at 252 nm

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines

PubMed Central

Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura

2013-01-01

The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer. PMID:24149212

Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines.

PubMed

Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura

2013-12-01

The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer.

Generation of Adaptive Gait Patterns for Quadruped Robot with CPG Network including Motor Dynamic Model

NASA Astrophysics Data System (ADS)

Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu

This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.

Rooting Out Aberrant Behavior in Training.

ERIC Educational Resources Information Center

Kokalis, Jerry, Jr.; Paquin, Dave

1989-01-01

Discusses aberrant, or disruptive, behavior in an industrial/business, classroom-based, instructor-led training setting. Three examples of aberrant behavior are described, typical case studies are provided for each, and preventive (long-term) and corrective (on-the-spot) strategies for dealing with the problems are discussed. (LRW)

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine

Human eyes do not need monochromatic aberrations for dynamic accommodation.

PubMed

Bernal-Molina, Paula; Marín-Franch, Iván; Del Águila-Carrasco, Antonio J; Esteve-Taboada, Jose J; López-Gil, Norberto; Kruger, Philip B; Montés-Micó, Robert

2017-09-01

To determine if human accommodation uses the eye's own monochromatic aberrations to track dynamic accommodative stimuli. Wavefront aberrations were measured while subjects monocularly viewed a monochromatic Maltese cross moving sinusoidally around 2D of accommodative demand with 1D amplitude at 0.2 Hz. The amplitude and phase (delay) of the accommodation response were compared to the actual vergence of the stimulus to obtain gain and temporal phase, calculated from wavefront aberrations recorded over time during experimental trials. The tested conditions were as follows: Correction of all the subject's aberrations except defocus (C); Correction of all the subject's aberrations except defocus and habitual second-order astigmatism (AS); Correction of all the subject's aberrations except defocus and odd higher-order aberrations (HOAs); Correction of all the subject's aberrations except defocus and even HOAs (E); Natural aberrations of the subject's eye, i.e., the adaptive-optics system only corrected the optical system's aberrations (N); Correction of all the subject's aberrations except defocus and fourth-order spherical aberration (SA). The correction was performed at 20 Hz and each condition was repeated six times in randomised order. Average gain (±2 standard errors of the mean) varied little across conditions; between 0.55 ± 0.06 (SA), and 0.62 ± 0.06 (AS). Average phase (±2 standard errors of the mean) also varied little; between 0.41 ± 0.02 s (E), and 0.47 ± 0.02 s (O). After Bonferroni correction, no statistically significant differences in gain or phase were found in the presence of specific monochromatic aberrations or in their absence. These results show that the eye's monochromatic aberrations are not necessary for accommodation to track dynamic accommodative stimuli. © 2017 The Authors. Ophthalmic and Physiological Optics published by John Wiley & Sons Ltd on behalf of College of Optometrists.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

Third-rank chromatic aberrations of electron lenses.

PubMed

Liu, Zhixiong

2018-02-01

In this paper the third-rank chromatic aberration coefficients of round electron lenses are analytically derived and numerically calculated by Mathematica. Furthermore, the numerical results are cross-checked by the differential algebraic (DA) method, which verifies that all the formulas for the third-rank chromatic aberration coefficients are completely correct. It is hoped that this work would be helpful for further chromatic aberration correction in electron microscopy. Copyright © 2017 Elsevier B.V. All rights reserved.

18q loss of heterozygosity in microsatellite stable colorectal cancer is correlated with CpG island methylator phenotype-negative (CIMP-0) and inversely with CIMP-low and CIMP-high.

PubMed

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Ohnishi, Mutsuko; Fuchs, Charles S

2007-05-02

The CpG island methylator phenotype (CIMP) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer, associated with microsatellite instability-high (MSI-high) and BRAF mutations. 18q loss of heterozygosity (LOH) commonly present in colorectal cancer with chromosomal instability (CIN) is associated with global hypomethylation in tumor cell. A recent study has shown an inverse correlation between CIN and CIMP (determined by MINTs, p16, p14 and MLH1 methylation) in colorectal cancer. However, no study has examined 18q LOH in relation to CIMP-high, CIMP-low (less extensive promoter methylation) and CIMP-0 (CIMP-negative), determined by quantitative DNA methylation analysis. Utilizing MethyLight technology (real-time PCR), we quantified DNA methylation in 8 CIMP-specific promoters {CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1} in 758 non-MSI-high colorectal cancers obtained from two large prospective cohorts. Using four 18q microsatellite markers (D18S55, D18S56, D18S67 and D18S487) and stringent criteria for 18q LOH, we selected 374 tumors (236 LOH-positive tumors with > or = 2 markers showing LOH; and 138 LOH-negative tumors with > or = 3 informative markers and no LOH). CIMP-0 (0/8 methylated promoters) was significantly more common in 18q LOH-positive tumors (59% = 139/236, p = 0.002) than 18q LOH-negative tumors (44% = 61/138), while CIMP-low/high (1/8-8/8 methylated promoters) was significantly more common (56%) in 18q LOH-negative tumors than 18q LOH-positive tumors (41%). These relations persisted after stratification by sex, location, or the status of MSI, p53 expression (by immunohistochemistry), or KRAS/BRAF mutation. 18q LOH is correlated positively with CIMP-0 and inversely with CIMP-low and CIMP-high. Our findings provide supporting evidence for relationship between CIMP-0 and 18q LOH as well as a molecular difference between CIMP-0 and CIMP-low in colorectal cancer.

The Distribution of Chromosomal Aberrations in Human Cells Predicted by a Generalized Time-Dependent Model of Radiation-Induced Formation of Aberrations

NASA Technical Reports Server (NTRS)

Ponomarev, Artem L.; George, K.; Cucinotta, F. A.

2011-01-01

New experimental data show how chromosomal aberrations for low- and high-LET radiation are dependent on DSB repair deficiencies in wild-type, AT and NBS cells. We simulated the development of chromosomal aberrations in these cells lines in a stochastic track-structure-dependent model, in which different cells have different kinetics of DSB repair. We updated a previously formulated model of chromosomal aberrations, which was based on a stochastic Monte Carlo approach, to consider the time-dependence of DSB rejoining. The previous version of the model had an assumption that all DSBs would rejoin, and therefore we called it a time-independent model. The chromosomal-aberrations model takes into account the DNA and track structure for low- and high-LET radiations, and provides an explanation and prediction of the statistics of rare and more complex aberrations. We compared the program-simulated kinetics of DSB rejoining to the experimentally-derived bimodal exponential curves of the DSB kinetics. We scored the formation of translocations, dicentrics, acentric and centric rings, deletions, and inversions. The fraction of DSBs participating in aberrations was studied in relation to the rejoining time. Comparisons of simulated dose dependence for simple aberrations to the experimental dose-dependence for HF19, AT and NBS cells will be made.

Harmonic oscillator states in aberration optics

NASA Technical Reports Server (NTRS)

Wolf, Kurt Bernardo

1993-01-01

The states of the three-dimensional quantum harmonic oscillator classify optical aberrations of axis-symmetric systems due to the isomorphism between the two mathematical structures. Cartesian quanta and angular momentum classifications have their corresponding aberration classifications. The operation of concatenation of optical elements introduces a new operation between harmonic oscillator states.

Distortion of ultrashort pulses caused by aberrations

NASA Astrophysics Data System (ADS)

Horváth, Z. L.; Kovács, A. P.; Bor, Zs.

The effect of the primary wave aberrations (spherical aberration, astigmatism and coma) on ultrashort pulses is studied by the Nijboer-Zernike theory. The results of the geometrical and the wave optical treatments are compared.

Aberration-free intraocular lenses - What does this really mean?

PubMed

Langenbucher, Achim; Schröder, Simon; Cayless, Alan; Eppig, Timo

2017-09-01

So-called aberration-free intraocular lenses (IOLs) are well established in modern cataract surgery. Usually, they are designed to perfectly refract a collimated light beam onto the focal point. We show how much aberration can be expected with such an IOL in a convergent light beam such as that found anterior to the human cornea. Additionally, the aberration in a collimated beam is estimated for an IOL that has no aberrations in the convergent beam. The convergent beam is modelled as the pencil of rays corresponding to the spherical wavefront resulting from a typical corneal power of 43m -1 . The IOLs are modelled as infinitely thin phase plates with 20m -1 optical power placed 5mm behind the cornea. Their aberrations are reported in terms of optical path length difference and longitudinal spherical aberration (LSA) of the marginal rays, as well as nominal spherical aberration (SA) calculated based on a Zernike representation of the wavefront-error at the corneal plane within a 6mm aperture. The IOL designed to have no aberrations in a collimated light beam has an optical path length difference of -1.8μm, and LSA of 0.15m -1 in the convergent beam of a typical eye. The corresponding nominal SA is 0.065μm. The IOL designed to have no aberrations in a convergent light beam has an optical path length difference of 1.8μm, and LSA of -0.15m -1 in the collimated beam. An IOL designed to have no aberrations in a collimated light beam will increase the SA of a patient's eye after implantation. Copyright © 2017. Published by Elsevier GmbH.

MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

PubMed

Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

2009-07-16

Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

Significant associations between driver gene mutations and DNA methylation alterations across many cancer types

PubMed Central

Chen, Yun-Ching; Margolin, Gennady

2017-01-01

Recent evidence shows that mutations in several driver genes can cause aberrant methylation patterns, a hallmark of cancer. In light of these findings, we hypothesized that the landscapes of tumor genomes and epigenomes are tightly interconnected. We measured this relationship using principal component analyses and methylation-mutation associations applied at the nucleotide level and with respect to genome-wide trends. We found that a few mutated driver genes were associated with genome-wide patterns of aberrant hypomethylation or CpG island hypermethylation in specific cancer types. In addition, we identified associations between 737 mutated driver genes and site-specific methylation changes. Moreover, using these mutation-methylation associations, we were able to distinguish between two uterine and two thyroid cancer subtypes. The driver gene mutation–associated methylation differences between the thyroid cancer subtypes were linked to differential gene expression in JAK-STAT signaling, NADPH oxidation, and other cancer-related pathways. These results establish that driver gene mutations are associated with methylation alterations capable of shaping regulatory network functions. In addition, the methodology presented here can be used to subdivide tumors into more homogeneous subsets corresponding to underlying molecular characteristics, which could improve treatment efficacy. PMID:29125844

A DERL3-associated defect in the degradation of SLC2A1 mediates the Warburg effect

PubMed Central

Lopez-Serra, Paula; Marcilla, Miguel; Villanueva, Alberto; Ramos-Fernandez, Antonio; Palau, Anna; Leal, Lucía; Wahi, Jessica E.; Setien-Baranda, Fernando; Szczesna, Karolina; Moutinho, Catia; Martinez-Cardus, Anna; Heyn, Holger; Sandoval, Juan; Puertas, Sara; Vidal, August; Sanjuan, Xavier; Martinez-Balibrea, Eva; Viñals, Francesc; Perales, Jose C.; Bramsem, Jesper B.; Ørntoft, Torben F.; Andersen, Claus L.; Tabernero, Josep; McDermott, Ultan; Boxer, Matthew B.; Heiden, Matthew G. Vander; Albar, Juan Pablo; Esteller, Manel

2014-01-01

Cancer cells possess aberrant proteomes that can arise by the disruption of genes involved in physiological protein degradation. Here we demonstrate the presence of promoter CpG island hypermethylation-linked inactivation of DERL3 (Derlin-3), a key gene in the endoplasmic reticulum-associated protein degradation pathway, in human tumours. The restoration of in vitro and in vivo DERL3 activity highlights the tumour suppressor features of the gene. Using the stable isotopic labelling of amino acids in cell culture workflow for differential proteome analysis, we identify SLC2A1 (glucose transporter 1, GLUT1) as a downstream target of DERL3. Most importantly, SLC2A1 overexpression mediated by DERL3 epigenetic loss contributes to the Warburg effect in the studied cells and pinpoints a subset of human tumours with greater vulnerability to drugs targeting glycolysis. PMID:24699711

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

Effect of aberrations in human eye on contrast sensitivity function

NASA Astrophysics Data System (ADS)

Quan, Wei; Wang, Feng-lin; Wang, Zhao-qi

2011-06-01

The quantitative analysis of the effect of aberrations in human eye on vision has important clinical value in the correction of aberrations. The wave-front aberrations of human eyes were measured with the Hartmann-Shack wave-front sensor and modulation transfer function (MTF) was computed from the wave-front aberrations. Contrast sensitivity function (CSF) was obtained from MTF and the retinal aerial image modulation (AIM). It is shown that the 2nd, 3rd, 4th, 5th, 6th Zernike aberrations deteriorate contrast sensitivity function. When the 2nd, 3rd, 4th, 5th, 6th Zernike aberrations are corrected high contrast sensitivity function can be obtained.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

PubMed

Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

Detecting independent and recurrent copy number aberrations using interval graphs.

PubMed

Wu, Hsin-Ta; Hajirasouliha, Iman; Raphael, Benjamin J

2014-06-15

Somatic copy number aberrations SCNAS: are frequent in cancer genomes, but many of these are random, passenger events. A common strategy to distinguish functional aberrations from passengers is to identify those aberrations that are recurrent across multiple samples. However, the extensive variability in the length and position of SCNA: s makes the problem of identifying recurrent aberrations notoriously difficult. We introduce a combinatorial approach to the problem of identifying independent and recurrent SCNA: s, focusing on the key challenging of separating the overlaps in aberrations across individuals into independent events. We derive independent and recurrent SCNA: s as maximal cliques in an interval graph constructed from overlaps between aberrations. We efficiently enumerate all such cliques, and derive a dynamic programming algorithm to find an optimal selection of non-overlapping cliques, resulting in a very fast algorithm, which we call RAIG (Recurrent Aberrations from Interval Graphs). We show that RAIG outperforms other methods on simulated data and also performs well on data from three cancer types from The Cancer Genome Atlas (TCGA). In contrast to existing approaches that employ various heuristics to select independent aberrations, RAIG optimizes a well-defined objective function. We show that this allows RAIG to identify rare aberrations that are likely functional, but are obscured by overlaps with larger passenger aberrations. http://compbio.cs.brown.edu/software. © The Author 2014. Published by Oxford University Press.

Linear phase conjugation for atmospheric aberration compensation

NASA Astrophysics Data System (ADS)

Grasso, Robert J.; Stappaerts, Eddy A.

1998-01-01

Atmospheric induced aberrations can seriously degrade laser performance, greatly affecting the beam that finally reaches the target. Lasers propagated over any distance in the atmosphere suffer from a significant decrease in fluence at the target due to these aberrations. This is especially so for propagation over long distances. It is due primarily to fluctuations in the atmosphere over the propagation path, and from platform motion relative to the intended aimpoint. Also, delivery of high fluence to the target typically requires low beam divergence, thus, atmospheric turbulence, platform motion, or both results in a lack of fine aimpoint control to keep the beam directed at the target. To improve both the beam quality and amount of laser energy delivered to the target, Northrop Grumman has developed the Active Tracking System (ATS); a novel linear phase conjugation aberration compensation technique. Utilizing a silicon spatial light modulator (SLM) as a dynamic wavefront reversing element, ATS undoes aberrations induced by the atmosphere, platform motion or both. ATS continually tracks the target as well as compensates for atmospheric and platform motion induced aberrations. This results in a high fidelity, near-diffraction limited beam delivered to the target.

Wave aberrations in rhesus monkeys with vision-induced ametropias

PubMed Central

Ramamirtham, Ramkumar; Kee, Chea-su; Hung, Li-Fang; Qiao-Grider, Ying; Huang, Juan; Roorda, Austin; Smith, Earl L.

2007-01-01

The purpose of this study was to investigate the relationship between refractive errors and high-order aberrations in infant rhesus monkeys. Specifically, we compared the monochromatic wave aberrations measured with a Shack-Hartman wavefront sensor between normal monkeys and monkeys with vision-induced refractive errors. Shortly after birth, both normal monkeys and treated monkeys reared with optically induced defocus or form deprivation showed a decrease in the magnitude of high-order aberrations with age. However, the decrease in aberrations was typically smaller in the treated animals. Thus, at the end of the lens-rearing period, higher than normal amounts of aberrations were observed in treated eyes, both hyperopic and myopic eyes and treated eyes that developed astigmatism, but not spherical ametropias. The total RMS wavefront error increased with the degree of spherical refractive error, but was not correlated with the degree of astigmatism. Both myopic and hyperopic treated eyes showed elevated amounts of coma and trefoil and the degree of trefoil increased with the degree of spherical ametropia. Myopic eyes also exhibited a much higher prevalence of positive spherical aberration than normal or treated hyperopic eyes. Following the onset of unrestricted vision, the amount of high-order aberrations decreased in the treated monkeys that also recovered from the experimentally induced refractive errors. Our results demonstrate that high-order aberrations are influenced by visual experience in young primates and that the increase in high-order aberrations in our treated monkeys appears to be an optical byproduct of the vision-induced alterations in ocular growth that underlie changes in refractive error. The results from our study suggest that the higher amounts of wave aberrations observed in ametropic humans are likely to be a consequence, rather than a cause, of abnormal refractive development. PMID:17825347

Aberrations in stimulated emission depletion (STED) microscopy

NASA Astrophysics Data System (ADS)

Antonello, Jacopo; Burke, Daniel; Booth, Martin J.

2017-12-01

Like all methods of super-resolution microscopy, stimulated emission depletion (STED) microscopy can suffer from the effects of aberrations. The most important aspect of a STED microscope is that the depletion focus maintains a minimum, ideally zero, intensity point that is surrounded by a region of higher intensity. It follows that aberrations that cause a non-zero value of this minimum intensity are the most detrimental, as they inhibit fluorescence emission even at the centre of the depletion focus. We present analysis that elucidates the nature of these effects in terms of the different polarisation components at the focus for two-dimensional and three-dimensional STED resolution enhancement. It is found that only certain low-order aberration modes can affect the minimum intensity at the Gaussian focus. This has important consequences for the design of adaptive optics aberration correction systems.

3D resolved mapping of optical aberrations in thick tissues

PubMed Central

Zeng, Jun; Mahou, Pierre; Schanne-Klein, Marie-Claire; Beaurepaire, Emmanuel; Débarre, Delphine

2012-01-01

We demonstrate a simple method for mapping optical aberrations with 3D resolution within thick samples. The method relies on the local measurement of the variation in image quality with externally applied aberrations. We discuss the accuracy of the method as a function of the signal strength and of the aberration amplitude and we derive the achievable resolution for the resulting measurements. We then report on measured 3D aberration maps in human skin biopsies and mouse brain slices. From these data, we analyse the consequences of tissue structure and refractive index distribution on aberrations and imaging depth in normal and cleared tissue samples. The aberration maps allow the estimation of the typical aplanetism region size over which aberrations can be uniformly corrected. This method and data pave the way towards efficient correction strategies for tissue imaging applications. PMID:22876353

Primary aberrations in focused radially polarized vortex beams

NASA Astrophysics Data System (ADS)

Biss, David P.; Brown, T. G.

2004-02-01

We study the effect of primary aberrations on the 3-D polarization of the electric field in a focused lowest order radially polarized beam. A full vector diffraction treatment of the focused beams is used. Attention is given to the effects of primary spherical, astigmatic, and comatic aberrations on the local polarization, Strehl ratio, and aberration induced degradation of the longitudinal field at focus

Whole-genome transcription and DNA methylation analysis of peripheral blood mononuclear cells identified aberrant gene regulation pathways in systemic lupus erythematosus.

PubMed

Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen

2016-07-13

CpG sites in the promotor region of the gene. Our study has demonstrated that significant number of differential genes in SLE were involved in IFN, TLR signaling pathways, and inflammatory cytokines. The enrichment of differential genes has been associated with aberrant DNA methylation, which may be relevant to the pathogenesis of SLE. Our observations have laid the groundwork for further diagnostic and mechanistic studies of SLE and LN.

Aberrant DNA methylation patterns of spermatozoa in men with unexplained infertility.

PubMed

Urdinguio, Rocío G; Bayón, Gustavo F; Dmitrijeva, Marija; Toraño, Estela G; Bravo, Cristina; Fraga, Mario F; Bassas, Lluís; Larriba, Sara; Fernández, Agustín F

2015-05-01

Are there DNA methylation alterations in sperm that could explain the reduced biological fertility of male partners from couples with unexplained infertility? DNA methylation patterns, not only at specific loci but also at Alu Yb8 repetitive sequences, are altered in infertile individuals compared with fertile controls. Aberrant DNA methylation of sperm has been associated with human male infertility in patients demonstrating either deficiencies in the process of spermatogenesis or low semen quality. Case and control prospective study. This study compares 46 sperm samples obtained from 17 normospermic fertile men and 29 normospermic infertile patients. Illumina Infinium HD Human Methylation 450K arrays were used to identify genomic regions showing differences in sperm DNA methylation patterns between five fertile and seven infertile individuals. Additionally, global DNA methylation of sperm was measured using the Methylamp Global DNA Methylation Quantification Ultra kit (Epigentek) in 14 samples, and DNA methylation at several repetitive sequences (LINE-1, Alu Yb8, NBL2, D4Z4) measured by bisulfite pyrosequencing in 44 sperm samples. A sperm-specific DNA methylation pattern was obtained by comparing the sperm methylomes with the DNA methylomes of differentiated somatic cells using data obtained from methylation arrays (Illumina 450 K) of blood, neural and glial cells deposited in public databases. In this study we conduct, for the first time, a genome-wide study to identify alterations of sperm DNA methylation in individuals with unexplained infertility that may account for the differences in their biological fertility compared with fertile individuals. We have identified 2752 CpGs showing aberrant DNA methylation patterns, and more importantly, these differentially methylated CpGs were significantly associated with CpG sites which are specifically methylated in sperm when compared with somatic cells. We also found statistically significant (P < 0.001) associations

The Art of Optical Aberrations

NASA Astrophysics Data System (ADS)

Wylde, Clarissa Eileen Kenney

Art and optics are inseparable. Though seemingly opposite disciplines, the combination of art and optics has significantly impacted both culture and science as they are now known. As history has run its course, in the sciences, arts, and their fruitful combinations, optical aberrations have proved to be a problematic hindrance to progress. In an effort to eradicate aberrations the simple beauty of these aberrational forms has been labeled as undesirable and discarded. Here, rather than approach aberrations as erroneous, these beautiful forms are elevated to be the photographic subject in a new body of work, On the Bright Side. Though many recording methods could be utilized, this work was composed on classic, medium-format, photographic film using white-light, Michelson interferometry. The resulting images are both a representation of the true light rays that interacted on the distorted mirror surfaces (data) and the artist's compositional eye for what parts of the interferogram are chosen and displayed. A detailed description of the captivating interdisciplinary procedure is documented and presented alongside the final artwork, CCD digital reference images, and deformable mirror contour maps. This alluring marriage between the arts and sciences opens up a heretofore minimally explored aspect of the inextricable art-optics connection. It additionally provides a fascinating new conversation on the importance of light and optics in photographic composition.

Population dynamics of aberrant chromosome 1 in mice.

PubMed

Sabantsev, I; Spitsin, O; Agulnik, S; Ruvinsky, A

1993-05-01

Natural populations of two semispecies of house mouse, Mus musculus domesticus and M.m. musculus, were found to be polymorphic for an aberrant chromosome 1 bearing a large inserted block of homogeneously staining heterochromatin. Strong meiotic drive for the aberrant chromosome from M.m. musculus was previously observed in heterozygous female mice. There are at least three meiotic drive levels determined by different allelic variants of distorter. Homozygotes had low viability and females showed low fertility. Both homo- and heterozygous males had normal fertility and their segregation patterns did not deviate from normal. Computer simulations were performed of the dynamics of aberrant chromosome 1 in demes and populations. The data demonstrate that a spontaneous mutation (inversion) of an aberrant chromosome 1, once arisen, has a high probability of spreading in a population at high coefficients of meiotic drive and migration. In the long-term, the population attains a stationary state which is determined by the drive level and migration intensity. The state of stable genotypic equilibrium is independent of deme and population size, as well as of the initial concentration of the aberrant chromosome. As populations initially polymorphic for the distorters approach the stationary state, the stronger distorter is eliminated. The frequencies of the aberrant chromosome determined by computer analysis agree well with those obtained for the studied Asian M.m. musculus populations. The evolutionary pathways for the origin and fixation of the aberrant chromosome in natural populations are considered.

Aberration design of zoom lens systems using thick lens modules.

PubMed

Zhang, Jinkai; Chen, Xiaobo; Xi, Juntong; Wu, Zhuoqi

2014-12-20

A systematic approach for the aberration design of a zoom lens system using a thick lens module is presented. Each component is treated as a thick lens module at the beginning of the design. A thick lens module refers to a thick lens component with a real lens structure, like lens materials, lens curvatures, lens thicknesses, and lens interval distances. All nine third-order aberrations of a thick lens component are considered during the design. The relationship of component aberrations in different zoom positions can be approximated from the aberration shift. After minimizing the aberrations of the zoom lens system, the nine third-order aberrations of every lens component can be determined. Then the thick lens structure of every lens component can be determined after optimization according to their first-order properties and third-order aberration targets. After a third optimization for minimum practical third-order aberrations of a zoom lens system, the aberration design using the thick lens module is complete, which provides a practical zoom lens system with thick lens structures. A double-sided telecentric zoom lens system is designed using the thick lens module in this paper, which shows that this method is practical for zoom lens design.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

PubMed

Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

2013-10-01

The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

CpG-island methylation study of liver fluke-related cholangiocarcinoma

PubMed Central

Sriraksa, R; Zeller, C; El-Bahrawy, M A; Dai, W; Daduang, J; Jearanaikoon, P; Chau-in, S; Brown, R; Limpaiboon, T

2011-01-01

Background: Genetic changes have been widely reported in association with cholangiocarcinoma (CCA), while epigenetic changes are poorly characterised. We aimed to further evaluate CpG-island hypermethylation in CCA at candidate loci, which may have potential as diagnostic or prognostic biomarkers. Methods: We analysed methylation of 26 CpG-islands in 102 liver fluke related-CCA and 29 adjacent normal samples using methylation-specific PCR (MSP). Methylation of interest loci was confirmed using pyrosequencing and/or combined bisulfite restriction analysis, and protein expression by immunohistochemistry. Results: A number of CpG-islands (OPCML, SFRP1, HIC1, PTEN and DcR1) showed frequency of hypermethylation in >28% of CCA, but not adjacent normal tissues. The results showed that 91% of CCA were methylated in at least one CpG-island. The OPCML was the most frequently methylated locus (72.5%) and was more frequently methylated in less differentiated CCA. Patients with methylated DcR1 had significantly longer overall survival (Median; 41.7 vs 21.7 weeks, P=0.027). Low-protein expression was found in >70% of CCA with methylation of OPCML or DcR1. Conclusion: Aberrant hypermethylation of certain loci is a common event in liver fluke-related CCA and may potentially contribute to cholangiocarcinogenesis. The OPCML and DcR1 might serve as methylation biomarkers in CCA that can be readily examined by MSP. PMID:21448164

Aberration of a negative ion beam caused by space charge effect.

PubMed

Miyamoto, K; Wada, S; Hatayama, A

2010-02-01

Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

Tracking the Correlation Between CpG Island Methylator Phenotype and Other Molecular Features and Clinicopathological Features in Human Colorectal Cancers: A Systematic Review and Meta-Analysis

PubMed Central

Zong, Liang; Abe, Masanobu; Ji, Jiafu; Zhu, Wei-Guo; Yu, Duonan

2016-01-01

Objectives: The controversy of CpG island methylator phenotype (CIMP) in colorectal cancers (CRCs) persists, despite many studies that have been conducted on its correlation with molecular and clinicopathological features. To drive a more precise estimate of the strength of this postulated relationship, a meta-analysis was performed. Methods: A comprehensive search for studies reporting molecular and clinicopathological features of CRCs stratified by CIMP was performed within the PubMed, EMBASE, and Cochrane Library. CIMP was defined by either one of the three panels of gene-specific CIMP markers (Weisenberger panel, classic panel, or a mixture panel of the previous two) or the genome-wide DNA methylation profile. The associations of CIMP with outcome parameters were estimated using odds ratio (OR) or weighted mean difference (WMD) or hazard ratios (HRs) with 95% confidence interval (CI) for each study using a fixed effects or random effects model. Results: A total of 29 studies involving 9,393 CRC patients were included for analysis. We observed more BRAF mutations (OR 34.87; 95% CI, 22.49–54.06) and microsatellite instability (MSI) (OR 12.85 95% CI, 8.84–18.68) in CIMP-positive vs. -negative CRCs, whereas KRAS mutations were less frequent (OR 0.47; 95% CI, 0.30–0.75). Subgroup analysis showed that only the genome-wide methylation profile-defined CIMP subset encompassed all BRAF-mutated CRCs. As expected, CIMP-positive CRCs displayed significant associations with female (OR 0.64; 95% CI, 0.56–0.72), older age at diagnosis (WMD 2.77; 95% CI, 1.15–4.38), proximal location (OR 6.91; 95% CI, 5.17–9.23), mucinous histology (OR 3.81; 95% CI, 2.93–4.95), and poor differentiation (OR 4.22; 95% CI, 2.52–7.08). Although CIMP did not show a correlation with tumor stage (OR 1.10; 95% CI, 0.82–1.46), it was associated with shorter overall survival (HR 1.73; 95% CI, 1.27–2.37). Conclusions: The meta-analysis highlights that CIMP-positive CRCs take their own

Aberrant regeneration of the third cranial nerve.

PubMed

Shrestha, U D; Adhikari, S

2012-01-01

Aberrant regeneration of the third cranial nerve is most commonly due to its damage by trauma. A ten-month old child presented with the history of a fall from a four-storey building. She developed traumatic third nerve palsy and eventually the clinical features of aberrant regeneration of the third cranial nerve. The adduction of the eye improved over time. She was advised for patching for the strabismic amblyopia as well. Traumatic third nerve palsy may result in aberrant regeneration of the third cranial nerve. In younger patients, motility of the eye in different gazes may improve over time. © NEPjOPH.

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

Hydronephrosis by an Aberrant Renal Artery: A Case Report

PubMed Central

Park, Byoung Seok; Jeong, Taek Kyun; Ma, Seong Kwon; Kim, Soo Wan; Kim, Nam Ho; Choi, Ki Chul; Jeong, Yong Yeon

2003-01-01

Ureteropelvic junction obstruction is usually intrinsic and is most common in children. Aberrant renal arteries are present in about 30% of individuals. Aberrant renal arteries to the inferior pole cross anteriorly to the ureter and may cause hydronephrosis. To the best of our knowledge, although there are some papers about aberrant renal arteries producing ureteropelvic junction obstruction, there is no report of a case which is diagnosed by the new modalities, such as computed tomography angiogram (CTA) or magnetic resonance angiogram (MRA). We describe a 36-year-old woman with right hydronephrosis. Kidney ultrasonogram and excretory urogram revealed right hydronephrosis. CTA and MRA clearly displayed an aberrant renal artery and hydronephrosis. The patient underwent surgical exploration. For the evaluation of hydronephrosis by an aberrant renal artery, use of CTA and MRA is advocated. PMID:12760271

Ocular higher-order aberrations in a school children population.

PubMed

Papamastorakis, George; Panagopoulou, Sophia; Tsilimbaris, Militadis K; Pallikaris, Ioannis G; Plainis, Sotiris

2015-01-01

The primary objective of the study was to explore the statistics of ocular higher-order aberrations in a population of primary and secondary school children. A sample of 557 children aged 10-15 years were selected from two primary and two secondary schools in Heraklion, Greece. Children were classified by age in three subgroups: group I (10.7±0.5 years), group II (12.4±0.5 years) and group III (14.5±0.5 years). Ocular aberrations were measured using a wavefront aberrometer (COAS, AMO Wavefront Sciences, USA) at mesopic light levels (illuminance at cornea was 4lux). Wavefront analysis was achieved for a 5mm pupil. Statistical analysis was carried out for the right eye only. The average coefficient of most high-order aberrations did not differ from zero with the exception of vertical (0.076μm) and horizontal (0.018μm) coma, oblique trefoil (-0.055μm) and spherical aberration (0.018μm). The most prominent change between the three groups was observed for the spherical aberration, which increased from 0.007μm (SE 0.005) in group I to 0.011μm (SE 0.004) in group II and 0.030μm (SE 0.004) in group III. Significant differences were also found for the oblique astigmatism and the third-order coma aberrations. Differences in the low levels of ocular spherical aberration in young children possibly reflect differences in lenticular spherical aberration and relate to the gradient refractive index of the lens. The evaluation of spherical aberration at certain stages of eye growth may help to better understand the underlying mechanisms of myopia development. Copyright © 2014 Spanish General Council of Optometry. Published by Elsevier Espana. All rights reserved.

Ocular higher-order aberrations in a school children population

PubMed Central

Papamastorakis, George; Panagopoulou, Sophia; Tsilimbaris, Militadis K.; Pallikaris, Ioannis G.; Plainis, Sotiris

2014-01-01

Purpose The primary objective of the study was to explore the statistics of ocular higher-order aberrations in a population of primary and secondary school children. Methods A sample of 557 children aged 10–15 years were selected from two primary and two secondary schools in Heraklion, Greece. Children were classified by age in three subgroups: group I (10.7 ± 0.5 years), group II (12.4 ± 0.5 years) and group III (14.5 ± 0.5 years). Ocular aberrations were measured using a wavefront aberrometer (COAS, AMO Wavefront Sciences, USA) at mesopic light levels (illuminance at cornea was 4 lux). Wavefront analysis was achieved for a 5 mm pupil. Statistical analysis was carried out for the right eye only. Results The average coefficient of most high-order aberrations did not differ from zero with the exception of vertical (0.076 μm) and horizontal (0.018 μm) coma, oblique trefoil (−0.055 μm) and spherical aberration (0.018 μm). The most prominent change between the three groups was observed for the spherical aberration, which increased from 0.007 μm (SE 0.005) in group I to 0.011 μm (SE 0.004) in group II and 0.030 μm (SE 0.004) in group III. Significant differences were also found for the oblique astigmatism and the third-order coma aberrations. Conclusions Differences in the low levels of ocular spherical aberration in young children possibly reflect differences in lenticular spherical aberration and relate to the gradient refractive index of the lens. The evaluation of spherical aberration at certain stages of eye growth may help to better understand the underlying mechanisms of myopia development. PMID:25288226

Generalized Alvarez lens for correction of laser aberrations

DOE Office of Scientific and Technical Information (OSTI.GOV)

LaFortune, K N

2004-12-02

The Alvarez lens (US Patent No. 3,305,294 [1]) is a compact aberration corrector. The original design emphasized in the patent consists of a pair of adjacent optical elements that provide a variable focus. A lens system with a variable effective focal length is nothing new. Such systems are widely used in cameras, for example. It is the compactness and simplicity of operation that is the key advantage of the Alvarez lens. All of the complexity is folded into the design and fabrication of the optical elements. As mentioned in the Alvarez patent [1] and elaborated upon in Palusinski et al.more » [2], if one is willing to fold even more complexity into the optical elements, it is possible to correct higher-order aberrations as well. There is no theoretical limit to the number or degree of wavefront distortions that can be corrected. The only limitation is that there must be a fixed relative magnitude of the aberrations. Independent correction of each component of the higher-order aberrations can not be performed without additional elements and degrees of freedom [3]. Under some circumstances, coupling may be observed between different aberrations. This can be mitigated with the appropriate choice of design parameters. New methods are available today that increase the practicality of making higher-order aberration correctors [4,5,6].« less

Statistical estimation of ultrasonic propagation path parameters for aberration correction.

PubMed

Waag, Robert C; Astheimer, Jeffrey P

2005-05-01

Parameters in a linear filter model for ultrasonic propagation are found using statistical estimation. The model uses an inhomogeneous-medium Green's function that is decomposed into a homogeneous-transmission term and a path-dependent aberration term. Power and cross-power spectra of random-medium scattering are estimated over the frequency band of the transmit-receive system by using closely situated scattering volumes. The frequency-domain magnitude of the aberration is obtained from a normalization of the power spectrum. The corresponding phase is reconstructed from cross-power spectra of subaperture signals at adjacent receive positions by a recursion. The subapertures constrain the receive sensitivity pattern to eliminate measurement system phase contributions. The recursion uses a Laplacian-based algorithm to obtain phase from phase differences. Pulse-echo waveforms were acquired from a point reflector and a tissue-like scattering phantom through a tissue-mimicking aberration path from neighboring volumes having essentially the same aberration path. Propagation path aberration parameters calculated from the measurements of random scattering through the aberration phantom agree with corresponding parameters calculated for the same aberrator and array position by using echoes from the point reflector. The results indicate the approach describes, in addition to time shifts, waveform amplitude and shape changes produced by propagation through distributed aberration under realistic conditions.

Icariin may benefit the mesenchymal stem cells of patients with steroid-associated osteonecrosis by ABCB1-promoter demethylation: a preliminary study.

PubMed

Sun, Z-B; Wang, J-W; Xiao, H; Zhang, Q-S; Kan, W-S; Mo, F-B; Hu, S; Ye, S-N

2015-01-01

In this study, we found out a previously undefined function of icariin which restored the dynamic balance between osteogenic and adipogenic differentiation of mesenchymal stem cells (MSCs) in patients with osteonecrosis of femoral head (ONFH) via ABCB1-promoter demethylation. These findings provided important information regarding potential implication of icariin targeting epigenetic changes for the treatment of steroid -associated ONFH. Here, we investigated whether icariin can also exert a beneficial role in the reactivation of MSCs in the patients with steroid-associated ONFH via ABCB1-promoter demethylation. Bone marrow was collected from the proximal femur in patients with steroid-associated ONFH (n = 20) and patients with new femoral neck fractures (n = 22), and then MSCs were isolated. We investigated cell viability, intracellular reactive oxygen species (ROS) level, mitochondrial membrane potential (MMP), P-glycoprotein (P-gp) activity, the transcript levels of ABCB1 and oxidative stress-related genes, methylation extent at CpG islands of ABCB1 promoter, and osteogenic and adipogenic differentiation ability of MSCs from the femoral neck fractures group and from the steroid-associated ONFH group treated with or without icariin. We observed that MSCs from the steroid-associated ONFH group showed reduced proliferation ability, elevated ROS level, depressed MMP, weakened osteogenesis, and enhanced adipogenesis while low P-gp activity, transcription level of ABCB1, and oxidative stress-related genes as well as aberrant CpG islands hypermethylation of ABCB1 were also noted in steroid-associated ONFH group. Treatment with icariin obviously induced de novo P-gp expression, decreased oxidative stress, and promoted osteogenesis. Icariin may be a potential drug targeting epigenetic changes for the treatment of steroid-associated ONFH.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

PubMed Central

Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

PubMed

László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

2016-08-01

The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

DTIC Science & Technology

2012-09-01

tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

Aberrant growth of maxillary canine teeth in male babirusa (genus Babyrousa).

PubMed

Macdonald, Alastair A

2018-04-01

A worldwide survey of babirusa skulls curated in museum and private collections located 431 that were from adult males and had retained at least one maxillary canine tooth. Eighty-three of these skulls were identified as exhibiting aberrant maxillary canine tooth growth. Twenty-four of the skulls represented babirusa from Buru and the Sula Islands, and forty-five skulls represented babirusa from Sulawesi and the Togian Islands. The remaining series of fourteen babirusa skulls originally came from zoo animals. Fifteen skulls showed anomalous alveolar and tooth rotation in a median plane. Twenty-nine skulls had maxillary canine teeth that did not grow symmetrically towards the median plane of the cranium. Fourteen skulls showed evidence that the tips of one or both maxillary canine teeth had eroded the nasal bones. Twenty-one skulls had maxillary canine teeth that had eroded the frontal bones. The teeth of two skulls had eroded a parietal bone. One skull had two maxillary canines arising from an adjacent pair of alveoli on the left side of the cranium. Three skulls exhibited alveoli with no formed maxillary canine teeth in them. Analysis suggested that approximately 12% of the adult male babirusa in the wild experience erosion of the cranial bony tissues as a result of maxillary canine tooth growth. There was no skeletal evidence that maxillary canine teeth penetrate the eye. Crown Copyright © 2018. Published by Elsevier Masson SAS. All rights reserved.

Influence of Misalignment on High-Order Aberration Correction for Normal Human Eyes

NASA Astrophysics Data System (ADS)

Zhao, Hao-Xin; Xu, Bing; Xue, Li-Xia; Dai, Yun; Liu, Qian; Rao, Xue-Jun

2008-04-01

Although a compensation device can correct aberrations of human eyes, the effect will be degraded by its misalignment, especially for high-order aberration correction. We calculate the positioning tolerance of correction device for high-order aberrations, and within what degree the correcting effect is better than low-order aberration (defocus and astigmatism) correction. With fixed certain misalignment within the positioning tolerance, we calculate the residual wavefront rms aberration of the first-6 to first-35 terms along with the 3rd-5th terms of aberrations corrected, and the combined first-13 terms of aberrations are also studied under the same quantity of misalignment. However, the correction effect of high-order aberrations does not meliorate along with the increase of the high-order terms under some misalignment, moreover, some simple combined terms correction can achieve similar result as complex combinations. These results suggest that it is unnecessary to correct too much the terms of high-order aberrations which are difficult to accomplish in practice, and gives confidence to correct high-order aberrations out of the laboratory.

Orthonormal aberration polynomials for anamorphic optical imaging systems with rectangular pupils.

PubMed

Mahajan, Virendra N

2010-12-20

The classical aberrations of an anamorphic optical imaging system, representing the terms of a power-series expansion of its aberration function, are separable in the Cartesian coordinates of a point on its pupil. We discuss the balancing of a classical aberration of a certain order with one or more such aberrations of lower order to minimize its variance across a rectangular pupil of such a system. We show that the balanced aberrations are the products of two Legendre polynomials, one for each of the two Cartesian coordinates of the pupil point. The compound Legendre polynomials are orthogonal across a rectangular pupil and, like the classical aberrations, are inherently separable in the Cartesian coordinates of the pupil point. They are different from the balanced aberrations and the corresponding orthogonal polynomials for a system with rotational symmetry but a rectangular pupil.

DNA methylation screening of primary prostate tumors identifies SRD5A2 and CYP11A1 as candidate markers for assessing risk of biochemical recurrence.

PubMed

Horning, Aaron M; Awe, Julius A; Wang, Chiou-Miin; Liu, Joseph; Lai, Zhao; Wang, Vickie Yao; Jadhav, Rohit R; Louie, Anna D; Lin, Chun-Lin; Kroczak, Tad; Chen, Yidong; Jin, Victor X; Abboud-Werner, Sherry L; Leach, Robin J; Hernandez, Javior; Thompson, Ian M; Saranchuk, Jeff; Drachenberg, Darrel; Chen, Chun-Liang; Mai, Sabine; Huang, Tim Hui-Ming

2015-11-01

Altered DNA methylation in CpG islands of gene promoters has been implicated in prostate cancer (PCa) progression and can be used to predict disease outcome. In this study, we determine whether methylation changes of androgen biosynthesis pathway (ABP)-related genes in patients' plasma cell-free DNA (cfDNA) can serve as prognostic markers for biochemical recurrence (BCR). Methyl-binding domain capture sequencing (MBDCap-seq) was used to identify differentially methylated regions (DMRs) in primary tumors of patients who subsequently developed BCR or not, respectively. Methylation pyrosequencing of candidate loci was validated in cfDNA samples of 86 PCa patients taken at and/or post-radical prostatectomy (RP) using univariate and multivariate prediction analyses. Putative DMRs in 13 of 30 ABP-related genes were found between tumors of BCR (n = 12) versus no evidence of disease (NED) (n = 15). In silico analysis of The Cancer Genome Atlas data confirmed increased DNA methylation of two loci-SRD5A2 and CYP11A1, which also correlated with their decreased expression, in tumors with subsequent BCR development. Their aberrant cfDNA methylation was also associated with detectable levels of PSA taken after patients' post-RP. Multivariate analysis of the change in cfDNA methylation at all of CpG sites measured along with patient's treatment history predicted if a patient will develop BCR with 77.5% overall accuracy. Overall, increased DNA methylation of SRD5A2 and CYP11A1 related to androgen biosynthesis functions may play a role in BCR after patients' RP. The correlation between aberrant cfDNA methylation and detectable PSA in post-RP further suggests their utility as predictive markers for PCa recurrence. . © 2015 Wiley Periodicals, Inc.

G-cimp status prediction of glioblastoma samples using mRNA expression data.

PubMed

Baysan, Mehmet; Bozdag, Serdar; Cam, Margaret C; Kotliarova, Svetlana; Ahn, Susie; Walling, Jennifer; Killian, Jonathan K; Stevenson, Holly; Meltzer, Paul; Fine, Howard A

2012-01-01

Glioblastoma Multiforme (GBM) is a tumor with high mortality and no known cure. The dramatic molecular and clinical heterogeneity seen in this tumor has led to attempts to define genetically similar subgroups of GBM with the hope of developing tumor specific therapies targeted to the unique biology within each of these subgroups. Recently, a subset of relatively favorable prognosis GBMs has been identified. These glioma CpG island methylator phenotype, or G-CIMP tumors, have distinct genomic copy number aberrations, DNA methylation patterns, and (mRNA) expression profiles compared to other GBMs. While the standard method for identifying G-CIMP tumors is based on genome-wide DNA methylation data, such data is often not available compared to the more widely available gene expression data. In this study, we have developed and evaluated a method to predict the G-CIMP status of GBM samples based solely on gene expression data.

G-Cimp Status Prediction Of Glioblastoma Samples Using mRNA Expression Data

PubMed Central

Baysan, Mehmet; Bozdag, Serdar; Cam, Margaret C.; Kotliarova, Svetlana; Ahn, Susie; Walling, Jennifer; Killian, Jonathan K.; Stevenson, Holly; Meltzer, Paul; Fine, Howard A.

2012-01-01

Glioblastoma Multiforme (GBM) is a tumor with high mortality and no known cure. The dramatic molecular and clinical heterogeneity seen in this tumor has led to attempts to define genetically similar subgroups of GBM with the hope of developing tumor specific therapies targeted to the unique biology within each of these subgroups. Recently, a subset of relatively favorable prognosis GBMs has been identified. These glioma CpG island methylator phenotype, or G-CIMP tumors, have distinct genomic copy number aberrations, DNA methylation patterns, and (mRNA) expression profiles compared to other GBMs. While the standard method for identifying G-CIMP tumors is based on genome-wide DNA methylation data, such data is often not available compared to the more widely available gene expression data. In this study, we have developed and evaluated a method to predict the G-CIMP status of GBM samples based solely on gene expression data. PMID:23139755

Epigenetics in Prostate Cancer

PubMed Central

Albany, Costantine; Alva, Ajjai S.; Aparicio, Ana M.; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M.

2011-01-01

Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a “normal” epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases. PMID:22191037

Epigenetics in prostate cancer.

PubMed

Albany, Costantine; Alva, Ajjai S; Aparicio, Ana M; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M

2011-01-01

Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a "normal" epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases.

Theory of aberration fields for general optical systems with freeform surfaces.

PubMed

Fuerschbach, Kyle; Rolland, Jannick P; Thompson, Kevin P

2014-11-03

This paper utilizes the framework of nodal aberration theory to describe the aberration field behavior that emerges in optical systems with freeform optical surfaces, particularly φ-polynomial surfaces, including Zernike polynomial surfaces, that lie anywhere in the optical system. If the freeform surface is located at the stop or pupil, the net aberration contribution of the freeform surface is field constant. As the freeform optical surface is displaced longitudinally away from the stop or pupil of the optical system, the net aberration contribution becomes field dependent. It is demonstrated that there are no new aberration types when describing the aberration fields that arise with the introduction of freeform optical surfaces. Significantly it is shown that the aberration fields that emerge with the inclusion of freeform surfaces in an optical system are exactly those that have been described by nodal aberration theory for tilted and decentered optical systems. The key contribution here lies in establishing the field dependence and nodal behavior of each freeform term that is essential knowledge for effective application to optical system design. With this development, the nodes that are distributed throughout the field of view for each aberration type can be anticipated and targeted during optimization for the correction or control of the aberrations in an optical system with freeform surfaces. This work does not place any symmetry constraints on the optical system, which could be packaged in a fully three dimensional geometry, without fold mirrors.

Isabela Island, Galapagos Islands

NASA Image and Video Library

1996-01-20

STS072-732-072 (11-20 Jan. 1996) --- Three of the nineteen Galapagos Islands are visible in this image, photographed from the Earth-orbiting Space Shuttle Endeavour. The Galapagos Islands are located 600 miles (1,000 kilometers) to the west of Ecuador. The largest of the islands, Isabela, is at center (north is toward the upper right corner). The numerous circular features on the island, highlighted by clouds, are volcanoes. The Galapagos Islands owe their existence to a hot spot, or persistent heat source in the mantle, which also is located over a rift, or place where plates are separating and new crust is being created. The rift is located between the Cocos and Nazca Plates. The dark linear features on the islands are lava flows from past eruptions. The island to the left of Isabela is Fernandina, while the island to the right is San Salvador. The Galapagos Islands were visited by the English naturalist Charles Darwin in 1835.

Image based method for aberration measurement of lithographic tools

NASA Astrophysics Data System (ADS)

Xu, Shuang; Tao, Bo; Guo, Yongxing; Li, Gongfa

2018-01-01

Information of lens aberration of lithographic tools is important as it directly affects the intensity distribution in the image plane. Zernike polynomials are commonly used for a mathematical description of lens aberrations. Due to the advantage of lower cost and easier implementation of tools, image based measurement techniques have been widely used. Lithographic tools are typically partially coherent systems that can be described by a bilinear model, which entails time consuming calculations and does not lend a simple and intuitive relationship between lens aberrations and the resulted images. Previous methods for retrieving lens aberrations in such partially coherent systems involve through-focus image measurements and time-consuming iterative algorithms. In this work, we propose a method for aberration measurement in lithographic tools, which only requires measuring two images of intensity distribution. Two linear formulations are derived in matrix forms that directly relate the measured images to the unknown Zernike coefficients. Consequently, an efficient non-iterative solution is obtained.

Minimum change in spherical aberration that can be perceived

PubMed Central

Manzanera, Silvestre; Artal, Pablo

2016-01-01

It is important to know the visual sensitivity to optical blur from both a basic science perspective and a practical point of view. Of particular interest is the sensitivity to blur induced by spherical aberration because it is being used to increase depth of focus as a component of a presbyopic solution. Using a flicker detection-based procedure implemented on an adaptive optics visual simulator, we measured the spherical aberration thresholds that produce just-noticeable differences in perceived image quality. The thresholds were measured for positive and negative values of spherical aberration, for best focus and + 0.5 D and + 1.0 D of defocus. At best focus, the SA thresholds were 0.20 ± 0.01 µm and −0.17 ± 0.03 µm for positive and negative spherical aberration respectively (referred to a 6-mm pupil). These experimental values may be useful in setting spherical aberration permissible levels in different ophthalmic techniques. PMID:27699113

Surface geometry and optical aberrations of ex-vivo crystalline lenses

NASA Astrophysics Data System (ADS)

Bueno, Juan M.; Schwarz, Christina; Acosta, Eva; Artal, Pablo

2010-02-01

The shape of the surfaces of ex-vivo human crystalline lenses was measured using a shadow photography technique. From these data, the back-focal distance and the contribution of each surface to the main optical aberrations of the lenses were estimated. The aberrations of the lenses were measured separately with two complementary techniques: a Hartmann-Shack wavefront sensor and a point-diffraction interferometer. A laser scanning set-up was also used to measure the actual back-focal length as well as the phase aberration in one meridian section of the lenses. Measured and predicted back-focal length agreed well within the experimental errors. The lens aberrations computed with a ray-tracing approach from the measured surfaces and geometrical data only reproduce quantitatively the measured aberrations.

Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

PubMed

Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

2014-09-01

BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Genotoxicity of mercury used in chromosome aberration tests.

PubMed

Akiyama, M; Oshima, H; Nakamura, M

2001-01-01

The purpose of this study was to investigate the genotoxic effects of Hg released from dental amalgams. The chromosome aberration test was conducted using original extracts and their diluted solutions of conventional type amalgam and high copper amalgam. The concentrations of Hg, Cu and Ag in the original extract of high copper amalgam were 17.64, 7.97 and 43.90 microM, respectively. Those in the original extract of conventional type amalgam were 20.63, 7.87 and 14.79 microM, respectively. 10 and 30 microM Hg(2+) were also used for comparison. The frequency of chromosome aberrations was below 5% with 0 microM Hg(2+) and with a triple dilution of high copper amalgam extract, containing 5.88 microM Hg, 14.63 microM Cu and 2.65 microM Ag. However, 9.5% of the cells showed chromosome aberrations with a quadruple dilution of conventional type amalgam, containing 5.15 microM Hg, 3.69 microM Cu and 1.96 microM Ag. The amount of Hg in the quadruple dilution of conventional type amalgam was less than that in the triple dilution of high copper amalgam extract and 10 microM Hg(2+). A concentration of 30 microM Hg(2+) caused 34.5% of the cells to show chromosome aberrations while with a two-thirds dilution of high copper amalgam extract, containing 11.76 microM Hg, 29.26 microM Cu and 5.31 microM Ag, 58.5% of the cells showed chromosome aberrations. A two-thirds dilution of high copper amalgam extract induced more chromosome aberrations than 30 microM Hg(2+), although the amount of Hg was less than 30 microM Hg(2+). A triple dilution of conventional type amalgam extract, original extracts of conventional type amalgam and high copper amalgam and 100 microM Hg(2+) were induced few metaphases. It was revealed that the conventional type amalgam induced chromosome aberrations with quadruple dilution where cell viability was about 80% and that the high copper amalgam induced a high level of chromosome aberrations with the two-thirds dilution. The effects of low level Hg on humans

Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

PubMed

Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

2016-07-01

Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

PubMed

Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

2017-01-01

Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

Identification of the human homolog of the imprinted mouse Air non-coding RNA

PubMed Central

Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

2010-01-01

Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

PubMed

Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

2010-02-04

The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

PubMed Central

Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

2010-01-01

Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

Optical aberrations, retinal image quality and eye growth: Experimentation and modeling

NASA Astrophysics Data System (ADS)

Tian, Yibin

2007-12-01

Retinal image quality is important for normal eye growth. Optical aberrations are of interest for two reasons: first, they degrade retinal images; second, they might provide some cues to defocus. Higher than normal ocular aberrations have been previously associated with human myopia. However, these studies were cross-sectional in design, and only reported aberrations in terms of root mean square (RMS) errors of Zernike coefficients, a poor metric of optical quality. This dissertation presents results from investigations of ocular optical aberrations, retinal image quality and eye growth in chicks and humans. A number of techniques were utilized, including Shack-Hartmann aberrometry, high-frequency A-scan ultrasonography, ciliary nerve section (CNX), photorefractive keratectomy (PRK) as well as computer simulations and modeling. A technique to extract light scatter information from Shack-Hartmann images was also developed. The main findings of the dissertation are summarized below. In young chicks, most ocular aberrations decreased with growth in both normal and CNX eyes, and there were diurnal fluctuations in some aberrations. Modeling suggested active reduction in higher order aberrations (HOAs) during early development. Although CNX eyes manifested greater than normal HOAs, they showed near normal growth. Retinal image degradation varied greatly among individual eyes post-PRK in young chicks. Including light scatter information into analyses of retinal image quality better estimated the latter. Albino eyes showed more severe retinal image degradation than normal eyes, due to increased optical aberrations and light scatter, but their growth was similar to those of normal eyes, implying that they are relatively insensitive to retina image quality. Although the above results questioned the influence of optical aberrations on early ocular growth, some optical quality metrics, derived from optical aberrations data, could predict how much the eyes of young chicks

Characterization of tumor cells and stem cells by differential nuclear methylation imaging

NASA Astrophysics Data System (ADS)

Tajbakhsh, Jian; Wawrowsky, Kolja A.; Gertych, Arkadiusz; Bar-Nur, Ori; Vishnevsky, Eugene; Lindsley, Erik H.; Farkas, Daniel L.

2008-02-01

DNA methylation plays a key role in cellular differentiation. Aberrant global methylation patterns are associated with several cancer types, as a result of changes in long-term activation status of up to 50% of genes, including oncogenes and tumor-suppressor genes, which are regulated by methylation and demethylation of promoter region CpG dinucleotides (CpG islands). Furthermore, DNA methylation also occurs in nonisland CpG sites (> 95% of the genome), present once per 80 dinucleotides on average. Nuclear DNA methylation increases during the course of cellular differentiation while cancer cells usually show a net loss in methylation. Given the large dynamic range in DNA methylation load, the methylation pattern of a cell can provide a valuable distinction as to its status during differentiation versus the disease state. By applying immunofluorescence, confocal microscopy and 3D image analysis we assessed the potential of differential nuclear distribution of methylated DNA to be utilized as a biomarker to characterize cells during development and when diseased. There are two major fields that may immediately benefit from this development: (1) the search for factors that contribute to pluripotency and cell fate in human embryonic stem cell expansion and differentiation, and (2) the characterization of tumor cells with regard to their heterogeneity in molecular composition and behavior. We performed topological analysis of the distribution of methylated CpG-sites (MeC) versus heterochromatin. This innovative approach revealed significant differences in colocalization patterns of MeC and heterochromatin-derived signals between undifferentiated and differentiated human embryonic stem cells, as well as untreated AtT20 mouse pituitary tumor cells compared to a subpopulation of these cells treated with 5-azacytidine for 48 hours.

DNA methylation analysis of phenotype specific stratified Indian population.

PubMed

Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

2015-05-08

DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

Correcting highly aberrated eyes using large-stroke adaptive optics.

PubMed

Sabesan, Ramkumar; Ahmad, Kamran; Yoon, Geunyoung

2007-11-01

To investigate the optical performance of a large-stroke deformable mirror in correcting large aberrations in highly aberrated eyes. A large-stroke deformable mirror (Mirao 52D; Imagine Eyes) and a Shack-Hartmann wavefront sensor were used in an adaptive optics system. Closed-loop correction of the static aberrations of a phase plate designed for an advanced keratoconic eye was performed for a 6-mm pupil. The same adaptive optics system was also used to correct the aberrations in one eye each of two moderate keratoconic and three normal human eyes for a 6-mm pupil. With closed-loop correction of the phase plate, the total root-mean-square (RMS) over a 6-mm pupil was reduced from 3.54 to 0.04 microm in 30 to 40 iterations, corresponding to 3 to 4 seconds. Adaptive optics closed-loop correction reduced an average total RMS of 1.73+/-0.998 to 0.10+/-0.017 microm (higher order RMS of 0.39+/-0.124 to 0.06+/-0.004 microm) in the three normal eyes and 2.73+/-1.754 to 0.10+/-0.001 microm (higher order RMS of 1.82+/-1.058 to 0.05+/-0.017 microm) in the two keratoconic eyes. Aberrations in both normal and highly aberrated eyes were successfully corrected using the large-stroke deformable mirror to provide almost perfect optical quality. This mirror can be a powerful tool to assess the limit of visual performance achievable after correcting the aberrations, especially in eyes with abnormal corneal profiles.

Subjective face recognition difficulties, aberrant sensibility, sleeping disturbances and aberrant eating habits in families with Asperger syndrome

PubMed Central

Nieminen-von Wendt, Taina; Paavonen, Juulia E; Ylisaukko-Oja, Tero; Sarenius, Susan; Källman, Tiia; Järvelä, Irma; von Wendt, Lennart

2005-01-01

Background The present study was undertaken in order to determine whether a set of clinical features, which are not included in the DSM-IV or ICD-10 for Asperger Syndrome (AS), are associated with AS in particular or whether they are merely a familial trait that is not related to the diagnosis. Methods Ten large families, a total of 138 persons, of whom 58 individuals fulfilled the diagnostic criteria for AS and another 56 did not to fulfill these criteria, were studied using a structured interview focusing on the possible presence of face recognition difficulties, aberrant sensibility and eating habits and sleeping disturbances. Results The prevalence for face recognition difficulties was 46.6% in individuals with AS compared with 10.7% in the control group. The corresponding figures for subjectively reported presence of aberrant sensibilities were 91.4% and 46.6%, for sleeping disturbances 48.3% and 23.2% and for aberrant eating habits 60.3% and 14.3%, respectively. Conclusion An aberrant processing of sensory information appears to be a common feature in AS. The impact of these and other clinical features that are not incorporated in the ICD-10 and DSM-IV on our understanding of AS may hitherto have been underestimated. These associated clinical traits may well be reflected by the behavioural characteristics of these individuals. PMID:15826308

Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

PubMed

Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

2012-07-01

Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

Spectral estimation for characterization of acoustic aberration.

PubMed

Varslot, Trond; Angelsen, Bjørn; Waag, Robert C

2004-07-01

Spectral estimation based on acoustic backscatter from a motionless stochastic medium is described for characterization of aberration in ultrasonic imaging. The underlying assumptions for the estimation are: The correlation length of the medium is short compared to the length of the transmitted acoustic pulse, an isoplanatic region of sufficient size exists around the focal point, and the backscatter can be modeled as an ergodic stochastic process. The motivation for this work is ultrasonic imaging with aberration correction. Measurements were performed using a two-dimensional array system with 80 x 80 transducer elements and an element pitch of 0.6 mm. The f number for the measurements was 1.2 and the center frequency was 3.0 MHz with a 53% bandwidth. Relative phase of aberration was extracted from estimated cross spectra using a robust least-mean-square-error method based on an orthogonal expansion of the phase differences of neighboring wave forms as a function of frequency. Estimates of cross-spectrum phase from measurements of random scattering through a tissue-mimicking aberrator have confidence bands approximately +/- 5 degrees wide. Both phase and magnitude are in good agreement with a reference characterization obtained from a point scatterer.

Statistical virtual eye model based on wavefront aberration

PubMed Central

Wang, Jie-Mei; Liu, Chun-Ling; Luo, Yi-Ning; Liu, Yi-Guang; Hu, Bing-Jie

2012-01-01

Wavefront aberration affects the quality of retinal image directly. This paper reviews the representation and reconstruction of wavefront aberration, as well as the construction of virtual eye model based on Zernike polynomial coefficients. In addition, the promising prospect of virtual eye model is emphasized. PMID:23173112

Double-pass measurement of human eye aberrations: limitations and practical realization

NASA Astrophysics Data System (ADS)

Letfullin, Renat R.; Belyakov, Alexey I.; Cherezova, Tatyana Y.; Kudryashov, Alexis V.

2004-11-01

The problem of correct eye aberrations measurement is very important with the rising widespread of a surgical procedure for reducing refractive error in the eye, so called, LASIK (laser-assisted in situ keratomileusis). The double-pass technique commonly used for measuring aberrations of a human eye involves some uncertainties. One of them is loosing the information about odd human eye aberrations. We report about investigations of the applicability limit of the double-pass measurements depending upon the aberrations status introduced by human eye and actual size of the entrance pupil. We evaluate the double-pass effects for various aberrations and different pupil diameters. It is shown that for small pupils the double-pass effects are negligible. The testing and alignment of aberrometer was performed using the schematic eye, developed in our lab. We also introduced a model of human eye based on bimorph flexible mirror. We perform calculations to demonstrate that our schematic eye is capable of reproducing spatial-temporal statistics of aberrations of living eye with normal vision or even myopic or hypermetropic or with high aberrations ones.

Using aberrant behaviors as reinforcers for autistic children.

PubMed Central

Charlop, M H; Kurtz, P F; Casey, F G

1990-01-01

In a series of experiments, we assessed the efficacy of using autistic children's aberrant behaviors as reinforcers to increase their correct task responding. In Experiment 1, reinforcer conditions of stereotypy, food, and varied (food or stereotypy) were compared. In Experiment 2, the conditions were delayed echolalia, food, and varied (food or delayed echolalia), and in Experiment 3, perseverative behavior was compared with stereotypy and food as potential reinforcers. A multielement design was used for all comparisons, and side-effect measures were recorded during and after teaching sessions as well as at home. Results indicated that, in general, task performance was highest when brief opportunities to engage in aberrant behaviors were provided as reinforcers. Edibles were associated with the lowest performance. Furthermore, no negative side effects (e.g., an increase in aberrant behaviors) occurred. The results are discussed in terms of suggesting a more pragmatic treatment approach by addressing the contingent use of autistic children's aberrant behaviors as reinforcers. PMID:2373653

Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

PubMed

Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

2017-12-01

Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

Copy number rather than epigenetic alterations are the major dictator of imprinted methylation in tumors.

PubMed

Martin-Trujillo, Alex; Vidal, Enrique; Monteagudo-Sa Nchez, Ana; Sanchez-Delgado, Marta; Moran, Sebastian; Hernandez Mora, Jose Ramon; Heyn, Holger; Guitart, Miriam; Esteller, Manel; Monk, David

2017-09-07

It has been postulated that imprinting aberrations are common in tumors. To understand the role of imprinting in cancer, we have characterized copy-number and methylation in over 280 cancer cell lines and confirm our observations in primary tumors. Imprinted differentially methylated regions (DMRs) regulate parent-of-origin monoallelic expression of neighboring transcripts in cis. Unlike single-copy CpG islands that may be prone to hypermethylation, imprinted DMRs can either loose or gain methylation during tumorigenesis. Here, we show that methylation profiles at imprinted DMRs often not represent genuine epigenetic changes but simply the accumulation of underlying copy-number aberrations (CNAs), which is independent of the genome methylation state inferred from cancer susceptible loci. Our results reveal that CNAs also influence allelic expression as loci with copy-number neutral loss-of-heterozygosity or amplifications may be expressed from the appropriate parental chromosomes, which is indicative of maintained imprinting, although not observed as a single expression foci by RNA FISH.Altered genomic imprinting is frequently reported in cancer. Here, the authors analyze copy number and methylation in cancer cell lines and primary tumors to show that imprinted methylation profiles represent the accumulation of copy number alteration, rather than epigenetic alterations.

DNA methylation in adult diffuse gliomas.

PubMed

LeBlanc, Veronique G; Marra, Marco A

2016-11-01

Adult diffuse gliomas account for the majority of primary malignant brain tumours, and are in most cases lethal. Current therapies are often only marginally effective, and improved options will almost certainly benefit from further insight into the various processes contributing to gliomagenesis and pathology. While molecular characterization of these tumours classifies them on the basis of genetic alterations and chromosomal abnormalities, DNA methylation patterns are increasingly understood to play a role in glioma pathogenesis. Indeed, a subset of gliomas associated with improved survival is characterized by the glioma CpG island methylator phenotype (G-CIMP), which can be induced by the expression of mutant isocitrate dehydrogenase (IDH1/2). Aberrant methylation of particular genes or regulatory elements, within the context of G-CIMP-positive and/or negative tumours, has also been shown to be associated with differential survival. In this review, we provide an overview of the current knowledge regarding the role of DNA methylation in adult diffuse gliomas. In particular, we discuss IDH mutations and G-CIMP, MGMT promoter methylation, DNA methylation-mediated microRNA regulation and aberrant methylation of specific genes or groups of genes. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Ocular Chromatic Aberrations and Their Effects on Polychromatic Retinal Image Quality

NASA Astrophysics Data System (ADS)

Zhang, Xiaoxiao

Previous studies of ocular chromatic aberrations have concentrated on chromatic difference of focus (CDF). Less is known about the chromatic difference of image position (CDP) in the peripheral retina and no experimental attempt has been made to measure the ocular chromatic difference of magnification (CDM). Consequently, theoretical modelling of human eyes is incomplete. The insufficient knowledge of ocular chromatic aberrations is partially responsible for two unsolved applied vision problems: (1) how to improve vision by correcting ocular chromatic aberration? (2) what is the impact of ocular chromatic aberration on the use of isoluminance gratings as a tool in spatial-color vision?. Using optical ray tracing methods, MTF analysis methods of image quality, and psychophysical methods, I have developed a more complete model of ocular chromatic aberrations and their effects on vision. The ocular CDM was determined psychophysically by measuring the tilt in the apparent frontal parallel plane (AFPP) induced by interocular difference in image wavelength. This experimental result was then used to verify a theoretical relationship between the ocular CDM, the ocular CDF and the entrance pupil of the eye. In the retinal image after correcting the ocular CDF with existing achromatizing methods, two forms of chromatic aberration (CDM and chromatic parallax) were examined. The CDM was predicted by theoretical ray tracing and measured with the same method used to determine ocular CDM. The chromatic parallax was predicted with a nodal ray model and measured with the two-color vernier alignment method. The influence of these two aberrations on polychromatic MTF were calculated. Using this improved model of ocular chromatic aberration, luminance artifacts in the images of isoluminance gratings were calculated. The predicted luminance artifacts were then compared with experimental data from previous investigators. The results show that: (1) A simple relationship exists between

Orthonormal aberration polynomials for anamorphic optical imaging systems with circular pupils.

PubMed

Mahajan, Virendra N

2012-06-20

In a recent paper, we considered the classical aberrations of an anamorphic optical imaging system with a rectangular pupil, representing the terms of a power series expansion of its aberration function. These aberrations are inherently separable in the Cartesian coordinates (x,y) of a point on the pupil. Accordingly, there is x-defocus and x-coma, y-defocus and y-coma, and so on. We showed that the aberration polynomials orthonormal over the pupil and representing balanced aberrations for such a system are represented by the products of two Legendre polynomials, one for each of the two Cartesian coordinates of the pupil point; for example, L(l)(x)L(m)(y), where l and m are positive integers (including zero) and L(l)(x), for example, represents an orthonormal Legendre polynomial of degree l in x. The compound two-dimensional (2D) Legendre polynomials, like the classical aberrations, are thus also inherently separable in the Cartesian coordinates of the pupil point. Moreover, for every orthonormal polynomial L(l)(x)L(m)(y), there is a corresponding orthonormal polynomial L(l)(y)L(m)(x) obtained by interchanging x and y. These polynomials are different from the corresponding orthogonal polynomials for a system with rotational symmetry but a rectangular pupil. In this paper, we show that the orthonormal aberration polynomials for an anamorphic system with a circular pupil, obtained by the Gram-Schmidt orthogonalization of the 2D Legendre polynomials, are not separable in the two coordinates. Moreover, for a given polynomial in x and y, there is no corresponding polynomial obtained by interchanging x and y. For example, there are polynomials representing x-defocus, balanced x-coma, and balanced x-spherical aberration, but no corresponding y-aberration polynomials. The missing y-aberration terms are contained in other polynomials. We emphasize that the Zernike circle polynomials, although orthogonal over a circular pupil, are not suitable for an anamorphic system as

Frequency Modulation and Spatiotemporal Stability of the sCPG in Preterm Infants with RDS

PubMed Central

Barlow, Steven M.; Burch, Mimi; Venkatesan, Lalit; Harold, Meredith; Zimmerman, Emily

2012-01-01

The nonnutritive suck (NNS) is an observable and accessible motor behavior which is often used to make inference about brain development and pre-feeding skill in preterm and term infants. The purpose of this study was to model NNS burst compression pressure dynamics in the frequency and time domain among two groups of preterm infants, including those with respiratory distress syndrome (RDS, N = 15) and 17 healthy controls. Digitized samples of NNS compression pressure waveforms recorded at a 1-week interval were collected 15 minutes prior to a scheduled feed. Regression analysis and ANOVA revealed that healthy preterm infants produced longer NNS bursts and the mean burst initiation cycle frequencies were higher when compared to the RDS group. Moreover, the initial 5 cycles of the NNS burst manifest a frequency modulated (FM) segment which is a significant feature of the suck central pattern generator (sCPG), and differentially expressed in healthy and RDS infants. The NNS burst structure revealed significantly lower spatiotemporal index values for control versus RDS preterm infants during FM, and provides additional information on the microstructure of the sCPG which may be used to gauge the developmental status and progression of oromotor control systems among these fragile infants. PMID:22888359

Numerical analysis of wavefront aberration correction using multielectrode electrowetting-based devices.

PubMed

Zohrabi, Mo; Cormack, Robert H; Mccullough, Connor; Supekar, Omkar D; Gibson, Emily A; Bright, Victor M; Gopinath, Juliet T

2017-12-11

We present numerical simulations of multielectrode electrowetting devices used in a novel optical design to correct wavefront aberration. Our optical system consists of two multielectrode devices, preceded by a single fixed lens. The multielectrode elements function as adaptive optical devices that can be used to correct aberrations inherent in many imaging setups, biological samples, and the atmosphere. We are able to accurately simulate the liquid-liquid interface shape using computational fluid dynamics. Ray tracing analysis of these surfaces shows clear evidence of aberration correction. To demonstrate the strength of our design, we studied three different input aberrations mixtures that include astigmatism, coma, trefoil, and additional higher order aberration terms, with amplitudes as large as one wave at 633 nm.

Stability of corneal topography and wavefront aberrations in young Singaporeans.

PubMed

Zhu, Mingxia; Collins, Michael J; Yeo, Anna C H

2013-09-01

The aim was to investigate the differences between and variations across time in corneal topography and ocular wavefront aberrations in young Singaporean myopes and emmetropes. We used a videokeratoscope and wavefront sensor to measure the ocular surface topography and wavefront aberrations of the total-eye optics in the morning, midday and late afternoon on two separate days. Topographic data were used to derive the corneal surface wavefront aberrations. Both the corneal and total wavefronts were analysed up to the fourth radial order of the Zernike polynomial expansion and were centred on the entrance pupil (5.0 mm). The participants included 12 young progressing myopes, 13 young stable myopes and 15 young age-matched emmetropes. For all subjects considered together, there were significant changes in some of the aberrations across the day, such as spherical aberration ( Z(4 0)) and vertical coma ( Z (3 - 1)) (repeated measures analysis of variance, p < 0.05). The magnitude of positive spherical aberration ( Z(4 0)) was significantly lower in the progressing myopic group than in the stable myopic (p = 0.04) and emmetropic (p = 0.02) groups. There were also significant interactions between refractive group and time of day for with and against-the-rule astigmatism ( Z(2 2)). Significantly lower fourth-order root mean square of ocular wavefront aberrations were found in the progressing myopic group compared with the stable myopes and emmetropes (p < 0.01). These differences and variations in the corneal and total aberrations may have significance for our understanding of refractive error development and for clinical applications requiring accurate wavefront measurements. © 2013 The Authors. Clinical and Experimental Optometry © 2013 Optometrists Association Australia.

Chromosomal aberrations in 2000 couples of Indian ethnicity with reproductive failure.

PubMed

Gada Saxena, S; Desai, K; Shewale, L; Ranjan, P; Saranath, D

2012-08-01

Constitutional chromosomal aberrations contribute to infertility and repeated miscarriage leading to reproductive failure in couples. These aberrations may show no obvious clinical manifestations and remain undetected across multiple generations. However, infertility or recurrent spontaneous pregnancy loss, and/or genotypic/phenotypic aberrations may be manifested in the progeny during gametogenesis. The current study was a retrospective analysis to examine the chromosomal aberrations and prevalence in 2000 couples of Indian ethnicity with reproductive failure. Cytogenetic analysis via conventional G-band karyotyping analysis was carried out on phytohaemagglutinin stimulated peripheral blood lymphocytes, cultured in RPMI1640 medium. The chromosomes were enumerated as per International System for Human Cytogenetic Nomenclature at 500-550 band resolution, and recorded in the screening sheets. Chromosomal aberrations were detected in a total of 110 (2.78%) couples, with structural chromosomal aberrations in 88 cases including reciprocal translocations in 56 cases, Robertsonian translocations in 16 cases, inversions in eight cases, deletions in three cases, derivative chromosomes in five cases and numerical chromosome aberrations in 23 cases. The study emphasizes the importance of cytogenetic work up in both the partners associated with a history of reproductive failure. Genetic counselling with an option of prenatal diagnosis should be offered to couples with chromosomal aberrations. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871