Sample records for abf1 binding site

  1. Structure-function analysis of the DNA binding domain of Saccharomyces cerevisiae ABF1.

    PubMed Central

    Cho, G; Kim, J; Rho, H M; Jung, G


    To localize the DNA binding domain of the Saccharomyces cerevisiae Ars binding factor 1 (ABF1), a multifunctional DNA binding protein, plasmid constructs carrying point mutations and internal deletions in the ABF1 gene were generated and expressed in Escherichia coli. Normal and mutant ABF1 proteins were purified by affinity chromatography and their DNA binding activities were analyzed. The substitution of His61, Cys66 and His67 respectively, located in the zinc finger motif in the N-terminal region (amino acids 40-91), eliminated the DNA binding activity of ABF1 protein. Point mutations in the middle region of ABF1, specifically at Leu353, Leu399, Tyr403, Gly404, Phe410 and Lys434, also eliminated or reduced DNA binding activity. However, the DNA binding activity of point mutants of Ser307, Ser496 and Glu649 was the same as that of wild-type ABF1 protein and deletion mutants of amino acids 200-265, between the zinc finger region and the middle region (residues 323-496) retained DNA binding activity. As a result, we confirmed that the DNA binding domain of ABF1 appears to be bipartite and another DNA binding motif, other than the zinc finger motif, is situated between amino acid residues 323 and 496. Images PMID:7659521

  2. Kluyveromyces contains a functional ABF1-homologue.

    PubMed Central

    Gonçalves, P M; Maurer, K; Mager, W H; Planta, R J


    ABF1 is a multifunctional protein present in Saccharomyces cerevisiae, involved in transcription-activation and -repression as well as in DNA-replication. Several lines of evidence indicate the occurrence in the related species Kluyveromyces lactis of a protein having similar properties to those of ABF1 in S. cerevisiae. In order to identify conserved functional domains in ABF1, we have cloned and sequenced the gene encoding the ABF1-homologue from K. lactis. KIABF1 is much smaller than ScABF1 (54.6 vs. 81.7 kD). It exhibits extensive homology with its S. cerevisiae counterpart in the N-terminal region. The C-terminal domain however, is divergent, with the striking exception of a stretch of 20 amino acids, which is virtually identical in the two proteins. KIABF1 can substitute ABF1 in S. cerevisiae, emphasizing the conservation of the multiple functions of this protein. Images PMID:1594441

  3. abf-1 and abf-2, ASABF-type antimicrobial peptide genes in Caenorhabditis elegans.

    PubMed Central

    Kato, Yusuke; Aizawa, Tomoyasu; Hoshino, Hirokazu; Kawano, Keiichi; Nitta, Katsutoshi; Zhang, Hong


    Two genes encoding the ASABF (Ascaris suum antibacterial factor)-type antimicrobial peptide, abf-1 and abf-2, were identified in Caenorhabditis elegans. Recombinant ABF-2 exhibited potent microbicidal activity against Gram-positive and Gram-negative bacteria, and yeasts. The tissue-specific distribution estimated by immunofluorescence staining and transgenic analysis of a gfp fusion gene (where GFP corresponds to green fluorescent protein) suggested that ABF-2 contributes to surface defence in the pharynx. abf-1 contains a single intron at a conserved position, suggesting that asabf and abf originated from a common ancestor. Both transcripts for abf-1 and abf-2 were detected as two distinct forms, i.e. spliced leader (SL)1-trans-spliced with a long 5'-untranslated region (UTR) and SL-less with a short 5'-UTR. A polycistronic precursor RNA encoding ABF-1 and ABF-2 was detected, suggesting that these genes form an operon. An 'opportunistic operon' model for regulation of abf genes, including the generation of short SL-less transcripts, is proposed. In conclusion, C. elegans should have an immune defence system due to the antimicrobial peptides. C. elegans can be a novel model for innate immunity. Furthermore, the combination of biochemical identification in Ascaris suum and homologue hunting in C. elegans should be a powerful method of finding rapidly evolved proteins, such as some immune-related molecules in C. elegans. PMID:11772394

  4. Thioredoxin binding site of phosphoribulokinase overlaps the catalytic site. [R

    SciTech Connect

    Porter, M.A.; Hartman, F.C.


    The ATP-regulatory binding site of phosphoribulokinase was studied using bromoacetylethanolamine phosphate (BrAcNHEtOP). BrAcNHEtOP binds to the active-regulatory binding site of the protein. Following trypsin degradation of the labeled protein, fragments were separated by HPLC and sequenced. (DT)

  5. Receptor-binding sites: bioinformatic approaches.


    Flower, Darren R


    It is increasingly clear that both transient and long-lasting interactions between biomacromolecules and their molecular partners are the most fundamental of all biological mechanisms and lie at the conceptual heart of protein function. In particular, the protein-binding site is the most fascinating and important mechanistic arbiter of protein function. In this review, I examine the nature of protein-binding sites found in both ligand-binding receptors and substrate-binding enzymes. I highlight two important concepts underlying the identification and analysis of binding sites. The first is based on knowledge: when one knows the location of a binding site in one protein, one can "inherit" the site from one protein to another. The second approach involves the a priori prediction of a binding site from a sequence or a structure. The full and complete analysis of binding sites will necessarily involve the full range of informatic techniques ranging from sequence-based bioinformatic analysis through structural bioinformatics to computational chemistry and molecular physics. Integration of both diverse experimental and diverse theoretical approaches is thus a mandatory requirement in the evaluation of binding sites and the binding events that occur within them. PMID:16671408

  6. (/sup 3/)tetrahydrotrazodone binding. Association with serotonin binding sites

    SciTech Connect

    Kendall, D.A.; Taylor, D.P.; Enna, S.J.


    High (17 nM) and low (603 nM) affinity binding sites for (/sup 3/)tetrahydrotrazodone ((/sup 3/) THT), a biologically active analogue of trazodone, have been identified in rat brain membranes. The substrate specificity, concentration, and subcellular and regional distributions of these sites suggest that they may represent a component of the serotonin transmitter system. Pharmacological analysis of (/sup 3/)THT binding, coupled with brain lesion and drug treatment experiments, revealed that, unlike other antidepressants, (/sup 3/) THT does not attach to either a biogenic amine transporter or serotonin binding sites. Rather, it would appear that (/sup 3/)THT may be an antagonist ligand for the serotonin binding site. This probe may prove of value in defining the mechanism of action of trazodone and in further characterizing serotonin receptors.

  7. Ethylene binding site affinity in ripening apples

    SciTech Connect

    Blankenship, S.M. . Dept. of Horticultural Science); Sisler, E.C. )


    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by apple tissue.

  8. Reversible calcitonin binding to solubilized sheep brain binding sites.

    PubMed Central

    Sexton, P M; Schneider, H G; D'Santos, C S; Mendelsohn, F A; Kemp, B E; Moseley, J M; Martin, T J; Findlay, D M


    In this study we have solubilized and characterized binding sites for calcitonin (CT) from sheep brainstem. Autoradiography of 125I-labelled salmon CT (125I-sCT) binding to sheep diencephalon revealed a similar pattern of binding to that seen in other species, although the extent of distribution was greater in the sheep. CT binding activity could be extracted from membranes with either CHAPS or digitonin, but not with beta-octyl glucoside, 125I-sCT binding was saturable, with a dissociation constant for CHAPS-solubilized membranes of 2.8 +/- 0.5 nM and a maximum binding site concentration of 6.2 +/- 1.6 pmol/mg of protein. In competition binding studies, various CTs and their analogues demonstrated a similar rank order of potency to that seen in other CT receptor systems, Optimal binding occurred in the pH range 6.5-7.5, and was decreased in the presence of NaCl concentrations greater than 200 mM. In contrast with most other CT receptor binding systems, in which binding is poorly reversible, the binding of 125I-sCT to sheep brain binding sites underwent substantial dissociation upon addition of excess unlabelled sCT, with 40% and 46% dissociation after 2 h at 4 degree C in particulate and solubilized membranes respectively. Photoaffinity labelling of the binding site with the biologically active analogue 125I-[Arg11,18,4-azidobenzoyl-Lys14]sCT and analysis on SDS/PAGE under reducing conditions revealed a specific protein band of Mr approximately solubilized and particulate brain membranes. This is in accordance with the molecular size of CT receptors in other tissues where two species of receptor have been identified. one of Mr approximately 71,000 and another of Mr approximately 88,000. These results demonstrate the presence of high concentrations of CT binding sites in sheep brain which display different kinetic properties to those of CT receptors found in other tissues. Images Fig. 1. Fig. 6. PMID:1846527

  9. Localization of the chaperone binding site

    NASA Technical Reports Server (NTRS)

    Boyle, D.; Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)


    The hypothesis derived from models of the multi-oligomeric chaperone complex suggests that partially denatured proteins bind in a central cavity in the aggregate. To test this hypothesis, the molecular chaperone, alpha crystallin, was bound to partially denatured forms of gamma crystallin, and the binding site was visualized by immunogold localization. In an alternative approach, gold particles were directly complexed with gamma crystallin, followed by binding to the alpha crystallin aggregate. In both cases, binding was localized to the central region of the aggregate, confirming for the first time that partially denatured proteins do indeed bind to a central region of the molecular chaperone aggregate.

  10. Muscarine binding sites in bovine adrenal medulla.


    Barron, B A; Murrin, L C; Hexum, T D


    The presence of muscarinic binding sites in the bovine adrenal medulla was investigated using [3H]QNB and the bovine adrenal medulla. Scatchard analysis combined with computer analysis yielded data consistent with a two binding site configuration. KDs of 0.15 and 14 nM and Bmax s of 29 and 210 fmol/mg protein, respectively, were observed. Displacement of [3H]QNB by various cholinergic agents is, in order of decreasing potency: QNB, dexetimide, atropine, scopolamine, imipramine, desipramine, oxotremorine, pilocarpine, acetylcholine, methacholine and carbachol. These results demonstrate the presence of more than one muscarine binding site in the bovine adrenal gland. PMID:3709656

  11. Multiple instance learning of Calmodulin binding sites

    PubMed Central

    Minhas, Fayyaz ul Amir Afsar; Ben-Hur, Asa


    Motivation: Calmodulin (CaM) is a ubiquitously conserved protein that acts as a calcium sensor, and interacts with a large number of proteins. Detection of CaM binding proteins and their interaction sites experimentally requires a significant effort, so accurate methods for their prediction are important. Results: We present a novel algorithm (MI-1 SVM) for binding site prediction and evaluate its performance on a set of CaM-binding proteins extracted from the Calmodulin Target Database. Our approach directly models the problem of binding site prediction as a large-margin classification problem, and is able to take into account uncertainty in binding site location. We show that the proposed algorithm performs better than the standard SVM formulation, and illustrate its ability to recover known CaM binding motifs. A highly accurate cascaded classification approach using the proposed binding site prediction method to predict CaM binding proteins in Arabidopsis thaliana is also presented. Availability: Matlab code for training MI-1 SVM and the cascaded classification approach is available on request. Contact: or PMID:22962461

  12. Follitropin receptors contain cryptic ligand binding sites.


    Lin, Win; Bernard, Michael P; Cao, Donghui; Myers, Rebecca V; Kerrigan, John E; Moyle, William R


    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with different regions of an FSHR/LHR chimera having only two unique LHR residues and that binds both hormones with high affinity. hCG and hFSH analogs dock with this receptor chimera in a manner similar to that in which they bind LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  13. Identification of consensus binding sites clarifies FMRP binding determinants.


    Anderson, Bart R; Chopra, Pankaj; Suhl, Joshua A; Warren, Stephen T; Bassell, Gary J


    Fragile X mental retardation protein (FMRP) is a multifunctional RNA-binding protein with crucial roles in neuronal development and function. Efforts aimed at elucidating how FMRP target mRNAs are selected have produced divergent sets of target mRNA and putative FMRP-bound motifs, and a clear understanding of FMRP's binding determinants has been lacking. To clarify FMRP's binding to its target mRNAs, we produced a shared dataset of FMRP consensus binding sequences (FCBS), which were reproducibly identified in two published FMRP CLIP sequencing datasets. This comparative dataset revealed that of the various sequence and structural motifs that have been proposed to specify FMRP binding, the short sequence motifs TGGA and GAC were corroborated, and a novel TAY motif was identified. In addition, the distribution of the FCBS set demonstrates that FMRP preferentially binds to the coding region of its targets but also revealed binding along 3' UTRs in a subset of target mRNAs. Beyond probing these putative motifs, the FCBS dataset of reproducibly identified FMRP binding sites is a valuable tool for investigating FMRP targets and function. PMID:27378784

  14. Predicting Ca(2+)-binding sites in proteins.

    PubMed Central

    Nayal, M; Di Cera, E


    The coordination shell of Ca2+ ions in proteins contains almost exclusively oxygen atoms supported by an outer shell of carbon atoms. The bond-strength contribution of each ligating oxygen in the inner shell can be evaluated by using an empirical expression successfully applied in the analysis of crystals of metal oxides. The sum of such contributions closely approximates the valence of the bound cation. When a protein is embedded in a very fine grid of points and an algorithm is used to calculate the valence of each point representing a potential Ca(2+)-binding site, a typical distribution of valence values peaked around 0.4 is obtained. In 32 documented Ca(2+)-binding proteins, containing a total of 62 Ca(2+)-binding sites, a very small fraction of points in the distribution has a valence close to that of Ca2+. Only 0.06% of the points have a valence > or = 1.4. These points share the remarkable tendency to cluster around documented Ca2+ ions. A high enough value of the valence is both necessary (58 out of 62 Ca(2+)-binding sites have a valence > or = 1.4) and sufficient (87% of the grid points with a valence > or = 1.4 are within 1.0 A from a documented Ca2+ ion) to predict the location of bound Ca2+ ions. The algorithm can also be used for the analysis of other cations and predicts the location of Mg(2+)- and Na(+)-binding sites in a number of proteins. The valence is, therefore, a tool of pinpoint accuracy for locating cation-binding sites, which can also be exploited in engineering high-affinity binding sites and characterizing the linkage between structural components and functional energetics for molecular recognition of metal ions by proteins. Images Fig. 4 PMID:8290605

  15. Computational Prediction of RNA-Binding Proteins and Binding Sites

    PubMed Central

    Si, Jingna; Cui, Jing; Cheng, Jin; Wu, Rongling


    Proteins and RNA interaction have vital roles in many cellular processes such as protein synthesis, sequence encoding, RNA transfer, and gene regulation at the transcriptional and post-transcriptional levels. Approximately 6%–8% of all proteins are RNA-binding proteins (RBPs). Distinguishing these RBPs or their binding residues is a major aim of structural biology. Previously, a number of experimental methods were developed for the determination of protein–RNA interactions. However, these experimental methods are expensive, time-consuming, and labor-intensive. Alternatively, researchers have developed many computational approaches to predict RBPs and protein–RNA binding sites, by combining various machine learning methods and abundant sequence and/or structural features. There are three kinds of computational approaches, which are prediction from protein sequence, prediction from protein structure, and protein-RNA docking. In this paper, we review all existing studies of predictions of RNA-binding sites and RBPs and complexes, including data sets used in different approaches, sequence and structural features used in several predictors, prediction method classifications, performance comparisons, evaluation methods, and future directions. PMID:26540053

  16. Radiation inactivation reveals discrete cation binding sites that modulate dihydropyridine binding sites

    SciTech Connect

    Bolger, G.T.; Skolnick, P.; Kempner, E.S. )


    In low ionic strength buffer (5 mM Tris.HCl), the binding of (3H) nitrendipine to dihydropyridine calcium antagonist binding sites of mouse forebrain membranes is increased by both Na{sup +} and Ca{sup 2+}. Radiation inactivation was used to determine the target size of ({sup 3}H)nitrendipine binding sites in 5 mM Tris.HCl buffer, in the presence and absence of these cations. After irradiation, ({sup 3}H) nitrendipine binding in buffer with or without Na+ was diminished, due to a loss of binding sites and also to an increase in Kd. After accounting for radiation effects on the dissociation constant, the target size for the nitrendipine binding site in buffer was 160-170 kDa and was 170-180 kDa in the presence of sodium. In the presence of calcium ions, ({sup 3}H)nitrendipine binding showed no radiation effects on Kd and yielded a target size of 150-170 kDa. These findings suggest, as in the case of opioid receptors, the presence of high molecular weight membrane components that modulate cation-induced alterations in radioligand binding to dihydropyridine binding sites.

  17. Dynamics of Transcription Factor Binding Site Evolution

    PubMed Central

    Tuğrul, Murat; Paixão, Tiago; Barton, Nicholas H.; Tkačik, Gašper


    Evolution of gene regulation is crucial for our understanding of the phenotypic differences between species, populations and individuals. Sequence-specific binding of transcription factors to the regulatory regions on the DNA is a key regulatory mechanism that determines gene expression and hence heritable phenotypic variation. We use a biophysical model for directional selection on gene expression to estimate the rates of gain and loss of transcription factor binding sites (TFBS) in finite populations under both point and insertion/deletion mutations. Our results show that these rates are typically slow for a single TFBS in an isolated DNA region, unless the selection is extremely strong. These rates decrease drastically with increasing TFBS length or increasingly specific protein-DNA interactions, making the evolution of sites longer than ∼ 10 bp unlikely on typical eukaryotic speciation timescales. Similarly, evolution converges to the stationary distribution of binding sequences very slowly, making the equilibrium assumption questionable. The availability of longer regulatory sequences in which multiple binding sites can evolve simultaneously, the presence of “pre-sites” or partially decayed old sites in the initial sequence, and biophysical cooperativity between transcription factors, can all facilitate gain of TFBS and reconcile theoretical calculations with timescales inferred from comparative genomics. PMID:26545200

  18. Preferred Metal Binding Site of Aniline

    NASA Astrophysics Data System (ADS)

    Kumari, Sudesh; Sohnlein, Brad; Yang, Dong-Sheng


    Group III metal-aniline complexes, M-aniline (M = Sc, Y, and La), were produced by interactions between laser-vaporized metal atoms and aniline vapor in a pulsed molecular beam source, identified by photoionization time-of-flight mass spectrometry, and studied by pulsed-field ionization zero electron kinetic energy (ZEKE) spectroscopy and density functional theory calculations. Adiabatic ionization energies and several vibrational intervals were measured from the ZEKE spectra. Metal binding sites and electronic states were determined by combining the ZEKE measurements and theoretical calculations. Although aniline has various possible sites for metal coordination, the preferred site was determined to be phenyl ring. The metal binding with the phenyl ring yields syn and anti conformers. In these conformers, the neutral complexes are in doublet ground states and the corresponding singly charged cations in singlet states.

  19. Molecular design of substrate binding sites

    SciTech Connect

    Shelnutt, J.A.; Hobbs, J.D.


    Computer-aided molecular design methods were used to tailor binding sites for small substrate molecules, including CO{sub 2} and methane. The goal is to design a cavity, adjacent to a catalytic metal center, into which the substrate will selectively bind through only non-bonding interactions with the groups lining the binding pocket. Porphyrins are used as a basic molecular structure, with various substituents added to construct the binding pocket. The conformations of these highly-substituted porphyrins are predicted using molecular mechanics calculations with a force field that gives accurate predictions for metalloporhyrins. Dynamics and energy-minimization calculations of substrate molecules bound to the cavity indicate high substrate binding affinity. The size, shape and charge-distribution of groups surrounding the cavity provide molecular selectivity. Specifically, calculated binding energies of methane, benzene, dichloromethane, CO{sub 2} and chloroform vary by about 10 kcal/mol for metal octaethyl-tetraphenylporphyrins (OETPPs) with chloroform, dichloromethane, and CO{sub 2} having the lowest. Significantly, a solvent molecule is found in the cavity in the X-ray structures of Co- and CuOETPP crystals obtained from dichloromethane. 5 refs., 3 figs., 3 tabs.

  20. Molecular design of substrate binding sites

    SciTech Connect

    Shelnutt, J.A.; Hobbs, J.D.


    Computer-aided molecular design methods were used to tailor binding sites for small substrate molecules, including CO{sub 2} and methane. The goal is to design a cavity, adjacent to a catalytic metal center, into which the substrate will selectively bind through only non-bonding interactions with the groups lining the binding pocket. Porphyrins are used as a basic molecular structure, with various substituents added to construct the binding pocket. The conformations of these highly-substituted porphyrins are predicted using molecular mechanics calculations with a force field that gives accurate predictions for metalloporhyrins. Dynamics and energy-minimization calculations of substrate molecules bound to the cavity indicate high substrate binding affinity. The size, shape and charge-distribution of groups surrounding the cavity provide molecular selectivity. Specifically, calculated binding energies of methane, benzene, dichloromethane, CO{sub 2} and chloroform vary by about 10 kcal/mol for metal octaethyl-tetraphenylporphyrins (OETPPs) with chloroform, dichloromethane, and CO{sub 2} having the lowest. Significantly, a solvent molecule is found in the cavity in the X-ray structures of Co- and CuOETPP crystals obtained from dichloromethane. 5 refs., 3 figs., 3 tabs.

  1. Molecular anatomy of the antibody binding site.


    Novotný, J; Bruccoleri, R; Newell, J; Murphy, D; Haber, E; Karplus, M


    The binding region of immunoglobulins, which includes the portion of the molecule having the most variability in its amino acid sequence, is shown to have a surprisingly constant structure that can be characterized in terms of a simple, well-defined model. The binding region is composed of the antigen combining site plus its immediate vicinity and arises by noncovalent association of the light and heavy chain variable domains (VL and VH, respectively). The antigen combining site itself consists of six polypeptide chain segments ("hypervariable loops") which comprise some 80 amino acid residues and are attached to a framework of VL and VH beta-sheet bilayers. Having analyzed refined x-ray crystallographic coordinates for three antigen-binding fragments (Fab KOL (Marquart, M., Deisenhofer, J., and Huber, R. (1980) J. Mol. Biol. 141, 369-391), MCPC 603 (Segal, D., Padlan, E. A., Cohen, G. H., Rudikoff, S., Potter, M., and Davies, D. R. (1974) Proc. Natl. Acad. Sci. U. S. A. 71, 4298-4302), and NEW (Saul, F. A., Amzel, L. M., and Poljak, R. J. (1978) J. Biol. Chem. 253, 585-597] we use the results to introduce a general model for the VL-VH interface forming the binding region. The region consists of two closely packed beta-sheets, and its geometry corresponds to a 9-stranded, cylindrical barrel of average radius 0.84 nm with an average angle of -53 degrees between its two constituent beta-sheets. The barrel forms the bottom and sides of the antigen combining site. The model demonstrates that the structural variability of the binding region is considerably less than was thought previously. Amino acid residues which are part of the domain-domain interface and appear not to be accessible to solvent or antigen contribute to antibody specificity. PMID:6643494

  2. Predicting tissue specific transcription factor binding sites

    PubMed Central


    Background Studies of gene regulation often utilize genome-wide predictions of transcription factor (TF) binding sites. Most existing prediction methods are based on sequence information alone, ignoring biological contexts such as developmental stages and tissue types. Experimental methods to study in vivo binding, including ChIP-chip and ChIP-seq, can only study one transcription factor in a single cell type and under a specific condition in each experiment, and therefore cannot scale to determine the full set of regulatory interactions in mammalian transcriptional regulatory networks. Results We developed a new computational approach, PIPES, for predicting tissue-specific TF binding. PIPES integrates in vitro protein binding microarrays (PBMs), sequence conservation and tissue-specific epigenetic (DNase I hypersensitivity) information. We demonstrate that PIPES improves over existing methods on distinguishing between in vivo bound and unbound sequences using ChIP-seq data for 11 mouse TFs. In addition, our predictions are in good agreement with current knowledge of tissue-specific TF regulation. Conclusions We provide a systematic map of computationally predicted tissue-specific binding targets for 284 mouse TFs across 55 tissue/cell types. Such comprehensive resource is useful for researchers studying gene regulation. PMID:24238150

  3. Oxytocin binding sites in bovine mammary tissue

    SciTech Connect

    Zhao, Xin.


    Oxytocin binding sites were identified and characterized in bovine mammary tissue. ({sup 3}H)-oxytocin binding reached equilibrium by 50 min at 20{degree}C and by 8 hr at 4{degree}C. The half-time of displacement at 20{degree}C was approximately 1 hr. Thyrotropin releasing hormone, adrenocorticotropin, angiotensin I, angiotensin II, pentagastrin, bradykinin, xenopsin and L-valyl-histidyl-L-leucyl-L-threonyl-L-prolyl-L-valyl-L-glutamyl-L-lysine were not competitive. In the presence of 10 nM LiCl, addition of oxytocin to dispersed bovine mammary cells, in which phosphatidylinositol was pre-labelled, caused a time and dose-dependent increase in radioactive inositiol monophosphate incorporation. The possibility that there are distinct vasopressin receptors in bovine mammary tissue was investigated. ({sup 3}H)-vasopressin binding reached equilibrium by 40 min at 20{degree}. The half-time of displacement at 20{degree}C was approximately 1 hr. The ability of the peptides to inhibit ({sup 3}H)-vasopressin binding was: (Thr{sup 4},Gly{sup 7})-oxytocin > Arg{sup 8}-vasopressin > (lys{sup 8})-vasopressin > (Deamino{sup 1},D-arg{sup 8})-vasopressin > oxytocin > d (CH{sub 2}){sub 5}Tyr(Me)AVP.

  4. Being a binding site: characterizing residue composition of binding sites on proteins.


    Iván, Gábor; Szabadka, Zoltán; Grolmusz, Vince


    The Protein Data Bank contains the description of more than 45,000 three-dimensional protein and nucleic-acid structures today. Started to exist as the computer-readable depository of crystallographic data complementing printed articles, the proper interpretation of the content of the individual files in the PDB still frequently needs the detailed information found in the citing publication. This fact implies that the fully automatic processing of the whole PDB is a very hard task. We first cleaned and re-structured the PDB data, then analyzed the residue composition of the binding sites in the whole PDB for frequency and for hidden association rules. Main results of the paper: (i) the cleaning and repairing algorithm (ii) redundancy elimination from the data (iii) application of association rule mining to the cleaned non-redundant data set. We have found numerous significant relations of the residue-composition of the ligand binding sites on protein surfaces, summarized in two figures. One of the classical data-mining methods for exploring implication-rules, the association-rule mining, is capable to find previously unknown residue-set preferences of bind ligands on protein surfaces. Since protein-ligand binding is a key step in enzymatic mechanisms and in drug discovery, these uncovered preferences in the study of more than 19,500 binding sites may help in identifying new binding protein-ligand pairs. PMID:18305831

  5. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny


    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on PMID:24533055

  6. The yeast protein Gcr1p binds to the PGK UAS and contributes to the activation of transcription of the PGK gene.


    Henry, Y A; López, M C; Gibbs, J M; Chambers, A; Kingsman, S M; Baker, H V; Stanway, C A


    Analysis of the upstream activation sequence (UAS) of the yeast phosphoglycerate kinase gene (PGK) has demonstrated that a number of sequence elements are involved in its activity and two of these sequences are bound by the multifunctional factors Rap1p and Abf1p. In this report we show by in vivo footprinting that the regulatory factor encoded by GCR1 binds to two elements in the 3' half of the PGK UAS. These elements contain the sequence CTTCC, which was previously suggested to be important for the activity of the PGK UAS and has been shown to be able to bind Gcr1p in vitro. Furthermore, we find that Gcr1p positively influences PGK transcription, although it is not responsible for the carbon source dependent regulation of PGK mRNA synthesis. In order to mediate its transcriptional influence we find that Gcr1p requires the Rap1p binding site, in addition to its own, but not the Abf1p site. As neither a Rap1p nor a Gcr1p binding site alone is able to activate transcription, we propose that Gcr1p and Rap1p interact in an interdependent fashion to activate PGK transcription. PMID:7808400

  7. Binding Site Graphs: A New Graph Theoretical Framework for Prediction of Transcription Factor Binding Sites

    PubMed Central

    Reddy, Timothy E; DeLisi, Charles; Shakhnovich, Boris E


    Computational prediction of nucleotide binding specificity for transcription factors remains a fundamental and largely unsolved problem. Determination of binding positions is a prerequisite for research in gene regulation, a major mechanism controlling phenotypic diversity. Furthermore, an accurate determination of binding specificities from high-throughput data sources is necessary to realize the full potential of systems biology. Unfortunately, recently performed independent evaluation showed that more than half the predictions from most widely used algorithms are false. We introduce a graph-theoretical framework to describe local sequence similarity as the pair-wise distances between nucleotides in promoter sequences, and hypothesize that densely connected subgraphs are indicative of transcription factor binding sites. Using a well-established sampling algorithm coupled with simple clustering and scoring schemes, we identify sets of closely related nucleotides and test those for known TF binding activity. Using an independent benchmark, we find our algorithm predicts yeast binding motifs considerably better than currently available techniques and without manual curation. Importantly, we reduce the number of false positive predictions in yeast to less than 30%. We also develop a framework to evaluate the statistical significance of our motif predictions. We show that our approach is robust to the choice of input promoters, and thus can be used in the context of predicting binding positions from noisy experimental data. We apply our method to identify binding sites using data from genome scale ChIP–chip experiments. Results from these experiments are publicly available at The graphical framework developed here may be useful when combining predictions from numerous computational and experimental measures. Finally, we discuss how our algorithm can be used to improve the sensitivity of computational predictions of transcription factor

  8. Detection of secondary binding sites in proteins using fragment screening

    PubMed Central

    Ludlow, R. Frederick; Verdonk, Marcel L.; Saini, Harpreet K.; Tickle, Ian J.; Jhoti, Harren


    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets. PMID:26655740

  9. Tuning Genetic Clocks Employing DNA Binding Sites

    PubMed Central

    Jayanthi, Shridhar; Del Vecchio, Domitilla


    Periodic oscillations play a key role in cell physiology from the cell cycle to circadian clocks. The interplay of positive and negative feedback loops among genes and proteins is ubiquitous in these networks. Often, delays in a negative feedback loop and/or degradation rates are a crucial mechanism to obtain sustained oscillations. How does nature control delays and kinetic rates in feedback networks? Known mechanisms include proper selection of the number of steps composing a feedback loop and alteration of protease activity, respectively. Here, we show that a remarkably simple means to control both delays and effective kinetic rates is the employment of DNA binding sites. We illustrate this design principle on a widely studied activator-repressor clock motif, which is ubiquitous in natural systems. By suitably employing DNA target sites for the activator and/or the repressor, one can switch the clock “on” and “off” and precisely tune its period to a desired value. Our study reveals a design principle to engineer dynamic behavior in biomolecular networks, which may be largely exploited by natural systems and employed for the rational design of synthetic circuits. PMID:22859962

  10. Mu opioid receptor binding sites in human brain

    SciTech Connect

    Pilapil, C.; Welner, S.; Magnan, J.; Zamir, N.; Quirion, R.


    Our experiments focused on the examination of the distribution of mu opioid receptor binding sites in normal human brain using the highly selective ligand (/sup 3/H)DAGO, in both membrane binding assay and in vitro receptor autoradiography. Mu opioid binding sites are very discretely distributed in human brain with high densities of sites found in the posterior amygdala, caudate, putamen, hypothalamus and certain cortical areas. Moreover the autoradiographic distribution of (/sup 3/H)DAGO binding sites clearly reveals the discrete lamination (layers I and III-IV) of mu sites in cortical areas.

  11. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    SciTech Connect

    Zhao, Y.D.; Springall, D.R.; Wharton, J.; Polak, J.M. )


    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with the known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.

  12. Unraveling determinants of transcription factor binding outside the core binding site.


    Levo, Michal; Zalckvar, Einat; Sharon, Eilon; Dantas Machado, Ana Carolina; Kalma, Yael; Lotam-Pompan, Maya; Weinberger, Adina; Yakhini, Zohar; Rohs, Remo; Segal, Eran


    Binding of transcription factors (TFs) to regulatory sequences is a pivotal step in the control of gene expression. Despite many advances in the characterization of sequence motifs recognized by TFs, our ability to quantitatively predict TF binding to different regulatory sequences is still limited. Here, we present a novel experimental assay termed BunDLE-seq that provides quantitative measurements of TF binding to thousands of fully designed sequences of 200 bp in length within a single experiment. Applying this binding assay to two yeast TFs, we demonstrate that sequences outside the core TF binding site profoundly affect TF binding. We show that TF-specific models based on the sequence or DNA shape of the regions flanking the core binding site are highly predictive of the measured differential TF binding. We further characterize the dependence of TF binding, accounting for measurements of single and co-occurring binding events, on the number and location of binding sites and on the TF concentration. Finally, by coupling our in vitro TF binding measurements, and another application of our method probing nucleosome formation, to in vivo expression measurements carried out with the same template sequences serving as promoters, we offer insights into mechanisms that may determine the different expression outcomes observed. Our assay thus paves the way to a more comprehensive understanding of TF binding to regulatory sequences and allows the characterization of TF binding determinants within and outside of core binding sites. PMID:25762553

  13. Protein Function Annotation By Local Binding Site Surface Similarity

    PubMed Central

    Spitzer, Russell; Cleves, Ann E.; Varela, Rocco; Jain, Ajay N.


    Hundreds of protein crystal structures exist for proteins whose function cannot be confidently determined from sequence similarity. Surflex-PSIM, a previously reported surface-based protein similarity algorithm, provides an alternative method for hypothesizing function for such proteins. The method now supports fully automatic binding site detection and is fast enough to screen comprehensive databases of protein binding sites. The binding site detection methodology was validated on apo/holo cognate protein pairs, correctly identifying 91% of ligand binding sites in holo structures and 88% in apo structures where corresponding sites existed. For correctly detected apo binding sites, the cognate holo site was the most similar binding site 87% of the time. PSIM was used to screen a set of proteins that had poorly characterized functions at the time of crystallization, but were later biochemically annotated. Using a fully automated protocol, this set of 8 proteins was screened against approximately 60,000 ligand binding sites from the PDB. PSIM correctly identified functional matches that pre-dated query protein biochemical annotation for five out of the eight query proteins. A panel of twelve currently unannotated proteins was also screened, resulting in a large number of statistically significant binding site matches, some of which suggest likely functions for the poorly characterized proteins. PMID:24166661

  14. The molecular architecture of protein-protein binding sites.


    Reichmann, Dana; Rahat, Ofer; Cohen, Mati; Neuvirth, Hani; Schreiber, Gideon


    The formation of specific protein interactions plays a crucial role in most, if not all, biological processes, including signal transduction, cell regulation, the immune response and others. Recent advances in our understanding of the molecular architecture of protein-protein binding sites, which facilitates such diversity in binding affinity and specificity, are enabling us to address key questions. What is the amino acid composition of binding sites? What are interface hotspots? How are binding sites organized? What are the differences between tight and weak interacting complexes? How does water contribute to binding? Can the knowledge gained be translated into protein design? And does a universal code for binding exist, or is it the architecture and chemistry of the interface that enable diverse but specific binding solutions? PMID:17239579

  15. Sizes of Mn-binding sites in spinach thylakoids

    SciTech Connect

    Takahashi, M.; Asada, K.


    The sizes of the Mn-binding sites in spinach thylakoids were estimated by target size analysis, assaying the membrane-bound Mn that was resistant to EDTA washing after radiation inactivation. The inactivation curve showed well the inactivation of two independent Mn-binding sites of different sizes: about two-thirds of the Mn coordinated to a binding site of 65 kDa, and the rest bound to a much smaller site of only about 3 kDa. In the large site, there was about 1 g atom of Mn/110 mol of chlorophyll in spinach thylakoids, which was constant in normally grown plants, although the Mn level in the small site depended on culture conditions. Thylakoids that had been incubated with hydroxylamine or in 0.8 M Tris lost Mn exclusively from the large binding site.

  16. Identification and characterization of anion binding sites in RNA

    SciTech Connect

    Kieft, Jeffrey S.; Chase, Elaine; Costantino, David A.; Golden, Barbara L.


    Although RNA molecules are highly negatively charged, anions have been observed bound to RNA in crystal structures. It has been proposed that anion binding sites found within isolated RNAs represent regions of the molecule that could be involved in intermolecular interactions, indicating potential contact points for negatively charged amino acids from proteins or phosphate groups from an RNA. Several types of anion binding sites have been cataloged based on available structures. However, currently there is no method for unambiguously assigning anions to crystallographic electron density, and this has precluded more detailed analysis of RNA-anion interaction motifs and their significance. We therefore soaked selenate into two different types of RNA crystals and used the anomalous signal from these anions to identify binding sites in these RNA molecules unambiguously. Examination of these sites and comparison with other suspected anion binding sites reveals features of anion binding motifs, and shows that selenate may be a useful tool for studying RNA-anion interactions.

  17. Ab initio prediction of transcription factor binding sites.


    Liu, L Angela; Bader, Joel S


    Transcription factors are DNA-binding proteins that control gene transcription by binding specific short DNA sequences. Experiments that identify transcription factor binding sites are often laborious and expensive, and the binding sites of many transcription factors remain unknown. We present a computational scheme to predict the binding sites directly from transcription factor sequence using all-atom molecular simulations. This method is a computational counterpart to recent high-throughput experimental technologies that identify transcription factor binding sites (ChIP-chip and protein-dsDNA binding microarrays). The only requirement of our method is an accurate 3D structural model of a transcription factor-DNA complex. We apply free energy calculations by thermodynamic integration to compute the change in binding energy of the complex due to a single base pair mutation. By calculating the binding free energy differences for all possible single mutations, we construct a position weight matrix for the predicted binding sites that can be directly compared with experimental data. As water-bridged hydrogen bonds between the transcription factor and DNA often contribute to the binding specificity, we include explicit solvent in our simulations. We present successful predictions for the yeast MAT-alpha2 homeodomain and GCN4 bZIP proteins. Water-bridged hydrogen bonds are found to be more prevalent than direct protein-DNA hydrogen bonds at the binding interfaces, indicating why empirical potentials with implicit water may be less successful in predicting binding. Our methodology can be applied to a variety of DNA-binding proteins. PMID:17990512

  18. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    SciTech Connect

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.; Stemmler, T.L.; Gil, J.A.; Mateos, L.M.; Rosen, B.P.


    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, and the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.

  19. Paramagnetic Ligand Tagging To Identify Protein Binding Sites

    PubMed Central


    Transient biomolecular interactions are the cornerstones of the cellular machinery. The identification of the binding sites for low affinity molecular encounters is essential for the development of high affinity pharmaceuticals from weakly binding leads but is hindered by the lack of robust methodologies for characterization of weakly binding complexes. We introduce a paramagnetic ligand tagging approach that enables localization of low affinity protein–ligand binding clefts by detection and analysis of intermolecular protein NMR pseudocontact shifts, which are invoked by the covalent attachment of a paramagnetic lanthanoid chelating tag to the ligand of interest. The methodology is corroborated by identification of the low millimolar volatile anesthetic interaction site of the calcium sensor protein calmodulin. It presents an efficient route to binding site localization for low affinity complexes and is applicable to rapid screening of protein–ligand systems with varying binding affinity. PMID:26289584

  20. RNA binding protein and binding site useful for expression of recombinant molecules


    Mayfield, Stephen


    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  1. RNA binding protein and binding site useful for expression of recombinant molecules


    Mayfield, Stephen P.


    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  2. Temperature and pressure adaptation of the binding site of acetylcholinesterase.


    Hochachka, P W


    1. Studies with a carbon substrate analogue, 3,3-dimethylbutyl acetate, indicate that the hydrophobic contribution to binding at the anionic site of acetylcholinesterase is strongly disrupted at low temperatures and high pressures. 2. Animals living in different physical environments circumvent this problem by adjusting the enthalpic and entropic contributions to binding. 3. An extreme example of this adaptational strategy is supplied by brain acetylcholinesterase extracted from an abyssal fish living at 2 degrees C and up to several hundred atmospheres of pressure. This acetylcholinesterase appears to have a smaller hydrophobic binding region in the anionic site, playing a measurably decreased role in ligand binding. PMID:4462739

  3. Druggability of methyl-lysine binding sites.


    Santiago, C; Nguyen, K; Schapira, M


    Structural modules that specifically recognize--or read--methylated or acetylated lysine residues on histone peptides are important components of chromatin-mediated signaling and epigenetic regulation of gene expression. Deregulation of epigenetic mechanisms is associated with disease conditions, and antagonists of acetyl-lysine binding bromodomains are efficacious in animal models of cancer and inflammation, but little is known regarding the druggability of methyl-lysine binding modules. We conducted a systematic structural analysis of readers of methyl marks and derived a predictive druggability landscape of methyl-lysine binding modules. We show that these target classes are generally less druggable than bromodomains, but that some proteins stand as notable exceptions. PMID:22146969

  4. Tryptophan-binding sites on nuclear envelopes of rat liver

    SciTech Connect

    Kurl, R.; Verney, E.; Sidransky, H.


    Tryptophan (TRP), an essential amino acid, has been demonstrated to affect certain cellular processes including transcriptional and translational events in the liver. These events are presumed to be mediated at the nuclear level possibly via binding of TRP to nuclei. In an effort to delineate the role of TRP on these metabolic processes, the nuclear location of these binding sites was investigated. Incubation of isolated, intact, hepatic nuclei with (/sup 3/H)TRP followed by fractionation revealed the presence of about 60% of specific TRP binding to nuclear membranes. This binding reached equilibrium by 2 hours after incubation at room temperature. Scatchard analysis revealed two classes of binding sites: (1) high affinity (K/sub D/ of about 10/sup -10/M) and (2) low affinity (K/sub D/ of about 10/sup -8/M). The inhibition of binding by treatment with either ..beta..-galactosidase or concanavalin A suggested that the binding entity was a glycoprotein. However, treatment with neuraminidase resulted in an increase in binding which suggested that terminal sialic acid residues play a role, possibly an inhibitory one, on TRP binding. The function of these binding sites on the mechanism of TRP action is being investigated.

  5. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    SciTech Connect

    Sloan, J.W.


    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) have been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.

  6. Evidence for a second receptor binding site on human prolactin.


    Goffin, V; Struman, I; Mainfroid, V; Kinet, S; Martial, J A


    The existence of a second receptor binding site on human prolactin (hPRL) was investigated by site-directed mutagenesis. First, 12 residues of helices 1 and 3 were mutated to alanine. Since none of the resulting mutants exhibit reduced bioactivity in the Nb2 cell proliferation bioassay, the mutated residues do not appear to be functionally necessary. Next, small residues surrounding the helix 1-helix 3 interface were replaced with Arg and/or Trp, the aim being to sterically hinder the second binding site. Several of these mutants exhibit only weak agonistic properties, supporting our hypothesis that the channel between helices 1 and 3 is involved in a second receptor binding site. We then analyzed the antagonistic and self-antagonistic properties of native hPRL and of several hPRLs analogs altered at binding site 1 or 2. Even at high concentrations (approximately 10 microM), no self-inhibition was observed with native hPRL; site 2 hPRL mutants self-antagonized while site 1 mutants did not. From these data, we propose a model of hPRL-PRL receptor interaction which slightly differs from that proposed earlier for the homologous human growth hormone (hGH) (Fuh, G., Cunningham, B. C., Fukunaga, R., Nagata, S., and Goeddel, D. V., and Well, J. A. (1992) Science 256, 1677-1680). Like hGH, hPRL would bind sequentially to two receptor molecules, first through site 1, then through site 2, but we would expect the two sites of hPRL to display, unlike the two binding sites of hGH, about the same binding affinity, thus preventing self-antagonism at high concentrations. PMID:7798264

  7. Binding sites associated with inhibition of photosystem II

    SciTech Connect

    Shipman, L.L.


    A variety of experimental and theoretical evidence has been integrated into coherent molecular mechanisms for the action of photosystem II herbicides. Photosystem II herbicides act by inhibiting electron transfers between the first and second plastoquinones on the reducing side of photosystem II. Each herbicide molecule must have a flat polar component with hydrophobic substituents to be active. The hydrophobic substituents serve to partition the molecule into lipid regions of the cell and to fit the hydrophobic region of the herbicide binding site. The flat polar portion of the herbicide is used for electrostatic binding to the polar region of the herbicide binding site. Theoretical calculations have been carried out to investigate the binding of herbicides to model proteinaceous binding sites.

  8. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan


    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  9. Autoradiographic localization of relaxin binding sites in rat brain

    SciTech Connect

    Osheroff, P.L.; Phillips, H.S. )


    Relaxin is a member of the insulin family of polypeptide hormones and exerts its best understood actions in the mammalian reproductive system. Using a biologically active 32P-labeled human relaxin, the authors have previously shown by in vitro autoradiography specific relaxin binding sites in rat uterus, cervix, and brain tissues. Using the same approach, they describe here a detailed localization of human relaxin binding sites in the rat brain. Displaceable relaxin binding sites are distributed in discrete regions of the olfactory system, neocortex, hypothalamus, hippocampus, thalamus, amygdala, midbrain, and medulla of the male and female rat brain. Characterization of the relaxin binding sites in the subfornical organ and neocortex reveals a single class of high-affinity sites (Kd = 1.4 nM) in both regions. The binding of relaxin to two of the circumventricular organs (subfornical organ and organum vasculosum of the lamina terminalis) and the neurosecretory magnocellular hypothalamic nuclei (i.e., paraventricular and supraoptic nuclei) provides the anatomical and biochemical basis for emerging physiological evidence suggesting a central role for relaxin in the control of blood pressure and hormone release. They conclude that specific, high-affinity relaxin binding sites are present in discrete regions of the rat brain and that the distribution of some of these sites may be consistent with a role for relaxin in control of vascular volume and blood pressure.

  10. Polypharmacology within CXCR4: Multiple binding sites and allosteric behavior

    NASA Astrophysics Data System (ADS)

    Planesas, Jesús M.; Pérez-Nueno, Violeta I.; Borrell, José I.; Teixidó, Jordi


    CXCR4 is a promiscuous receptor, which binds multiple diverse ligands. As usual in promiscuous proteins, CXCR4 has a large binding site, with multiple subsites, and high flexibility. Hence, it is not surprising that it is involved in the phenomenon of allosteric modulation. However, incomplete knowledge of allosteric ligand-binding sites has hampered an in-depth molecular understanding of how these inhibitors work. For example, it is known that lipidated fragments of intracellular GPCR loops, so called pepducins, such as pepducin ATI-2341, modulate CXCR4 activity using an agonist allosteric mechanism. Nevertheless, there are also examples of small organic molecules, such as AMD11070 and GSK812397, which may act as antagonist allosteric modulators. Here, we give new insights into this issue by proposing the binding interactions between the CXCR4 receptor and the above-mentioned allosteric modulators. We propose that CXCR4 has minimum two topographically different allosteric binding sites. One allosteric site would be in the intracellular loop 1 (ICL1) where pepducin ATI-2341 would bind to CXCR4, and the second one, in the extracellular side of CXCR4 in a subsite into the main orthosteric binding pocket, delimited by extracellular loops n° 1, 2, and the N-terminal end, where antagonists AMD11070 and GSK812397 would bind. Prediction of allosteric interactions between CXCR4 and pepducin ATI-2341 were studied first by rotational blind docking to determine the main binding region and a subsequent refinement of the best pose was performed using flexible docking methods and molecular dynamics. For the antagonists AMD11070 and GSK812397, the entire CXCR4 protein surface was explored by blind docking to define the binding region. A second docking analysis by subsites of the identified binding region was performed to refine the allosteric interactions. Finally, we identified the binding residues that appear to be essential for CXCR4 (agonists and antagonists) allosteric

  11. Development of cholecystokinin binding sites in rat upper gastrointestinal tract

    SciTech Connect

    Robinson, P.H.; Moran, T.H.; Goldrich, M.; McHugh, P.R.


    Autoradiography using /sup 125/I-labeled Bolton Hunter-CCK-33 was used to study the distribution of cholecystokinin binding sites at different stages of development in the rat upper gastrointestinal tract. Cholecystokinin (CCK) binding was present in the distal stomach, esophagus, and gastroduodenal junction in the rat fetus of gestational age of 17 days. In the 20-day fetus, specific binding was found in the gastric mucosa, antral circular muscle, and pyloric sphincter. Mucosal binding declined during postnatal development and had disappeared by day 15. Antral binding declined sharply between day 10 and day 15 and disappeared by day 50. Pyloric muscle binding was present in fetal stomach and persisted in the adult. Pancreatic CCK binding was not observed before day 10. These results suggest that CCK may have a role in the control of gastric emptying and ingestive behavior in the neonatal rat.

  12. Opioid binding sites in the guinea pig and rat kidney: Radioligand homogenate binding and autoradiography

    SciTech Connect

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C. )


    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE bound with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.

  13. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    SciTech Connect

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.


    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  14. Binding sites for gonadotropins in human postmenopausal ovaries

    SciTech Connect

    Nakano, R.; Shima, K.; Yamoto, M.; Kobayashi, M.; Nishimori, K.; Hiraoka, J.


    The binding of human LH and human FSH to postmenopausal ovarian tissue from 21 patients with cervical carcinoma was analyzed. The binding sites for FSH and LH were demonstrated in postmenopausal ovarian tissue. The surface-binding sites for gonadotropins were localized in the cells of cortical stroma of the postmenopausal ovary. In addition, diffuse cytoplasmic staining of endogenous estrogen and 3 beta-hydroxysteroid dehydrogenase activity were detected immunohistochemically and histochemically in the cells of the cortical stroma. Electron microscopic study also suggested steroidogenic function in the cells of the cortical stroma. The results of the present study suggest that postmenopausal ovaries contain specific binding sites for pituitary gonadotropins and play a role in ovarian steroidogenesis.

  15. Partial characterization of specific cantharidin binding sites in mouse tissues

    SciTech Connect

    Graziano, M.J.; Pessah, I.N.; Matsuzawa, M.; Casida, J.E.


    The mode of action of cantharidin, the natural vesicant of blister beetles, is examined by radioligand binding studies with mouse tissues. (3H)Cantharidin undergoes specific and saturable binding with the liver cytosol, which is characterized as follows: Kd and Bmax values of 30 nM and 1.8 pmol/mg of protein, respectively; linearity with respect to protein concentration; pH optimum of 6.5 to 7.5; association and dissociation half-times of 20 min and 12 hr, respectively; and 50% inhibition by Mg2+ at 70 microM, Ca2+ at 224 microM, pyrophosphate at 27 microM, and nucleotide triphosphates at 52-81 microM. The binding site undergoes a loss of activity at 45 degrees or higher. The toxicological relevance of this specific (3H)cantharidin binding site of mouse liver cytosol is established in three ways. First, the potency of 15 active cantharidin analogs for inhibiting (3H)cantharidin binding is correlated with their acute toxicity to mice (r = 0.829). Second, 26 related compounds that are inactive in inhibiting (3H)cantharidin binding are also of little or no toxicity to mice. Finally, the binding of (3H) cantharidin to liver cytosol from mice poisoned with increasing amounts of unlabeled cantharidin is inhibited in a dose-dependent manner. (3H)Cantharidin also specifically binds to cytosol fractions of blood, brain, heart, kidney, lung, pancreas, skin, spleen, and stomach. The characteristics of the specific binding site in brain are very similar to those determined in liver with respect to Kd, Bmax, association/dissociation kinetics, and sensitivity to inhibitors. It therefore appears that the toxicity of cantharidin and related oxabicycloheptanes, including the herbicide endothal, is attributable to binding at a specific site in liver and possibly other tissues.

  16. Functional conservation of Rel binding sites in drosophilid genomes

    PubMed Central

    Copley, Richard R.; Totrov, Maxim; Linnell, Jane; Field, Simon; Ragoussis, Jiannis; Udalova, Irina A.


    Evolutionary constraints on gene regulatory elements are poorly understood: Little is known about how the strength of transcription factor binding correlates with DNA sequence conservation, and whether transcription factor binding sites can evolve rapidly while retaining their function. Here we use the model of the NFKB/Rel-dependent gene regulation in divergent Drosophila species to examine the hypothesis that the functional properties of authentic transcription factor binding sites are under stronger evolutionary constraints than the genomic background. Using molecular modeling we compare tertiary structures of the Drosophila Rel family proteins Dorsal, Dif, and Relish and demonstrate that their DNA-binding and protein dimerization domains undergo distinct rates of evolution. The accumulated amino acid changes, however, are unlikely to affect DNA sequence recognition and affinity. We employ our recently developed microarray-based experimental platform and principal coordinates statistical analysis to quantitatively and systematically profile DNA binding affinities of three Drosophila Rel proteins to 10,368 variants of the NFKB recognition sequences. We then correlate the evolutionary divergence of gene regulatory regions with differences in DNA binding affinities. Genome-wide analyses reveal a significant increase in the number of conserved Rel binding sites in promoters of developmental and immune genes. Significantly, the affinity of Rel proteins to these sites was higher than to less conserved sites and was maintained by the conservation of the DNA binding site sequence (static conservation) or in some cases despite significantly diverged sequences (dynamic conservation). We discuss how two types of conservation may contribute to the stabilization and optimization of a functional gene regulatory code in evolution. PMID:17785540

  17. Perturbation Approaches for Exploring Protein Binding Site Flexibility to Predict Transient Binding Pockets.


    Kokh, Daria B; Czodrowski, Paul; Rippmann, Friedrich; Wade, Rebecca C


    Simulations of the long-time scale motions of a ligand binding pocket in a protein may open up new perspectives for the design of compounds with steric or chemical properties differing from those of known binders. However, slow motions of proteins are difficult to access using standard molecular dynamics (MD) simulations and are thus usually neglected in computational drug design. Here, we introduce two nonequilibrium MD approaches to identify conformational changes of a binding site and detect transient pockets associated with these motions. The methods proposed are based on the rotamerically induced perturbation (RIP) MD approach, which employs perturbation of side-chain torsional motion for initiating large-scale protein movement. The first approach, Langevin-RIP (L-RIP), entails a series of short Langevin MD simulations, each starting with perturbation of one of the side-chains lining the binding site of interest. L-RIP provides extensive sampling of conformational changes of the binding site. In less than 1 ns of MD simulation with L-RIP, we observed distortions of the α-helix in the ATP binding site of HSP90 and flipping of the DFG loop in Src kinase. In the second approach, RIPlig, a perturbation is applied to a pseudoligand placed in different parts of a binding pocket, which enables flexible regions of the binding site to be identified in a small number of 10 ps MD simulations. The methods were evaluated for four test proteins displaying different types and degrees of binding site flexibility. Both methods reveal all transient pocket regions in less than a total of 10 ns of simulations, even though many of these regions remained closed in 100 ns conventional MD. The proposed methods provide computationally efficient tools to explore binding site flexibility and can aid in the functional characterization of protein pockets, and the identification of transient pockets for ligand design. PMID:27399277

  18. Estrophilin immunoreactivity versus estrogen receptor binding activity in meningiomas: evidence for multiple estrogen binding sites

    SciTech Connect

    Lesch, K.P.; Schott, W.; Gross, S.


    The existence of estrogen receptors in human meningiomas has long been a controversial issue. This may be explained, in part, by apparent heterogeneity of estrogen binding sites in meningioma tissue. In this study, estrogen receptors were determined in 58 meningiomas with an enzyme immunoassay using monoclonal antibodies against human estrogen receptor protein (estrophilin) and with a sensitive radioligand binding assay using /sup 125/I-labeled estradiol (/sup 125/I-estradiol) as radioligand. Low levels of estrophilin immunoreactivity were found in tumors from 62% of patients, whereas radioligand binding activity was demonstrated in about 46% of the meningiomas examined. In eight (14%) tissue samples multiple binding sites for estradiol were observed. The immunoreactive binding sites correspond to the classical, high affinity estrogen receptors: the Kd for /sup 125/I-estradiol binding to the receptor was approximately 0.2 nM and the binding was specific for estrogens. The second, low affinity class of binding sites considerably influenced measurement of the classical receptor even at low ligand concentrations. The epidemiological and clinical data from patients with meningiomas, and the existence of specific estrogen receptors confirmed by immunochemical detection, may be important factors in a theory of oncogenesis.

  19. The TRPV5/6 calcium channels contain multiple calmodulin binding sites with differential binding properties.


    Kovalevskaya, Nadezda V; Bokhovchuk, Fedir M; Vuister, Geerten W


    The epithelial Ca(2+) channels TRPV5/6 (transient receptor potential vanilloid 5/6) are thoroughly regulated in order to fine-tune the amount of Ca(2+) reabsorption. Calmodulin has been shown to be involved into calcium-dependent inactivation of TRPV5/6 channels by binding directly to the distal C-terminal fragment of the channels (de Groot et al. in Mol Cell Biol 31:2845-2853, 12). Here, we investigate this binding in detail and find significant differences between TRPV5 and TRPV6. We also identify and characterize in vitro four other CaM binding fragments of TRPV5/6, which likely are also involved in TRPV5/6 channel regulation. The five CaM binding sites display diversity in binding modes, binding stoichiometries and binding affinities, which may fine-tune the response of the channels to varying Ca(2+)-concentrations. PMID:22354706

  20. SiteOut: An Online Tool to Design Binding Site-Free DNA Sequences

    PubMed Central

    Scholes, Clarissa; Wunderlich, Zeba; DePace, Angela H.


    DNA-binding proteins control many fundamental biological processes such as transcription, recombination and replication. A major goal is to decipher the role that DNA sequence plays in orchestrating the binding and activity of such regulatory proteins. To address this goal, it is useful to rationally design DNA sequences with desired numbers, affinities and arrangements of protein binding sites. However, removing binding sites from DNA is computationally non-trivial since one risks creating new sites in the process of deleting or moving others. Here we present an online binding site removal tool, SiteOut, that enables users to design arbitrary DNA sequences that entirely lack binding sites for factors of interest. SiteOut can also be used to delete sites from a specific sequence, or to introduce site-free spacers between functional sequences without creating new sites at the junctions. In combination with commercial DNA synthesis services, SiteOut provides a powerful and flexible platform for synthetic projects that interrogate regulatory DNA. Here we describe the algorithm and illustrate the ways in which SiteOut can be used; it is publicly available at PMID:26987123


    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.


    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  2. Identification and characterization of anion binding sites in RNA.


    Kieft, Jeffrey S; Chase, Elaine; Costantino, David A; Golden, Barbara L


    Although RNA molecules are highly negatively charged, anions have been observed bound to RNA in crystal structures. It has been proposed that anion binding sites found within isolated RNAs represent regions of the molecule that could be involved in intermolecular interactions, indicating potential contact points for negatively charged amino acids from proteins or phosphate groups from an RNA. Several types of anion binding sites have been cataloged based on available structures. However, currently there is no method for unambiguously assigning anions to crystallographic electron density, and this has precluded more detailed analysis of RNA-anion interaction motifs and their significance. We therefore soaked selenate into two different types of RNA crystals and used the anomalous signal from these anions to identify binding sites in these RNA molecules unambiguously. Examination of these sites and comparison with other suspected anion binding sites reveals features of anion binding motifs, and shows that selenate may be a useful tool for studying RNA-anion interactions. PMID:20410239

  3. Penicillin-binding site on the Escherichia coli cell envelope

    SciTech Connect

    Amaral, L.; Lee, Y.; Schwarz, U.; Lorian, V.


    The binding of /sup 35/S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and free epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin.

  4. Evidence for chemoreceptors with bimodular ligand-binding regions harboring two signal-binding sites

    PubMed Central

    Pineda-Molina, Estela; Reyes-Darias, José-Antonio; Lacal, Jesús; Ramos, Juan L.; García-Ruiz, Juan Manuel; Gavira, Jose A.; Krell, Tino


    Chemoreceptor-based signaling is a central mechanism in bacterial signal transduction. Receptors are classified according to the size of their ligand-binding region. The well-studied cluster I proteins have a 100- to 150-residue ligand-binding region that contains a single site for chemoattractant recognition. Cluster II receptors, which contain a 220- to 300-residue ligand-binding region and which are almost as abundant as cluster I receptors, remain largely uncharacterized. Here, we report high-resolution structures of the ligand-binding region of the cluster II McpS chemotaxis receptor (McpS-LBR) of Pseudomonas putida KT2440 in complex with different chemoattractants. The structure of McpS-LBR represents a small-molecule binding domain composed of two modules, each able to bind different signal molecules. Malate and succinate were found to bind to the membrane-proximal module, whereas acetate binds to the membrane-distal module. A structural alignment of the two modules revealed that the ligand-binding sites could be superimposed and that amino acids involved in ligand recognition are conserved in both binding sites. Ligand binding to both modules was shown to trigger chemotactic responses. Further analysis showed that McpS-like receptors were found in different classes of proteobacteria, indicating that this mode of response to different carbon sources may be universally distributed. The physiological relevance of the McpS architecture may lie in its capacity to respond with high sensitivity to the preferred carbon sources malate and succinate and, at the same time, mediate lower sensitivity responses to the less preferred but very abundant carbon source acetate. PMID:23112148

  5. Allosteric interaction of trimebutine maleate with dihydropyridine binding sites.


    Nagasaki, M; Kurosawa, H; Naito, K; Tamaki, H


    The effects of trimebutine maleate on [3H]nitrendipine binding to guinea-pig ileal smooth muscle membranes and Ca2(+)-induced contraction of the taenia cecum were studied. Specific binding of [3H]nitrendipine to smooth muscle membranes was saturable, with a KD value and maximum number of binding sites (Bmax) of 0.16 nM and 1070 fmol/mg protein, respectively. Trimebutine inhibited [3H]nitrendipine binding in a concentration-dependent manner with a Ki value of 9.3 microM. In the presence of trimebutine (10 microM), Scatchard analysis indicated a competitive-like inhibition with a decrease in the binding affinity (0.31 nM) without a change in Bmax (1059 fmol/mg protein). However, a dissociation experiment using trimebutine (10 or 100 microM) showed that the decreased affinity was due to an increase of the dissociation rate constant of [3H]nitrendipine binding to the membrane. In mechanical experiments using the taenia cecum, trimebutine (3-30 microM) caused a parallel rightward shift of the dose-response curve for the contractile response to a higher concentration range of Ca2+ under high-K+ conditions in a noncompetitive manner. These results suggest that trimebutine has negative allosteric interactions with 1,4-dihydropyridine binding sites on voltage-dependent Ca2+ channels and antagonizes Ca2+ influx, consequently inhibiting contractions of intestinal smooth muscle. PMID:2171963

  6. Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

    SciTech Connect

    Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.; Janis, R.A. State Univ. of New York, Buffalo )


    The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{sup 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.

  7. Identification of the endothelial cell binding site for factor IX.

    PubMed Central

    Cheung, W F; van den Born, J; Kühn, K; Kjellén, L; Hudson, B G; Stafford, D W


    We previously demonstrated that the primary region of factor IX and IXa responsible for saturable specific binding to bovine aortic endothelial cells resides in residues 3-11 at the amino terminus of factor IX. We also demonstrated that mutations of lysine to alanine at residue 5, factor IX K5A, or valine to lysine at residue 10, factor IX V10K, resulted in a molecule unable to bind to endothelial cells. Moreover, a mutation with lysine to arginine at residue 5, factor IX K5R, resulted in a factor IX molecule with increased affinity for the endothelial cell binding site. In this paper we report that collagen IV is a strong candidate for the factor IX binding site on endothelial cells. Factor IX and factor IX K5R compete with 125I-labeled factor IX for binding to tetrameric collagen IV immobilized on microtiter plates, while factor X, factor VII, and factor IX K5A or V10K fail to compete. The Kd for wild-type factor IX binding to collagen IV in the presence of heparin was 6.8 +/- 2 nM, and the Kd for factor IX K5R was 1.1 +/- 0.2 nM, which agrees well with our previously published Kd values of 7.4 and 2.4 nM for binding of the same proteins to endothelial cells. Our working assumption is that we have identified the endothelial cell binding site and that it is collagen IV. Its physiological relevance remains to be determined. PMID:8855310

  8. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.


    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  9. The RNA binding site of bacteriophage MS2 coat protein.

    PubMed Central

    Peabody, D S


    The coat protein of the RNA bacteriophage MS2 binds a specific stem-loop structure in viral RNA to accomplish encapsidation of the genome and translational repression of replicase synthesis. In order to identify the structural components of coat protein required for its RNA binding function, a series of repressor-defective mutants has been isolated. To ensure that the repressor defects were due to substitution of binding site residues, the mutant coat proteins were screened for retention of the ability to form virus-like particles. Since virus assembly presumably requires native structure, this approach eliminated mutants whose repressor defects were secondary consequences of protein folding or stability defects. Each of the variant coat proteins was purified and its ability to bind operator RNA in vitro was measured. DNA sequence analysis identified the nucleotide and amino acid substitutions responsible for reduced RNA binding affinity. Localization of the substituted sites in the three-dimensional structure of coat protein reveals that amino acid residues on three adjacent strands of the coat protein beta-sheet are required for translational repression and RNA binding. The sidechains of the affected residues form a contiguous patch on the interior surface of the viral coat. Images PMID:8440248

  10. Eel calcitonin binding site distribution and antinociceptive activity in rats

    SciTech Connect

    Guidobono, F.; Netti, C.; Sibilia, V.; Villa, I.; Zamboni, A.; Pecile, A.


    The distribution of binding site for (/sup 125/I)-eel-calcitonin (ECT) to rat central nervous system, studied by an autoradiographic technique, showed concentrations of binding in the diencephalon, the brain stem and the spinal cord. Large accumulations of grains were seen in the hypothalamus, the amygdala, in the fasciculus medialis prosencephali, in the fasciculus longitudinalis medialis, in the ventrolateral part of the periventricular gray matter, in the lemniscus medialis and in the raphe nuclei. The density of grains in the reticular formation and in the nucleus tractus spinalis nervi trigemini was more moderate. In the spinal cord, grains were scattered throughout the dorsal horns. Binding of the ligand was displaced equally by cold ECT and by salmon CT(sCT), indicating that both peptides bind to the same receptors. Human CT was much weaker than sCT in displacing (/sup 125/I)-ECT binding. The administration of ECT into the brain ventricles of rats dose-dependently induced a significant and long-lasting enhancement of hot-plate latencies comparable with that obtained with sCT. The antinociceptive activity induced by ECT is compatible with the topographical distribution of binding sites for the peptide and is a further indication that fish CTs are active in the mammalian brain.

  11. Specific binding sites for muramyl peptides on murine macrophages

    SciTech Connect

    Silverman, D.H.S.; Krueger, J.M.; Karnovsky, M.L.


    Two radiolabeled (/sup 125/I) muramyl peptide derivatives of high specific activity were prepared: a tripeptide with an iodinated C-terminal tyrosine methyl ester (Ligand I), and a muramyl tripeptide with a C-terminal lysine derivatized with Bolton-Hunter reagent (Ligand II). These were used to characterize binding of muramyl peptides to monolayers of murine macrophages. Saturable high-affinity binding to resident, caseinate-elicited, and Listeria-activated peritoneal cells was observed with both radioligands. Binding affinities varied with the state of activation of the macrophages, and K/sub D/ values ranged from 48 +/- 33 pM (for resident macrophages, Ligand I) to 1020 +/- 90 pM (for activated macrophages, Ligand II). Specific binding sites were also found on a macrophage-derived cell line. The ability of several unlabeled muramyl peptides to compete with Ligands I and II for their binding sites was tested. Competition was stereospecific and correlated with known biological activities of these compounds (i.e., immunoadjuvanticity, pyrogenicity, and somnogenicity). The sites identified here for Ligands I and II may mediate some of the effects that muramyl peptides have previously been demonstrated to have on macrophages.

  12. Characterization of Heparin-binding Site of Tissue Transglutaminase

    PubMed Central

    Wang, Zhuo; Collighan, Russell J.; Pytel, Kamila; Rathbone, Daniel L.; Li, Xiaoling; Griffin, Martin


    Tissue transglutaminase (TG2) is a multifunctional Ca2+-activated protein cross-linking enzyme secreted into the extracellular matrix (ECM), where it is involved in wound healing and scarring, tissue fibrosis, celiac disease, and metastatic cancer. Extracellular TG2 can also facilitate cell adhesion important in wound healing through a nontransamidating mechanism via its association with fibronectin, heparan sulfates (HS), and integrins. Regulating the mechanism how TG2 is translocated into the ECM therefore provides a strategy for modulating these physiological and pathological functions of the enzyme. Here, through molecular modeling and mutagenesis, we have identified the HS-binding site of TG2 202KFLKNAGRDCSRRSSPVYVGR222. We demonstrate the requirement of this binding site for translocation of TG2 into the ECM through a mechanism involving cell surface shedding of HS. By synthesizing a peptide NPKFLKNAGRDCSRRSS corresponding to the HS-binding site within TG2, we also demonstrate how this mimicking peptide can in isolation compensate for the RGD-induced loss of cell adhesion on fibronectin via binding to syndecan-4, leading to activation of PKCα, pFAK-397, and ERK1/2 and the subsequent formation of focal adhesions and actin cytoskeleton organization. A novel regulatory mechanism for TG2 translocation into the extracellular compartment that depends upon TG2 conformation and the binding of HS is proposed. PMID:22298777

  13. Functional differences between neurotransmitter binding sites of muscle acetylcholine receptors

    PubMed Central

    Nayak, Tapan K.; Bruhova, Iva; Chakraborty, Srirupa; Gupta, Shaweta; Zheng, Wenjun; Auerbach, Anthony


    A muscle acetylcholine receptor (AChR) has two neurotransmitter binding sites located in the extracellular domain, at αδ and either αε (adult) or αγ (fetal) subunit interfaces. We used single-channel electrophysiology to measure the effects of mutations of five conserved aromatic residues at each site with regard to their contribution to the difference in free energy of agonist binding to active versus resting receptors (ΔGB1). The two binding sites behave independently in both adult and fetal AChRs. For four different agonists, including ACh and choline, ΔGB1 is ∼−2 kcal/mol more favorable at αγ compared with at αε and αδ. Only three of the aromatics contribute significantly to ΔGB1 at the adult sites (αY190, αY198, and αW149), but all five do so at αγ (as well as αY93 and γW55). γW55 makes a particularly large contribution only at αγ that is coupled energetically to those contributions of some of the α-subunit aromatics. The hydroxyl and benzene groups of loop C residues αY190 and αY198 behave similarly with regard to ΔGB1 at all three kinds of site. ACh binding energies estimated from molecular dynamics simulations are consistent with experimental values from electrophysiology and suggest that the αγ site is more compact, better organized, and less dynamic than αε and αδ. We speculate that the different sensitivities of the fetal αγ site versus the adult αε and αδ sites to choline and ACh are important for the proper maturation and function of the neuromuscular synapse. PMID:25422413

  14. Thymocyte plasma membrane: the location of specific glucocorticoid binding sites

    SciTech Connect

    Sergeev, P.V.; Kalinin, G.V.; Dukhanin, A.S.


    In modern molecular endocrinology it is now possible to determine the localization of receptors for biologically active substances with the aid of ligands, with high affinity for the receptor, immobilized on polymers. The purpose of this paper is to study the ability of hydrocortisone (HC), immobilized on polyvinylpyrrolidone (PVP-HC), to reduce binding of tritium-HC by thymocytes of adrenalectomized rats. It is determined that specific binding sites for HC on rat thymocytes are also accessible for PVP-HC, which, due to the fact that this immobilized version of HC does not penetrate into the cell, leads to the conclusion that the binding sites for HC itself are located in the plasma membrane.

  15. CLIPZ: a database and analysis environment for experimentally determined binding sites of RNA-binding proteins

    PubMed Central

    Khorshid, Mohsen; Rodak, Christoph; Zavolan, Mihaela


    The stability, localization and translation rate of mRNAs are regulated by a multitude of RNA-binding proteins (RBPs) that find their targets directly or with the help of guide RNAs. Among the experimental methods for mapping RBP binding sites, cross-linking and immunoprecipitation (CLIP) coupled with deep sequencing provides transcriptome-wide coverage as well as high resolution. However, partly due to their vast volume, the data that were so far generated in CLIP experiments have not been put in a form that enables fast and interactive exploration of binding sites. To address this need, we have developed the CLIPZ database and analysis environment. Binding site data for RBPs such as Argonaute 1-4, Insulin-like growth factor II mRNA-binding protein 1-3, TNRC6 proteins A-C, Pumilio 2, Quaking and Polypyrimidine tract binding protein can be visualized at the level of the genome and of individual transcripts. Individual users can upload their own sequence data sets while being able to limit the access to these data to specific users, and analyses of the public and private data sets can be performed interactively. CLIPZ, available at, aims to provide an open access repository of information for post-transcriptional regulatory elements. PMID:21087992

  16. Reliable prediction of transcription factor binding sites by phylogenetic verification.


    Li, Xiaoman; Zhong, Sheng; Wong, Wing H


    We present a statistical methodology that largely improves the accuracy in computational predictions of transcription factor (TF) binding sites in eukaryote genomes. This method models the cross-species conservation of binding sites without relying on accurate sequence alignment. It can be coupled with any motif-finding algorithm that searches for overrepresented sequence motifs in individual species and can increase the accuracy of the coupled motif-finding algorithm. Because this method is capable of accurately detecting TF binding sites, it also enhances our ability to predict the cis-regulatory modules. We applied this method on the published chromatin immunoprecipitation (ChIP)-chip data in Saccharomyces cerevisiae and found that its sensitivity and specificity are 9% and 14% higher than those of two recent methods. We also recovered almost all of the previously verified TF binding sites and made predictions on the cis-regulatory elements that govern the tight regulation of ribosomal protein genes in 13 eukaryote species (2 plants, 4 yeasts, 2 worms, 2 insects, and 3 mammals). These results give insights to the transcriptional regulation in eukaryotic organisms. PMID:16286651

  17. Can cofactor-binding sites in proteins be flexible? Desulfovibrio desulfuricans flavodoxin binds FMN dimer.


    Muralidhara, B K; Wittung-Stafshede, Pernilla


    Flavodoxins catalyze redox reactions using the isoalloxazine moiety of the flavin mononucleotide (FMN) cofactor stacked between two aromatic residues located in two peptide loops. At high FMN concentrations that favor stacked FMN dimers in solution, isothermal titration calorimetric studies show that these dimers bind strongly to apo-flavodoxin from Desulfovibrio desulfuricans (30 degrees C, 20 mM Hepes, pH 7, K(D) = 5.8 microM). Upon increasing the temperature so the FMN dimers dissociate (as shown by (1)H NMR), only one-to-one (FMN-to-protein) binding is observed. Calorimetric titrations result in one-to-one binding also in the presence of phosphate or sulfate (30 degrees C, 13 mM anion, pH 7, K(D) = 0.4 microM). FMN remains dimeric in the presence of phosphate and sulfate, suggesting that specific binding of a divalent anion to the phosphate-binding site triggers ordering of the peptide loops so only one isoalloxazine can fit. Although the physiological relevance of FMN and other nucleotides as dimers has not been explored, our study shows that high-affinity binding to proteins of such dimers can occur in vitro. This emphasizes that the cofactor-binding site in flavodoxin is more flexible than previously expected. PMID:14596623

  18. Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites

    PubMed Central

    Savic, Daniel; Roberts, Brian S.; Carleton, Julia B.; Partridge, E. Christopher; White, Michael A.; Cohen, Barak A.; Cooper, Gregory M.; Gertz, Jason; Myers, Richard M.


    Transcription factors (TFs) bind to thousands of DNA sequences in mammalian genomes, but most of these binding events appear to have no direct effect on gene expression. It is unclear why only a subset of TF bound sites are actively involved in transcriptional regulation. Moreover, the key genomic features that accurately discriminate between active and inactive TF binding events remain ambiguous. Recent studies have identified promoter-distal RNA polymerase II (RNAP2) binding at enhancer elements, suggesting that these interactions may serve as a marker for active regulatory sequences. Despite these correlative analyses, a thorough functional validation of these genomic co-occupancies is still lacking. To characterize the gene regulatory activity of DNA sequences underlying promoter-distal TF binding events that co-occur with RNAP2 and TF sites devoid of RNAP2 occupancy using a functional reporter assay, we performed cis-regulatory element sequencing (CRE-seq). We tested more than 1000 promoter-distal CCAAT/enhancer-binding protein beta (CEBPB)-bound sites in HepG2 and K562 cells, and found that CEBPB-bound sites co-occurring with RNAP2 were more likely to exhibit enhancer activity. CEBPB-bound sites further maintained substantial cell-type specificity, indicating that local DNA sequence can accurately convey cell-type–specific regulatory information. By comparing our CRE-seq results to a comprehensive set of genome annotations, we identified a variety of genomic features that are strong predictors of regulatory element activity and cell-type–specific activity. Collectively, our functional assay results indicate that RNAP2 occupancy can be used as a key genomic marker that can distinguish active from inactive TF bound sites. PMID:26486725

  19. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  20. The human "magnesome": detecting magnesium binding sites on human proteins

    PubMed Central


    Background Magnesium research is increasing in molecular medicine due to the relevance of this ion in several important biological processes and associated molecular pathogeneses. It is still difficult to predict from the protein covalent structure whether a human chain is or not involved in magnesium binding. This is mainly due to little information on the structural characteristics of magnesium binding sites in proteins and protein complexes. Magnesium binding features, differently from those of other divalent cations such as calcium and zinc, are elusive. Here we address a question that is relevant in protein annotation: how many human proteins can bind Mg2+? Our analysis is performed taking advantage of the recently implemented Bologna Annotation Resource (BAR-PLUS), a non hierarchical clustering method that relies on the pair wise sequence comparison of about 14 millions proteins from over 300.000 species and their grouping into clusters where annotation can safely be inherited after statistical validation. Results After cluster assignment of the latest version of the human proteome, the total number of human proteins for which we can assign putative Mg binding sites is 3,751. Among these proteins, 2,688 inherit annotation directly from human templates and 1,063 inherit annotation from templates of other organisms. Protein structures are highly conserved inside a given cluster. Transfer of structural properties is possible after alignment of a given sequence with the protein structures that characterise a given cluster as obtained with a Hidden Markov Model (HMM) based procedure. Interestingly a set of 370 human sequences inherit Mg2+ binding sites from templates sharing less than 30% sequence identity with the template. Conclusion We describe and deliver the "human magnesome", a set of proteins of the human proteome that inherit putative binding of magnesium ions. With our BAR-hMG, 251 clusters including 1,341 magnesium binding protein structures

  1. Variable structure motifs for transcription factor binding sites

    PubMed Central


    Background Classically, models of DNA-transcription factor binding sites (TFBSs) have been based on relatively few known instances and have treated them as sites of fixed length using position weight matrices (PWMs). Various extensions to this model have been proposed, most of which take account of dependencies between the bases in the binding sites. However, some transcription factors are known to exhibit some flexibility and bind to DNA in more than one possible physical configuration. In some cases this variation is known to affect the function of binding sites. With the increasing volume of ChIP-seq data available it is now possible to investigate models that incorporate this flexibility. Previous work on variable length models has been constrained by: a focus on specific zinc finger proteins in yeast using restrictive models; a reliance on hand-crafted models for just one transcription factor at a time; and a lack of evaluation on realistically sized data sets. Results We re-analysed binding sites from the TRANSFAC database and found motivating examples where our new variable length model provides a better fit. We analysed several ChIP-seq data sets with a novel motif search algorithm and compared the results to one of the best standard PWM finders and a recently developed alternative method for finding motifs of variable structure. All the methods performed comparably in held-out cross validation tests. Known motifs of variable structure were recovered for p53, Stat5a and Stat5b. In addition our method recovered a novel generalised version of an existing PWM for Sp1 that allows for variable length binding. This motif improved classification performance. Conclusions We have presented a new gapped PWM model for variable length DNA binding sites that is not too restrictive nor over-parameterised. Our comparison with existing tools shows that on average it does not have better predictive accuracy than existing methods. However, it does provide more interpretable

  2. Targeting Different Transthyretin Binding Sites with Unusual Natural Compounds.


    Ortore, Gabriella; Orlandini, Elisabetta; Braca, Alessandra; Ciccone, Lidia; Rossello, Armando; Martinelli, Adriano; Nencetti, Susanna


    Misfolding and aggregation of the transthyretin (TTR) protein leads to certain forms of amyloidosis. Some nutraceuticals, such as flavonoids and natural polyphenols, have recently been investigated as modulators of the self-assembly process of TTR, but they generally suffer from limited bioavailability. To discover innovative and more bioavailable natural compounds able to inhibit TTR amyloid formation, a docking study was performed using the crystallographic structure of TTR. This computational strategy was projected as an ad hoc inspection of the possible relationship between binding site location and modulation of the assembly process; interactions with the as-yet-unexplored epigallocatechin gallate (EGCG) sites and with the thyroxine (T4) pocket were simultaneously analyzed. All the compounds studied seem to prefer the traditional T4 binding site, but some interesting results emerged from the screening of an in-house database, used for validating the computational protocol, and of the Herbal Ingredients Targets (HIT) catalogue available on the ZINC database. PMID:27159149

  3. Predicting ligand binding affinity with alchemical free energy methods in a polar model binding site

    PubMed Central

    Boyce, Sarah E.; Mobley, David L.; Rocklin, Gabriel; Graves, Alan P.


    We present a combined experimental and modeling study of organic ligand molecules binding to a slightly polar engineered cavity site in T4 lysozyme (L99A/M102Q). For modeling, we computed alchemical absolute binding free energies. These were blind tests performed prospectively on 13 diverse, previously untested candidate ligand molecules. We predicted that eight compounds would bind to the cavity and five would not; 11 of 13 predictions were correct at this level. The RMS error to the measurable absolute binding energies was 1.8 kcal/mol. In addition, we computed relative binding free energies for six phenol derivatives starting from two known ligands: phenol and catechol. The average RMS error in the relative free energy prediction was 2.5 (phenol) and 1.1 (catechol) kcal/mol. To understand these results at atomic resolution, we obtained x-ray co-complex structures for nine of the diverse ligands and for all six phenol analogs. The average RMSD of the predicted pose to the experiment was 2.0Å (diverse set), 1.8Å (phenol derived predictions) and 1.2Å (catechol derived predictions). We found that to predict accurate affinities and rank-orderings required near-native starting orientations of the ligand in the binding site. Unanticipated binding modes, multiple ligand binding, and protein conformational change all proved challenging for the free energy methods. We believe these results can help guide future improvements in physics-based absolute binding free energy methods. PMID:19782087

  4. Ligand binding sites of Na,K-ATPase.


    Lingrel, J B; Croyle, M L; Woo, A L; Argüello, J M


    Our studies have concentrated on two aspects of the Na,K-ATPase, the first relates to the identification of amino acids involved in binding Na+ and K+ during the catalytic cycle and the second involves defining how cardiac glycosides inhibit the enzyme. To date, three amino acids, Ser775, Asp804 and Asp808, all located in transmembrane regions five and six, have been shown to play a major role in K+ binding. These findings are based on site directed mutagenesis and expression studies. In order to understand how cardiac glycosides interact with the Na,K-ATPase, studies again involving mutagenesis coupled with expression have been used. More specifically, amino acid residues have been substituted in an ouabain sensitive alpha subunit using random mutagenesis, and the ability of the resulting enzyme to confer resistance to ouabain sensitive cells was determined. Interestingly, the amino acids of the alpha subunit which alter ouabain sensitivity cluster in two major regions, one comprised of the first and second transmembrane spanning domains and the extracellular loop joining them, and the second formed by the extracellular halves of transmembrane regions four, five, six and seven. As noted above, transmembrane regions five and six also contain the three amino acid residues Ser775, Asp804 and Asp808 which play a key role in cation transport, possibly binding K+. Thus, it is reasonable to propose that cardiac glycosides bind to two sites, the N- terminal region and the central region which contains the cation binding sites. Cardiac glycoside binding to the center region may lock the cation transport region into a configuration such that the enzyme cannot go through the conformational change required for ion transport. PMID:9789548

  5. Binding site of MraZ transcription factor in Mollicutes.


    Fisunov, G Y; Evsyutina, D V; Semashko, T A; Arzamasov, A A; Manuvera, V A; Letarov, A V; Govorun, V M


    Mollicutes (mycoplasmas) feature a significant loss of known regulators of gene expression. Here, we identified the recognition site of the MraZ-family regulator of Mycoplasma gallisepticum, which is conserved in many species of different clades within class Mollicutes. The MraZ binding site is AAAGTG[T/G], in the promoter of mraZ gene it forms a series of direct repeats with a structure (AAAGTG[T/G]N3)k, where k = 3 most frequently. MraZ binds to a single repeat as an octamer complex. MraZ can also bind a single binding site or a series of repeats with different spacer lengths (2-4 nt); thus, it may play a role in the regulation of multiple operons in Mollicutes. In M. gallisepticum, MraZ acts as a transcriptional activator. The overexpression of MraZ leads to moderate filamentation of cells and the formation of aggregates, likely as a result of incomplete cytokinesis. PMID:26945841

  6. Ion Binding Sites and their Representations by Reduced Models

    PubMed Central

    Roux, Benoît


    The binding of small metal ions to complex macromolecular structures is typically dominated by strong local interactions of the ion with its nearest ligands. Progress in understanding the molecular determinants of ion selectivity can often be achieved by considering simplified reduced models comprised of only the most important ion-coordinating ligands. Although the main ingredients underlying simplified reduced models are intuitively clear, a formal statistical mechanical treatment is nonetheless necessary in order to draw meaningful conclusions about complex macromolecular systems. By construction, reduced models only treat the ion and the nearest coordinating ligands explicitly. The influence of the missing atoms from the protein or the solvent is incorporated indirectly. Quasi-chemical theory offers one example of how to carry out such a separation in the case of ion solvation in bulk liquids, and in several ways, a statistical mechanical formulation of reduced binding site models for macromolecules is expected to follow a similar route. However, there are also important differences when the ion-coordinating moieties are not solvent molecules from a bulk phase, but are molecular ligands covalently bonded to a macromolecular structure. Here, a statistical mechanical formulation of reduced binding site models is elaborated to address these issues. The formulation provides a useful framework to construct reduced binding site models, and define the average effect from the surroundings on the ion and the nearest coordinating ligands. PMID:22494321

  7. Computational investigation of cholesterol binding sites on mitochondrial VDAC.


    Weiser, Brian P; Salari, Reza; Eckenhoff, Roderic G; Brannigan, Grace


    The mitochondrial voltage-dependent anion channel (VDAC) allows passage of ions and metabolites across the mitochondrial outer membrane. Cholesterol binds mammalian VDAC, and we investigated the effects of binding to human VDAC1 with atomistic molecular dynamics simulations that totaled 1.4 μs. We docked cholesterol to specific sites on VDAC that were previously identified with NMR, and we tested the reliability of multiple docking results in each site with simulations. The most favorable binding modes were used to build a VDAC model with cholesterol occupying five unique sites, and during multiple 100 ns simulations, cholesterol stably and reproducibly remained bound to the protein. For comparison, VDAC was simulated in systems with identical components but with cholesterol initially unbound. The dynamics of loops that connect adjacent β-strands were most affected by bound cholesterol, with the averaged root-mean-square fluctuation (RMSF) of multiple residues altered by 20-30%. Cholesterol binding also stabilized charged residues inside the channel and localized the surrounding electrostatic potentials. Despite this, ion diffusion through the channel was not significantly affected by bound cholesterol, as evidenced by multi-ion potential of mean force measurements. Although we observed modest effects of cholesterol on the open channel, our model will be particularly useful in experiments that investigate how cholesterol affects VDAC function under applied electrochemical forces and also how other ligands and proteins interact with the channel. PMID:25080204

  8. Detection of Binding Site Molecular Interaction Field Similarities.


    Chartier, Matthieu; Najmanovich, Rafael


    Protein binding-site similarity detection methods can be used to predict protein function and understand molecular recognition, as a tool in drug design for drug repurposing and polypharmacology, and for the prediction of the molecular determinants of drug toxicity. Here, we present IsoMIF, a method able to identify binding site molecular interaction field similarities across protein families. IsoMIF utilizes six chemical probes and the detection of subgraph isomorphisms to identify geometrically and chemically equivalent sections of protein cavity pairs. The method is validated using six distinct data sets, four of those previously used in the validation of other methods. The mean area under the receiver operator curve (AUC) obtained across data sets for IsoMIF is higher than those of other methods. Furthermore, while IsoMIF obtains consistently high AUC values across data sets, other methods perform more erratically across data sets. IsoMIF can be used to predict function from structure, to detect potential cross-reactivity or polypharmacology targets, and to help suggest bioisosteric replacements to known binding molecules. Given that IsoMIF detects spatial patterns of molecular interaction field similarities, its predictions are directly related to pharmacophores and may be readily translated into modeling decisions in structure-based drug design. IsoMIF may in principle detect similar binding sites with distinct amino acid arrangements that lead to equivalent interactions within the cavity. The source code to calculate and visualize MIFs and MIF similarities are freely available. PMID:26158641

  9. Photoaffinity labeling in target- and binding-site identification

    PubMed Central

    Smith, Ewan; Collins, Ian


    Photoaffinity labeling (PAL) using a chemical probe to covalently bind its target in response to activation by light has become a frequently used tool in drug discovery for identifying new drug targets and molecular interactions, and for probing the location and structure of binding sites. Methods to identify the specific target proteins of hit molecules from phenotypic screens are highly valuable in early drug discovery. In this review, we summarize the principles of PAL including probe design and experimental techniques for in vitro and live cell investigations. We emphasize the need to optimize and validate probes and highlight examples of the successful application of PAL across multiple disease areas. PMID:25686004

  10. Extra-helical binding site of a glucagon receptor antagonist.


    Jazayeri, Ali; Doré, Andrew S; Lamb, Daniel; Krishnamurthy, Harini; Southall, Stacey M; Baig, Asma H; Bortolato, Andrea; Koglin, Markus; Robertson, Nathan J; Errey, James C; Andrews, Stephen P; Teobald, Iryna; Brown, Alastair J H; Cooke, Robert M; Weir, Malcolm; Marshall, Fiona H


    Glucagon is a 29-amino-acid peptide released from the α-cells of the islet of Langerhans, which has a key role in glucose homeostasis. Glucagon action is transduced by the class B G-protein-coupled glucagon receptor (GCGR), which is located on liver, kidney, intestinal smooth muscle, brain, adipose tissue, heart and pancreas cells, and this receptor has been considered an important drug target in the treatment of diabetes. Administration of recently identified small-molecule GCGR antagonists in patients with type 2 diabetes results in a substantial reduction of fasting and postprandial glucose concentrations. Although an X-ray structure of the transmembrane domain of the GCGR has previously been solved, the ligand (NNC0640) was not resolved. Here we report the 2.5 Å structure of human GCGR in complex with the antagonist MK-0893 (ref. 4), which is found to bind to an allosteric site outside the seven transmembrane (7TM) helical bundle in a position between TM6 and TM7 extending into the lipid bilayer. Mutagenesis of key residues identified in the X-ray structure confirms their role in the binding of MK-0893 to the receptor. The unexpected position of the binding site for MK-0893, which is structurally similar to other GCGR antagonists, suggests that glucagon activation of the receptor is prevented by restriction of the outward helical movement of TM6 required for G-protein coupling. Structural knowledge of class B receptors is limited, with only one other ligand-binding site defined--for the corticotropin-releasing hormone receptor 1 (CRF1R)--which was located deep within the 7TM bundle. We describe a completely novel allosteric binding site for class B receptors, providing an opportunity for structure-based drug design for this receptor class and furthering our understanding of the mechanisms of activation of these receptors. PMID:27111510

  11. Opioid binding site in EL-4 thymoma cell line

    SciTech Connect

    Fiorica, E.; Spector, S.


    Using EL-4 thymoma cell-line we found a binding site similar to the k opioid receptor of the nervous system. The Scatchard analysis of the binding of (/sup 3/H) bremazocine indicated a single site with a K/sub D/ = 60 +/- 17 nM and Bmax = 2.7 +/- 0.8 pmols/10/sup 6/ cells. To characterize this binding site, competition studies were performed using selective compounds for the various opioid receptors. The k agonist U-50,488H was the most potent displacer of (/sup 3/H) bremazocine with an IC/sub 50/ value = The two steroisomers levorphanol and dextrorphan showed the same affinity for this site. While morphine, (D-Pen/sup 2/, D-Pen/sup 5/) enkephalin and ..beta..-endorphin failed to displace, except at very high concentrations, codeine demonstrated a IC/sub 50/ =, that was similar to naloxone. 32 references, 3 figures, 2 tables.

  12. Binding of dinitrogen to an iron-sulfur-carbon site

    NASA Astrophysics Data System (ADS)

    Čorić, Ilija; Mercado, Brandon Q.; Bill, Eckhard; Vinyard, David J.; Holland, Patrick L.


    Nitrogenases are the enzymes by which certain microorganisms convert atmospheric dinitrogen (N2) to ammonia, thereby providing essential nitrogen atoms for higher organisms. The most common nitrogenases reduce atmospheric N2 at the FeMo cofactor, a sulfur-rich iron-molybdenum cluster (FeMoco). The central iron sites that are coordinated to sulfur and carbon atoms in FeMoco have been proposed to be the substrate binding sites, on the basis of kinetic and spectroscopic studies. In the resting state, the central iron sites each have bonds to three sulfur atoms and one carbon atom. Addition of electrons to the resting state causes the FeMoco to react with N2, but the geometry and bonding environment of N2-bound species remain unknown. Here we describe a synthetic complex with a sulfur-rich coordination sphere that, upon reduction, breaks an Fe-S bond and binds N2. The product is the first synthetic Fe-N2 complex in which iron has bonds to sulfur and carbon atoms, providing a model for N2 coordination in the FeMoco. Our results demonstrate that breaking an Fe-S bond is a chemically reasonable route to N2 binding in the FeMoco, and show structural and spectroscopic details for weakened N2 on a sulfur-rich iron site.

  13. Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins.


    Cogliati, Clelia; Tomaselli, Simona; Assfalg, Michael; Pedò, Massimo; Ferranti, Pasquale; Zetta, Lucia; Molinari, Henriette; Ragona, Laura


    Bile acid-binding proteins (BABPs) are cytosolic lipid chaperones that play central roles in driving bile flow, as well as in the adaptation to various pathological conditions, contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Understanding the mode of binding of bile acids with their cytoplasmic transporters is a key issue in providing a model for the mechanism of their transfer from the cytoplasm to the nucleus, for delivery to nuclear receptors. A number of factors have been shown to modulate bile salt selectivity, stoichiometry, and affinity of binding to BABPs, e.g. chemistry of the ligand, protein plasticity and, possibly, the formation of disulfide bridges. Here, the effects of the presence of a naturally occurring disulfide bridge on liver BABP ligand-binding properties and backbone dynamics have been investigated by NMR. Interestingly, the disulfide bridge does not modify the protein-binding stoichiometry, but has a key role in modulating recognition at both sites, inducing site selectivity for glycocholic and glycochenodeoxycholic acid. Protein conformational changes following the introduction of a disulfide bridge are small and located around the inner binding site, whereas significant changes in backbone motions are observed for several residues distributed over the entire protein, both in the apo form and in the holo form. Site selectivity appears, therefore, to be dependent on protein mobility rather than being governed by steric factors. The detected properties further establish a parallelism with the behaviour of human ileal BABP, substantiating the proposal that BABPs have parallel functions in hepatocytes and enterocytes. PMID:19754879

  14. Direct GR Binding Sites Potentiate Clusters of TF Binding across the Human Genome.


    Vockley, Christopher M; D'Ippolito, Anthony M; McDowell, Ian C; Majoros, William H; Safi, Alexias; Song, Lingyun; Crawford, Gregory E; Reddy, Timothy E


    The glucocorticoid receptor (GR) binds the human genome at >10,000 sites but only regulates the expression of hundreds of genes. To determine the functional effect of each site, we measured the glucocorticoid (GC) responsive activity of nearly all GR binding sites (GBSs) captured using chromatin immunoprecipitation (ChIP) in A549 cells. 13% of GBSs assayed had GC-induced activity. The responsive sites were defined by direct GR binding via a GC response element (GRE) and exclusively increased reporter-gene expression. Meanwhile, most GBSs lacked GC-induced reporter activity. The non-responsive sites had epigenetic features of steady-state enhancers and clustered around direct GBSs. Together, our data support a model in which clusters of GBSs observed with ChIP-seq reflect interactions between direct and tethered GBSs over tens of kilobases. We further show that those interactions can synergistically modulate the activity of direct GBSs and may therefore play a major role in driving gene activation in response to GCs. PMID:27565349

  15. Occupancy of the iron binding sites of human transferrin.

    PubMed Central

    Huebers, H A; Josephson, B; Huebers, E; Csiba, E; Finch, C A


    The in vivo distribution of iron between the binding sites of transferrin was examined. Plasma was obtained from normal subjects under basal conditions and after in vitro and in vivo iron loading. Independent methods, including measurement of the transferrin profile after isoelectric focusing and cross immunoelectrophoresis, and determination of the iron content in the separated fractions were in agreement that there was a random distribution of iron on binding sites. This held true with in vitro loading, when iron was increased by intestinal absorption and with loading from the reticuloendothelial system. The data indicate that the distribution of apo-, monoferric, and diferric transferrins is predictable on the basis of the plasma transferrin saturation and negate the concept that iron loading of transferrin in vitro is a selective process with possible functional consequences in tissue iron delivery. PMID:6589596

  16. The Allosteric Binding Sites of Sulfotransferase 1A1

    PubMed Central

    Cook, Ian; Wang, Ting; Falany, Charles N.


    Human sulfotransferases (SULTs) comprise a small, 13-member enzyme family that regulates the activities of thousands of compounds—endogenous metabolites, drugs, and other xenobiotics. SULTs transfer the sulfuryl-moiety (–SO3) from a nucleotide donor, PAPS (3′-phosphoadenosine 5′-phosphosulfate), to the hydroxyls and primary amines of acceptors. SULT1A1, a progenitor of the family, has evolved to sulfonate compounds that are remarkably structurally diverse. SULT1A1, which is found in many tissues, is the predominant SULT in liver, where it is a major component of phase II metabolism. Early work demonstrated that catechins and nonsteroidal anti-inflammatory drugs inhibit SULT1A1 and suggested that the inhibition was not competitive versus substrates. Here, the mechanism of inhibition of a single, high affinity representative from each class [epigallocatechin gallate (EGCG) and mefenamic acid] is determined using initial-rate and equilibrium-binding studies. The findings reveal that the inhibitors bind at sites separate from those of substrates, and at saturation turnover of the enzyme is reduced to a nonzero value. Further, the EGCG inhibition patterns suggest a molecular explanation for its isozyme specificity. Remarkably, the inhibitors bind at sites that are separate from one another, and binding at one site does not affect affinity at the other. For the first time, it is clear that SULT1A1 is allosterically regulated, and that it contains at least two, functionally distinct allosteric sites, each of which responds to a different class of compounds. PMID:25534770

  17. Analysis of zinc binding sites in protein crystal structures.

    PubMed Central

    Alberts, I. L.; Nadassy, K.; Wodak, S. J.


    The geometrical properties of zinc binding sites in a dataset of high quality protein crystal structures deposited in the Protein Data Bank have been examined to identify important differences between zinc sites that are directly involved in catalysis and those that play a structural role. Coordination angles in the zinc primary coordination sphere are compared with ideal values for each coordination geometry, and zinc coordination distances are compared with those in small zinc complexes from the Cambridge Structural Database as a guide of expected trends. We find that distances and angles in the primary coordination sphere are in general close to the expected (or ideal) values. Deviations occur primarily for oxygen coordinating atoms and are found to be mainly due to H-bonding of the oxygen coordinating ligand to protein residues, bidentate binding arrangements, and multi-zinc sites. We find that H-bonding of oxygen containing residues (or water) to zinc bound histidines is almost universal in our dataset and defines the elec-His-Zn motif. Analysis of the stereochemistry shows that carboxyl elec-His-Zn motifs are geometrically rigid, while water elec-His-Zn motifs show the most geometrical variation. As catalytic motifs have a higher proportion of carboxyl elec atoms than structural motifs, they provide a more rigid framework for zinc binding. This is understood biologically, as a small distortion in the zinc position in an enzyme can have serious consequences on the enzymatic reaction. We also analyze the sequence pattern of the zinc ligands and residues that provide elecs, and identify conserved hydrophobic residues in the endopeptidases that also appear to contribute to stabilizing the catalytic zinc site. A zinc binding template in protein crystal structures is derived from these observations. PMID:10082367

  18. DNA methylation presents distinct binding sites for human transcription factors.


    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng


    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI: PMID:24015356

  19. DNA methylation presents distinct binding sites for human transcription factors

    PubMed Central

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng


    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI: PMID:24015356

  20. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    SciTech Connect

    Qin, Ling; Mills, Denise A.; Buhrow, Leann; Hiser, Carrie; Ferguson-Miller, Shelagh


    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  1. Cloud Computing for Protein-Ligand Binding Site Comparison

    PubMed Central


    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

  2. Cloud computing for protein-ligand binding site comparison.


    Hung, Che-Lun; Hua, Guan-Jie


    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

  3. Binding characterization, synthesis and biological evaluation of RXRα antagonists targeting the coactivator binding site.


    Xu, Dingyu; Guo, Shangjie; Chen, Ziwen; Bao, Yuzhou; Huang, Fengyu; Xu, Dan; Zhang, Xindao; Zeng, Zhiping; Zhou, Hu; Zhang, Xiaokun; Su, Ying


    Previously we identified the first retinoid X receptor-alpha (RXRα) modulators that regulate the RXRα biological function via binding to the coregulator-binding site. Here we report the characterization of the interactions between the hit molecule and RXRα through computational modeling, mutagenesis, SAR and biological evaluation. In addition, we reported studies of additional new compounds and identified a molecule that mediated the NF-κB pathway by inhibiting the TNFα-induced IκBα degradation and p65 nuclear translocation. PMID:27450787

  4. Coenzyme A Binding to the Aminoglycoside Acetyltransferase (3)-IIIb Increases Conformational Sampling of Antibiotic Binding Site

    SciTech Connect

    Hu, Xiaohu; Norris, Adrianne; Baudry, Jerome Y; Serpersu, Engin H


    NMR spectroscopy experiments and molecular dynamics simulations were performed to describe the dynamic properties of the aminoglycoside acetyltransferase (3)-IIIb (AAC) in its apo and coenzyme A (CoASH) bound forms. The {sup 15}N-{sup 1}H HSQC spectra indicate a partial structural change and coupling of the CoASH binding site with another region in the protein upon the CoASH titration into the apo enzyme. Molecular dynamics simulations indicate a significant structural and dynamic variation of the long loop in the antibiotic binding domain in the form of a relatively slow (250 ns), concerted opening motion in the CoASH enzyme complex and that binding of the CoASH increases the structural flexibility of the loop, leading to an interchange between several similar equally populated conformations.

  5. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    SciTech Connect

    Lummis, S.C.R.; Johnston, G.A.R. ); Nicoletti, G. ); Holan, G. )


    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligand spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.

  6. Flavopiridol inhibits glycogen phosphorylase by binding at the inhibitor site.


    Oikonomakos, N G; Schnier, J B; Zographos, S E; Skamnaki, V T; Tsitsanou, K E; Johnson, L N


    Flavopiridol (L86-8275) ((-)-cis-5, 7-dihydroxy-2-(2-chlorophenyl)-8-[4-(3-hydroxy-1-methyl)-piperidinyl] -4H-benzopyran-4-one), a potential antitumor drug, currently in phase II trials, has been shown to be an inhibitor of muscle glycogen phosphorylase (GP) and to cause glycogen accumulation in A549 non-small cell lung carcinoma cells (Kaiser, A., Nishi, K., Gorin, F.A., Walsh, D.A., Bradbury, E. M., and Schnier, J. B., unpublished data). Kinetic experiments reported here show that flavopiridol inhibits GPb with an IC(50) = 15.5 microm. The inhibition is synergistic with glucose resulting in a reduction of IC(50) for flavopiridol to 2.3 microm and mimics the inhibition of caffeine. In order to elucidate the structural basis of inhibition, we determined the structures of GPb complexed with flavopiridol, GPb complexed with caffeine, and GPa complexed with both glucose and flavopiridol at 1.76-, 2.30-, and 2.23-A resolution, and refined to crystallographic R values of 0.216 (R(free) = 0.247), 0.189 (R(free) = 0.219), and 0.195 (R(free) = 0.252), respectively. The structures provide a rational for flavopiridol potency and synergism with glucose inhibitory action. Flavopiridol binds at the allosteric inhibitor site, situated at the entrance to the catalytic site, the site where caffeine binds. Flavopiridol intercalates between the two aromatic rings of Phe(285) and Tyr(613). Both flavopiridol and glucose promote the less active T-state through localization of the closed position of the 280s loop which blocks access to the catalytic site, thereby explaining their synergistic inhibition. The mode of interactions of flavopiridol with GP is different from that of des-chloro-flavopiridol with CDK2, illustrating how different functional parts of the inhibitor can be used to provide specific and potent binding to two different enzymes. PMID:10924512

  7. PeptiSite: a structural database of peptide binding sites in 4D.


    Acharya, Chayan; Kufareva, Irina; Ilatovskiy, Andrey V; Abagyan, Ruben


    We developed PeptiSite, a comprehensive and reliable database of biologically and structurally characterized peptide-binding sites, in which each site is represented by an ensemble of its complexes with protein, peptide and small molecule partners. The unique features of the database include: (1) the ensemble site representation that provides a fourth dimension to the otherwise three dimensional data, (2) comprehensive characterization of the binding site architecture that may consist of a multimeric protein assembly with cofactors and metal ions and (3) analysis of consensus interaction motifs within the ensembles and identification of conserved determinants of these interactions. Currently the database contains 585 proteins with 650 peptide-binding sites. link allows searching for the sites of interest and interactive visualization of the ensembles using the ActiveICM web-browser plugin. This structural database for protein-peptide interactions enables understanding of structural principles of these interactions and may assist the development of an efficient peptide docking benchmark. PMID:24406170

  8. Positional distribution of transcription factor binding sites in Arabidopsis thaliana

    PubMed Central

    Yu, Chun-Ping; Lin, Jinn-Jy; Li, Wen-Hsiung


    Binding of a transcription factor (TF) to its DNA binding sites (TFBSs) is a critical step to initiate the transcription of its target genes. It is therefore interesting to know where the TFBSs of a gene are likely to locate in the promoter region. Here we studied the positional distribution of TFBSs in Arabidopsis thaliana, for which many known TFBSs are now available. We developed a method to identify the locations of TFBSs in the promoter sequences of genes in A. thaliana. We found that the distribution is nearly bell-shaped with a peak at 50 base pairs (bp) upstream of the transcription start site (TSS) and 86% of the TFBSs are in the region from −1,000 bp to +200 bp with respect to the TSS. Our distribution was supported by chromatin immunoprecipitation sequencing and microarray data and DNase I hypersensitive site sequencing data. When TF families were considered separately, differences in positional preference were observed between TF families. Our study of the positional distribution of TFBSs seems to be the first in a plant. PMID:27117388

  9. Structural neighboring property for identifying protein-protein binding sites

    PubMed Central


    Background The protein-protein interaction plays a key role in the control of many biological functions, such as drug design and functional analysis. Determination of binding sites is widely applied in molecular biology research. Therefore, many efficient methods have been developed for identifying binding sites. In this paper, we calculate structural neighboring property through Voronoi diagram. Using 6,438 complexes, we study local biases of structural neighboring property on interface. Results We propose a novel statistical method to extract interacting residues, and interacting patches can be clustered as predicted interface residues. In addition, structural neighboring property can be adopted to construct a new energy function, for evaluating docking solutions. It includes new statistical property as well as existing energy items. Comparing to existing methods, our approach improves overall Fnat value by at least 3%. On Benchmark v4.0, our method has average Irmsd value of 3.31Å and overall Fnat value of 63%, which improves upon Irmsd of 3.89 Å and Fnat of 49% for ZRANK, and Irmsd of 3.99Å and Fnat of 46% for ClusPro. On the CAPRI targets, our method has average Irmsd value of 3.46 Å and overall Fnat value of 45%, which improves upon Irmsd of 4.18 Å and Fnat of 40% for ZRANK, and Irmsd of 5.12 Å and Fnat of 32% for ClusPro. Conclusions Experiments show that our method achieves better results than some state-of-the-art methods for identifying protein-protein binding sites, with the prediction quality improved in terms of CAPRI evaluation criteria. PMID:26356630

  10. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.; Iyer, VenkyN.; Eisen, Michael B.


    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  11. CryptoSite: Expanding the Druggable Proteome by Characterization and Prediction of Cryptic Binding Sites.


    Cimermancic, Peter; Weinkam, Patrick; Rettenmaier, T Justin; Bichmann, Leon; Keedy, Daniel A; Woldeyes, Rahel A; Schneidman-Duhovny, Dina; Demerdash, Omar N; Mitchell, Julie C; Wells, James A; Fraser, James S; Sali, Andrej


    Many proteins have small-molecule binding pockets that are not easily detectable in the ligand-free structures. These cryptic sites require a conformational change to become apparent; a cryptic site can therefore be defined as a site that forms a pocket in a holo structure, but not in the apo structure. Because many proteins appear to lack druggable pockets, understanding and accurately identifying cryptic sites could expand the set of drug targets. Previously, cryptic sites were identified experimentally by fragment-based ligand discovery and computationally by long molecular dynamics simulations and fragment docking. Here, we begin by constructing a set of structurally defined apo-holo pairs with cryptic sites. Next, we comprehensively characterize the cryptic sites in terms of their sequence, structure, and dynamics attributes. We find that cryptic sites tend to be as conserved in evolution as traditional binding pockets but are less hydrophobic and more flexible. Relying on this characterization, we use machine learning to predict cryptic sites with relatively high accuracy (for our benchmark, the true positive and false positive rates are 73% and 29%, respectively). We then predict cryptic sites in the entire structurally characterized human proteome (11,201 structures, covering 23% of all residues in the proteome). CryptoSite increases the size of the potentially "druggable" human proteome from ~40% to ~78% of disease-associated proteins. Finally, to demonstrate the utility of our approach in practice, we experimentally validate a cryptic site in protein tyrosine phosphatase 1B using a covalent ligand and NMR spectroscopy. The CryptoSite Web server is available at PMID:26854760

  12. Viral receptor-binding site antibodies with diverse germline origins

    PubMed Central

    Schmidt, Aaron G.; Therkelsen, Matthew D.; Stewart, Shaun; Kepler, Thomas B.; Liao, Hua-Xin; Moody, M. Anthony; Haynes, Barton F.; Harrison, Stephen C.


    Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by eleven different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B-cell targets. PMID:25959776

  13. Viral receptor-binding site antibodies with diverse germline origins.


    Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C


    Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. PMID:25959776

  14. Analysis of Binding at a Single Spatially Localized Cluster of Binding Sites by Fluorescence Recovery after Photobleaching

    PubMed Central

    Sprague, Brian L.; Müller, Florian; Pego, Robert L.; Bungay, Peter M.; Stavreva, Diana A.; McNally, James G.


    Cells contain many subcellular structures in which specialized proteins locally cluster. Binding interactions within such clusters may be analyzed in live cells using models for fluorescence recovery after photobleaching (FRAP). Here we analyze a three-dimensional FRAP model that accounts for a single spatially localized cluster of binding sites in the presence of both diffusion and impermeable boundaries. We demonstrate that models completely ignoring the spatial localization of binding yield poor estimates for the binding parameters within the binding site cluster. In contrast, we find that ignoring only the restricted axial height of the binding-site cluster is far less detrimental, thereby enabling the use of computationally less expensive models. We also identify simplified solutions to the FRAP model for limiting behaviors where either diffusion or binding dominate. We show how ignoring a role for diffusion can sometimes produce serious errors in binding parameter estimation. We illustrate application of the method by analyzing binding of a transcription factor, the glucocorticoid receptor, to a tandem array of mouse mammary tumor virus promoter sites in live cells, obtaining an estimate for an in vivo binding constant (10−7 M), and a first approximation of an upper bound on the transcription-factor residence time at the promoter (∼170 ms). These FRAP analysis tools will be important for measuring key cellular binding parameters necessary for a complete and accurate description of the networks that regulate cellular behavior. PMID:16679358

  15. Atrial natriuretic factor binding sites in experimental congestive heart failure

    SciTech Connect

    Bianchi, C.; Thibault, G.; Wrobel-Konrad, E.; De Lean, A.; Genest, J.; Cantin, M. )


    A quantitative in vitro autoradiographic study was performed on the aorta, renal glomeruli, and adrenal cortex of cardiomyopathic hamsters in various stages of heart failure and correlated, in some instances, with in vivo autoradiography. The results indicate virtually no correlation between the degree of congestive heart failure and the density of 125I-labeled atrial natriuretic factor ((Ser99, Tyr126)ANF) binding sites (Bmax) in the tissues examined. Whereas the Bmax was increased in the thoracic aorta in moderate and severe heart failure, there were no significant changes in the zona glomerulosa. The renal glomeruli Bmax was lower in mild and moderate heart failure compared with control and severe heart failure. The proportion of ANF B- and C-receptors was also evaluated in sections of the aorta, adrenal, and kidney of control and cardiomyopathic hamsters with severe heart failure. (Arg102, Cys121)ANF (des-(Gln113, Ser114, Gly115, Leu116, Gly117) NH2) (C-ANF) at 10(-6) M displaced approximately 505 of (Ser99, Tyr126)125I-ANF bound in the aorta and renal glomeruli and approximately 20% in the adrenal zona glomerulosa in both series of animals. These results suggest that ANF may exert a buffering effect on the vasoconstriction of heart failure and to a certain extent may inhibit aldosterone secretion. The impairment of renal sodium excretion does not appear to be related to glomerular ANF binding sites at any stage of the disease.

  16. Conserved properties of individual Ca2+-binding sites in calmodulin

    PubMed Central

    Halling, D. Brent; Liebeskind, Benjamin J.; Hall, Amelia W.; Aldrich, Richard W.


    Calmodulin (CaM) is a Ca2+-sensing protein that is highly conserved and ubiquitous in eukaryotes. In humans it is a locus of life-threatening cardiomyopathies. The primary function of CaM is to transduce Ca2+ concentration into cellular signals by binding to a wide range of target proteins in a Ca2+-dependent manner. We do not fully understand how CaM performs its role as a high-fidelity signal transducer for more than 300 target proteins, but diversity among its four Ca2+-binding sites, called EF-hands, may contribute to CaM’s functional versatility. We therefore looked at the conservation of CaM sequences over deep evolutionary time, focusing primarily on the four EF-hand motifs. Expanding on previous work, we found that CaM evolves slowly but that its evolutionary rate is substantially faster in fungi. We also found that the four EF-hands have distinguishing biophysical and structural properties that span eukaryotes. These results suggest that all eukaryotes require CaM to decode Ca2+ signals using four specialized EF-hands, each with specific, conserved traits. In addition, we provide an extensive map of sites associated with target proteins and with human disease and correlate these with evolutionary sequence diversity. Our comprehensive evolutionary analysis provides a basis for understanding the sequence space associated with CaM function and should help guide future work on the relationship between structure, function, and disease. PMID:26884197

  17. Sequence variation in ligand binding sites in proteins

    PubMed Central

    Magliery, Thomas J; Regan, Lynne


    Background The recent explosion in the availability of complete genome sequences has led to the cataloging of tens of thousands of new proteins and putative proteins. Many of these proteins can be structurally or functionally categorized from sequence conservation alone. In contrast, little attention has been given to the meaning of poorly-conserved sites in families of proteins, which are typically assumed to be of little structural or functional importance. Results Recently, using statistical free energy analysis of tetratricopeptide repeat (TPR) domains, we observed that positions in contact with peptide ligands are more variable than surface positions in general. Here we show that statistical analysis of TPRs, ankyrin repeats, Cys2His2 zinc fingers and PDZ domains accurately identifies specificity-determining positions by their sequence variation. Sequence variation is measured as deviation from a neutral reference state, and we present probabilistic and information theory formalisms that improve upon recently suggested methods such as statistical free energies and sequence entropies. Conclusion Sequence variation has been used to identify functionally-important residues in four selected protein families. With TPRs and ankyrin repeats, protein families that bind highly diverse ligands, the effect is so pronounced that sequence "hypervariation" alone can be used to predict ligand binding sites. PMID:16194281

  18. Active site - a site of binding of affinity inhibitors in baker's yeast inorganic pyrophosphatase

    SciTech Connect

    Svyato, I.E.; Sklyankina, V.A.; Avaeva, S.M.


    The interaction of the enzyme-substrate complex with methyl phosphate, O-phosphoethanolamine, O-phosphopropanolamine, N-acetylphosphoserine, and phosphoglyolic acid, as well as pyrophosphatase, modified by monoesters of phosphoric acid, with pyrophosphate and tripolyphosphate, was investigated. It was shown that the enzyme containing the substrate in the active site does not react with monophosphates, but modified pyrophosphatase entirely retains the ability to bind polyanions to the regulatory site. It is concluded that the inactivation of baker's yeast inorganic pyrophosphatase by monoesters of phosphoric acid, which are affinity inhibitors of it, is the result of modification of the active site of the enzyme.

  19. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    SciTech Connect

    Harada, Y.; Li, H.; Li, Hua; Lennarz, W. J.


    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.

  20. NMR Mapping of the IFNAR1-EC binding site on IFNα2 reveals allosteric changes in the IFNAR2-EC binding site

    PubMed Central

    Akabayov, Sabine Ruth; Biron, Zohar; Lamken, Peter; Piehler, Jacob; Anglister, Jacob


    All type I interferons (IFNs) bind to a common cell-surface receptor consisting of two subunits. IFNs initiate intracellular signal transduction cascades by simultaneous interaction with the extracellular domains of its receptor subunits IFNAR1 and IFNAR2. In this study we mapped the surface of IFNα2 interacting with the extracellular domain of IFNAR1 (IFNAR1-EC) by following changes in or the disappearance of the [1H,15N]-TROSY-HSQC cross peaks of IFNα2 caused by the binding of the extracellular domain of IFNAR1 (IFNAR1-EC) to the binary complex of IFNα2 with IFNAR2-EC. The NMR study on the 89 kDa complex was conducted at pH 8 and 308 K using an 800 MHz spectrometer. IFNAR1 binding affected a total of 47 out of 165 IFNα2 residues contained in two large patches on the face of the protein opposing the binding site for IFNAR2 and in a third patch located on the face containing the IFNAR2 binding site. The first two patches form the IFNAR1 binding site and one of these matches the IFNAR1 binding site previously identified by site-directed mutagenesis. The third patch partially matches the IFNα2 binding site for IFNAR2-EC indicating allosteric communication between the binding sites for the two receptor subunits. PMID:20047337

  1. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    SciTech Connect

    Singh,S.; Yamashita, A.; Gouaux, E.


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  2. Antidepressant binding site in a bacterial homologue of neurotransmitter transporters.


    Singh, Satinder K; Yamashita, Atsuko; Gouaux, Eric


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 A above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational design of

  3. Substance P and substance K receptor binding sites in the human gastrointestinal tract: localization by autoradiography

    SciTech Connect

    Gates, T.S.; Zimmerman, R.P.; Mantyh, C.R.; Vigna, S.R.; Maggio, J.E.; Welton, M.L.; Passaro, E.P. Jr.; Mantyh, P.W.


    Quantitative receptor autoradiography was used to localize and quantify the distribution of binding sites for /sup 125/I-radiolabeled substance P (SP), substance K (SK) and neuromedin K (NK) in the human GI tract using histologically normal tissue obtained from uninvolved margins of resections for carcinoma. The distribution of SP and SK binding sites is different for each gastrointestinal (GI) segment examined. Specific SP binding sites are expressed by arterioles and venules, myenteric plexus, external circular muscle, external longitudinal muscle, muscularis mucosa, epithelial cells of the mucosa, and the germinal centers of lymph nodules. SK binding sites are distributed in a pattern distinct from SP binding sites and are localized to the external circular muscle, external longitudinal muscle, and the muscularis mucosa. Binding sites for NK were not detected in any part of the human GI tract. These results demonstrate that: (1) surgical specimens from the human GI tract can be effectively processed for quantitative receptor autoradiography; (2) of the three mammalian tachykinins tested, SP and SK, but not NK binding sites are expressed in detectable levels in the human GI tract; (3) whereas SK receptor binding sites are expressed almost exclusively by smooth muscle, SP binding sites are expressed by smooth muscle cells, arterioles, venules, epithelial cells of the mucosa and cells associated with lymph nodules; and (4) both SP and SK binding sites expressed by smooth muscle are more stable than SP binding sites expressed by blood vessels, lymph nodules, and mucosal cells.

  4. Chloramphenicol binding to human serum albumin: Determination of binding constants and binding sites by steady-state fluorescence

    NASA Astrophysics Data System (ADS)

    Ding, Fei; Zhao, Guangyu; Chen, Shoucong; Liu, Feng; Sun, Ying; Zhang, Li


    The interaction between chloramphenicol and human serum albumin (HSA) was studied by fluorescence, UV/vis, circular dichroism (CD) and three-dimensional fluorescence spectroscopy. Fluorescence data revealed that the fluorescence quenching of HSA by chloramphenicol was the result of the formation of drug-HSA complex, and the effective quenching constants ( Ka) were 2.852 × 10 4, 2.765 × 10 4, 2.638 × 10 4 and 2.542 × 10 4 M -1 at 287, 295, 303 and 311 K, respectively. The thermodynamic parameters, enthalpy change (Δ H) and entropy change (Δ S) for the reaction were calculated to be -3.634 kJ mol -1 and 72.66 J mol -1 K -1 according to van't Hoff equation. The results indicated that the hydrophobic and electrostatic interactions played a major role in the binding of drug to HSA. The distance r between donor and acceptor was obtained to be 3.63 nm according to Förster's theory. Site marker competitive experiments indicated that the binding of drug to HSA primarily took place in subdomain IIA. The alterations of HSA secondary structure in the presence of chloramphenicol were confirmed by the evidences from synchronous fluorescence, CD and three-dimensional fluorescence spectra. In addition, the effect of common ions on the binding constants of drug-HSA complex was also discussed.

  5. Paracetamol and cytarabine binding competition in high affinity binding sites of transporting protein

    NASA Astrophysics Data System (ADS)

    Sułkowska, A.; Bojko, B.; Równicka, J.; Sułkowski, W. W.


    Paracetamol (acetaminophen, AA) the most popular analgesic drug is commonly used in the treatment of pain in patients suffering from cancer. In our studies, we evaluated the competition in binding with serum albumin between paracetamol (AA) and cytarabine, antyleukemic drug (araC). The presence of one drug can alter the binding affinity of albumin towards the second one. Such interaction can result in changing of the free fraction of the one of these drugs in blood. Two spectroscopic methods were used to determine high affinity binding sites and the competition of the drugs. Basing on the change of the serum albumin fluorescence in the presence of either of the drugs the quenching ( KQ) constants for the araC-BSA and AA-BSA systems were calculated. Analysis of UV difference spectra allowed us to describe the changes in drug-protein complexes (araC-albumin and AA-albumin) induced by the presence of the second drug (AA and araC, respectively). The mechanism of competition between araC and AA has been proposed.

  6. Functional impact of HIV coreceptor-binding site mutations

    SciTech Connect

    Biscone, Mark J.; Miamidian, John L.; Muchiri, John M.; Baik, Sarah S.W.; Lee, Fang-Hua; Doms, Robert W. . E-mail:; Reeves, Jacqueline D. . E-mail:


    The bridging sheet region of the gp120 subunit of the HIV-1 Env protein interacts with the major virus coreceptors, CCR5 and CXCR4. We examined the impact of mutations in and adjacent to the bridging sheet region of an X4 tropic HIV-1 on membrane fusion and entry inhibitor susceptibility. When the V3-loop of this Env was changed so that CCR5 was used, the effects of these same mutations on CCR5 use were assayed as well. We found that coreceptor-binding site mutations had greater effects on CXCR4-mediated fusion and infection than when CCR5 was used as a coreceptor, perhaps related to differences in coreceptor affinity. The mutations also reduced use of the alternative coreceptors CCR3 and CCR8 to varying degrees, indicating that the bridging sheet region is important for the efficient utilization of both major and minor HIV coreceptors. As seen before with a primary R5 virus strain, bridging sheet mutations increased susceptibility to the CCR5 inhibitor TAK-779, which correlated with CCR5 binding efficiency. Bridging sheet mutations also conferred increased susceptibility to the CXCR4 ligand AMD-3100 in the context of the X4 tropic Env. However, these mutations had little effect on the rate of membrane fusion and little effect on susceptibility to enfuvirtide, a membrane fusion inhibitor whose activity is dependent in part on the rate of Env-mediated membrane fusion. Thus, mutations that reduce coreceptor binding and enhance susceptibility to coreceptor inhibitors can affect fusion and enfuvirtide susceptibility in an Env context-dependent manner.

  7. XAS and Pulsed EPR Studies of the Copper Binding Site in Riboflavin Binding Protein

    SciTech Connect

    Smith,S.; Bencze, K.; Wasiukanis, K.; Benore-Parsons, T.; Stemmler, T.


    Riboflavin Binding Protein (RBP) binds copper in a 1:1 molar ratio, forming a distinct well-ordered type II site. The nature of this site has been examined using X-ray absorption and pulsed electron paramagnetic resonance (EPR) spectroscopies, revealing a four coordinate oxygen/nitrogen rich environment. On the basis of analysis of the Cambridge Structural Database, the average protein bound copper-ligand bond length of 1.96 Angstroms, obtained by extended x-ray absorption fine structure (EXAFS), is consistent with four coordinate Cu(I) and Cu(II) models that utilize mixed oxygen and nitrogen ligand distributions. These data suggest a CuO3N coordination state for copper bound to RBP. While pulsed EPR studies including hyperfine sublevel correlation spectroscopy and electron nuclear double resonance show clear spectroscopic evidence for a histidine bound to the copper, inclusion of a histidine in the EXAFS simulation did not lead to any significant improvement in the fit.

  8. POBO, transcription factor binding site verification with bootstrapping

    PubMed Central

    Kankainen, Matti; Holm, Liisa


    Transcription factors can either activate or repress target genes by binding onto short nucleotide sequence motifs in the promoter regions of these genes. Here, we present POBO, a promoter bootstrapping program, for gene expression data. POBO can be used to detect, compare and verify predetermined transcription factor binding site motifs in the promoters of one or two clusters of co-regulated genes. The program calculates the frequencies of the motif in the input promoter sets. A bootstrap analysis detects significantly over- or underrepresented motifs. The output of the program presents bootstrapped results in picture and text formats. The program was tested with published data from transgenic WRKY70 microarray experiments. Intriguingly, motifs recognized by the WRKY transcription factors of plant defense pathways are similarly enriched in both up- and downregulated clusters. POBO analysis suggests slightly modified hypothetical motifs that discriminate between up- and downregulated clusters. In conclusion, POBO allows easy, fast and accurate verification of putative regulatory motifs. The statistical tests implemented in POBO can be useful in eliminating false positives from the results of pattern discovery programs and increasing the reliability of true positives. POBO is freely available from PMID:15215385

  9. Muscarinic acetylcholine receptors: location of the ligand binding site

    SciTech Connect

    Hulme, E.; Wheatley, M.; Curtis, C.; Birdsall, N.


    The key to understanding the pharmacological specificity of muscarinic acetylcholine receptors (mAChR's) is the location within the receptor sequence of the amino acid residues responsible for ligand binding. To approach this problem, they have purified mAChR's from rat brain to homogeneity by sequential ion-exchange chromatography, affinity chromatography and molecular weight fractionation. Following labelling of the binding site with an alkylating affinity label, /sup 3/H-propylbenzilycholine mustard aziridinium ion (/sup 3/H-PrBCM), the mAChR was digested with a lysine-specific endoproteinase, and a ladder of peptides of increasing molecular weight, each containing the glycosylated N-terminus, isolated by chromatography on wheat-germ agglutinin sepharose. The pattern of labelling showed that a residue in the peptides containing transmembrane helices 2 and/or 3 of the mAChR was alkylated. The linkage was cleaved by 1 M hydroxylamine, showing that /sup 3/H-PrBCM was attached to an acidic residue, whose properties strongly suggested it to be embedded in a hydrophobic intramembrane region of the mAChR. Examination of the cloned sequence of the mAChR reveals several candidate residues, the most likely of which is homologous to an aspartic acid residue thought to protonate the retinal Schiff's base in the congeneric protein rhodopsin.

  10. A Sialic Acid Binding Site in a Human Picornavirus

    PubMed Central

    Frank, Martin; Hähnlein-Schick, Irmgard; Ekström, Jens-Ola; Arnberg, Niklas; Stehle, Thilo


    The picornaviruses coxsackievirus A24 variant (CVA24v) and enterovirus 70 (EV70) cause continued outbreaks and pandemics of acute hemorrhagic conjunctivitis (AHC), a highly contagious eye disease against which neither vaccines nor antiviral drugs are currently available. Moreover, these viruses can cause symptoms in the cornea, upper respiratory tract, and neurological impairments such as acute flaccid paralysis. EV70 and CVA24v are both known to use 5-N-acetylneuraminic acid (Neu5Ac) for cell attachment, thus providing a putative link between the glycan receptor specificity and cell tropism and disease. We report the structures of an intact human picornavirus in complex with a range of glycans terminating in Neu5Ac. We determined the structure of the CVA24v to 1.40 Å resolution, screened different glycans bearing Neu5Ac for CVA24v binding, and structurally characterized interactions with candidate glycan receptors. Biochemical studies verified the relevance of the binding site and demonstrated a preference of CVA24v for α2,6-linked glycans. This preference can be rationalized by molecular dynamics simulations that show that α2,6-linked glycans can establish more contacts with the viral capsid. Our results form an excellent platform for the design of antiviral compounds to prevent AHC. PMID:25329320

  11. Single prenyl-binding site on protein prenyl transferases

    PubMed Central

    Desnoyers, Luc; Seabra, Miguel C.


    Three distinct protein prenyl transferases, one protein farnesyl transferase (FTase) and two protein geranylgeranyl transferases (GGTase), catalyze prenylation of many cellular proteins. One group of protein substrates contains a C-terminal CAAX motif (C is Cys, A is aliphatic, and X is a variety of amino acids) in which the single cysteine residue is modified with either farnesyl or geranylgeranyl (GG) by FTase or GGTase type-I (GGTase-I), respectively. Rab proteins constitute a second group of substrates that contain a C-terminal double-cysteine motif (such as XXCC in Rab1a) in which both cysteines are geranylgeranylated by Rab GG transferase (RabGGTase). Previous characterization of CAAX prenyl transferases showed that the enzymes form stable complexes with their prenyl pyrophosphate substrates, acting as prenyl carriers. We developed a prenyl-binding assay and show that RabGGTase has a prenyl carrier function similar to the CAAX prenyl transferases. Stable RabGGTase:GG pyrophosphate (GGPP), FTase:GGPP, and GGTase-I:GGPP complexes show 1:1 (enzyme:GGPP) stoichiometry. Chromatographic analysis of prenylated products after single turnover reactions by using isolated RabGGTase:GGPP complex revealed that Rab is mono-geranylgeranylated. This study establishes that all three protein prenyl transferases contain a single prenyl-binding site and suggests that RabGGTase transfers two GG groups to Rabs in independent and consecutive reactions. PMID:9770475

  12. Mapping protein binding sites on the biomolecular corona of nanoparticles

    NASA Astrophysics Data System (ADS)

    Kelly, Philip M.; Åberg, Christoffer; Polo, Ester; O'Connell, Ann; Cookman, Jennifer; Fallon, Jonathan; Krpetić, Željka; Dawson, Kenneth A.


    Nanoparticles in a biological milieu are known to form a sufficiently long-lived and well-organized ‘corona’ of biomolecules to confer a biological identity to the particle. Because this nanoparticle-biomolecule complex interacts with cells and biological barriers, potentially engaging with different biological pathways, it is important to clarify the presentation of functional biomolecular motifs at its interface. Here, we demonstrate that by using antibody-labelled gold nanoparticles, differential centrifugal sedimentation and various imaging techniques it is possible to identify the spatial location of proteins, their functional motifs and their binding sites. We show that for transferrin-coated polystyrene nanoparticles only a minority of adsorbed proteins exhibit functional motifs and the spatial organization appears random, which is consistent, overall, with a stochastic and irreversible adsorption process. Our methods are applicable to a wide array of nanoparticles and can offer a microscopic molecular description of the biological identity of nanoparticles.

  13. Heavy metal binding to heparin disaccharides. I. Iduronic acid is the main binding site.


    Whitfield, D M; Choay, J; Sarkar, B


    As model compounds for Ni(II)-binding heparin-like compounds isolated from human kidneys (Templeton, D.M. & Sarkar, B. (1985) Biochem. J. 230 35-42.), we investigated two disaccharides--4-O-(2-O-sulfo-alpha-L-idopyranosyluronic acid)-2,5-anhydro- D-mannitol, disodium salt (1a), and 4-O-(2-O-sulfo-alpha-L-idopyranosyluronic acid)-6-O- sulfo-2,5-anhydro-D-mannitol, trisodium salt (1b)--that were isolated from heparin after nitrous acid hydrolysis and reduction. The monosulfate (1a) was active whereas the disulfate (1b) was inactive in a high-performance liquid chromatography (HPLC) binding assay with the tracer ions 63Ni(II) 54Mn(II), 65Zn(II), and 109Cd(II). This result is in accord with the isolation of two 67Cu(II) and 63Ni(II) binding fractions from a complete pool of nitrous-acid-derived heparin disaccharides using sulfate gradients and a MonoQ anion exchange column on an FPLC system. One was identified as compound (1a) and the other as a tetrasulfated trisaccharide by high resolution FAB-MS, NMR and HPLC-PAD. Similarly, two synthetic disaccharides-methyl, 2-O-sulfo-4-O-(alpha-L-idopyranosyluronic acid)-2-deoxy-2-sulfamide-alpha-D-glucosamine, trisodium salt [IdopA2S(alpha 1,4)GlcNS alpha Me, 2a], and 2-O-sulfo-4-O-(alpha-L-idopyranosyluronic acid)-2-deoxy-2-sulfamide-6-O-sulfo- alpha-D-glucosamine, tetrasodium salt [IdopA2S (alpha 1,4)GlcNS6S alpha Me, 2b]--were shown to bind tracer amounts of 63Ni and 67Cu using chromatographic assays. Subsequently, 1H NMR titrations of 1a, 1b, 2a, and 2b with Zn (OAc)2 were analyzed to yield 1:1 Zn(II)-binding constants of 472 +/- 59, 698 +/- 120, 8,758 +/- 2,237 and 20,100 +/- 5,598 M-1, respectively. The values for 2a and 2b suggest chelation. It is suggested that the idopyranosiduronic acid residue is the major metal binding site. NMR evidence for this hypothesis comes from marked 1H and 13C chemical shift changes to the iduronic acid resonances after addition of diamagnetic Zn(II) ions. PMID:1643264

  14. An aprotinin binding site localized in the hormone binding domain of the estrogen receptor from calf uterus.


    Nigro, V; Medici, N; Abbondanza, C; Minucci, S; Moncharmont, B; Molinari, A M; Puca, G A


    It has been proposed that the estrogen receptor bears proteolytic activity responsible for its own transformation. This activity was inhibited by aprotinin. Incubation of transformed ER with aprotinin modified the proteolytic digestion of the hormone binding subunit by proteinase K. The smallest hormone-binding fragment of the ER, obtained by tryptic digestion, was still able to bind to aprotinin. These results suggest that aprotinin interacts with ER and the hormone-binding domain of ER is endowed with a specific aprotinin-binding site. PMID:1696480

  15. Physicochemical features of the HERG channel drug binding site.


    Fernandez, David; Ghanta, Azad; Kauffman, Gregory W; Sanguinetti, Michael C


    Blockade of hERG K(+) channels in the heart is an unintentional side effect of many drugs and can induce cardiac arrhythmia and sudden death. It has become common practice in the past few years to screen compounds for hERG channel activity early during the drug discovery process. Understanding the molecular basis of drug binding to hERG is crucial for the rational design of medications devoid of this activity. We previously identified 2 aromatic residues, Tyr-652 and Phe-656, located in the S6 domain of hERG, as critical sites of interaction with structurally diverse drugs. Here, Tyr-652 and Phe-656 were systematically mutated to different residues to determine how the physicochemical properties of the amino acid side group affected channel block by cisapride, terfenadine, and MK-499. The potency for block by all three drugs was well correlated with measures of hydrophobicity, especially the two-dimensional approximation of the van der Waals hydrophobic surface area of the side chain of residue 656. For residue 652, an aromatic side group was essential for high affinity block, suggesting the importance of a cation-pi interaction between Tyr-652 and the basic tertiary nitrogen of these drugs. hERG also lacks a Pro-Val-Pro motif common to the S6 domain of most other voltage-gated K(+) channels. Introduction of Pro-Val-Pro into hERG reduced sensitivity to drugs but also altered channel gating. Together, these findings assign specific residues to receptor fields predicted by pharmacophore models of hERG channel blockers and provide a refined molecular understanding of the drug binding site. PMID:14699101

  16. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively

    NASA Astrophysics Data System (ADS)

    Clifford, Jacob; Adami, Christoph


    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  17. High-affinity dextromethorphan binding sites in guinea pig brain. II. Competition experiments.


    Craviso, G L; Musacchio, J M


    Binding of dextromethorphan (DM) to guinea pig brain is stereoselective, since levomethorphan is 20 times weaker than DM in competing for DM sites. In general, opiate agonists and antagonists as well as their corresponding dextrorotatory isomers are weak competitors for tritiated dextromethorphan ([3H]DM) binding sites and display IC50 values in the micromolar range. In contrast, several non-narcotic, centrally acting antitussives are inhibitory in the nanomolar range (IC50 values for caramiphen, carbetapentane, dimethoxanate, and pipazethate are 25 nM, 9 nM, 41 nM, and 190 nM, respectively). Other antitussives, such as levopropoxyphene, chlophedianol, and fominoben, have poor affinity for DM sites whereas the antitussive noscapine enhances DM binding by increasing the affinity of DM for its central binding sites. Additional competition studies indicate that there is no correlation of DM binding with any of the known or putative neurotransmitters in the central nervous system. DM binding is also not related to tricyclic antidepressant binding sites or biogenic amine uptake sites. However, certain phenothiazine neuroleptics and typical and atypical antidepressants inhibit binding with IC50 values in the nanomolar range. Moreover, the anticonvulsant drug diphenylhydantoin enhances DM binding in a manner similar to that of noscapine. Preliminary experiments utilizing acid extracts of brain have not demonstrated the presence of an endogenous ligand for DM sites. The binding characteristics of DM sites studied in rat and mouse brain indicate that the relative potencies of several antitussives to inhibit specific DM binding vary according to species. High-affinity, saturable, and stereoselective [3H]DM binding sites are present in liver homogenates, but several differences have been found for these peripheral binding sites and those described for brain. Although the nature of central DM binding sites is not known, the potent interaction of several classes of centrally

  18. MicroRNA binding sites in C. elegans 3' UTRs.


    Liu, Chaochun; Rennie, William A; Mallick, Bibekanand; Kanoria, Shaveta; Long, Dang; Wolenc, Adam; Carmack, C Steven; Ding, Ye


    MicroRNAs (miRNAs) are post-transcriptional regulators of gene expression. Since the discovery of lin-4, the founding member of the miRNA family, over 360 miRNAs have been identified for Caenorhabditis elegans (C. elegans). Prediction and validation of targets are essential for elucidation of regulatory functions of these miRNAs. For C. elegans, crosslinking immunoprecipitation (CLIP) has been successfully performed for the identification of target mRNA sequences bound by Argonaute protein ALG-1. In addition, reliable annotation of the 3' untranslated regions (3' UTRs) as well as developmental stage-specific expression profiles for both miRNAs and 3' UTR isoforms are available. By utilizing these data, we developed statistical models and bioinformatics tools for both transcriptome-scale and developmental stage-specific predictions of miRNA binding sites in C. elegans 3' UTRs. In performance evaluation via cross validation on the ALG-1 CLIP data, the models were found to offer major improvements over established algorithms for predicting both seed sites and seedless sites. In particular, our top-ranked predictions have a substantially higher true positive rate, suggesting a much higher likelihood of positive experimental validation. A gene ontology analysis of stage-specific predictions suggests that miRNAs are involved in dynamic regulation of biological functions during C. elegans development. In particular, miRNAs preferentially target genes related to development, cell cycle, trafficking, and cell signaling processes. A database for both transcriptome-scale and stage-specific predictions and software for implementing the prediction models are available through the Sfold web server at PMID:24827614

  19. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A


    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  20. Shared binding sites in Lepidoptera for Bacillus thuringiensis Cry1Ja and Cry1A toxins.


    Herrero, S; González-Cabrera, J; Tabashnik, B E; Ferré, J


    Bacillus thuringiensis toxins act by binding to specific target sites in the insect midgut epithelial membrane. The best-known mechanism of resistance to B. thuringiensis toxins is reduced binding to target sites. Because alteration of a binding site shared by several toxins may cause resistance to all of them, knowledge of which toxins share binding sites is useful for predicting cross-resistance. Conversely, cross-resistance among toxins suggests that the toxins share a binding site. At least two strains of diamondback moth (Plutella xylostella) with resistance to Cry1A toxins and reduced binding of Cry1A toxins have strong cross-resistance to Cry1Ja. Thus, we hypothesized that Cry1Ja shares binding sites with Cry1A toxins. We tested this hypothesis in six moth and butterfly species, each from a different family: Cacyreus marshalli (Lycaenidae), Lobesia botrana (Tortricidae), Manduca sexta (Sphingidae), Pectinophora gossypiella (Gelechiidae), P. xylostella (Plutellidae), and Spodoptera exigua (Noctuidae). Although the extent of competition varied among species, experiments with biotinylated Cry1Ja and radiolabeled Cry1Ac showed that Cry1Ja and Cry1Ac competed for binding sites in all six species. A recent report also indicates shared binding sites for Cry1Ja and Cry1A toxins in Heliothis virescens (Noctuidae). Thus, shared binding sites for Cry1Ja and Cry1A occur in all lepidopteran species tested so far. PMID:11722929

  1. Shared Binding Sites in Lepidoptera for Bacillus thuringiensis Cry1Ja and Cry1A Toxins

    PubMed Central

    Herrero, Salvador; González-Cabrera, Joel; Tabashnik, Bruce E.; Ferré, Juan


    Bacillus thuringiensis toxins act by binding to specific target sites in the insect midgut epithelial membrane. The best-known mechanism of resistance to B. thuringiensis toxins is reduced binding to target sites. Because alteration of a binding site shared by several toxins may cause resistance to all of them, knowledge of which toxins share binding sites is useful for predicting cross-resistance. Conversely, cross-resistance among toxins suggests that the toxins share a binding site. At least two strains of diamondback moth (Plutella xylostella) with resistance to Cry1A toxins and reduced binding of Cry1A toxins have strong cross-resistance to Cry1Ja. Thus, we hypothesized that Cry1Ja shares binding sites with Cry1A toxins. We tested this hypothesis in six moth and butterfly species, each from a different family: Cacyreus marshalli (Lycaenidae), Lobesia botrana (Tortricidae), Manduca sexta (Sphingidae), Pectinophora gossypiella (Gelechiidae), P. xylostella (Plutellidae), and Spodoptera exigua (Noctuidae). Although the extent of competition varied among species, experiments with biotinylated Cry1Ja and radiolabeled Cry1Ac showed that Cry1Ja and Cry1Ac competed for binding sites in all six species. A recent report also indicates shared binding sites for Cry1Ja and Cry1A toxins in Heliothis virescens (Noctuidae). Thus, shared binding sites for Cry1Ja and Cry1A occur in all lepidopteran species tested so far. PMID:11722929

  2. Turnover of binding sites for transcription factors involved in early Drosophila development.


    Costas, Javier; Casares, Fernando; Vieira, Jorge


    Despite the importance of cis-regulatory regions in evolution, little is know about their evolutionary dynamics. In this report, we analyze the process of evolution of binding sites for transcription factors using as a model a well characterized system, the Drosophila early developmental enhancers. We compare the sequences of eight enhancer regions for early developmental genes between Drosophila melanogaster and other two species, Drosophila virilis and Drosophila pseudoobscura, searching for the presence/absence of 104 biochemically verified binding sites from D. melanogaster. We also modeled the binding specificity of each binding site by the use of well-defined positional weight matrices (PWMs). The comparisons showed that turnover of binding sites seems to fit a molecular clock, at an approximate rate of 0.94% of gain/loss of binding sites per million years. This intense turnover affects both high and low affinity binding sites at the same extent. Furthermore, the subset of overlapping binding sites is also subjected to this high turnover. Conserved binding sites seem to be constrained to maintain not only location but also the exact sequence at each particular position. Finally, we detected a significant decrease in mean PWM scores for the D. virilis binding sites in the case of Hunchback. Possible explanations for this fact are discussed. PMID:12801649

  3. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha


    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  4. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site.


    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R; Phillips, Chris; Augustin, Martin A; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek


    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5-inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  5. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek


    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  6. Identification of the synaptic vesicle glycoprotein 2 receptor binding site in botulinum neurotoxin A.


    Strotmeier, Jasmin; Mahrhold, Stefan; Krez, Nadja; Janzen, Constantin; Lou, Jianlong; Marks, James D; Binz, Thomas; Rummel, Andreas


    Botulinum neurotoxins (BoNTs) inhibit neurotransmitter release by hydrolysing SNARE proteins. The most important serotype BoNT/A employs the synaptic vesicle glycoprotein 2 (SV2) isoforms A-C as neuronal receptors. Here, we identified their binding site by blocking SV2 interaction using monoclonal antibodies with characterised epitopes within the cell binding domain (HC). The site is located on the backside of the conserved ganglioside binding pocket at the interface of the HCC and HCN subdomains. The dimension of the binding pocket was characterised in detail by site directed mutagenesis allowing the development of potent inhibitors as well as modifying receptor binding properties. PMID:24583011

  7. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.


    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  8. Prediction of calcium-binding sites by combining loop-modeling with machine learning

    PubMed Central


    Background Protein ligand-binding sites in the apo state exhibit structural flexibility. This flexibility often frustrates methods for structure-based recognition of these sites because it leads to the absence of electron density for these critical regions, particularly when they are in surface loops. Methods for recognizing functional sites in these missing loops would be useful for recovering additional functional information. Results We report a hybrid approach for recognizing calcium-binding sites in disordered regions. Our approach combines loop modeling with a machine learning method (FEATURE) for structure-based site recognition. For validation, we compared the performance of our method on known calcium-binding sites for which there are both holo and apo structures. When loops in the apo structures are rebuilt using modeling methods, FEATURE identifies 14 out of 20 crystallographically proven calcium-binding sites. It only recognizes 7 out of 20 calcium-binding sites in the initial apo crystal structures. We applied our method to unstructured loops in proteins from SCOP families known to bind calcium in order to discover potential cryptic calcium binding sites. We built 2745 missing loops and evaluated them for potential calcium binding. We made 102 predictions of calcium-binding sites. Ten predictions are consistent with independent experimental verifications. We found indirect experimental evidence for 14 other predictions. The remaining 78 predictions are novel predictions, some with intriguing potential biological significance. In particular, we see an enrichment of beta-sheet folds with predicted calcium binding sites in the connecting loops on the surface that may be important for calcium-mediated function switches. Conclusion Protein crystal structures are a potentially rich source of functional information. When loops are missing in these structures, we may be losing important information about binding sites and active sites. We have shown that

  9. Structural identification of DnaK binding sites within bovine and sheep bactenecin Bac7.


    Zahn, Michael; Kieslich, Bjorn; Berthold, Nicole; Knappe, Daniel; Hoffmann, Ralf; Strater, Norbert


    Bacterial resistance against common antibiotics is an increasing health problem. New pharmaceuticals for the treatment of infections caused by resistant pathogens are needed. Small proline-rich antimicrobial peptides (PrAMPs) from insects are known to bind intracellularly to the conventional substrate binding cleft of the E. coli Hsp70 chaperone DnaK. Furthermore, bactenecins from mammals, members of the cathelicidin family, also contain potential DnaK binding sites. Crystal structures of bovine and sheep Bac7 in complex with the DnaK substrate binding domain show that the peptides bind in the forward binding mode with a leucine positioned in the central hydrophobic pocket. In most structures, proline and arginine residues preceding leucine occupy the hydrophobic DnaK binding sites -1 and -2. Within bovine Bac7, four potential DnaK binding sites were identified. PMID:24164259

  10. COTRASIF: conservation-aided transcription-factor-binding site finder.


    Tokovenko, Bogdan; Golda, Rostyslav; Protas, Oleksiy; Obolenskaya, Maria; El'skaya, Anna


    COTRASIF is a web-based tool for the genome-wide search of evolutionary conserved regulatory regions (transcription factor-binding sites, TFBS) in eukaryotic gene promoters. Predictions are made using either a position-weight matrix search method, or a hidden Markov model search method, depending on the availability of the matrix and actual sequences of the target TFBS. COTRASIF is a fully integrated solution incorporating both a gene promoter database (based on the regular Ensembl genome annotation releases) and both JASPAR and TRANSFAC databases of TFBS matrices. To decrease the false-positives rate an integrated evolutionary conservation filter is available, which allows the selection of only those of the predicted TFBS that are present in the promoters of the related species' orthologous genes. COTRASIF is very easy to use, implements a regularly updated database of promoters and is a powerful solution for genome-wide TFBS searching. COTRASIF is freely available at PMID:19264796

  11. Every Site Counts: Submitting Transcription Factor-Binding Site Information through the CollecTF Portal.


    Erill, Ivan


    Experimentally verified transcription factor-binding sites represent an information-rich and highly applicable data type that aptly summarizes the results of time-consuming experiments and inference processes. Currently, there is no centralized repository for this type of data, which is routinely embedded in articles and extremely hard to mine. CollecTF provides the first standardized resource for submission and deposition of these data into the NCBI RefSeq database, maximizing its accessibility and prompting the community to adopt direct submission policies. PMID:26013488

  12. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei


    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  13. Characterization of the Estradiol-Binding Site Structure of Human Protein Disulfide Isomerase (PDI)

    PubMed Central

    Fu, Xin-Miao; Wang, Pan; Zhu, Bao Ting


    Background Earlier studies showed that 17β-estradiol (E2), an endogenous female sex hormone, can bind to human protein disulfide isomerase (PDI), a protein folding catalyst for disulfide bond formation and rearrangement. This binding interaction can modulate the intracellular levels of E2 and its biological actions. However, the structure of PDI's E2-binding site is still unclear at present, which is the focus of this study. Methodology/Principal Findings The E2-binding site structure of human PDI was studied by using various biochemical approaches coupled with radiometric receptor-binding assays, site-directed mutagenesis, and molecular computational modeling. Analysis of various PDI protein fragments showed that the [3H]E2-binding activity is not associated with the single b or b' domain but is associated with the b-b' domain combination. Computational docking analyses predicted that the E2-binding site is located in a hydrophobic pocket composed mainly of the b' domain and partially of the b domain. A hydrogen bond, formed between the 3-hydroxyl group of E2 and His256 of PDI is critical for the binding interaction. This binding model was jointly confirmed by a series of detailed experiments, including site-directed mutagenesis of the His256 residue coupled with selective modifications of the ligand structures to alter the binding interaction. Conclusions/Significance The results of this study elucidated the structural basis for the PDI–E2 binding interaction and the reservoir role of PDI in modulating the intracellular E2 levels. The identified PDI E2-binding site is quite different from its known peptide binding sites. Given that PDI is a potential therapeutic target for cancer chemotherapy and HIV prevention and that E2 can inhibit PDI activity in vitro, the E2-binding site structure of human PDI determined here offers structural insights which may aid in the rational design of novel PDI inhibitors. PMID:22073283

  14. Duplicate gene divergence by changes in microRNA binding sites in Arabidopsis and Brassica.


    Wang, Sishuo; Adams, Keith L


    Gene duplication provides large numbers of new genes that can lead to the evolution of new functions. Duplicated genes can diverge by changes in sequences, expression patterns, and functions. MicroRNAs play an important role in the regulation of gene expression in many eukaryotes. After duplication, two paralogs may diverge in their microRNA binding sites, which might impact their expression and function. Little is known about conservation and divergence of microRNA binding sites in duplicated genes in plants. We analyzed microRNA binding sites in duplicated genes in Arabidopsis thaliana and Brassica rapa. We found that duplicates are more often targeted by microRNAs than singletons. The vast majority of duplicated genes in A. thaliana with microRNA binding sites show divergence in those sites between paralogs. Analysis of microRNA binding sites in genes derived from the ancient whole-genome triplication in B. rapa also revealed extensive divergence. Paralog pairs with divergent microRNA binding sites show more divergence in expression patterns compared with paralog pairs with the same microRNA binding sites in Arabidopsis. Close to half of the cases of binding site divergence are caused by microRNAs that are specific to the Arabidopsis genus, indicating evolutionarily recent gain of binding sites after target gene duplication. We also show rapid evolution of microRNA binding sites in a jacalin gene family. Our analyses reveal a dynamic process of changes in microRNA binding sites after gene duplication in Arabidopsis and highlight the role of microRNA regulation in the divergence and contrasting evolutionary fates of duplicated genes. PMID:25644246

  15. Identification of clustered YY1 binding sites in Imprinting Control Regions

    SciTech Connect

    Kim, J D; Hinz, A; Bergmann, A; Huang, J; Ovcharenko, I; Stubbs, L; Kim, J


    Mammalian genomic imprinting is regulated by Imprinting Control Regions (ICRs) that are usually associated with tandem arrays of transcription factor binding sites. In the current study, the sequence features derived from a tandem array of YY1 binding sites of Peg3-DMR (differentially methylated region) led us to identify three additional clustered YY1 binding sites, which are also localized within the DMRs of Xist, Tsix, and Nespas. These regions have been shown to play a critical role as ICRs for the regulation of surrounding genes. These ICRs have maintained a tandem array of YY1 binding sites during mammalian evolution. The in vivo binding of YY1 to these regions is allele-specific and only to the unmethylated active alleles. Promoter/enhancer assays suggest that a tandem array of YY1 binding sites function as a potential orientation-dependent enhancer. Insulator assays revealed that the enhancer-blocking activity is detected only in the YY1 binding sites of Peg3-DMR but not in the YY1 binding sites of other DMRs. Overall, our identification of three additional clustered YY1 binding sites in imprinted domains suggests a significant role for YY1 in mammalian genomic imprinting.

  16. Site-directed alkylation of multiple opioid receptors. I. Binding selectivity

    SciTech Connect

    James, I.F.; Goldstein, A.


    A method for measuring and expressing the binding selectivity of ligands for mu, delta, and kappa opioid binding sites is reported. Radioligands are used that are partially selective for these sites in combination with membrane preparations enriched in each site. Enrichment was obtained by treatment of membranes with the alkylating agent beta-chlornaltrexamine in the presence of appropriate protecting ligands. After enrichment for mu receptors, (/sup 3/H) dihydromorphine bound to a single type of site as judged by the slope of competition binding curves. After enrichment for delta or kappa receptors, binding sites for (/sup 3/H) (D-Ala2, D-Leu5)enkephalin and (3H)ethylketocyclazocine, respectively, were still not homogeneous. There were residual mu sites in delta-enriched membranes but no evidence for residual mu or delta sites in kappa-enriched membranes were found. This method was used to identify ligands that are highly selective for each of the three types of sites.

  17. Lack of [3H]quinuclidinyl benzylate binding to biologically relevant binding sites on mononuclear cells.


    Adams, E M; Lubrano, T M; Gordon, J; Fields, J Z


    We analyzed the binding characteristics of [3H]quinuclidinyl benzylate ([3H]QNB), a muscarinic cholinergic ligand, to rat and human mononuclear cells (MNC). Under various assay conditions, atropine-sensitive, saturable binding occurred with an apparent Kd of 10 nM. Conditions which disrupted the MNC membrane reduced total binding and eliminated specific binding. Muscarinic agonists were unable to inhibit [3H]QNB binding to MNC at concentrations up to 10(-2) M. Stereoisomers dexetimide and levetimide were equipotent inhibitors of binding (IC50 2 x 10(-5) M). We conclude that, although atropine-sensitive binding of [3H]QNB to MNC occurs, the binding is not consistent with the presence of a biologically relevant muscarinic cholinergic receptor. PMID:1392105

  18. Functional Linkage of Adenine Nucleotide Binding Sites in Mammalian Muscle 6-Phosphofructokinase*

    PubMed Central

    Brüser, Antje; Kirchberger, Jürgen; Kloos, Marco; Sträter, Norbert; Schöneberg, Torsten


    6-Phosphofructokinases (Pfk) are homo- and heterooligomeric, allosteric enzymes that catalyze one of the rate-limiting steps of the glycolysis: the phosphorylation of fructose 6-phosphate at position 1. Pfk activity is modulated by a number of regulators including adenine nucleotides. Recent crystal structures from eukaryotic Pfk revealed several adenine nucleotide binding sites. Herein, we determined the functional relevance of two adenine nucleotide binding sites through site-directed mutagenesis and enzyme kinetic studies. Subsequent characterization of Pfk mutants allowed the identification of the activating (AMP, ADP) and inhibitory (ATP, ADP) allosteric binding sites. Mutation of one binding site reciprocally influenced the allosteric regulation through nucleotides interacting with the other binding site. Such reciprocal linkage between the activating and inhibitory binding sites is in agreement with current models of allosteric enzyme regulation. Because the allosteric nucleotide binding sites in eukaryotic Pfk did not evolve from prokaryotic ancestors, reciprocal linkage of functionally opposed allosteric binding sites must have developed independently in prokaryotic and eukaryotic Pfk (convergent evolution). PMID:22474333

  19. Helicase binding to DnaI exposes a cryptic DNA-binding site during helicase loading in Bacillus subtilis

    PubMed Central

    Ioannou, Charikleia; Schaeffer, Patrick M.; Dixon, Nicholas E.; Soultanas, Panos


    The Bacillus subtilis DnaI, DnaB and DnaD proteins load the replicative ring helicase DnaC onto DNA during priming of DNA replication. Here we show that DnaI consists of a C-terminal domain (Cd) with ATPase and DNA-binding activities and an N-terminal domain (Nd) that interacts with the replicative ring helicase. A Zn2+-binding module mediates the interaction with the helicase and C67, C70 and H84 are involved in the coordination of the Zn2+. DnaI binds ATP and exhibits ATPase activity that is not stimulated by ssDNA, because the DNA-binding site on Cd is masked by Nd. The ATPase activity resides on the Cd domain and when detached from the Nd domain, it becomes sensitive to stimulation by ssDNA because its cryptic DNA-binding site is exposed. Therefore, Nd acts as a molecular ‘switch’ regulating access to the ssDNA binding site on Cd, in response to binding of the helicase. DnaI is sufficient to load the replicative helicase from a complex with six DnaI molecules, so there is no requirement for a dual helicase loader system. PMID:17003052

  20. Helicase binding to DnaI exposes a cryptic DNA-binding site during helicase loading in Bacillus subtilis.


    Ioannou, Charikleia; Schaeffer, Patrick M; Dixon, Nicholas E; Soultanas, Panos


    The Bacillus subtilis DnaI, DnaB and DnaD proteins load the replicative ring helicase DnaC onto DNA during priming of DNA replication. Here we show that DnaI consists of a C-terminal domain (Cd) with ATPase and DNA-binding activities and an N-terminal domain (Nd) that interacts with the replicative ring helicase. A Zn2+-binding module mediates the interaction with the helicase and C67, C70 and H84 are involved in the coordination of the Zn2+. DnaI binds ATP and exhibits ATPase activity that is not stimulated by ssDNA, because the DNA-binding site on Cd is masked by Nd. The ATPase activity resides on the Cd domain and when detached from the Nd domain, it becomes sensitive to stimulation by ssDNA because its cryptic DNA-binding site is exposed. Therefore, Nd acts as a molecular 'switch' regulating access to the ssDNA binding site on Cd, in response to binding of the helicase. DnaI is sufficient to load the replicative helicase from a complex with six DnaI molecules, so there is no requirement for a dual helicase loader system. PMID:17003052

  1. Predicting Flavin and Nicotinamide Adenine Dinucleotide-Binding Sites in Proteins Using the Fragment Transformation Method

    PubMed Central

    Lin, Yu-Feng; Chen, Jin-Yi


    We developed a computational method to identify NAD- and FAD-binding sites in proteins. First, we extracted from the Protein Data Bank structures of proteins that bind to at least one of these ligands. NAD-/FAD-binding residue templates were then constructed by identifying binding residues through the ligand-binding database BioLiP. The fragment transformation method was used to identify structures within query proteins that resembled the ligand-binding templates. By comparing residue types and their relative spatial positions, potential binding sites were identified and a ligand-binding potential for each residue was calculated. Setting the false positive rate at 5%, our method predicted NAD- and FAD-binding sites at true positive rates of 67.1% and 68.4%, respectively. Our method provides excellent results for identifying FAD- and NAD-binding sites in proteins, and the most important is that the requirement of conservation of residue types and local structures in the FAD- and NAD-binding sites can be verified. PMID:26000290

  2. Genomic mapping of Suppressor of Hairy-wing binding sites in Drosophila

    PubMed Central

    Adryan, Boris; Woerfel, Gertrud; Birch-Machin, Ian; Gao, Shan; Quick, Marie; Meadows, Lisa; Russell, Steven; White, Robert


    Background Insulator elements are proposed to play a key role in the organization of the regulatory architecture of the genome. In Drosophila, one of the best studied is the gypsy retrotransposon insulator, which is bound by the Suppressor of Hairy-wing (Su [Hw]) transcriptional regulator. Immunolocalization studies suggest that there are several hundred Su(Hw) sites in the genome, but few of these endogenous Su(Hw) binding sites have been identified. Results We used chromatin immunopurification with genomic microarray analysis to identify in vivo Su(Hw) binding sites across the 3 megabase Adh region. We find 60 sites, and these enabled the construction of a robust new Su(Hw) binding site consensus. In contrast to the gypsy insulator, which contains tightly clustered Su(Hw) binding sites, endogenous sites generally occur as isolated sites. These endogenous sites have three key features. In contrast to most analyses of DNA-binding protein specificity, we find that strong matches to the binding consensus are good predictors of binding site occupancy. Examination of occupancy in different tissues and developmental stages reveals that most Su(Hw) sites, if not all, are constitutively occupied, and these isolated Su(Hw) sites are generally highly conserved. Analysis of transcript levels in su(Hw) mutants indicate widespread and general changes in gene expression. Importantly, the vast majority of genes with altered expression are not associated with clustering of Su(Hw) binding sites, emphasizing the functional relevance of isolated sites. Conclusion Taken together, our in vivo binding and gene expression data support a role for the Su(Hw) protein in maintaining a constant genomic architecture. PMID:17705839

  3. Active Site and Laminarin Binding in Glycoside Hydrolase Family 55*

    PubMed Central

    Bianchetti, Christopher M.; Takasuka, Taichi E.; Deutsch, Sam; Udell, Hannah S.; Yik, Eric J.; Bergeman, Lai F.; Fox, Brian G.


    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100–10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  4. Active site and laminarin binding in glycoside hydrolase family 55.


    Bianchetti, Christopher M; Takasuka, Taichi E; Deutsch, Sam; Udell, Hannah S; Yik, Eric J; Bergeman, Lai F; Fox, Brian G


    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100-10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  5. Crystal structure of equine serum albumin in complex with cetirizine reveals a novel drug binding site.


    Handing, Katarzyna B; Shabalin, Ivan G; Szlachta, Karol; Majorek, Karolina A; Minor, Wladek


    Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1Å. Cetirizine is bound in two sites--a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizine binding sites. We show that the residues forming the binding pockets in ESA are highly conserved in human serum albumin (HSA), and suggest that binding of cetirizine to HSA will be similar. In support of that hypothesis, we show that the dissociation constants for cetirizine binding to CBS2 in ESA and HSA are identical using tryptophan fluorescence quenching. Presence of lysine and arginine residues that have been previously reported to undergo nonenzymatic glycosylation in CBS1 and CBS2 suggests that cetirizine transport in patients with diabetes could be altered. A review of all available SA structures from the PDB shows that in addition to the novel drug binding site we present here (CBS1), there are two pockets on SA capable of binding drugs that do not overlap with fatty acid binding sites and have not been discussed in published reviews. PMID:26896718

  6. Using circular permutation analysis to redefine the R17 coat protein binding site.


    Gott, J M; Pan, T; LeCuyer, K A; Uhlenbeck, O C


    The bacteriophage R17 coat protein binding site consists of an RNA hairpin with a single purine nucleotide bulge in the helical stem. Circular permutation analysis (CPA) was used to examine binding effects caused by a single break in the phosphodiester backbone. This method revealed that breakage of all but one phosphodiester bond within a well-defined binding site substantially reduced the binding affinity. This is probably due to destabilization of the hairpin structure upon breaking the ribose phosphates at these positions. One circularly permuted isomer with the 5' and 3' ends at the bulged nucleotide bound with wild-type affinity. However, extending the 5' end of this CP isomer greatly reduces binding, making it unlikely that this circularly permuted binding site will be active when embedded in a larger RNA. CPA also locates the 5' and 3' boundaries of protein binding sites on the RNA. The 5' boundary of the R17 coat protein site as defined by CPA was two nucleotides shorter (nucleotides -15 to +2) than the previously determined site (-17 to +2). The smaller binding site was verified by terminal truncation experiments. A minimal-binding fragment (-14 to +2) was synthesized and was found to bind tightly to the coat protein. The site size determined by 3-ethyl-1-nitrosourea-modification interference was larger at the 5' end (-16 to +1), probably due, however, to steric effects of ethylation of phosphate oxygens. Thus, the apparent site size of a protein binding site is dependent upon the method used. PMID:7504949

  7. Evidence for a non-opioid sigma binding site din the guinea-pig myenteric plexus

    SciTech Connect

    Roman, F.; Pascaud, X.; Vauche, D.; Junien, J.


    The presence of a binding site to (+)-(/sup 3/H)SKF 10,047 was demonstrated in a guinea-pig myenteric plexus (MYP) membrane preparation. Specific binding to this receptor was saturable, reversible, linear with protein concentration and consisted of two components, a high affinity site and a low affinity site. Morphine and naloxone 10/sup -4/M were unable to displace (+)-(/sup 3/H)SKF 10,047 binding. Haloperidol, imipramine, ethylketocyclazocine and propranolol were among the most potent compounds to inhibit this specific binding. These results suggest the presence of a non-opioid haloperidol sensitive sigma receptor in the MYP of the guinea-pig.

  8. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    SciTech Connect

    Muccioli, G.; Guardabassi, A.; Pattono, P. )


    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrence of prolactin specific binding sites in Xenopus laevis choroid plexus cells.

  9. 2-([sup 125]I) iodomelatonin binding sites in rat adrenals: Pharmacological characteristics and subcellular distribution

    SciTech Connect

    Persengiev, S.P. )


    Specific binding sites for 2-[[sup 125]I] iodomelatonin, a selective radiolabeled melatonin receptor ligand, were detected and characterized in rat adrenal membranes. Saturation studies demonstrated that 2-[[sup 125]I]iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 541 pM and a total binding capacity (Bmax) of 3.23 fmol/mg protein. Competition experiments revealed that the relative order of potency of compounds tested was as follows: 6-chloromelatonin > 2-iodomelatonin > melatonin > 5-methoxytryptamine > 5-methoxytryptophol. The highest density of binding sites was found in membranes from nuclear and mitochondrial subcellular fractions.

  10. ABC transporters: one, two or four extracytoplasmic substrate-binding sites?

    PubMed Central

    van der Heide, Tiemen; Poolman, Bert


    Two families of ATP-binding cassette (ABC) transporters in which one or two extracytoplasmic substrate-binding domains are fused to either the N- or C-terminus of the translocator protein have been detected. This suggests that two, or even four, substrate-binding sites may function in the ABC transporter complex. This domain organization in ABC transporters, widely represented among microorganisms, raises new possibilities for how the substrate-binding protein(s) (SBPs) might interact with the translocator. One appealing hypothesis is that multiple substrate-binding sites in proximity to the entry site of the translocation pore enhance the transport capacity. We also discuss the implications of multiple substrate-binding sites in close proximity to the translocator in terms of broadened substrate specificity and possible cooperative interactions between SBPs and the translocator. PMID:12370206

  11. Pharmacological characterization of tachykinin septide-sensitive binding sites in the rat submaxillary gland.


    Beaujouan, J C; Saffroy, M; Torrens, Y; Sagan, S; Glowinski, J


    Binding studies have shown that [125I]NKA is a selective ligand of tachykinin septide-sensitive binding sites from membranes of the rat submaxillary gland. Indeed, this ligand bound with high affinity to a single population of sites. In addition, competition studies indicated that natural tachykinins and tachykinin-related compounds had a similar affinity for these sites than for those labeled with [3H]ALIE-124, a selective ligand of septide-sensitive binding sites. Moreover, selective tachykinin NK2, or NK3 agonists or antagonists exhibited weak or no affinity for [125I]NKA binding sites. As indicated by Ki values of several compounds, the pharmacological characteristics of the septide-sensitive binding sites (labeled with [125I]NKA) largely differ from those of classic NK1 binding sites, as determined on crude synaptosomes from the rat brain using [125I]Bolton-Hunter substance P (SP) as ligand. Indeed, several tachykinins including neurokinin A (NKA), neuropeptide K (NPK), neuropeptide gamma (NKgamma), and neurokinin B, as well as some SP and NKA analogues or C-terminal fragments such as septide, ALIE-124, SP(6-11), NKA(4-10), which have a weak affinity for classic tachykinin NK1 binding sites exhibited a high affinity for the septide-sensitive binding sites. In contrast, SP, classic selective NK1 agonists, and antagonists had a high affinity for both types of binding sites. The presence of a large population of tachykinin septide-sensitive binding sites in the rat submaxillary gland may thus explain why NPK and NPgamma induce salivary secretion and may potentiate the SP-evoked response in spite of the absence of tachykinin NK2 receptors in this tissue. PMID:10612450

  12. Identification of two uridine binding domain peptides of the UDP-glucose-binding site of rabbit muscle glycogenin.


    Carrizo, M E; Curtino, J A


    Glycogenin, the autoglucosyltransferase that initiates the de novo biosynthesis of glycogen, photoaffinity labeled with [beta32P]5-azido-UDP-glucose. The photoinsertion of the azidouridine derivative showed activating ultraviolet light dependency, saturation effects, and inhibition by UDP-glucose, thus demonstrating the specificity of the interaction. In the absence of Mn2+, the requirement for the catalytic activity of glycogenin, the photolabeling decreased by 70%. Competitive binding experiments indicated that the pyrophosphate or a phosphate was the moiety of UDP-glucose implicated in the strongest interaction at the binding site. Proteolytic digestion of photolabeled glycogenin resulted in the identification of two labeled fragments, 89-143 and 168-233, that carried the uridine binding sites. This is the first report of the region of glycogenin that harbors the UDP-glucose-binding domain. PMID:9918805

  13. Selectivity of ORC binding sites and the relation to replication timing, fragile sites, and deletions in cancers.


    Miotto, Benoit; Ji, Zhe; Struhl, Kevin


    The origin recognition complex (ORC) binds sites from which DNA replication is initiated. We address ORC binding selectivity in vivo by mapping ∼52,000 ORC2 binding sites throughout the human genome. The ORC binding profile is broader than those of sequence-specific transcription factors, suggesting that ORC is not bound or recruited to specific DNA sequences. Instead, ORC binds nonspecifically to open (DNase I-hypersensitive) regions containing active chromatin marks such as H3 acetylation and H3K4 methylation. ORC sites in early and late replicating regions have similar properties, but there are far more ORC sites in early replicating regions. This suggests that replication timing is due primarily to ORC density and stochastic firing of origins. Computational simulation of stochastic firing from identified ORC sites is in accord with replication timing data. Large genomic regions with a paucity of ORC sites are strongly associated with common fragile sites and recurrent deletions in cancers. We suggest that replication origins, replication timing, and replication-dependent chromosome breaks are determined primarily by the genomic distribution of activator proteins at enhancers and promoters. These activators recruit nucleosome-modifying complexes to create the appropriate chromatin structure that allows ORC binding and subsequent origin firing. PMID:27436900

  14. Characterization of Naphthaleneacetic Acid Binding to Receptor Sites on Cellular Membranes of Maize Coleoptile Tissue 1

    PubMed Central

    Ray, Peter M.; Dohrmann, Ulrike; Hertel, Rainer


    Characteristics of and optimum conditions for saturable (“specific”) binding of [14C]naphthaleneacetic acid to sites located on membranous particles from maize (Zea mays L.) coleoptiles are described. Most, if not all, of the specific binding appears to be due to a single kinetic class of binding sites having a KD of 5 to 7 × 10−7m for naphthalene-1-acetic acid (NAA). Binding of NAA is insensitive to high monovalent salt concentrations, indicating that binding is not primarily ionic. However, specific binding is inhibited by Mg2+ or Ca2+ above 5 mm. Specific binding is improved by organic acids, especially citrate. Binding is heat-labile and is sensitive to agents that act either on proteins or on lipids. Specific binding is reversibly inactivated by reducing agents such as dithioerythritol; a reducible group, possibly a disulfide group, may be located at the binding site and required for its function. The affinity of the specific binding sites for auxins is modified by an unidentified dialyzable, heat-stable, apparently amphoteric, organic factor (“supernatant factor”) found in maize tissue. PMID:16659851

  15. Probing the Binding Site of Bile Acids in TGR5.


    Macchiarulo, Antonio; Gioiello, Antimo; Thomas, Charles; Pols, Thijs W H; Nuti, Roberto; Ferrari, Cristina; Giacchè, Nicola; De Franco, Francesca; Pruzanski, Mark; Auwerx, Johan; Schoonjans, Kristina; Pellicciari, Roberto


    TGR5 is a G-protein-coupled receptor (GPCR) mediating cellular responses to bile acids (BAs). Although some efforts have been devoted to generate homology models of TGR5 and draw structure-activity relationships of BAs, none of these studies has hitherto described how BAs bind to TGR5. Here, we present an integrated computational, chemical, and biological approach that has been instrumental to determine the binding mode of BAs to TGR5. As a result, key residues have been identified that are involved in mediating the binding of BAs to the receptor. Collectively, these results provide new hints to design potent and selective TGR5 agonists. PMID:24900622

  16. Comparing binding site information to binding affinity reveals that Crp/DNA complexes have several distinct binding conformers

    PubMed Central

    Holmquist, Peter C.; Holmquist, Gerald P.; Summers, Michael L.


    We show that the cAMP receptor protein (Crp) binds to DNA as several different conformers. This situation has precluded discovering a high correlation between any sequence property and binding affinity for proteins that bend DNA. Experimentally quantified affinities of Synechocystis sp. PCC 6803 cAMP receptor protein (SyCrp1), the Escherichia coli Crp (EcCrp, also CAP) and DNA were analyzed to mathematically describe, and make human-readable, the relationship of DNA sequence and binding affinity in a given system. Here, sequence logos and weight matrices were built to model SyCrp1 binding sequences. Comparing the weight matrix model to binding affinity revealed several distinct binding conformations. These Crp/DNA conformations were asymmetrical (non-palindromic). PMID:21586590

  17. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.


    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte


    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  18. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte


    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  19. Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters

    PubMed Central

    Erb, Ionas; van Nimwegen, Erik


    The availability of sequence specificities for a substantial fraction of yeast's transcription factors and comparative genomic algorithms for binding site prediction has made it possible to comprehensively annotate transcription factor binding sites genome-wide. Here we use such a genome-wide annotation for comprehensively studying promoter architecture in yeast, focusing on the distribution of transcription factor binding sites relative to transcription start sites, and the architecture of TATA and TATA-less promoters. For most transcription factors, binding sites are positioned further upstream and vary over a wider range in TATA promoters than in TATA-less promoters. In contrast, a group of ‘proximal promoter motifs’ (GAT1/GLN3/DAL80, FKH1/2, PBF1/2, RPN4, NDT80, and ROX1) occur preferentially in TATA-less promoters and show a strong preference for binding close to the transcription start site in these promoters. We provide evidence that suggests that pre-initiation complexes are recruited at TATA sites in TATA promoters and at the sites of the other proximal promoter motifs in TATA-less promoters. TATA-less promoters can generally be classified by the proximal promoter motif they contain, with different classes of TATA-less promoters showing different patterns of transcription factor binding site positioning and nucleosome coverage. These observations suggest that different modes of regulation of transcription initiation may be operating in the different promoter classes. In addition we show that, across all promoter classes, there is a close match between nucleosome free regions and regions of highest transcription factor binding site density. This close agreement between transcription factor binding site density and nucleosome depletion suggests a direct and general competition between transcription factors and nucleosomes for binding to promoters. PMID:21931670

  20. Detecting O2 binding sites in protein cavities

    PubMed Central

    Kitahara, Ryo; Yoshimura, Yuichi; Xue, Mengjun; Kameda, Tomoshi; Mulder, Frans A. A.


    Internal cavities are important elements in protein structure, dynamics, stability and function. Here we use NMR spectroscopy to investigate the binding of molecular oxygen (O2) to cavities in a well-studied model for ligand binding, the L99A mutant of T4 lysozyme. On increasing the O2 concentration to 8.9 mM, changes in 1H, 15N, and 13C chemical shifts and signal broadening were observed specifically for backbone amide and side chain methyl groups located around the two hydrophobic cavities of the protein. O2-induced longitudinal relaxation enhancements for amide and methyl protons could be adequately accounted for by paramagnetic dipolar relaxation. These data provide the first experimental demonstration that O2 binds specifically to the hydrophobic, and not the hydrophilic cavities, in a protein. Molecular dynamics simulations visualized the rotational and translational motions of O2 in the cavities, as well as the binding and egress of O2, suggesting that the channel consisting of helices D, E, G, H, and J could be the potential gateway for ligand binding to the protein. Due to strong paramagnetic relaxation effects, O2 gas-pressure NMR measurements can detect hydrophobic cavities when populated to as little as 1%, and thereby provide a general and highly sensitive method for detecting oxygen binding in proteins. PMID:26830762

  1. Examination of Glycosaminoglycan Binding Sites on the XCL1 Dimer.


    Fox, Jamie C; Tyler, Robert C; Peterson, Francis C; Dyer, Douglas P; Zhang, Fuming; Linhardt, Robert J; Handel, Tracy M; Volkman, Brian F


    Known for its distinct metamorphic behavior, XCL1 interconverts between a canonical chemokine folded monomer (XCL1mon) that interacts with the receptor, XCR1, and a unique dimer (XCL1dim) that interacts with glycosaminoglycans and inhibits HIV-1 activity. This study presents the first detailed analysis of the GAG binding properties of XCL1dim. Basic residues within a conformationally selective dimeric variant of XCL1 (W55D) were mutated and analyzed for their effects on heparin binding. Mutation of Arg23 and Arg43 greatly diminished the level of heparin binding in both heparin Sepharose chromatography and surface plasmon resonance assays. To assess the contributions of different GAG structures to XCL1 binding, we developed a solution fluorescence polarization assay and correlated affinity with the length and level of sulfation of heparan sulfate oligosaccharides. It was recently demonstrated that the XCL1 GAG binding form, XCL1dim, is responsible for preventing HIV-1 infection through interactions with gp120. This study defines a GAG binding surface on XCL1dim that includes residues that are important for HIV-1 inhibition. PMID:26836755

  2. A Three-Site Mechanism for Agonist/Antagonist Selective Binding to Vasopressin Receptors.


    Saleh, Noureldin; Saladino, Giorgio; Gervasio, Francesco L; Haensele, Elke; Banting, Lee; Whitley, David C; Sopkova-de Oliveira Santos, Jana; Bureau, Ronan; Clark, Timothy


    Molecular-dynamics simulations with metadynamics enhanced sampling reveal three distinct binding sites for arginine vasopressin (AVP) within its V2 -receptor (V2 R). Two of these, the vestibule and intermediate sites, block (antagonize) the receptor, and the third is the orthosteric activation (agonist) site. The contacts found for the orthosteric site satisfy all the requirements deduced from mutagenesis experiments. Metadynamics simulations for V2 R and its V1a R-analog give an excellent correlation with experimental binding free energies by assuming that the most stable binding site in the simulations corresponds to the experimental binding free energy in each case. The resulting three-site mechanism separates agonists from antagonists and explains subtype selectivity. PMID:27184628

  3. Low affinity binding site clusters confer hox specificity and regulatory robustness.


    Crocker, Justin; Abe, Namiko; Rinaldi, Lucrezia; McGregor, Alistair P; Frankel, Nicolás; Wang, Shu; Alsawadi, Ahmad; Valenti, Philippe; Plaza, Serge; Payre, François; Mann, Richard S; Stern, David L


    In animals, Hox transcription factors define regional identity in distinct anatomical domains. How Hox genes encode this specificity is a paradox, because different Hox proteins bind with high affinity in vitro to similar DNA sequences. Here, we demonstrate that the Hox protein Ultrabithorax (Ubx) in complex with its cofactor Extradenticle (Exd) bound specifically to clusters of very low affinity sites in enhancers of the shavenbaby gene of Drosophila. These low affinity sites conferred specificity for Ubx binding in vivo, but multiple clustered sites were required for robust expression when embryos developed in variable environments. Although most individual Ubx binding sites are not evolutionarily conserved, the overall enhancer architecture-clusters of low affinity binding sites-is maintained and required for enhancer function. Natural selection therefore works at the level of the enhancer, requiring a particular density of low affinity Ubx sites to confer both specific and robust expression. PMID:25557079

  4. Crystallographic Study of Novel Transthyretin Ligands Exhibiting Negative-Cooperativity between Two Thyroxine Binding Sites

    PubMed Central

    Singh, Rajiv Ranjan; Mishra, Satyendra; Gupta, Sarika; Surolia, Avadhesha; Salunke, Dinakar M.


    Background Transthyretin (TTR) is a homotetrameric serum and cerebrospinal fluid protein that transports thyroxine (T4) and retinol by binding to retinol binding protein. Rate-limiting tetramer dissociation and rapid monomer misfolding and disassembly of TTR lead to amyloid fibril formation in different tissues causing various amyloid diseases. Based on the current understanding of the pathogenesis of TTR amyloidosis, it is considered that the inhibition of amyloid fibril formation by stabilization of TTR in native tetrameric form is a viable approach for the treatment of TTR amyloidosis. Methodology and Principal Findings We have examined interactions of the wtTTR with a series of compounds containing various substitutions at biphenyl ether skeleton and a novel compound, previously evaluated for binding and inhibiting tetramer dissociation, by x-ray crystallographic approach. High resolution crystal structures of five ligands in complex with wtTTR provided snapshots of negatively cooperative binding of ligands in two T4 binding sites besides characterizing their binding orientations, conformations, and interactions with binding site residues. In all complexes, the ligand has better fit and more potent interactions in first T4 site i.e. (AC site) than the second T4 site (BD site). Together, these results suggest that AC site is a preferred ligand binding site and retention of ordered water molecules between the dimer interfaces further stabilizes the tetramer by bridging a hydrogen bond interaction between Ser117 and its symmetric copy. Conclusion Novel biphenyl ether based compounds exhibit negative-cooperativity while binding to two T4 sites which suggests that binding of only single ligand molecule is sufficient to inhibit the TTR tetramer dissociation. PMID:22973437

  5. Position specific variation in the rate of evolution intranscription factor binding sites

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.


    The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

  6. Common Internal Allosteric Network Links Anesthetic Binding Sites in a Pentameric Ligand-Gated Ion Channel.


    Joseph, Thomas T; Mincer, Joshua S


    General anesthetics bind reversibly to ion channels, modifying their global conformational distributions, but the underlying atomic mechanisms are not completely known. We examine this issue by way of the model protein Gloeobacter violaceous ligand-gated ion channel (GLIC) using computational molecular dynamics, with a coarse-grained model to enhance sampling. We find that in flooding simulations, both propofol and a generic particle localize to the crystallographic transmembrane anesthetic binding region, and that propofol also localizes to an extracellular region shared with the crystallographic ketamine binding site. Subsequent simulations to probe these binding modes in greater detail demonstrate that ligand binding induces structural asymmetry in GLIC. Consequently, we employ residue interaction correlation analysis to describe the internal allosteric network underlying the coupling of ligand and distant effector sites necessary for conformational change. Overall, the results suggest that the same allosteric network may underlie the actions of various anesthetics, regardless of binding site. PMID:27403526

  7. Common Internal Allosteric Network Links Anesthetic Binding Sites in a Pentameric Ligand-Gated Ion Channel

    PubMed Central

    Joseph, Thomas T.


    General anesthetics bind reversibly to ion channels, modifying their global conformational distributions, but the underlying atomic mechanisms are not completely known. We examine this issue by way of the model protein Gloeobacter violaceous ligand-gated ion channel (GLIC) using computational molecular dynamics, with a coarse-grained model to enhance sampling. We find that in flooding simulations, both propofol and a generic particle localize to the crystallographic transmembrane anesthetic binding region, and that propofol also localizes to an extracellular region shared with the crystallographic ketamine binding site. Subsequent simulations to probe these binding modes in greater detail demonstrate that ligand binding induces structural asymmetry in GLIC. Consequently, we employ residue interaction correlation analysis to describe the internal allosteric network underlying the coupling of ligand and distant effector sites necessary for conformational change. Overall, the results suggest that the same allosteric network may underlie the actions of various anesthetics, regardless of binding site. PMID:27403526

  8. Heparanase Activates Antithrombin through the Binding to Its Heparin Binding Site

    PubMed Central

    Águila, Sonia; Teruel-Montoya, Raúl; Vicente, Vicente; Corral, Javier; Martínez-Martínez, Irene


    Heparanase is an endoglycosidase that participates in morphogenesis, tissue repair, heparan sulphates turnover and immune response processes. It is over-expressed in tumor cells favoring the metastasis as it penetrates the endothelial layer that lines blood vessels and facilitates the metastasis by degradation of heparan sulphate proteoglycans of the extracellular matrix. Heparanase may also affect the hemostatic system in a non-enzymatic manner, up-regulating the expression of tissue factor, which is the initiator of blood coagulation, and dissociating tissue factor pathway inhibitor on the cell surface membrane of endothelial and tumor cells, thus resulting in a procoagulant state. Trying to check the effect of heparanase on heparin, a highly sulphated glycosaminoglycan, when it activates antithrombin, our results demonstrated that heparanase, but not proheparanase, interacted directly with antithrombin in a non-covalent manner. This interaction resulted in the activation of antithrombin, which is the most important endogenous anticoagulant. This activation mainly accelerated FXa inhibition, supporting an allosteric activation effect. Heparanase bound to the heparin binding site of antithrombin as the activation of Pro41Leu, Arg47Cys, Lys114Ala and Lys125Alaantithrombin mutants was impaired when it was compared to wild type antithrombin. Intrinsic fluorescence analysis showed that heparanase induced an activating conformational change in antithrombin similar to that induced by heparin and with a KD of 18.81 pM. In conclusion, under physiological pH and low levels of tissue factor, heparanase may exert a non-enzymatic function interacting and activating the inhibitory function of antithrombin. PMID:27322195

  9. Pharmacological specificity of some psychotomimetic and antipsychotic agents for the sigma and PCP binding sites

    SciTech Connect

    Itzhak, Y.


    The pharmacological specificity of representative psychotomimetic agents such a phencyclidine (PCP) analogs, opiate benzomorphans and several antipsychotic agents was assessed for the sigma and PCP binding sites. In a series of binding experiments, in rat brain membranes, sigma and PCP binding sites were labeled with (/sup 3/H)-1-(1-(3-hydroxyphenyl) cyclohexyl) piperidine ((/sup 3/H)PCP-3-OH), (+)(/sup 3/H)-N-allylnormetazocine ((+)(/sup 3/H)SKF 10047) and (+) (/sup 3/H)-3-(3-hydroxy-phenyl)-N-(1-propyl) piperidine and ((+)(/sup 3/H)-3-PPP). PCP analogs inhibit potently high affinity (/sup 3/H)PCP-3-OH binding and (+)(/sup 3/H)SKF 10047 binding, moderately the low affinity binding component of (/sup 3/H)PCP-3-OH and very weakly (+) (/sup 3/H)-3-PPP binding. (+)SKF 10047 and cyclazocine are potent to moderate inhibitors of (+)(/sup 3/H)SKF 10047, high affinity (/sup 3/H)PCP-3-OH and (+)(/sup 3/H)-3-PCP-3-OH binding. The antipsychotic agents display high affinity for (+)(/sup 3/H)-3-PPP binding sites, moderate affinity for (+)(/sup 3/H)SKF 10047 sites and have no effect on either the high or low affinity (/sup 3/H)PCP-3-OH binding. 20 references, 3 figures, 2 tables.

  10. Multiple sup 3 H-oxytocin binding sites in rat myometrial plasma membranes

    SciTech Connect

    Crankshaw, D.; Gaspar, V.; Pliska, V. )


    The affinity spectrum method has been used to analyse binding isotherms for {sup 3}H-oxytocin to rat myometrial plasma membranes. Three populations of binding sites with dissociation constants (Kd) of 0.6-1.5 x 10(-9), 0.4-1.0 x 10(-7) and 7 x 10(-6) mol/l were identified and their existence verified by cluster analysis based on similarities between Kd, binding capacity and Hill coefficient. When experimental values were compared to theoretical curves constructed using the estimated binding parameters, good fits were obtained. Binding parameters obtained by this method were not influenced by the presence of GTP gamma S (guanosine-5'-O-3-thiotriphosphate) in the incubation medium. The binding parameters agree reasonably well with those found in uterine cells, they support the existence of a medium affinity site and may allow for an explanation of some of the discrepancies between binding and response in this system.

  11. Phosfinder: a web server for the identification of phosphate-binding sites on protein structures.


    Parca, Luca; Mangone, Iolanda; Gherardini, Pier Federico; Ausiello, Gabriele; Helmer-Citterich, Manuela


    Phosfinder is a web server for the identification of phosphate binding sites in protein structures. Phosfinder uses a structural comparison algorithm to scan a query structure against a set of known 3D phosphate binding motifs. Whenever a structural similarity between the query protein and a phosphate binding motif is detected, the phosphate bound by the known motif is added to the protein structure thus representing a putative phosphate binding site. Predicted binding sites are then evaluated according to (i) their position with respect to the query protein solvent-excluded surface and (ii) the conservation of the binding residues in the protein family. The server accepts as input either the PDB code of the protein to be analyzed or a user-submitted structure in PDB format. All the search parameters are user modifiable. Phosfinder outputs a list of predicted binding sites with detailed information about their structural similarity with known phosphate binding motifs, and the conservation of the residues involved. A graphical applet allows the user to visualize the predicted binding sites on the query protein structure. The results on a set of 52 apo/holo structure pairs show that the performance of our method is largely unaffected by ligand-induced conformational changes. Phosfinder is available at PMID:21622655

  12. Triphenylethylene antiestrogen-binding sites in cockerel liver nuclei: evidence for an endogenous ligand.


    Murphy, P R; Butts, C; Lazier, C B


    Salt extracts of purified nuclei from cockerel liver contain a limited number of sites that bind triphenylethylene nonsteroidal antiestrogens with high affinity and specificity. The assay of the [3H]tamoxifen (3H-labeled 1-[4-(2-dimethylaminoethyoxy)phenyl] 1,2-diphenylbut-1-(Z)ene)-binding sites is optimally achieved by preincubation of the salt extracts with charcoal-dextran suspension; a 4- to 8-fold increase in activity over that obtained with nontreated extracts is found. This suggests that the binding sites are occupied in vivo by an unknown endogenous ligand. The equilibrium dissociation constant for [3H]tamoxifen binding is 4.76 +/- 1.8 nM, and the binding site concentration is 1.7 +/- 0.7 fmol/microgram DNA. The concentration of high affinity estrogen-binding sites in the same extracts is almost 30-fold less (0.06 +/- 0.01 fmol/micrograms DNA). The relative binding affinities of various antiestrogens for the nuclear antiestrogen-binding sites (with tamoxifen arbitrarily set at 100%) are as follows: nafoxidine (1-[2-(p-[3,4-dihydro-6-methoxy-2-phenyl-1-naphthyl]phenoxy)ethyl] pyrrolidine hydrochloride); 126%) greater than tamoxifen (100%) greater than N-des-methyltamoxifen (16%) greater than CI-628 (alpha-[p-[2-(1-pyrrolidine)ethyoxy]phenyl] 4-methoxy-alpha'-nitrostilbene; 14%) greater than 4-hydroxytamoxifen (7%). Estrogens (17 beta-estradiol, estriol, estrone, and diethylstilbestrol) and several other steroids (cholesterol, dihydrotestosterone, pregnenolone, progesterone, and hydrocortisone) show little or no affinity for binding to the nuclear sites (relative binding affinity, less than 0.5%). However, ether extracts of cockerel serum or liver nuclei contain a substance(s) that competitively inhibits [3H]tamoxifen binding to the nuclear antiestrogen-binding sites. The ether-soluble material does not compete for [3H]estradiol binding to the salt-soluble nuclear estrogen receptor. These studies suggest that cockerel serum and liver nuclei contain a natural

  13. Prediction of the key binding site of odorant-binding protein of Holotrichia oblita Faldermann (Coleoptera: Scarabaeida).


    Zhuang, X; Wang, Q; Wang, B; Zhong, T; Cao, Y; Li, K; Yin, J


    The scarab beetle Holotrichia oblita Faldermann (Coleoptera: Scarabaeidae) is a predominant underground pest in the northern parts of China, and its larvae (grubs) cause great economic losses because of its wide range of host plants and covert habitats. Environmentally friendly strategies for controlling adults would have novel and broad potential applications. One potential pest management measure is the regulation of olfactory chemoreception to control target insect pests. In the process of olfactory recognition, odorant-binding proteins (OBPs) are believed to carry hydrophobic odorants from the environment to the surface of olfactory receptor neurons. To obtain a better understanding of the relationship between OBP structures and their ligands, homology modelling and molecular docking have been conducted on the interaction between HoblOBP1 and hexyl benzoate in the present study. Based on the results, site-directed mutagenesis and binding experiments were combined to describe the binding sites of HoblOBP1 and to explore its ligand-binding mechanism. After homology modelling of HoblOBP1, it was found that the three-dimensional structure of HoblOBP1 consists of six α-helices and three disulphide bridges that connect the helices, and the hydrophobic pockets are both composed of five helices. Based on the docking study, we found that van der Waals interactions and hydrophobic interactions are both important in the bonding between HoblOBP1 and hexyl benzoate. Intramolecular residues formed the hydrogen bonds in the C terminus of the protein and the bonds are crucial for the ligand-binding specificity. Finally, MET48, ILE80 and TYR111 are binding sites predicted for HoblOBP1. Using site-directed mutagenesis and fluorescence assays, it was found that ligands could not be recognized by mutant of Tyr111. A possible explanation is that the compound could not be recognized by the mutant, and remains in the binding cavity because of the loss of the intramolecular

  14. Locating the binding sites of antitumor drug tamoxifen and its metabolites with DNA.


    Bourassa, P; Thomas, T J; Tajmir-Riahi, H A


    We located the binding sites of antitumor drugs tamoxifen, 4-hydroxytamoxifen and endoxifen with calf-thymus DNA. FTIR, CD, UV-vis and fluorescence spectroscopic methods as well as molecular modeling were used to characterize the drug binding sites, binding constant and the effect of drug binding on DNA stability and conformation. Structural analysis showed that tamoxifen and its metabolites bind DNA via hydrophobic and hydrophilic interactions with overall binding constants of K(tam-DNA)=3.5 (±0.2)×10⁴ M⁻¹, K(4-hydroxytam-DNA)=3.3 (±0.4) × 10⁴ M⁻¹ and K(endox)-DNA=2.8 (±0.8)×10⁴ M⁻¹. The number of binding sites occupied by drug is 1 (tamoxifen), 0.8 (4-hydroxitamoxifen) and 1.2 (endoxifen). Docking showed the participation of several nucleobases in drug-DNA complexes with the free binding energy of -3.85 (tamoxifen), -4.18 (4-hydroxtamoxifen) and -3.74 kcal/mol (endoxifen). The order of binding is 4-hydroxy-tamoxen>tamoxifen>endoxifen. Drug binding did not alter DNA conformation from B-family structure, while major biopolymer aggregation occurred at high drug concentrations. The drug binding mode is correlated with the mechanism of action of antitumor activity of tamoxifen and its metabolites. PMID:24682017

  15. Autoradiographic localization of peptide YY and neuropeptide Y binding sites in the medulla oblongata

    SciTech Connect

    Leslie, R.A.; McDonald, T.J.; Robertson, H.A.


    Peptide YY is a highly potent emetic when given intravenously in dogs. We hypothesized that the area postrema, a small brain stem nucleus that acts as a chemoreceptive trigger zone for vomiting and lies outside the blood-brain barrier, might have receptors that PYY would bind to, in order to mediate the emetic response. We prepared (/sup 125/I)PYY and used autoradiography to show that high affinity binding sites for this ligand were highly localized in the area postrema and related nuclei of the dog medulla oblongata. Furthermore, the distribution of (/sup 125/I)PYY binding sites in the rat medulla oblongata was very similar to that in the dog; the distribution of (/sup 125/I)PYY binding sites throughout the rat brain was seen to be similar to the distribution of (/sup 125/I)NPY binding sites.

  16. Impact of Binding Site Comparisons on Medicinal Chemistry and Rational Molecular Design.


    Ehrt, Christiane; Brinkjost, Tobias; Koch, Oliver


    Modern rational drug design not only deals with the search for ligands binding to interesting and promising validated targets but also aims to identify the function and ligands of yet uncharacterized proteins having impact on different diseases. Additionally, it contributes to the design of inhibitors with distinct selectivity patterns and the prediction of possible off-target effects. The identification of similarities between binding sites of various proteins is a useful approach to cope with those challenges. The main scope of this perspective is to describe applications of different protein binding site comparison approaches to outline their applicability and impact on molecular design. The article deals with various substantial application domains and provides some outstanding examples to show how various binding site comparison methods can be applied to promote in silico drug design workflows. In addition, we will also briefly introduce the fundamental principles of different protein binding site comparison methods. PMID:27046190

  17. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin.


    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya; Imamura, Akihiro; Ishida, Hideharu; Kiso, Makoto; Ando, Hiromune; Kato, Ryuichi


    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding site has a different carbohydrate binding affinity. PMID:27318092

  18. Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene.

    PubMed Central

    Groenen, M A; Dijkhof, R J; van der Poel, J J; van Diggelen, R; Verstege, E


    Using a set of overlapping oligonucleotides from the promoter region of the bovine alpha s2-casein gene we have identified two nuclear factors which probably are involved in expression of this gene and the related calcium sensitive alpha s1- and beta-casein genes. One of these factors which was present in extracts of all tissues that have been tested including Hela cells turned out to be the octamer binding protein OCT-1. Oct-1 binds with different affinity to 4 sites at positions centred around -480, -260, -210 and -50. The strongest of these 4 binding sites, the one around position -50, is highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. The other nuclear factor (MGF, mammary gland factor) which is specifically expressed in the mammary gland, binds to a site around position -90. This binding site is also highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. Images PMID:1508722

  19. Computational predictions suggest that structural similarity in viral polymerases may lead to comparable allosteric binding sites.


    Brown, Jodian A; Espiritu, Marie V; Abraham, Joel; Thorpe, Ian F


    The identification of ligand-binding sites is often the first step in drug targeting and design. To date there are numerous computational tools available to predict ligand binding sites. These tools can guide or mitigate the need for experimental methods to identify binding sites, which often require significant resources and time. Here, we evaluate four ligand-binding site predictor (LBSP) tools for their ability to predict allosteric sites within the Hepatitis C Virus (HCV) polymerase. Our results show that the LISE LBSP is able to identify all three target allosteric sites within the HCV polymerase as well as a known allosteric site in the Coxsackievirus polymerase. LISE was then employed to identify novel binding sites within the polymerases of the Dengue, West Nile, and Foot-and-mouth Disease viruses. Our results suggest that all three viral polymerases have putative sites that share structural or chemical similarities with allosteric pockets of the HCV polymerase. Thus, these binding locations may represent an evolutionarily conserved structural feature of several viral polymerases that could be exploited for the development of small molecule therapeutics. PMID:27262620

  20. Hybridoma antibodies to the lipid-binding site(s) in the amino-terminal region of fibronectin inhibits binding of streptococcal lipoteichoic acid.


    Stanislawski, L; Courtney, H S; Simpson, W A; Hasty, D L; Beachey, E H; Robert, L; Ofek, I


    In this report, we present evidence to suggest that streptococci and lipoteichoic acid (LTA) interact with a fatty acid binding site located near the NH2-terminus of fibronectin. The evidence is based on the following observations. Antibodies directed against a synthetic peptide (residues 1-30 of the amino-terminus of fibronectin) reacted with the two thermolysin-generated peptides (24 and 28 kilodaltons [kDa]) that were adsorbed by and eluted from streptococci. The adsorption of the 24- and 28-kDa peptides to streptococci was inhibited by LTA. The two monoclonal antibodies that inhibited the binding of LTA to fibronectin reacted only with the 24- and 28-kDa fragments of fibronectin. Conversely, LTA, as well as lauric acid and oleic acid, blocked the binding of the same monoclonal antibodies to fibronectin. LTA had no effect on the binding of hybridoma antibodies directed against the collagen or cell-binding domain. PMID:3298457

  1. Evidence for two distinct binding sites for tau on microtubules

    PubMed Central

    Makrides, Victoria; Massie, Michelle R.; Feinstein, Stuart C.; Lew, John


    The microtubule-associated protein tau regulates diverse and essential microtubule functions, from the nucleation and promotion of microtubule polymerization to the regulation of microtubule polarity and dynamics, as well as the spacing and bundling of axonal microtubules. Thermodynamic studies show that tau interacts with microtubules in the low- to mid-nanomolar range, implying moderate binding affinity. At the same time, it is well established that microtubule-bound tau does not undergo exchange with the bulk medium readily, suggesting that the tau-microtubule interaction is essentially irreversible. Given this dilemma, we investigated the mechanism of interaction between tau and microtubules in kinetic detail. Stopped-flow kinetic analysis reveals moderate binding affinity between tau and preassembled microtubules and rapid dissociation/association kinetics. In contrast, when microtubules are generated by copolymerization of tubulin and tau, a distinct population of microtubule-bound tau is observed, the binding of which seems irreversible. We propose that reversible binding occurs between tau and the surface of preassembled microtubules, whereas irreversible binding results when tau is coassembled with tubulin into a tau-microtubule copolymer. Because the latter is expected to be physiologically relevant, its characterization is of central importance. PMID:15096589

  2. Binding sites for L-(/sup 3/H)glutamate in hippocampus

    SciTech Connect

    Werling, L.L.


    Three binding sites for L-(/sup 3/H)glutamate on freshly-prepared hippocampal synaptic membranes were identified on the basis of their differing affinities for L-glutamate or quisqualate. The high affinity site yielded K/sub D/ and B/sub max/ values of 12 nM and 2.5 pmol/mg protein, respectively. Binding sites of lower affinity had K/sub D/ values of 200 nM (GLU A) and 1 (GLU B) and B/sub max/ values of about 30 and 60 pmol/mg protein, respectively. GLU A sites bound quisqualate with about 70 times the affinity fo GLU B sites, and thus quisoqualate could be used as a tool to discriminate them. Hill slopes indicated that each site represented a single population of non-interacting binding sites. Freezing drastically decreased GLU A binding, but nearly tripled GLU B binding. Both sites bound L-glutamate with 10-30 times the affinity of D-glutamate. The GLU A site also bound L-glutamate with about 10 times the affinity of L-asparate and discriminated poorly between L- and D-asparate. In contrast, the GLU B site bound L-aspartate with similar affinity to L-gluamate, and with much higher affinity than it bound D-aspartate. Both lesions of perforant path and destruction of the granule cells with colchicine markedly reduced radioligand binding to the GLU A site in the fascia dentata, but only the perforant path lesion significantly reduced binding to the GLU B site. The structural specificity of the GLU A site is consistent with its identification as a type of quisqualate receptor.

  3. ConBind: motif-aware cross-species alignment for the identification of functional transcription factor binding sites.


    Lelieveld, Stefan H; Schütte, Judith; Dijkstra, Maurits J J; Bawono, Punto; Kinston, Sarah J; Göttgens, Berthold; Heringa, Jaap; Bonzanni, Nicola


    Eukaryotic gene expression is regulated by transcription factors (TFs) binding to promoter as well as distal enhancers. TFs recognize short, but specific binding sites (TFBSs) that are located within the promoter and enhancer regions. Functionally relevant TFBSs are often highly conserved during evolution leaving a strong phylogenetic signal. While multiple sequence alignment (MSA) is a potent tool to detect the phylogenetic signal, the current MSA implementations are optimized to align the maximum number of identical nucleotides. This approach might result in the omission of conserved motifs that contain interchangeable nucleotides such as the ETS motif (IUPAC code: GGAW). Here, we introduce ConBind, a novel method to enhance alignment of short motifs, even if their mutual sequence similarity is only partial. ConBind improves the identification of conserved TFBSs by improving the alignment accuracy of TFBS families within orthologous DNA sequences. Functional validation of the Gfi1b + 13 enhancer reveals that ConBind identifies additional functionally important ETS binding sites that were missed by all other tested alignment tools. In addition to the analysis of known regulatory regions, our web tool is useful for the analysis of TFBSs on so far unknown DNA regions identified through ChIP-sequencing. PMID:26721389

  4. ConBind: motif-aware cross-species alignment for the identification of functional transcription factor binding sites

    PubMed Central

    Lelieveld, Stefan H.; Schütte, Judith; Dijkstra, Maurits J.J.; Bawono, Punto; Kinston, Sarah J.; Göttgens, Berthold; Heringa, Jaap; Bonzanni, Nicola


    Eukaryotic gene expression is regulated by transcription factors (TFs) binding to promoter as well as distal enhancers. TFs recognize short, but specific binding sites (TFBSs) that are located within the promoter and enhancer regions. Functionally relevant TFBSs are often highly conserved during evolution leaving a strong phylogenetic signal. While multiple sequence alignment (MSA) is a potent tool to detect the phylogenetic signal, the current MSA implementations are optimized to align the maximum number of identical nucleotides. This approach might result in the omission of conserved motifs that contain interchangeable nucleotides such as the ETS motif (IUPAC code: GGAW). Here, we introduce ConBind, a novel method to enhance alignment of short motifs, even if their mutual sequence similarity is only partial. ConBind improves the identification of conserved TFBSs by improving the alignment accuracy of TFBS families within orthologous DNA sequences. Functional validation of the Gfi1b + 13 enhancer reveals that ConBind identifies additional functionally important ETS binding sites that were missed by all other tested alignment tools. In addition to the analysis of known regulatory regions, our web tool is useful for the analysis of TFBSs on so far unknown DNA regions identified through ChIP-sequencing. PMID:26721389

  5. DISPLAR: an accurate method for predicting DNA-binding sites on protein surfaces

    PubMed Central

    Tjong, Harianto; Zhou, Huan-Xiang


    Structural and physical properties of DNA provide important constraints on the binding sites formed on surfaces of DNA-targeting proteins. Characteristics of such binding sites may form the basis for predicting DNA-binding sites from the structures of proteins alone. Such an approach has been successfully developed for predicting protein–protein interface. Here this approach is adapted for predicting DNA-binding sites. We used a representative set of 264 protein–DNA complexes from the Protein Data Bank to analyze characteristics and to train and test a neural network predictor of DNA-binding sites. The input to the predictor consisted of PSI-blast sequence profiles and solvent accessibilities of each surface residue and 14 of its closest neighboring residues. Predicted DNA-contacting residues cover 60% of actual DNA-contacting residues and have an accuracy of 76%. This method significantly outperforms previous attempts of DNA-binding site predictions. Its application to the prion protein yielded a DNA-binding site that is consistent with recent NMR chemical shift perturbation data, suggesting that it can complement experimental techniques in characterizing protein–DNA interfaces. PMID:17284455

  6. Host-Guest Binding-Site-Tunable Self-Assembly of Stimuli-Responsive Supramolecular Polymers.


    Yao, Hao; Qi, Miao; Liu, Yuyang; Tian, Wei


    Despite the remarkable progress made in controllable self-assembly of stimuli-responsive supramolecular polymers (SSPs), a basic issue that has not been consideration to date is the essential binding site. The noncovalent binding sites, which connect the building blocks and endow supramolecular polymers with their ability to respond to stimuli, are expected to strongly affect the self-assembly of SSPs. Herein, the design and synthesis of a dual-stimuli thermo- and photoresponsive Y-shaped supramolecular polymer (SSP2) with two adjacent β-cyclodextrin/azobenzene (β-CD/Azo) binding sites, and another SSP (SSP1) with similar building blocks, but only one β-CD/Azo binding site as a control, are described. Upon gradually increasing the polymer solution temperature or irradiating with UV light, SSP2 self-assemblies with a higher binding-site distribution density; exhibits a flower-like morphology, smaller size, and more stable dynamic aggregation process; and greater controllability for drug-release behavior than those observed with SSP1 self-assemblies. The host-guest binding-site-tunable self-assembly was attributed to the positive cooperativity generated among adjacent binding sites on the surfaces of SSP2 self-assemblies. This work is beneficial for precisely controlling the structural parameters and controlled release function of SSP self-assemblies. PMID:27167577

  7. An Overview of the Prediction of Protein DNA-Binding Sites

    PubMed Central

    Si, Jingna; Zhao, Rui; Wu, Rongling


    Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications. PMID:25756377

  8. Analysis of a nucleotide-binding site of 5-lipoxygenase by affinity labelling: binding characteristics and amino acid sequences.

    PubMed Central

    Zhang, Y Y; Hammarberg, T; Radmark, O; Samuelsson, B; Ng, C F; Funk, C D; Loscalzo, J


    5-Lipoxygenase (5LO) catalyses the first two steps in the biosynthesis of leukotrienes, which are inflammatory mediators derived from arachidonic acid. 5LO activity is stimulated by ATP; however, a consensus ATP-binding site or nucleotide-binding site has not been found in its protein sequence. In the present study, affinity and photoaffinity labelling of 5LO with 5'-p-fluorosulphonylbenzoyladenosine (FSBA) and 2-azido-ATP showed that 5LO bound to the ATP analogues quantitatively and specifically and that the incorporation of either analogue inhibited ATP stimulation of 5LO activity. The stoichiometry of the labelling was 1.4 mol of FSBA/mol of 5LO (of which ATP competed with 1 mol/mol) or 0.94 mol of 2-azido-ATP/mol of 5LO (of which ATP competed with 0.77 mol/mol). Labelling with FSBA prevented further labelling with 2-azido-ATP, indicating that the same binding site was occupied by both analogues. Other nucleotides (ADP, AMP, GTP, CTP and UTP) also competed with 2-azido-ATP labelling, suggesting that the site was a general nucleotide-binding site rather than a strict ATP-binding site. Ca(2+), which also stimulates 5LO activity, had no effect on the labelling of the nucleotide-binding site. Digestion with trypsin and peptide sequencing showed that two fragments of 5LO were labelled by 2-azido-ATP. These fragments correspond to residues 73-83 (KYWLNDDWYLK, in single-letter amino acid code) and 193-209 (FMHMFQSSWNDFADFEK) in the 5LO sequence. Trp-75 and Trp-201 in these peptides were modified by the labelling, suggesting that they were immediately adjacent to the C-2 position of the adenine ring of ATP. Given the stoichiometry of the labelling, the two peptide sequences of 5LO were probably near each other in the enzyme's tertiary structure, composing or surrounding the ATP-binding site of 5LO. PMID:11042125

  9. Structural studies of neuropilin-2 reveal a zinc ion binding site remote from the vascular endothelial growth factor binding pocket.


    Tsai, Yi-Chun Isabella; Fotinou, Constantina; Rana, Rohini; Yelland, Tamas; Frankel, Paul; Zachary, Ian; Djordjevic, Snezana


    Neuropilin-2 is a transmembrane receptor involved in lymphangiogenesis and neuronal development. In adults, neuropilin-2 and its homologous protein neuropilin-1 have been implicated in cancers and infection. Molecular determinants of the ligand selectivity of neuropilins are poorly understood. We have identified and structurally characterized a zinc ion binding site on human neuropilin-2. The neuropilin-2-specific zinc ion binding site is located near the interface between domains b1 and b2 in the ectopic region of the protein, remote from the neuropilin binding site for its physiological ligand, i.e. vascular endothelial growth factor. We also present an X-ray crystal structure of the neuropilin-2 b1 domain in a complex with the C-terminal sub-domain of VEGF-A. Zn(2+) binding to neuropilin-2 destabilizes the protein structure but this effect was counteracted by heparin, suggesting that modifications by glycans and zinc in the extracellular matrix may affect functional neuropilin-2 ligand binding and signalling activity. PMID:26991001

  10. Activation of brown adipose tissue mitochondrial GDP binding sites

    SciTech Connect

    Swick, A.G.


    The primary function of brown adipose tissue (BAT) is heat production. This ability is attributed to the existence of a unique inner mitochondrial membrane protein termed the uncoupling protein or thermogenin. This protein is permeable to H+ and thus allows respiration (and therefore thermogenesis) to proceed at a rapid rate, independent of ADP phosphorylation. Proton conductance can be inhibited by the binding of purine nucleotides to the uncoupling protein. The binding of (/sup 3/H)-GDP to BAT mitochondria is frequently used as a measure of BAT thermogenic activity. Rats fed a diet that was low but adequate in protein exhibited a decrease in feed efficiency. In addition, BAT thermogenesis was activated as indicated by an elevation in the level of GDP binding to BAT mitochondria. This phenomena occurred in older rats and persisted over time.

  11. A unique inhibitor binding site in ERK1/2 is associated with slow binding kinetics

    PubMed Central

    Chaikuad, Apirat; Tacconi, Eliana; Zimmer, Jutta; Liang, Yanke; Gray, Nathanael S.; Tarsounas, Madalena; Knapp, Stefan


    Activation of the ERK pathway is a hallmark of cancer and targeting of upstream signalling partners led to the development of approved drugs. Recently SCH772984 has been shown to be a selective and potent ERK1/2 inhibitor. Here we report the structural mechanism for its remarkable selectivity. In ERK1/2, SCH772984 induced a so far unknown binding pocket that accommodated the piperazine-phenyl-pyrimidine decoration. This novel binding pocket was created by an inactive conformation of the phosphate binding loop and an outward tilt of helix αC. In contrast, structure determination of SCH772984 with the off-target haspin and JNK1 revealed canonical but two distinct type-I binding modes. Intriguingly, the novel binding mode with ERK1/2 was associated with slow binding kinetics in vitro as well as in cell based assay systems. The described binding mode of SCH772984 with ERK1/2 enables the design of a new type of specific kinase inhibitors with prolonged on-target activity. PMID:25195011

  12. Defining the Plasticity of Transcription Factor Binding Sites by Deconstructing DNA Consensus Sequences: The PhoP-Binding Sites among Gamma/Enterobacteria

    PubMed Central

    Harari, Oscar; Park, Sun-Yang; Huang, Henry; Groisman, Eduardo A.; Zwir, Igor


    Transcriptional regulators recognize specific DNA sequences. Because these sequences are embedded in the background of genomic DNA, it is hard to identify the key cis-regulatory elements that determine disparate patterns of gene expression. The detection of the intra- and inter-species differences among these sequences is crucial for understanding the molecular basis of both differential gene expression and evolution. Here, we address this problem by investigating the target promoters controlled by the DNA-binding PhoP protein, which governs virulence and Mg2+ homeostasis in several bacterial species. PhoP is particularly interesting; it is highly conserved in different gamma/enterobacteria, regulating not only ancestral genes but also governing the expression of dozens of horizontally acquired genes that differ from species to species. Our approach consists of decomposing the DNA binding site sequences for a given regulator into families of motifs (i.e., termed submotifs) using a machine learning method inspired by the “Divide & Conquer” strategy. By partitioning a motif into sub-patterns, computational advantages for classification were produced, resulting in the discovery of new members of a regulon, and alleviating the problem of distinguishing functional sites in chromatin immunoprecipitation and DNA microarray genome-wide analysis. Moreover, we found that certain partitions were useful in revealing biological properties of binding site sequences, including modular gains and losses of PhoP binding sites through evolutionary turnover events, as well as conservation in distant species. The high conservation of PhoP submotifs within gamma/enterobacteria, as well as the regulatory protein that recognizes them, suggests that the major cause of divergence between related species is not due to the binding sites, as was previously suggested for other regulators. Instead, the divergence may be attributed to the fast evolution of orthologous target genes and/or the

  13. Binding activities of non-β-glucan glycoclusters to dectin-1 and exploration of their binding site.


    Jiang, Shan; Niu, Shan; Yao, Wang; Li, Zhong-Jun; Li, Qing


    Dectin-1, which specifically recognizes β-(1,3)-glucans, plays an important role in innate immune responses. For the first time, in this study we found that a series of non-β-glucan glycoclusters can bind to dectin-1 by means of surface plasmon resonance (SPR) assay. Hexavalent lactoside Ju-6 showed the strongest affinity property (KD=1.6 µM). Interestingly, a continuous binding-dissociation experiment on SPR showed that Ju-6 and Laminarin binding to dectin-1 are independent of each other. Moreover, RT-PCR assay showed that Ju-6 cannot up-regulate cytokine gene expression or inhibit the promoting effect caused by Zymosan (a long-chain β-glucan). These results indicated that there might be a possible new carbohydrate binding site on dectin-1. PMID:27197693

  14. Aldose and aldehyde reductases : structure-function studies on the coenzyme and inhibitor-binding sites.

    SciTech Connect

    El-Kabbani, O.; Old, S. E.; Ginell, S. L.; Carper, D. A.; Biosciences Division; Monash Univ.; NIH


    PURPOSE: To identify the structural features responsible for the differences in coenzyme and inhibitor specificities of aldose and aldehyde reductases. METHODS: The crystal structure of porcine aldehyde reductase in complex with NADPH and the aldose reductase inhibitor sorbinil was determined. The contribution of each amino acid lining the coenzyme-binding site to the binding of NADPH was calculated using the Discover package. In human aldose reductase, the role of the non-conserved Pro 216 (Ser in aldehyde reductase) in the binding of coenzyme was examined by site-directed mutagenesis. RESULTS: Sorbinil binds to the active site of aldehyde reductase and is hydrogen-bonded to Trp 22, Tyr 50, His 113, and the non-conserved Arg 312. Unlike tolrestat, the binding of sorbinil does not induce a change in the side chain conformation of Arg 312. Mutation of Pro 216 to Ser in aldose reductase makes the binding of coenzyme more similar to that of aldehyde reductase. CONCLUSIONS: The participation of non-conserved active site residues in the binding of inhibitors and the differences in the structural changes required for the binding to occur are responsible for the differences in the potency of inhibition of aldose and aldehyde reductases. We report that the non-conserved Pro 216 in aldose reductase contributes to the tight binding of NADPH.

  15. Heparin binding to platelet factor-4. An NMR and site-directed mutagenesis study: arginine residues are crucial for binding.

    PubMed Central

    Mayo, K H; Ilyina, E; Roongta, V; Dundas, M; Joseph, J; Lai, C K; Maione, T; Daly, T J


    Native platelet factor-4 (PF4) is an asymmetrically associated, homo-tetrameric protein (70 residues/subunit) known for binding polysulphated glycosaminoglycans like heparin. PF4 N-terminal chimeric mutant M2 (PF4-M2), on the other hand, forms symmetric tetramers [Mayo, Roongta, Ilyina, Milius, Barker, Quinlan, La Rosa and Daly (1995) Biochemistry 34, 11399-11409] making NMR studies with this 32 kDa protein tractable. PF4-M2, moreover, binds heparin with a similar affinity to that of native PF4. NMR data presented here indicate that heparin (9000 Da cut-off) binding to PF4-M2, while not perturbing the overall structure of the protein, does perturb specific side-chain proton resonances which map to spatially related residues within a ring of positively charged side chains on the surface of tetrameric PF4-M2. Contrary to PF4-heparin binding models which centre around C-terminal alpha-helix lysines, this study indicates that a loop containing Arg-20, Arg-22, His-23 and Thr-25, as well as Lys-46 and Arg-49, are even more affected by heparin binding. Site-directed mutagenesis and heparin binding data support these NMR findings by indicating that arginines more than C-terminal lysines, are crucial to the heparin binding process. Images Figure 4 PMID:8526843

  16. Nucleotide Binding Site Communication in Arabidopsis thaliana Adenosine 5;-Phosphosulfate Kinase

    SciTech Connect

    Ravilious, Geoffrey E.; Jez, Joseph M.


    Adenosine 5{prime}-phosphosulfate kinase (APSK) catalyzes the ATP-dependent synthesis of adenosine 3{prime}-phosphate 5{prime}-phosphosulfate (PAPS), which is an essential metabolite for sulfur assimilation in prokaryotes and eukaryotes. Using APSK from Arabidopsis thaliana, we examine the energetics of nucleotide binary and ternary complex formation and probe active site features that coordinate the order of ligand addition. Calorimetric analysis shows that binding can occur first at either nucleotide site, but that initial interaction at the ATP/ADP site was favored and enhanced affinity for APS in the second site by 50-fold. The thermodynamics of the two possible binding models (i.e. ATP first versus APS first) differs and implies that active site structural changes guide the order of nucleotide addition. The ligand binding analysis also supports an earlier suggestion of intermolecular interactions in the dimeric APSK structure. Crystallographic, site-directed mutagenesis, and energetic analyses of oxyanion recognition by the P-loop in the ATP/ADP binding site and the role of Asp136, which bridges the ATP/ADP and APS/PAPS binding sites, suggest how the ordered nucleotide binding sequence and structural changes are dynamically coordinated for catalysis.

  17. Computational investigation of stoichiometric effects, binding site heterogeneities, and selectivities of molecularly imprinted polymers.


    Terracina, Jacob J; Bergkvist, Magnus; Sharfstein, Susan T


    A series of quantum mechanical (QM) computational optimizations of molecularly imprinted polymer (MIP) systems were used to determine optimal monomer-to-target ratios. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (3-7 molecules) and larger-scale models (15-35 molecules). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to quantify the heterogeneity of these sites. The more fully surrounded sites had greater binding energies. No discretization of binding modes was seen, furthering arguments for continuous affinity distribution models. Molecular mechanical (MM) docking was then used to measure the selectivities of the QM-optimized binding sites. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. Here we present a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Modeling schemes were designed such that no computing clusters or other specialized modeling equipment would be required. Improving the in silico analysis of MIP system properties will ultimately allow for the production of more sensitive and selective polymers. PMID:27207254

  18. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans.


    Weyer, Sven; Pääbo, Svante


    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  19. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans

    PubMed Central

    Weyer, Sven; Pääbo, Svante


    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  20. Distribution of cholecystokinin receptor binding sites in the human brain: an autoradiographic study

    SciTech Connect

    Dietl, M.M.; Probst, A.; Palacios, J.M.


    Cholecystokinin (CCK) binding sites were localized by in vitro autoradiography in human postmortem brain materials from 12 patients without reported neurological diseases using (125I)Bolton-Hunter CCK octapeptide (BHCCK-8) as a ligand. The pharmacological characteristics of BHCCK-8 binding to mounted tissue sections were comparable to those previously reported in the rat. CCK-8 being the most potent displacer, followed by caerulein, CCK-4, and gastrin I. The distribution of BHCCK-8 binding sites was heterogeneous. These sites were highly concentrated in a limited number of gray matter areas and nuclei. The highest binding densities were seen in the glomerular and external plexiform layers of the olfactory bulb. BHCCK-8 binding sites were also enriched in the neocortex, where they presented a laminar distribution with low levels in lamina I, moderate concentration in laminae II to IV, high density in lamina V, and low levels in lamina VI. A different laminar distribution was seen in the visual cortex, where a low receptor density was observed in lamina IV but higher density in laminae II and VI. In the basal ganglia the nucleus accumbens, caudatus, and the putamen presented moderate to high densities of binding sites, while the globus pallidus lacked sites of BHCCK-8 binding. In the limbic system the only area presenting moderate to high density was the amygdaloid complex, particularly in the granular nucleus, while most of the thalamic nuclei were extremely poor or lacked BHCCK-8 binding. The hippocampal formation showed low (CA1-3) to moderate (subiculum) densities. Midbrain areas generally disclosed very low levels of BHCCK-8 binding sites. The pontine gray and the nucleus reticularis tegmenti pontis showed a relatively high density of CCK-8 receptor specific binding.

  1. Quantitative autoradiographic distribution of L-(3H)glutamate-binding sites in rat central nervous system

    SciTech Connect

    Greenamyre, J.T.; Young, A.B.; Penney, J.B.


    Quantitative autoradiography was used to determine the distribution of L-(3H)glutamate-binding sites in the rat central nervous system. Autoradiography was carried out in the presence of Cl- and Ca2+ ions. Scatchard plots and Hill coefficients of glutamate binding suggested that glutamate was interacting with a single population of sites having a K-D of about 300 nM and a capacity of 14.5 pmol/mg of protein. In displacement studies, ibotenate also appeared to bind to a single class of non-interacting sites with a KI of 28 microM. However, quisqualate displacement of (3H)glutamate binding revealed two well-resolved sites with KIS of 12 nM and 114 microM in striatum. These sites were unevenly distributed, representing different proportions of specific glutamate binding in different brain regions. The distribution of glutamate-binding sites correlated very well with the projection areas of putative glutamatergic pathways. This technique provides an extremely sensitive assay which can be used to gather detailed pharmacological and anatomical information about L-(3H)glutamate binding in the central nervous system.

  2. Sulfhydryl Binding Sites within Bacterial Extracellular Polymeric Substances.


    Yu, Qiang; Fein, Jeremy B


    In this study, the concentration of sulfhydryl sites on bacterial biomass samples with and without extracellular polymeric substances (EPS) was measured in order to determine the distribution of sulfhydryl sites on bacteria. Three different approaches were employed for EPS removal from Pseudomonas putida, and the measured sulfhydryl concentrations on bacterial EPS molecules are independent of the EPS removal protocols used. Prior to EPS removal, the measured sulfhydryl sites within P. putida samples was 34.9 ± 9.5 μmol/g, and no sulfhydryl sites were detected after EPS removal, indicating that virtually all of the sulfhydryl sites are located on the EPS molecules produced by P. putida. In contrast, the sulfhydryl sites within the S. oneidensis samples increased from 32.6 ± 3.6 μmol/g to 51.9 ± 7.2 μmol/g after EPS removal, indicating that the EPS produced by S. oneidensis contained fewer sulfhydryl sites than those present on the untreated cells. This study suggests that the sulfhydryl concentrations on EPS molecules may vary significantly from one bacterial species to another, thus it is crucial to quantify the concentration of sulfhydryl sites on EPS molecules of other bacterial species in order to determine the effect of bacterial EPS on metal cycling in the environment. PMID:27177017

  3. The binding sites for cocaine and dopamine in the dopamine transporter overlap

    PubMed Central

    Beuming, Thijs; Kniazeff, Julie; Bergmann, Marianne L; Shi, Lei; Gracia, Luis; Raniszewska, Klaudia; Newman, Amy Hauck; Javitch, Jonathan A; Weinstein, Harel; Gether, Ulrik; Loland, Claus J


    Cocaine is a widely abused substance with psychostimulant effects that are attributed to inhibition of the dopamine transporter (DAT). We present molecular models for DAT binding of cocaine and cocaine analogs constructed from the high-resolution structure of the bacterial transporter homolog LeuT. Our models suggest that the binding site for cocaine and cocaine analogs is deeply buried between transmembrane segments 1, 3, 6 and 8, and overlaps with the binding sites for the substrates dopamine and amphetamine, as well as for benztropine-like DAT inhibitors. We validated our models by detailed mutagenesis and by trapping the radiolabeled cocaine analog [3H]CFT in the transporter, either by cross-linking engineered cysteines or with an engineered Zn2+-binding site that was situated extracellularly to the predicted common binding pocket. Our data demonstrate the molecular basis for the competitive inhibition of dopamine transport by cocaine. PMID:18568020

  4. Binding sites for atrial natriuretic factor (ANF) in brain: alterations in Brattleboro rats

    SciTech Connect

    McCarty, R.; Plunkett, L.M.


    Binding sites for atrial natriuretic factor (ANF-28) were analyzed in discrete brain areas of Brattleboro rats with hereditary diabetes insipidus and Long-Evans (LE) controls by quantitative autoradiography. The maximum binding capacity (Bmax) and affinity constant (Ka) for /sup 125/I-ANF-28 were elevated significantly in the subfornical organ of Brattleboro rats compared to matched LE controls. In contrast, values for Bmax and Ka for /sup 125/I-ANF-28 binding in choroid plexus and area postrema were similar for rats of the two strains. These findings are consistent with a selective upregulation of ANF-28 binding sites in the subfornical organ of Brattleboro rats which exhibit a profound disturbance in body fluid homeostasis. These alterations in ANF-28 binding sites in the subfornical organ may represent a compensatory response to the absence of vasopressin in the Brattleboro rat.

  5. An Accessory Agonist Binding Site Promotes Activation of α4β2* Nicotinic Acetylcholine Receptors*

    PubMed Central

    Wang, Jingyi; Kuryatov, Alexander; Sriram, Aarati; Jin, Zhuang; Kamenecka, Theodore M.; Kenny, Paul J.; Lindstrom, Jon


    Neuronal nicotinic acetylcholine receptors containing α4, β2, and sometimes other subunits (α4β2* nAChRs) regulate addictive and other behavioral effects of nicotine. These nAChRs exist in several stoichiometries, typically with two high affinity acetylcholine (ACh) binding sites at the interface of α4 and β2 subunits and a fifth accessory subunit. A third low affinity ACh binding site is formed when this accessory subunit is α4 but not if it is β2. Agonists selective for the accessory ACh site, such as 3-[3-(3-pyridyl)-1,2,4-oxadiazol-5-yl]benzonitrile (NS9283), cannot alone activate a nAChR but can facilitate more efficient activation in combination with agonists at the canonical α4β2 sites. We therefore suggest categorizing agonists according to their site selectivity. NS9283 binds to the accessory ACh binding site; thus it is termed an accessory site-selective agonist. We expressed (α4β2)2 concatamers in Xenopus oocytes with free accessory subunits to obtain defined nAChR stoichiometries and α4/accessory subunit interfaces. We show that α2, α3, α4, and α6 accessory subunits can form binding sites for ACh and NS9283 at interfaces with α4 subunits, but β2 and β4 accessory subunits cannot. To permit selective blockage of the accessory site, α4 threonine 126 located on the minus side of α4 that contributes to the accessory site, but not the α4β2 sites, was mutated to cysteine. Alkylation of this cysteine with a thioreactive reagent blocked activity of ACh and NS9283 at the accessory site. Accessory agonist binding sites are promising drug targets. PMID:25869137

  6. Internal binding sites for MSH: Analyses in wild-type and variant Cloudman melanoma cells

    SciTech Connect

    Orlow, S.J.; Hotchkiss, S.; Pawelek, J.M. )


    Cloudman S91 mouse melanoma cells express both external (plasma membrane) and internal binding sites for MSH. Using 125I-beta melanotropin (beta-MSH) as a probe, we report here an extensive series of studies on the biological relevance of these internal sites. Cells were swollen in a hypotonic buffer and lysed, and a particulate fraction was prepared by high-speed centrifugation. This fraction was incubated with 125I-beta-MSH with or without excess nonradioactive beta-MSH in the cold for 2 hours. The material was then layered onto a step-wise sucrose gradient and centrifuged; fractions were collected and counted in a gamma counter or assayed for various enzymatic activities. The following points were established: (1) Specific binding sites for MSH were observed sedimenting at an average density of 50% sucrose in amelanotic cells and at higher densities in melanotic cells. (2) These sites were similar in density to those observed when intact cells were labeled externally with 125I-beta-MSH and then warmed to promote internalization of the hormone. (3) Most of the internal binding sites were not as dense as fully melanized melanosomes. (4) In control experiments, the MSH binding sites were not found in cultured hepatoma cells. (5) Variant melanoma cells, which differed from the wild-type in their responses to MSH, had reduced expression of internal binding sites even though their ability to bind MSH to the outer cell surface appeared normal. (MSH-induced responses included changes in tyrosinase, dopa oxidase, and dopachrome conversion factor activities, melanization, proliferation, and morphology.) (6) Isobutylmethylxanthine, which enhanced cellular responsiveness to MSH, also enhanced expression of internal binding sites. The results indicate that expression of internal binding sites for MSH is an important criterion for cellular responsiveness to the hormone.

  7. Nanoparticle amplification via photothermal unveiling of cryptic collagen binding sites

    PubMed Central

    Lo, Justin H.; von Maltzahn, Geoffrey; Douglass, Jacqueline; Park, Ji-Ho; Sailor, Michael J.; Ruoslahti, Erkki


    The success of nanoparticle-based cancer therapies ultimately depends on their ability to selectively and efficiently accumulate in regions of disease. Outfitting nanoparticles to actively target tumor-specific markers has improved specificity, yet it remains a challenge to amass adequate therapy in a selective manner. To help address this challenge, we have developed a mechanism of nanoparticle amplification based on stigmergic (environment-modifying) signalling, in which a “Signalling” population of gold nanorods induces localized unveiling of cryptic collagen epitopes, which are in turn targeted by “Responding” nanoparticles bearing gelatin-binding fibronectin fragments. We demonstrate that this two-particle system results in significantly increased, selective recruitment of responding particles. Such amplification strategies have the potential to overcome limitations associated with single-particle targeting by leveraging the capacity of nanoparticles to interact with their environment to create abundant new binding motifs. PMID:24177171

  8. Photoaffinity studies of the tubulin-colchicine binding site

    SciTech Connect

    Hahn, K.M.


    A variety of colchicine derivatives were synthesized and coupled with 3,3,3-trifluoro-2-diazapropionyl chloride (TFDP-Cl) to produce colchicine photoaffinity analogs for use in tubulin labelling studies. Photoaffinity analogs of allocolchicine and podophylotoxin were also made using the same photoreactive moiety. Several labels were found to be effective inhibitors of tubulin polymerization. The approximate tubulin binding constants of the labels, calculated from polymerization inhibition data, varied between 2.2 x 10/sup 5/ to 2.5 x 10/sup 3/ M/sup -1/. The labels chosen for use in tubulin labelling experiments were (N-TFDP) deacetyl-thiocolchicine 1, (O-TFDP)thiocolchifoline 2, and (O-TFDP)-2-demethylthiocolchicine 3. Compound 1 was found to bind tubulin reversibly and to competitively inhibit colchicine binding. Methods for the incorporation of tritium and /sup 14/C in these labels were developed. Conditions were found which caused labels to insert into solvent without photorearrangement of the colchicine skeleton. Catalytic base caused the ..cap alpha..-diazo amide of 1 to rearrange to a triazole.

  9. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.


    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  10. In vivo interaction of the Escherichia coli integration host factor with its specific binding sites.


    Engelhorn, M; Boccard, F; Murtin, C; Prentki, P; Geiselmann, J


    The histone-like protein integration host factor (IHF) of Escherichia coli binds to specific binding sites on the chromosome or on mobile genetic elements, and is involved in many cellular processes. We have analyzed the interaction of IHF with five different binding sites in vitro and in vivo using UV laser footprinting, a technique that probes the immediate environment and conformation of a segment of DNA. Using this generally applicable technique we can directly compare the binding modes and interaction strengths of a DNA binding protein in its physiological environment within the cell to measurements performed in vitro. We conclude that the interactions between IHF and its specific binding sites are identical in vitro and in vivo. The footprinting signal is consistent with the model of IHF-binding to DNA proposed by Yang and Nash (1989). The occupancy of binding sites varies with the concentration of IHF in the cell and allows to estimate the concentration of free IHF protein in the cell. PMID:7659518

  11. In vivo interaction of the Escherichia coli integration host factor with its specific binding sites.


    Engelhorn, M; Boccard, F; Murtin, C; Prentki, P; Geiselmann, J


    The histone-like protein integration host factor (IHF) of Escherichia coli binds to specific binding sites on the chromosome or on mobile genetic elements, and is involved in many cellular processes. We have analyzed the interaction of IHF with five different binding sites in vitro and in vivo using UV laser footprinting, a technique that probes the immediate environment and conformation of a segment of DNA. Using this generally applicable technique we can directly compare the binding modes and interaction strengths of a DNA binding protein in its physiological environment within the cell to measurements performed in vitro. We conclude that the interactions between IHF and its specific binding sites are identical in vitro and in vivo. The footprinting signal is consistent with the model of IHF-binding to DNA proposed by Yang and Nash (1989). The occupancy of binding sites varies with the concentration of IHF in the cell and allows to estimate the concentration of free IHF protein in the cell. PMID:7567442

  12. Identification of binding sites for the group A streptococcal global regulator CovR.


    Federle, Michael J; Scott, June R


    The CovRS two-component system (also called CsrRS) of the group A streptococcus (GAS) acts as a global regulator, influencing the transcription of at least six virulence factors. The synthesis of the hyaluronic acid capsule, a virulence factor encoded by the hasABC operon, is negatively regulated by CovRS. We confirmed that phosphorylation of CovR increases its binding to a DNA fragment containing the hasA promoter. Using DNase I footprinting, we identified five binding sites surrounding the hasA promoter from bases -79 to +73 (where +1 is the start of transcription). One pair of thymines within each binding site appears to be necessary for CovR binding in vitro, as shown by uracil interference analysis. When each of these thymine pairs was altered by site-directed mutagenesis, CovR binding was reduced in vitro, confirming the role of each thymine pair in binding. Using a transcriptional reporter system with a single chromosomal copy of PhasA-gusA, we demonstrated the importance of each of four of these binding sites for CovR repression of the hasA promoter. Based on this information, we propose a consensus sequence for CovR binding to DNA. PMID:11918804

  13. Threading polyintercalators with extremely slow dissociation rates and extended DNA binding sites

    PubMed Central

    Smith, Amy Rhoden; Iverson, Brent L.


    The development of small molecules that bind DNA sequence specifically has the potential to modulate gene expression in a general way. One mode of DNA binding is intercalation, or the insertion of molecules between DNA base pairs. We have developed a modular polyintercalation system in which intercalating naphthalene diimide (NDI) units are connected by flexible linkers that alternate between the minor and major grooves of DNA when bound. We recently reported a threading tetraintercalator with a dissociation half-life of 16 days, the longest reported to date, from its preferred 14 bp binding site. Herein, three new tetraintercalator derivatives were synthesized with one, two, and three additional methylene units in the central major groove-binding linker. These molecules displayed dissociation half-lives of 57, 27, and 18 days, respectively, from the 14 bp site. The optimal major groove-binding linker was used in the design of an NDI hexaintercalator that was analyzed by gel-shift assays, DNase I footprinting, and UV-visible spectroscopy. The hexaintercalator bound its entire 22 bp binding site, the longest reported specific binding site for a synthetic, non-nucleic acid based DNA binding molecule, but with a significantly faster dissociation rate compared to the tetraintercalators. PMID:23919778

  14. Threading polyintercalators with extremely slow dissociation rates and extended DNA binding sites.


    Rhoden Smith, Amy; Iverson, Brent L


    The development of small molecules that bind DNA sequence specifically has the potential to modulate gene expression in a general way. One mode of DNA binding is intercalation, or the insertion of molecules between DNA base pairs. We have developed a modular polyintercalation system in which intercalating naphthalene diimide (NDI) units are connected by flexible linkers that alternate between the minor and major grooves of DNA when bound. We recently reported a threading tetraintercalator with a dissociation half-life of 16 days, the longest reported to date, from its preferred 14 bp binding site. Herein, three new tetraintercalator derivatives were synthesized with one, two, and three additional methylene units in the central major groove-binding linker. These molecules displayed dissociation half-lives of 57, 27, and 18 days, respectively, from the 14 bp site. The optimal major groove-binding linker was used in the design of an NDI hexaintercalator that was analyzed by gel-shift assays, DNase I footprinting, and UV-vis spectroscopy. The hexaintercalator bound its entire 22 bp binding site, the longest reported specific binding site for a synthetic, non-nucleic acid-based DNA binding molecule, but with a significantly faster dissociation rate compared to the tetraintercalators. PMID:23919778

  15. The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.


    Wang, Jinling; de Montellano, Paul R Ortiz


    Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases. PMID:12626517

  16. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.


    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P


    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method. PMID:18556261

  17. An Overview of Tubulin Inhibitors That Interact with the Colchicine Binding Site

    PubMed Central

    Lu, Yan; Chen, Jianjun; Xiao, Min; Li, Wei


    Tubulin dynamics is a promising target for new chemotherapeutic agents. The colchicine binding site is one of the most important pockets for potential tubulin polymerization destabilizers. Colchicine binding site inhibitors (CBSI) exert their biological effects by inhibiting tubulin assembly and suppressing microtubule formation. A large number of molecules interacting with the colchicine binding site have been designed and synthesized with significant structural diversity. CBSIs have been modified as to chemical structure as well as pharmacokinetic properties, and tested in order to find a highly potent, low toxicity agent for treatment of cancers. CBSIs are believed to act by a common mechanism via binding to the colchicine site on tubulin. The present review is a synopsis of compounds that have been reported in the past decade that have provided an increase in our understanding of the actions of CBSIs. PMID:22814904

  18. Structural and functional analysis of a novel haloalkane dehalogenase with two halide-binding sites.


    Chaloupkova, Radka; Prudnikova, Tatyana; Rezacova, Pavlina; Prokop, Zbynek; Koudelakova, Tana; Daniel, Lukas; Brezovsky, Jan; Ikeda-Ohtsubo, Wakako; Sato, Yukari; Kuty, Michal; Nagata, Yuji; Kuta Smatanova, Ivana; Damborsky, Jiri


    The crystal structure of the novel haloalkane dehalogenase DbeA from Bradyrhizobium elkanii USDA94 revealed the presence of two chloride ions buried in the protein interior. The first halide-binding site is involved in substrate binding and is present in all structurally characterized haloalkane dehalogenases. The second halide-binding site is unique to DbeA. To elucidate the role of the second halide-binding site in enzyme functionality, a two-point mutant lacking this site was constructed and characterized. These substitutions resulted in a shift in the substrate-specificity class and were accompanied by a decrease in enzyme activity, stability and the elimination of substrate inhibition. The changes in enzyme catalytic activity were attributed to deceleration of the rate-limiting hydrolytic step mediated by the lower basicity of the catalytic histidine. PMID:25004965

  19. Arabidopsis AtADF1 is functionally affected by mutations on actin binding sites.


    Dong, Chun-Hai; Tang, Wei-Ping; Liu, Jia-Yao


    The plant actin depolymerizing factor (ADF) binds to both monomeric and filamentous actin, and is directly involved in the depolymerization of actin filaments. To better understand the actin binding sites of the Arabidopsis thaliana L. AtADF1, we generated mutants of AtADF1 and investigated their functions in vitro and in vivo. Analysis of mutants harboring amino acid substitutions revealed that charged residues (Arg98 and Lys100) located at the α-helix 3 and forming an actin binding site together with the N-terminus are essential for both G- and F-actin binding. The basic residues on the β-strand 5 (K82/A) and the α-helix 4 (R135/A, R137/A) form another actin binding site that is important for F-actin binding. Using transient expression of CFP-tagged AtADF1 mutant proteins in onion (Allium cepa) peel epidermal cells and transgenic Arabidopsis thaliana L. plants overexpressing these mutants, we analyzed how these mutant proteins regulate actin organization and affect seedling growth. Our results show that the ADF mutants with a lower affinity for actin filament binding can still be functional, unless the affinity for actin monomers is also affected. The G-actin binding activity of the ADF plays an essential role in actin binding, depolymerization of actin polymers, and therefore in the control of actin organization. PMID:23190411

  20. Brain natriuretic peptide binding sites in rats: In vitro autoradiographic study

    SciTech Connect

    Konrad, E.M.; Thibault, G.; Pelletier, S.; Genest, J.; Cantin, M. )


    Brain natriuretic peptide (BNP) is a recently discovered family of natriuretic peptides highly homologous to atrial natriuretic factor (ANF). Quantitative in vitro autoradiography with a computerized microdensitometer demonstrated that the distribution of BNP binding sites is similar to the known distribution pattern of ANF binding sites in rat tissues. Analysis of saturation and competition curves disclosed that the maximal binding capacity for BNP-(Asp-81--Tyr-106) and ANF-(Ser-99--Tyr-126) is similar within the plexiform layer of the olfactory bulb, the choroid plexus, and the adrenal zona glomerulosa. Examination of the competition curves of BNP-(Asp-81--Tyr-106), ANF-(Ser-99--Tyr-126), and des-(Gln-116--Gly-120)ANF-(Asp-102--Cys-121)NH2 (C-ANF, a ligand highly specific for ANF-R2 receptors) for {sup 125}I-labeled BNP-(Asp-81--Tyr-106) and {sup 125}I-labeled ANF-(Ser-99--Tyr-126) binding revealed that ANF fully displaced {sup 125}I-BNP binding and, conversely, BNP completely displaced {sup 125}I-ANF binding in these tissues, whereas C-ANF partially displaced 125-BNP and 125-ANF binding. Angiotensin II, insulin, glucagon, and substance P had no influence on {sup 125}I-BNP binding in the above tissues. These results support the view that BNP and ANF share the same binding sites in rats.

  1. Dual Effects of Adp and Adenylylimidodiphosphate on Cftr Channel Kinetics Show Binding to Two Different Nucleotide Binding Sites

    PubMed Central

    Weinreich, Frank; Riordan, John R.; Nagel, Georg


    The CFTR chloride channel is regulated by phosphorylation by protein kinases, especially PKA, and by nucleotides interacting with the two nucleotide binding domains, NBD-A and NBD-B. Giant excised inside-out membrane patches from Xenopus oocytes expressing human epithelial cystic fibrosis transmembrane conductance regulator (CFTR) were tested for their chloride conductance in response to the application of PKA and nucleotides. Rapid changes in the concentration of ATP, its nonhydrolyzable analogue adenylylimidodiphosphate (AMP-PNP), its photolabile derivative ATP-P3-[1-(2-nitrophenyl)ethyl]ester, or ADP led to changes in chloride conductance with characteristic time constants, which reflected interaction of CFTR with these nucleotides. The conductance changes of strongly phosphorylated channels were slower than those of partially phosphorylated CFTR. AMP-PNP decelerated relaxations of conductance increase and decay, whereas ATP-P3-[1-(2-nitrophenyl)ethyl]ester only decelerated the conductance increase upon ATP addition. ADP decelerated the conductance increase upon ATP addition and accelerated the conductance decay upon ATP withdrawal. The results present the first direct evidence that AMP-PNP binds to two sites on the CFTR. The effects of ADP also suggest two different binding sites because of the two different modes of inhibition observed: it competes with ATP for binding (to NBD-A) on the closed channel, but it also binds to channels opened by ATP, which might either reflect binding to NBD-A (i.e., product inhibition in the hydrolysis cycle) or allosteric binding to NBD-B, which accelerates the hydrolysis cycle at NBD-A. PMID:10398692

  2. Dual effects of ADP and adenylylimidodiphosphate on CFTR channel kinetics show binding to two different nucleotide binding sites.


    Weinreich, F; Riordan, J R; Nagel, G


    The CFTR chloride channel is regulated by phosphorylation by protein kinases, especially PKA, and by nucleotides interacting with the two nucleotide binding domains, NBD-A and NBD-B. Giant excised inside-out membrane patches from Xenopus oocytes expressing human epithelial cystic fibrosis transmembrane conductance regulator (CFTR) were tested for their chloride conductance in response to the application of PKA and nucleotides. Rapid changes in the concentration of ATP, its nonhydrolyzable analogue adenylylimidodiphosphate (AMP-PNP), its photolabile derivative ATP-P3-[1-(2-nitrophenyl)ethyl]ester, or ADP led to changes in chloride conductance with characteristic time constants, which reflected interaction of CFTR with these nucleotides. The conductance changes of strongly phosphorylated channels were slower than those of partially phosphorylated CFTR. AMP-PNP decelerated relaxations of conductance increase and decay, whereas ATP-P3-[1-(2-nitrophenyl)ethyl]ester only decelerated the conductance increase upon ATP addition. ADP decelerated the conductance increase upon ATP addition and accelerated the conductance decay upon ATP withdrawal. The results present the first direct evidence that AMP-PNP binds to two sites on the CFTR. The effects of ADP also suggest two different binding sites because of the two different modes of inhibition observed: it competes with ATP for binding (to NBD-A) on the closed channel, but it also binds to channels opened by ATP, which might either reflect binding to NBD-A (i.e., product inhibition in the hydrolysis cycle) or allosteric binding to NBD-B, which accelerates the hydrolysis cycle at NBD-A. PMID:10398692

  3. Quantitative autoradiography of /sup 3/H-nomifensine binding sites in rat brain

    SciTech Connect

    Scatton, B.; Dubois, A.; Dubocovich, M.L.; Zahniser, N.R.; Fage, D.


    The distribution of /sup 3/H-nomifensine binding sites in the rat brain has been studied by quantitative autoradiography. The binding of /sup 3/H-nomifensine to caudate putamen sections was saturable, specific, of a highly affinity (Kd = 56 nM) and sodium-dependent. The dopamine uptake inhibitors benztropine, nomifensine, cocaine, bupropion and amfonelic acid were the most potent competitors of /sup 3/H-nomifensine binding to striatal sections. The highest levels of (benztropine-displaceable) /sup 3/H-nomifensine binding sites were found in the caudate-putamen, the olfactory tubercle and the nucleus accumbens. 6-Hydroxy-dopamine-induced lesion of the ascending dopaminergic bundle resulted in a marked decrease in the /sup 3/H-ligand binding in these areas. Moderately high concentrations of the /sup 3/H-ligand were observed in the bed nucleus of the stria terminalis, the anteroventral thalamic nucleus, the cingulate cortex, the lateral septum, the hippocampus, the amygdala, the zona incerta and some hypothalamic nuclei. There were low levels of binding sites in the habenula, the dorsolateral geniculate body, the substantia nigra, the ventral tegmental area and the periaqueductal gray matter. These autoradiographic data are consistent with the hypothesis that /sup 3/H-nomifensine binds primarily to the presynaptic uptake site for dopamine but also labels the norepinephrine uptake site. 33 references, 2 figures, 1 table.

  4. Characterization of the Escherichia coli F factor traY gene product and its binding sites.

    PubMed Central

    Nelson, W C; Morton, B S; Lahue, E E; Matson, S W


    The traY gene product (TraYp) from the Escherichia coli F factor has previously been purified and shown to bind a DNA fragment containing the F plasmid oriT region (E. E. Lahue and S. W. Matson, J. Bacteriol. 172:1385-1391, 1990). To determine the precise nucleotide sequence bound by TraYp, DNase I footprinting was performed. The TraYp-binding site is near, but not coincident with, the site that is nicked to initiate conjugative DNA transfer. In addition, a second TraYp binding site, which is coincident with the mRNA start site at the traYI promoter, is described. The Kd for each binding site was determined by a gel mobility shift assay. TraYp exhibits a fivefold higher affinity for the oriT binding site compared with the traYI promoter binding site. Hydrodynamic studies were performed to show that TraYp is a monomer in solution under the conditions used in DNA binding assays. Early genetic experiments implicated the traY gene product in the site- and strand-specific endonuclease activity that nicks at oriT (R. Everett and N. Willetts, J. Mol. Biol. 136:129-150, 1980; S. McIntire and N. Willetts, Mol. Gen. Genet. 178:165-172, 1980). As this activity has recently been ascribed to helicase I, it was of interest to see whether TraYp had any effect on this reaction. Addition of TraYp to nicking reactions catalyzed by helicase I showed no effect on the rate or efficiency of oriT nicking. Roles for TraYp in conjugative DNA transfer and a possible mode of binding to DNA are discussed. Images PMID:8468282

  5. High affinity ( sup 3 H)glibenclamide binding sites in rat neuronal and cardiac tissue: Localization and developmental characteristics

    SciTech Connect

    Miller, J.A.; Velayo, N.L.; Dage, R.C.; Rampe, D. )


    We examined the binding of the antidiabetic sulfonylurea (3H) glibenclamide to rat brain and heart membranes. High affinity binding was observed in adult rat forebrain (Kd = 137.3 pM, maximal binding site density = 91.8 fmol/mg of protein) and ventricle (Kd = 77.1 pM, maximal binding site density = 65.1 fmol/mg of protein). Binding site density increased approximately 250% in forebrain membranes during postnatal development but was constant in ventricular membranes. Quantitative autoradiography was used to examine the regional distribution of (3H) glibenclamide binding sites in sections from rat brain, spinal cord and heart. The greatest density of binding in adult brain was found in the substantia nigra and globus pallidus, whereas the other areas displayed heterogenous binding. In agreement with the membrane binding studies, 1-day-old rat brain had significantly fewer (3H)glibenclamide binding sites than adult brain. Additionally, the pattern of distribution of these sites was qualitatively different from that of the adult. In adult rat spinal cord, moderate binding densities were observed in spinal cord gray and displayed a rostral to caudal gradient. In adult rat heart, moderate binding densities were observed and the sites were distributed homogeneously. In conclusion, significant development of (3H)glibenclamide binding sites was seen in the brain but not the heart during postnatal maturation. Furthermore, a heterogeneous distribution of binding sites was observed in both the brain and spinal cord of adult rats.

  6. MBSTAR: multiple instance learning for predicting specific functional binding sites in microRNA targets

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, Sanghamitra; Ghosh, Dip; Mitra, Ramkrishna; Zhao, Zhongming


    MicroRNA (miRNA) regulates gene expression by binding to specific sites in the 3'untranslated regions of its target genes. Machine learning based miRNA target prediction algorithms first extract a set of features from potential binding sites (PBSs) in the mRNA and then train a classifier to distinguish targets from non-targets. However, they do not consider whether the PBSs are functional or not, and consequently result in high false positive rates. This substantially affects the follow up functional validation by experiments. We present a novel machine learning based approach, MBSTAR (Multiple instance learning of Binding Sites of miRNA TARgets), for accurate prediction of true or functional miRNA binding sites. Multiple instance learning framework is adopted to handle the lack of information about the actual binding sites in the target mRNAs. Biologically validated 9531 interacting and 973 non-interacting miRNA-mRNA pairs are identified from Tarbase 6.0 and confirmed with PAR-CLIP dataset. It is found that MBSTAR achieves the highest number of binding sites overlapping with PAR-CLIP with maximum F-Score of 0.337. Compared to the other methods, MBSTAR also predicts target mRNAs with highest accuracy. The tool and genome wide predictions are available at

  7. Substance P receptor binding sites are expressed by glia in vivo after neuronal injury

    SciTech Connect

    Mantyh, P.W.; Johnson, D.J.; Boehmer, C.G.; Catton, M.D.; Vinters, H.V.; Maggio, J.E.; Too, Hengphon; Vigna, S.R. )


    In vitro studies have demonstrated that glia can express functional receptors for a variety of neurotransmitters. To determine whether similar neurotransmitter receptors are also expressed by glia in vivo, the authors examined the glial scar in the transected optic nerve of the albino rabbit by quantitative receptor autoradiography. Receptor binding sites for radiolabeled calcitonin gene-related peptide, cholecystokinin, galanin, glutamate, somatostatin, substance P, and vasoactive intestinal peptide were examined. Specific receptor binding sites for each of these neurotransmitters were identified in the rabbit forebrain but were not detected in the normal optic nerve or tract. In the transected optic nerve and tract, only receptor binding sites for substance P were expressed at detectable levels. The density of substance P receptor binding sites observed in this glial scar is among the highest observed in the rabbit forebrain. Ligand displacement and saturation experiments indicate that the substance P receptor binding site expressed by the glial scar has pharmacological characteristics similar to those of substance P receptors in the rabbit striatum, rat brain, and rat and canine gut. The present study demonstrates that glial cells in vivo express high concentrations of substance P receptor binding sites after transection of retinal ganglion cell axons. Because substance P has been shown to regulate inflammatory and immune responses in peripheral tissues, substance P may also, by analogy, be involved in regulating the glial response to injury in the central nervous system.

  8. Substance P Receptor Binding Sites are Expressed by Glia in vivo after Neuronal Injury

    NASA Astrophysics Data System (ADS)

    Mantyh, Patrick W.; Johnson, Donald J.; Boehmer, Christian G.; Catton, Mark D.; Vinters, Harry V.; Maggio, John E.; Too, Heng-Phon; Vigna, Steven R.


    In vitro studies have demonstrated that glia can express functional receptors for a variety of neurotransmitters. To determine whether similar neurotransmitter receptors are also expressed by glia in vivo, we examined the glial scar in the transected optic nerve of the albino rabbit by quantitative receptor autoradiography. Receptor binding sites for radiolabeled calcitonin gene-related peptide, cholecystokinin, galanin, glutamate, somatostatin, substance P, and vasoactive intestinal peptide were examined. Specific receptor binding sites for each of these neurotransmitters were identified in the rabbit forebrain but were not detected in the normal optic nerve or tract. In the transected optic nerve and tract, only receptor binding sites for substance P were expressed at detectable levels. The density of substance P receptor binding sites observed in this glial scar is among the highest observed in the rabbit forebrain. Ligand displacement and saturation experiments indicate that the substance P receptor binding site expressed by the glial scar has pharmacological characteristics similar to those of substance P receptors in the rabbit striatum, rat brain, and rat and canine gut. The present study demonstrates that glial cells in vivo express high concentrations of substance P receptor binding sites after transection of retinal ganglion cell axons. Because substance P has been shown to regulate inflammatory and immune responses in peripheral tissues, substance P may also, by analogy, be involved in regulating the glial response to injury in the central nervous system.

  9. Antimalarial 4(1H)-pyridones bind to the Qi site of cytochrome bc1

    PubMed Central

    Capper, Michael J.; O’Neill, Paul M.; Fisher, Nicholas; Strange, Richard W.; Moss, Darren; Ward, Stephen A.; Berry, Neil G.; Lawrenson, Alexandre S.; Hasnain, S. Samar; Biagini, Giancarlo A.; Antonyuk, Svetlana V.


    Cytochrome bc1 is a proven drug target in the prevention and treatment of malaria. The rise in drug-resistant strains of Plasmodium falciparum, the organism responsible for malaria, has generated a global effort in designing new classes of drugs. Much of the design/redesign work on overcoming this resistance has been focused on compounds that are presumed to bind the Qo site (one of two potential binding sites within cytochrome bc1) using the known crystal structure of this large membrane-bound macromolecular complex via in silico modeling. Cocrystallization of the cytochrome bc1 complex with the 4(1H)-pyridone class of inhibitors, GSK932121 and GW844520, that have been shown to be potent antimalarial agents in vivo, revealed that these inhibitors do not bind at the Qo site but bind at the Qi site. The discovery that these compounds bind at the Qi site may provide a molecular explanation for the cardiotoxicity and eventual failure of GSK932121 in phase-1 clinical trial and highlight the need for direct experimental observation of a compound bound to a target site before chemical optimization and development for clinical trials. The binding of the 4(1H)-pyridone class of inhibitors to Qi also explains the ability of this class to overcome parasite Qo-based atovaquone resistance and provides critical structural information for future design of new selective compounds with improved safety profiles. PMID:25564664

  10. Cycloxaprid insecticide: nicotinic acetylcholine receptor binding site and metabolism.


    Shao, Xusheng; Swenson, Tami L; Casida, John E


    Cycloxaprid (CYC) is a novel neonicotinoid prepared from the (nitromethylene)imidazole (NMI) analogue of imidacloprid. In this study we consider whether CYC is active per se or only as a proinsecticide for NMI. The IC50 values (nM) for displacing [(3)H]NMI binding are 43-49 for CYC and 2.3-3.2 for NMI in house fly and honeybee head membranes and 302 and 7.2, respectively, in mouse brain membranes, potency relationships interpreted as partial conversion of some CYC to NMI under the assay conditions. The 6-8-fold difference in toxicity of injected CYC and NMI to house flies is consistent with their relative potencies as in vivo nicotinic acetylcholine receptor (nAChR) inhibitors in brain measured with [(3)H]NMI binding assays. CYC metabolism in mice largely involves cytochrome P450 pathways without NMI as a major intermediate. Metabolites of CYC tentatively assigned are five monohydroxy derivatives and one each of dihydroxy, nitroso, and amino modifications. CYC appears be a proinsecticide, serving as a slow-release reservoir for NMI with selective activity for insect versus mammalian nAChRs. PMID:23889077

  11. Characterization of the Copper(II) Binding Sites in Human Carbonic Anhydrase II

    PubMed Central

    Nettles, Whitnee L.; Song, He; Farquhar, Erik R.; Fitzkee, Nicholas C.; Emerson, Joseph P.


    Human carbonic anhydrase (CA) is a well-studied, robust, mononuclear Zn-containing metalloprotein that serves as an excellent biological ligand system to study the thermodynamics associated with metal ion coordination chemistry in aqueous solution. The apo-form of human carbonic anhydrase II (CA) binds two equivalents of copper(II) with high affinity. The Cu2+ ions bind independently forming two non-coupled type-II copper centers in CA (CuA and CuB). However, the location and coordination mode of the CuA site in solution is unclear, compared to the CuB site that has been well characterized. Using paramagnetic NMR techniques and X-ray absorption spectroscopy we have identified an N-terminal Cu2+ binding location and collected information on the coordination mode of the CuA site in CA, which is consistent with a four to five coordinate N-terminal Cu2+ binding site reminiscent to a number of N-terminal copper(II) binding sites including the copper(II)-ATCUN and copper(II)-beta-amyloid complexes. Additionally, we report a more detailed analysis of the thermodynamics associated with copper(II) binding to CA. Although we are still unable to fully deconvolute Cu2+ binding data to the high-affinity CuA site, we have derived pH- and buffer-independent values for the thermodynamics parameters K and ΔH associated with Cu2+ binding to the CuB site of CA to be 2 × 109 and −17.4 kcal/mol, respectively. PMID:26010488

  12. Muscarinic cholinergic receptor binding sites differentiated by their affinity for pirenzepine do not interconvert

    SciTech Connect

    Gil, D.W.; Wolfe, B.B.


    Although it has been suggested by many investigators that subtypes of muscarinic cholinergic receptors exist, physical studies of solubilized receptors have indicated that only a single molecular species may exist. To test the hypothesis that the putative muscarinic receptor subtypes in rat forebrain are interconvertible states of the same receptor, the selective antagonist pirenzepine (PZ) was used to protect muscarinic receptors from blockade by the irreversible muscarinic receptor antagonist propylbenzilylcholine mustard (PBCM). If interconversion of high (M1) and low (M2) affinity binding sites for PZ occurs, incubation of cerebral cortical membranes with PBCM in the presence of PZ should not alter the proportions of M1 and M2 binding sites that are unalkylated (i.e., protected). If, on the other hand, the binding sites are not interconvertible, PZ should be able to selectively protect M1 sites and alter the proportions of unalkylated M1 and M2 binding sites. In the absence of PZ, treatment of cerebral cortical membranes with 20 nM PBCM at 4 degrees C for 50 min resulted in a 69% reduction in the density of M1 binding sites and a 55% reduction in the density of M2 binding sites with no change in the equilibrium dissociation constants of the radioligands (/sup 3/H)quinuclidinyl benzilate or (/sup 3/H)PZ. The reasons for this somewhat selective effect of PBCM are not apparent. In radioligand binding experiments using cerebral cortical membranes, PZ inhibited the binding of (/sup 3/H)quinuclidinyl benzilate in a biphasic manner.

  13. Unusually Situated Binding Sites for Bacterial Transcription Factors Can Have Hidden Functionality

    PubMed Central

    Haycocks, James R. J.; Grainger, David C.


    A commonly accepted paradigm of molecular biology is that transcription factors control gene expression by binding sites at the 5' end of a gene. However, there is growing evidence that transcription factor targets can occur within genes or between convergent genes. In this work, we have investigated one such target for the cyclic AMP receptor protein (CRP) of enterotoxigenic Escherichia coli. We show that CRP binds between two convergent genes. When bound, CRP regulates transcription of a small open reading frame, which we term aatS, embedded within one of the adjacent genes. Our work demonstrates that non-canonical sites of transcription factor binding can have hidden functionality. PMID:27258043

  14. Ca2+ binding sites in calmodulin and troponin C alter interhelical angle movements.


    Goto, Kunihiko; Toyama, Akira; Takeuchi, Hideo; Takayama, Kazuyoshi; Saito, Tsutomu; Iwamoto, Masatoshi; Yeh, Jay Z; Narahashi, Toshio


    Molecular dynamics analyses were performed to examine conformational changes in the C-domain of calmodulin and the N-domain of troponin C induced by binding of Ca(2+) ions. Analyses of conformational changes in calmodulin and troponin C indicated that the shortening of the distance between Ca(2+) ions and Ca(2+) binding sites of helices caused widening of the distance between Ca(2+) binding sites of helices on opposite sides, while the hydrophobic side chains in the center of helices hardly moved due to their steric hindrance. This conformational change acts as the clothespin mechanism. PMID:15013750

  15. Molecular simulations of Taxawallin I inside classical taxol binding site of β-tubulin.


    Khan, Inamullah; Nisar, Muhammad; Ahmad, Manzoor; Shah, Hamidullah; Iqbal, Zafar; Saeed, Muhammad; Halimi, Syed Muhammad Ashhad; Kaleem, Waqar Ahmad; Qayum, Mughal; Aman, Akhter; Abdullah, Syed Muhammad


    A new taxoid Taxawallin I (1) along with two known taxoids (2-3) were isolated from methanolic bark extract of Taxus wallichiana Zucc. Structural characterization was confirmed by mass and NMR spectral techniques. Taxawallin I exhibited significant in-vitro anticancer activity against HepG2, A498, NCI-H226 and MDR 2780AD cancer lines. Tubulin binding assay was performed to assess its tubulin binding activity. Molecular docking analysis was performed to study the potential binding mode inside the taxol binding site of β-tubulin. PMID:20969934

  16. Differential Nucleosome Occupancies across Oct4-Sox2 Binding Sites in Murine Embryonic Stem Cells

    PubMed Central

    Sebeson, Amy; Xi, Liqun; Zhang, Quanwei; Sigmund, Audrey; Wang, Ji-Ping; Wang, Xiaozhong


    The binding sequence for any transcription factor can be found millions of times within a genome, yet only a small fraction of these sequences encode functional transcription factor binding sites. One of the reasons for this dichotomy is that many other factors, such as nucleosomes, compete for binding. To study how the competition between nucleosomes and transcription factors helps determine a functional transcription factor site from a predicted transcription factor site, we compared experimentally-generated in vitro nucleosome occupancy with in vivo nucleosome occupancy and transcription factor binding in murine embryonic stem cells. Using a solution hybridization enrichment technique, we generated a high-resolution nucleosome map from targeted regions of the genome containing predicted sites and functional sites of Oct4/Sox2 regulation. We found that at Pax6 and Nes, which are bivalently poised in stem cells, functional Oct4 and Sox2 sites show high amounts of in vivo nucleosome displacement compared to in vitro. Oct4 and Sox2, which are active, show no significant displacement of in vivo nucleosomes at functional sites, similar to nonfunctional Oct4/Sox2 binding. This study highlights a complex interplay between Oct4 and Sox2 transcription factors and nucleosomes among different target genes, which may result in distinct patterns of stem cell gene regulation. PMID:25992972

  17. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.


    Marsh, Lorraine


    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function. PMID:26064949

  18. Breast anticancer drug tamoxifen and its metabolites bind tRNA at multiple sites.


    Bourassa, P; Thomas, T J; Bariyanga, J; Tajmir-Riahi, H A


    The binding sites of breast anticancer drug tamoxifen and its metabolites with tRNA were located by FTIR, CD, UV-visible, and fluorescence spectroscopic methods and molecular modeling. Structural analysis showed that tamoxifen and its metabolites bind tRNA at several binding sites with overall binding constants of K(tam-tRNA) = 5.2 (± 0.6) × 10(4) M(-1), K(4-hydroxytam-tRNA) = 6.5 ( ± 0.5) × 10(4) M(-1) and K(endox-tRNA) = 1.3 (± 0.2) × 10(4) M(-1). The number of binding sites occupied by drug molecules on tRNA were 1 (tamoxifen), 0.8 (4-hydroxitamoxifen) and 1.2 (endoxifen). Docking showed the participation of several nucleobases in drug-tRNA complexes with the free binding energy of -4.31 (tamoxifen), -4.45 (4-hydroxtamoxifen) and -4.38 kcal/mol (endoxifen). The order of binding is 4-hydroxy-tamoxifen > tamoxifen > endoxifen. Drug binding did not alter tRNA conformation from A-family structure, while biopolymer aggregation occurred at high drug concentration. PMID:25263468

  19. Identification of neomycin B-binding site in T box antiterminator model RNA.


    Anupam, Rajaneesh; Denapoli, Leyna; Muchenditsi, Abigael; Hines, Jennifer V


    The T box transcription antitermination mechanism regulates the expression of unique genes in many Gram-positive bacteria by responding, in a magnesium-dependent manner, to uncharged cognate tRNA base pairing with an antiterminator RNA element and other regions of the 5'-untranslated region. Model T box antiterminator RNA is known to bind aminoglycosides, ligands that typically bind RNA in divalent metal ion-binding sites. In this study, enzymatic footprinting and spectroscopic assays were used to identify and characterize the binding site of neomycin B to an antiterminator model RNA. Neomycin B binds the antiterminator bulge nucleotides in an electrostatic-dependent manner and displaces 3-4 monovalent cations, indicating that the antiterminator likely contains a divalent metal ion-binding site. Neomycin B facilitates rather than inhibits tRNA binding indicating that bulge-targeted inhibitors that bind the antiterminator via non-electrostatic interactions may be the more optimal candidates for antiterminator-targeted ligand design. PMID:18329274

  20. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites

    PubMed Central


    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where “nonspecific” interactions contribute to biological function. PMID:26064949

  1. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    SciTech Connect

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.; Mantyh, P.W. )


    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific binding of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.

  2. 65-kilodalton protein phosphorylated by interleukin 2 stimulation bears two putative actin-binding sites and two calcium-binding sites

    SciTech Connect

    Zu, Youli; Shigesada, Katsuya; Hanaoka, Masao; Namba, Yuziro ); Nishida, Eisuke ); Kubota, Ichiro ); Kohno, Michiaki )


    The authors have previously characterized a 65-kilodalton protein (p65) as an interleukin 2 stimulated phosphoprotein in human T cells and showed that three endopeptide sequences of p65 are present in the sequence of l-plastin. In this paper, they present the complete primary structure of p65 based on the cDNA isolated from a human T lymphocyte (KUT-2) cDNA library. Analysis of p65 sequences and the amino acid composition of cleaved p65 N-terminal peptide indicated that the deduced p65 amino acid sequence exactly coincides with that of l-plastin over the C-terminal 580 residues and has a 57-residue extension at the N-terminus to l-plastin. Computer-assisted structural analysis revealed that p65 is a multidomain molecule involving at least three intriguing functional domains: two putative calcium-binding sites along the N-terminal 80 amino acid residues; a putative calmodulin-binding site following the calcium-binding region; and two tandem repeats of putative actin-binding domains in its middle and C-terminal parts, each containing approximately 240 amino acid residues. These results suggest that p65 belongs to actin-binding proteins.

  3. Evidence for Internal and External Binding Sites on Human Tear Lipocalin

    PubMed Central

    Gasymov, Oktay K.; Abduragimov, Adil R.; Glasgow, Ben J.


    8-anilino-1-naphthalenesulfonic acid (ANS) is widely used as a probe for locating binding sites of proteins. To characterize the binding sites of tear lipocalin (TL), we studied ANS binding to apoTL by steady-state and time-resolved fluorescence. Deconvolution of ANS binding revealed that two lifetime components, 16.99 ns and 2.76 ns at pH 7.3, have dissociation constants of 0.58 μM and 5.7 μM, respectively. At pH 3.0, the lifetime components show decreased affinities with dissociation constants of 2.42 μM and ∼21 μM, respectively. Selective displacement of ANS molecules from the ANS-apoTL complex by stearic acid discriminates the internal and external binding sites. Dependence of the binding affinity on ionic strength under various conditions provides strong evidence that an electrostatic interaction is involved. Time-resolved fluorescence is a promising tool to segregate multiple binding sites of proteins. PMID:17945179

  4. Evidence for internal and external binding sites on human tear lipocalin.


    Gasymov, Oktay K; Abduragimov, Adil R; Glasgow, Ben J


    8-anilino-1-naphthalenesulfonic acid (ANS) is widely used as a probe for locating binding sites of proteins. To characterize the binding sites of tear lipocalin (TL), we studied ANS binding to apoTL by steady-state and time-resolved fluorescence. Deconvolution of ANS binding revealed that two lifetime components, 16.99ns and 2.76ns at pH 7.3, have dissociation constants of 0.58muM and 5.7muM, respectively. At pH 3.0, the lifetime components show decreased affinities with dissociation constants of 2.42muM and approximately 21muM, respectively. Selective displacement of ANS molecules from the ANS-apoTL complex by stearic acid discriminates the internal and external binding sites. Dependence of the binding affinity on ionic strength under various conditions provides strong evidence that an electrostatic interaction is involved. Time-resolved fluorescence is a promising tool to segregate multiple binding sites of proteins. PMID:17945179

  5. Syntax compensates for poor binding sites to encode tissue specificity of developmental enhancers.


    Farley, Emma K; Olson, Katrina M; Zhang, Wei; Rokhsar, Daniel S; Levine, Michael S


    Transcriptional enhancers are short segments of DNA that switch genes on and off in response to a variety of intrinsic and extrinsic signals. Despite the discovery of the first enhancer more than 30 y ago, the relationship between primary DNA sequence and enhancer activity remains obscure. In particular, the importance of "syntax" (the order, orientation, and spacing of binding sites) is unclear. A high-throughput screen identified synthetic notochord enhancers that are activated by the combination of ZicL and ETS transcription factors in Ciona embryos. Manipulation of these enhancers elucidated a "regulatory code" of sequence and syntax features for notochord-specific expression. This code enabled in silico discovery of bona fide notochord enhancers, including those containing low-affinity binding sites that would be excluded by standard motif identification methods. One of the newly identified enhancers maps upstream of the known enhancer that regulates Brachyury (Ci-Bra), a key determinant of notochord specification. This newly identified Ci-Bra shadow enhancer contains binding sites with very low affinity, but optimal syntax, and therefore mediates surprisingly strong expression in the notochord. Weak binding sites are compensated by optimal syntax, whereas enhancers containing high-affinity binding affinities possess suboptimal syntax. We suggest this balance has obscured the importance of regulatory syntax, as noncanonical binding motifs are typically disregarded by enhancer detection methods. As a result, enhancers with low binding affinities but optimal syntax may be a vastly underappreciated feature of the regulatory genome. PMID:27155014

  6. 2( sup 125 I)Iodomelatonin binding sites in spleens of guinea pigs

    SciTech Connect

    Poon, A.M.S. ); Pang, S.F. )


    2-({sup 125}I)Iodomelatonin was found to bind specifically to the membrane preparations of the spleens of guinea pigs with high affinity. The binding was rapid, stable, saturable and reversible. Scatchard analysis of the binding assays revealed an equilibrium dissociation constant (Kd) of 49.8{plus minus}4.12 pmol/l and binding site density (Bmax) of 0.69{plus minus}0.082 fmol/mg protein at mid-light. There was no significant change in the Kd or the Bmax at mid-dark. Kinetic analysis showed a Kd of 23.13{plus minus}4.81 pmol/l, in agreement to that derived from the saturation studies. The 2-({sup 125}I)iodomelatonin binding sites have the following order of potency: 2-iodomelatonin > melatonin > 6-chloromelatonin {much gt} N-acetylserotonin, 6-hydroxymelatonin > 5-methoxytryptamine, 5-methoxytryptophol > serotonin, 5-methoxyindole-3-acetic acid > 5-hydroxytryptophol, 3-acetylindole, 1-acetylindole-3-carboxyaldehyde, L-tryptophan > tryptamine, 5-hydroxyindole-3-acetic acid. Differential centrifugation studies showed that the binding sites are localized mainly in the nuclear fraction, the rest are distributed in the microsomal fraction, mitochondrial fraction and cytosolic fraction. The demonstration of 2-({sup 125}I)iodomelatonin binding sites in the spleen suggests the presence of melatonin receptors and a direct mechanism of action of melatonin on the immune system.

  7. Identification of Ligand Binding Sites of Proteins Using the Gaussian Network Model

    PubMed Central

    Tuzmen, Ceren; Erman, Burak


    The nonlocal nature of the protein-ligand binding problem is investigated via the Gaussian Network Model with which the residues lying along interaction pathways in a protein and the residues at the binding site are predicted. The predictions of the binding site residues are verified by using several benchmark systems where the topology of the unbound protein and the bound protein-ligand complex are known. Predictions are made on the unbound protein. Agreement of results with the bound complexes indicates that the information for binding resides in the unbound protein. Cliques that consist of three or more residues that are far apart along the primary structure but are in contact in the folded structure are shown to be important determinants of the binding problem. Comparison with known structures shows that the predictive capability of the method is significant. PMID:21283550

  8. Specific strychnine binding sites on acrosome-associated membranes of golden hamster spermatozoa.


    Llanos, Miguel N; Ronco, Ana M; Aguirre, María C


    This study demonstrates for the first time, that membrane vesicles originated from the hamster sperm head after the occurrence of the acrosome reaction, possess specific strychnine binding sites. [3H]Strychnine binding was saturable and reversible, being displaced by unlabeled strychnine (IC(50)=26.7+/-2.3 microM). Kinetic analysis revealed one binding site with K(d)=120nM and B(max)=142fmol/10(6) spermatozoa. Glycine receptor agonists beta-alanine and taurine inhibited strychnine binding by 20-30%. Surprisingly, glycine stimulated binding by about 40-50%. Results obtained in this study strongly suggest the presence of glycine receptors-with distinctive kinetic properties on the periacrosomal plasma membrane of hamster spermatozoa. Localization of this receptor fits well with its previously proposed role in acrosomal exocytosis during mammalian fertilization. PMID:12804573

  9. Photoaffinity crosslinking of etorphine with opioid binding sites in the bovine adrenal medulla

    SciTech Connect

    Cantau, P.; Bourhim, N.; Giraud, P.; Oliver, C.; Castanas, E.


    The covalent crosslinking of (/sup 3/H)etorphine with opioid binding sites in the bovine adrenal medulla is reported. Of all the radiolabeled opiates tested (ethylketocyclazocine, etorphine, (D-Ala2, D-Leu5)enkephalin, (D-Ala2, Me-Phe4, Gly5-ol)enkephalin only etorphine could be crosslinked under uv irradiation. In our conditions (black uv lamp, 160 W, peak mean 360 nm, from a distance of 10 cm) maximum covalent binding was observed after a 10-min irradiation. Protein concentration was a crucial factor for the irreversible/total binding ratio. A good ratio (50%) was obtained at protein concentrations of about 1.0 mg/ml. Covalent binding of nonmodified opiates could be of interest for the biochemical characterization of their binding sites.

  10. Severe MgADP Inhibition of Bacillus subtilis F1-ATPase Is Not Due to the Absence of Nucleotide Binding to the Noncatalytic Nucleotide Binding Sites

    PubMed Central

    Ishikawa, Toru; Kato-Yamada, Yasuyuki


    F1-ATPase from Bacillus subtilis (BF1) is severely suppressed by the MgADP inhibition. Here, we have tested if this is due to the loss of nucleotide binding to the noncatalytic site that is required for the activation. Measurements with a tryptophan mutant of BF1 indicated that the noncatalytic sites could bind ATP normally. Furthermore, the mutant BF1 that cannot bind ATP to the noncatalytic sites showed much lower ATPase activity. It was concluded that the cause of strong MgADP inhibition of BF1 is not the weak nucleotide binding to the noncatalytic sites but the other steps required for the activation. PMID:25244289

  11. Analysis of functional importance of binding sites in the Drosophila gap gene network model

    PubMed Central


    Background The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. Results We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. Conclusions The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains. PMID:26694511

  12. Resonance energy transfer study on the proximity relationship between the GTP binding site and the rifampicin binding site of Escherichia coli RNA polymerase

    SciTech Connect

    Kumar, K.P.; Chatterji, D. )


    Terbium(III) upon complexation with guanosine 5{prime}-triphosphate showed remarkable enhancement of fluorescence emission at 488 and 545 nm when excited at 295 nm. Analysis of the binding data yielded a value for the mean K{sub d} between Tb(III) and GTP of 0.2 {mu}M, with three binding sites for TB(III) on GTP. {sup 31}P and {sup 1}H NMR measurements revealed that Tb(III) mainly binds the phosphate moiety of GTP. Fluorescence titration of the emission signals of the TbGTP complex with varying concentrations of Escherichia coli RNA polymerase resulted in a K{sub d} values of 4 {mu}M between the TbGTP and the enzyme. It was observed that TbGTP can be incorporated in the place of GTP during E. coli RNA polymerase catalyzed abortive synthesis of dinucleotide tetraphosphate at T7A2 promoter. Both the substrate TbGTP and the inhibitor of the initiation of transcription rifampicin bind to the {beta}-subunit of E. coli RNA polymerase. This allows the measurement of the fluorescence excited-state energy transfer from the donor TbGTP-RNA polymerase to the acceptor rifampicin. Both emission bands of Tb(III) overlap with the rifampicin absorption, and the distances at 50% efficiency of energy transfer were calculated to be 28 and 24 {angstrom} for the 488- and 545-nm emission bands, respectively. The distance between the substrate binding site and the rifampicin binding site on the {beta}-subunit of E. coli RNA polymerase was measured to be around 30 {angstrom}. This suggest that the nature of inhibition of transcription by rifampicin is essentially noncompetitive with the substrate.

  13. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP).


    Van Nostrand, Eric L; Pratt, Gabriel A; Shishkin, Alexander A; Gelboin-Burkhart, Chelsea; Fang, Mark Y; Sundararaman, Balaji; Blue, Steven M; Nguyen, Thai B; Surka, Christine; Elkins, Keri; Stanton, Rebecca; Rigo, Frank; Guttman, Mitchell; Yeo, Gene W


    As RNA-binding proteins (RBPs) play essential roles in cellular physiology by interacting with target RNA molecules, binding site identification by UV crosslinking and immunoprecipitation (CLIP) of ribonucleoprotein complexes is critical to understanding RBP function. However, current CLIP protocols are technically demanding and yield low-complexity libraries with high experimental failure rates. We have developed an enhanced CLIP (eCLIP) protocol that decreases requisite amplification by ∼1,000-fold, decreasing discarded PCR duplicate reads by ∼60% while maintaining single-nucleotide binding resolution. By simplifying the generation of paired IgG and size-matched input controls, eCLIP improves specificity in the discovery of authentic binding sites. We generated 102 eCLIP experiments for 73 diverse RBPs in HepG2 and K562 cells (available at, demonstrating that eCLIP enables large-scale and robust profiling, with amplification and sample requirements similar to those of ChIP-seq. eCLIP enables integrative analysis of diverse RBPs to reveal factor-specific profiles, common artifacts for CLIP and RNA-centric perspectives on RBP activity. PMID:27018577

  14. Exploration of Gated Ligand Binding Recognizes an Allosteric Site for Blocking FABP4-Protein Interaction

    PubMed Central

    Li, Yan; Li, Xiang; Dong, Zigang


    Fatty acid binding protein 4 (FABP4), reversibly binding to fatty acids and other lipids with high affinities, is a potential target for treatment of cancers. The binding site of FABP4 is buried in an interior cavity and thereby ligand binding/unbinding is coupled with opening/closing of FABP4. It is a difficult task both experimentally and computationally to illuminate the entry or exit pathway, especially with the conformational gating. In this report we combine extensive computer simulations, clustering analysis, and Markov state model to investigate the binding mechanism of FABP4 and troglitazone. Our simulations capture spontaneous binding and unbinding events as well as the conformational transition of FABP4 between the open and closed states. An allosteric binding site on the protein surface is recognized for development of novel FABP4 inhibitors. The binding affinity is calculated and compared with the experimental value. The kinetic analysis suggests that ligand residence on the protein surface may delay the binding process. Overall, our results provide a comprehensive picture of ligand diffusion on the protein surface, ligand migration into the buried cavity, and the conformational change of FABP4 at an atomic level. PMID:26580122

  15. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.


    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul


    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS. PMID:18820259

  16. The effect of saturation of ACE binding sites on the pharmacokinetics of enalaprilat in man.

    PubMed Central

    Wade, J R; Meredith, P A; Hughes, D M; Elliott, H L


    1. Eight healthy male volunteers received oral enalapril, 10 mg, in the presence and absence of pretreatment with captopril, 50 mg, twice daily for 5 days. 2. Enalaprilat pharmacokinetics were characterised after both doses of enalapril to investigate the effect of saturating ACE binding sites by pretreatment with captopril. 3. The pharmacokinetics of enalaprilat were best described by a one compartment model with zero order input incorporating saturable binding to plasma and tissue ACE. 4. Values of AUC (0.72 h) for enalaprilat were 419 +/- 97 and 450 +/- 87 ng ml-1 h in the presence and absence of captopril, respectively. The difference was not statistically significant nor were there any other differences in model parameters. 5. Induction of ACE by captopril resulting in an increase in the number of ACE binding sites, may have obscured any effect of captopril on the occupancy of ACE binding sites by enalapril. PMID:1312853

  17. Altered Gene Expression Associated with microRNA Binding Site Polymorphisms

    PubMed Central

    Võsa, Urmo; Esko, Tõnu; Kasela, Silva; Annilo, Tarmo


    Allele-specific gene expression associated with genetic variation in regulatory regions can play an important role in the development of complex traits. We hypothesized that polymorphisms in microRNA (miRNA) response elements (MRE-SNPs) that either disrupt a miRNA binding site or create a new miRNA binding site can affect the allele-specific expression of target genes. By integrating public expression quantitative trait locus (eQTL) data, miRNA binding site predictions, small RNA sequencing, and Argonaute crosslinking immunoprecipitation (AGO-CLIP) datasets, we identified genetic variants that can affect gene expression by modulating miRNA binding efficiency. We also identified MRE-SNPs located in regions associated with complex traits, indicating possible causative mechanisms associated with these loci. The results of this study expand the current understanding of gene expression regulation and help to interpret the mechanisms underlying eQTL effects. PMID:26496489

  18. Evolutionary conservation of the lipopolysaccharide binding site of β₂-glycoprotein I.


    Ağar, Çetin; de Groot, Philip G; Marquart, J Arnoud; Meijers, Joost C M


    β₂-Glycoprotein I (β₂GPI) is a highly abundant plasma protein and the major antigen for autoantibodies in the antiphospholipid syndrome. Recently, we have described a novel function of β₂GPI as scavenger of lipopolysaccharide (LPS). With this in mind we investigated the conservation of β₂GPI in vertebrates and set out to identify the binding site of LPS within β₂GPI. The genome sequences of 42 species were surveyed. Surface plasmon resonance (SPR) was performed with peptides to characterise the binding site of β₂GPI for LPS. β₂GPI could be identified in most tested vertebrates with a high overall amino acid homology of 80% or more in mammals. SPR revealed that a synthesised peptide (LAFWKTDA) from domain V of β₂GPI was able to compete for binding of β₂GPI to LPS. The AFWKTDA sequence was completely conserved in all mammals. The peptide containing the LPS binding site attenuated the inhibition by β₂GPI in a cellular model of LPS-induced tissue factor expression. Other important sites, such as the binding site for anionic phospholipids and the antiphospholipid antibody binding epitope, were also preserved. β₂GPI is highly conserved across the animal kingdom, which suggests that the function of β₂GPI may be more important than anticipated. PMID:21947351

  19. Oligomycin frames a common drug-binding site in the ATP synthase

    SciTech Connect

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric; Mueller, David M.


    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100% conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.

  20. FAD binding, cobinamide binding and active site communication in the corrin reductase (CobR)

    PubMed Central

    Lawrence, Andrew D.; Taylor, Samantha L.; Scott, Alan; Rowe, Michelle L.; Johnson, Christopher M.; Rigby, Stephen E. J.; Geeves, Michael A.; Pickersgill, Richard W.; Howard, Mark J.; Warren, Martin J.


    Adenosylcobalamin, the coenzyme form of vitamin B12, is one Nature's most complex coenzyme whose de novo biogenesis proceeds along either an anaerobic or aerobic metabolic pathway. The aerobic synthesis involves reduction of the centrally chelated cobalt metal ion of the corrin ring from Co(II) to Co(I) before adenosylation can take place. A corrin reductase (CobR) enzyme has been identified as the likely agent to catalyse this reduction of the metal ion. Herein, we reveal how Brucella melitensis CobR binds its coenzyme FAD (flavin dinucleotide) and we also show that the enzyme can bind a corrin substrate consistent with its role in reduction of the cobalt of the corrin ring. Stopped-flow kinetics and EPR reveal a mechanistic asymmetry in CobR dimer that provides a potential link between the two electron reduction by NADH to the single electron reduction of Co(II) to Co(I). PMID:24909839

  1. Mapping of anion binding sites on cytochrome c by differential chemical modification of lysine residues.

    PubMed Central

    Osheroff, N; Brautigan, D L; Margoliash, E


    The carbonate binding site on horse cytochrome c was mapped by comparing the yields of carboxydinitrophenyl-cytochromes c, each with a single carboxydinitrophenyl-substituted lysine residue per molecule, when the modification reaction was carried out in the presence and absence of carbonate. The site is located on the "left surface" of the protein and consists of lysine residues 72 and/or 73 as well as 86 and/or 87 (Carbonate Site). Although one of the binding sites for phosphate on cytochrome c (Phosphat Site I) is located near the carbonate site, the sites are distinctly different since carbonate does not displace bound phosphate, as monitored by 31P NMR. Furthermore, citrate interacts with Phosphate Site I with high affinity, whereas chloride, acetate, borate, and cacodylate have a much lower affinity for this site, if they bind to it at all. The affinity of phosphate for Phosphate Site I (KD = 2 X 10(-4) M) is at least 1 order of magnitude higher than it is for other sites of interaction. Images PMID:6254024

  2. Cation binding at the node of Ranvier: II. Redistribution of binding sites during electrical stimulation.


    Zagoren, J C; Arezzo, J C


    The nodal and paranodal areas of mature myelinated axons are known to bind cations. To examine whether the cation binding substance may play a role in saltatory conduction, a combined electrophysiological and histochemical study was undertaken. The sciatic nerve of anesthetized or unanesthetized adult C57B1 mice was exposed and not stimulated (control) or stimulated with constant square-wave pulses at one of the following rates: 10/sec, 30/sec, 100/sec or 500/sec. Phosphate-buffered 2.5% glutaraldehyde was either dropped onto the nerve during stimulation until cessation of the compound action potential or the nerve was fixed after discontinuing stimulation. The nerve was excised and processed for the histochemical reaction of copper sulfate/potassium ferrocyanide (which forms an electron dense precipitate at areas of cation binding), dehydrated and infiltrated with SpurrR epoxy resin. Individual nerve fibers were microdissected and counts made of the numbers of paranodal and nodal areas exhibiting the reaction product. The percentage of nodes stained, with respect to the total numbers of nodes and paranodes stained, was calculated. There was no significant difference in percent of nodes stained between the simultaneously fixed, non-stimulated, anesthetized (43.1%), the non-stimulated unanesthetized (45.3%), the animals stimulated at 10/sec (45.9%) and the animals stimulated at 30/sec (50.2%) and 100/sec(46.0%), and fixed post-stimulation. However, all values at the higher frequencies and fixed during stimulation were significantly different both from the control and from each other (30/sec-59.3%; 100/sec-70.5%; and 500/sec-76.4%). The location of cation binding appears to change in response to electrical stimulation and correlates with the increased frequency of the inward movement of sodium ions. PMID:7104729

  3. Calculation of Relative Binding Free Energy in the Water-Filled Active Site of Oligopeptide-Binding Protein A.


    Maurer, Manuela; de Beer, Stephanie B A; Oostenbrink, Chris


    The periplasmic oligopeptide binding protein A (OppA) represents a well-known example of water-mediated protein-ligand interactions. Here, we perform free-energy calculations for three different ligands binding to OppA, using a thermodynamic integration approach. The tripeptide ligands share a high structural similarity (all have the sequence KXK), but their experimentally-determined binding free energies differ remarkably. Thermodynamic cycles were constructed for the ligands, and simulations conducted in the bound and (freely solvated) unbound states. In the unbound state, it was observed that the difference in conformational freedom between alanine and glycine leads to a surprisingly slow convergence, despite their chemical similarity. This could be overcome by increasing the softness parameter during alchemical transformations. Discrepancies remained in the bound state however, when comparing independent simulations of the three ligands. These difficulties could be traced to a slow relaxation of the water network within the active site. Fluctuations in the number of water molecules residing in the binding cavity occur mostly on a timescale larger than the simulation time along the alchemical path. After extensive simulations, relative binding free energies that were converged to within thermal noise could be obtained, which agree well with available experimental data. PMID:27092480

  4. GATA1 Binding Kinetics on Conformation-Specific Binding Sites Elicit Differential Transcriptional Regulation.


    Hasegawa, Atsushi; Kaneko, Hiroshi; Ishihara, Daishi; Nakamura, Masahiro; Watanabe, Akira; Yamamoto, Masayuki; Trainor, Cecelia D; Shimizu, Ritsuko


    GATA1 organizes erythroid and megakaryocytic differentiation by orchestrating the expression of multiple genes that show diversified expression profiles. Here, we demonstrate that GATA1 monovalently binds to a single GATA motif (Single-GATA) while a monomeric GATA1 and a homodimeric GATA1 bivalently bind to two GATA motifs in palindromic (Pal-GATA) and direct-repeat (Tandem-GATA) arrangements, respectively, and form higher stoichiometric complexes on respective elements. The amino-terminal zinc (N) finger of GATA1 critically contributes to high occupancy of GATA1 on Pal-GATA. GATA1 lacking the N finger-DNA association fails to trigger a rate of target gene expression comparable to that seen with the wild-type GATA1, especially when expressed at low level. This study revealed that Pal-GATA and Tandem-GATA generate transcriptional responses from GATA1 target genes distinct from the response of Single-GATA. Our results support the notion that the distinct alignments in binding motifs are part of a critical regulatory strategy that diversifies and modulates transcriptional regulation by GATA1. PMID:27215385

  5. CTCF binding site sequence differences are associated with unique regulatory and functional trends during embryonic stem cell differentiation.


    Plasschaert, Robert N; Vigneau, Sébastien; Tempera, Italo; Gupta, Ravi; Maksimoska, Jasna; Everett, Logan; Davuluri, Ramana; Mamorstein, Ronen; Lieberman, Paul M; Schultz, David; Hannenhalli, Sridhar; Bartolomei, Marisa S


    CTCF (CCCTC-binding factor) is a highly conserved multifunctional DNA-binding protein with thousands of binding sites genome-wide. Our previous work suggested that differences in CTCF's binding site sequence may affect the regulation of CTCF recruitment and its function. To investigate this possibility, we characterized changes in genome-wide CTCF binding and gene expression during differentiation of mouse embryonic stem cells. After separating CTCF sites into three classes (LowOc, MedOc and HighOc) based on similarity to the consensus motif, we found that developmentally regulated CTCF binding occurs preferentially at LowOc sites, which have lower similarity to the consensus. By measuring the affinity of CTCF for selected sites, we show that sites lost during differentiation are enriched in motifs associated with weaker CTCF binding in vitro. Specifically, enrichment for T at the 18(th) position of the CTCF binding site is associated with regulated binding in the LowOc class and can predictably reduce CTCF affinity for binding sites. Finally, by comparing changes in CTCF binding with changes in gene expression during differentiation, we show that LowOc and HighOc sites are associated with distinct regulatory functions. Our results suggest that the regulatory control of CTCF is dependent in part on specific motifs within its binding site. PMID:24121688

  6. CTCF binding site sequence differences are associated with unique regulatory and functional trends during embryonic stem cell differentiation

    PubMed Central

    Plasschaert, Robert N.; Vigneau, Sébastien; Tempera, Italo; Gupta, Ravi; Maksimoska, Jasna; Everett, Logan; Davuluri, Ramana; Mamorstein, Ronen; Lieberman, Paul M.; Schultz, David; Hannenhalli, Sridhar; Bartolomei, Marisa S.


    CTCF (CCCTC-binding factor) is a highly conserved multifunctional DNA-binding protein with thousands of binding sites genome-wide. Our previous work suggested that differences in CTCF’s binding site sequence may affect the regulation of CTCF recruitment and its function. To investigate this possibility, we characterized changes in genome-wide CTCF binding and gene expression during differentiation of mouse embryonic stem cells. After separating CTCF sites into three classes (LowOc, MedOc and HighOc) based on similarity to the consensus motif, we found that developmentally regulated CTCF binding occurs preferentially at LowOc sites, which have lower similarity to the consensus. By measuring the affinity of CTCF for selected sites, we show that sites lost during differentiation are enriched in motifs associated with weaker CTCF binding in vitro. Specifically, enrichment for T at the 18th position of the CTCF binding site is associated with regulated binding in the LowOc class and can predictably reduce CTCF affinity for binding sites. Finally, by comparing changes in CTCF binding with changes in gene expression during differentiation, we show that LowOc and HighOc sites are associated with distinct regulatory functions. Our results suggest that the regulatory control of CTCF is dependent in part on specific motifs within its binding site. PMID:24121688

  7. Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor.


    Lawrence, Callum F; Margetts, Mai B; Menting, John G; Smith, Nicholas A; Smith, Brian J; Ward, Colin W; Lawrence, Michael C


    Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe(701) and Phe(705) The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

  8. Identification of candidate transcription factor binding sites in the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...

  9. Characterization of an intracellular hyaluronic acid binding site in isolated rat hepatocytes

    SciTech Connect

    Frost, S.J.; Raja, R.H.; Weigel, P.H. )


    125I-HA, prepared by chemical modification at the reducing sugar, specifically binds to rat hepatocytes in suspension or culture. Intact hepatocytes have relatively few surface 125I-HA binding sites and show low specific binding. However, permeabilization of hepatocytes with the nonionic detergent digitonin results in increased specific 125I-HA binding (45-65%) and a very large increase in the number of specific 125I-HA binding sites. Scatchard analysis of equilibrium 125I-HA binding to permeabilized hepatocytes in suspension at 4 degrees C indicates a Kd = 1.8 x 10(-7) M and 1.3 x 10(6) molecules of HA (Mr approximately 30,000) bound per cell at saturation. Hepatocytes in primary culture for 24 h show the same affinity but the total number of HA molecules bound per cell at saturation decreases to approximately 6.2 x 10(5). Increasing the ionic strength above physiologic concentrations decreases 125I-HA binding to permeable cells, whereas decreasing the ionic strength above causes an approximately 4-fold increase. The divalent cation chelator EGTA does not prevent binding nor does it release 125I-HA bound in the presence of 2 mM CaCl2, although higher divalent cation concentrations stimulate 125I-HA binding. Ten millimolar CaCl2 or MnCl2 increases HA binding 3-6-fold compared to EGTA-treated cells. Ten millimolar MgCl2, SrCl2, or BaCl2 increased HA binding by 2-fold. The specific binding of 125I-HA to digitonin-treated hepatocytes at 4{degrees}C increased greater than 10-fold at pH 5.0 as compared to pH 7.

  10. Communication between the Zinc and Tetrahydrobiopterin Binding Sites in Nitric Oxide Synthase

    PubMed Central


    The nitric oxide synthase (NOS) dimer is stabilized by a Zn2+ ion coordinated to four symmetry-related Cys residues exactly along the dimer 2-fold axis. Each of the two essential tetrahydrobiopterin (H4B) molecules in the dimer interacts directly with the heme, and each H4B molecule is ∼15 Å from the Zn2+. We have determined the crystal structures of the bovine endothelial NOS dimer oxygenase domain bound to three different pterin analogues, which reveal an intimate structural communication between the H4B and Zn2+ sites. The binding of one of these compounds, 6-acetyl-2-amino-7,7-dimethyl-7,8-dihydro-4(3H)-pteridinone (1), to the pterin site and Zn2+ binding are mutually exclusive. Compound 1 both directly and indirectly disrupts hydrogen bonding between key residues in the Zn2+ binding motif, resulting in destabilization of the dimer and a complete disruption of the Zn2+ site. Addition of excess Zn2+ stabilizes the Zn2+ site at the expense of weakened binding of 1. The unique structural features of 1 that disrupt the dimer interface are extra methyl groups that extend into the dimer interface and force a slight opening of the dimer, thus resulting in disruption of the Zn2+ site. These results illustrate a very delicate balance of forces and structure at the dimer interface that must be maintained to properly form the Zn2+, pterin, and substrate binding sites. PMID:24819538

  11. Autoradiographic localization of (/sup 125/I)-angiotensin II binding sites in the rat adrenal gland

    SciTech Connect

    Healy, D.P.; Maciejewski, A.R.; Printz, M.P.


    To gain greater insight into sites of action of circulating angiotensin II (Ang II) within the adrenal, we have localized the (/sup 125/I)-Ang II binding site using in vitro autoradiography. Autoradiograms were generated either by apposition of isotope-sensitive film or with emulsion-coated coverslips to slide-mounted adrenal sections labeled in vitro with 1.0 nM (/sup 125/I)-Ang II. Analysis of the autoradiograms showed that Ang II binding sites were concentrated in a thin band in the outer cortex (over the cells of the zona glomerulosa) and in the adrenal medulla, which at higher power was seen as dense patches. Few sites were evident in the inner cortex. The existence of Ang II binding sites in the adrenal medulla was confirmed by conventional homogenate binding techniques which revealed a single class of high affinity Ang II binding site (K/sub d/ . 0.7nM, B/sub max/ . 168.7 fmol/mg). These results suggest that the adrenal medulla may be a target for direct receptor-mediated actions of Ang II.

  12. Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain

    SciTech Connect

    Rogulja, I.


    The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue within the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.

  13. Secondary anionic phospholipid binding site and gating mechanism in Kir2.1 inward rectifier channels

    NASA Astrophysics Data System (ADS)

    Lee, Sun-Joo; Wang, Shizhen; Borschel, William; Heyman, Sarah; Gyore, Jacob; Nichols, Colin G.


    Inwardly rectifying potassium (Kir) channels regulate multiple tissues. All Kir channels require interaction of phosphatidyl-4,5-bisphosphate (PIP2) at a crystallographically identified binding site, but an additional nonspecific secondary anionic phospholipid (PL(-)) is required to generate high PIP2 sensitivity of Kir2 channel gating. The PL(-)-binding site and mechanism are yet to be elucidated. Here we report docking simulations that identify a putative PL(-)-binding site, adjacent to the PIP2-binding site, generated by two lysine residues from neighbouring subunits. When either lysine is mutated to cysteine (K64C and K219C), channel activity is significantly decreased in cells and in reconstituted liposomes. Directly tethering K64C to the membrane by modification with decyl-MTS generates high PIP2 sensitivity in liposomes, even in the complete absence of PL(-)s. The results provide a coherent molecular mechanism whereby PL(-) interaction with a discrete binding site results in a conformational change that stabilizes the high-affinity PIP2 activatory site.

  14. Phylogenetic distribution of (/sup 3/H)cyclohexyladenosine binding sites in nervous tissue

    SciTech Connect

    Siebenaller, J.F.; Murray, T.F.


    The specific binding of the A/sub 1/ adenosine receptor ligand. (/sup 3/H)CHA, was investigated in membrane fractions prepared from brains of eleven vertebrate species and ganglia of four invertebrate species. Substantial amounts of specific (/sup 3/H)CHA binding sites were demonstrated in brain membranes of all vertebrate species examined; however, (/sup 3/H)CHA binding sites were not detectable in nervous sites in vertebrate brains increase in higher vertebrates. Moreover, the pharmacological characteristics of the site labeled by (/sup 3/H)CHA in two divergent classes of vertebrates were similar. The broad phylogenetic distribution of A/sub 1/ adenosine receptors in primitive as well as advanced vertebrate species suggests a fundamental role for adenosine in neuronal modulation.

  15. Proteus and the Design of Ligand Binding Sites.


    Polydorides, Savvas; Michael, Eleni; Mignon, David; Druart, Karen; Archontis, Georgios; Simonson, Thomas


    This chapter describes the organization and use of Proteus, a multitool computational suite for the optimization of protein and ligand conformations and sequences, and the calculation of pK α shifts and relative binding affinities. The software offers the use of several molecular mechanics force fields and solvent models, including two generalized Born variants, and a large range of scoring functions, which can combine protein stability, ligand affinity, and ligand specificity terms, for positive and negative design. We present in detail the steps for structure preparation, system setup, construction of the interaction energy matrix, protein sequence and structure optimizations, pK α calculations, and ligand titration calculations. We discuss illustrative examples, including the chemical/structural optimization of a complex between the MHC class II protein HLA-DQ8 and the vinculin epitope, and the chemical optimization of the compstatin analog Ac-Val4Trp/His9Ala, which regulates the function of protein C3 of the complement system. PMID:27094287

  16. Integrin LFA-1 alpha subunit contains an ICAM-1 binding site in domains V and VI.

    PubMed Central

    Stanley, P; Bates, P A; Harvey, J; Bennett, R I; Hogg, N


    In order to identify a binding site for ligand intercellular adhesion molecule-1 (ICAM-1) on the beta 2 integrin lymphocyte function-associated antigen-1 (LFA-1), protein fragments of LFA-1 were made by in vitro translation of a series of constructs which featured domain-sized deletions starting from the N-terminus of the alpha subunit of LFA-1. Monoclonal antibodies and ICAM-1 were tested for their ability to bind to these protein fragments. Results show that the putative divalent cation binding domains V and VI contain an ICAM-1 binding site. A series of consecutive peptides covering these domains indicated two discontinuous areas as specific contact sites: residues 458-467 in domain V and residues 497-516 in domain VI. A three-dimensional model of these domains of LFA-1 was constructed based on the sequence similarity to known EF hands. The two regions critical for the interaction of LFA-1 with ICAM-1 lie adjacent to each other, the first next to the non-functional EF hand in domain V and the second coinciding with the potential divalent cation binding loop in domain VI. The binding of ICAM-1 with the domain V and VI region in solution was not sensitive to divalent cation chelation. In short, a critical motif for ICAM-1 binding to the alpha subunit of LFA-1 is shared between two regions of domains V and VI. Images PMID:7909511

  17. Light-chain binding sites on renal brush-border membranes

    SciTech Connect

    Batuman, V.; Dreisbach, A.W.; Cyran, J.


    Immunoglobulin light chains are low-molecular-weight proteins filtered at the renal glomerulus and catabolized within the proximal tubular epithelium. Excessive production and urinary excretion of light chains are associated with renal dysfunction. They also interfere with proximal renal tubule epithelial functions in vitro. We studied the binding of 125I-labeled kappa- and lambda-light chains, obtained from the urine of multiple myeloma patients, to rat and human renal proximal tubular brush-border membranes. Light-chain binding to brush borders was also demonstrated immunologically by flow cytometry. Computer analysis of binding data was consistent with presence of a single class of low-affinity, high-capacity, non-cooperative binding sites with relative selectivity for light chains on both rat and human kidney brush-border membranes. The dissociation constants of light chains ranged from 1.6 X 10(-5) to 1.2 X 10(-4) M, and maximum binding capacity ranged from 4.7 +/- 1.3 X 10(-8) to 8.0 +/- 0.9 X 10(-8) (SD) mol/mg protein at 25 degrees C. Kappa- and lambda-light chains competed with each other for binding with comparable affinity constants. Competition by albumin and beta-lactoglobulin, however, was much weaker, suggesting relative site selectivity for light chains. These binding sites probably function as endocytotic receptors for light chains and possibly other low-molecular-weight proteins.

  18. Characterization of a second ligand binding site of the insulin receptor

    SciTech Connect

    Hao Caili; Whittaker, Linda; Whittaker, Jonathan . E-mail:


    Insulin binding to its receptor is characterized by high affinity, curvilinear Scatchard plots, and negative cooperativity. These properties may be the consequence of binding of insulin to two receptor binding sites. The N-terminal L1 domain and the C-terminus of the {alpha} subunit contain one binding site. To locate a second site, we examined the binding properties of chimeric receptors in which the L1 and L2 domains and the first Fibronectin Type III repeat of the insulin-like growth factor-I receptor were replaced by corresponding regions of the insulin receptor. Substitutions of the L2 domain and the first Fibronectin Type III repeat together with the L1 domain produced 80- and 300-fold increases in affinity for insulin. Fusion of these domains to human immunoglobulin Fc fragment produced a protein which bound insulin with a K {sub d} of 2.9 nM. These data strongly suggest that these domains contain an insulin binding site.

  19. Cloning and characterisation of a nuclear, site specific ssDNA binding protein.


    Smidt, M P; Russchen, B; Snippe, L; Wijnholds, J; Ab, G


    Estradiol inducible, liver-specific expression of the apoVLDL II gene is mediated through the estrogen receptor and a variety of other DNA-binding proteins. In the present study we report the cloning and characterisation of a single-strand DNA binding protein that interacts with the lower strand of a complex regulatory site, which includes the major estrogen responsive element and a site that resembles the rat albumin site D (apoVLDL II site D). Based on its binding specificity determined with electro-mobility shift assays, the protein is named single-strand D-box binding factor (ssDBF). Analysis of the deduced 302 amino acid sequence revealed that the protein belongs to the heteronuclear ribonucleoprotein A/B family (hnRNP A/B) and resembles other known eukaryotic single-strand DNA binding proteins. Transient transfection experiments in a chicken liver cell-line showed that the protein represses estrogen-induced transcription. A protein with similar binding characteristics is present in liver nuclear extract. The relevance of the occurrence of this protein to the expression of the apoVLDL II gene is discussed. PMID:7630716

  20. Identification of the NAD(P)H binding site of eukaryotic UDP-galactopyranose mutase.


    Dhatwalia, Richa; Singh, Harkewal; Solano, Luis M; Oppenheimer, Michelle; Robinson, Reeder M; Ellerbrock, Jacob F; Sobrado, Pablo; Tanner, John J


    UDP-galactopyranose mutase (UGM) plays an essential role in galactofuranose biosynthesis in microorganisms by catalyzing the conversion of UDP-galactopyranose to UDP-galactofuranose. The enzyme has gained attention recently as a promising target for the design of new antifungal, antitrypanosomal, and antileishmanial agents. Here we report the first crystal structure of UGM complexed with its redox partner NAD(P)H. Kinetic protein crystallography was used to obtain structures of oxidized Aspergillus fumigatus UGM (AfUGM) complexed with NADPH and NADH, as well as reduced AfUGM after dissociation of NADP(+). NAD(P)H binds with the nicotinamide near the FAD isoalloxazine and the ADP moiety extending toward the mobile 200s active site flap. The nicotinamide riboside binding site overlaps that of the substrate galactopyranose moiety, and thus NADPH and substrate binding are mutually exclusive. On the other hand, the pockets for the adenine of NADPH and uracil of the substrate are distinct and separated by only 6 Å, which raises the possibility of designing novel inhibitors that bind both sites. All 12 residues that contact NADP(H) are conserved among eukaryotic UGMs. Residues that form the AMP pocket are absent in bacterial UGMs, which suggests that eukaryotic and bacterial UGMs have different NADP(H) binding sites. The structures address the longstanding question of how UGM binds NAD(P)H and provide new opportunities for drug discovery. PMID:23036087

  1. Down-regulation of endothelin binding sites in rat vascular smooth muscle cells

    SciTech Connect

    Roubert, P.; Gillard, V.; Plas, P.; Chabrier, P.E.; Braquet, P. )


    In cultured rat aortic smooth muscle cells, ({sup 125}I)endothelin (ET-1) bound to an apparent single class of high affinity recognition sites with a dissociation constant of 1.84 +/- 0.29 nmol/L and a maximum binding of 62 +/- 10.5 fmol/10(6) cells. The binding was not affected by calcium antagonists or vasoactive substances, including angiotensin II, arginine vasopressin, atrial natriuretic factor and bradykinin. Exposure of the cells to ET-1 (0.01 nmol/L to 10 nmol/L) resulted in an apparent dose-dependent reduction of the number of endothelin binding sites with no significant modification of its binding affinity. The time course of the down-regulation of ET-1 binding sites showed that this effect was present after 30 min incubation and persisted after 18 h. This indicates that down-regulation of ET-1 binding sites can modulate the activity of ET-1 and suggests a rapid internalization of ET-1 in vascular cells.

  2. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    SciTech Connect

    Stoeckel, M.E.; Freund-Mercier, M.J. )


    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experiments showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.

  3. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    SciTech Connect

    Nye, J.S.


    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one class of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.

  4. High affinity binding sites for the Wilms' tumour suppressor protein WT1.

    PubMed Central

    Hamilton, T B; Barilla, K C; Romaniuk, P J


    The Wilms' tumour suppressor protein (WT1) is a putative transcriptional regulatory protein with four zinc fingers, the last three of which have extensive sequence homology to the early growth response-1 (EGR-1) protein. Although a peptide encoding the zinc finger domain of WT1[-KTS] can bind to a consensus 9 bp EGR-1 binding site, current knowledge about the mechanisms of zinc finger-DNA interactions would predict a more extended recognition site for WT1. Using a WT1[-KTS] zinc finger peptide (WT1-ZFP) and the template oligonucleotide GCG-TGG-GCG-NNNNN in a binding site selection assay, we have determined that the highest affinity binding sites for WT1[-KTS] consist of a 12 bp sequence GCG-TGG-GCG-(T/G)(G/A/T)(T/G). The binding of WT1-ZFP to a number of the selected sequences was measured by a quantitative nitrocellulose filter binding assay, and the results demonstrated that these sequences have a 4-fold higher affinity for the protein than the nonselected sequence GCG-TGG-GCG-CCC. The full length WT1 protein regulates transcription of reporter genes linked to these high affinity sequences. A peptide lacking the first zinc finger of WT1[-KTS], but containing the three zinc fingers homologous to EGR-1 failed to select any specific sequences downstream of the GCG-TGG-GCG consensus sequence in the binding site selection assay. DNA sequences in the fetal promoter of the insulin-like growth factor II gene that confer WT1 responsiveness in a transient transfection assay bind to the WT1-ZFP with affinities that vary according to the number of consensus bases each sequence possesses in the finger 1 subsite. PMID:7862533

  5. Detection and characterization of xenon-binding sites in proteins by 129Xe NMR spectroscopy.


    Rubin, Seth M; Lee, Seok-Yong; Ruiz, E Janette; Pines, Alexander; Wemmer, David E


    Xenon-binding sites in proteins have led to a number of applications of xenon in biochemical and structural studies. Here we further develop the utility of 129Xe NMR in characterizing specific xenon-protein interactions. The sensitivity of the 129Xe chemical shift to its local environment and the intense signals attainable by optical pumping make xenon a useful NMR reporter of its own interactions with proteins. A method for detecting specific xenon-binding interactions by analysis of 129Xe chemical shift data is illustrated using the maltose binding protein (MBP) from Escherichia coli as an example. The crystal structure of MBP in the presence of 8atm of xenon confirms the binding site determined from NMR data. Changes in the structure of the xenon-binding cavity upon the binding of maltose by the protein can account for the sensitivity of the 129Xe chemical shift to MBP conformation. 129Xe NMR data for xenon in solution with a number of cavity containing phage T4 lysozyme mutants show that xenon can report on cavity structure. In particular, a correlation exists between cavity size and the binding-induced 129Xe chemical shift. Further applications of 129Xe NMR to biochemical assays, including the screening of proteins for xenon binding for crystallography are considered. PMID:12217701

  6. Tubulin exchanges divalent cations at both guanine nucleotide-binding sites.


    Correia, J J; Beth, A H; Williams, R C


    The tubulin heterodimer binds a molecule of GTP at the nonexchangeable nucleotide-binding site (N-site) and either GDP or GTP at the exchangeable nucleotide-binding site (E-site). Mg2+ is known to be tightly linked to the binding of GTP at the E-site (Correia, J. J., Baty, L. T., and Williams, R. C., Jr. (1987) J. Biol. Chem. 262, 17278-17284). Measurements of the exchange of Mn2+ for bound Mg2+ (as monitored by atomic absorption and EPR) demonstrate that tubulin which has GDP at the E-site possesses one high affinity metal-binding site and that tubulin which has GTP at the E-site possesses two such sites. The apparent association constants are 0.7-1.1 x 10(6) M-1 for Mg2+ and approximately 4.1-4.9 x 10(7) M-1 for Mn2+. Divalent cations do bind to GDP at the E-site, but with much lower affinity (2.0-2.3 x 10(3) M-1 for Mg2+ and 3.9-6.6 x 10(3) M-1 for Mn2+). These data suggest that divalent cations are involved in GTP binding to both the N- and E-sites of tubulin. The N-site metal exchanges slowly (kapp = 0.020 min-1), suggesting a mechanism involving protein "breathing" or heterodimer dissociation. The N-site metal exchange rate is independent of the concentration of protein and metal, an observation consistent with the possibility that a dynamic breathing process is the rate-limiting step. The exchange of Mn2+ for Mg2+ has no effect on the secondary structure of tubulin at 4 degrees C or on the ability of tubulin to form microtubules. These results have important consequences for the interpretation of distance measurements within the tubulin dimer using paramagnetic ions. They are also relevant to the detailed mechanism of divalent cation release from microtubules after GTP hydrolysis. PMID:3392036

  7. Impact of disruption of secondary binding site S2 on dopamine transporter function.


    Zhen, Juan; Reith, Maarten E A


    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. PMID

  8. A nuclear magnetic resonance-based structural rationale for contrasting stoichiometry and ligand binding site(s) in fatty acid-binding proteins.


    He, Yan; Estephan, Rima; Yang, Xiaomin; Vela, Adriana; Wang, Hsin; Bernard, Cédric; Stark, Ruth E


    Liver fatty acid-binding protein (LFABP) is a 14 kDa cytosolic polypeptide, differing from other family members in the number of ligand binding sites, the diversity of bound ligands, and the transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional (1)H-(15)N nuclear magnetic resonance (NMR) signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without determining the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and an R122L/S124A mutant in which electrostatic interactions viewed as being essential to fatty acid binding were removed. For wild-type LFABP, the results compared favorably with the data for previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, (1)H and (15)N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. PMID:21226535

  9. Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding Site Tyr Residue.


    Chen, Wentao; Dong, Jiajia; Plate, Lars; Mortenson, David E; Brighty, Gabriel J; Li, Suhua; Liu, Yu; Galmozzi, Andrea; Lee, Peter S; Hulce, Jonathan J; Cravatt, Benjamin F; Saez, Enrique; Powers, Evan T; Wilson, Ian A; Sharpless, K Barry; Kelly, Jeffery W


    Arylfluorosulfates have appeared only rarely in the literature and have not been explored as probes for covalent conjugation to proteins, possibly because they were assumed to possess high reactivity, as with other sulfur(VI) halides. However, we find that arylfluorosulfates become reactive only under certain circumstances, e.g., when fluoride displacement by a nucleophile is facilitated. Herein, we explore the reactivity of structurally simple arylfluorosulfates toward the proteome of human cells. We demonstrate that the protein reactivity of arylfluorosulfates is lower than that of the corresponding aryl sulfonyl fluorides, which are better characterized with regard to proteome reactivity. We discovered that simple hydrophobic arylfluorosulfates selectively react with a few members of the intracellular lipid binding protein (iLBP) family. A central function of iLBPs is to deliver small-molecule ligands to nuclear hormone receptors. Arylfluorosulfate probe 1 reacts with a conserved tyrosine residue in the ligand-binding site of a subset of iLBPs. Arylfluorosulfate probes 3 and 4, featuring a biphenyl core, very selectively and efficiently modify cellular retinoic acid binding protein 2 (CRABP2), both in vitro and in living cells. The X-ray crystal structure of the CRABP2-4 conjugate, when considered together with binding site mutagenesis experiments, provides insight into how CRABP2 might activate arylfluorosulfates toward site-specific reaction. Treatment of breast cancer cells with probe 4 attenuates nuclear hormone receptor activity mediated by retinoic acid, an endogenous client lipid of CRABP2. Our findings demonstrate that arylfluorosulfates can selectively target single iLBPs, making them useful for understanding iLBP function. PMID:27191344

  10. Purification of high affinity benzodiazepine receptor binding site fragments from rat brain

    SciTech Connect

    Klotz, K.L.


    In central nervous system benzodiazepine recognition sites occur on neuronal cell surfaces as one member of a multireceptor complex, including recognition sites for benzodiazepines, gamma aminobutyric acid (GABA), barbiturates and a chloride ionophore. During photoaffinity labelling, the benzodiazepine agonist, /sup 3/H-flunitrazepam, is irreversibly bound to central benzodiazepine high affinity recognition sites in the presence of ultraviolet light. In these studies a /sup 3/H-flunitrazepam radiolabel was used to track the isolation and purification of high affinity agonist binding site fragments from membrane-bound benzodiazepine receptor in rat brain. The authors present a method for limited proteolysis of /sup 3/H-flunitrazepam photoaffinity labeled rat brain membranes, generating photolabeled benzodiazepine receptor fragments containing the agonist binding site. Using trypsin chymotrypsin A/sub 4/, or a combination of these two proteases, they have demonstrated the extent and time course for partial digestion of benzodiazepine receptor, yielding photolabeled receptor binding site fragments. These photolabeled receptor fragments have been further purified on the basis of size, using ultrafiltration, gel permeation chromatography, and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as well as on the basis of hydrophobicity, using a high performance liquid chromatography (HPLC) precolumn, several HPLC elution schemes, and two different HPLC column types. Using these procedures, they have purified three photolabeled benzodiazepine receptor fragments containing the agonist binding site which appear to have a molecular weight of less than 2000 daltons each.

  11. Mercury binding sites in thiol-functionalized mesostructured silica.


    Billinge, Simon J L; McKimmy, Emily J; Shatnawi, Mouath; Kim, HyunJeong; Petkov, Valeri; Wermeille, Didier; Pinnavaia, Thomas J


    Thiol-functionalized mesostructured silica with anhydrous compositions of (SiO(2))(1)(-)(x)()(LSiO(1.5))(x)(), where L is a mercaptopropyl group and x is the fraction of functionalized framework silicon centers, are effective trapping agents for the removal of mercuric(II) ions from water. In the present work, we investigate the mercury-binding mechanism for representative thiol-functionalized mesostructures by atomic pair distribution function (PDF) analysis of synchrotron X-ray powder diffraction data and by Raman spectroscopy. The mesostructures with wormhole framework structures and compositions corresponding to x = 0.30 and 0.50 were prepared by direct assembly methods in the presence of a structure-directing amine porogen. PDF analyses of five mercury-loaded compositions with Hg/S ratios of 0.50-1.30 provided evidence for the bridging of thiolate sulfur atoms to two metal ion centers and the formation of chain structures on the pore surfaces. We find no evidence for Hg-O bonds and can rule out oxygen coordination of the mercury at greater than the 10% level. The relative intensities of the PDF peaks corresponding to Hg-S and Hg-Hg atomic pairs indicate that the mercury centers cluster on the functionalized surfaces by virtue of thiolate bridging, regardless of the overall mercury loading. However, the Raman results indicate that the complexation of mercury centers by thiolate depends on the mercury loading. At low mercury loadings (Hg/S < or = 0.5), the dominant species is an electrically neutral complex in which mercury most likely is tetrahedrally coordinated to bridging thiolate ligands, as in Hg(SBu(t))(2). At higher loadings (Hg/S 1.0-1.3), mercury complex cations predominate, as evidenced by the presence of charge-balancing anions (nitrate) on the surface. This cationic form of bound mercury is assigned a linear coordination to two bridging thiolate ligands. PMID:15941284

  12. Identification of a novel calcium antagonist binding site in rat brain by SR 33557.

    PubMed Central

    Kenny, B. A.; Fraser, S.; Spedding, M.


    1. In K(+)-depolarized taenia preparations from guinea-pig caecum SR 33557 was a potent antagonist of Ca(2+)-induced contractions and antagonized the effect of the calcium channel activator Bay K 8644. 2. SR 33557 displayed high affinity (pKi 9.54 +/- 0.04, nH 1.01) for the [3H]-(+/-)-PN 200-110 binding site in rat cerebral cortex membranes. In the presence of 5 mM Ca2+ this affinity was reduced (pKi 8.82 +/- 0.01, nH 1.05) whilst the affinity of nitrendipine was unaffected by this concentration of Ca2+. 3. Saturation binding experiments in rat cerebral cortex carried out in the absence and presence of SR 33557 (0.1-1.0 nM) indicated an apparently competitive interaction at the dihydropyridine site, in that SR 33557 reduced the KD of [3H]-(+/-)-PN 200-110 binding without any effect on Bmax. In kinetic experiments, the rate of dissociation of [3H]-(+/-)-PN 200-110 from rat cerebral cortex was unchanged in the presence of SR 33557 (5 nM). 4. D-cis-diltiazem fully reversed the inhibition [3H]-nitrendipine binding to rat cerebral cortex produced by SR 33557 indicating the site of action of SR 33557 to be distinct from the dihydropyridine (DHP) binding site. 5. Saturation analysis indicated that [3H]-SR 33557 (0.01-0.8 nM) labelled a single class of binding sites in rat cerebral cortex membranes with high affinity (KD 0.12 +/- 0.01, Bmax 222 +/- 20 fmol mg-1 protein), although kinetic data indicated the existence of negative cooperativity between the binding sites.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7679034

  13. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1.


    Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; Cho, Sung-Hwan; Xu, Dong; Stacey, Gary


    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecular interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. The in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues. PMID:27583834

  14. Survey of phosphorylation near drug binding sites in the Protein Data Bank (PDB) and their effects.


    Smith, Kyle P; Gifford, Kathleen M; Waitzman, Joshua S; Rice, Sarah E


    While it is currently estimated that 40 to 50% of eukaryotic proteins are phosphorylated, little is known about the frequency and local effects of phosphorylation near pharmaceutical inhibitor binding sites. In this study, we investigated how frequently phosphorylation may affect the binding of drug inhibitors to target proteins. We examined the 453 non-redundant structures of soluble mammalian drug target proteins bound to inhibitors currently available in the Protein Data Bank (PDB). We cross-referenced these structures with phosphorylation data available from the PhosphoSitePlus database. Three hundred twenty-two of 453 (71%) of drug targets have evidence of phosphorylation that has been validated by multiple methods or labs. For 132 of 453 (29%) of those, the phosphorylation site is within 12 Å of the small molecule-binding site, where it would likely alter small molecule binding affinity. We propose a framework for distinguishing between drug-phosphorylation site interactions that are likely to alter the efficacy of drugs versus those that are not. In addition we highlight examples of well-established drug targets, such as estrogen receptor alpha, for which phosphorylation may affect drug affinity and clinical efficacy. Our data suggest that phosphorylation may affect drug binding and efficacy for a significant fraction of drug target proteins. PMID:24833420

  15. Benzene Probes in Molecular Dynamics Simulations Reveal Novel Binding Sites for Ligand Design.


    Tan, Yaw Sing; Reeks, Judith; Brown, Christopher J; Thean, Dawn; Ferrer Gago, Fernando Jose; Yuen, Tsz Ying; Goh, Eunice Tze Leng; Lee, Xue Er Cheryl; Jennings, Claire E; Joseph, Thomas L; Lakshminarayanan, Rajamani; Lane, David P; Noble, Martin E M; Verma, Chandra S


    Protein flexibility poses a major challenge in binding site identification. Several computational pocket detection methods that utilize small-molecule probes in molecular dynamics (MD) simulations have been developed to address this issue. Although they have proven hugely successful at reproducing experimental structural data, their ability to predict new binding sites that are yet to be identified and characterized has not been demonstrated. Here, we report the use of benzenes as probe molecules in ligand-mapping MD (LMMD) simulations to predict the existence of two novel binding sites on the surface of the oncoprotein MDM2. One of them was serendipitously confirmed by biophysical assays and X-ray crystallography to be important for the binding of a new family of hydrocarbon stapled peptides that were specifically designed to target the other putative site. These results highlight the predictive power of LMMD and suggest that predictions derived from LMMD simulations can serve as a reliable basis for the identification of novel ligand binding sites in structure-based drug design. PMID:27532490

  16. Survey of phosphorylation near drug binding sites in the Protein Data Bank (PDB) and their effects

    PubMed Central

    Smith, Kyle P.; Gifford, Kathleen M.; Waitzman, Joshua S.; Rice, Sarah E.


    While it is currently estimated that 40–50% of eukaryotic proteins are phosphorylated, little is known about the frequency and local effects of phosphorylation near pharmaceutical inhibitor binding sites. In this study, we investigated how frequently phosphorylation may affect the binding of drug inhibitors to target proteins. We examined the 453 non-redundant structures of soluble mammalian drug target proteins bound to inhibitors currently available in the Protein Data Bank (PDB). We cross-referenced these structures with phosphorylation data available from the PhosphoSitePlus database. 322/453 (71%) of drug targets have evidence of phosphorylation that has been validated by multiple methods or labs. For 132/453 (29%) of those, the phosphorylation site is within 12Å of the small molecule-binding site, where it would likely alter small molecule binding affinity. We propose a framework for distinguishing between drug-phosphorylation site interactions that are likely to alter the efficacy of drugs vs. those that are not. In addition we highlight examples of well-established drug targets, such as estrogen receptor alpha, for which phosphorylation may affect drug affinity and clinical efficacy. Our data suggest that phosphorylation may affect drug binding and efficacy for a significant fraction of drug target proteins. PMID:24833420

  17. Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

    PubMed Central

    Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.


    Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server ( is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

  18. Diazepam-bound GABAA receptor models identify new benzodiazepine binding-site ligands

    PubMed Central

    Richter, Lars; de Graaf, Chris; Sieghart, Werner; Varagic, Zdravko; Mörzinger, Martina; de Esch, Iwan J P; Ecker, Gerhard F; Ernst, Margot


    Benzodiazepines exert their anxiolytic, anticonvulsant, muscle-relaxant and sedative-hypnotic properties by allosterically enhancing the action of GABA at GABAA receptors via their benzodiazepine-binding site. Although these drugs have been used clinically since 1960, the molecular basis of this interaction is still not known. By using multiple homology models and an un biased docking protocol, we identified a binding hypothesis for the diazepam-bound structure of the benzodiazepine site, which was confirmed by experimental evidence. Moreover, two independent virtual screening approaches based on this structure identified known benzodiazepine-site ligands from different structural classes and predicted potential new ligands for this site. Receptor-binding assays and electrophysiological studies on recombinant receptors confirmed these predictions and thus identified new chemotypes for the benzodiazepine-binding site. Our results support the validity of the diazepam-bound structure of the benzodiazepine-binding pocket, demonstrate its suitability for drug discovery and pave the way for structure-based drug design. PMID:22446838

  19. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.


    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  20. ATP and AMP mutually influence their interaction with the ATP-binding cassette (ABC) adenylate kinase cystic fibrosis transmembrane conductance regulator (CFTR) at separate binding sites.


    Randak, Christoph O; Dong, Qian; Ver Heul, Amanda R; Elcock, Adrian H; Welsh, Michael J


    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP &lrarr2; 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5'-triphosphate (8-N3-ATP) and 8-azidoadenosine 5'-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P(1),P(5)-di(adenosine-5') pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  1. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    SciTech Connect

    Biegon, A.; Rainbow, T.C.


    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea that high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.

  2. How the mongoose can fight the snake: the binding site of the mongoose acetylcholine receptor.

    PubMed Central

    Barchan, D; Kachalsky, S; Neumann, D; Vogel, Z; Ovadia, M; Kochva, E; Fuchs, S


    The ligand binding site of the nicotinic acetylcholine receptor (AcChoR) is within a short peptide from the alpha subunit that includes the tandem cysteine residues at positions 192 and 193. To elucidate the molecular basis of the binding properties of the AcChoR, we chose to study nonclassical muscle AcChoRs from animals that are resistant to alpha-neurotoxins. We have previously reported that the resistance of snake AcChoR to alpha-bungarotoxin (alpha-BTX) may be accounted for by several major substitutions in the ligand binding site of the receptor. In the present study, we have analyzed the binding site of AcChoR from the mongoose, which is also resistant to alpha-neurotoxins. It was shown that mongoose AcChoR does not bind alpha-BTX in vivo or in vitro. cDNA fragments of the alpha subunit of mongoose AcChoR corresponding to codons 122-205 and including the presumed ligand binding site were cloned, sequenced, and expressed in Escherichia coli. The expressed protein fragments of the mongoose, as well as of snake receptors, do not bind alpha-BTX. The mongoose fragment is highly homologous (greater than 90%) to the respective mouse fragment. Out of the seven amino acid differences between the mongoose and mouse in this region, five cluster in the presumed ligand binding site, close to cysteines 192 and 193. These changes are at positions 187 (Trp----Asn), 189 (Phe----Thr), 191 (Ser----Ala), 194 (Pro----Leu), and 197 (Pro----His). The mongoose like the snake AcChoR has a potential glycosylation site in the binding site domain. Sequence comparison between species suggests that substitutions at positions 187, 189, and 194 are important in determining the resistance of mongoose and snake AcChoR to alpha-BTX. In addition, it was shown that amino acid residues that had been reported to be necessary for acetylcholine binding are conserved in the toxin-resistant animals as well. Images PMID:1380164

  3. How the mongoose can fight the snake: the binding site of the mongoose acetylcholine receptor.


    Barchan, D; Kachalsky, S; Neumann, D; Vogel, Z; Ovadia, M; Kochva, E; Fuchs, S


    The ligand binding site of the nicotinic acetylcholine receptor (AcChoR) is within a short peptide from the alpha subunit that includes the tandem cysteine residues at positions 192 and 193. To elucidate the molecular basis of the binding properties of the AcChoR, we chose to study nonclassical muscle AcChoRs from animals that are resistant to alpha-neurotoxins. We have previously reported that the resistance of snake AcChoR to alpha-bungarotoxin (alpha-BTX) may be accounted for by several major substitutions in the ligand binding site of the receptor. In the present study, we have analyzed the binding site of AcChoR from the mongoose, which is also resistant to alpha-neurotoxins. It was shown that mongoose AcChoR does not bind alpha-BTX in vivo or in vitro. cDNA fragments of the alpha subunit of mongoose AcChoR corresponding to codons 122-205 and including the presumed ligand binding site were cloned, sequenced, and expressed in Escherichia coli. The expressed protein fragments of the mongoose, as well as of snake receptors, do not bind alpha-BTX. The mongoose fragment is highly homologous (greater than 90%) to the respective mouse fragment. Out of the seven amino acid differences between the mongoose and mouse in this region, five cluster in the presumed ligand binding site, close to cysteines 192 and 193. These changes are at positions 187 (Trp----Asn), 189 (Phe----Thr), 191 (Ser----Ala), 194 (Pro----Leu), and 197 (Pro----His). The mongoose like the snake AcChoR has a potential glycosylation site in the binding site domain. Sequence comparison between species suggests that substitutions at positions 187, 189, and 194 are important in determining the resistance of mongoose and snake AcChoR to alpha-BTX. In addition, it was shown that amino acid residues that had been reported to be necessary for acetylcholine binding are conserved in the toxin-resistant animals as well. PMID:1380164

  4. Mercury Binding Sites in Thiol-Functionalized Mesostructured Silica

    SciTech Connect

    Billinge, Simon J.L.; McKimmey, Emily J.; Shatnawi, Mouath; Kim, HyunJeong; Petkov, Valeri; Wermeille, Didier; Pinnavaia, Thomas J.


    Thiol-functionalized mesostructured silica with anhydrous compositions of (SiO{sub 2}){sub 1-x}(LSiO{sub 1.5}){sub x}, where L is a mercaptopropyl group and x is the fraction of functionalized framework silicon centers, are effective trapping agents for the removal of mercuric(II) ions from water. In the present work, we investigate the mercury-binding mechanism for representative thiol-functionalized mesostructures by atomic pair distribution function (PDF) analysis of synchrotron X-ray powder diffraction data and by Raman spectroscopy. The mesostructures with wormhole framework structures and compositions corresponding to x = 0.30 and 0.50 were prepared by direct assembly methods in the presence of a structure-directing amine porogen. PDF analyses of five mercury-loaded compositions with Hg/S ratios of 0.50-1.30 provided evidence for the bridging of thiolate sulfur atoms to two metal ion centers and the formation of chain structures on the pore surfaces. We find no evidence for Hg-O bonds and can rule out oxygen coordination of the mercury at greater than the 10% level. The relative intensities of the PDF peaks corresponding to Hg-S and Hg-Hg atomic pairs indicate that the mercury centers cluster on the functionalized surfaces by virtue of thiolate bridging, regardless of the overall mercury loading. However, the Raman results indicate that the complexation of mercury centers by thiolate depends on the mercury loading. At low mercury loadings (Hg/S {le} 0.5), the dominant species is an electrically neutral complex in which mercury most likely is tetrahedrally coordinated to bridging thiolate ligands, as in Hg(SBu{sup t}){sub 2}. At higher loadings (Hg/S 1.0-1.3), mercury complex cations predominate, as evidenced by the presence of charge-balancing anions (nitrate) on the surface. This cationic form of bound mercury is assigned a linear coordination to two bridging thiolate ligands.

  5. Identification of the target binding site of ethanolamine-binding aptamers and its exploitation for ethanolamine detection.


    Heilkenbrinker, Alexandra; Reinemann, Christine; Stoltenburg, Regina; Walter, Johanna-Gabriela; Jochums, André; Stahl, Frank; Zimmermann, Stefan; Strehlitz, Beate; Scheper, Thomas


    Aptamers are promising recognition elements for sensitive and specific detection of small molecules. We have previously selected ssDNA aptamers for ethanolamine, one of the smallest aptamer targets so far. The work presented here focuses on the determination of the binding region within the aptamer structure and its exploitation for the development of an aptamer-based assay for detection of ethanolamine. Sequence analysis of the aptamers resulted in the identification of a G-rich consensus sequence, which was able to fold in a typical two- or three-layered G-quartet structure. Experiments with stepwise truncated variants of the aptamers revealed that the consensus sequence is responsible and sufficient for binding to the target. On the basis of the knowledge of the aptamers binding site, we developed an aptamer-based microarray assay relying on competition between ethanolamine and an oligonucleotide complementary to the consensus sequence. Competitive binding of ethanolamine and fluorescently labeled complementary oligonucleotides resulted in fluorescence intensities dependent on ethanolamine concentration with a limit of detection of 10 pM. This method enables detection of small molecules without any labeling of analytes. The competitive assay could potentially be transferred to other aptamers and thus provides a promising system for aptamer-based detection of diverse small molecules. PMID:25435319

  6. Solubilization and characterization of guanine nucleotide-sensitive muscarinic agonist binding sites from rat myocardium.

    PubMed Central

    Berrie, C. P.; Birdsall, N. J.; Hulme, E. C.; Keen, M.; Stockton, J. M.


    Muscarinic receptors from rat myocardial membranes may be solubilized by digitonin in good yield at low temperatures in the presence of Mg2+. Under these conditions, up to 60% of the soluble receptors show high affinity binding for the potent agonist [3H]-oxotremorine-M (KA = 10(9)M-1), which is inhibited by 5'-guanylylimidodiphosphate. The muscarinic binding site labelled with [3H]-oxotremorine-M has a higher sedimentation coefficient (13.4 s) than sites labelled with a 3H antagonist in the presence of guanylylimidodiphosphate (11.6 s) and probably represents a complex between the ligand binding subunit of the receptor and a guanine nucleotide binding protein. PMID:6478115

  7. Crystallographic characterization of the ribosomal binding site and molecular mechanism of action of Hygromycin A

    PubMed Central

    Kaminishi, Tatsuya; Schedlbauer, Andreas; Fabbretti, Attilio; Brandi, Letizia; Ochoa-Lizarralde, Borja; He, Cheng-Guang; Milón, Pohl; Connell, Sean R.; Gualerzi, Claudio O.; Fucini, Paola


    Hygromycin A (HygA) binds to the large ribosomal subunit and inhibits its peptidyl transferase (PT) activity. The presented structural and biochemical data indicate that HygA does not interfere with the initial binding of aminoacyl-tRNA to the A site, but prevents its subsequent adjustment such that it fails to act as a substrate in the PT reaction. Structurally we demonstrate that HygA binds within the peptidyl transferase center (PTC) and induces a unique conformation. Specifically in its ribosomal binding site HygA would overlap and clash with aminoacyl-A76 ribose moiety and, therefore, its primary mode of action involves sterically restricting access of the incoming aminoacyl-tRNA to the PTC. PMID:26464437

  8. Effects of sodium on cell surface and intracellular TH-naloxone binding sites

    SciTech Connect

    Pollack, A.E.; Wooten, G.F.


    The binding of the opiate antagonist TH-naloxone was examined in rat whole brain homogenates and in crude subcellular fractions of these homogenates (nuclear, synaptosomal, and mitochondrial fractions) using buffers that approximated intra- (low sodium concentration) and extracellular (high sodium concentration) fluids. Saturation studies showed a two-fold decrease in the dissociation constant (Kd) in all subcellular fractions examined in extracellular buffer compared to intracellular buffer. In contrast, there was no significant effect of the buffers on the Bmax. Thus, TH-naloxone did not distinguish between binding sites present on cell surface and intracellular tissues in these two buffers. These results show that the sodium effect of opiate antagonist binding is probably not a function of altered selection of intra- and extracellular binding sites. 17 references, 2 tables.

  9. The X-ray Structure of a BAK Homodimer Reveals an Inhibitory Zinc Binding Site

    SciTech Connect

    Modoveanu,T.; Liu, Q.; Tocilj, A.; Watson, M.; Shore, G.; Gehring, K.


    BAK/BAX-mediated mitochondrial outer-membrane permeabilization (MOMP) drives cell death during development and tissue homeostasis from zebrafish to humans. In most cancers, this pathway is inhibited by BCL-2 family antiapoptotic members, which bind and block the action of proapoptotic BCL proteins. We report the 1.5 {angstrom} crystal structure of calpain-proteolysed BAK, cBAK, to reveal a zinc binding site that regulates its activity via homodimerization. cBAK contains an occluded BH3 peptide binding pocket that binds a BID BH3 peptide only weakly . Nonetheless, cBAK requires activation by truncated BID to induce cytochrome c release in mitochondria isolated from bak/bax double-knockout mouse embryonic fibroblasts. The BAK-mediated MOMP is inhibited by low micromolar zinc levels. This inhibition is alleviated by mutation of the zinc-coordination site in BAK. Our results link directly the antiapoptotic effects of zinc to BAK.

  10. Statistical Mechanics of Transcription-Factor Binding Site Discovery Using Hidden Markov Models

    PubMed Central

    Mehta, Pankaj; Schwab, David J.; Sengupta, Anirvan M.


    Hidden Markov Models (HMMs) are a commonly used tool for inference of transcription factor (TF) binding sites from DNA sequence data. We exploit the mathematical equivalence between HMMs for TF binding and the “inverse” statistical mechanics of hard rods in a one-dimensional disordered potential to investigate learning in HMMs. We derive analytic expressions for the Fisher information, a commonly employed measure of confidence in learned parameters, in the biologically relevant limit where the density of binding sites is low. We then use techniques from statistical mechanics to derive a scaling principle relating the specificity (binding energy) of a TF to the minimum amount of training data necessary to learn it. PMID:22851788

  11. The Adenovirus Type 3 Dodecahedron's RGD Loop Comprises an HSPG Binding Site That Influences Integrin Binding

    PubMed Central

    Gout, E.; Schoehn, G.; Fenel, D.; Lortat-Jacob, H.; Fender, P.


    Human type 3 adenovirus dodecahedron (a virus like particle made of twelve penton bases) features the ability to enter cells through Heparan Sulphate Proteoglycans (HSPGs) and integrins interaction and is used as a versatile vector to deliver DNA or proteins. Cryo-EM reconstruction of the pseudoviral particle with Heparan Sulphate (HS) oligosaccharide shows an extradensity on the RGD loop. A set of mutants was designed to study the respective roles of the RGD sequence (RGE mutant) and of a basic sequence located just downstream. Results showed that the RGE mutant binding to the HS deficient CHO-2241 cells was abolished and unexpectedly, mutation of the basic sequence (KQKR to AQAS) dramatically decreased integrin recognition by the viral pseudoparticle. This basic sequence is thus involved in integrin docking, showing a close interplay between HSPGs and integrin receptors. PMID:20224646

  12. A new class of mutations reveals a novel function for the original phosphatidylinositol 3-kinase binding site

    PubMed Central

    Hong, Y. Kate; Mikami, Aki; Schaffhausen, Brian; Jun, Toni; Roberts, Thomas M.


    Previous studies have demonstrated that the specificity of Src homology 2 (SH2) and phosphotyrosine-binding domain interactions are mediated by phosphorylated tyrosines and their neighboring amino acids. Two of the first phosphotyrosine-based binding sites were found on middle T antigen of polyoma virus. Tyr-250 acts as a binding site for ShcA, whereas Tyr-315 forms a binding site for the SH2 domain of the p85 subunit of phosphatidylinositol 3-kinase. However, genetic analysis of a given phosphotyrosine's role in signaling can be complicated when it serves as a binding site for multiple proteins. The situation is particularly difficult when the phosphotyrosine serves as a secondary binding site for a protein with primary binding determinates elsewhere. Mutation of a tyrosine residue to phenylalanine blocks association of all bound proteins. Here we show that the mutation of the amino acids following the phosphorylated tyrosine to alanine can reveal phosphotyrosine function as a secondary binding site, while abrogating the phosphotyrosine motif's role as a primary binding site for SH2 domains. We tested this methodology by using middle T antigen. Our results suggest that Tyr-250 is a secondary binding site for phosphatidylinositol 3-kinase, whereas Tyr-315 is a secondary binding site for a yet-to-be-identified protein, which is critical for transformation. PMID:12881485

  13. Zinc-induced oligomerization of zinc α2 glycoprotein reveals multiple fatty acid-binding sites.


    Zahid, Henna; Miah, Layeque; Lau, Andy M; Brochard, Lea; Hati, Debolina; Bui, Tam T T; Drake, Alex F; Gor, Jayesh; Perkins, Stephen J; McDermott, Lindsay C


    Zinc α2 glycoprotein (ZAG) is an adipokine with a class I MHC protein fold and is associated with obesity and diabetes. Although its intrinsic ligand remains unknown, ZAG binds the dansylated C11 fatty acid 11-(dansylamino)undecanoic acid (DAUDA) in the groove between the α1 and α2 domains. The surface of ZAG has approximately 15 weak zinc-binding sites deemed responsible for precipitation from human plasma. In the present study the functional significance of these metal sites was investigated. Analytical ultracentrifugation (AUC) and CD showed that zinc, but not other divalent metals, causes ZAG to oligomerize in solution. Thus ZAG dimers and trimers were observed in the presence of 1 and 2 mM zinc. Molecular modelling of X-ray scattering curves and sedimentation coefficients indicated a progressive stacking of ZAG monomers, suggesting that the ZAG groove may be occluded in these. Using fluorescence-detected sedimentation velocity, these ZAG-zinc oligomers were again observed in the presence of the fluorescent boron dipyrromethene fatty acid C16-BODIPY (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid). Fluorescence spectroscopy confirmed that ZAG binds C16-BODIPY. ZAG binding to C16-BODIPY, but not to DAUDA, was reduced by increased zinc concentrations. We conclude that the lipid-binding groove in ZAG contains at least two distinct fatty acid-binding sites for DAUDA and C16-BODIPY, similar to the multiple lipid binding seen in the structurally related immune protein CD1c. In addition, because high concentrations of zinc occur in the pancreas, the perturbation of these multiple lipid-binding sites by zinc may be significant in Type 2 diabetes where dysregulation of ZAG and zinc homoeostasis occurs. PMID:26487699

  14. Functional Identification of Catalytic Metal Ion Binding Sites within RNA

    PubMed Central


    The viability of living systems depends inextricably on enzymes that catalyze phosphoryl transfer reactions. For many enzymes in this class, including several ribozymes, divalent metal ions serve as obligate cofactors. Understanding how metal ions mediate catalysis requires elucidation of metal ion interactions with both the enzyme and the substrate(s). In the Tetrahymena group I intron, previous work using atomic mutagenesis and quantitative analysis of metal ion rescue behavior identified three metal ions (MA, MB, and MC) that make five interactions with the ribozyme substrates in the reaction's transition state. Here, we combine substrate atomic mutagenesis with site-specific phosphorothioate substitutions in the ribozyme backbone to develop a powerful, general strategy for defining the ligands of catalytic metal ions within RNA. In applying this strategy to the Tetrahymena group I intron, we have identified the pro-SP phosphoryl oxygen at nucleotide C262 as a ribozyme ligand for MC. Our findings establish a direct connection between the ribozyme core and the functionally defined model of the chemical transition state, thereby extending the known set of transition-state interactions and providing information critical for the application of the recent group I intron crystallographic structures to the understanding of catalysis. PMID:16092891

  15. Localization of the binding site of tissue-type plasminogen activator to fibrin.

    PubMed Central

    Ichinose, A; Takio, K; Fujikawa, K


    Functionally active A and B chains were separated from a two-chain form of recombinant tissue-type plasminogen activator after mild reduction and alkylation. The A chain was found to be responsible for the binding to lysine-Sepharose or fibrin and the B chain contained the catalytic activity of tissue-type plasminogen activator. An extensive reduction of two-chain tissue-type plasminogen activator, however, destroyed both the binding and catalytic activities. A thermolytic fragment, Fr. 1, of tissue-type plasminogen activator that contained a growth factor and two kringle segments retained its lysine binding activity. Additional thermolytic cleavages in the kringle-2 segment of Fr. 1 caused a total loss of the binding activity. These results indicated that the binding site of tissue-type plasminogen activator to fibrin was located in the kringle-2 segment. Images PMID:3088041

  16. LISE: a server using ligand-interacting and site-enriched protein triangles for prediction of ligand-binding sites.


    Xie, Zhong-Ru; Liu, Chuan-Kun; Hsiao, Fang-Chih; Yao, Adam; Hwang, Ming-Jing


    LISE is a web server for a novel method for predicting small molecule binding sites on proteins. It differs from a number of servers currently available for such predictions in two aspects. First, rather than relying on knowledge of similar protein structures, identification of surface cavities or estimation of binding energy, LISE computes a score by counting geometric motifs extracted from sub-structures of interaction networks connecting protein and ligand atoms. These network motifs take into account spatial and physicochemical properties of ligand-interacting protein surface atoms. Second, LISE has now been more thoroughly tested, as, in addition to the evaluation we previously reported using two commonly used small benchmark test sets and targets of two community-based experiments on ligand-binding site predictions, we now report an evaluation using a large non-redundant data set containing >2000 protein-ligand complexes. This unprecedented test, the largest ever reported to our knowledge, demonstrates LISE's overall accuracy and robustness. Furthermore, we have identified some hard to predict protein classes and provided an estimate of the performance that can be expected from a state-of-the-art binding site prediction server, such as LISE, on a proteome scale. The server is freely available at PMID:23609546

  17. Molecular docking characterizes substrate-binding sites and efflux modulation mechanisms within P-glycoprotein.


    Ferreira, Ricardo J; Ferreira, Maria-José U; dos Santos, Daniel J V A


    P-Glycoprotein (Pgp) is one of the best characterized ABC transporters, often involved in the multidrug-resistance phenotype overexpressed by several cancer cell lines. Experimental studies contributed to important knowledge concerning substrate polyspecificity, efflux mechanism, and drug-binding sites. This information is, however, scattered through different perspectives, not existing a unifying model for the knowledge available for this transporter. Using a previously refined structure of murine Pgp, three putative drug-binding sites were hereby characterized by means of molecular docking. The modulator site (M-site) is characterized by cross interactions between both Pgp halves herein defined for the first time, having an important role in impairing conformational changes leading to substrate efflux. Two other binding sites, located next to the inner leaflet of the lipid bilayer, were identified as the substrate-binding H and R sites by matching docking and experimental results. A new classification model with the ability to discriminate substrates from modulators is also proposed, integrating a vast number of theoretical and experimental data. PMID:23802684

  18. Control of Ion Selectivity in LeuT: Two Na+ Binding Sites with two different mechanisms

    PubMed Central

    Noskov, Sergei Y.; Roux, Benoît


    The x-ray structure of LeuT, a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporter, provides a great opportunity to better understand the molecular basis of monovalent cation selectivity in ion-coupled transporters. LeuT possesses two ion-binding sites, NA1 and NA2, which are highly selective for Na+. Extensive all-atom free energy molecular dynamics simulations of LeuT embedded in an explicit membrane are performed at different temperatures and various occupancy states of the binding sites to dissect the molecular mechanism of ion selectivity. The results show that the two binding sites display robust selectivity for Na+ over K+ or Li+, the competing ions of most similar radii. Of particular interest, the mechanism primarily responsible for selectivity for each of the two binding sites appears to be different. In site NA1, selectivity for Na+ over K+ arises predominantly from the strong electrostatic field arising from the negatively charged carboxylate group of the leucine substrate coordinating the ion directly. In site NA2, which comprises only neutral ligands, selectivity for Na+ is enforced by the local structural restraints arising from the hydrogen-bonding network and the covalent connectivity of the poly-peptide chain surrounding the ion according to a snug-fit mechanism. PMID:18280500

  19. Ultrafast ligand binding dynamics in the active site of native bacterial nitric oxide reductase.


    Kapetanaki, Sofia M; Field, Sarah J; Hughes, Ross J L; Watmough, Nicholas J; Liebl, Ursula; Vos, Marten H


    The active site of nitric oxide reductase from Paracoccus denitrificans contains heme and non-heme iron and is evolutionarily related to heme-copper oxidases. The CO and NO dynamics in the active site were investigated using ultrafast transient absorption spectroscopy. We find that, upon photodissociation from the active site heme, 20% of the CO rebinds in 170 ps, suggesting that not all the CO transiently binds to the non-heme iron. The remaining 80% does not rebind within 4 ns and likely migrates out of the active site without transient binding to the non-heme iron. Rebinding of NO to ferrous heme takes place in approximately 13 ps. Our results reveal that heme-ligand recombination in this enzyme is considerably faster than in heme-copper oxidases and are consistent with a more confined configuration of the active site. PMID:18420024

  20. Purification, molecular cloning, and expression of the mammalian sigma1-binding site.

    PubMed Central

    Hanner, M; Moebius, F F; Flandorfer, A; Knaus, H G; Striessnig, J; Kempner, E; Glossmann, H


    Sigma-ligands comprise several chemically unrelated drugs such as haloperidol, pentazocine, and ditolylguanidine, which bind to a family of low molecular mass proteins in the endoplasmic reticulum. These so-called sigma-receptors are believed to mediate various pharmacological effects of sigma-ligands by as yet unknown mechanisms. Based on their opposite enantioselectivity for benzomorphans and different molecular masses, two subtypes are differentiated. We purified the sigma1-binding site as a single 30-kDa protein from guinea pig liver employing the benzomorphan(+)[3H]pentazocine and the arylazide (-)[3H]azidopamil as specific probes. The purified (+)[3H]pentazocine-binding protein retained its high affinity for haloperidol, pentazocine, and ditolylguanidine. Partial amino acid sequence obtained after trypsinolysis revealed no homology to known proteins. Radiation inactivation of the pentazocine-labeled sigma1-binding site yielded a molecular mass of 24 +/- 2 kDa. The corresponding cDNA was cloned using degenerate oligonucleotides and cDNA library screening. Its open reading frame encoded a 25.3-kDa protein with at least one putative transmembrane segment. The protein expressed in yeast cells transformed with the cDNA showed the pharmacological characteristics of the brain and liver sigma1-binding site. The deduced amino acid sequence was structurally unrelated to known mammalian proteins but it shared homology with fungal proteins involved in sterol synthesis. Northern blots showed high densities of the sigma1-binding site mRNA in sterol-producing tissues. This is also in agreement with the known ability of sigma1-binding sites to interact with steroids, such as progesterone. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8755605

  1. Anatomy of protein pockets and cavities: measurement of binding site geometry and implications for ligand design.

    PubMed Central

    Liang, J.; Edelsbrunner, H.; Woodward, C.


    Identification and size characterization of surface pockets and occluded cavities are initial steps in protein structure-based ligand design. A new program, CAST, for automatically locating and measuring protein pockets and cavities, is based on precise computational geometry methods, including alpha shape and discrete flow theory. CAST identifies and measures pockets and pocket mouth openings, as well as cavities. The program specifies the atoms lining pockets, pocket openings, and buried cavities; the volume and area of pockets and cavities; and the area and circumference of mouth openings. CAST analysis of over 100 proteins has been carried out; proteins examined include a set of 51 monomeric enzyme-ligand structures, several elastase-inhibitor complexes, the FK506 binding protein, 30 HIV-1 protease-inhibitor complexes, and a number of small and large protein inhibitors. Medium-sized globular proteins typically have 10-20 pockets/cavities. Most often, binding sites are pockets with 1-2 mouth openings; much less frequently they are cavities. Ligand binding pockets vary widely in size, most within the range 10(2)-10(3)A3. Statistical analysis reveals that the number of pockets and cavities is correlated with protein size, but there is no correlation between the size of the protein and the size of binding sites. Most frequently, the largest pocket/cavity is the active site, but there are a number of instructive exceptions. Ligand volume and binding site volume are somewhat correlated when binding site volume is < or =700 A3, but the ligand seldom occupies the entire site. Auxiliary pockets near the active site have been suggested as additional binding surface for designed ligands (Mattos C et al., 1994, Nat Struct Biol 1:55-58). Analysis of elastase-inhibitor complexes suggests that CAST can identify ancillary pockets suitable for recruitment in ligand design strategies. Analysis of the FK506 binding protein, and of compounds developed in SAR by NMR (Shuker SB et

  2. Rational design of a protein that binds integrin αvβ3 outside the ligand binding site

    PubMed Central

    Turaga, Ravi Chakra; Yin, Lu; Yang, Jenny J.; Lee, Hsiauwei; Ivanov, Ivaylo; Yan, Chunli; Yang, Hua; Grossniklaus, Hans E.; Wang, Siming; Ma, Cheng; Sun, Li; Liu, Zhi-Ren


    Integrin αvβ3 expression is altered in various diseases and has been proposed as a drug target. Here we use a rational design approach to develop a therapeutic protein, which we call ProAgio, that binds to integrin αvβ3 outside the classical ligand-binding site. We show ProAgio induces apoptosis of integrin αvβ3-expressing cells by recruiting and activating caspase 8 to the cytoplasmic domain of integrin αvβ3. ProAgio also has anti-angiogenic activity and strongly inhibits growth of tumour xenografts, but does not affect the established vasculature. Toxicity analyses demonstrate that ProAgio is not toxic to mice. Our study reports a new integrin-targeting agent with a unique mechanism of action, and provides a template for the development of integrin-targeting therapeutics. PMID:27241473

  3. Rational design of a protein that binds integrin αvβ3 outside the ligand binding site.


    Turaga, Ravi Chakra; Yin, Lu; Yang, Jenny J; Lee, Hsiauwei; Ivanov, Ivaylo; Yan, Chunli; Yang, Hua; Grossniklaus, Hans E; Wang, Siming; Ma, Cheng; Sun, Li; Liu, Zhi-Ren


    Integrin αvβ3 expression is altered in various diseases and has been proposed as a drug target. Here we use a rational design approach to develop a therapeutic protein, which we call ProAgio, that binds to integrin αvβ3 outside the classical ligand-binding site. We show ProAgio induces apoptosis of integrin αvβ3-expressing cells by recruiting and activating caspase 8 to the cytoplasmic domain of integrin αvβ3. ProAgio also has anti-angiogenic activity and strongly inhibits growth of tumour xenografts, but does not affect the established vasculature. Toxicity analyses demonstrate that ProAgio is not toxic to mice. Our study reports a new integrin-targeting agent with a unique mechanism of action, and provides a template for the development of integrin-targeting therapeutics. PMID:27241473

  4. Binding of cGMP to both allosteric sites of cGMP-binding cGMP-specific phosphodiesterase (PDE5) is required for its phosphorylation.

    PubMed Central

    Turko, I V; Francis, S H; Corbin, J D


    cGMP-binding phosphodiesterases contain two homologous allosteric cGMP-binding sites (sites a and b) that are arranged in tandem; they constitute a superfamily of mammalian cyclic nucleotide receptors distinct from the cyclic nucleotide-dependent protein kinases/cation channels family. The functional role of each of these two sites in the phosphodiesterases is not known. The cGMP-binding sites of one of these phosphodiesterases, the cGMP-binding cGMP-specific phosphodiesterase (cGB-PDE, PDE5), have been analysed by using site-directed mutagenesis. Mutations that affect cGMP binding to either one or both allosteric sites do not influence cGMP hydrolysis in the catalytic site under the conditions used. However, compared with wild-type enzyme, the D289A, D478A and D289A/D478A mutants, which are defective in cGMP binding to either site a or site b, or both allosteric sites, require much higher cGMP concentrations for the allosteric stimulation of phosphorylation by the catalytic subunit of cAMP-dependent protein kinase. The cGMP effect is on the cGB-PDE rather than on the catalytic subunit of the protein kinase because the latter enzyme does not require cGMP for activity. The D289N mutant, which has higher binding affinity for cGMP than does the wild-type enzyme, is phosphorylated at lower concentrations of cGMP than is the wild-type enzyme. It is concluded that cGMP binding to the allosteric sites of cGB-PDE does not directly affect catalysis, but binding to both of these sites regulates phosphorylation of this enzyme. PMID:9445376

  5. The second metal-binding site of 70 kDa heat-shock protein is essential for ADP binding, ATP hydrolysis and ATP synthesis.

    PubMed Central

    Wu, Xueji; Yano, Mihiro; Washida, Hiroyo; Kido, Hiroshi


    The chaperone activity of Hsp70 (70 kDa heat-shock protein) in protein folding and its conformational switch, including oligomeric and monomeric interconversion, are regulated by the hydrolysis of ATP and the ATP-ADP exchange cycle. The crystal structure of human ATPase domain shows two metal-binding sites, the first for ATP binding and a second, in close proximity to the first, whose function remains unknown [Sriram, Osipiuk, Freeman, Morimoto and Joachimiak (1997) Structure 5, 403-414]. In this study, we have characterized the second metal-binding motif by site-directed mutagenesis and the kinetics of ATP and ADP binding, and found that the second metal-binding site, comprising a loop co-ordinated by His-227, Glu-231 and Asp-232, participates both in ATP hydrolysis and ATP-synthetic activities, in co-operation with the first metal-binding site. The first metal-binding site, a catalytic centre, is essential for ATP binding and the second site for ADP binding in the reactions of ATP hydrolysis and ATP synthesis. PMID:14664695

  6. Radioiodinated rat parathyroid hormone-(1-34) binds to its receptor on rat osteosarcoma cells in a manner consistent with two classes of binding sites

    SciTech Connect

    Seitz, P.K.; Nickols, G.A.; Nickols, M.A.; McPherson, M.B.; Cooper, C.W. )


    Binding of 125I-labeled rat (r) PTH-(1-34) to ROS 17/2.8 osteoblastic bone cells and to membranes from these cells was examined. Competitive binding inhibition experiments were performed using unlabeled rPTH-(1-34) with particular emphasis on concentrations of peptide below 1 nM. In intact cells, binding of labeled rPTH-(1-34) was highly specific, and inhibition of binding by unlabeled ligand suggested the presence of two classes of binding sites, one with high affinity and low capacity (KD = 40 pM, approximately 20% of total binding sites) and the other with lower affinity and high capacity (KD = 2 nM, approximately 80% of the sites). Membranes prepared from ROS cells also exhibited a pattern of binding from competitive inhibition curves consistent with two distinct binding sites (KD = 30 pM and 6 nM). In intact ROS cells, cellular cAMP levels increased over the range of 10(-11)-10(-9) M rPTH-(1-34) with an ED50 intermediate between the two KD values (0.25 nM). These data suggest that osteoblastic bone cells possess two distinct classes of membrane receptors for PTH. Since the KD of the higher affinity site more closely approximates circulating concentrations of PTH, binding to this site may have physiologic relevance.

  7. Screening of raw coffee for thiol binding site precursors using "in bean" model roasting experiments.


    Müller, Christoph; Hofmann, Thomas


    The purpose of the following study was to investigate the influence of coffee roasting on the thiol-binding activity of coffee beverages, and to investigate the potential of various green bean compounds as precursors of thiol-binding sites by using promising "in bean" model roast experiments. Headspace gas chromatographic analysis on coffee brews incubated in the presence of the roasty-sulfury smelling 2-furfurylthiol for 20 min at 30 degrees C in septum-closed vessels revealed that the amounts of "free" thiol decreased drastically with increasing the roasting degree of the beans used for preparation of the brews. A half-maximal binding capacity (BC(50)) of 183 mg of 2-furfurylthiol per liter of standard coffee beverage was determined for a roasted coffee (CTN value of 67), thus demonstrating that enormous amounts of the odor-active thiol are "bound" by the coffee. Furthermore, biomimetic "in bean" precursor experiments have been performed in order to elucidate the precursor for the thiol-binding sites in the raw coffee bean. These experiments opened the possibility of studying coffee model reactions under quasi-natural roasting conditions and undoubtedly identified chlorogenic acids as well as thermal degradation products caffeic acid and quinic acid as important precursors for low-molecular-weight thiol-binding sites. In particular, when roasted in the presence of transition metal ions, chlorogenic acids and even more caffeic acid showed thiol-binding activity which was comparable to the activity measured for the authentic coffee brew. PMID:15796603

  8. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    SciTech Connect

    Shima, K.; Kitayama, S.; Nakano, R.


    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3 beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.

  9. Marked reduction in the number of platelet-tritiated imipramine binding sites in geriatric depression

    SciTech Connect

    Nemeroff, C.B.; Knight, D.L.; Krishnan, R.R.; Slotkin, T.A.; Bissette, G.; Melville, M.L.; Blazer, D.G.


    The number (Bmax) and affinity (Kd) of platelet-tritiated imipramine binding sites was determined in young and middle-aged controls 50 years of age and younger (n = 25), elderly normal controls over 60 years of age (n = 18), patients who fulfilled DSM-III criteria for major depression who were under 50 years of age (n = 29), patients who fulfilled DSM-III criteria for major depression who were 60 years of age and older (n = 19), and patients who fulfilled both DSM-III criteria for primary degenerative dementia and National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association criteria for probable Alzheimer's disease (n = 13). Both groups of depressed patients (under 50 and over 60 years of age) exhibited significant reductions (decreases 42%) in the number of platelet-tritiated imipramine binding sites with no change in affinity, when compared with their age-matched controls. There was little overlap in Bmax values between the elderly depressed patients and their controls. The patients with probable Alzheimer's disease showed no alteration in platelet-tritiated imipramine binding. There was no statistically significant relationship between postdexamethasone plasma cortisol concentrations and tritiated imipramine binding. These results indicate that platelet-tritiated imipramine binding may have potential utility as a diagnostic adjunct in geriatric depression, and moreover that the reduction in the number of platelet-tritiated imipramine binding sites is not due to hypercortisolemia.

  10. Substrate Binding and Active Site Residues in RNases E and G

    PubMed Central

    Garrey, Stephen M.; Blech, Michaela; Riffell, Jenna L.; Hankins, Janet S.; Stickney, Leigh M.; Diver, Melinda; Hsu, Ying-Han Roger; Kunanithy, Vitharani; Mackie, George A.


    The paralogous endoribonucleases, RNase E and RNase G, play major roles in intracellular RNA metabolism in Escherichia coli and related organisms. To assay the relative importance of the principal RNA binding sites identified by crystallographic analysis, we introduced mutations into the 5′-sensor, the S1 domain, and the Mg+2/Mn+2 binding sites. The effect of such mutations has been measured by assays of activity on several substrates as well as by an assay of RNA binding. RNase E R169Q and the equivalent mutation in RNase G (R171Q) exhibit the strongest reductions in both activity (the kcat decrease ∼40- to 100-fold) and RNA binding consistent with a key role for the 5′-sensor. Our analysis also supports a model in which the binding of substrate results in an increase in catalytic efficiency. Although the phosphate sensor plays a key role in vitro, it is unexpectedly dispensable in vivo. A strain expressing only RNase E R169Q as the sole source of RNase E activity is viable, exhibits a modest reduction in doubling time and colony size, and accumulates immature 5 S rRNA. Our results point to the importance of alternative RNA binding sites in RNase E and to alternative pathways of RNA recognition. PMID:19778900

  11. High-affinity binding sites involved in the import of porin into mitochondria.

    PubMed Central

    Pfaller, R; Neupert, W


    The specific recognition by mitochondria of the precursor of porin and the insertion into the outer membrane were studied with a radiolabeled water-soluble form of porin derived from the mature protein. High-affinity binding sites had a number of 5-10 pmol/mg mitochondrial protein and a ka of 1-5 X 10(8) M-1. Binding was abolished after trypsin pretreatment of mitochondria indicating that binding sites were of protein-aceous nature. Specifically bound porin could be extracted at alkaline pH but not by high salt and was protected against low concentrations of proteinase K. It could be chased to a highly protease resistant form corresponding to mature porin. High-affinity binding sites could be extracted from mitochondria with detergent and reconstituted in asolectin-ergosterol liposomes. Water-soluble porin competed for the specific binding and import of the precursor of the ADP/ATP carrier, an inner membrane protein. We suggest that (i) binding of precursors to proteinaceous receptors serves as an initial step for recognition, (ii) the receptor for porin may also be involved in the import of precursors of inner membrane proteins, and (iii) interaction with the receptor triggers partial insertion of the precursor into the outer membrane. Images Fig. 4. PMID:2960520

  12. Tumor Suppressor Activity of Profilin Requires a Functional Actin Binding Site

    PubMed Central

    Wittenmayer, Nina; Jandrig, Burkhard; Rothkegel, Martin; Schlüter, Kathrin; Arnold, Wolfgang; Haensch, Wolfgang; Scherneck, Siegfried; Jockusch, Brigitte M.


    Profilin 1 (PFN1) is a regulator of the microfilament system and is involved in various signaling pathways. It interacts with many cytoplasmic and nuclear ligands. The importance of PFN1 for human tissue differentiation has been demonstrated by the findings that human cancer cells, expressing conspicuously low PFN1 levels, adopt a nontumorigenic phenotype upon raising their PFN1 level. In the present study, we characterize the ligand binding site crucial for profilin's tumor suppressor activity. Starting with CAL51, a human breast cancer cell line highly tumorigenic in nude mice, we established stable clones that express PFN1 mutants differentially defective in ligand binding. Clones expressing PFN1 mutants with reduced binding to either poly-proline-stretch ligands or phosphatidyl-inositol-4,5-bisphosphate, but with a functional actin binding site, were normal in growth, adhesion, and anchorage dependence, with only a weak tendency to elicit tumors in nude mice, similar to controls expressing wild-type PFN1. In contrast, clones expressing a mutant with severely reduced capacity to bind actin still behaved like the parental CAL51 and were highly tumorigenic. We conclude that the actin binding site on profilin is instrumental for normal differentiation of human epithelia and the tumor suppressor function of PFN1. PMID:14767055

  13. On the ATP binding site of the ε subunit from bacterial F-type ATP synthases.


    Krah, Alexander; Takada, Shoji


    F-type ATP synthases are reversible machinery that not only synthesize adenosine triphosphate (ATP) using an electrochemical gradient across the membrane, but also can hydrolyze ATP to pump ions under certain conditions. To prevent wasteful ATP hydrolysis, subunit ε in bacterial ATP synthases changes its conformation from the non-inhibitory down- to the inhibitory up-state at a low cellular ATP concentration. Recently, a crystal structure of the ε subunit in complex with ATP was solved in a non-biologically relevant dimeric form. Here, to derive the functional ATP binding site motif, we carried out molecular dynamics simulations and free energy calculations. Our results suggest that the ATP binding site markedly differs from the experimental resolved one; we observe a reorientation of several residues, which bind to ATP in the crystal structure. In addition we find that an Mg(2+) ion is coordinated by ATP, replacing interactions of the second chain in the crystal structure. Thus we demonstrate more generally the influence of crystallization effects on ligand binding sites and their respective binding modes. Furthermore, we propose a role for two highly conserved residues to control the ATP binding/unbinding event, which have not been considered before. Additionally our results provide the basis for the rational development of new biosensors based on subunit ε, as shown previously for novel sensors measuring the ATP concentration in cells. PMID:26780667

  14. Platelet 3H-imipramine binding sites in obsessive-compulsive behavior.


    Kim, S W; Dysken, M W; Pandey, G N; Davis, J M


    Several studies indicate a serotonergic dysfunction in patients with obsessive-compulsive disorder (OCD). We examined serotonergic function in OCD by determining platelet 3H-impiramine binding sites in patients with OCD during a drug-free baseline period as well as normal control volunteers. The maximum number of binding sites (Bmax) and apparent dissociation constant (Kd) was determined using 3H-imipramine (IMI) as the binding ligand. We observed that the mean 3H-IMI binding Bmax (fmol/mg protein) determined in 24 patients with OCD was not significantly different from that in 23 normal control subjects. There were no significant differences in the Kd between patients with OCD and normal control subjects. Our results are thus similar to those reported by Insel et al (1985) and Black et al (1990), who observed no significant differences in platelet 3H-IMI binding between OCD patients and controls; but different from those reported by Weizmann et al (1986), who observed decreased 3H-IMI Bmax in OCD patients. The discrepancy in the results is not clear, but may be related to several factors. Our results thus indicate that any abnormality in serotonergic function present in patients with OCD is not related to imipramine binding sites in the platelets. However, the possibility that there may be an abnormal platelet serotonin uptake or other serotonergic function in OCD cannot be ruled out. PMID:1657222

  15. Sequences flanking the core-binding site modulate glucocorticoid receptor structure and activity.


    Schöne, Stefanie; Jurk, Marcel; Helabad, Mahdi Bagherpoor; Dror, Iris; Lebars, Isabelle; Kieffer, Bruno; Imhof, Petra; Rohs, Remo; Vingron, Martin; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H


    The glucocorticoid receptor (GR) binds as a homodimer to genomic response elements, which have particular sequence and shape characteristics. Here we show that the nucleotides directly flanking the core-binding site, differ depending on the strength of GR-dependent activation of nearby genes. Our study indicates that these flanking nucleotides change the three-dimensional structure of the DNA-binding site, the DNA-binding domain of GR and the quaternary structure of the dimeric complex. Functional studies in a defined genomic context show that sequence-induced changes in GR activity cannot be explained by differences in GR occupancy. Rather, mutating the dimerization interface mitigates DNA-induced changes in both activity and structure, arguing for a role of DNA-induced structural changes in modulating GR activity. Together, our study shows that DNA sequence identity of genomic binding sites modulates GR activity downstream of binding, which may play a role in achieving regulatory specificity towards individual target genes. PMID:27581526

  16. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali


    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  17. Romulus: robust multi-state identification of transcription factor binding sites from DNase-seq data

    PubMed Central

    Jankowski, Aleksander; Tiuryn, Jerzy; Prabhakar, Shyam


    Motivation: Computational prediction of transcription factor (TF) binding sites in the genome remains a challenging task. Here, we present Romulus, a novel computational method for identifying individual TF binding sites from genome sequence information and cell-type–specific experimental data, such as DNase-seq. It combines the strengths of previous approaches, and improves robustness by reducing the number of free parameters in the model by an order of magnitude. Results: We show that Romulus significantly outperforms existing methods across three sources of DNase-seq data, by assessing the performance of these tools against ChIP-seq profiles. The difference was particularly significant when applied to binding site prediction for low-information-content motifs. Our method is capable of inferring multiple binding modes for a single TF, which differ in their DNase I cut profile. Finally, using the model learned by Romulus and ChIP-seq data, we introduce Binding in Closed Chromatin (BCC) as a quantitative measure of TF pioneer factor activity. Uniquely, our measure quantifies a defining feature of pioneer factors, namely their ability to bind closed chromatin. Availability and Implementation: Romulus is freely available as an R package at Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153645

  18. Interaction of triprolidine hydrochloride with serum albumins: thermodynamic and binding characteristics, and influence of site probes.


    Sandhya, B; Hegde, Ashwini H; Kalanur, Shankara S; Katrahalli, Umesha; Seetharamappa, J


    The interaction between triprolidine hydrochloride (TRP) to serum albumins viz. bovine serum albumin (BSA) and human serum albumin (HSA) has been studied by spectroscopic methods. The experimental results revealed the static quenching mechanism in the interaction of TRP with protein. The number of binding sites close to unity for both TRP-BSA and TRP-HSA indicated the presence of single class of binding site for the drug in protein. The binding constant values of TRP-BSA and TRP-HSA were observed to be 4.75 ± 0.018 × 10(3) and 2.42 ± 0.024 × 10(4)M(-1) at 294 K, respectively. Thermodynamic parameters indicated that the hydrogen bond and van der Waals forces played the major role in the binding of TRP to proteins. The distance of separation between the serum albumin and TRP was obtained from the Förster's theory of non-radioactive energy transfer. The metal ions viz., K(+), Ca(2+), Co(2+), Cu(2+), Ni(2+), Mn(2+) and Zn(2+) were found to influence the binding of the drug to protein. Displacement experiments indicated the binding of TRP to Sudlow's site I on both BSA and HSA. The CD, 3D fluorescence spectra and FT-IR spectral results revealed the changes in the secondary structure of protein upon interaction with TRP. PMID:21215548

  19. DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.


    Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere


    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders. PMID:17946719

  20. Precise temporal control of the eye regulatory gene Pax6 via enhancer-binding site affinity.


    Rowan, Sheldon; Siggers, Trevor; Lachke, Salil A; Yue, Yingzi; Bulyk, Martha L; Maas, Richard L


    How transcription factors interpret the cis-regulatory logic encoded within enhancers to mediate quantitative changes in spatiotemporally restricted expression patterns during animal development is not well understood. Pax6 is a dosage-sensitive gene essential for eye development. Here, we identify the Prep1 (pKnox1) transcription factor as a critical dose-dependent upstream regulator of Pax6 expression during lens formation. We show that Prep1 activates the Pax6 lens enhancer by binding to two phylogenetically conserved lower-affinity DNA-binding sites. Finally, we describe a mechanism whereby Pax6 levels are determined by transcriptional synergy of Prep1 bound to the two sites, while timing of enhancer activation is determined by binding site affinity. PMID:20413611

  1. Studies on phytohemagglutinins. XXVII. A study of the pea lectin binding site.


    Cermáková, M; Entlicher, G; Kocourek, J


    Under defined mild conditions the reaction of the pea lectin with 2-nitrophenylsulfenyl chloride results in sulfenylation of only 2 of the 10 tryptophan residues of the lectin molecule with simultaneous loss of biological activity. Both sulfenylated tryptophan residues belong to the two heavy subunits of the lectin. Enzymic hydrolysis and separation of the tryptic peptides yields only one homogeneous yellow peptide containing the modified tryptophan residue. The isolated peptide has the following sequence (NPS, nitrophenylsulfenyl): HAsp-Val-Val-Pro-Glu-(2-NPS-Trp)-Val-ArgOH. The octapeptide is either directly a part of the pea lectin binding site or it plays an important role in maintaining the tertiary structure of the binding site. According to the amino acid composition and amino acid sequence, the octapeptide isolated from the pea lectin is almost identical with that part of the peptide chain of concanavalin A near to which the location of the sugar binding site is supposed to be. PMID:1252454

  2. Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in vitro

    NASA Astrophysics Data System (ADS)

    Cooney, Michael; Czernuszewicz, Graznya; Postel, Edith H.; Flint, S. Jane; Hogan, Michael E.


    A 27-base-long DNA oligonucleotide was designed that binds to duplex DNA at a single site within the 5' end of the human c-myc gene, 115 base pairs upstream from the transcription origin P1. On the basis of the physical properties of its bound complex, it was concluded that the oligonucleotide forms a colinear triplex with the duplex binding site. By means of an in vitro assay system, it was possible to show a correlation between triplex formation at -115 base pairs and repression of c-myc transcription. The possibility is discussed that triplex formation (site-specific RNA binding to a DNA duplex) could serve as the basis for an alternative program of gene control in vivo.

  3. Towards the identification of the allosteric Phe-binding site in phenylalanine hydroxylase.


    Carluccio, Carla; Fraternali, Franca; Salvatore, Francesco; Fornili, Arianna; Zagari, Adriana


    The enzyme phenylalanine hydroxylase (PAH) is defective in the inherited disorder phenylketonuria. PAH, a tetrameric enzyme, is highly regulated and displays positive cooperativity for its substrate, Phe. Whether Phe binds to an allosteric site is a matter of debate, despite several studies worldwide. To address this issue, we generated a dimeric model for Phe-PAH interactions, by performing molecular docking combined with molecular dynamics simulations on human and rat wild-type sequences and also on a human G46S mutant. Our results suggest that the allosteric Phe-binding site lies at the dimeric interface between the regulatory and the catalytic domains of two adjacent subunits. The structural and dynamical features of the site were characterized in depth and described. Interestingly, our findings provide evidence for lower allosteric Phe-binding ability of the G46S mutant than the human wild-type enzyme. This also explains the disease-causing nature of this mutant. PMID:26479306

  4. Ivermectin binding sites in human and invertebrate Cys-loop receptors.


    Lynagh, Timothy; Lynch, Joseph W


    Ivermectin is a gold standard antiparasitic drug that has been used successfully to treat billions of humans, livestock and pets. Until recently, the binding site on its Cys-loop receptor target had been a mystery. Recent protein crystal structures, site-directed mutagenesis data and molecular modelling now explain how ivermectin binds to these receptors and reveal why it is selective for invertebrate members of the Cys-loop receptor family. Combining this with emerging genomic information, we are now in a position to predict species sensitivity to ivermectin and better understand the molecular basis of ivermectin resistance. An understanding of the molecular structure of the ivermectin binding site, which is formed at the interface of two adjacent subunits in the transmembrane domain of the receptor, should also aid the development of new lead compounds both as anthelmintics and as therapies for a wide variety of human neurological disorders. PMID:22677714

  5. Wnts grasp the WIF domain of Wnt Inhibitory Factor 1 at two distinct binding sites.


    Kerekes, Krisztina; Bányai, László; Patthy, László


    Wnts have a structure resembling a hand with "thumb" and "index" fingers that grasp the cysteine rich domains of Frizzled receptors at two distinct binding sites. In the present work we show that the WIF domain of Wnt Inhibitory Factor 1 is also bound by Wnts at two sites. Using C-terminal domains of Wnt5a and Wnt7a and arginine-scanning mutagenesis of the WIF domain we demonstrate that, whereas the N-terminal, lipid-modified "thumb" of Wnts interacts with the alkyl-binding site of the WIF domain, the C-terminal domain of Wnts (Wnt-CTD) binds to a surface on the opposite side of the WIF domain. PMID:26342861

  6. Elucidation of distinct ligand binding sites for cytochrome P450 3A4.


    Hosea, N A; Miller, G P; Guengerich, F P


    Cytochrome P450 (P450) 3A4 is the most abundant human P450 enzyme and has broad selectivity for substrates. The enzyme can show marked catalytic regioselectivity and unusual patterns of homotropic and heterotropic cooperativity, for which several models have been proposed. Spectral titration studies indicated one binding site for the drug indinavir (M(r) 614), a known substrate and inhibitor. Several C-terminal aminated peptides, including the model morphiceptin (YPFP-NH(2)), bind with spectral changes indicative of Fe-NH(2) bonding. The binding of the YPFP-NH(2) N-terminal amine and the influence of C-terminal modification on binding argue that the entire molecule (M(r) 521) fits within P450 3A4. YPFP-NH(2) was not oxidized by P450 3A4 but blocked binding of the substrates testosterone and midazolam, with K(i) values similar to the spectral binding constant (K(s)) for YPFP-NH(2). YPFP-NH(2) inhibited the oxidations of several typical P450 substrates with K(i) values 10-fold greater than the K(s) for binding YPFP-NH(2) and its K(i) for inhibiting substrate binding. The n values for cooperativity of these oxidations were not altered by YPFP-NH(2). YPFP-NH(2) inhibited the oxidations of midazolam at two different positions (1'- and 4-) with 20-fold different K(i) values. The differences in the K(i) values for blocking the binding to ferric P450 3A4 and the oxidation of several substrates may be attributed to weaker binding of YPFP-NH(2) to ferrous P450 3A4 than to the ferric form. The ferrous protein can be considered a distinct form of the enzyme in binding and catalysis because many substrates (but not YPFP-NH(2)) facilitate reduction of the ferric to ferrous enzyme. Our results with these peptides are considered in the context of several proposed models. A P450 3A4 model based on these peptide studies contains at least two and probably three distinct ligand sites, with testosterone and alpha-naphthoflavone occupying distinct sites. Midazolam appears to be able to

  7. Novel benzimidazole inhibitors bind to a unique site in the kinesin spindle protein motor domain.


    Sheth, Payal R; Shipps, Gerald W; Seghezzi, Wolfgang; Smith, Catherine K; Chuang, Cheng-Chi; Sanden, David; Basso, Andrea D; Vilenchik, Lev; Gray, Kimberly; Annis, D Allen; Nickbarg, Elliott; Ma, Yao; Lahue, Brian; Herbst, Ronald; Le, Hung V


    Affinity selection-mass spectrometry (AS-MS) screening of kinesin spindle protein (KSP) followed by enzyme inhibition studies and temperature-dependent circular dichroism (TdCD) characterization was utilized to identify a series of benzimidazole compounds. This series also binds in the presence of Ispinesib, a known anticancer KSP inhibitor in phase I/II clinical trials for breast cancer. TdCD and AS-MS analyses support simultaneous binding implying existence of a novel non-Ispinesib binding pocket within KSP. Additional TdCD analyses demonstrate direct binding of these compounds to Ispinesib-resistant mutants (D130V, A133D, and A133D + D130V double mutant), further strengthening the hypothesis that the compounds bind to a distinct binding pocket. Also importantly, binding to this pocket causes uncompetitive inhibition of KSP ATPase activity. The uncompetitive inhibition with respect to ATP is also confirmed by the requirement of nucleotide for binding of the compounds. After preliminary affinity optimization, the benzimidazole series exhibited distinctive antimitotic activity as evidenced by blockade of bipolar spindle formation and appearance of monoasters. Cancer cell growth inhibition was also demonstrated either as a single agent or in combination with Ispinesib. The combination was additive as predicted by the binding studies using TdCD and AS-MS analyses. The available data support the existence of a KSP inhibitory site hitherto unknown in the literature. The data also suggest that targeting this novel site could be a productive strategy for eluding Ispinesib-resistant tumors. Finally, AS-MS and TdCD techniques are general in scope and may enable screening other targets in the presence of known drugs, clinical candidates, or tool compounds that bind to the protein of interest in an effort to identify potency-enhancing small molecules that increase efficacy and impede resistance in combination therapy. PMID:20718440

  8. Monoclonal antibodies specific for each of the two toxin-binding sites of Torpedo acetylcholine receptor

    SciTech Connect

    Dowding, A.J.; Hall, Z.W.


    The authors have isolated and characterized 12 monoclonal antibodies (mAbs) that block the binding of ..cap alpha..-bungarotoxin (..cap alpha..-BuTx) to the acetylcholine receptor (AChR) of Torpedo californica. Two of the mAbs block ..cap alpha..-BuTx binding completely; the other 10 inhibit only about 50% of the binding. The mAbs that partially inhibit ..cap alpha..-BuTx binding can be divided into two groups by examination of the additive effect of pairs of mAbs on toxin binding, and by analysis of competition between mAbs for binding to the AChR. These two groups of mAbs, which we have termed A and B, appear to recognize different toxin-binding sites on the same receptor. A and B mAbs were used to determine the kinetic and pharmacological properties of the two sites. The site recognized by A mAbs binds ..cap alpha..-BuTx with a forward rate constant of 0.98 x 10/sup 5/ M/sup -1/ s/sup -1/, d-tubocurarine (dTC) with a K/sub D/ of (6.8 +/- 0.3) x 10/sup -8/ M, and pancuronium with a K/sub D/ of (1.9 +/- 1.0) x 10/sup -9/ M. The site recognized by B mAbs binds ..cap alpha..-BuTx with a forward rate constant of 9.3 x 10/sup 5/ M/sup -1/ s/sup -1/, dTC with a K/sub D/ of (4.6 +/- 0.3) x 10/sup -6/ M, and pancurionium with a K/sub D/ of (9.3 +/- 0.8) x 10/sup -6/ M. Binding of A and B mAbs to the AChR was variably inhibited by nicotinic cholinergic agonists and antagonists, and by ..cap alpha..-conotoxin. The observed pattern of inhibition is consistent with the relative affinity of the two sites for antagonists as given above but also indicates that the mAbs recognize a diversity of epitopes within each site.

  9. Autoradiographic distribution of /sup 125/I-galanin binding sites in the rat central nervous system

    SciTech Connect

    Skofitsch, G.; Sills, M.A.; Jacobowitz, D.M.


    Galanin (GAL) binding sites in coronal sections of the rat brain were demonstrated using autoradiographic methods. Scatchard analysis of /sup 125/I-GAL binding to slide-mounted tissue sections revealed saturable binding to a single class of receptors with a Kd of approximately 0.2 nM. /sup 125/I-GAL binding sites were demonstrated throughout the rat central nervous system. Dense binding was observed in the following areas: prefrontal cortex, the anterior nuclei of the olfactory bulb, several nuclei of the amygdaloid complex, the dorsal septal area, dorsal bed nucleus of the stria terminalis, the ventral pallidum, the internal medullary laminae of the thalamus, medial pretectal nucleus, nucleus of the medial optic tract, borderline area of the caudal spinal trigeminal nucleus adjacent to the spinal trigeminal tract, the substantia gelatinosa and the superficial layers of the dorsal spinal cord. Moderate binding was observed in the piriform, periamygdaloid, entorhinal, insular cortex and the subiculum, the nucleus accumbens, medial forebrain bundle, anterior hypothalamic, ventromedial, dorsal premamillary, lateral and periventricular thalamic nuclei, the subzona incerta, Forel's field H1 and H2, periventricular gray matter, medial and superficial gray strata of the superior colliculus, dorsal parts of the central gray, peripeduncular area, the interpeduncular nucleus, substantia nigra zona compacta, ventral tegmental area, the dorsal and ventral parabrachial and parvocellular reticular nuclei. The preponderance of GAL-binding in somatosensory as well as in limbic areas suggests a possible involvement of GAL in a variety of brain functions.

  10. Disruption of NAD+ binding site in glyceraldehyde 3-phosphate dehydrogenase affects its intranuclear interactions

    PubMed Central

    Phadke, Manali; Krynetskaia, Natalia; Mishra, Anurag; Barrero, Carlos; Merali, Salim; Gothe, Scott A; Krynetskiy, Evgeny


    AIM: To characterize phosphorylation of human glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and mobility of GAPDH in cancer cells treated with chemotherapeutic agents. METHODS: We used proteomics analysis to detect and characterize phosphorylation sites within human GAPDH. Site-specific mutagenesis and alanine scanning was then performed to evaluate functional significance of phosphorylation sites in the GAPDH polypeptide chain. Enzymatic properties of mutated GAPDH variants were assessed using kinetic studies. Intranuclear dynamics parameters (diffusion coefficient and the immobile fraction) were estimated using fluorescence recovery after photobleaching (FRAP) experiments and confocal microscopy. Molecular modeling experiments were performed to estimate the effects of mutations on NAD+ cofactor binding. RESULTS: Using MALDI-TOF analysis, we identified novel phosphorylation sites within the NAD+ binding center of GAPDH at Y94, S98, and T99. Using polyclonal antibody specific to phospho-T99-containing peptide within GAPDH, we demonstrated accumulation of phospho-T99-GAPDH in the nuclear fractions of A549, HCT116, and SW48 cancer cells after cytotoxic stress. We performed site-mutagenesis, and estimated enzymatic properties, intranuclear distribution, and intranuclear mobility of GAPDH mutated variants. Site-mutagenesis at positions S98 and T99 in the NAD+ binding center reduced enzymatic activity of GAPDH due to decreased affinity to NAD+ (Km = 741 ± 257 μmol/L in T99I vs 57 ± 11.1 µmol/L in wild type GAPDH. Molecular modeling experiments revealed the effect of mutations on NAD+ binding with GAPDH. FRAP (fluorescence recovery after photo bleaching) analysis showed that mutations in NAD+ binding center of GAPDH abrogated its intranuclear interactions. CONCLUSION: Our results suggest an important functional role of phosphorylated amino acids in the NAD+ binding center in GAPDH interactions with its intranuclear partners. PMID:26629320

  11. Computational prediction of cAMP receptor protein (CRP) binding sites in cyanobacterial genomes

    PubMed Central

    Xu, Minli; Su, Zhengchang


    Background Cyclic AMP receptor protein (CRP), also known as catabolite gene activator protein (CAP), is an important transcriptional regulator widely distributed in many bacteria. The biological processes under the regulation of CRP are highly diverse among different groups of bacterial species. Elucidation of CRP regulons in cyanobacteria will further our understanding of the physiology and ecology of this important group of microorganisms. Previously, CRP has been experimentally studied in only two cyanobacterial strains: Synechocystis sp. PCC 6803 and Anabaena sp. PCC 7120; therefore, a systematic genome-scale study of the potential CRP target genes and binding sites in cyanobacterial genomes is urgently needed. Results We have predicted and analyzed the CRP binding sites and regulons in 12 sequenced cyanobacterial genomes using a highly effective cis-regulatory binding site scanning algorithm. Our results show that cyanobacterial CRP binding sites are very similar to those in E. coli; however, the regulons are very different from that of E. coli. Furthermore, CRP regulons in different cyanobacterial species/ecotypes are also highly diversified, ranging from photosynthesis, carbon fixation and nitrogen assimilation, to chemotaxis and signal transduction. In addition, our prediction indicates that crp genes in modern cyanobacteria are likely inherited from a common ancestral gene in their last common ancestor, and have adapted various cellular functions in different environments, while some cyanobacteria lost their crp genes as well as CRP binding sites during the course of evolution. Conclusion The CRP regulons in cyanobacteria are highly diversified, probably as a result of divergent evolution to adapt to various ecological niches. Cyanobacterial CRPs may function as lineage-specific regulators participating in various cellular processes, and are important in some lineages. However, they are dispensable in some other lineages. The loss of CRPs in these species

  12. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor.


    Qi, Suzhen; Casida, John E


    Anthranilic and phthalic diamides exemplified by chlorantraniliprole (Chlo) or cyantraniliprole (Cyan) and flubendiamide (Flu), respectively, are the newest major chemotype of insecticides with outstanding potency, little or no cross resistance with other classes and low mammalian toxicity. They are activators of the ryanodine (Ry) receptor (RyR)-Ca(2+) channel, based on Ca(2+) flux and electrophysiology investigations. The goal of this study is to define species differences in the degree and mechanisms of diamide selective action by radioligand specific binding studies at the [(3)H]Ry, [(3)H]Chlo and [(3)H]Flu sites. The [(3)H]Ry site is observed in muscle of lobster, rabbit and four insect species (Musca domestica, Apis mellifera, Heliothis virescens and Agrotis ipsilon) whereas the [(3)H]Chlo site is evident in the four insects and the [(3)H]Flu site in only the two lepidoptera (Agrotis and Heliothis). [(3)H]Ry binding is significantly stimulated by Chlo, Cyan and Flu with the insects (except Flu with Musca) but not the lobster and rabbit. [(3)H]Chlo binding is stimulated by Ry and Flu in Musca and Apis but not in the lepidoptera, while Flu and Cyan are inhibitory. [(3)H]Flu binding is strongly inhibited by Chlo and Cyan in Agrotis and Heliothis. [(3)H]Chlo and [(3)H]Flu binding are not dependent on added Ca(2+) or ATP in Heliothis and Agrotis whereas the other radioligand-receptor combinations are usually enhanced by Ca(2+) and ATP. More generally, there are species differences in the Ry, Chlo and Flu binding sites of the RyR that may confer selective toxicity and determine target site cross resistance mechanisms. PMID:24267693

  13. Progesterone receptor induces bcl-x expression through intragenic binding sites favoring RNA polymerase II elongation.


    Bertucci, Paola Y; Nacht, A Silvina; Alló, Mariano; Rocha-Viegas, Luciana; Ballaré, Cecilia; Soronellas, Daniel; Castellano, Giancarlo; Zaurin, Roser; Kornblihtt, Alberto R; Beato, Miguel; Vicent, Guillermo P; Pecci, Adali


    Steroid receptors were classically described for regulating transcription by binding to target gene promoters. However, genome-wide studies reveal that steroid receptors-binding sites are mainly located at intragenic regions. To determine the role of these sites, we examined the effect of progestins on the transcription of the bcl-x gene, where only intragenic progesterone receptor-binding sites (PRbs) were identified. We found that in response to hormone treatment, the PR is recruited to these sites along with two histone acetyltransferases CREB-binding protein (CBP) and GCN5, leading to an increase in histone H3 and H4 acetylation and to the binding of the SWI/SNF complex. Concomitant, a more relaxed chromatin was detected along bcl-x gene mainly in the regions surrounding the intragenic PRbs. PR also mediated the recruitment of the positive elongation factor pTEFb, favoring RNA polymerase II (Pol II) elongation activity. Together these events promoted the re-distribution of the active Pol II toward the 3'-end of the gene and a decrease in the ratio between proximal and distal transcription. These results suggest a novel mechanism by which PR regulates gene expression by facilitating the proper passage of the polymerase along hormone-dependent genes. PMID:23640331

  14. Role of DNA binding sites and slow unbinding kinetics in titration-based oscillators

    NASA Astrophysics Data System (ADS)

    Karapetyan, Sargis; Buchler, Nicolas E.


    Genetic oscillators, such as circadian clocks, are constantly perturbed by molecular noise arising from the small number of molecules involved in gene regulation. One of the strongest sources of stochasticity is the binary noise that arises from the binding of a regulatory protein to a promoter in the chromosomal DNA. In this study, we focus on two minimal oscillators based on activator titration and repressor titration to understand the key parameters that are important for oscillations and for overcoming binary noise. We show that the rate of unbinding from the DNA, despite traditionally being considered a fast parameter, needs to be slow to broaden the space of oscillatory solutions. The addition of multiple, independent DNA binding sites further expands the oscillatory parameter space for the repressor-titration oscillator and lengthens the period of both oscillators. This effect is a combination of increased effective delay of the unbinding kinetics due to multiple binding sites and increased promoter ultrasensitivity that is specific for repression. We then use stochastic simulation to show that multiple binding sites increase the coherence of oscillations by mitigating the binary noise. Slow values of DNA unbinding rate are also effective in alleviating molecular noise due to the increased distance from the bifurcation point. Our work demonstrates how the number of DNA binding sites and slow unbinding kinetics, which are often omitted in biophysical models of gene circuits, can have a significant impact on the temporal and stochastic dynamics of genetic oscillators.

  15. Upregulation of RNase E activity by mutation of a site that uncompetitively interferes with RNA binding

    PubMed Central

    Lee, Minho; Shin, Eunkyoung; Jeon, Che Ok; Cha, Chang-Jun; Han, Seung Hyun; Kim, Su-Jin; Lee, Sang-Won; Lee, Younghoon; Ha, Nam-Chul


    Escherichia coli RNase E contains a site that selectively binds to RNAs containing 5′-monophosphate termini, increasing the efficiency of endonucleolytic cleavage of these RNAs. Random mutagenesis of N-Rne, the N-terminal catalytic region of RNase E, identified a hyperactive variant that remains preferentially responsive to phosphorylation at 5′ termini. Biochemical analyses showed that the mutation (Q36R), which replaces glutamine with arginine at a position distant from the catalytic site, increases formation of stable RNA-protein complexes without detectably affecting the enzyme's secondary or tertiary structure. Studies of cleavage of fluorogenic substrate and EMSA experiments indicated that the Q36R mutation increases catalytic activity and RNA binding. however, UV crosslinking and mass spectrometry studies suggested that the mutant enzyme lacks an RNA binding site present in its wild-type counterpart. Two substrate-bound tryptic peptides, 65HGFLPLK71—which includes amino acids previously implicated in substrate binding and catalysis—and 24LYDLDIESPGHEQK37—which includes the Q36 locus—were identified in wild-type enzyme complexes, whereas only the shorter peptide was observed for complexes containing Q36R. Our results identify a novel RNase E locus that disparately affects the number of substrate binding sites and catalytic activity of the enzyme. We propose a model that may account for these surprising effects. PMID:22186084

  16. Progesterone receptor induces bcl-x expression through intragenic binding sites favoring RNA polymerase II elongation

    PubMed Central

    Bertucci, Paola Y.; Nacht, A. Silvina; Alló, Mariano; Rocha-Viegas, Luciana; Ballaré, Cecilia; Soronellas, Daniel; Castellano, Giancarlo; Zaurin, Roser; Kornblihtt, Alberto R.; Beato, Miguel; Vicent, Guillermo P.; Pecci, Adali


    Steroid receptors were classically described for regulating transcription by binding to target gene promoters. However, genome-wide studies reveal that steroid receptors-binding sites are mainly located at intragenic regions. To determine the role of these sites, we examined the effect of progestins on the transcription of the bcl-x gene, where only intragenic progesterone receptor-binding sites (PRbs) were identified. We found that in response to hormone treatment, the PR is recruited to these sites along with two histone acetyltransferases CREB-binding protein (CBP) and GCN5, leading to an increase in histone H3 and H4 acetylation and to the binding of the SWI/SNF complex. Concomitant, a more relaxed chromatin was detected along bcl-x gene mainly in the regions surrounding the intragenic PRbs. PR also mediated the recruitment of the positive elongation factor pTEFb, favoring RNA polymerase II (Pol II) elongation activity. Together these events promoted the re-distribution of the active Pol II toward the 3′-end of the gene and a decrease in the ratio between proximal and distal transcription. These results suggest a novel mechanism by which PR regulates gene expression by facilitating the proper passage of the polymerase along hormone-dependent genes. PMID:23640331

  17. Binding isotope effects as a tool for distinguishing hydrophobic and hydrophilic binding sites of HIV-1 RT.


    Krzemińska, Agnieszka; Paneth, Piotr; Moliner, Vicent; Świderek, Katarzyna


    The current treatment for HIV-1 infected patients consists of a cocktail of inhibitors, in an attempt to improve the potency of the drugs by adding the possible effects of each supplied compound. In this contribution, nine different inhibitors of HIV-1 RT, one of the three key proteins responsible for the virus replication, have been selected to develop and test a computational protocol that allows getting a deep insight into the inhibitors' binding mechanism. The interaction between the inhibitors and the protein have been quantified by computing binding free energies through FEP calculations, while a more detailed characterization of the kind of inhibitor-protein interactions is based on frequency analysis of the ligands in the initial and final state, i.e. in solution and binding the protein. QM/MM calculation of heavy atoms ((13)C, (15)N, and (18)O) binding isotope effects (BIE) have been used to identify the binding sites of the different inhibitors. Specific interactions between the isotopically labeled atoms of the inhibitors and polar residues and magnesium cations on the hydrophilic pocket of the protein are responsible for the frequencies shifting that can be detected when comparing the IR spectra of the compounds in solution and in the protein. On the contrary, it seems that changes in vdW interactions from solution to the final state when the ligand is interacting with residues of the hydrophobic cavity, does not influence frequency modes and then no BIE are observed. Our results suggest that a proper computational protocol can be a valuable tool which in turn can be used to increase the efficiency of anti AIDS drugs. PMID:25132465

  18. Profiling the Binding Sites of RNA-Binding Proteins with Nucleotide Resolution Using iCLIP.


    Sutandy, F X Reymond; Hildebrandt, Andrea; König, Julian


    The importance of posttranscriptional regulation in cellular metabolism has recently gone beyond what was previously appreciated. The regulatory mechanisms are controlled by RNA-binding proteins (RBPs), which form complexes with RNA and regulate RNA processing, stability, and localization, among others. Consistently, mutations in RBPs result in defects in developmental processes, diseases, and cancer. Gaining deeper insights into the biology of RNA-RBP interactions will lead to a better understanding of regulatory processes and disease development. Several techniques have been developed to capture the properties of RNA-RBP interactions. Furthermore, the development of high-throughput sequencing has broadened the capability of these methods. Here, we summarize individual-nucleotide resolution UV cross-linking and immunoprecipitation (iCLIP), a powerful technique that provides genome-wide information on RNA-RBP interactions at nucleotide resolution. In this chapter, we outline the iCLIP protocol and list possible controls that allow a targeted and cost-minimizing optimization of the protocol for an RBP-of-interest. Moreover, we provide notes on experimental design and a troubleshooting guideline for common problems that can occur during iCLIP library preparation. PMID:26463384

  19. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.


    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua


    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes

  20. The Culprit Is in the Cave: The Core Sites Explain the Binding Profiles of Amyloid-Specific Tracers.


    Murugan, N Arul; Halldin, Christer; Nordberg, Agneta; Långström, Bengt; Ågren, Hans


    The design of molecular probes and tracer molecules with specificity toward amyloid beta (Aβ) fibrils is of paramount importance for the selective diagnosis of Alzheimer's disease. This requires a detailed understanding of the binding sites in amyloid targets, their number, and their binding mechanism for various tracer molecules. We adopt an integrated approach including molecular docking, molecular dynamics, and generalized Born-based free energy calculations to investigate site-specific interactions of different amyloid binding molecules. Our study reproduces the experimental results on the relative binding affinity of the tracers and amyloid binders and explains the feature of "multiple binding sites" in amyloid targets as probed by competition binding experiments. A major outcome of this study is that it is the core sites of the Aβ fibrils that are responsible for the experimentally reported binding profiles of tracers in amyloid targets rather than the surface sites that received much focus in earlier investigations. PMID:27498616

  1. Identification of glycosaminoglycan-binding sites within hepatitis C virus envelope glycoprotein E2*.


    Olenina, L V; Kuzmina, T I; Sobolev, B N; Kuraeva, T E; Kolesanova, E F; Archakov, A I


    Heparan sulphate is one of the candidate receptors for hepatitis C virus (HCV). Envelope glycoproteins of HCV have been proposed to be responsible for recognition and binding with cell receptors. They are characterized by great genetic polymorphism. In this study the mapping of regions with glycosaminoglycan-binding properties within HCV envelope proteins has been undertaken. We prepared a set of overlapping peptides corresponding to conserved regions of these envelope proteins and analysed them by solid phase heparin-binding assay. The search for established glycosaminoglycan-binding motifs in the HCV envelope proteins showed the absence of the sites corresponding to the glycosaminoglycan-binding patterns in consensus sequence. We identified one highly conserved and two less conserved heparin-binding sequences within the envelope protein E2 based on solid phase assay results. We did not find any differences in binding efficiency of these peptides with heparin, heparan sulphate or dextran sulphate. Our data supported the specific association between HCV envelope protein E2 and cell surface glycosaminoglycans. We hypothesize that identified regions from E2 can contribute to HCV binding to cell surface glycosaminoglycans. PMID:16255759

  2. Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

    PubMed Central

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.


    SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

  3. Tristetraprolin binding site atlas in the macrophage transcriptome reveals a switch for inflammation resolution.


    Sedlyarov, Vitaly; Fallmann, Jörg; Ebner, Florian; Huemer, Jakob; Sneezum, Lucy; Ivin, Masa; Kreiner, Kristina; Tanzer, Andrea; Vogl, Claus; Hofacker, Ivo; Kovarik, Pavel


    Precise regulation of mRNA decay is fundamental for robust yet not exaggerated inflammatory responses to pathogens. However, a global model integrating regulation and functional consequences of inflammation-associated mRNA decay remains to be established. Using time-resolved high-resolution RNA binding analysis of the mRNA-destabilizing protein tristetraprolin (TTP), an inflammation-limiting factor, we qualitatively and quantitatively characterize TTP binding positions in the transcriptome of immunostimulated macrophages. We identify pervasive destabilizing and non-destabilizing TTP binding, including a robust intronic binding, showing that TTP binding is not sufficient for mRNA destabilization. A low degree of flanking RNA structuredness distinguishes occupied from silent binding motifs. By functionally relating TTP binding sites to mRNA stability and levels, we identify a TTP-controlled switch for the transition from inflammatory into the resolution phase of the macrophage immune response. Mapping of binding positions of the mRNA-stabilizing protein HuR reveals little target and functional overlap with TTP, implying a limited co-regulation of inflammatory mRNA decay by these proteins. Our study establishes a functionally annotated and navigable transcriptome-wide atlas ( of cis-acting elements controlling mRNA decay in inflammation. PMID:27178967

  4. Characterization of pancreatic somatostatin binding sites with a /sup 125/I-somatostatin 28 analog

    SciTech Connect

    Zeggari, M.; Viguerie, N.; Susini, C.; Esteve, J.P.; Vaysse, N.; Rivier, J.; Wunsch, E.; Ribet, A.


    Somatostatin binding to guinea pig pancreatic acinar cell plasma membranes was characterized with an iodinated stable analog of somatostatin 28 (S28): /sup 125/I-(Leu8,DTrp22,Tyr25)S28. The binding was highly dependent on calcium ions. In 0.2 mM free Ca2+ medium, binding at 37 degrees C was saturable, slowly reversible and exhibited a single class of high affinity binding sites (KD = 0.05 +/- 0.01 nM, Bmax = 157 +/- 33 fmol/mg protein). Dissociation of bound radioactivity occurred with biphasic kinetics. Rate of dissociation increased when dissociation was measured at a time before equilibrium binding was reached. In 30 nM free Ca2+ medium, binding affinity and maximal binding capacity were decreased by about 4-fold. Decreasing calcium concentrations increased the amount of rapidly dissociating form of the receptor. Somatostatin 14 antagonist, Des AA1,2(AzaAla4-5,DTrp8, Phe12-13)-somatostatin was active at the membrane level in inhibiting the binding. We conclude that using /sup 125/I-(Leu8,DTrp22,Tyr25)S28 as radioligand allows us to characterize a population of specific somatostatin receptors which are not different from those we previously described with the radioligand /sup 125/I-(Tyr11)-somatostatin. Somatostatin receptors could exist in two interconvertible forms. Calcium ions are an essential component in the regulation of the conformational change of somatostatin receptors.

  5. STarMir: a web server for prediction of microRNA binding sites.


    Rennie, William; Liu, Chaochun; Carmack, C Steven; Wolenc, Adam; Kanoria, Shaveta; Lu, Jun; Long, Dang; Ding, Ye


    STarMir web server predicts microRNA (miRNA) binding sites on a target ribonucleic acid (RNA). STarMir is an implementation of logistic prediction models developed with miRNA binding data from crosslinking immunoprecipitation (CLIP) studies (Liu,C., Mallick, B., Long, D., Rennie, W.A., Wolenc, A., Carmack, C.S. and Ding, Y. (2013). CLIP-based prediction of mammalian microRNA binding sites. Nucleic Acids Res., 41(14), e138). In both intra-dataset and inter-dataset validations, the models showed major improvements over established algorithms in predictions of both seed and seedless sites. General applicability of the models was indicated by good performance in cross-species validations. The input data for STarMir is processed by the web server to perform prediction of miRNA binding sites, compute comprehensive sequence, thermodynamic and target structure features and a logistic probability as a measure of confidence for each predicted site. For each of seed and seedless sites and for all three regions of a mRNA (3' UTR, CDS and 5' UTR), STarMir output includes the computed binding site features, the logistic probability and a publication-quality diagram of the predicted miRNA:target hybrid. The prediction results are available through both an interactive viewer and downloadable text files. As an application module of the Sfold RNA package (, STarMir is freely available to all at PMID:24803672

  6. Predicting target-ligand interactions using protein ligand-binding site and ligand substructures

    PubMed Central


    Background Cell proliferation, differentiation, Gene expression, metabolism, immunization and signal transduction require the participation of ligands and targets. It is a great challenge to identify rules governing molecular recognition between chemical topological substructures of ligands and the binding sites of the targets. Methods We suppose that the ligand-target interactions are determined by ligand substructures as well as the physical-chemical properties of the binding sites. Therefore, we propose a fragment interaction model (FIM) to describe the interactions between ligands and targets, with the purpose of facilitating the chemical interpretation of ligand-target binding. First we extract target-ligand complexes from sc-PDB database, based on which, we get the target binding sites and the ligands. Then we represent each binding site as a fragment vector based on a target fragment dictionary that is composed of 199 clusters (denoted as fragements in this work) obtained by clustering 4200 trimers according to their physical-chemical properties. And then, we represent each ligand as a substructure vector based on a dictionary containing 747 substructures. Finally, we build the FIM by generating the interaction matrix M (representing the fragment interaction network), and the FIM can later be used for predicting unknown ligand-target interactions as well as providing the binding details of the interactions. Results The five-fold cross validation results show that the proposed model can get higher AUC score (92%) than three prevalence algorithms CS-PD (80%), BLM-NII (85%) and RF (85%), demonstrating the remarkable predictive ability of FIM. We also show that the ligand binding sites (local information) overweight the sequence similarities (global information) in ligand-target binding, and introducing too much global information would be harmful to the predictive ability. Moreover, The derived fragment interaction network can provide the chemical insights on

  7. Structural and energetic requirements for a second binding site at the dimeric β-lactoglobulin interface.


    Bello, Martiniano


    Through experimental and theoretical approaches, it has been shown that bovine β-lactoglobulin (βlg) uses its hydrophobic cavity or calyx as the primary binding site for hydrophobic molecules, whereas the existence of a second ligand binding site at the dimeric interface has only been structurally identified for vitamin D3 (VD3). This binding exists even in the thermally denatured state, suggesting the prevalence of this secondary site. Although crystallographic experiments have suggested that VD3 can bind to both monomeric and dimeric states without significant structural differences, theoretical and experimental reports have proposed some structural requirements. Thus, in this study, based on known experimental data, the dynamic interaction of VD3 with the monomeric or dimeric forms of βlg was investigated through a protocol combining blind docking and 2 microsecond molecular dynamics simulations coupled with binding free energy and per-residue binding free energy decomposition analyses using the Molecular Mechanics Generalized Born Surface Area approach. Binding free energy calculations allowed us to estimate the energetic differences of coupling VD3 at the calyx and the dimeric interface for the monomeric or dimeric state, revealing that the dimeric structure is required to form a stable complex with VD3 at the dimeric interface. This also has an important impact on the dimerization process, whereas although the monomeric state also forms a stable complex with VD3 at the dimeric interface, the incorporation of the entropy component contributed to producing a marginally favorable binding free energy. Finally, the per-residue decomposition analysis provided energetic information about the most relevant residues in stabilizing the different systems. PMID:26375627

  8. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jingjing; Kitova, Elena N.; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S.


    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (β-Gal-(1→3)-β-GalNAc-(1→4)[α-Neu5Ac-(2→3)]-β-Gal-(1→4)-Glc), Pk trisaccharide (α-Gal-(1→4)-β-Gal-(1→4)-Glc) and CD-grease (α-Gal-(1→3)-β-Gal-(1→4)-β-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics.

  9. Nature of the individual Ca2+ binding sites in Ca2+-regenerated bacteriorhodopsin

    PubMed Central

    Zhang, Y. N.; Sweetman, L. L.; Awad, E. S.; El-Sayed, M. A.


    The binding constants, K1 and K2, and the number of Ca2+ ions in each of the two high affinity sites of Ca2+-regenerated bacteriorhodopsin (bR) are determined potentiometrically at different pH values in the range of pH 3.5-4.5 by using the Scatchard plot method. From the pH dependence of K1 and K2, it was found that two hydrogen ions are released for each Ca2+ bound to each of the two high affinity sites. Furthermore, we have measured by a direct spectroscopic method the association constant, Ks, for the binding of Ca2+ to deionized bR, which is responsible for producing the blue to purple color change. Comparing the value of Ks and its pH dependence with those of K1 and K2 showed that the site corresponding to Ks is to be identified with that of K2. This is in agreement with the conclusion reached previously, using a different approach, which showed that it is the second Ca2+ that causes the blue to purple color change. Our studies also show that in addition to the two distinct high affinity sites, there are about four to six sites with lower binding constants. These are attributed to the nonspecific binding in bR. PMID:19431830

  10. Germline V-genes sculpt the binding site of a family of antibodies neutralizing human cytomegalovirus

    SciTech Connect

    Thomson, Christy A.; Bryson, Steve; McLean, Gary R.; Creagh, A. Louise; Pai, Emil F.; Schrader, John W.


    Immunoglobulin genes are generated somatically through specialized mechanisms resulting in a vast repertoire of antigen-binding sites. Despite the stochastic nature of these processes, the V-genes that encode most of the antigen-combining site are under positive evolutionary selection, raising the possibility that V-genes have been selected to encode key structural features of binding sites of protective antibodies against certain pathogens. Human, neutralizing antibodies to human cytomegalovirus that bind the AD-2S1 epitope on its gB envelope protein repeatedly use a pair of well-conserved, germline V-genes IGHV3-30 and IGKV3-11. Here, we present crystallographic, kinetic and thermodynamic analyses of the binding site of such an antibody and that of its primary immunoglobulin ancestor. These show that these germline V-genes encode key side chain contacts with the viral antigen and thereby dictate key structural features of the hypermutated, high-affinity neutralizing antibody. V-genes may thus encode an innate, protective immunological memory that targets vulnerable, invariant sites on multiple pathogens.

  11. PIP(2)-binding site in Kir channels: definition by multiscale biomolecular simulations.


    Stansfeld, Phillip J; Hopkinson, Richard; Ashcroft, Frances M; Sansom, Mark S P


    Phosphatidylinositol bisphosphate (PIP(2)) is an activator of mammalian inwardly rectifying potassium (Kir) channels. Multiscale simulations, via a sequential combination of coarse-grained and atomistic molecular dynamics, enabled exploration of the interactions of PIP(2) molecules within the inner leaflet of a lipid bilayer membrane with possible binding sites on Kir channels. Three Kir channel structures were investigated: X-ray structures of KirBac1.1 and of a Kir3.1-KirBac1.3 chimera and a homology model of Kir6.2. Coarse-grained simulations of the Kir channels in PIP(2)-containing lipid bilayers identified the PIP(2)-binding site on each channel. These models of the PIP(2)-channel complexes were refined by conversion to an atomistic representation followed by molecular dynamics simulation in a lipid bilayer. All three channels were revealed to contain a conserved binding site at the N-terminal end of the slide (M0) helix, at the interface between adjacent subunits of the channel. This binding site agrees with mutagenesis data and is in the proximity of the site occupied by a detergent molecule in the Kir chimera channel crystal. Polar contacts in the coarse-grained simulations corresponded to long-lived electrostatic and H-bonding interactions between the channel and PIP(2) in the atomistic simulations, enabling identification of key side chains. PMID:19839652

  12. Binding of bovine thyrotropin to specific sites in thyroid tissue from control and hemithyroidectomized rats

    SciTech Connect

    Clark, O.H.; Lambert, W.R.; Amir, S.M.; Ingbar, S.H.


    The binding of 125I-bovine thyrotropin to thyroid particulate fractions from sham-operated (control) and hemithyroidectomized rats was compared to determine if a change in either the number of bovine thyroid-stimulating hormone (bTSH) binding sites or their affinity for bTSH occurs in physiological situations that evoke changes in the intensity of thyroid stimulation. Following hemithyroidectomy serum TSH levels increase and the remnant thyroid lobe enlarges. Because of compensatory thyroid hypertrophy the concentration of TSH binding sites in the thyroid glands from hemithyroidectomized and control rats was related to particulate protein concentration, to the degree of thyroid cellularity as indicated by DNA concentration, and to the concentration of the plasma membrane markers, 5'-nucleotidase and magnesium-dependent ATPase. In each of four experiments, saturation studies revealed that the maximum specific binding of TSH per unit particulate protein and per thyroid lobe was greater in particulates from remnant than from control thyroid lobes. When related to DNA concentration, the concentration of TSH binding sites in remnant lobes was approximately twice that in control lobes. Because of an increase in plasma membrane markers per lobe after hemithyroidectomy, however, there was no difference in the number of TSH binding sites when related to the concentrations of the membrane marker enzymes in the particulate fractions. As judged from Scatchard analysis, the affinity of TSH binding was lower in remnant than in control lobes. This was partially but not completely due to the increased concentration of particulate protein in the remnant thyroid. These experiments demonstrate that the increase in serum TSH levels after hemithyroidectomy in the rat is associated with alterations in TSH receptor capacity and affinity.

  13. Discovery and Characterization of a Cell-Permeable, Small-Molecule c-Abl Kinase Activator that Binds to the Myristoyl Binding Site

    SciTech Connect

    Yang, Jingsong; Campobasso, Nino; Biju, Mangatt P.; Fisher, Kelly; Pan, Xiao-Qing; Cottom, Josh; Galbraith, Sarah; Ho, Thau; Zhang, Hong; Hong, Xuan; Ward, Paris; Hofmann, Glenn; Siegfried, Brett; Zappacosta, Francesca; Washio, Yoshiaki; Cao, Ping; Qu, Junya; Bertrand, Sophie; Wang, Da-Yuan; Head, Martha S.; Li, Hu; Moores, Sheri; Lai, Zhihong; Johanson, Kyung; Burton, George; Erickson-Miller, Connie; Simpson, Graham; Tummino, Peter; Copeland, Robert A.; Oliff, Allen


    c-Abl kinase activity is regulated by a unique mechanism involving the formation of an autoinhibited conformation in which the N-terminal myristoyl group binds intramolecularly to the myristoyl binding site on the kinase domain and induces the bending of the {alpha}I helix that creates a docking surface for the SH2 domain. Here, we report a small-molecule c-Abl activator, DPH, that displays potent enzymatic and cellular activity in stimulating c-Abl activation. Structural analyses indicate that DPH binds to the myristoyl binding site and prevents the formation of the bent conformation of the {alpha}I helix through steric hindrance, a mode of action distinct from the previously identified allosteric c-Abl inhibitor, GNF-2, that also binds to the myristoyl binding site. DPH represents the first cell-permeable, small-molecule tool compound for c-Abl activation.

  14. Spatial determinants of the alfalfa mosaic virus coat protein binding site.


    Laforest, Siana M; Gehrke, Lee


    The biological functions of RNA-protein complexes are, for the most part, poorly defined. Here, we describe experiments that are aimed at understanding the functional significance of alfalfa mosaic virus RNA-coat protein binding, an interaction that parallels the initiation of viral RNA replication. Peptides representing the RNA-binding domain of the viral coat protein are biologically active in initiating replication and bind to a 39-nt 3'-terminal RNA with a stoichiometry of two peptides: 1 RNA. To begin to understand how RNA-peptide interactions induce RNA conformational changes and initiate replication, the AMV RNA fragment was experimentally manipulated by increasing the interhelical spacing, by interrupting the apparent nucleotide symmetry, and by extending the binding site. In general, both asymmetric and symmetric insertions between two proposed hairpins diminished binding, whereas 5' and 3' extensions had minimal effects. Exchanging the positions of the binding site hairpins resulted in only a moderate decrease in peptide binding affinity without changing the hydroxyl radical footprint protection pattern. To assess biological relevance in viral RNA replication, the nucleotide changes were transferred into infectious genomic RNA clones. RNA mutations that disrupted coat protein binding also prevented viral RNA replication without diminishing coat protein mRNA (RNA 4) translation. These results, coupled with the highly conserved nature of the AUGC865-868 sequence, suggest that the distance separating the two proposed hairpins is a critical binding determinant. The data may indicate that the 5' and 3' hairpins interact with one of the bound peptides to nucleate the observed RNA conformational changes. PMID:14681584

  15. Molecular Features of an Alcohol Binding Site in a Neuronal Potassium Channel†

    PubMed Central

    Shahidullah, Mohammad; Harris, Thanawath; Germann, Markus W.; Covarrubias, Manuel


    Aliphatic alcohols (1-alkanols) selectively inhibit the neuronal Shaw2 K+ channel at an internal binding site. This inhibition is conferred by a sequence of 13 residues that constitutes the S4–S5 loop in the pore-forming subunit. Here, we combined functional and structural approaches to gain insights into the molecular basis of this interaction. To infer the forces that are involved, we employed a fast concentration-clamp method (10–90% exchange time = 800 μs) to examine the kinetics of the interaction of three members of the homologous series of 1-alkanols (ethanol, 1-butanol, and 1-hexanol) with Shaw2 K+ channels in Xenopus oocyte inside-out patches. As expected for a second-order mechanism involving a receptor site, only the observed association rate constants were linearly dependent on the 1-alkanol concentration. While the alkyl chain length modestly influenced the dissociation rate constants (decreasing only ∼2-fold between ethanol and 1-hexanol), the second-order association rate constants increased e-fold per carbon atom. Thus, hydrophobic interactions govern the probability of productive collisions at the 1-alkanol binding site, and short-range polar interactions help to stabilize the complex. We also examined the relationship between the energetics of 1-alkanol binding and the structural properties of the S4–S5 loop. Circular dichroism spectroscopy applied to peptides corresponding to the S4–S5 loop of various K+ channels revealed a correlation between the apparent binding affinity of the 1-alkanol binding site and the α-helical propensity of the S4–S5 loop. The data suggest that amphiphilic interactions at the Shaw2 1-alkanol binding site depend on specific structural constraints in the pore-forming subunit of the channel. PMID:14503874

  16. Candidate PET Radioligand Development for Neurofibrillary Tangles: Two Distinct Radioligand Binding Sites Identified in Postmortem Alzheimer's Disease Brain.


    Cai, Lisheng; Qu, Baoxi; Hurtle, Bryan T; Dadiboyena, Sureshbabu; Diaz-Arrastia, Ramon; Pike, Victor W


    [(18)F]THK-523 and [(18)F]807 are promising radioligands for imaging neurofibrillary tangles (NFTs) with positron emission tomography (PET) in neurodegenerative diseases, such as Alzheimer's disease (AD) and traumatic brain injury. Although [(18)F]THK-523 and [(18)F]T807 are considered high-affinity selective radioligands for NFTs, uncertainty has existed as to whether PET radioligands for imaging NFTs bind to the same molecular site because in vitro assays for ligands binding to NFTs have been lacking. We labeled THK-523 and T807 with tritium to serve as reference radioligands for in vitro binding assays with AD brain homogenates for newly synthesized ligands. With these radioligands, we identified two distinct binding sites for small molecules, one site with high affinity for THK-523 and the other with high affinity for T807. Moreover, binding assays with [(3)H]PIB confirmed that the two newly identified binding sites are also distinct from the thioflavin-T binding site where all current clinically useful PET radioligands for imaging β-amyloid plaque bind with high affinity. The two newly identified binding sites are considered to reside on NFTs rather than on β-amyloid plaques. Furthermore, we applied all three binding assays to a set of newly prepared compounds, based on chain modifications to THK-523. Some compounds with high affinity and selectivity for the THK-523 binding site emerged from this set, including one with amenability to labeling with fluorine-18, namely, ligand 10b. PMID:27171905

  17. Tritium-bradykinin binding site localization in guinea pig urinary system

    SciTech Connect

    Manning, D.C.; Snyder, S.H.


    Bradykinin (BK) causes vasodilation and increases free water and sodium excretion in the kidney and stimulates smooth muscle contraction in the ureter and bladder. Several proposed sites of action for BK include the renal medullary collecting duct, renal blood vessels and the ureter and bladder smooth muscle. This study employs 3H-BK autoradiography to localize the sites of BK action. 3H-BK binding sites in the kidney are localized in the medullary interstitium where BK may produce prostaglandins which mediate its blood flow, natriuretic and diuretic effects. 3H-BK binding sites in the ureter and bladder are localized in the lamina propria below the basal epithelial layer and absent over the muscle layers suggesting an indirect action on urinary tract smooth muscle.

  18. Functional evaluation of residues in the herbicide-binding site of Mycobacterium tuberculosis acetohydroxyacid synthase by site-directed mutagenesis.


    Jung, In-Pil; Cho, Jun-Haeng; Koo, Bon-Sung; Yoon, Moon-Young


    Mycobacterium tuberculosis acetohydroxyacid synthase (M. tuberculosis AHAS) has been proposed to bean essential target for novel herbicide- and chemical-based antibacterial agents. Therefore, here we investigated the roles of multiple conserved herbicide-binding site residues (R318, A146, Q148, M512, and V513) in M. tuberculosis AHAS through site-directed mutagenesis by characterizing the kinetic parameters and herbicide sensitivities of various point mutants. Interestingly, all mutant enzymes showed significantly altered kinetic parameters, specifically reduced affinity towards both the substrate and cofactor. Importantly, mutation of R318 led to a complete loss of AHAS activity, indicating a key role for this residue in substrate binding. Furthermore, all mutants demonstrated significant herbicide resistance against chlorimuron ethyl (CE), with several-fold higher IC50 than that of wild type AHAS. Docking analysis also indicated that binding of CE was slightly affected upon mutation of these residues. Taken together, these data suggest that the residues examined here mediate CE binding and may also be important for the catalytic activity of AHAS. This study will pave the way for future structure-function studies of CE and will also aid the development of novel anti-tuberculosis agents based on this chemical scaffold. PMID:26215340

  19. S100A1 and Calmodulin Compete for the Same Binding Site on Ryanodine Receptor*

    PubMed Central

    Wright, Nathan T.; Prosser, Benjamin L.; Varney, Kristen M.; Zimmer, Danna B.; Schneider, Martin F.; Weber, David J.


    In heart and skeletal muscle an S100 protein family member, S100A1, binds to the ryanodine receptor (RyR) and promotes Ca2+ release. Using competition binding assays, we further characterized this system in skeletal muscle and showed that Ca2+-S100A1 competes with Ca2+-calmodulin (CaM) for the same binding site on RyR1. In addition, the NMR structure was determined for Ca2+-S100A1 bound to a peptide derived from this CaM/S100A1 binding domain, a region conserved in RyR1 and RyR2 and termed RyRP12 (residues 3616-3627 in human RyR1). Examination of the S100A1-RyRP12 complex revealed residues of the helical RyRP12 peptide (Lys-3616, Trp-3620, Lys-3622, Leu-3623, Leu-3624, and Lys-3626) that are involved in favorable hydrophobic and electrostatic interactions with Ca2+-S100A1. These same residues were shown previously to be important for RyR1 binding to Ca2+-CaM. A model for regulating muscle contraction is presented in which Ca2+-S100A1 and Ca2+-CaM compete directly for the same binding site on the ryanodine receptor. PMID:18650434

  20. A Large-Scale Assessment of Nucleic Acids Binding Site Prediction Programs.


    Miao, Zhichao; Westhof, Eric


    Computational prediction of nucleic acid binding sites in proteins are necessary to disentangle functional mechanisms in most biological processes and to explore the binding mechanisms. Several strategies have been proposed, but the state-of-the-art approaches display a great diversity in i) the definition of nucleic acid binding sites; ii) the training and test datasets; iii) the algorithmic methods for the prediction strategies; iv) the performance measures and v) the distribution and availability of the prediction programs. Here we report a large-scale assessment of 19 web servers and 3 stand-alone programs on 41 datasets including more than 5000 proteins derived from 3D structures of protein-nucleic acid complexes. Well-defined binary assessment criteria (specificity, sensitivity, precision, accuracy…) are applied. We found that i) the tools have been greatly improved over the years; ii) some of the approaches suffer from theoretical defects and there is still room for sorting out the essential mechanisms of binding; iii) RNA binding and DNA binding appear to follow similar driving forces and iv) dataset bias may exist in some methods. PMID:26681179

  1. Deconstructing the DGAT1 Enzyme: Membrane Interactions at Substrate Binding Sites

    PubMed Central

    Lopes, Jose L. S.; Beltramini, Leila M.; Wallace, Bonnie A.; Araujo, Ana P. U.


    Diacylglycerol acyltransferase 1 (DGAT1) is a key enzyme in the triacylglyceride synthesis pathway. Bovine DGAT1 is an endoplasmic reticulum membrane-bound protein associated with the regulation of fat content in milk and meat. The aim of this study was to evaluate the interaction of DGAT1 peptides corresponding to putative substrate binding sites with different types of model membranes. Whilst these peptides are predicted to be located in an extramembranous loop of the membrane-bound protein, their hydrophobic substrates are membrane-bound molecules. In this study, peptides corresponding to the binding sites of the two substrates involved in the reaction were examined in the presence of model membranes in order to probe potential interactions between them that might influence the subsequent binding of the substrates. Whilst the conformation of one of the peptides changed upon binding several types of micelles regardless of their surface charge, suggesting binding to hydrophobic domains, the other peptide bound strongly to negatively-charged model membranes. This binding was accompanied by a change in conformation, and produced leakage of the liposome-entrapped dye calcein. The different hydrophobic and electrostatic interactions observed suggest the peptides may be involved in the interactions of the enzyme with membrane surfaces, facilitating access of the catalytic histidine to the triacylglycerol substrates. PMID:25719207

  2. Evaluation of water displacement energetics in protein binding sites with grid cell theory.


    Gerogiokas, G; Southey, M W Y; Mazanetz, M P; Heifetz, A; Hefeitz, A; Bodkin, M; Law, R J; Michel, J


    Excess free energies, enthalpies and entropies of water in protein binding sites were computed via classical simulations and Grid Cell Theory (GCT) analyses for three pairs of congeneric ligands in complex with the proteins scytalone dehydratase, p38α MAP kinase and EGFR kinase respectively. Comparative analysis is of interest since the binding modes for each ligand pair differ in the displacement of one binding site water molecule, but significant variations in relative binding affinities are observed. Protocols that vary in their use of restraints on protein and ligand atoms were compared to determine the influence of protein-ligand flexibility on computed water structure and energetics, and to assess protocols for routine analyses of protein-ligand complexes. The GCT-derived binding affinities correctly reproduce experimental trends, but the magnitude of the predicted changes in binding affinities is exaggerated with respect to results from a previous Monte Carlo Free Energy Perturbation study. Breakdown of the GCT water free energies into enthalpic and entropic components indicates that enthalpy changes dominate the observed variations in energetics. In EGFR kinase GCT analyses revealed that replacement of a pyrimidine by a cyanopyridine perturbs water energetics up three hydration shells away from the ligand. PMID:25600031

  3. Identification of a mitochondrial-binding site on the N-terminal end of hexokinase II

    PubMed Central

    Bryan, Nadezda; Raisch, Kevin P.


    Hexokinase II (HKII) is responsible for the first step in the glycolysis pathway by adding a phosphate on to the glucose molecule so it can proceed down the pathway to produce the energy for continuous cancer cell growth. Tumour cells overexpress the HKII enzyme. In fact, it is the overexpression of the HKII enzyme that makes the diagnosis of cancer possible when imaged by positron emission tomography (PET). HKII binds to the voltage-dependent anion channel (VDAC) located on the mitochondrial outer membrane (MOM). When bound to the MOM, HKII is blocking a major cell death pathway. Thus, HKII is responsible for two characteristics of cancer cells, rapid tumour growth and inability of cancer cells to undergo apoptosis. One method to identify novel compounds that may interfere with the HKII–VDAC-binding site is to create a molecular model using the crystal structure of HKII. However, the amino acid(s) responsible for HKII binding to VDAC are not known. Therefore, a series of truncations and point mutations were made to the N-terminal end of HKII to identify the binding site to VDAC. Deletions of the first 10 and 20 amino acids indicated that important amino acid(s) for binding were located within the first 10 amino acids. Next, a series of point mutations were made within the first 10 amino acids. It is clear from the immunofluorescence images and immunoblot results that mutating the fifth amino acid from histidine to proline completely abolished binding to the MOM. PMID:26182367

  4. Compact, universal DNA microarrays to comprehensively determine transcription-factor binding site specificities

    PubMed Central

    Berger, Michael F.; Philippakis, Anthony A.; Qureshi, Aaron M.; He, Fangxue S.; Estep, Preston W.; Bulyk, Martha L.


    Transcription factors (TFs) regulate the expression of genes involved in myriad cellular processes through sequence-specific interactions with DNA. In order to predict DNA regulatory elements and the TFs targeting them with greater accuracy, detailed knowledge of the binding preferences of TFs is needed. Protein binding microarray (PBM) technology permits rapid, high-throughput characterization of the in vitro DNA binding specificities of proteins1. Here, we present a novel, maximally compact, synthetic DNA sequence design that represents all possible DNA sequence variants of a given length k (i.e., all “k-mers”) on a single, universal microarray. We constructed such all k-mer microarrays covering all 10 base pair (bp) binding sites by converting high-density single-stranded oligonucleotide arrays to double-stranded DNA arrays. Using these microarrays, we comprehensively determined the binding specificities over a full range of affinities for five TFs of diverse structural classes from yeast, worm, mouse, and human. Importantly, the unbiased coverage of all k-mers permits an interrogation of binding site preferences, including nucleotide interdependencies, at unprecedented resolution. PMID:16998473

  5. Pathogenesis of Shigella diarrhea: rabbit intestinal cell microvillus membrane binding site for Shigella toxin

    SciTech Connect

    Fuchs, G.; Mobassaleh, M.; Donohue-Rolfe, A.; Montgomery, R.K.; Grand, R.J.; Keusch, G.T.


    This study examined the binding of purified /sup 125/I-labeled shigella toxin to rabbit jejunal microvillus membranes (MVMs). Toxin binding was concentration dependent, saturable, reversible, and specifically inhibited by unlabeled toxin. The calculated number of toxin molecules bound at 4/sup 0/C was 7.9 X 10(10) (3 X 10(10) to 2 X 10(11))/micrograms of MVM protein or 1.2 X 10(6) per enterocyte. Scatchard analysis showed the binding site to be of a single class with an equilibrium association constant, K, of 4.7 X 10(9) M-1 at 4/sup 0/C. Binding was inversely related to the temperature of incubation. A total of 80% of the labeled toxin binding at 4/sup 0/C dissociated from MVM when the temperature was raised to 37/sup 0/C, but reassociated when the temperature was again brought to 4/sup 0/C. There was no structural or functional change of MVM due to toxin as monitored by electron microscopy or assay of MVM sucrase activity. These studies demonstrate a specific binding site for shigella toxin on rabbit MVMs. The physiological relevance of this receptor remains to be determined.

  6. Common binding site for disialyllactose and tri-peptide in C-fragment of tetanus neurotoxin.


    Jayaraman, Seetharaman; Eswaramoorthy, Subramaniam; Kumaran, Desigan; Swaminathan, Subramanyam


    Clostridial neurotoxins are comprised of botulinum (BoNT) and tetanus (TeNT), which share significant structural and functional similarity. Crystal structures of the binding domain of TeNT complexed with disialyllactose (DiSia) and a tri-peptide Tyr-Glu-Trp (YEW) have been determined to 2.3 and 2.2 A, respectively. Both DiSia and YEW bind in a shallow cleft region on the surface of the molecule in the beta-trefoil domain, interacting with a set of common residues, Asp1147, Asp1214, Asn1216, and Arg1226. DiSia and YEW binding at the same site in tetanus toxin provides a putative site that could be occupied either by a ganglioside moiety or a peptide. Soaking experiments with a mixture of YEW and DiSia show that YEW competes with DiSia, suggesting that YEW can be used to block ganglioside binding. A comparison with the TeNT binding domain in complex with small molecules, BoNT/A and /B, provides insight into the different modes of ganglioside binding. PMID:16104015

  7. A Large-Scale Assessment of Nucleic Acids Binding Site Prediction Programs

    PubMed Central

    Miao, Zhichao; Westhof, Eric


    Computational prediction of nucleic acid binding sites in proteins are necessary to disentangle functional mechanisms in most biological processes and to explore the binding mechanisms. Several strategies have been proposed, but the state-of-the-art approaches display a great diversity in i) the definition of nucleic acid binding sites; ii) the training and test datasets; iii) the algorithmic methods for the prediction strategies; iv) the performance measures and v) the distribution and availability of the prediction programs. Here we report a large-scale assessment of 19 web servers and 3 stand-alone programs on 41 datasets including more than 5000 proteins derived from 3D structures of protein-nucleic acid complexes. Well-defined binary assessment criteria (specificity, sensitivity, precision, accuracy…) are applied. We found that i) the tools have been greatly improved over the years; ii) some of the approaches suffer from theoretical defects and there is still room for sorting out the essential mechanisms of binding; iii) RNA binding and DNA binding appear to follow similar driving forces and iv) dataset bias may exist in some methods. PMID:26681179

  8. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.


    Drake, Andrew W; Klakamp, Scott L


    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data. PMID:17141800

  9. Locating the binding sites of antioxidants resveratrol, genistein and curcumin with tRNA.


    N'soukpoé-Kossi, C N; Bourassa, P; Mandeville, J S; Bekale, L; Bariyanga, J; Tajmir-Riahi, H A


    We located the binding sites of antioxidants resveratrol, genistein and curcumin on tRNA in aqueous solution at physiological conditions using constant tRNA concentration and various polyphenol contents. FTIR, UV-visible, CD spectroscopic methods and molecular modeling were used to determine polyphenol binding sites, the binding constant and the effects of polyphenol complexation on tRNA conformation and particle formation. Structural analysis showed that polyphenols bind tRNA via G-C and A-U base pairs through hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of K(res-tRNA)=8.95(±0.80)×10(3) M(-1), K(gen-tRNA)=3.07(±0.5)×10(3) M(-1) and K(cur-tRNA)=1.55(±0.3)×10(4) M(-1). Molecular modeling showed the participation of several nucleobases in polyphenol-tRNA adduct formation with free binding energy of -4.43 for resveratrol, -4.26 kcal/mol for genistein and -4.84 kcal/mol for curcumin, indicating that the interaction process is spontaneous at room temperature. While tRNA remains in A-family structure, major biopolymer aggregation and particle formation occurred at high polyphenol contents. PMID:26093317

  10. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.


    Chukwudi, Chinwe U


    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  11. Structural Studies of GABAA Receptor Binding Sites: Which Experimental Structure Tells us What?


    Puthenkalam, Roshan; Hieckel, Marcel; Simeone, Xenia; Suwattanasophon, Chonticha; Feldbauer, Roman V; Ecker, Gerhard F; Ernst, Margot


    Atomic resolution structures of cys-loop receptors, including one of a γ-aminobutyric acid type A receptor (GABAA receptor) subtype, allow amazing insights into the structural features and conformational changes that these pentameric ligand-gated ion channels (pLGICs) display. Here we present a comprehensive analysis of more than 30 cys-loop receptor structures of homologous proteins that revealed several allosteric binding sites not previously described in GABAA receptors. These novel binding sites were examined in GABAA receptor homology models and assessed as putative candidate sites for allosteric ligands. Four so far undescribed putative ligand binding sites were proposed for follow up studies based on their presence in the GABAA receptor homology models. A comprehensive analysis of conserved structural features in GABAA and glycine receptors (GlyRs), the glutamate gated ion channel, the bacterial homologs Erwinia chrysanthemi (ELIC) and Gloeobacter violaceus GLIC, and the serotonin type 3 (5-HT3) receptor was performed. The conserved features were integrated into a master alignment that led to improved homology models. The large fragment of the intracellular domain that is present in the structure of the 5-HT3 receptor was utilized to generate GABAA receptor models with a corresponding intracellular domain fragment. Results of mutational and photoaffinity ligand studies in GABAA receptors were analyzed in the light of the model structures. This led to an assignment of candidate ligands to two proposed novel pockets, candidate binding sites for furosemide and neurosteroids in the trans-membrane domain were identified. The homology models can serve as hypotheses generators, and some previously controversial structural interpretations of biochemical data can be resolved in the light of the presented multi-template approach to comparative modeling. Crystal and cryo-EM microscopic structures of the closest homologs that were solved in different conformational

  12. A novel lipid binding site formed by the MAP kinase insert in p38 alpha.


    Diskin, Ron; Engelberg, David; Livnah, Oded


    The p38 mitogen-activated protein (MAP) kinases function as signaling molecules essential for many cellular processes, particularly mediating stress response. The activity of p38 MAP kinases is meticulously regulated to reach the desired cellular phenotype. Several alternative activation and attenuation mechanisms have been characterized recently which include new phosphorylation sites. Here we present the crystal structure of p38 alpha MAP kinase in complex with n-octyl-beta-glucopyranoside detergent. The complex unveils a novel lipid-binding site formed by a local conformational change of the MAP kinase insert. This binding is the first attribution for a possible role of the MAP kinase insert in p38. The binding site can accommodate a large selection of lipidic molecules. In addition, we also show via biophysical methods that arachidonic acid and its derivatives bind p38 alpha in vitro. Based on our analysis we propose that the binding of lipids could fine-tune p38 alpha catalytic activity towards a preferred phenotype. PMID:17999933

  13. Heterosubtypic antibody recognition of the influenza virus hemagglutinin receptor binding site enhanced by avidity

    PubMed Central

    Lee, Peter S.; Yoshida, Reiko; Ekiert, Damian C.; Sakai, Naoki; Suzuki, Yasuhiko; Takada, Ayato; Wilson, Ian A.


    Continual and rapid mutation of seasonal influenza viruses by antigenic drift necessitates the almost annual reformulation of flu vaccines, which may offer little protection if the match to the dominant circulating strain is poor. S139/1 is a cross-reactive antibody that neutralizes multiple HA strains and subtypes, including those from H1N1 and H3N2 viruses that currently infect humans. The crystal structure of the S139/1 Fab in complex with the HA from the A/Victoria/3/1975 (H3N2) virus reveals that the antibody targets highly conserved residues in the receptor binding site and contacts antigenic sites A, B, and D. Binding and plaque reduction assays show that the monovalent Fab alone can protect against H3 strains, but the enhanced avidity from binding of bivalent IgG increases the breadth of neutralization to additional strains from the H1, H2, H13, and H16 subtypes. Thus, antibodies making relatively low affinity Fab interactions with the receptor binding site can have significant antiviral activity when enhanced by avidity through bivalent interactions of the IgG, thereby extending the breadth of binding and neutralization to highly divergent influenza virus strains and subtypes. PMID:23027945

  14. H274Y's Effect on Oseltamivir Resistance: What Happens Before the Drug Enters the Binding Site.


    Yusuf, Muhammad; Mohamed, Nornisah; Mohamad, Suriyati; Janezic, Dusanka; Damodaran, K V; Wahab, Habibah A


    Increased reports of oseltamivir (OTV)-resistant strains of the influenza virus, such as the H274Y mutation on its neuraminidase (NA), have created some cause for concern. Many studies have been conducted in the attempt to uncover the mechanism of OTV resistance in H274Y NA. However, most of the reported studies on H274Y focused only on the drug-bound system, so the direct effects of the mutation on NA itself prior to drug binding still remain unclear. Therefore, molecular dynamics simulations of NA in apo form, followed by principal component analysis and interaction energy calculations, were performed to investigate the structural changes of the NA binding site as a result of the H274Y mutation. It was observed that the disruption of the NA binding site due to the H274Y mutation was initiated by the repulsive effect of Y274 on the 250-loop, which in turn altered the hydrogen-bonding network around residue 274. The rotated W295 side chain caused the upward movement of the 340-loop. Consequently, sliding box docking results suggested that the binding pathway of OTV was compromised because of the disruption of this binding site. This study also highlighted the importance of the functional group at C6 of the sialic acid mimicry. It is hoped that these results will improve the understanding of OTV resistance and shed some light on the design of a novel anti-influenza drug. PMID:26703840

  15. Molecular environment of the phencyclidine binding site in the nicotinic acetylcholine receptor membrane

    SciTech Connect

    Palma, A.L.; Wang, H.H. )


    Phencyclidine is a highly specific noncompetitive inhibitor of the nicotinic acetylcholine receptor. In a novel approach to study this site, a spin-labeled analogue of phencyclidine, 4-phenyl-4-(1-piperidinyl)-2,2,6,6-tetramethylpiperidinoxyl (PPT) was synthesized. The binding of PPT inhibits 86Rb flux (IC50 = 6.6 microM), and (3H)phencyclidine binding to both resting and desensitized acetylcholine receptor (IC50 = 17 microM and 0.22 microM, respectively). From an indirect Hill plot of the inhibition of (3H)phencyclidine binding by PPT, a Hill coefficient of approximately one was obtained in the presence of carbamylcholine and 0.8 in alpha-bungarotoxin-treated preparations. Taken together, these results indicate that PPT mimics phencyclidine in its ability to bind to the noncompetitive inhibitor site and is functionally active in blocking ion flux across the acetylcholine receptor channel. Analysis of the electron spin resonance signal of the bound PPT suggests that the environment surrounding the probe within the ion channel is hydrophobic, with a hydrophobicity parameter of 1.09. A dielectric constant for the binding site was estimated to be in the range of 2-3 units.

  16. Two disparate ligand binding sites in the human P2Y1 receptor

    PubMed Central

    Zhang, Dandan; Gao, Zhan-Guo; Zhang, Kaihua; Kiselev, Evgeny; Crane, Steven; Wang, Jiang; Paoletta, Silvia; Yi, Cuiying; Ma, Limin; Zhang, Wenru; Han, Gye Won; Liu, Hong; Cherezov, Vadim; Katritch, Vsevolod; Jiang, Hualiang; Stevens, Raymond C.; Jacobson, Kenneth A.; Zhao, Qiang; Wu, Beili


    In response to adenosine 5′-diphosphate, the P2Y1 receptor (P2Y1R) facilitates platelet aggregation, and thus serves as an important antithrombotic drug target. Here we report the crystal structures of the human P2Y1R in complex with a nucleotide antagonist MRS2500 at 2.7Å resolution, and with a non-nucleotide antagonist BPTU at 2.2Å resolution. The structures reveal two distinct ligand binding sites, providing atomic details of P2Y1R’s unique ligand binding modes. MRS2500 recognizes a binding site within the seven transmembrane bundle of P2Y1R, which, however, is different in shape and location from the nucleotide binding site in previously determined P2Y12R structure. BPTU binds to an allosteric pocket on the external receptor interface with the lipid bilayer, making it the first structurally characterized selective G protein-coupled receptor (GPCR) ligand located entirely outside of the helical bundle. These high-resolution insights into P2Y1R should enable discovery of new orthosteric and allosteric antithrombotic drugs with reduced adverse effects. PMID:25822790

  17. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

    SciTech Connect

    Shen, Aimee; Higgins, Darren E.; Panne, Daniel


    The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity. The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.

  18. Comparative binding character of two general anaesthetics for sites on human serum albumin.

    PubMed Central

    Liu, Renyu; Meng, Qingcheng; Xi, Jin; Yang, Jinsheng; Ha, Chung-Eun; Bhagavan, Nadhipuram V; Eckenhoff, Roderic G


    Propofol and halothane are clinically used general anaesthetics, which are transported primarily by HSA (human serum albumin) in the blood. Binding characteristics are therefore of interest for both the pharmacokinetics and pharmacodynamics of these drugs. We characterized anaesthetic-HSA interactions in solution using elution chromatography, ITC (isothermal titration calorimetry), hydrogen-exchange experiments and geometric analyses of high-resolution structures. Binding affinity of propofol to HSA was determined to have a K(d) of 65 microM and a stoichiometry of approx. 2, whereas the binding of halothane to HSA showed a K(d) of 1.6 mM and a stoichiometry of approx. 7. Anaesthetic-HSA interactions are exothermic, with propofol having a larger negative enthalpy change relative to halothane. Hydrogen-exchange studies in isolated recombinant domains of HSA showed that propofol-binding sites are primarily found in domain III, whereas halothane sites are more widely distributed. Both location and stoichiometry from these solution studies agree with data derived from X-ray crystal-structure studies, and further analyses of the architecture of sites from these structures suggested that greater hydrophobic contacts, van der Waals interactions and hydrogen-bond formation account for the stronger binding of propofol as compared with the less potent anaesthetic, halothane. PMID:14759223

  19. An information transmission model for transcription factor binding at regulatory DNA sites

    PubMed Central


    Background Computational identification of transcription factor binding sites (TFBSs) is a rapid, cost-efficient way to locate unknown regulatory elements. With increased potential for high-throughput genome sequencing, the availability of accurate computational methods for TFBS prediction has never been as important as it currently is. To date, identifying TFBSs with high sensitivity and specificity is still an open challenge, necessitating the development of novel models for predicting transcription factor-binding regulatory DNA elements. Results Based on the information theory, we propose a model for transcription factor binding of regulatory DNA sites. Our model incorporates position interdependencies in effective ways. The model computes the information transferred (TI) between the transcription factor and the TFBS during the binding process and uses TI as the criterion to determine whether the sequence motif is a possible TFBS. Based on this model, we developed a computational method to identify TFBSs. By theoretically proving and testing our model using both real and artificial data, we found that our model provides highly accurate predictive results. Conclusions In this study, we present a novel model for transcription factor binding regulatory DNA sites. The model can provide an increased ability to detect TFBSs. PMID:22672438

  20. Quantitative distribution of angiotensin II binding sites in rat brain by autoradiography

    SciTech Connect

    Saavedra, J.M.; Israel, A.; Plunkett, L.M.; Kurihara, M.; Shigematsu, K.; Correa, F.M.


    Angiotensin II binding sites were localized and quantified in individual brain nuclei from single rats by incubation of tissue sections with 1 nM /sup 125/I-(Sar1)-angiotensin II, (/sup 3/H)-Ultrofilm autoradiography, computerized microdensitometry and comparison with /sup 125/I-standards. High angiotensin II binding was present in the circumventricular organs (organon vasculosum laminae terminalis, organon subfornicalis and area postrema), in selected hypothalamic nuclei (nuclei suprachiasmatis, periventricularis and paraventricularis) and in the nucleus tractus olfactorii lateralis, the nucleus preopticus medianus, the dorsal motor nucleus of the vagus and the nucleus tractus solitarii. High affinity (KA from 0.3 to 1.5 X 10(9) M-1) angiotensin II binding sites were demonstrated in the organon subfornicalis, the nucleus tractus solitarii and the area postrema after incubation of consecutive sections from single rat brains with /sup 125/I-(Sar1)-angiotensin II in concentrations from 100 pM to 5 nM. These results demonstrate and characterize brain binding sites for angiotensin II of variable high affinity binding both inside and outside the blood-brain barrier.

  1. Novel TCF-binding sites specify transcriptional repression by Wnt signalling.


    Blauwkamp, Timothy A; Chang, Mikyung V; Cadigan, Ken M


    Both transcriptional activation and repression have essential functions in maintaining proper spatial and temporal control of gene expression. Although Wnt signalling is often associated with gene activation, we have identified several directly repressed targets of Wnt signalling in Drosophila. Here, we explore how individual Wnt target genes are specified for signal-induced activation or repression. Similar to activation, repression required binding of Armadillo (Arm) to the N terminus of TCF. However, TCF/Arm mediated repression by binding to DNA motifs that are markedly different from typical TCF-binding sites. Conversion of the novel motifs to standard TCF-binding sites reversed the mode of regulation, resulting in Wnt-mediated activation instead of repression. A mutant form of Arm defective in activation was still functional for repression, indicating that distinct domains of the protein are required for each activity. This study suggests that the sequence of TCF-binding sites allosterically regulates the TCF/Arm complex to effect either transcriptional activation or repression. PMID:18418383

  2. Binding of transcription factor GabR to DNA requires recognition of DNA shape at a location distinct from its cognate binding site.


    Al-Zyoud, Walid A; Hynson, Robert M G; Ganuelas, Lorraine A; Coster, Adelle C F; Duff, Anthony P; Baker, Matthew A B; Stewart, Alastair G; Giannoulatou, Eleni; Ho, Joshua W K; Gaus, Katharina; Liu, Dali; Lee, Lawrence K; Böcking, Till


    Mechanisms for transcription factor recognition of specific DNA base sequences are well characterized and recent studies demonstrate that the shape of these cognate binding sites is also important. Here, we uncover a new mechanism where the transcription factor GabR simultaneously recognizes two cognate binding sites and the shape of a 29 bp DNA sequence that bridges these sites. Small-angle X-ray scattering and multi-angle laser light scattering are consistent with a model where the DNA undergoes a conformational change to bend around GabR during binding. In silico predictions suggest that the bridging DNA sequence is likely to be bendable in one direction and kinetic analysis of mutant DNA sequences with biolayer interferometry, allowed the independent quantification of the relative contribution of DNA base and shape recognition in the GabR-DNA interaction. These indicate that the two cognate binding sites as well as the bendability of the DNA sequence in between these sites are required to form a stable complex. The mechanism of GabR-DNA interaction provides an example where the correct shape of DNA, at a clearly distinct location from the cognate binding site, is required for transcription factor binding and has implications for bioinformatics searches for novel binding sites. PMID:26681693

  3. Binding of transcription factor GabR to DNA requires recognition of DNA shape at a location distinct from its cognate binding site

    PubMed Central

    Al-Zyoud, Walid A.; Hynson, Robert MG.; Ganuelas, Lorraine A.; Coster, Adelle CF.; Duff, Anthony P.; Baker, Matthew AB.; Stewart, Alastair G.; Giannoulatou, Eleni; Ho, Joshua WK.; Gaus, Katharina; Liu, Dali; Lee, Lawrence K.; Böcking, Till


    Mechanisms for transcription factor recognition of specific DNA base sequences are well characterized and recent studies demonstrate that the shape of these cognate binding sites is also important. Here, we uncover a new mechanism where the transcription factor GabR simultaneously recognizes two cognate binding sites and the shape of a 29 bp DNA sequence that bridges these sites. Small-angle X-ray scattering and multi-angle laser light scattering are consistent with a model where the DNA undergoes a conformational change to bend around GabR during binding. In silico predictions suggest that the bridging DNA sequence is likely to be bendable in one direction and kinetic analysis of mutant DNA sequences with biolayer interferometry, allowed the independent quantification of the relative contribution of DNA base and shape recognition in the GabR–DNA interaction. These indicate that the two cognate binding sites as well as the bendability of the DNA sequence in between these sites are required to form a stable complex. The mechanism of GabR–DNA interaction provides an example where the correct shape of DNA, at a clearly distinct location from the cognate binding site, is required for transcription factor binding and has implications for bioinformatics searches for novel binding sites. PMID:26681693

  4. Investigation of the Copper Binding Site And the Role of Histidine As a Ligand in Riboflavin Binding Protein

    SciTech Connect

    Smith, S.R.; Bencze, K.Z.; Russ, K.A.; Wasiukanis, K.; Benore-Parsons, M.; Stemmler, T.L.


    Riboflavin Binding Protein (RBP) binds copper in a 1:1 molar ratio, forming a distinct well-ordered type II site. The nature of this site has been examined using X-ray absorption and pulsed electron paramagnetic resonance (EPR) spectroscopies, revealing a four coordinate oxygen/nitrogen rich environment. On the basis of analysis of the Cambridge Structural Database, the average protein bound copper-ligand bond length of 1.96 {angstrom}, obtained by extended x-ray absorption fine structure (EXAFS), is consistent with four coordinate Cu(I) and Cu(II) models that utilize mixed oxygen and nitrogen ligand distributions. These data suggest a Cu-O{sub 3}N coordination state for copper bound to RBP. While pulsed EPR studies including hyperfine sublevel correlation spectroscopy and electron nuclear double resonance show clear spectroscopic evidence for a histidine bound to the copper, inclusion of a histidine in the EXAFS simulation did not lead to any significant improvement in the fit.

  5. Investigation of the Copper Binding Site and the Role of Histidine as a Ligand in Riboflavin Binding Protein

    PubMed Central

    Smith, Sheila R.; Bencze, Krisztina Z.; Russ, Kristen A.; Wasiukanis, Kristen; Benore-Parsons, Marilee; Stemmler, Timothy L.


    Riboflavin Binding Protein (RBP) binds copper in a 1:1 molar ratio, forming a distinct well-ordered type II site. The nature of this site has been examined using X-ray absorption and pulsed electron paramagnetic resonance (EPR) spectroscopies, revealing a four coordinate oxygen/nitrogen rich environment. On the basis of analysis of the Cambridge Structural Database, the average protein bound copper-ligand bond length of 1.96 Å, obtained by extended x-ray absorption fine structure (EXAFS), is consistent with four coordinate Cu(I) and Cu(II) models that utilize mixed oxygen and nitrogen ligand distributions. These data suggest a Cu–O3N coordination state for copper bound to RBP. While pulsed EPR studies including hyperfine sublevel correlation spectroscopy and electron nuclear double resonance show clear spectroscopic evidence for a histidine bound to the copper, inclusion of a histidine in the EXAFS simulation did not lead to any significant improvement in the fit. PMID:18593109

  6. Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites

    SciTech Connect

    Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong; Alam, Amer; Shi, Ning; Jiang, Youxing


    Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only the channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.

  7. Identification and characterization of Hoxa9 binding sites in hematopoietic cells.


    Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven; Hess, Jay L


    The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553

  8. Elucidation of binding mechanism and identification of binding site for an anti HIV drug, stavudine on human blood proteins.


    Sandhya, B; Hegde, Ashwini H; Seetharamappa, J


    The binding of stavudine (STV) to two human blood proteins [human hemoglobin (HHb) and human serum albumin (HSA)] was studied in vitro under simulated physiological conditions by spectroscopic methods viz., fluorescence, UV absorption, resonance light scattering, synchronous fluorescence, circular dichroism (CD) and three-dimensional fluorescence. The binding parameters of STV-blood protein were determined from fluorescence quenching studies. Stern-Volmer plots indicated the presence of static quenching mechanism in the interaction of STV with blood proteins. The values of n close to unity indicated that one molecule of STV bound to one molecule of blood protein. The binding process was found to be spontaneous. Analysis of thermodynamic parameters revealed the presence of hydrogen bond and van der Waals forces between protein and STV. Displacement experiments indicated the binding of STV to Sudlow's site I on HSA. Secondary structures of blood proteins have undergone changes upon interaction with STV as evident from the reduction of α-helices (from 46.11% in free HHb to 38.34% in STV-HHb, and from 66.44% in free HSA to 52.26% in STV-HSA). Further, the alterations in secondary structures of proteins in the presence of STV were confirmed by synchronous and 3D-fluorescence spectral data. The distance between the blood protein (donor) and acceptor (STV) was found to be 5.211 and 5.402 nm for STV-HHb and STV-HSA, respectively based on Föster's non-radiative energy transfer theory. Effect of some metal ions was also investigated. The fraction of STV bound to HSA was found to be 87.8%. PMID:23275205

  9. Specific binding sites for proadrenomedullin N-terminal 20 peptide (PAMP) in the rat.


    Iwasaki, H; Hirata, Y; Iwashina, M; Sato, K; Marumo, F


    Adrenomedullin (AM), a potent and novel vasodilator 52-residue peptide originally isolated from pheochromocytoma, is processed from a precursor molecule (preproAM) in which another unique 20-residue sequence, termed proadrenomedullin N-terminal 20 peptide (PAMP), exists. Using [125I Tyr0] rat PAMP as a radioligand, we have examined PAMP binding sites in various rat tissues and cultured vascular smooth muscle cells (VSMC) from rat aorta. Specific binding sites for rat PAMP, although very low, were widely distributed in various rat tissues examined. The relatively more abundant sites were present in aorta and adrenal glands, followed by lung, kidney, brain, spleen, and heart. An equilibrium binding study using cultured rat VSMC revealed the presence of a single class of high-affinity [dissociation constant (Kd): 3.5 x 10(-8) M] binding sites for rat PAMP with a maximal binding capacity of 4.5 x 10(6) sites per cell. Binding studies revealed that synthetic rat PAMP(1-19)-NH2 was about 10-fold less potent, and rat PAMP(1-20)-OH and human PAMP were about 20-fold less potent than rat PAMP(1-20)-NH2. SDS-polyacylamide gel electrophoresis after affinity-labeling of membranes from various rat tissues (aorta, adrenal glands, lung) and VSMC revealed a distinct labeled band with the apparent molecular mass of 90 kDa, which was diminished by excess unlabeled rat PAMP. A nonhydrolyzable GTP analog (GTP-gammaS) dose-dependently reduced binding of [125I] rat PAMP to VSMC membranes, while ATP-gammaS had no effect. Neither cyclic AMP nor inositol-1,4,5-triphosphate formation was affected by rat PAMP in rat VSMC. The present study demonstrates for the first time that PAMP receptors are widely distributed in various rat tissues, among which aorta and adrenal glands have the most abundant sites. Our data suggest that PAMP receptors are functionally coupled to G-proteins, although its signal transduction remains obscure. The present study also shows that amidation of C-terminal residue

  10. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    SciTech Connect

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.; Herkenham, M.


    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu binding sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.

  11. Aspects of 1,25-dihydroxyvitamin D3 binding sites in fish: an autoradiographic study.


    Bidman, H J; Radu, I; Stumpf, W E


    The distribution of specific binding sites for vitamin D3 in adult female and male Xiphophorus helleri is studies after injection of tritiated 1,25-dihydroxyvitamin D3 (vitamin D) by thaw-mount autoradiography. Five hours after injection of labeled vitamin D specific nuclear binding is present in brain, pituitary, skin, gills, cartilage, gut, liver, pancreas, spleen, kidney, muscle, ovary, and testis. Cytoplasmic binding exists strongest in gills, gut, and kidney while it is comparatively weak in hepatocytes. In reproductive organs cytoplasmic retention of radioactivity is also present in oocytes. Weak nuclear labeling exists in interstitial cells in ovary. Conspicuous nuclear labeling exists in active lobules of testis, while inactive lobules show occasionally a few labeled cells. The results demonstrate specific binding and retention of vitamin D in many target organs of teleost fish, suggesting an extensive and multifunctional regulatory role of this steroid hormone of sunlight. PMID:9747110

  12. Adeno-Associated Virus Type 2 Rep68 Can Bind to Consensus Rep-Binding Sites on the Herpes Simplex Virus 1 Genome

    PubMed Central

    Seyffert, Michael; Glauser, Daniel L.; Tobler, Kurt; Georgiev, Oleg; Vogel, Rebecca; Vogt, Bernd; Agúndez, Leticia; Linden, Michael; Büning, Hildegard; Ackermann, Mathias


    Adeno-associated virus type 2 is known to inhibit replication of herpes simplex virus 1 (HSV-1). This activity has been linked to the helicase- and DNA-binding domains of the Rep68/Rep78 proteins. Here, we show that Rep68 can bind to consensus Rep-binding sites on the HSV-1 genome and that the Rep helicase activity can inhibit replication of any DNA if binding is facilitated. Therefore, we hypothesize that inhibition of HSV-1 replication involves direct binding of Rep68/Rep78 to the HSV-1 genome. PMID:26292324

  13. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    SciTech Connect

    Lerch, Thomas F.; Chapman, Michael S.


    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites of AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.

  14. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    SciTech Connect

    Lerch, Thomas F.; Chapman, Michael S.


    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites of AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.

  15. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting

    PubMed Central

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye


    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  16. Identification and mapping of nucleotide binding site-leucine rich repeat resistance gene analogs in bermudagrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty-one bermudagrass (Cynodon spp.) disease resistance gene homologs (BRGH) were cloned and sequenced from diploid, triploid, and hexaploid bermudagrass using degenerate primers to target the nucleotide binding site (NBS) of the NBS- leucine rich repeat (LRR) resistance gene family. Alignment of ...

  17. Discovery of dual binding site acetylcholinesterase inhibitors identified by pharmacophore modeling and sequential virtual screening techniques.


    Gupta, Shikhar; Fallarero, Adyary; Järvinen, Päivi; Karlsson, Daniela; Johnson, Mark S; Vuorela, Pia M; Mohan, C Gopi


    Dual binding site acetylcholinesterase (AChE) inhibitors are promising for the treatment of Alzheimer's disease (AD). They alleviate the cognitive deficits and AD-modifying agents, by inhibiting the β-amyloid (Aβ) peptide aggregation, through binding to both the catalytic and peripheral anionic sites, the so called dual binding site of the AChE enzyme. In this Letter, chemical features based 3D-pharmacophore models were developed based on the eight potent and structurally diverse AChE inhibitors (I-VIII) obtained from high-throughput in vitro screening technique. The best 3D-pharmacophore model, Hypo1, consists of two hydrogen-bond acceptor lipid, one hydrophobe, and two hydrophobic aliphatic features obtained by Catalyst/HIPHOP algorithm adopted in Discovery studio program. Hypo1 was used as a 3D query in sequential virtual screening study to filter three small compound databases. Further, a total of nine compounds were selected and followed on in vitro analysis. Finally, we identified two leads--Specs1 (IC(50)=3.279 μM) and Spec2 (IC(50)=5.986 μM) dual binding site compounds from Specs database, having good AChE enzyme inhibitory activity. PMID:21273074

  18. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

    PubMed Central

    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing


    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor ( is made available for free public accessible to the biological research community. PMID:27282833

  19. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting.


    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye


    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  20. Extraction of Functional Binding Sites from Unique Regulatory Regions: The Drosophila Early Developmental Enhancers

    PubMed Central

    Papatsenko, Dmitri A.; Makeev, Vsevolod J.; Lifanov, Alex P.; Régnier, Mireille; Nazina, Anna G.; Desplan, Claude


    The early developmental enhancers of Drosophila melanogaster comprise one of the most sophisticated regulatory systems in higher eukaryotes. An elaborate code in their DNA sequence translates both maternal and early embryonic regulatory signals into spatial distribution of transcription factors. One of the most striking features of this code is the redundancy of binding sites for these transcription factors (BSTF). Using this redundancy, we explored the possibility of predicting functional binding sites in a single enhancer region without any prior consensus/matrix description or evolutionary sequence comparisons. We developed a conceptually simple algorithm, Scanseq, that employs an original statistical evaluation for identifying the most redundant motifs and locates the position of potential BSTF in a given regulatory region. To estimate the biological relevance of our predictions, we built thorough literature-based annotations for the best-known Drosophila developmental enhancers and we generated detailed distribution maps for the most robust binding sites. The high statistical correlation between the location of BSTF in these experiment-based maps and the location predicted in silico by Scanseq confirmed the relevance of our approach. We also discuss the definition of true binding sites and the possible biological principles that govern patterning of regulatory regions and the distribution of transcriptional signals. PMID:11875036

  1. Synthesis of Zn-MOF incorporating titanium-hydrides as active sites binding H2 molecules

    NASA Astrophysics Data System (ADS)

    Kim, Jongsik; Ok Kim, Dong; Wook Kim, Dong; Sagong, Kil


    This paper describes the synthetic effort for a Zn-MOF imparting Ti-H as a preferential binding site potentially capturing H2 molecules via Kubas-type interaction. The formation mechanism of Ti-H innate to the final material was potentially demonstrated to follow a radical dissociation rather than a β-hydrogen elimination and a C-H reductive elimination.

  2. Multiple binding sites in the nicotinic acetylcholine receptors: An opportunity for polypharmacolgy.


    Iturriaga-Vásquez, Patricio; Alzate-Morales, Jans; Bermudez, Isabel; Varas, Rodrigo; Reyes-Parada, Miguel


    For decades, the development of selective compounds has been the main goal for chemists and biologists involved in drug discovery. However, diverse lines of evidence indicate that polypharmacological agents, i.e. those that act simultaneously at various protein targets, might show better profiles than selective ligands, regarding both efficacy and side effects. On the other hand, the availability of the crystal structure of different receptors allows a detailed analysis of the main interactions between drugs and receptors in a specific binding site. Neuronal nicotinic acetylcholine receptors (nAChRs) constitute a large and diverse family of ligand-gated ion channels (LGICs) that, as a product of its modulation, regulate neurotransmitter release, which in turns produce a global neuromodulation of the central nervous system. nAChRs are pentameric protein complexes in such a way that expression of compatible subunits can lead to various receptor assemblies or subtypes. The agonist binding site, located at the extracellular region, exhibits different properties depending on the subunits that conform the receptor. In the last years, it has been recognized that nAChRs could also contain one or more allosteric sites which could bind non-classical nicotinic ligands including several therapeutically useful drugs. The presence of multiple binding sites in nAChRs offers an interesting possibility for the development of novel polypharmacological agents with a wide spectrum of actions. PMID:26318763

  3. Alcohol-Binding Sites in Distinct Brain Proteins: The Quest for Atomic Level Resolution

    PubMed Central

    Howard, Rebecca J.; Slesinger, Paul A.; Davies, Daryl L.; Das, Joydip; Trudell, James R.; Harris, R. Adron


    Defining the sites of action of ethanol on brain proteins is a major prerequisite to understanding the molecular pharmacology of this drug. The main barrier to reaching an atomic-level understanding of alcohol action is the low potency of alcohols, ethanol in particular, which is a reflection of transient, low-affinity interactions with their targets. These mechanisms are difficult or impossible to study with traditional techniques such as radioligand binding or spectroscopy. However, there has been considerable recent progress in combining X-ray crystallography, structural modeling, and site-directed mutagenesis to define the sites and mechanisms of action of ethanol and related alcohols on key brain proteins. We review such insights for several diverse classes of proteins including inwardly rectifying potassium, transient receptor potential, and neurotransmit-ter-gated ion channels, as well as protein kinase C epsilon. Some common themes are beginning to emerge from these proteins, including hydrogen bonding of the hydroxyl group and van der Waals interactions of the methylene groups of ethanol with specific amino acid residues. The resulting binding energy is proposed to facilitate or stabilize low-energy state transitions in the bound proteins, allowing ethanol to act as a “molecular lubricant” for protein function. We discuss evidence for characteristic, discrete alcohol-binding sites on protein targets, as well as evidence that binding to some proteins is better characterized by an interaction region that can accommodate multiple molecules of ethanol. PMID:21676006

  4. A Second RNA-Binding Site in the NS1 Protein of Influenza B Virus.


    Ma, Li-Chung; Guan, Rongjin; Hamilton, Keith; Aramini, James M; Mao, Lei; Wang, Shanshan; Krug, Robert M; Montelione, Gaetano T


    Influenza viruses cause a highly contagious respiratory disease in humans. The NS1 proteins of influenza A and B viruses (NS1A and NS1B proteins, respectively) are composed of two domains, a dimeric N-terminal domain and a C-terminal domain, connected by a flexible polypeptide linker. Here we report the 2.0-Å X-ray crystal structure and nuclear magnetic resonance studies of the NS1B C-terminal domain, which reveal a novel and unexpected basic RNA-binding site that is not present in the NS1A protein. We demonstrate that single-site alanine replacements of basic residues in this site lead to reduced RNA-binding activity, and that recombinant influenza B viruses expressing these mutant NS1B proteins are severely attenuated in replication. This novel RNA-binding site of NS1B is required for optimal influenza B virus replication. Most importantly, this study reveals an unexpected RNA-binding function in the C-terminal domain of NS1B, a novel function that distinguishes influenza B viruses from influenza A viruses. PMID:27545620

  5. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context.


    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing


    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor ( is made available for free public accessible to the biological research community. PMID:27282833

  6. AthaMap: from in silico data to real transcription factor binding sites.


    Bülow, Lorenz; Steffens, Nils Ole; Galuschka, Claudia; Schindler, Martin; Hehl, Reinhard


    AthaMap generates a map for cis-regulatory sequences for the whole Arabidopsis thaliana genome. AthaMap was initially developed by matrix-based detection of putative transcription factor binding sites (TFBS) mostly determined from random binding site selection experiments. Now, also experimentally verified TFBS have been included for 48 different Arabidopsis thaliana transcription factors (TF). Based on these sequences, 89,416 very similar putative TFBS were determined within the genome of A. thaliana and annotated to AthaMap. Matrix- and single sequence-based binding sites can be included in colocalization analysis for the identification of combinatorial cis-regulatory elements. As an example, putative target genes of the WRKY18 transcription factor that is involved in plant-pathogen interaction were determined. New functions of AthaMap include descriptions for all annotated Arabidopsis thaliana genes and direct links to TAIR, TIGR and MIPS. Transcription factors used in the binding site determination are linked to TAIR and TRANSFAC databases. AthaMap is freely available at PMID:16922688

  7. DNA binding induces active site conformational change in the human TREX2 3'-exonuclease.


    de Silva, Udesh; Perrino, Fred W; Hollis, Thomas


    The TREX enzymes process DNA as the major 3'-->5' exonuclease activity in mammalian cells. TREX2 and TREX1 are members of the DnaQ family of exonucleases and utilize a two metal ion catalytic mechanism of hydrolysis. The structure of the dimeric TREX2 enzyme in complex with single-stranded DNA has revealed binding properties that are distinct from the TREX1 protein. The TREX2 protein undergoes a conformational change in the active site upon DNA binding including ordering of active site residues and a shift of an active site helix. Surprisingly, even when a single monomer binds DNA, both monomers in the dimer undergo the structural rearrangement. From this we have proposed a model for DNA binding and 3' hydrolysis for the TREX2 dimer. The structure also shows how TREX proteins potentially interact with double-stranded DNA and suggest features that might be involved in strand denaturation to provide a single-stranded substrate for the active site. PMID:19321497

  8. External location of sites on pig erythrocyte membranes that bind nitrobenzylthioinosine

    SciTech Connect

    Agbanyo, F.R.; Cass, C.E.; Paterson, A.R.


    Nucleoside transport in erythrocytes of various species is inhibited by the binding of nitrobenzylthioinosine (NBMPR) to high affinity sites associated with nucleoside transport elements of the plasma membrane. The present study examined binding of (/sup 3/H)NBMPR to unsealed ghosts and to sealed right-side-out vesicles (ROVs) and inside-out vesicles (IOVs) prepared from pig erythrocytes. Kd values for NBMPR dissociation from the ligand-site complex in unsealed ghosts, ROVs and IOVs were similar (1.6-2.4 nM), and Bmax values (mean +/- SD) were, respectively, 22.2 +/- 5.5, 25.8 +/- 6.4, and 37.3 +/- 4.0 molecules/fg of protein, reflecting differences in the protein content of the membrane preparations. When temperatures were decreased from 22 degrees to 4 degrees, NBMPR binding to erythrocyte membrane preparations was reduced in IOVs relative to that in unsealed ghosts and ROVs. At 22 degrees, the association of NBMPR molecules with IOVs was slower than with ROVs and unsealed ghosts, differences that were virtually eliminated by permeabilization of the membrane preparations with saponin. Thus, the binding sites were more accessible to external NBMPR in sealed ROVs and unsealed ghosts than in sealed IOVs, indicating that the NBMPR sites are located on the extracellular aspect of the membrane.

  9. YY1 is autoregulated through its own DNA-binding sites

    PubMed Central

    Kim, Jeong Do; Yu, Sungryul; Kim, Joomyeong


    Background The transcription factor Yin Yang 1 (YY1) is a ubiquitously expressed, multifunctional protein that controls a large number of genes and biological processes in vertebrates. As a general transcription factor, the proper levels of YY1 protein need to be maintained for the normal function of cells and organisms. However, the mechanism for the YY1 homeostasis is currently unknown. Results The current study reports that the YY1 gene locus of all vertebrates contains a cluster of its own DNA-binding sites within the 1st intron. The intact structure of these DNA-binding sites is absolutely necessary for transcriptional activity of the YY1 promoter. In an inducible cell line system that over-expresses an exogenous YY1 gene, the overall increased levels of YY1 protein caused a reduction in transcription levels of the endogenous YY1 gene. Reversion to the normal levels of YY1 protein restored the transcriptional levels of the endogenous YY1 to normal levels. This homeostatic response was also mediated through its cluster of YY1 binding sites. Conclusion Taken together, the transcriptional level of YY1 is self-regulated through its internal DNA-binding sites. This study identifies YY1 as the first known autoregulating transcription factor in mammalian genomes. PMID:19712462

  10. Cross-linking of atrial natriuretic peptide to binding sites in rat olfactory bulb membranes

    SciTech Connect

    Wildey, G.M.; Glembotski, C.C.


    Binding sites for /sup 125/I-atrial natriuretic peptide (ANP)2 in rat olfactory bulb membranes have been studied using pharmacological and biochemical methods. Various unlabeled ANP-related peptides were tested for the ability to inhibit the binding of the radioligand in membrane binding assays. ANP(92-126) and ANP(99-126) were the most potent inhibitors tested, both exhibiting an IC50 value of 0.40 nM. ANP(103-126) and ANP(103-123) were 3 and 70 times less potent, respectively. ANP(111-126) was unable to inhibit the binding of the radioligand at a concentration of 1 microM. Several peptides unrelated to ANP were unable to inhibit the binding of the radioligand to rat olfactory bulb membranes. Membranes labeled with /sup 125/I-ANP were incubated with cross-linking agents and subjected to SDS-PAGE followed by autoradiography. A band possessing an apparent molecular mass of 116 kDa was identified. The labeling of this band was progressively decreased by increasing concentrations of unlabeled ANP(99-126) (IC50 = 0.6 nM) and by several other ANP-related peptides at nanomolar concentrations. For comparison purposes, ANP binding sites in rat aorta membranes were labeled with /sup 125/I-ANP and cross-linked using identical techniques. Three bands possessing molecular masses of 120, 72, and 62 kDa were identified. These results indicate that the ANP binding site in rat olfactory bulb membranes displays pharmacological and biochemical properties similar to peripheral ANP receptors.

  11. The binding site of the nicotinic acetylcholine receptor in animal species resistant to alpha-bungarotoxin.


    Barchan, D; Ovadia, M; Kochva, E; Fuchs, S


    The ligand binding site of the nicotinic acetylcholine receptor (AChR) is located in the alpha-subunit, within a small fragment containing the tandem cysteines at positions 192 and 193. We have been analyzing the binding site domain of AChRs from several animal species exhibiting various degrees of resistance to alpha-bungarotoxin (alpha-BTX). Our earlier work on the snake and mongoose AChR, both of which do not bind alpha-BTX, suggested that amino acid substitutions at positions 187, 189, and 194 of the AChR alpha-subunit are important in determining the resistance of these AChRs to alpha-BTX. In the present study, we have examined the correlation between alpha-BTX binding and the structure of the binding site domain of AChR from the hedgehog, shrew, cat, and human. Fragments of the AChR alpha-subunit corresponding to residues 122-205 from these species were cloned, sequenced, and expressed in Escherichia coli. The hedgehog fragment does not bind alpha-BTX, in common with the snake and mongoose AChR, and the human fragment is a partial binder. The shrew and cat fragments bind alpha-BTX to a similar extent as the mouse fragment. The hedgehog and human AChRs have nonaromatic amino acid residues at positions 187 and 189 of the alpha-subunit, as is seen with the "toxin resistant" snake and mongoose, and in contrast with the "toxin binders", which have aromatic residues at these two positions.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7619817

  12. Site-specific basicities regulate molecular recognition in receptor binding: in silico docking of thyroid hormones.


    Tóth, Gergő; Baska, Ferenc; Schretner, András; Rácz, Akos; Noszál, Béla


    Interactions between thyroid hormone α and β receptors and the eight protonation microspecies of each of the main thyroid hormones (thyroxine, liothyronine, and reverse liothyronine) were investigated and quantitated by molecular modeling. Flexible docking of the various protonation forms of thyroid hormones and high-affinity thyromimetics to the two thyroid receptors was carried out. In this method the role of the ionization state of each basic site could be studied in the composite process of molecular recognition. Our results quantitate at the molecular level how the ionization state and the charge distribution influence the protein binding. The anionic form of the carboxyl group (i.e., carboxylate site) is essential for protein binding, whereas the protonated form of amino group worsens the binding. The protonation state of the phenolate plays a less important role in the receptor affinity; its protonation, however, alters the electron density and the concomitant stacking propensity of the aromatic rings, resulting in a different binding score. The combined results of docking and microspeciation studies show that microspecies with the highest concentration at the pH of blood are not the strongest binding ones. The calculated binding free energy values can be well interpreted in terms of the interactions between the actual sites of the microspecies and the receptor amino acids. Our docking results were validated and compared with biological data from the literature. Since the thyroid hormone receptors influence several physiologic functions, such as metabolic rate, cholesterol and triglyceride levels, and heart frequency, our binding results provide a molecular basis for drug design and development in related therapeutic indications. PMID:23907234

  13. Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2

    PubMed Central

    Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.


    The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045

  14. (/sup 3/H) spiperone binding sites in rat primary cultures, C6 glioma, and B104 neuroblastoma

    SciTech Connect

    Severson, J.A.; de Vellis, J.S.; Finch, C.E.


    Binding sites for (/sup 3/H) spiperone were detected on membranes from primary glial cultures from neonatal rat cortex and striatum and from the C6 glioma cells. (/sup 3/H) spiperone binding was displacable by d-butaclamol. However, competition studies suggest that (/sup 3/H) spiperone binding to primary glial cultures was mainly to serotonergic sites, and binding to the C6 glioma was alpha-adrenergic. No specific binding was detected to membranes from B104 neuroblastoma cells. Although (/sup 3/H) spiperone binding to glial sites in whole striatum under generally used conditions is small (about 10%), the striatal glial hyperactivity which is often associated with neuronal degeneration could lead to an overestimation of presumed neuronal binding sites for dopaminergic ligands.

  15. Preliminary study of the metal binding site of an anti-DTPA-indium antibody by equilibrium binding immunoassays and immobilized metal ion affinity chromatography.


    Boden, V; Colin, C; Barbet, J; Le Doussal, J M; Vijayalakshmi, M


    Creating metal coordination sites by modifying an existing enzyme or by eliciting antibodies against metal chelate haptens is of great interest in biotechnology to create enzyme catalysts with novel specificities. Here, we investigate the metal binding potential of a monoclonal antibody raised against a DTPA-In(III) hapten (mAb 734). We study its relative binding efficiency to metals of biological relevance by equilibrium binding immunoassays and immobilized metal ion affinity chromatography, two approaches which can give complementary information regarding composition and/or structure of the metal binding site(s). Fe(III), Fe(II), Cu(II), Mg(II), Ca(II), and Zn(II) binding was compared to In(III). All of them were shown to displace indium, but their affinity for mAb 734 decreased by 100-fold compared to indium. Competitive metal binding immunoassays between Zn(II) and In(III) revealed an unusual behavior by Zn(II) which remains to be explained. Moreover, IMAC allowed us to predict the metal binding amino acids involved in the antibody paratope. The antibody metal binding site was shown to contain at least two histidine residues in a cluster, and the presence of aspartic and glutamic acid as well as cysteine residues could not be excluded. Thus, simple competition studies allows us to obtain some partial information on the metal binding structural features of this anti-metal chelate antibody and to guide our screening of its catalytic potential. PMID:7578356

  16. Conformational Sampling and Binding Site Assessment of Suppression of Tumorigenicity 2 Ectodomain

    PubMed Central

    Yang, Chao-Yie; Delproposto, James; Chinnaswamy, Krishnapriya; Brown, William Clay; Wang, Shuying; Stuckey, Jeanne A.; Wang, Xinquan


    Suppression of Tumorigenicity 2 (ST2), a member of the interleukin-1 receptor (IL-1R) family, activates type 2 immune responses to pathogens and tissue damage via binding to IL-33. Dysregulated responses contribute to asthma, graft-versus-host and autoinflammatory diseases and disorders. To study ST2 structure for inhibitor development, we performed the principal component (PC) analysis on the crystal structures of IL1-1R1, IL1-1R2, ST2 and the refined ST2 ectodomain (ST2ECD) models, constructed from previously reported small-angle X-ray scattering data. The analysis facilitates mapping of the ST2ECD conformations to PC subspace for characterizing structural changes. Extensive coverage of ST2ECD conformations was then obtained using the accelerated molecular dynamics simulations started with the IL-33 bound ST2ECD structure as instructed by their projected locations on the PC subspace. Cluster analysis of all conformations further determined representative conformations of ST2ECD ensemble in solution. Alignment of the representative conformations with the ST2/IL-33 structure showed that the D3 domain of ST2ECD (containing D1-D3 domains) in most conformations exhibits no clashes with IL-33 in the crystal structure. Our experimental binding data informed that the D1-D2 domain of ST2ECD contributes predominantly to the interaction between ST2ECD and IL-33 underscoring the importance of the D1-D2 domain in binding. Computational binding site assessment revealed one third of the total detected binding sites in the representative conformations may be suitable for binding to potent small molecules. Locations of these sites include the D1-D2 domain ST2ECD and modulation sites conformed to ST2ECD conformations. Our study provides structural models and analyses of ST2ECD that could be useful for inhibitor discovery. PMID:26735493

  17. Identification and Pharmacological Characterization of Multiple Allosteric Binding Sites on the Free Fatty Acid 1 Receptor

    PubMed Central

    Lin, Daniel C.-H.; Guo, Qi; Luo, Jian; Zhang, Jane; Nguyen, Kathy; Chen, Michael; Tran, Thanh; Dransfield, Paul J.; Brown, Sean P.; Houze, Jonathan; Vimolratana, Marc; Jiao, Xian Yun; Wang, Yingcai; Birdsall, Nigel J. M.


    Activation of FFA1 (GPR40), a member of G protein-coupling receptor family A, is mediated by medium- and long-chain fatty acids and leads to amplification of glucose-stimulated insulin secretion, suggesting a potential role for free fatty acid 1 (FFA1) as a target for type 2 diabetes. It was assumed previously that there is a single binding site for fatty acids and synthetic FFA1 agonists. However, using members of two chemical series of partial and full agonists that have been identified, radioligand binding interaction studies revealed that the full agonists do not bind to the same site as the partial agonists but exhibit positive heterotropic cooperativity. Analysis of functional data reveals positive functional cooperativity between the full agonists and partial agonists in various functional assays (in vitro and ex vivo) and also in vivo. Furthermore, the endogenous fatty acid docosahexaenoic acid (DHA) shows negative or neutral cooperativity with members of both series of agonists in