Immune Abnormalities in Patients with Autism.
ERIC Educational Resources Information Center
Warren, Reed P.; And Others
1986-01-01
A study of 31 autistic patients (3-28 years old) has revealed several immune-system abnormalities, including decreased numbers of T lymphocytes and an altered ratio of helper-to-suppressor T cells. Immune-system abnormalities may be directly related to underlying biologic processes of autism or an indirect reflection of the actual pathologic…
Amiri, Shayan; Haj-Mirzaian, Arya; Momeny, Majid; Amini-Khoei, Hossein; Rahimi-Balaei, Maryam; Poursaman, Simin; Rastegar, Mojgan; Nikoui, Vahid; Mokhtari, Tahmineh; Ghazi-Khansari, Mahmoud; Hosseini, Mir-Jamal
2017-01-06
Recent evidence indicates the involvement of inflammatory factors and mitochondrial dysfunction in the etiology of psychiatric disorders such as anxiety and depression. To investigate the possible role of mitochondrial-induced sterile inflammation in the co-occurrence of anxiety and depression, in this study, we treated adult male mice with the intracerebroventricular (i.c.v.) infusion of a single low dose of streptozotocin (STZ, 0.2mg/mouse). Using valid and qualified behavioral tests for the assessment of depressive and anxiety-like behaviors, we showed that STZ-treated mice exhibited behaviors relevant to anxiety and depression 24h following STZ treatment. We observed that the co-occurrence of anxiety and depressive-like behaviors in animals were associated with abnormal mitochondrial function, nitric oxide overproduction and, the increased activity of cytosolic phospholipase A 2 (cPLA 2 ) in the hippocampus. Further, STZ-treated mice had a significant upregulation of genes associated with the innate immune system such as toll-like receptors 2 and 4. Pathological evaluations showed no sign of neurodegeneration in the hippocampus of STZ-treated mice. Results of this study revealed that behavioral abnormalities provoked by STZ, as a cytotoxic agent that targets mitochondria and energy metabolism, are associated with abnormal mitochondrial activity and, consequently the initiation of innate-inflammatory responses in the hippocampus. Our findings highlight the role of mitochondria and innate immunity in the formation of sterile inflammation and behaviors relevant to anxiety and depression. Also, we have shown that STZ injection (i.c.v.) might be an animal model for depression and anxiety disorders based on sterile inflammation. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Immune Abnormalities in Autism Spectrum Disorder-Could They Hold Promise for Causative Treatment?
Gładysz, Dominika; Krzywdzińska, Amanda; Hozyasz, Kamil K
2018-01-06
Autism spectrum disorders (ASD) are characterized by impairments in language and communication development, social behavior, and the occurrence of stereotypic patterns of behavior and interests. Despite substantial speculation about causes of ASD, its exact etiology remains unknown. Recent studies highlight a link between immune dysfunction and behavioral traits. Various immune anomalies, including humoral and cellular immunity along with abnormalities at the molecular level, have been reported. There is evidence of altered immune function both in cerebrospinal fluid and peripheral blood. Several studies hypothesize a role for neuroinflammation in ASD and are supported by brain tissue and cerebrospinal fluid analysis, as well as evidence of microglial activation. It has been shown that immune abnormalities occur in a substantial number of individuals with ASD. Identifying subgroups with immune system dysregulation and linking specific cellular immunophenotypes to different symptoms would be key to defining a group of patients with immune abnormalities as a major etiology underlying behavioral symptoms. These determinations would provide the opportunity to investigate causative treatments for a defined patient group that may specifically benefit from such an approach. This review summarizes recent insights into immune system dysfunction in individuals with ASD and discusses the potential implications for future therapies.
[T-lymphocytes--do they control rheumatic immune responses?].
Wagner, U; Schulze-Koops, H
2005-09-01
T cells, in particular CD4(+) T cells, have been implicated in mediating many aspects of rheumatoid inflammation. In rheumatoid arthritis (RA), CD4(+) T cells display various functional abnormalities in the synovium as well as in the peripheral circulation. Current evidence suggests, however, that the role of CD4(+) T cells in the development of rheumatoid inflammation exceeds that of activated pro-inflammatory effector T cells that drive the chronic autoimmune response. Subsets of CD4(+) T cells with regulatory capacity, such as CD25(+) Tregs, have been identified in mice and man, and recent observations suggest that in RA, the function of these regulatory T cells is severely impaired. Thus, in RA, defective regulatory immune mechanisms might allow the breakdown of peripheral tolerance, following which the detrimental CD4(+) T-cell-driven immune response evolves and proceeds to chronic inflammation. Here, we review the functional abnormalities and the contribution of different T-cell subsets to rheumatoid inflammation.
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
NASA Astrophysics Data System (ADS)
Al Azzawi, Dia
Abnormal flight conditions play a major role in aircraft accidents frequently causing loss of control. To ensure aircraft operation safety in all situations, intelligent system monitoring and adaptation must rely on accurately detecting the presence of abnormal conditions as soon as they take place, identifying their root cause(s), estimating their nature and severity, and predicting their impact on the flight envelope. Due to the complexity and multidimensionality of the aircraft system under abnormal conditions, these requirements are extremely difficult to satisfy using existing analytical and/or statistical approaches. Moreover, current methodologies have addressed only isolated classes of abnormal conditions and a reduced number of aircraft dynamic parameters within a limited region of the flight envelope. This research effort aims at developing an integrated and comprehensive framework for the aircraft abnormal conditions detection, identification, and evaluation based on the artificial immune systems paradigm, which has the capability to address the complexity and multidimensionality issues related to aircraft systems. Within the proposed framework, a novel algorithm was developed for the abnormal conditions detection problem and extended to the abnormal conditions identification and evaluation. The algorithm and its extensions were inspired from the functionality of the biological dendritic cells (an important part of the innate immune system) and their interaction with the different components of the adaptive immune system. Immunity-based methodologies for re-assessing the flight envelope at post-failure and predicting the impact of the abnormal conditions on the performance and handling qualities are also proposed and investigated in this study. The generality of the approach makes it applicable to any system. Data for artificial immune system development were collected from flight tests of a supersonic research aircraft within a motion-based flight
Resolution of abnormal cardiac MRI T2 signal following immune suppression for cardiac sarcoidosis.
Crouser, Elliott D; Ruden, Emily; Julian, Mark W; Raman, Subha V
2016-08-01
Cardiac MR (CMR) with late gadolinium enhancement is commonly used to detect cardiac damage in the setting of cardiac sarcoidosis. The addition of T2 mapping to CMR was recently shown to enhance cardiac sarcoidosis detection and correlates with increased cardiac arrhythmia risk. This study was conducted to determine if CMR T2 abnormalities and related arrhythmias are reversible following immune suppression therapy. A retrospective study of subjects with cardiac sarcoidosis with abnormal T2 signal on baseline CMR and a follow-up CMR study at least 4 months later was conducted at The Ohio State University from 2011 to 2015. Immune suppression treated participants had a significant reduction in peak myocardial T2 value (70.0±5.5 vs 59.2±6.1 ms, pretreatment vs post-treatment; p=0.017), and 83% of immune suppression treated subjects had objective improvement in cardiac arrhythmias. Two subjects who had received inadequate immune suppression treatment experienced progression of cardiac sarcoidosis. This report indicates that abnormal CMR T2 signal represents an acute inflammatory manifestation of cardiac sarcoidosis that is potentially reversible with adequate immune suppression therapy. Copyright © 2016 American Federation for Medical Research.
Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans
2014-04-01
Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
The Role of the Immune Response in the Pathogenesis of Bronchiectasis.
King, Paul T
2018-01-01
Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.
Abnormal IgG4 antibody response to aeroallergens in allergic patients.
Jeannin, P; Delneste, Y; Tillie-Leblond, I; Wallaert, B; carlier, A; Pestel, J; Tonnel, A B
1994-01-01
Various studies have suggested the involvement of immunoglobulin G4 (IgG4) antibodies (Ab) in the physiopathology of allergic disorders. Recently, an abnormal IgG4 Ab production in response to immunization has been reported in some atopic patients. Thus, in order to evidence in allergic patients, a potential abnormal IgG4 Ab response to aeroallergens following natural exposure, we compared, in 34 patients sensitive to Dermatophagoides pteronyssinus and in 16 healthy subjects, the IgG4 Ab response to D. pteronyssinus, grass pollen and cat dander, using a solid-phase radioimmunoassay. Since some patients were also sensitive to grass pollen and/or to cat dander, we analyzed, in all patients, the IgG4 Ab responses both towards the allergen(s) they were sensitive to (sensitizing allergen) or not (unrelated allergen). The results showed that 90% of the patients produced levels of antisensitizing allergen(s) IgG4 Ab significantly higher than the controls; this IgG4 Ab response was correlated with the corresponding specific IgE Ab level. In addition, among these patients, around 40% presented high levels of IgG4 Ab to the unrelated allergen(s). Thus, in allergic patients, while specific IgE Ab define the nature of the sensitizing allergen, the presence of IgG4 Ab directed against various allergens seems in relation with an abnormal isotype regulation associated with atopic disorders.
Abnormal Epigenetic Regulation of Immune System during Aging.
Jasiulionis, Miriam G
2018-01-01
Epigenetics refers to the study of mechanisms controlling the chromatin structure, which has fundamental role in the regulation of gene expression and genome stability. Epigenetic marks, such as DNA methylation and histone modifications, are established during embryonic development and epigenetic profiles are stably inherited during mitosis, ensuring cell differentiation and fate. Under the effect of intrinsic and extrinsic factors, such as metabolic profile, hormones, nutrition, drugs, smoke, and stress, epigenetic marks are actively modulated. In this sense, the lifestyle may affect significantly the epigenome, and as a result, the gene expression profile and cell function. Epigenetic alterations are a hallmark of aging and diseases, such as cancer. Among biological systems compromised with aging is the decline of immune response. Different regulators of immune response have their promoters and enhancers susceptible to the modulation by epigenetic marks, which is fundamental to the differentiation and function of immune cells. Consistent evidence has showed the regulation of innate immune cells, and T and B lymphocytes by epigenetic mechanisms. Therefore, age-dependent alterations in epigenetic marks may result in the decline of immune function and this might contribute to the increased incidence of diseases in old people. In order to maintain health, we need to better understand how to avoid epigenetic alterations related to immune aging. In this review, the contribution of epigenetic mechanisms to the loss of immune function during aging will be discussed, and the promise of new means of disease prevention and management will be pointed.
Malpuech-Brugère, C; Rock, E; Astier, C; Nowacki, W; Mazur, A; Rayssiguier, Y
1998-01-01
The aim of this study was to assess the potential mechanism underlying the enhanced inflammatory processes during magnesium deficit. In this study, exacerbated response to live bacteria and platelet activating factors was shown in rats fed a magnesium-deficient diet. Peritoneal cells from these animals also showed enhanced superoxide anion production and calcium mobilising potency following in vitro stimulation. The latter effect occurred very early in the course of magnesium deficiency. These studies first showed that an abnormal calcium handling induced by extracellular magnesium depression in vivo may be at the origin of exacerbated inflammatory response.
Bronson, Stefanie L.; Ahlbrand, Rebecca; Horn, Paul S.; Kern, Joseph R.; Richtand, Neil M.
2011-01-01
Maternal infection during pregnancy elevates risk for schizophrenia and related disorders in offspring. Converging evidence suggests the maternal inflammatory response mediates the interaction between maternal infection, altered brain development, and behavioral outcome. The extent to which individual differences in the maternal response to immune challenge influence the development of these abnormalities is unknown. The present study investigated the impact of individual differences in maternal response to the viral mimic polyinosinic:polycytidylic acid (poly I:C) on offspring behavior. We observed significant variability in body weight alterations of pregnant rats induced by administration of poly I:C on gestational day 14. Furthermore, the presence or absence of maternal weight loss predicted MK-801 and amphetamine stimulated locomotor abnormalities in offspring. MK-801 stimulated locomotion was altered in offspring of all poly I:C treated dams; however, the presence or absence of maternal weight loss resulted in decreased and modestly increased locomotion, respectively. Adult offspring of poly I:C treated dams that lost weight exhibited significantly decreased amphetamine stimulated locomotion, while offspring of poly I:C treated dams without weight loss performed similarly to vehicle controls. Social isolation and increased maternal age predicted weight loss in response to poly I:C but not vehicle injection. In combination, these data identify environmental factors associated with the maternal response to immune challenge and functional outcome of offspring exposed to maternal immune activation. PMID:21255612
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Abnormal B cell memory subsets dominate HIV-specific responses in infected individuals
Kardava, Lela; Moir, Susan; Shah, Naisha; Wang, Wei; Wilson, Richard; Buckner, Clarisa M.; Santich, Brian H.; Kim, Leo J.Y.; Spurlin, Emily E.; Nelson, Amy K.; Wheatley, Adam K.; Harvey, Christopher J.; McDermott, Adrian B.; Wucherpfennig, Kai W.; Chun, Tae-Wook; Tsang, John S.; Li, Yuxing; Fauci, Anthony S.
2014-01-01
Recently, several neutralizing anti-HIV antibodies have been isolated from memory B cells of HIV-infected individuals. Despite extensive evidence of B cell dysfunction in HIV disease, little is known about the cells from which these rare HIV-specific antibodies originate. Accordingly, we used HIV envelope gp140 and CD4 or coreceptor (CoR) binding site (bs) mutant probes to evaluate HIV-specific responses in peripheral blood B cells of HIV-infected individuals at various stages of infection. In contrast to non-HIV responses, HIV-specific responses against gp140 were enriched within abnormal B cells, namely activated and exhausted memory subsets, which are largely absent in the blood of uninfected individuals. Responses against the CoRbs, which is a poorly neutralizing epitope, arose early, whereas those against the well-characterized neutralizing epitope CD4bs were delayed and infrequent. Enrichment of the HIV-specific response within resting memory B cells, the predominant subset in uninfected individuals, did occur in certain infected individuals who maintained low levels of plasma viremia and immune activation with or without antiretroviral therapy. The distribution of HIV-specific responses among memory B cell subsets was corroborated by transcriptional analyses. Taken together, our findings provide valuable insight into virus-specific B cell responses in HIV infection and demonstrate that memory B cell abnormalities may contribute to the ineffectiveness of the antibody response in infected individuals. PMID:24892810
Madakkannu, Boothapandi; Ravichandran, Ramanibai
2017-01-01
Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w) showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days) induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant's aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices.
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Patel, Nisha Subhash; Oury, Anais; Daniels, Gregory A; Bazhenova, Lyudmila; Patel, Sandip Pravin
2018-05-16
With the advent of immune-checkpoint inhibitor (ICI) therapy (anti-CTLA-4, anti-PD-1), immune-related adverse events such as thyroid function test abnormalities (TFTAs) are common, with a reported incidence range of 2%-15% depending upon the ICI used. The aim of this study is to describe the incidence of TFTAs retrospectively in patients who received ICI therapy. A total of 285 patients were reviewed (178 male, 107 female; 16-94 years of age), of whom 218 had no baseline TFTAs, 61 had baseline TFTAs, and 6 had a history of thyroidectomy (excluded). At least one dose of ipilimumab and/or nivolumab or pembrolizumab was administered. Post-ICI therapy TFTAs were classified according to standard definitions of thyroid conditions when possible. A total of 35% (76/218) patients had new-onset TFTAs on ICI therapy. Of note, 70.5% (43/61) had baseline TFTAs that were exacerbated by ICI therapy. The median times to new-onset or exacerbated baseline TFTA were 46 and 33 days, respectively. Of note, 64.5% (20/31) of patients on both ipilimumab and nivolumab had new-onset TFTAs, compared with 31.3% (15/48) on ipilimumab, 31.5% (28/89) on nivolumab, and 26% (13/50) on pembrolizumab. The incidence of TFTAs with ICI therapy was higher than previously reported. Patients with baseline TFTAs and/or who were receiving ipilimumab and nivolumab combination therapy had a higher incidence of TFTAs than patients receiving single-agent ICI therapy. We recommend more frequent evaluation of thyroid function in the first 8 weeks, especially in patients with baseline TFTAs. Increased use of immune-checkpoint inhibitors in cancer treatment has highlighted the importance of monitoring for and treating immune-related adverse events. This study was conducted to assess the incidence of thyroid function test abnormalities retrospectively in patients with cancer on immune-checkpoint inhibitors, which is not known exactly. This study is unique in that it included patients with a variety of histologic
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Zhang, Qiong; Huang, Yinping; Zhang, Keke; Huang, Yanjun; Yan, Yan; Wang, Fan; Wu, Jie; Wang, Xiao; Xu, Zhangye; Chen, Yongtao; Cheng, Xue; Li, Yong; Jiao, Jinyu; Ye, Duyun
2016-11-01
With increased industrial development, cadmium is an increasingly important environmental pollutant. Studies have identified various adverse effects of cadmium on human beings. However, the relationships between cadmium pollution and the pathogenesis of preeclampsia remain elusive. The objective of this study is to explore the effects of cadmium on immune system among preeclamptic patients and rats. The results showed that the cadmium levels in the peripheral blood of preeclamptic patients were significantly higher than those observed in normal pregnancy. Based on it, a novel rat model of preeclampsia was established by the intraperitoneal administration of cadmium chloride (CdCl2) (0.125 mg of Cd/kg body weight) on gestational days 9-14. Key features of preeclampsia, including hypertension, proteinuria, placental abnormalities and small foetal size, appeared in pregnant rats after the administration of low-dose of CdCl2. Cadmium increased immunoglobulin production, mainly angiotensin II type 1-receptor-agonistic autoantibodies (AT1-AA), by increasing the expression of activation-induced cytosine deaminase (AID) in B cells. AID is critical for the maturation of antibody and autoantibody responses. In addition, angiotensin II type 1-receptor-agonistic autoantibody, which emerged recently as a potential pathogenic contributor to PE, was responsible for the deposition of complement component 5 (C5) in kidneys of pregnant rats via angiotensin II type 1 receptor (AT1R) activation. C5a is a fragment of C5 that is released during C5 activation. Selectively interfering with C5a signalling by a complement C5a receptor-specific antagonist significantly attenuated hypertension and proteinuria in Cd-injected pregnant rats. Our results suggest that cadmium induces immune abnormalities that may be a key pathogenic contributor to preeclampsia and provide new insights into treatment strategies of preeclampsia. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Immunological modes of pregnancy loss: inflammation, immune effectors, and stress.
Kwak-Kim, Joanne; Bao, Shihua; Lee, Sung Ki; Kim, Joon Woo; Gilman-Sachs, Alice
2014-08-01
Inflammatory immune response plays a key role in reproductive failures such as multiple implantation failures (MIF), early pregnancy loss, and recurrent pregnancy losses (RPL). Cellular immune responses particularly mediated by natural killer (NK), and T cells are often dysregulated in these conditions. Excessive or inappropriate recruitment of peripheral blood NK cells to the uterus may lead to cytotoxic environment in utero, in which proliferation and differentiation of trophoblast is hampered. In addition, inadequate angiogenesis by uterine NK cells often leads to abnormal vascular development and blood flow patterns, which, in turn, leads to increased oxidative stress or ischemic changes in the invading trophoblast. T-cell abnormalities with increased Th1 and Th17 immunity, and decreased Th2 and T regulatory immune responses may play important roles in RPL and MIF. A possible role of stress in inflammatory immune response is also reviewed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Volk, David W.
2017-01-01
Studies of genetics, serum cytokines, and autoimmune illnesses suggest that immune-related abnormalities are involved in the disease process of schizophrenia. Furthermore, direct evidence of cortical immune activation, including markedly elevated levels of many immune-related markers, have been reported in the prefrontal cortex in multiple cohorts of schizophrenia subjects. Within the prefrontal cortex in schizophrenia, deficits in the basilar dendritic spines of layer 3 pyramidal neurons and disturbances in inhibitory inputs to pyramidal neurons have also been commonly reported. Interestingly, microglia, the resident immune-related cells of the brain, also regulate excitatory and inhibitory input to pyramidal neurons. Consequently, in this review, we describe the cytological and molecular evidence of immune activation that has been reported in the brains of individuals with schizophrenia and the potential links between these immune-related disturbances with previously reported disturbances in pyramidal and inhibitory neurons in the disorder. Finally, we discuss the role that activated microglia may play in connecting these observations and as potential therapeutic treatment targets in schizophrenia. PMID:28007586
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Hallmarks of response to immune checkpoint blockade
Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A
2017-01-01
Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159
Montoya, Carlos J; Toro, Maria F; Aguirre, Carlos; Bustamante, Alberto; Hernandez, Mariluz; Arango, Liliana P; Echeverry, Marta; Arango, Ana E; Prada, Maria C; Alarcon, Herminia del P; Rojas, Mauricio
2007-06-01
Given that highly active antiretroviral therapy (HAART) has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1)-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI) antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40) against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.
Spaceflight and immune responses of Rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1994-01-01
Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.
Virus-like nanostructures for tuning immune response
NASA Astrophysics Data System (ADS)
Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.
2015-11-01
Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Immune Response in Thyroid Cancer: Widening the Boundaries
Ward, Laura Sterian
2014-01-01
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Immune Responses to HCV and Other Hepatitis Viruses
Park, Su-Hyung; Rehermann, Barbara
2014-01-01
Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Maternal immune activation and abnormal brain development across CNS disorders.
Knuesel, Irene; Chicha, Laurie; Britschgi, Markus; Schobel, Scott A; Bodmer, Michael; Hellings, Jessica A; Toovey, Stephen; Prinssen, Eric P
2014-11-01
Epidemiological studies have shown a clear association between maternal infection and schizophrenia or autism in the progeny. Animal models have revealed maternal immune activation (mIA) to be a profound risk factor for neurochemical and behavioural abnormalities in the offspring. Microglial priming has been proposed as a major consequence of mIA, and represents a critical link in a causal chain that leads to the wide spectrum of neuronal dysfunctions and behavioural phenotypes observed in the juvenile, adult or aged offspring. Such diversity of phenotypic outcomes in the mIA model are mirrored by recent clinical evidence suggesting that infectious exposure during pregnancy is also associated with epilepsy and, to a lesser extent, cerebral palsy in children. Preclinical research also suggests that mIA might precipitate the development of Alzheimer and Parkinson diseases. Here, we summarize and critically review the emerging evidence that mIA is a shared environmental risk factor across CNS disorders that varies as a function of interactions between genetic and additional environmental factors. We also review ongoing clinical trials targeting immune pathways affected by mIA that may play a part in disease manifestation. In addition, future directions and outstanding questions are discussed, including potential symptomatic, disease-modifying and preventive treatment strategies.
Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P.; Grassi, Maria Fernanda R.; Carvalho, Edgar M.
2016-01-01
T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4+ T cells expressing IFN-γ, TNF and IL-10 in response to TT were lower in the (HC) than in the controls. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it’s necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4+ T cell immune responses after vaccination. PMID:27282836
Neuropeptide Substance P and the Immune Response
Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza
2016-01-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883
Neuropeptide substance P and the immune response.
Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza
2016-11-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.
Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation
Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.
1978-01-01
A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Immunomodulator-based enhancement of anti smallpox immune responses.
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.
Kozora, E; Filley, C M; Zhang, L; Brown, M S; Miller, D E; Arciniegas, D B; Pelzman, J L; West, S G
2012-04-01
This study examined the relationship between immune, cognitive and neuroimaging assessments in subjects with systemic lupus erythematosus (SLE) without histories of overt neuropsychiatric (NP) disorders. In total, 84 subjects with nonNPSLE and 37 healthy controls completed neuropsychological testing from the American College of Rheumatology SLE battery. Serum autoantibody and cytokine measures, volumetric magnetic resonance imaging, and magnetic resonance spectroscopy data were collected on a subset of subjects. NonNPSLE subjects had lower scores on measures of visual/complex attention, visuomotor speed and verbal memory compared with controls. No clinically significant differences between nonNPSLE patients and controls were found on serum measures of lupus anticoagulant, anticardiolipin antibodies, beta 2-glycoproteins, or pro-inflammatory cytokines (interleukin (IL)-1, IL-6, interferon alpha (IFN-alpha), and interferon gamma (IFN-gamma)). Higher scores on a global cognitive impairment index and a memory impairment index were correlated with lower IFN-alpha. Few associations between immune functions and neuroimaging parameters were found. Results indicated that nonNPSLE patients demonstrated cognitive impairment but not immune differences compared with controls. In these subjects, who were relatively young and with mild disease, no relationship between cognitive dysfunction, immune parameters, or previously documented neuroimaging abnormalities were noted. Immune measures acquired from cerebrospinal fluid instead of serum may yield stronger associations.
Camargo, F D; Huey-Louie, D A; Finn, A V; Sassani, A B; Cozen, A E; Moriwaki, H; Schneider, D B; Agah, R; Dichek, D A
2000-11-01
The utility of adenoviral vectors is limited by immune responses to adenoviral antigens. We sought to develop immune-competent mice in which the immune response to adenoviral antigens was selectively absent. To do so, we generated mice that were transgenic for a replication-defective vector. Adenoviral antigens might be seen as self-antigens by these mice, and the mice could exhibit immunologic tolerance after postnatal exposure to adenoviral vectors. In addition, characterization of these mice could reveal potential consequences of germline transmission of an adenoviral vector, as might occur in a gene therapy trial. Injection of a "null" (not containing a transgene) E1, E3-deleted vector genome into mouse zygotes yielded five founders that were capable of transmitting the vector genome. Among offspring of these mice, transgenic pups were significantly underrepresented: 108 of 255 pups (42%) were transgenic (P<0.02 versus expected frequency of 50%). Postnatal transgenic mice, however, had no apparent abnormalities. Persistence of an adenoviral vector after intravenous injection was equivalent in livers of transgenic mice and their nontransgenic littermates. Transgenic and nontransgenic mice also had equivalent humoral and cellular immune responses to adenoviral vector injection. Mice that are transgenic for an E1, E3-deleted adenoviral genome can be easily generated; however, they are not tolerant of adenovirus. Moreover, germline transmission of an adenoviral vector genome does not prevent generation of a robust immune response after exposure to adenoviral antigens.
Stress proteins and the immune response.
Moseley, P
2000-07-25
The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61
Human Immune Responses to Dengue Viruses.
1984-08-01
ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON
Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran
2016-01-01
Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population
The unfolded protein response in immunity and inflammation
Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.
2017-01-01
The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833
Mucosal immune response to poliovirus vaccines in childhood.
Ogra, P L
1984-01-01
Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.
Effect of antipyretic analgesics on immune responses to vaccination.
Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B
2016-09-01
While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
Effect of antipyretic analgesics on immune responses to vaccination
Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.
2016-01-01
ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Damage signals in the insect immune response
Krautz, Robert; Arefin, Badrul; Theopold, Ulrich
2014-01-01
Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815
Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P; Grassi, Maria Fernanda R; Carvalho, Edgar M
2016-08-01
T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls (UC) with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4(+) T cells expressing IFN-γ, TNF-α and IL-10 in response to TT were lower in the HC than in the UC. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it's necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4(+) T cell immune responses after vaccination. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Immune Response to Giardia duodenalis
Faubert, Gaétan
2000-01-01
The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490
Q fever in pregnant goats: humoral and cellular immune responses
2013-01-01
Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213
The innate and adaptive immune response to avian influenza virus
USDA-ARS?s Scientific Manuscript database
Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...
Human Immune Responses to Dengue Viruses.
1986-07-01
0-1 NO- 3K1- INO. "o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in
SUMO-Enriched Proteome for Drosophila Innate Immune Response
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.
2015-01-01
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570
SUMO-Enriched Proteome for Drosophila Innate Immune Response.
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S
2015-08-18
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.
Immune function trade-offs in response to parasite threats.
Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W
2017-04-01
Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Innate immune sensing and response to influenza.
Pulendran, Bali; Maddur, Mohan S
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
Innate immune response development in nestling tree swallows
Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.
2011-01-01
We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.
Modeling Systems-Level Regulation of Host Immune Responses
Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka
2007-01-01
Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Modeling the interactions between pathogenic bacteria, bacteriophage and immune response
NASA Astrophysics Data System (ADS)
Leung, Chung Yin (Joey); Weitz, Joshua S.
The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Peroxiredoxin 5 modulates immune response in Drosophila
Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.
2010-01-01
Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624
The innate immune response during urinary tract infection and pyelonephritis
Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.
2013-01-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397
The innate immune response during urinary tract infection and pyelonephritis.
Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S
2014-07-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a
Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.
Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M
2013-04-16
Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.
Immune and stress responses in oysters with insights on adaptation.
Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude
2015-09-01
Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate Immune Sensing and Response to Influenza
Pulendran, Bali; Maddur, Mohan S.
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919
Probiotics, antibiotics and the immune responses to vaccines
Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep
2015-01-01
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456
Probiotics, antibiotics and the immune responses to vaccines.
Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep
2015-06-19
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Characterization of host immune responses in Ebola virus infections.
Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo
2014-06-01
Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
The immune response to Nipah virus infection.
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J
2012-09-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.
Chemokine-mediated immune responses in the female genital tract mucosa.
Deruaz, Maud; Luster, Andrew D
2015-04-01
The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.
Influence of ionizing radiation on the immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brocadeszaalberg, O.
1974-01-01
The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2011-08-01
The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.
Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.
Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S
2017-07-10
Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID
Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Enhancing the Immune Response to Recombinant Plague Antigens
2006-05-01
Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant
Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens
Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.
2007-01-01
In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440
Costs of mounting an immune response during pregnancy in a lizard.
Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald
2013-01-01
Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
The immune response to Nipah virus infection
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.
2012-01-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Suppressive influences in the immune response to cancer.
Bronte, Vincenzo; Mocellin, Simone
2009-01-01
Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis
Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar
2017-01-01
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550
Fetal immune response to chorioamnionitis
Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.
2014-01-01
Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922
Human Immune Response to Dengue Infections
1989-07-31
antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8
Early-life inflammation, immune response and ageing.
Khan, Imroze; Agashe, Deepa; Rolff, Jens
2017-03-15
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).
Early-life inflammation, immune response and ageing
2017-01-01
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145
Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu
2017-01-01
While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733
Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam
2017-01-01
Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086
Strain difference in the immune response to hydralazine in inbred guinea-pigs
Ellman, L.; Inman, J.; Green, Ira
1971-01-01
Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639
big bang gene modulates gut immune tolerance in Drosophila.
Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc
2013-02-19
Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.
2013-01-01
Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Immune barriers of Ebola virus infection.
McElroy, Anita K; Mühlberger, Elke; Muñoz-Fontela, César
2018-02-01
Since its initial emergence in 1976 in northern Democratic Republic of Congo (DRC), Ebola virus (EBOV) has been a global health concern due to its virulence in humans, the mystery surrounding the identity of its host reservoir and the unpredictable nature of Ebola virus disease (EVD) outbreaks. Early after the first clinical descriptions of a disease resembling a 'septic-shock-like syndrome', with coagulation abnormalities and multi-system organ failure, researchers began to evaluate the role of the host immune response in EVD pathophysiology. In this review, we summarize how data gathered during the last 40 years in the laboratory as well as in the field have provided insight into EBOV immunity. From molecular mechanisms involved in EBOV recognition in infected cells, to antigen processing and adaptive immune responses, we discuss current knowledge on the main immune barriers of infection as well as outstanding research questions. Copyright © 2018 Elsevier B.V. All rights reserved.
Transcriptional Profiling of the Immune Response to Marburg Virus Infection.
Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J
2015-10-01
Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Changes in the immune system are conditioned by nutrition.
Marcos, A; Nova, E; Montero, A
2003-09-01
Undernutrition due to insufficient intake of energy and macronutrients and/or due to deficiencies in specific micronutrients impairs the immune system, suppressing immune functions that are fundamental to host protection. The most consistent abnormalities are seen in cell-mediated immunity, complement system, phagocyte function, cytokine production, mucosal secretory antibody response, and antibody affinity. There is a number of physiological situations such as ageing and performance of intense physical exercise associated with an impairment of some immune parameters' response. Nutrition can influence the extent of immune alteration in both of them. There are also numerous pathological situations in which nutrition plays a role as a primary or secondary determinant of some underlying immunological impairments. This includes obesity, eating disorders (anorexia nervosa and bulimia nervosa), food hypersensitivity and gastrointestinal disorders as some examples. The implications of nutrition on immune function in these disorders are briefly reviewed.
Innate Immune Responses to Cryptococcus.
Heung, Lena J
2017-09-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.
Leptospirosis in human: Biomarkers in host immune responses.
Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha
2018-03-01
Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.
Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.
Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi
2018-04-16
While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A basic mathematical model of the immune response
NASA Astrophysics Data System (ADS)
Mayer, H.; Zaenker, K. S.; an der Heiden, U.
1995-03-01
Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores
Lampert, Evan
2012-01-01
Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Proteomic contributions to our understanding of vaccine and immune responses
Galassie, Allison C.; Link, Andrew J.
2015-01-01
Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619
Innate Immune Response to Burkholderia mallei
2017-02-16
stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses
van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.
2012-01-01
The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167
The relevance of sleep abnormalities to chronic inflammatory conditions.
Ranjbaran, Z; Keefer, L; Stepanski, E; Farhadi, A; Keshavarzian, A
2007-02-01
Sleep is vital to health and quality of life while sleep abnormalities are associated with adverse health consequences. Nevertheless, sleep problems are not generally considered by clinicians in the management of chronic inflammatory conditions (CIC) such as asthma, RA, SLE and IBD. To determine whether this practice is justified, we reviewed the literature on sleep and chronic inflammatory diseases, including effects of sleep on immune system and inflammation. We found that a change in the sleep-wake cycle is often one of the first responses to acute inflammation and infection and that the reciprocal effect of sleep on the immune system in acute states is often protective and restorative. For example, slow wave sleep can attenuate proinflammatory immune responses while sleep deprivation can aggravate those responses. The role of sleep in CIC is not well explored. We found a substantial body of published evidence that sleep disturbances can worsen the course of CIC, aggravate disease symptoms such as pain and fatigue, and increase disease activity and lower quality of life. The mechanism underlying these effects probably involves dysregulation of the immune system. All this suggests that managing sleep disturbances should be considered as an important factor in the overall management of CIC.
Nitric oxide and redox mechanisms in the immune response
Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.
2011-01-01
The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414
Innate Immune Responses to Cryptococcus
Heung, Lena J.
2017-01-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Countermeasure for space flight effects on immune system: nutritional nucleotides
NASA Technical Reports Server (NTRS)
Kulkarni, A. D.; Yamauchi, K.; Sundaresan, A.; Ramesh, G. T.; Pellis, N. R.
2005-01-01
Microgravity and its environment have adverse effects on the immune system. Abnormal immune responses observed in microgravity may pose serious consequences, especially for the recent directions of NASA for long-term space missions to Moon, Mars and deep Space exploration. The study of space flight immunology is limited due to relative inaccessibility, difficulty of performing experiments in space, and inadequate provisions in this area in the United States and Russian space programs (Taylor 1993). Microgravity and stress experienced during space flights results in immune system aberration (Taylor 1993). In ground-based mouse models for some of the microgravity effects on the human body, hindlimb unloading (HU) has been reported to cause abnormal cell proliferation and cytokine production (Armstrong et al., 1993, Chapes et al. 1993). In this report, we document that a nutritional nucleotide supplementation as studied in ground-based microgravity analogs, has potential to serve as a countermeasure for the immune dysfunction observed in space travel.
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Twinn, Sheila
2006-09-01
The aims of this study were to examine the responses of Hong Kong Chinese women receiving an abnormal smear result and to compare any differences in responses depending on the diagnosis of the abnormal smear. The implementation of cervical screening programmes has resulted in an increasing number of women receiving an abnormal smear result requiring cytological surveillance or referral for colposcopy. Evidence suggests that women frequently misunderstood such results, believing that they already have cancer. However, little is known about the responses of Chinese women in this situation. An exploratory qualitative study. Face-to-face semi-structured tape-recorded interviews were undertaken with 66 women sampled opportunistically from an urban centre of a major non-governmental service provider. Amongst this sample, 22 women required cytological surveillance, 20 required treatment for vaginitis and 24 were referred for colposcopy. Thematic analysis was undertaken of the translated interviews within and across groups to identify categories and themes illustrating women's responses to an abnormal smear result. An important difference in the comparison of the data sets was that of women's understanding of the cause of the abnormal result. Women with vaginitis understood the cause of their abnormality, whereas those in the other groups remained unclear about their abnormality, generating feelings of fear and uncertainty. Trust in practitioners influenced women's acceptance of the result. Although responses of Chinese women are similar to those in other population groups, with those referred for colposcopy experiencing greater anxiety than those undergoing cytological surveillance, balancing feelings of uncertainty and acceptance influenced Chinese women's responses to their abnormal results and allowed them to make sense of their result in their everyday life. Trust in the practitioner was essential to the acceptance of their result. Such findings highlight implications
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
Mechanism of immune evasion in breast cancer
Wang, Mozhi; Zhang, Changwang; Song, Yongxi; Wang, Zhenning; Wang, Yaojia; Luo, Fang; Xu, Yujie; Zhao, Yi; Wu, Zhonghua; Xu, Yingying
2017-01-01
Breast cancer (BC) is the most common malignant tumor among women, with high morbidity and mortality. Its onset, development, metastasis, and prognosis vary among individuals due to the interactions between tumors and host immunity. Many diverse mechanisms have been associated with BC, with immune evasion being the most widely studied to date. Tumor cells can escape from the body’s immune response, which targets abnormal components and foreign bodies, using different approaches including modification of surface antigens and modulation of the surrounding environment. In this review, we summarize the mechanisms and factors that impact the immunoediting process and analyze their functions in detail. PMID:28352189
Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.
Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy
2018-02-01
We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.
Eosinophils in mucosal immune responses
Travers, J; Rothenberg, M E
2015-01-01
Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184
Spaceflight and Development of Immune Responses
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1996-01-01
Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.
Effect of gender and sex hormones on immune responses following shock.
Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H
2000-08-01
Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.
A multiherbal formulation influencing immune response in vitro.
Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L
2012-02-01
Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Drosophila blood cells and their role in immune responses.
Vlisidou, Isabella; Wood, Will
2015-04-01
Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Influence of bedding type on mucosal immune responses.
Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E
2002-10-01
The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.
Humoral immunity and autism spectrum disorders.
Fluegge, Keith
2017-05-01
Abnormal immune activation, particularly of a humoral nature, has consistently been described in the etiopathogenesis of autism spectrum disorders (ASD). In this journal, Mead and Ashwood (2015) reviewed immune abnormalities in autism and linked them to severity of classic autistic symptoms. However, there remains a lack of clarity as to how environmental risk factors in ASD may contribute to such immunophenotypes. The evidence presented herein highlights these immune deficits of a humoral nature in ASD. Moreover, aligned with prior research showing a link between chronic air pollution and suppression of humoral immunity, the author of this commentary has proposed that environmental exposure to pervasive air pollutants, particularly nitrous oxide (N 2 O), may target several anti-inflammatory biomarkers, including alpha 7 nicotinic acetylcholine receptor (α7nAChR) inhibition and stimulation of kappa opioid receptor (KOR) activity. Given that these physiological targets, in particular, may promote the oft-noted humoral immunophenotypes in ASD, including B cell survival and muted antibody responses, this correspondence supports an existing line of evidence that air pollution, and particularly exposure to environmental N 2 O, may be an important etiological risk factor in ASD. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Malnutrition: Modulator of Immune Responses in Tuberculosis
Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth
2017-01-01
Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710
A neuro-immune model of Myalgic Encephalomyelitis/Chronic fatigue syndrome.
Morris, Gerwyn; Maes, Michael
2013-12-01
This paper proposes a neuro-immune model for Myalgic Encephalomyelitis/Chronic fatigue syndrome (ME/CFS). A wide range of immunological and neurological abnormalities have been reported in people suffering from ME/CFS. They include abnormalities in proinflammatory cytokines, raised production of nuclear factor-κB, mitochondrial dysfunctions, autoimmune responses, autonomic disturbances and brain pathology. Raised levels of oxidative and nitrosative stress (O&NS), together with reduced levels of antioxidants are indicative of an immuno-inflammatory pathology. A number of different pathogens have been reported either as triggering or maintaining factors. Our model proposes that initial infection and immune activation caused by a number of possible pathogens leads to a state of chronic peripheral immune activation driven by activated O&NS pathways that lead to progressive damage of self epitopes even when the initial infection has been cleared. Subsequent activation of autoreactive T cells conspiring with O&NS pathways cause further damage and provoke chronic activation of immuno-inflammatory pathways. The subsequent upregulation of proinflammatory compounds may activate microglia via the vagus nerve. Elevated proinflammatory cytokines together with raised O&NS conspire to produce mitochondrial damage. The subsequent ATP deficit together with inflammation and O&NS are responsible for the landmark symptoms of ME/CFS, including post-exertional malaise. Raised levels of O&NS subsequently cause progressive elevation of autoimmune activity facilitated by molecular mimicry, bystander activation or epitope spreading. These processes provoke central nervous system (CNS) activation in an attempt to restore immune homeostatsis. This model proposes that the antagonistic activities of the CNS response to peripheral inflammation, O&NS and chronic immune activation are responsible for the remitting-relapsing nature of ME/CFS. Leads for future research are suggested based on this
CELLS INVOLVED IN THE IMMUNE RESPONSE
Singhal, Sharwan K.; Richter, Maxwell
1968-01-01
Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
Distinct abnormalities in the innate immune system of children with Down syndrome.
Bloemers, Beatrijs L P; van Bleek, Grada M; Kimpen, Jan L L; Bont, Louis
2010-05-01
To analyze the frequency and phenotype of cells of the innate immune system in the peripheral blood of children with Down syndrome (DS). Flow cytometric analysis of expression of cell surface markers was performed in children with DS (n = 41) and healthy age-matched controls (n = 41). Compared with controls, children with DS had significantly lower absolute total leukocyte counts, lymphocytes, monocytes, and granulocytes, but 1.5-times higher absolute numbers of CD14(dim)CD16(+) monocytes (147 x 10(6)/L vs 93 x 10(6)/L; P = .02). This difference is fully explained by a higher percentage of CD14(dim)CD16(+) monocytes within the monocyte compartment (28.7% vs 13.4%; P <.001). The absolute numbers of myeloid dendritic cells were lower in DS (13.8 x 10(6)/L vs 22.7 x 10(6)/L; P <.001). The numbers of plasmacytoid dendritic cells and natural killer cells were normal. Absolute numbers of invariant natural killer T cells were very low overall, but significantly lower in children with DS than in controls (1.2 x 10(6)/L vs 3.7 x 10(6)/L; P = .01). Children with DS exhibited distinct abnormalities in cells of the innate immune system. Most strikingly, they had a high number of proinflammatory CD14(dim)CD16(+) monocytes. This elevated level of CD14(dim)CD16(+) monocytes may play an important role in the onset and maintenance of chronic inflammatory disease in DS.
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
The host immune response to Clostridium difficile infection
2013-01-01
Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542
Intravital imaging of cutaneous immune responses.
Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji
2018-05-25
Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.
Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.
Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier
2009-03-23
Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.
Interplay of parasite-driven immune responses and autoimmunity.
Zaccone, Paola; Burton, Oliver T; Cooke, Anne
2008-01-01
As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil
2013-01-01
Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Chronic Systemic Immune Dysfunction in African-Americans with Small Vessel-Type Ischemic Stroke.
Brown, Candice M; Bushnell, Cheryl D; Samsa, Gregory P; Goldstein, Larry B; Colton, Carol A
2015-12-01
The incidence of small vessel-type (lacunar) ischemic strokes is greater in African-Americans compared to whites. The chronic inflammatory changes that result from lacunar stroke are poorly understood. To elucidate these changes, we measured serum inflammatory and thrombotic biomarkers in African-Americans at least 6 weeks post-stroke compared to control individuals. Cases were African-Americans with lacunar stroke (n = 30), and controls were age-matched African-Americans with no history of stroke or other major neurologic disease (n = 37). Blood was obtained >6 weeks post-stroke and was analyzed for inflammatory biomarkers. Freshly isolated peripheral blood mononuclear cells were stimulated with lipopolysaccharide (LPS) to assess immune responsiveness in a subset of cases (n = 5) and controls (n = 4). After adjustment for covariates, the pro-inflammatory biomarkers, soluble vascular cadherin adhesion molecule-1 (sVCAM-1) and thrombin anti-thrombin (TAT), were independently associated with lacunar stroke. Immune responsiveness to LPS challenge was abnormal in cases compared to controls. African-Americans with lacunar stroke had elevated blood levels of VCAM-1 and TAT and an abnormal response to acute immune challenge >6 weeks post-stroke, suggesting a chronically compromised systemic inflammatory response.
Anders, Sherry; Kinney, Dennis K
2015-08-18
Extensive research implicates disturbed immune function and development in the etiology and pathology of schizophrenia. In addition to reviewing evidence for immunological factors in schizophrenia, this paper discusses how an emerging model of atypical immune function and development helps explain a wide variety of well-established - but puzzling - findings about schizophrenia. A number of theorists have presented hypotheses that early immune system programming, disrupted by pre- and perinatal adversity, often combines with abnormal brain development to produce schizophrenia. The present paper focuses on the hypothesis that disruption of early immune system development produces a latent immune vulnerability that manifests more fully after puberty, when changes in immune function and the thymus leave individuals more susceptible to infections and immune dysfunctions that contribute to schizophrenia. Complementing neurodevelopmental models, this hypothesis integrates findings on many contributing factors to schizophrenia, including prenatal adversity, genes, climate, migration, infections, and stress, among others. It helps explain, for example, why (a) schizophrenia onset is typically delayed until years after prenatal adversity, (b) individual risk factors alone often do not lead to schizophrenia, and (c) schizophrenia prevalence rates actually tend to be higher in economically advantaged countries. Here we discuss how the hypothesis explains 10 key findings, and suggests new, potentially highly cost-effective, strategies for treatment and prevention of schizophrenia. Moreover, while most human research linking immune factors to schizophrenia has been correlational, these strategies provide ethical ways to experimentally test in humans theories about immune function and schizophrenia. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2015 Elsevier B.V. All rights reserved.
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.
Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P
2017-12-01
The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response
Zhong, Hong; Ma, Minjuan
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
A comparative study of an innate immune response in Lamprologine cichlid fishes.
O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
A comparative study of an innate immune response in Lamprologine cichlid fishes
NASA Astrophysics Data System (ADS)
O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
The host immune response to gastrointestinal nematode infection in sheep.
McRae, K M; Stear, M J; Good, B; Keane, O M
2015-12-01
Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.
[Bone marrow stromal damage mediated by immune response activity].
Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H
1994-01-01
The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.
The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)
King, Paul T.; Sharma, Roleen
2015-01-01
Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124
Barbour, E K; Kallas, M; Farran, M T
2001-12-01
Ervil (Vicia ervilia) seeds are produced in the Mediterranean region and used as a source of protein for cattle and poultry. The methods used to assess the toxic effects of legume seeds in the feed of poultry include the observation of one or more parameters, including abnormal signs, weight gain, feed consumption, gall bladder weight, pancreas weight, pancreas proteolytic and amylase activity, haemolysis of red blood cells, liver weight, liver glutathione level, liver and plasma lipid levels, and plasma lipid peroxide levels. The authors describe the use of quantitative determination of the immune response to Newcastle disease virus (NDV) vaccine in broilers as a model that can be used to assess different detoxification treatments of ervil seeds. Broiler chicks fed differently-treated ervil, supplemented as 25% of the diet, at one to four weeks of age and vaccinated intraocularly with live NDV vaccine at eight days of age, showed different immune responses at three weeks post vaccination. Immunosuppression with regards to NDV was apparent in the group of birds raised on untreated ervil supplement, resulting in a mean immune response (titre) of 798.5. Five of the six different treatments of ervil seeds resulted in different degrees of rectification of the immunosuppression, with some broilers reaching a mean NDV immune titre of 2070.6, similar to that obtained in control broilers raised on a basal diet with no ervil seed supplement (mean NDV immune titre of 2333.8; P > 0.05). The five successful treatments of ervil (in increasing order of rectification of immunosuppression in broilers, with mean NDV titres in parentheses) were: ground soaked dried ervil (971.6), ground autoclaved dried ervil (1223.1), soaked autoclaved dried ervil (1273.1), soaked dried ervil (1340.0), and ground-soaked autoclaved dried ervil (2070.6).
Fibroblast activation protein is dispensable in the anti-influenza immune response in mice
Chowdhury, Sumaiya; Polak, Natasa
2017-01-01
Fibroblast activation protein alpha (FAP) is a unique dual peptidase of the S9B serine protease family, being capable of both dipeptidyl peptidase and endopeptidase activities. FAP is expressed at low level in healthy adult organs including the pancreas, cervix, uterus, submaxillary gland and the skin, and highly upregulated in embryogenesis, chronic inflammation and tissue remodelling. It is also expressed by cancer-associated stromal fibroblasts in more than 90% of epithelial tumours. FAP has enzymatic and non-enzymatic functions in the growth, immunosuppression, invasion and cell signalling of tumour cells. FAP deficient mice are fertile and viable with no gross abnormality, but little data exist on the role of FAP in the immune system. FAP is upregulated in association with microbial stimulation and chronic inflammation, but its function in infection remains unknown. We showed that major populations of immune cells including CD4+ and CD8+ T cells, B cells, dendritic cells and neutrophils are generated and maintained normally in FAP knockout mice. Upon intranasal challenge with influenza virus, FAP mRNA was increased in the lungs and lung-draining lymph nodes. Nonetheless, FAP deficient mice showed similar pathologic kinetics to wildtype controls, and were capable of supporting normal anti-influenza T and B cell responses. There was no evidence of compensatory upregulation of other DPP4 family members in influenza-infected FAP-deficient mice. FAP appears to be dispensable in anti-influenza adaptive immunity. PMID:28158223
Radiation induces an antitumour immune response to mouse melanoma.
Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling
2009-12-01
Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.
Adjuvant effects of saponins on animal immune responses*
Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.
2007-01-01
Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses
Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.
Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.
Current views on the mechanisms of immune responses to trauma and infection
Michalak, Grzegorz; Słotwiński, Robert
2015-01-01
According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Insights on adaptive and innate immunity in canine leishmaniosis.
Hosein, Shazia; Blake, Damer P; Solano-Gallego, Laia
2017-01-01
Canine leishmaniosis (CanL) is caused by the parasite Leishmania infantum and is a systemic disease, which can present with variable clinical signs, and clinicopathological abnormalities. Clinical manifestations can range from subclinical infection to very severe systemic disease. Leishmaniosis is categorized as a neglected tropical disease and the complex immune responses associated with Leishmania species makes therapeutic treatments and vaccine development challenging for both dogs and humans. In this review, we summarize innate and adaptive immune responses associated with L. infantum infection in dogs, and we discuss the problems associated with the disease as well as potential solutions and the future direction of required research to help control the parasite.
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.
Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon
2018-01-01
Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.
A cognitive computational model inspired by the immune system response.
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.
Proportionate Responses to Life Events Influence Clinicians’ Judgments Of Psychological Abnormality
Kim, Nancy S.; Paulus, Daniel J.; Gonzalez, Jeffrey S.; Khalife, Danielle
2012-01-01
Psychological abnormality is a fundamental concept in the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR; APA, 2000) and in all clinical evaluations. How do practicing clinical psychologists use the context of life events to judge the abnormality of a person’s current behaviors? The appropriate role of life-event context in assessment has long been the subject of intense debate and scrutiny among clinical theorists, yet relatively little is known about clinicians’ own judgments in practice. We propose a proportionate-response hypothesis, such that judgments of abnormality are influenced by whether the behaviors are a disproportionate response to past events, rendering them difficult to understand or explain. We presented licensed, practicing clinical psychologists (N=77) with vignettes describing hypothetical people’s behaviors (disordered, mildly distressed, or unaffected) that had been preceded by either traumatic or mildly distressing events. Experts’ judgments of abnormality were strongly and systematically influenced by the degree of mismatch between the past event and current behaviors in strength and valence, such that the greater the mismatch, the more abnormal the person seemed. A separate, additional group of clinical psychologists (N=20) further confirmed that the greater the degree of mismatch, the greater the perceived difficulty in understanding the patient. These findings held true across clinicians of different theoretical orientations and in disorders for which these patterns of judgments ran contrary to formal recommendations in the DSM-IV-TR (APA, 2000). The rationality of these effects and implications for clinical decision science are discussed. PMID:22142425
The nurse response to abnormal vital sign recording in the emergency department.
Johnson, Kimberly D; Mueller, Lindsey; Winkelman, Chris
2017-01-01
To examine what occurs after a recorded observation of at least one abnormal vital sign in the emergency department. The aims were to determine how often abnormal vital signs were recorded, what interventions were documented, and what factors were associated with documented follow-up for abnormal vital signs. Monitoring quality of care, and preventing or intervening before harm occurs to patients are central to nurses' roles. Abnormal vital signs have been associated with poor patient outcomes and require follow-up after the observation of abnormal readings to prevent patient harm related to a deteriorating status. This documentation is important to quality and safety of care. Observational, retrospective chart review. Modified Early Warning Score was calculated for all recorded vital signs for 195 charts. Comparisons were made between groups: (1) no abnormal vital signs, (2) abnormal vital sign present, but normal Modified Early Warning Score and (3) critically abnormal Modified Early Warning Score. About 62·1% of charts had an abnormal vital sign documented. Critically abnormal values were present in 14·9%. No documentation was present in 44·6% of abnormal cases. When interventions were documented, it was usually to notify the physician. The timing within the emergency department visit when the abnormalities were observed and the degree of abnormality had significant relationships to the presence of documentation. It is doubtful that nurses do not recognise abnormalities because more severely abnormal vital signs were more likely to have documented follow-up. Perhaps the interruptive nature of the emergency department or the prioritised actions of the nurse impacted documentation within this study. Further research is required to determine why follow-up is not being documented. To ensure safety and quality of patient care, accurate documentation of responses to abnormal vital signs is required. © 2016 John Wiley & Sons Ltd.
Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery
NASA Astrophysics Data System (ADS)
Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole
2015-12-01
Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized
Dietary astaxanthin enhances immune response in dogs.
Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon
2011-04-15
No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
IL-2 infusion abrogates humoral immune responses in humans.
Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K
1992-01-01
Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235
Amiri, Shayan; Yousefi-Ahmadipour, Aliakbar; Hosseini, Mir-Jamal; Haj-Mirzaian, Arya; Momeny, Majid; Hosseini-Chegeni, Heshmat; Mokhtari, Tahmineh; Kharrazi, Sharmin; Hassanzadeh, Gholamreza; Amini, Seyed Mohammad; Jafarinejad, Somayeh; Ghazi-Khansari, Mahmoud
2018-05-01
Silver nanoparticles (Ag-NPs) are currently used in a wide range of consumer products. Considering the small size of Ag-NPs, they are able to pass through variety of biological barriers and exert their effects. In this regard, the unique physicochemical properties of Ag-NPs along with its high application in the industry have raised concerns about their negative effects on human health. Therefore, it investigated whether prenatal exposure to low doses of Ag-NPs is able to induce any abnormality in the cognitive and behavioral performance of adult offspring. We gavaged pregnant NMRI mice with, 1) Deionized water as vehicle, 2) Ag-NPs 10 nm (0.26 mg/kg/day), 3) Ag-NPs 30 nm (0.26 mg/kg/day), and 4) AgNO 3 (0.26 mg/kg/day) from gestational day (GD) 0 until delivery day. At the postnatal day (PD) 1, our results showed that high concentration of silver is present in the brain of pups. Further, we observed mitochondrial dysfunction and upregulation of the genes relevant to innate immune system in the brain. At PD 60, results revealed that prenatal exposure to Ag-NPs provoked severe cognitive and behavioral abnormalities in male offspring. In addition, we found that prenatal exposure to Ag-NPs was associated with abnormal mitochondrial function and significant up-regulation of the genes relevant to innate immunity in the brain. Although the Ag-NPs have been considered as safe compounds at low doses, our results indicate that prenatal exposure to low doses of Ag-NPs is able to induce behavioral and cognitive abnormalities in adulthood. Also, we found that these effects are at least partly associated with hippocampal mitochondrial dysfunction and the activation of sterile inflammation during early stages of life. Copyright © 2018 Elsevier B.V. All rights reserved.
[Immune response to live influenza vaccine].
Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G
2002-01-01
Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.
Hyperserotoninemia and Altered Immunity in Autism
ERIC Educational Resources Information Center
Burgess, Nancy K.; Sweeten, Thayne L.; McMahon, William M.; Fujinami, Robert S.
2006-01-01
One of the most consistent biological findings in autism is elevated whole blood serotonin (5-HT) levels found in about 1/3 of cases. Immune abnormalities are also commonly observed in this disorder. Given 5-HT's role as an immunomodulator, possible connections between 5-HT and immune abnormalities in autism are explored in this review. Areas of…
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
Barth, Kenneth; Genco, Caroline Attardo
2016-01-01
The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456
Immune responses to bioengineered organs
Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.
2017-01-01
Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
Immune response in asymptomatic smokers.
Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H
2002-09-01
It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production
CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL
Zhu, Yuwen; Yao, Sheng; Chen, Lieping
2011-01-01
Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182
Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA
Mandadi, Kranthi K.; Scholthof, Karen-Beth G.
2013-01-01
Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
Innate immune responses following Kawasaki disease and toxic shock syndrome
Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181
Innate immune responses following Kawasaki disease and toxic shock syndrome.
Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.
Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.
Fins, Joseph J
2015-04-01
Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.
A Cognitive Computational Model Inspired by the Immune System Response
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131
Do abnormal responses show utilitarian bias?
Kahane, Guy; Shackel, Nicholas
2008-03-20
Neuroscience has recently turned to the study of utilitarian and non-utilitarian moral judgement. Koenigs et al. examine the responses of normal subjects and those with ventromedial-prefrontal-cortex (VMPC) damage to moral scenarios drawn from functional magnetic resonance imaging studies by Greene et al., and claim that patients with VMPC damage have an abnormally "utilitarian" pattern of moral judgement. It is crucial to the claims of Koenigs et al. that the scenarios of Greene et al. pose a conflict between utilitarian consequence and duty: however, many of them do not meet this condition. Because of this methodological problem, it is too early to claim that VMPC patients have a utilitarian bias.
Angiotensin converting enzyme over expression in myelocytes enhances the immune response
Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.
2015-01-01
Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
The role of immune dysfunction in the pathophysiology of autism
Onore, Charity; Careaga, Milo; Ashwood, Paul
2012-01-01
Autism spectrum disorders (ASD) are a complex group of neurodevelopmental disorders encompassing impairments in communication, social interactions and restricted stereotypical behaviors. Although a link between altered immune responses and ASD was first recognized nearly 40 years ago, only recently has new evidence started to shed light on the complex multifaceted relationship between immune dysfunction and behavior in ASD. Neurobiological research in ASD has highlighted pathways involved in neural development, synapse plasticity, structural brain abnormalities, cognition and behavior. At the same time, several lines of evidence point to altered immune dysfunction in ASD that directly impacts some or all these neurological processes. Extensive alterations in immune function have now been described in both children and adults with ASD, including ongoing inflammation in brain specimens, elevated pro-inflammatory cytokine profiles in the CSF and blood, increased presence of brain-specific auto-antibodies and altered immune cell function. Furthermore, these dysfunctional immune responses are associated with increased impairments in behaviors characteristic of core features of ASD, in particular, deficits in social interactions and communication. This accumulating evidence suggests that immune processes play a key role in the pathophysiology of ASD. This review will discuss the current state of our knowledge of immune dysfunction in ASD, how these findings may impact on underlying neuro-immune mechanisms and implicate potential areas where the manipulation of the immune response could have an impact on behavior and immunity in ASD. PMID:21906670
Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.
West, A Phillip
2017-11-01
A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
Surviving Sepsis: Taming a Deadly Immune Response
... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...
Pathogenesis of NEC: Role of the Innate and Adaptive Immune Response
Denning, Timothy L.; Bhatia, Amina M.; Kane, Andrea F.; Patel, Ravi M.; Denning, Patricia L.
2017-01-01
Necrotizing enterocolitis (NEC) is a devastating disease in premature infants with high case fatality and significant morbidity among survivors. Immaturity of intestinal host defenses predisposes the premature infant gut to injury. An abnormal bacterial colonization pattern with a deficiency of commensal bacteria may lead to a further breakdown of these host defense mechanisms, predisposing the infant to NEC. Here, we review the role of the innate and adaptive immune system in the pathophysiology of NEC. PMID:27940091
The influence of the microbiota on the immune response to transplantation
Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa
2015-01-01
Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985
Respiratory tract immune response to microbial pathogens.
Wilkie, B N
1982-11-15
Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Assessment of the innate immune response in the periparturient cow.
Trevisi, Erminio; Minuti, Andrea
2018-02-01
The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Selection for avian immune response: a commercial breeding company challenge.
Fulton, J E
2004-04-01
Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.
Differential Immune Responses to New World and Old World Mammalian Arenaviruses
Ly, Hinh
2017-01-01
Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311
Franco-Belussi, Lilian; Fanali, Lara Zácari; De Oliveira, Classius
2018-03-01
Ultra-Violet (UV) radiation is a stressor of the immune system and causes DNA damage. Leukocytes can change in response to environmental changes in anurans, making them an important biomarker of stressful situations. The initial barrier against UV in ectothermic animals is melanin-containing cells in skin and in their internal organs. Here, we tested the effects of UV exposure on immune cells and DNA integrity in pigmented and non-pigmented tadpoles of Lithobates catesbeianus. We used an inflammation model with lipopolysaccharide (LPS) of Escherichia coli to test synergic effects of UV and LPS. We tested the following hypotheses: 1) DNA damage caused by UV will be more pronounced in non-pigmented than in pigmented animals; 2) LPS increases leukocytes in both pigmented and non-pigmented animals by systemic inflammation; 3) The combined LPS and UV exposure will decrease the number of leukocytes. We found that the frequency of immune cells differed between pigmented and non-pigmented tadpoles. UV exposure increased mast cells and DNA damage in erythrocytes in both pigmented and non-pigmented tadpoles, while leukocytes decreased after UV exposure. Non-pigmented tadpoles experienced DNA damage and a lower lymphocyte count earlier than pigmented tadpoles. UV altered immune cells likely as a consequence of local and systemic inflammation. These alterations were less severe in pigmented than in non-pigmented animals. UV and LPS increased internal melanin in pigmented tadpoles, which were correlated with DNA damage and leukocytes. Here, we described for the first time the effects of UV and LPS in immune cells of pigmented and non-pigmented tadpoles. In addition, we demonstrated that internal melanin in tadpoles help in these defenses, since leukocyte responses were faster in non-pigmented animals, supporting the hypothesis that melanin is involved in the initial innate immune response. Copyright © 2018 Elsevier B.V. All rights reserved.
Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses
Feng, Pinghui; Moses, Ashlee; Früh, Klaus
2015-01-01
γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Losartan corrects abnormal frequency response of renal vasculature in congestive heart failure.
DiBona, Gerald F; Sawin, Linda L
2003-11-01
In congestive heart failure, renal blood flow is decreased and renal vascular resistance is increased in a setting of increased activity of both the sympathetic nervous and renin-angiotensin systems. The renal vasoconstrictor response to renal nerve stimulation is enhanced. This is associated with an abnormality in the low-pass filter function of the renal vasculature wherein higher frequencies (> or =0.01 Hz) within renal sympathetic nerve activity are not normally attenuated and are passed into the renal blood flow signal. This study tested the hypothesis that excess angiotensin II action mediates the abnormal frequency response characteristics of the renal vasculature in congestive heart failure. In anesthetized rats, the renal vasoconstrictor response to graded frequency renal nerve stimulation was significantly greater in congestive heart failure than in control rats. Losartan attenuated the renal vasoconstrictor response to a significantly greater degree in congestive heart failure than in control rats. In control rats, the frequency response of the renal vasculature was that of a first order (-20 dB/frequency decade) low-pass filter with a corner frequency (-3 dB, 30% attenuation) of 0.002 Hz and 97% attenuation (-30 dB) at > or =0.1 Hz. In congestive heart failure rats, attenuation did not exceed 45% (-5 dB) over the frequency range of 0.001-0.6 Hz. The frequency response of the renal vasculature was not affected by losartan treatment in control rats but was completely restored to normal by losartan treatment in congestive heart failure rats. The enhanced renal vasoconstrictor response to renal nerve stimulation and the associated abnormality in the frequency response characteristics of the renal vasculature seen in congestive heart failure are mediated by the action of angiotensin II on renal angiotensin II AT1 receptors.
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.
Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna
2014-01-01
Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.
Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine
Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.
1973-01-01
The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112
Modulation of Human Immune Response by Fungal Biocontrol Agents
Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane
2017-01-01
Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107
Modular Activating Receptors in Innate and Adaptive Immunity.
Berry, Richard; Call, Matthew E
2017-03-14
Triggering of cell-mediated immunity is largely dependent on the recognition of foreign or abnormal molecules by a myriad of cell surface-bound receptors. Many activating immune receptors do not possess any intrinsic signaling capacity but instead form noncovalent complexes with one or more dimeric signaling modules that communicate with a common set of kinases to initiate intracellular information-transfer pathways. This modular architecture, where the ligand binding and signaling functions are detached from one another, is a common theme that is widely employed throughout the innate and adaptive arms of immune systems. The evolutionary advantages of this highly adaptable platform for molecular recognition are visible in the variety of ligand-receptor interactions that can be linked to common signaling pathways, the diversification of receptor modules in response to pathogen challenges, and the amplification of cellular responses through incorporation of multiple signaling motifs. Here we provide an overview of the major classes of modular activating immune receptors and outline the current state of knowledge regarding how these receptors assemble, recognize their ligands, and ultimately trigger intracellular signal transduction pathways that activate immune cell effector functions.
Work stress and innate immune response.
Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L
2011-01-01
Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.
Socioeconomic disadvantage, gestational immune activity, and neurodevelopment in early childhood
Hornig, Mady; Ghassabian, Akhgar; Hahn, Jill; Cherkerzian, Sara; Albert, Paul S.; Buka, Stephen L.; Goldstein, Jill M.
2017-01-01
Children raised in economically disadvantaged households face increased risks of poor health in adulthood, suggesting that inequalities in health have early origins. From the child’s perspective, exposure to economic hardship may begin as early as conception, potentially via maternal neuroendocrine–immune responses to prenatal stressors, which adversely impact neurodevelopment. Here we investigate whether socioeconomic disadvantage is associated with gestational immune activity and whether such activity is associated with abnormalities among offspring during infancy. We analyzed concentrations of five immune markers (IL-1β, IL-6, IL-8, IL-10, and TNF-α) in maternal serum from 1,494 participants in the New England Family Study in relation to the level of maternal socioeconomic disadvantage and their involvement in offspring neurologic abnormalities at 4 mo and 1 y of age. Median concentrations of IL-8 were lower in the most disadvantaged pregnancies [−1.53 log(pg/mL); 95% CI: −1.81, −1.25]. Offspring of these pregnancies had significantly higher risk of neurologic abnormalities at 4 mo [odds ratio (OR) = 4.61; CI = 2.84, 7.48] and 1 y (OR = 2.05; CI = 1.08, 3.90). This higher risk was accounted for in part by fetal exposure to lower maternal IL-8, which also predicted higher risks of neurologic abnormalities at 4 mo (OR = 7.67; CI = 4.05, 14.49) and 1 y (OR = 2.92; CI = 1.46, 5.87). Findings support the role of maternal immune activity in fetal neurodevelopment, exacerbated in part by socioeconomic disadvantage. This finding reveals a potential pathophysiologic pathway involved in the intergenerational transmission of socioeconomic inequalities in health. PMID:28607066
Complement anaphylatoxins as immune regulators in cancer.
Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T
2014-08-01
The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Famakin, Bolanle M.
2014-01-01
It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490
Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.
Mack, Madison R; Kim, Brian S
2016-07-19
The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.
Immune Response in Mussels To Environmental Pollution.
ERIC Educational Resources Information Center
Pryor, Stephen C.; Facher, Evan
1997-01-01
Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)
Effect of rituximab on human in vivo antibody immune responses.
Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana
2011-12-01
B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights
Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.
Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna
2017-12-11
Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.
Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J
2015-01-01
Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.
Spreading Photoparoxysmal EEG Response is Associated with an Abnormal Cortical Excitability Pattern
ERIC Educational Resources Information Center
Siniatchkin, Michael; Groppa, Sergey; Jerosch, Bettina; Muhle, Hiltrud; Kurth, Christoph; Shepherd, Alex J.; Siebner, Hartwig; Stephani, Ulrich
2007-01-01
Photosensitivity or photoparoxysmal response (PPR) is a highly heritable electroencephalographic trait characterized by an abnormal cortical response to intermittent photic stimulation (IPS). In PPR-positive individuals, IPS induces spikes, spike-waves or intermittent slow waves. The PPR may be restricted to posterior visual areas (i.e. local PPR…
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
Successful Treatment of Aggressive Mature B-cell Lymphoma Mimicking Immune Thrombocytopenic Purpura.
Ono, Koya; Onishi, Yasushi; Kobayashi, Masahiro; Ichikawa, Satoshi; Hatta, Shunsuke; Watanabe, Shotaro; Okitsu, Yoko; Fukuhara, Noriko; Ichinohasama, Ryo; Harigae, Hideo
2018-03-30
A 55-year-old woman suffered from hemorrhagic tendency. She had severe thrombocytopenia without any hematological or coagulatory abnormalities, and a bone marrow examination revealed an increased number of megakaryocytes without any abnormal cells or blasts. No lymphadenopathy or hepatosplenomegaly was observed on computed tomography. She was initially diagnosed with immune thrombocytopenic purpura (ITP). None of the treatments administered for ITP produced a response. However, abnormal cells were eventually found during the third bone marrow examination. The pathological diagnosis was mature B-cell lymphoma. Rituximab-containing chemotherapy produced a marked increase in the patient's platelet count, and her lymphoma went into complete remission.
Crosstalk between cancer and the neuro-immune system.
Kuol, Nyanbol; Stojanovska, Lily; Apostolopoulos, Vasso; Nurgali, Kulmira
2018-02-15
In the last decade, understanding of cancer initiation and progression has been given much attention with studies mainly focusing on genetic abnormalities. Importantly, cancer cells can influence their microenvironment and bi-directionally communicate with other systems such as the immune system. The nervous system plays a fundamental role in regulating immune responses to a range of disease states including cancer. Its dysfunction influences the progression of cancer. The role of the immune system in tumor progression is of relevance to the nervous system since they can bi-directionally communicate via neurotransmitters and neuropeptides, common receptors, and, cytokines. However, cross-talk between these cells is highly complex in nature, and numerous variations are possible according to the type of cancer involved. The neuro-immune interaction is essential in influencing cancer development and progression. Copyright © 2017 Elsevier B.V. All rights reserved.
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra
2016-06-01
Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.
Tricking the balance: NK cells in anti-cancer immunity.
Pahl, Jens; Cerwenka, Adelheid
2017-01-01
Natural Killer (NK) cells are classically considered innate immune effector cells involved in the first line of defense against infected and malignant cells. More recently, NK cells have emerged to acquire properties of adaptive immunity in response to certain viral infections such as expansion of specific NK cell subsets and long-lasting virus-specific responses to secondary challenges. NK cells distinguish healthy cells from abnormal cells by measuring the net input of activating and inhibitory signals perceived from target cells through NK cell surface receptors. Acquisition of activating ligands in combination with reduced expression of MHC class I molecules on virus-infected and cancer cells activates NK cell cytotoxicity and release of immunostimulatory cytokines like IFN-γ. In the cancer microenvironment however, NK cells become functionally impaired by inhibitory factors produced by immunosuppressive immune cells and cancer cells. Here we review recent progress on the role of NK cells in cancer immunity. We describe regulatory factors of the tumor microenvironment on NK cell function which determine cancer cell destruction or escape from immune recognition. Finally, recent strategies that focus on exploiting NK cell anti-cancer responses for immunotherapeutic approaches are outlined. Copyright © 2015 Elsevier GmbH. All rights reserved.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection
2000-01-01
iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT
How might infant and paediatric immune responses influence malaria vaccine efficacy?
Moormann, A M
2009-09-01
Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.
Acquired immunity to amyloodiniosis is associated with an antibody response.
Cobb, C S; Levy, M G; Noga, E J
1998-10-08
The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.
Immunosuppressive activity of tilmicosin on the immune responses in mice.
Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming
2011-06-01
Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Hardcastle, Sharni Lee; Brenu, Ekua Weba; Johnston, Samantha; Nguyen, Thao; Huth, Teilah; Ramos, Sandra; Staines, Donald; Marshall-Gradisnik, Sonya
2015-09-14
Research has identified immunological abnormalities in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME), a heterogeneous illness with an unknown cause and absence of diagnostic test. There have been no CFS/ME studies examining innate and adaptive immune cells longitudinally in patients with varying severities. This is the first study to investigate immune cells over 6 months while also examining CFS/ME patients of varying symptom severity. Participants were grouped into 18 healthy controls, 12 moderate and 12 severe CFS/ME patients and flow cytometry was used to examine cell parameters at 0 and 6 months. Over time, iNKT CD62L expression significantly increased in moderate CFS/ME patients and CD56(bright) NK receptors differed in severe CFS/ME. Naïve CD8(+)T cells, CD8(-)CD4(-) and CD56(-)CD16(-) iNKT phenotypes, γδ2T cells and effector memory subsets were significantly increased in severe CFS/ME patients at 6 months. Severe CFS/ME patients were significantly reduced in CD56(bright)CD16(dim) NKG2D, CD56(dim)CD16(-) KIR2DL2/DL3, CD94(-)CD11a(-) γδ1T cells and CD62L(+)CD11a(-) γδ1T cells at 6 months. Severe CFS/ME patients differed from controls and moderate CFS/ME patients over time and expressed significant alterations in iNKT cell phenotypes, CD8(+)T cell markers, NK cell receptors and γδT cells at 6 months. This highlights the importance of further assessing these potential immune biomarkers longitudinally in both moderate and severe CFS/ME patients.
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Ecosystem and immune systems: Hierarchial response provides resilience against invasions
Allen, Craig R.
2001-01-01
Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.
pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.
Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori
2017-11-04
(1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.
Reuben, C; Sundaram, K; Phondke, G P
1979-01-01
The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Bivalve immunity and response to infections: Are we looking at the right place?
Allam, Bassem; Pales Espinosa, Emmanuelle
2016-06-01
Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S
2014-01-01
The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157
How sex and age affect immune responses, susceptibility to infections, and response to vaccination
Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix
2015-01-01
Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438
NASA Astrophysics Data System (ADS)
Aguilera, Eduardo; Amat, Juan A.
2007-11-01
Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.
Interference of Aspergillus fumigatus with the immune response.
Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A
2015-03-01
Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes
Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen
2014-01-01
Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463
Antimicrobial autophagy: a conserved innate immune response in Drosophila.
Moy, Ryan H; Cherry, Sara
2013-01-01
Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Responses of innate immune cells to group A Streptococcus
Fieber, Christina; Kovarik, Pavel
2014-01-01
Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C
2011-10-01
A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease
NASA Astrophysics Data System (ADS)
Sun, Jun; Deem, Michael
2006-03-01
The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.
Huang, Lihui; Han, Demin; Guo, Ying; Liu, Sha; Cui, Xiaoyan; Mo, Lingyan; Qi, Beier; Cai, Zhenghua; Liu, Hui; En, Hui; Guo, Liansheng
2008-10-01
Audiological characteristics were investigated in 81 ears of 53 infants with abnormal transient evoked otoacoustic emission (TEOAE) and normal auditory brainstem response (ABR). The relationship between ABR and other hearing testing methods, including 40Hz auditory event-related potential (40Hz-AERP), auditory steady state response (ASSR), distortion product otoacoustic emission (DPOAE), tympanometry, and acoustic reflex, was analyzed. Of the 81 ears, 18 ears (22.2%) were normal, while 63 ears (77.8%) were abnormal according to the tests. Testing of the 40 Hz AERP (36 ears) and ASSR (45 ears) revealed that 14 ears (38.9%) and 27 ears (60.0%) were abnormal, respectively. Testing of DPOAE in 68 ears revealed that 50 ears (73.5%) were abnormal. Testing of tympanometry in 50 ears and acoustic reflex in 47 ears revealed that 9 ears (18%) and 27 ears (57.4%) were abnormal, respectively. The present data suggests that the hearing of infants cannot be sufficiently evaluated with ABR only and that it must be evaluated with integrative audiological testing methods.
The nature of immune responses to urinary tract infections
Abraham, Soman N.; Miao, Yuxuan
2016-01-01
The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331
RNA Editing, ADAR1, and the Innate Immune Response.
Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy
2017-01-18
RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.
Ubiquitination in the antiviral immune response.
Davis, Meredith E; Gack, Michaela U
2015-05-01
Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune responses of poultry to Newcastle disease virus.
Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J
2013-11-01
Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Host Immune Status and Response to Hepatitis E Virus Infection
Krain, Lisa J.; Nelson, Kenrad E.
2014-01-01
SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140
Bloem, B R; Beckley, D J; van Dijk, J G
1999-02-01
Abnormal automatic postural responses are thought to contribute to balance impairment in Parkinson's disease. However, because postural responses are modifiable by stance, we have speculated that some postural abnormalities in patients with Parkinson's disease are secondary to their stooped stance. We have studied this assumption by assessing automatic postural responses in 30 healthy subjects who were instructed either to stand upright or to assume a typical parkinsonian posture. During both conditions, subjects received 20 serial 4 degrees 'toe-up' rotational perturbations from a supporting forceplate. We recorded short-latency (SL) and medium-latency (ML) responses from stretched gastrocnemius muscles and long-latency (LL) responses from shortened tibialis anterior muscles. We also assessed changes in the center of foot pressure (CFP) and the center of gravity (COG). The results were qualitatively compared to a previously described group of patients with Parkinson's disease who, under these circumstances, typically have large ML responses, small LL responses and insufficient voluntary postural corrections, accompanied by a slow rate of backward CFP displacement and an increased posterior COG displacement. The stooped posture resulted in unloading of medial gastrocnemius muscles and loading of tibialis anterior muscles. Onset latencies of stretch responses in gastrocnemius muscles were delayed in stooped subjects, but the onset of LL responses was markedly reduced. Amplitudes of both ML and LL responses were reduced in stooped subjects. Prestimulus COG and, to a lesser extent, CFP were shifted forwards in stooped subjects. Posterior COG displacement and the rate of backward CFP displacement were diminished in stooped subjects. Voluntary postural corrections were unchanged while standing stooped. These results indicate that some postural abnormalities of patients with Parkinson's disease (most notably the reduced LL responses) can be reproduced in healthy subjects
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4
Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna
2017-01-01
Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D
2002-06-21
NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.
Einstein, Mark H
2008-04-01
Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.
2014-01-01
Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively
Dissecting innate immune responses with the tools of systems biology.
Smith, Kelly D; Bolouri, Hamid
2005-02-01
Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.
Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.
Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T
2013-11-01
Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Buckley, Katherine M.; Rast, Jonathan P.
2017-01-01
The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720
Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina
2016-07-19
mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock
2011-05-01
The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan
Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
Neutrophil Apoptosis: Relevance to the Innate Immune Response and Inflammatory Disease
Fox, Sarah; Leitch, Andrew E.; Duffin, Rodger; Haslett, Christopher; Rossi, Adriano G.
2010-01-01
Neutrophils are the most abundant cell type involved in the innate immune response. They are rapidly recruited to sites of injury or infection where they engulf and kill invading microorganisms. Neutrophil apoptosis, the process of programmed cell death that prevents the release of neutrophil histotoxic contents, is tightly regulated and limits the destructive capacity of neutrophil products to surrounding tissue. The subsequent recognition and phagocytosis of apoptotic cells by phagocytic cells such as macrophages is central to the successful resolution of an inflammatory response and it is increasingly apparent that the dying neutrophil itself exerts an anti-inflammatory effect through modulation of surrounding cell responses, particularly macrophage inflammatory cytokine release. Apoptosis may be delayed, induced or enhanced by micro-organisms dependent on their immune evasion strategies and the health of the host they encounter. There is now an established field of research aimed at understanding the regulation of apoptosis and its potential as a target for therapeutic intervention in inflammatory and infective diseases. This review focuses on the physiological regulation of neutrophil apoptosis with respect to the innate immune system and highlights recent advances in mechanistic understanding of apoptotic pathways and their therapeutic manipulation in appropriate and excessive innate immune responses. PMID:20375550
Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response
Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann
2015-01-01
Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190
Immune response varies with rate of dispersal in invasive cane toads (Rhinella marina).
Brown, Gregory P; Shine, Richard
2014-01-01
What level of immunocompetence should an animal maintain while undertaking long-distance dispersal? Immune function (surveillance and response) might be down-regulated during prolonged physical exertion due to energy depletion, and/or to avoid autoimmune reactions arising from damaged tissue. On the other hand, heightened immune vigilance might be favored if the organism encounters novel pathogens as it enters novel environments. We assessed the links between immune defense and long-distance movement in a population of invasive cane toads (Rhinella marina) in Australia. Toads were radio-tracked for seven days to measure their activity levels and were then captured and subjected to a suite of immune assays. Toads that moved further showed decreased bacteria-killing ability in their plasma and decreased phagocytic activity in their whole blood, but a heightened skin-swelling response to phytohemagglutinin. Baseline and post-stress corticosterone levels were unrelated to distance moved. Thus, long-distance movement in cane toads is associated with a dampened response in some systems and enhanced response in another. This pattern suggests that sustained activity is accompanied by trade-offs among immune components rather than an overall down or up-regulation. The finding that high mobility is accompanied by modification of the immune system has important implications for animal invasions.
Immune-expression of HSP27 and IL-10 in recurrent aphthous ulceration.
Miyamoto, Nelson T; Borra, Ricardo Carneiro; Abreu, Marilda; Weckx, Luc Louis Maurice; Franco, Marcello
2008-09-01
Recently, abnormal cellular immune response has been considered responsible for the oral lesion in the recurrent aphthous ulceration (RAU). For reasons not yet defined, antigens of the oral microbiota would trigger abnormal Th1 immune response against epithelial cells. On the other hand, studies have demonstrated that heat shock proteins (HSP) can block the production of proinflammatory cytokine through inhibition of NF-kappaB and mitogen-activated protein kinase pathways or activate anti-inflammatory cytokines and therefore control the magnitude of the immune response. HSP27 has been considered a powerful inductor of IL-10, a major inhibitor of Th1 response. Using immunohistochemistry, we studied the expression and location of HSP27 and IL-10 in ulcerated lesions clinically diagnosed as RAU (n = 27) and to compare it with that of oral clinically normal mucosa (CT; n = 6) and of other inflammatory chronic diseases such as oral fibrous inflammatory hyperplasia (FIH; n = 18), Crohn's disease (CD; n = 10) and ulcerative colitis (UC; n = 9). A lower proportion of HSP27-positive epithelial cells in RAU and CD were observed when compared with CT and FIH (P < 0.001**; P = 0.013**). A lower proportion of IL-10-positive interstitial cells in RAU was observed when compared with FIH, UC, CT and CD (P < 0.001**; P < 0.001**; P < 0.001**; P = 0.034*). Altogether the data suggest that a reduced cellular expression of HSP27 and IL-10 in RAU might be related with the aetiopathogenesis of the ulcerated oral lesions.
Abnormal immune response of CCR5-deficient mice to ocular infection with herpes simplex virus type 1
Carr, Daniel J.J.; Ash, John; Lane, Thomas E.; Kuziel, William A.
2006-01-01
Summary Ocular herpes simplex virus type 1 (HSV-1) infection elicits a strong inflammatory response that is associated with production of the β chemokines CCL3 and CCL5, which share a common receptor, CCR5. To gain insight into the role of these molecules in ocular immune responses, we infected the corneas of WT and CCR5-deficient (CCR5-/-) mice with HSV-1 and measured inflammatory parameters. In the absence of CCR5, the early infiltration of neutrophils into the cornea was diminished. Associated with this aberrant leukocyte recruitment, neutrophils in CCR5-/- mice were restricted to the stroma whereas in wild type mice these cells trafficked to the stroma and epithelial layers of the infected cornea. Virus titers and cytokine/chemokine levels in the infected tissue of these mice were similar for the first 5 days after infection. However, by day 7 post-infection, the CCR5-/- mice showed a significant elevation in the chemokines CCL2, CCL5, CXCL9, and CXCL10 in the trigeminal ganglion and brain stem as well as a significant increase in viral burden. The increase in chemokine expression was associated with an increase in the infiltration of CD4 and/or CD8 T cells into the trigeminal ganglion and brain stem of CCR5-/- mice. Surprisingly, even though infected CCR5-/- mice were less efficient at controlling the progression of virus replication, there was no difference in mortality. These results suggest that, although CCR5 plays a role in regulating leukocyte trafficking and control of virus burden, compensatory mechanisms are involved in preventing mortality following HSV-1 infection. PMID:16476970
T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.
Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua
2018-05-09
B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.
Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.
Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula
2017-05-03
Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.
Modulation of Specific and Allergy-Related Immune Responses by Helminths
Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne
2011-01-01
Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659
Tetranychus urticae mites do not mount an induced immune response against bacteria
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara
2017-01-01
The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670
Tetranychus urticae mites do not mount an induced immune response against bacteria.
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio
2017-06-14
The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.
Genomics of immune response to typhoid and cholera vaccines
Majumder, Partha P.
2015-01-01
Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454
Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce
2018-01-01
Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti
Immune response during space flight.
Criswell-Hudak, B S
1991-01-01
The health status of an astronaut prior to and following space flight has been a prime concern of NASA throughout the Apollo series of lunar landings, Skylab, Apollo-Soyuz Test Projects (ASTP), and the new Spacelab-Shuttle missions. Both humoral and cellular immunity has been studied using classical clinical procedures. Serum proteins show fluctuations that can be explained with adaptation to flight. Conversely, cellular immune responses of lymphocytes appear to be depressed in both in vivo as well as in vitro. If this depression in vivo and in vitro is a result of the same cause, then man's adaptation to outer space living will present interesting challenges in the future. Since the cause may be due to reduced gravity, perhaps the designs of the experiments for space flight will offer insights at the cellular levels that will facilitate development of mechanisms for adaptation. Further, if the aging process is viewed as an adaptational concept or model and not as a disease process then perhaps space flight could very easily interact to supply some information on our biological time clocks.
Obanewa, Olayinka; Newell, Marie-Louise
2017-09-01
To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Immune response and immunologic memory in medical personnel vaccinated with hepatitis B vaccine.
Kevorkyan, Ani K; Teoharov, Pavel B; Petrova, Nedyalka S; Baltadzhiev, Ivan G; Stoilova, Yordanka D; Angelova, Nevena G; Plachkova, Angelina D
2011-01-01
The occupation-related nature of Hepatitis B viral infection in medical personnel has been well documented in a lot of studies. The only reliable way of prevention of this infection is immunisation with hepatitis B vaccine. To follow-up the primary immune response after immunisation with recombinant vaccine and its duration in adult immunocompetent subjects. One hundred sixty-five health-care workers working at St. George University Hospital, Plovdiv in 2009/2010 were included in the study and allocated to two groups. Group 1 (N1 = 70) was followed up for the primary immune response after immunization; group 2 (N2 = 95) was with documented immunization in 1998/1999 (n = 81) and in 1994/1995 (n = 14). Tests based on ELISA for quantitative determination of anti-HBs in mIU/ml were used. The measurement were performed at the National Reference Laboratory of Viral Hepatitis at the NCIPD, Sofia. Descriptive statistics, non-parametric and parametric tests, qualitative correlation were used to analyse data. Group 1 mean age was 40.3 +/- 2.6 years; anti-HBs concentration of > or = 10 mIU/ ml was found in 92.8%. No association between the immune response and the commonly involved factors such as gender, age, overweight, smoking, etc., was found. In group 2, anti-HBs concentration of > or = 10 mIU/ml was found in 77.9%: it was in 75.3% in those immunized 10 years before, and in 92.9% in those immunized 15 years before (t = 0.24, p > 0.05). A booster dose of the vaccine was received by 15/21 subjects from group 2 (those immunized 10 years before that) with anti-HBs < 10 mIU/ml. After the booster, 9/15 produced anti-HBs in protective concentrations (anamnestic immune response). The actual level of seroprotection among the immunized more than 10 years ago was 92%. This study and the documentation of the primary postvaccinal immunity in high-risk medical personnel will help specify if additional hepatitis B vaccine shots are needed.
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Genes of innate immunity and the biological response to inhaled ozone
Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.
2013-01-01
Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704
The immune response against Candida spp. and Sporothrix schenckii.
Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M
2014-01-01
Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A
2016-01-01
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel
2017-10-27
For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27
Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.
Maeda, Yoshinobu
2013-09-01
In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P
2016-10-01
The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.
Immune-Neuroendocrine Interactions and Autoimmune Diseases
Jara, Luis J.; Navarro, Carmen; Medina, Gabriela; Vera-Lastra, Olga; Blanco, Francisco
2006-01-01
The relationship between immune-neuroendocrine system is firmly established. The messengers of this connection are hormones, neuropeptides, neurotransmitters and cytokines. The immune-neuroendocrine system have the capacity to synthesize and release these molecules, which, in turn, can stimulate or suppress the activity of immune or neuroendocrine cells by binding to receptors. In fact, hormones, neuropeptides and neurotransmitters participate in innate and adaptive immune response.Autoimmune rheumatic diseases (ARD) are characterized by aberrant production of pro-inflammatory cytokines, which are a potent activator of the HPA axis. In consequence, high levels of pro-inflammatory hormones such as estrogens and prolactin, and low levels of glucocorticoids, an anti-inflammatory hormone, have been described in the active phase of ARD. In addition, high levels of pro-inflammatory hormones and cytokines have also been frequently detected in organ involvement of patients with ARD, suggesting an abnormal local neuroendocrine immune interaction. There is evidence that hormonal changes may appear before the symptomatic phase of the disease. Therefore, it is possible that a pro-inflammatory hormone favors the rupture of tolerance, which is a key feature of autoimmune diseases. The interactions between the immune-neuroendocrine system have a major impact on our understanding of the pathogenic mechanisms, diagnosis and therapy of ARD. PMID:17162354
Berg, Michael G; Adams, Robert J; Gambhira, Ratish; Siracusa, Mark C; Scott, Alan L; Roden, Richard B S; Ketner, Gary
2014-09-01
Immunization with human papillomavirus (HPV) L1 virus-like particles (VLPs) prevents infection with HPV. However, the expense and logistical demands of current VLP vaccines will limit their widespread use in resource-limited settings, where most HPV-induced cervical cancer occurs. Live oral adenovirus vaccines have properties that are well-suited for use in such settings. We have described a live recombinant adenovirus vaccine prototype that produces abundant HPV16 L1 protein from the adenovirus major late transcriptional unit and directs the assembly of HPV16 VLPs in tissue culture. Recombinant-derived VLPs potently elicit neutralizing antibodies in mice. Here, we characterize the immune response to the recombinant after dual oral and intranasal immunization of pigtail macaques, in which the virus replicates as it would in immunized humans. The immunization of macaques induced vigorous humoral responses to adenovirus capsid and nonstructural proteins, although, surprisingly, not against HPV L1. In contrast, immunization elicited strong T-cell responses to HPV VLPs as well as adenovirus virions. T-cell responses arose immediately after the primary immunization and were boosted by a second immunization with recombinant virus. T-cell immunity contributes to protection against a wide variety of pathogens, including many viruses. The induction of a strong cellular response by the recombinant indicates that live adenovirus recombinants have potential as vaccines for those agents. These studies encourage and will inform the continued development of viable recombinant adenovirus vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Rossignol, D A; Frye, R E
2012-01-01
Recent studies have implicated physiological and metabolic abnormalities in autism spectrum disorders (ASD) and other psychiatric disorders, particularly immune dysregulation or inflammation, oxidative stress, mitochondrial dysfunction and environmental toxicant exposures (‘four major areas'). The aim of this study was to determine trends in the literature on these topics with respect to ASD. A comprehensive literature search from 1971 to 2010 was performed in these four major areas in ASD with three objectives. First, publications were divided by several criteria, including whether or not they implicated an association between the physiological abnormality and ASD. A large percentage of publications implicated an association between ASD and immune dysregulation/inflammation (416 out of 437 publications, 95%), oxidative stress (all 115), mitochondrial dysfunction (145 of 153, 95%) and toxicant exposures (170 of 190, 89%). Second, the strength of evidence for publications in each area was computed using a validated scale. The strongest evidence was for immune dysregulation/inflammation and oxidative stress, followed by toxicant exposures and mitochondrial dysfunction. In all areas, at least 45% of the publications were rated as providing strong evidence for an association between the physiological abnormalities and ASD. Third, the time trends in the four major areas were compared with trends in neuroimaging, neuropathology, theory of mind and genetics (‘four comparison areas'). The number of publications per 5-year block in all eight areas was calculated in order to identify significant changes in trends. Prior to 1986, only 12 publications were identified in the four major areas and 51 in the four comparison areas (42 for genetics). For each 5-year period, the total number of publications in the eight combined areas increased progressively. Most publications (552 of 895, 62%) in the four major areas were published in the last 5 years (2006–2010). Evaluation
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis
2014-07-01
Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S.; Rowe, Dawne K.; Smith, Michaela J.; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H.; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K.; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie
2014-01-01
Background. Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. Methods. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. Results. We showed that YF-17D–induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D–neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Conclusion. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Trial registration. Registration is not required for observational studies. Funding. This study was funded by Canada’s Global Health Research Initiative, Defense
Innate and adaptive immune responses to cell death
Rock, Kenneth L.; Lai, Jiann-Jyh; Kono, Hajime
2011-01-01
Summary The immune system plays an essential role in protecting the host against infections and to accomplish this task has evolved mechanisms to recognize microbes and destroy them. In addition, it monitors the health of cells and responds to ones that have been injured and die, even if this occurs under sterile conditions. This process is initiated when dying cells expose intracellular molecules that can be recognized by cells of the innate immune system. As a consequence of this recognition, dendritic cells are activated in ways that help to promote T-cell responses to antigens associated with the dying cells. In addition, macrophages are stimulated to produce the cytokine interleukin-1 that then acts on radioresistant parenchymal cells in the host in ways that drive a robust inflammatory response. In addition to dead cells, a number of other sterile particles and altered physiological states can similarly stimulate an inflammatory response and do so through common pathways involving the inflammasome and interleukin-1. These pathways underlie the pathogenesis of a number of diseases. PMID:21884177
Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection
Duan, Susu; Thomas, Paul G.
2016-01-01
Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022
Genetics of immune recognition and response in Drosophila host defense.
Ligoxygakis, Petros
2013-01-01
Due to the evolutionary conservation of innate immune mechanisms, Drosophila has been extensively used as a model for the dissection in genetic terms of innate host immunity to infection. Genetic screening in fruit flies has set the stage for the pathways and systems required for responding to immune challenge and the dynamics of the progression of bacterial and fungal infection. In addition, fruit flies have been used as infection models to dissect host-pathogen interactions from both sides of this equation. This chapter describes our current understanding of the genetics of the fruit fly immune response and summarizes the most important findings in this area during the past decade. © 2013 Elsevier Inc. All rights reserved.
GENETIC CONTROL OF THE IMMUNE RESPONSE
Lonai, Peter; McDevitt, Hugh O.
1974-01-01
In vitro antigen-induced tritiated thymidine uptake has been used to study the response of sensitized lymphocytes to (T,G)-A--L, (H,G)-A--L, and (Phe,G)-A--L in responder and nonresponder strains of mice. The reaction is T-cell and macrophage dependent. Highly purified T cells (91% Thy 1.2 positive) are also responsive, suggesting that this in vitro lymphocyte transformation system is not B-cell dependent. Lymphocytes from high and low responder mice stimulated in vitro react as responders and nonresponders in a pattern identical to that seen with in vivo immunization. Stimulation occurs only if soluble antigen is added at physiological temperatures; antigen exposure at 4°C followed by washing and incubation at 37°C fails to induce lymphocyte transformation. Stimulation is specific for the immunizing antigen and does not exhibit the serologic cross-reactivity which is characteristic of these three antigens and their respective antisera. The reaction can be inhibited by anti-H-2 sera but not by anti-immunoglobulin sera. The anti-immunoglobulin sera did, however, inhibit lipopolysaccharide or pokeweed mitogen stimulation. These results suggest that the Ir-1A gene(s) are expressed in T cells, and that there are fundamental physiologic differences between T- and B-cell antigen recognition. PMID:4547782
Effects of chalcone derivatives on players of the immune system
Lee, Jian Sian; Bukhari, Syed Nasir Abbas; Fauzi, Norsyahida Mohd
2015-01-01
The immune system is the defense mechanism in living organisms that protects against the invasion of foreign materials, microorganisms, and pathogens. It involves multiple organs and tissues in human body, such as lymph nodes, spleen, and mucosa-associated lymphoid tissues. However, the execution of immune activities depends on a number of specific cell types, such as B cells, T cells, macrophages, and granulocytes, which provide various immune responses against pathogens. In addition to normal physiological functions, abnormal proliferation, migration, and differentiation of these cells (in response to various chemical stimuli produced by invading pathogens) have been associated with several pathological disorders. The unwanted conditions related to these cells have made them prominent targets in the development of new therapeutic interventions against various pathological implications, such as atherosclerosis and autoimmune diseases. Chalcone derivatives exhibit a broad spectrum of pharmacological activities, such as immunomodulation, as well as anti-inflammatory, anticancer, antiviral, and antimicrobial properties. Many studies have been conducted to determine their inhibitory or stimulatory activities in immune cells, and the findings are of significance to provide a new direction for subsequent research. This review highlights the effects of chalcone derivatives in different types of immune cells. PMID:26316713
Gopalraj, Jeyanthi B P; Clarke, Francoise C; Donkin, Edward F
2013-01-01
Changes in serum gamma globulin levels, numbers of replete female ticks and engorged tick mass were used as parameters to monitor the acquired immune response (antibody mediated immune response) elicited by Rhipicephalus appendiculatus adult tick infestations. Three consecutive Rhipicephalus appendiculatus adult tick infestations were applied to South African Indigenous goats (Nguni), Saanen goats and cross-bred goats (Saanen goats crossed with South African Indigenous goats [Nguni]) under laboratory conditions. During the three consecutive Rhipicephalus appendiculatus adult tick infestations the serum gamma globulin levels increased in all three breeds, whilst the mean replete female tick numbers and engorged tick mass decreased. Even though all three goat breeds exhibited an acquired immune response, the South African Indigenous goats (Nguni) response was significantly higher than that of the Saanen and cross-bred goats. However, the acquired immune response elicited by Saanen goats was significantly lower when compared with cross-bred goats.
Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.
Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo
2017-01-01
Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.
Behavioural fever is a synergic signal amplifying the innate immune response.
Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S
2013-09-07
Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.
Jung, Bock-Gie; Lee, Jin-A; Lee, Bong-Joo
2012-12-01
It has been considered that drinking oxygenated water improves oxygen availability, which may increase vitality and improve immune functions. The present study evaluated the effects of oxygenated drinking water on immune function in pigs. Continuous drinking of oxygenated water markedly increased peripheral blood mononuclear cell proliferation, interleukin-1β expression level and the CD4(+):CD8(+) cell ratio in pigs. During Salmonella Typhimurium infection, total leukocytes and relative cytokines expression levels were significantly increased in pigs consuming oxygenated water compared with pigs consuming tap water. These findings suggest that oxygenated drinking water enhances immune activity in pigs and increases immune responses of pigs during S. Typhimurium Infection.
Spore load and immune response of honey bees naturally infected by Nosema ceranae.
Li, Wenfeng; Evans, Jay D; Li, Jianghong; Su, Songkun; Hamilton, Michele; Chen, Yanping
2017-12-01
Nosema ceranae causes widespread infection in adult workers of European honey bees, Apis mellifera, and has often been linked to honey bee colony losses worldwide. Previous investigations of honey bee immune response to N. ceranae infection were largely based on laboratory experiment, however, little is known about the immune response of honey bees that are naturally infected by N. ceranae. Here, we compared the infection levels of N. ceranae in three different categories of adult bees (emergent bees, nurses, and foragers) and detected the host immune response to the N. ceranae infection under natural conditions. Our studies showed that the Nosema spore load and infection prevalence varied among the different types of adult workers, and both of them increased as honey bees aged: No infection was detected in emergent bees, nurses had a medium spore load and prevalence, while foragers were with the highest Nosema infection level and prevalence. Quantification of the mRNA levels of antimicrobial peptides (abaecin, apidaecin, defensin-1, defensin-2, and hymenoptaecin) and microbial recognition proteins (PGRP-S1, PGRP-S2, PGRP-S3, PGRP-LC, GNBP1-1, and GNBP1-2) confirmed the involvement of the Toll and/or Imd immune pathways in the host response to N. ceranae infection, and revealed an activation of host immune response by N. ceranae infection under natural conditions. Additionally, the levels of immune response were positively correlated with the Nosema spore loads in the infected bees. The information gained from this study will be relevant to the predictive modeling of honey bee disease dynamics for Nosema disease prevention and management.
Seasonal changes in the relationship between ornamentation and immune response in red jungle fowl
Zuk, M.; Johnsen, T. S.
1998-01-01
Resistance to disease is frequently suggested to be important in mate choice, but information about how immune status can be conveyed is lacking. During the breeding season, male red jungle fowl with large combs, a sexually selected trait, have lower levels of lymphocytes, but greater cell-mediated immunity, indicated by a cutaneous hypersensitivity response. Before the breeding season, however, both cell-mediated immunity and proportion of lymphocytes are positively correlated with comb length. Cell-mediated immunity is particularly important to jungle fowl during the breeding season, because the likelihood of injury during sexual competition is high and cell-mediated immunity is essential for healing wounds and resisting infection. This seasonal change in one aspect of immunity but not another suggests that the birds adaptively maintain certain immune system abilities, and that it can be misleading to use a single aspect of immune response in evaluating immunocompetence.
Ondondo, Beatrice Omusiro
2014-01-01
Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678
Ma, Jin-lu; Jin, Long; Li, Yao-Dong; He, Chen-chen; Guo, Xi-jing; Liu, Rui; Yang, Yun-Yi; Han, Su-xia
2014-01-01
Radiation therapy is one of the standard therapeutic modalities for esophageal cancer, achieving its main antitumor efficacy through DNA damage. However, accumulating evidence shows that radiotherapy can substantially alter the tumor microenvironment, particularly with respect to its effects on immune cells. We hypothesized that the immune response elicited by radiotherapy may be as important as the radiation itself for successful treatment. More specifically, immunomodulatory cytokines may enhance the effectiveness of radiotherapy. To investigate this hypothesis, we measured changes in the serum interferon-gamma (IFN- γ ) and interleukin-2 (IL-2) concentrations during radiotherapy and compared these modifications with outcomes. We found that serum concentrations of IL-2 and IFN- γ were positively associated with local response to radiotherapy in esophageal cancer. More generally, the intensity of the radiotherapy-elicited immune response was positively associated with local response to radiotherapy in esophageal cancer. Changes in serum IL-2 and IFN- γ concentrations were further associated with increased risks of acute hematologic toxicity and acute organ toxicity of the esophagus, lung, and skin. These results suggest that deciphering the mechanisms of radiotherapy-elicited immune response may help in the development of therapeutic interventions that would enhance the efficacy of radiotherapy and convert some ineffective responses to effective responses.
Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists.
Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J
2005-01-01
The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.
[Research advances of anti-tumor immune response induced by pulse electric field ablation].
Cui, Guang-ying; Diao, Hong-yan
2015-11-01
As a novel tumor therapy, pulse electric field has shown a clinical perspective. This paper reviews the characteristics of tumor ablation by microsecond pulse and nanosecond pulse electric field, and the research advances of anti-tumor immune response induced by pulse electric field ablation. Recent researches indicate that the pulse electric field not only leads to a complete ablation of local tumor, but also stimulates a protective immune response, thereby inhibiting tumor recurrence and metastasis. These unique advantages will show an extensive clinical application in the future. However, the mechanism of anti-tumor immune response and the development of related tumor vaccine need further studies.
Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma
Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.
2014-01-01
Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327
Placental immune state shifts with gestational age.
Lewis, Emma L; Sierra, Luz-Jeannette; Barila, Guillermo O; Brown, Amy G; Porrett, Paige M; Elovitz, Michal A
2018-06-01
Placental immunologic functions are implicated in both the maintenance of a healthy pregnancy and the pathogenesis of obstetric complications. Immune populations at the maternal-fetal interface are hypothesized to support fetomaternal tolerance, defend the fetus from infection, and contribute to labor initiation. Despite the many potential roles of placental immune cells in normal and abnormal pregnancy, little is known about placental immune population dynamics over gestation, particularly near parturition. A daily placental immune cell census was established in a murine model by flow cytometry from mid to late gestation and compared to the maternal systemic immune census. Shifts in the placental immune state were further characterized through cytokine ELISAs. The placental immune census is distinct from the maternal systemic immune census, although the cells are primarily maternal in origin. Near term parturition, the placenta contains fewer CD11c-positive myeloid cells and regulatory T cells, and there is a concurrent decrease in placental IL-9 and IL-35. The immune profile of the placenta demonstrates a decrease in both regulatory immune cell types and cytokines late in gestation. Establishing the placental immune population dynamics over a healthy pregnancy will allow future investigation of placental immune cells during abnormal pregnancy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G
2015-06-01
The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.
The Immune System, Cytokines, and Biomarkers in Autism Spectrum Disorder.
Masi, Anne; Glozier, Nicholas; Dale, Russell; Guastella, Adam J
2017-04-01
Autism Spectrum Disorder (ASD) is a pervasive neurodevelopmental condition characterized by variable impairments in communication and social interaction as well as restricted interests and repetitive behaviors. Heterogeneity of presentation is a hallmark. Investigations of immune system problems in ASD, including aberrations in cytokine profiles and signaling, have been increasing in recent times and are the subject of ongoing interest. With the aim of establishing whether cytokines have utility as potential biomarkers that may define a subgroup of ASD, or function as an objective measure of response to treatment, this review summarizes the role of the immune system, discusses the relationship between the immune system, the brain, and behavior, and presents previously-identified immune system abnormalities in ASD, specifically addressing the role of cytokines in these aberrations. The roles and identification of biomarkers are also addressed, particularly with respect to cytokine profiles in ASD.
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans
Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali
2017-01-01
RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898
Immune responses in humans after 60 days of confinement
NASA Technical Reports Server (NTRS)
Schmitt, D. A.; Peres, C.; Sonnenfeld, G.; Tkackzuk, J.; Arquier, M.; Mauco, G.; Ohayon, E.
1995-01-01
A confinement experiment in a normobaric diving chamber was undertaken to better understand the effect of confinement and isolation on human psychology and physiology. Pre- and postconfinement blood samples were obtained from four test subjects and control donors to analyze immune responses. No modification in the levels of CD2+, CD3+, CD4+, CD8+, CD19+, and CD56+ cells was observed after confinement. Mitogen-induced T-lymphocyte proliferation and interleukin-2 receptor expression were not altered significantly. Whole blood interferon-alpha and gamma-induction and plasma cortisol levels were also unchanged, as was natural killer cell activity. These data suggest that in humans, no specific components of the immune response are affected by a 2-month isolation and confinement of a small group.
Rodenas, M C; Cabas, I; García-Alcázar, A; Meseguer, J; Mulero, V; García-Ayala, A
2016-05-01
17α-ethynylestradiol (EE2), a synthetic estrogen used in oral contraceptives and hormone replacement therapy, tamoxifen (Tmx), a selective estrogen-receptor modulator used in hormone replacement therapy, and G1, a G protein-coupled estrogen receptor (GPER) selective agonist, differentially increased the hepatic vitellogenin (vtg) gene expression and altered the immune response in adult gilthead seabream (Sparus aurata L.) males. However, no information exists on the effects of these compounds on the immune response of juveniles. This study aims, for the first time, to investigate the effects of the dietary intake of EE2, Tmx or G1 on the immune response of gilthead seabream juveniles and the capacity of the immune system of the specimens to recover its functionality after ceasing exposures (recovery period). The specimens were immunized with hemocyanin in the presence of aluminium adjuvant 1 (group A) or 120 (group B) days after the treatments ceased (dpt). The results indicate that EE2 and Tmx, but not G1, differentially promoted a transient alteration in hepatic vtg gene expression. Although all three compounds did not affect the production of reactive oxygen intermediates, they inhibited the induction of interleukin-1β (il1b) gene expression after priming. Interestingly, although Tmx increased the percentage of IgM-positive cells in both head kidney and spleen during the recovery period, the antibody response of vaccinated fish varied depending on the compound used and when the immunization was administered. Taken together, our results suggest that these compounds differentially alter the capacity of fish to respond to infection during ontogeny and, more interestingly, that the adaptive immune response remained altered to an extent that depends on the compound. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tarbell, Kristin V; Egen, Jackson G
2018-02-02
The generation and regulation of innate immune signals are key determinants of autoimmune pathogenesis. Emerging evidence suggests that parallel processes operating in the setting of solid tumors can similarly determine the balance between tolerance and immunity and ultimately the effectiveness of the antitumor immune response. In both contexts, self-specific responses start with innate immune cell activation that leads to the initial break in self-tolerance, which can be followed by immune response amplification and maturation through innate-adaptive crosstalk, and finally immune-mediated tissue/tumor destruction that can further potentiate inflammation. Of particular importance for these processes is type I IFN, which is induced in response to endogenous ligands, such as self-nucleic acids, and acts on myeloid cells to promote the expansion of autoreactive or tumor-specific T cells and their influx into the target tissue. Evidence from the study of human disease pathophysiology and genetics and mouse models of disease has revealed an extensive and complex network of negative regulatory pathways that has evolved to restrain type I IFN production and activity. Here, we review the overlapping features of self- and tumor-specific immune responses, including the central role that regulators of the type I IFN response and innate immune cell activation play in maintaining tolerance, and discuss how a better understanding of the pathophysiology of autoimmunity can help to identify new approaches to promote immune-mediated tumor destruction. ©2018 Society for Leukocyte Biology.
Lendvai, Nikoletta; Gnjatic, Sacha; Ritter, Erika; Mangone, Michael; Austin, Wayne; Reyner, Karina; Jayabalan, David; Niesvizky, Ruben; Jagannath, Sundar; Bhardwaj, Nina; Chen-Kiang, Selina; Old, Lloyd J.
2010-01-01
The type I melanoma antigen gene (MAGE) proteins CT7 (MAGE-C1) and MAGE-A3 are commonly expressed in multiple myeloma (MM), and their expression correlates with increased plasma cell proliferation and poor clinical outcome. They belong to the cancer-testis antigen (CTAg) group of tumor-associated proteins, some of which elicit spontaneous immune responses in cancer patients. CT7 and MAGE-A3 are promising antigenic targets for therapeutic tumor vaccines in myeloma; therefore, it is critical to determine if they are immunogenic in MM patients. We analyzed cellular and humoral immune responses against CTAgs in patients with plasma cell dyscrasias: MM, monoclonal gammopathy of undetermined significance (MGUS), and Waldenström's macroglobulinemia (WM). Bone marrow lymphocytes from two of four untreated MM patients exhibited CT7-specific cellular immune responses as measured by an autologous cellular immunity assay, the first such immune response to CT7 to be reported in cancer patients. Sera from 24 patients were screened by ELISA for humoral immune responses to CTAgs. Two patients with MM demonstrated positive titers, one for MAGE-A1 and the other for SSX1. These data demonstrate that CTAgs, particularly CT7, are immunogenic in MM patients and merit further exploration as targets of immunological therapy in MM. PMID:20108890
Lendvai, Nikoletta; Gnjatic, Sacha; Ritter, Erika; Mangone, Michael; Austin, Wayne; Reyner, Karina; Jayabalan, David; Niesvizky, Ruben; Jagannath, Sundar; Bhardwaj, Nina; Chen-Kiang, Selina; Old, Lloyd J; Cho, Hearn Jay
2010-01-29
The type I melanoma antigen gene (MAGE) proteins CT7 (MAGE-C1) and MAGE-A3 are commonly expressed in multiple myeloma (MM), and their expression correlates with increased plasma cell proliferation and poor clinical outcome. They belong to the cancer-testis antigen (CTAg) group of tumor-associated proteins, some of which elicit spontaneous immune responses in cancer patients. CT7 and MAGE-A3 are promising antigenic targets for therapeutic tumor vaccines in myeloma; therefore, it is critical to determine if they are immunogenic in MM patients. We analyzed cellular and humoral immune responses against CTAgs in patients with plasma cell dyscrasias: MM, monoclonal gammopathy of undetermined significance (MGUS), and Waldenström's macroglobulinemia (WM). Bone marrow lymphocytes from two of four untreated MM patients exhibited CT7-specific cellular immune responses as measured by an autologous cellular immunity assay, the first such immune response to CT7 to be reported in cancer patients. Sera from 24 patients were screened by ELISA for humoral immune responses to CTAgs. Two patients with MM demonstrated positive titers, one for MAGE-A1 and the other for SSX1. These data demonstrate that CTAgs, particularly CT7, are immunogenic in MM patients and merit further exploration as targets of immunological therapy in MM.
Emotional withdrawal, CT abnormalities and drug response in late life depression.
Altamura, A Carlo; Bassetti, Roberta; Santini, Annalisa; Frisoni, G B; Mundo, Emanuela
2004-03-01
In this study, the authors investigated if CNS degenerative abnormalities could correlate with depressive symptoms in elderly patients, if the presence of mild/moderate cognitive impairment could be related to the response to treatment and the role of peculiar clinical features in influencing the response to treatment. Fifty-three patients (60-75 years) diagnosed as affected by late onset (after 60 years) Major Depressive Episodes according to DSM-IV criteria were studied. Brain vascular and degenerative markers were assessed by computed tomography (CT) through measurements of a lateralized version of the bifrontal index and a rating scale addressing subcortical disease. The presence of mild/moderate cognitive impairment [(24-28 total score at the Mini-Mental State Examination (MMSE)], and of specific symptoms were assessed at baseline and evaluated with respect to the antidepressant response. Patients with CT abnormalities showed higher baseline scores on Hamilton Rating Scale for Depression (HAM-D) items "late insomnia" (t=-2.674, P=.002), "somatic symptoms" (t=-3.355 P=.002), and Brief Psychiatric Rating Scale (BPRS) item "emotional withdrawal" (t=-3.355, P=.002). No significant correlation was found between the vascular index and baseline clinical symptoms, while the HAM-D "depressed mood" item was negatively correlated to the right frontal index (R=-0.692, P=.006). Patients with CT abnormalities showed a lower reduction of HAM-D total scores than patients with normal CT (time effect: F=29.277, P<.0001; group effect: F=5.154, P<.03), while a significant reduction of symptoms in time (time effect: F=33.33, P<.0001) but no differences between groups were found on Hamilton Rating Scale for Anxiety (HAM-A). Both patients with and without mild cognitive impairment improved on the HAM-D (time effect: F=19.668, P<.0001), BPRS (time effect: F=18.345, P<.0001), and HAM-A (time effect: F=17.959, P<.0001) total scores. Patients with emotional withdrawal showed lower
The Abscopal Effect Associated With a Systemic Anti-melanoma Immune Response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stamell, Emily F.; Wolchok, Jedd D.; Ludwig Institute for Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, New York
2013-02-01
The clearance of nonirradiated tumors after localized radiation therapy is known as the abscopal effect. Activation of an antitumor immune response has been proposed as a mechanism for the abscopal effect. Here we report a patient with metastatic melanoma who received palliative radiation to his primary tumor with subsequent clearance of all his nonirradiated in-transit metastases. Anti-MAGEA3 antibodies were found upon serological testing, demonstrating an association between the abscopal effect and a systemic antitumor immune response. A brain recurrence was then treated with a combination of stereotactic radiosurgery and immunotherapy with ipilimumab. The patient experienced a complete remission that includedmore » resolution of nodal metastases, with a concomitant increase in MAGEA3 titers and a new response to the cancer antigen PASD1. This case supports the immune hypothesis for the abscopal effect, and illustrates the potential of combining radiotherapy and immunotherapy in the treatment of melanoma.« less
Dendritic Cells: A Double-Edged Sword in Immune Responses during Chagas Disease
Gil-Jaramillo, Natalia; Motta, Flávia N.; Favali, Cecília B. F.; Bastos, Izabela M. D.; Santana, Jaime M.
2016-01-01
Dendritic cells (DCs) are the most important member of the antigen presenting cells group due to their ability to recognize antigen at the infection site and their high specialized antigen internalization capacity. These cells have central role in connecting the innate and adaptive immune responses against Trypanosoma cruzi, the causative agent of Chagas disease. These first line defense cells modulate host immune response depending on type, maturation level, cytokine milieu and DC receptor involved in the interactions with T. cruzi, influencing the development of the disease clinic forms. Here, we present a review of DCs–T. cruzi interactions both in human and murine models, pointing out the parasite ability to manipulate DCs activity for the purpose of evading innate immune response and assuring its own survival and persistence. PMID:27471496
Solanki, Amit Kumar; Bhatia, Bharati; Kaushik, Himani; Deshmukh, Sachin K; Dixit, Aparna; Garg, Lalit C
2017-07-01
Clostridium perfringens beta toxin (CPB) is the primary pathogenic factor responsible for necrotic enteritis in sheep, cattle and humans. Owing to rapid progression of the disease, vaccination is the only possible recourse to avoid high mortality in animal farms and huge economic losses. The present study reports evaluation of a cpb gene-based DNA vaccine encoding the beta toxin of C. perfringens with homologous as well as heterologous booster strategy. Immunization strategy employing heterologous booster with heat-inactivated rCPB mounted stronger immune response when compared to that generated by homologous booster. Antibody isotyping and cytokine ELISA demonstrated the immune response to be Th1-biased mixed immune response. While moderate protection of immunized BALB/c and C57BL/6 mice against rCPB challenge was observed with homologous booster strategy, heterologous booster strategy led to complete protection. Thus, beta toxin-based DNA vaccine using the heterologous prime-boosting strategy was able to generate better immune response and conferred greater degree of protection against high of dose rCPB challenge than homologous booster regimen, making it an effective vaccination approach against C. perfringens beta toxin.
Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana
2012-12-11
To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.
Legey, A P; Pinho, A P; Chagas Xavier, S C; Leon, L L; Jansen, A M
1999-01-01
Philander opossum and Didelphis marsupialis considered the most ancient mammals and an evolutionary success, maintain parasitism by Trypanosoma cruzi without developing any apparent disease or important tissue lesion. In order to elucidate this well-balanced interaction, we decided to compare the humoral immune response kinetics of the two didelphids naturally and experimentally infected with T. cruzi and immunized by different schedules of parasite antigens, employing an indirect fluorescence antibody test (IFAT). Both didelphids responded with high serological titers to different immunization routes, while the earliest response occurred with the intradermic route. Serological titers of naturally infected P. opossum showed a significant individual variation, while those of D. marsupialis remained stable during the entire follow-up period. The serological titers of the experimentally infected animals varied according to the inoculated strain. Our data suggest that (1) IFAT was sensitive for follow-up of P. opossum in natural and experimental T. cruzi infections; (2) both P. opossum and D. marsupialis are able to mount an efficient humoral immune response as compared to placental mammals; (3) experimentally infected P. opossum and D. marsupialis present distinct patterns of infection, depending on the subpopulation of T. cruzi, (4) the differences observed in the humoral immune responses between P. opossum and D. marsupialis, probably, reflect distinct strategies selected by these animals during their coevolution with T. cruzi.
Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.
2013-01-01
Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242
Wu, Hong-Yin; Abdu, Samira; Stinson, Dana; Russell, Michael W.
2000-01-01
Genital antibody responses were compared in female mice immunized intravaginally (i.vag.) or intranasally (i.n.) with a bacterial protein antigen (AgI/II of Streptococcus mutans) coupled to the B subunit of cholera toxin. Serum and salivary antibodies were also evaluated as measures of disseminated mucosal and systemic responses. Although i.vag. immunization induced local vaginal immunoglobulin A (IgA) and IgG antibody responses, these were not disseminated to a remote secretion, the saliva, and only modest levels of serum antibodies were generated. In contrast, i.n. immunization was substantially more effective at inducing IgA and IgG antibody responses in the genital tract and in the circulation, as well as at inducing IgA antibodies in the saliva. Moreover, mucosal and systemic antibodies induced by i.n. immunization persisted for at least 12 months. Analysis of the molecular form of genital IgA indicated that the majority of both total IgA and specific IgA antibody was polymeric, and likely derived from the common mucosal immune system. PMID:10992451
Maternal immune status in pregnancy is related to offspring's immune responses and atopy risk.
Herberth, G; Hinz, D; Röder, S; Schlink, U; Sack, U; Diez, U; Borte, M; Lehmann, I
2011-08-01
The influence of maternal immune responses in pregnancy on children's immune competence and the development of atopic diseases later in life are poorly understood. To determine potential maternal effects on the maturation of children's immune system and resulting disease risks, we analysed immune responses in mother-child pairs in a prospective birth cohort study. Within the Lifestyle and Environmental factors and their Influence on Newborns Allergy risk (LINA) study, concentrations of Th1/Th2/Th17 and inflammatory cytokines/chemokines as well as IgE were measured in phytohemagglutinin and lipopolysaccharide stimulated maternal blood in the 34th week of gestation and in corresponding children's blood at birth and 1 year after (n = 353 mother-child pairs). Information on atopic outcomes during the first year of life was obtained from questionnaires. Concentrations of inflammatory markers, excepting TNF-α, were manifold higher in cord blood samples compared with maternal blood. Th1/Th2 cytokines were lower in children's blood with a Th2 bias at birth. Maternal inflammatory parameters (MCP-1, IL-10, TNF-α) in pregnancy showed an association with corresponding cytokines blood levels in children at the age of one. High maternal IgE concentrations in pregnancy were associated with increased children's IgE at birth and at the age of one, whereas children's atopic dermatitis (AD) was determined by maternal AD. Maternal inflammatory cytokines during pregnancy correlate with children's corresponding cytokines at the age of one but are not related to IgE or AD. While maternal IgE predicts children's IgE, AD in children is only associated with maternal disease. © 2011 John Wiley & Sons A/S.
Immune Response and Function: Exercise Conditioning Versus Bed-Rest and Spaceflight Deconditioning
NASA Technical Reports Server (NTRS)
Greenleaf, J. E.; Jackson, C. G. R.; Lawless, D.
1994-01-01
Immune responses measured at rest immediately or some hours after exercise training (some with and some without increase in maximal oxygen uptake) gave variable and sometimes conflicting results; therefore, no general conclusions can be drawn. On the other hand, most immune responses were either unchanged (immunoglobulin, T cells, CD4+, and natural killer activity) or decreased (blood properdin, neutrophil phagocytic activity, salivary lysozymes, brain immunoglobulin A and G, and liver B lymphocytes and phytohemagglutinin activity) during prolonged bed rest. Some data suggested that exercise training during bed rest may partially ameliorate the decreased functioning of the immune system. Exercise and change in body position, especially during prolonged bed rest with plasma fluid shifts and diuresis, may induce a change in plasma protein concentration and content, which can influence drug metabolism as well as immune function. Leukocytosis, accompanied by lymphopenia and a depressed lymphocyte response, occurs in astronauts on return to Earth from spaceflight; recovery may depend on time of exposure to microgravity. It is clear that the effect of drugs and exercise used as countermeasures for microgravity deconditioning should be evaluated for their effect on an astronaut's immune system to assure optimal health and performance on long-duration space missions.
Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A.; Thörn, Karolina; Cairns, Tina M.; Wegmann, Frank; Sattentau, Quentin J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Harandi, Ali M.
2016-01-01
Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes. PMID:28082979
Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A; Thörn, Karolina; Cairns, Tina M; Wegmann, Frank; Sattentau, Quentin J; Eisenberg, Roselyn J; Cohen, Gary H; Harandi, Ali M
2016-01-01
Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes.
Mathematical modeling provides kinetic details of the human immune response to vaccination
Le, Dustin; Miller, Joseph D.; Ganusov, Vitaly V.
2015-01-01
With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data. PMID:25621280
Mathematical modeling provides kinetic details of the human immune response to vaccination.
Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V
2014-01-01
With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.
Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K
2015-01-01
The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657
Mehrzad, Jalil; Shajari, Majid; Saleh-Moghaddam, Massoud; Sarmad-Nabavi, Mohammad
2015-09-01
We examined the impact of acute restraint stress (ARS) with(out) intraperitoneal E. coli infection on TLR4 mRNA abundance in brain and spleen, clinical signs, cytokines and oxidative loads and peritoneal E. coli growth in balb/c mice. ARS exacerbated E. coli virulence and behavioral abnormality. At different post-stress hour the pattern and intensity of TLR4 activity differed in brain and spleen. While TLR4 stimulation in spleen of E. coli-infected mice was maximal, it superseded in brain of post-stressed E. coli-infected mice. ARS and E. coli infection elicited systemic pro-inflammatory and pro-oxidant status, with defective peritoneal E. coli clearance in post-ARS mice. Continuous TLR4 activation in post-stressed mice partially disarms innate immune response, and contributes to inappropriate host-E. coli interactions and thus neuroimmune dysregulation/toxicity. The description of these observed novel effects induced by ARS will provide a basis for deeper investigations of the effects from increasingly stress-oriented rural/urban life upon neuroimmune system. Copyright © 2015 Elsevier B.V. All rights reserved.
Anti-gluten immune response following Toxoplasma gondii infection in mice.
Severance, Emily G; Kannan, Geetha; Gressitt, Kristin L; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V; Yolken, Robert H
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002-0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders.
Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates
NASA Astrophysics Data System (ADS)
Massich, Matthew David
Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly
Genetic polymorphism and immune response to tuberculosis in indigenous populations: a brief review.
Longhi, Renata Maronna Praça; Zembrzuski, Verônica Marques; Basta, Paulo Cesar; Croda, Julio
2013-01-01
We systematically reviewed studies of the immune response to tuberculosis and the genetic polymorphisms associated with Th1- or Th2-mediated cytokine expression in indigenous populations. A bibliographic search was performed on the Medline and ISI databases and included studies published between January 1980 and October 2011. The search terms were tuberculosis, American Indians, Amerindian, indigenous, Indians, native people, aboriginal, immun*, host immune, immune response, cytokine*, polymorphism*, and gene. Regardless of their design, studies that evaluated immunoglobulin, cytokine levels and genetic polymorphisms that altered cytokine expression were included. Thirteen studies met the inclusion criteria. The majority of studies were performed in Latin America, and five investigated the Warao ethnic group of Venezuela. Most of the investigations indirectly evaluated the immune response. Higher anergy to the tuberculin skin test, higher IgG4 and IgM levels, higher IL-5 production and lower TNF-α, IL-12p40 and IFN-γ production were found in the indigenous populations. The studies also reported a predominantly Th2-type response in these populations and a possibly higher susceptibility to tuberculosis. A better understanding of the relevant genetic polymorphisms and their role in immune regulation would help to clarify the immunogenetic mechanisms of TB infection in these populations. This information would be useful for identifying new treatments and preventing infection and progression to active disease. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.
Ocular surgical models for immune and angiogenic responses
Inomata, Takenori; Mashaghi, Alireza; Di Zazzo, Antonio; Dana, Reza
2015-01-01
Corneal transplantation serves as a reproducible and simple surgical model to study mechanisms regulating immunity and angiogenesis. The simplicity of the model allows for systematic analysis of different mechanisms involved in immune and angiogenic privilege and their failures. This protocol describes how to induce neovessels and inflammation in an actively regulated avascular and immune-privileged site. This involves placing intra-stromal corneal sutures for two weeks, disrupting the privileges, and performing corneal transplantation subsequently. Privileged and non-privileged recipient responses to donor cornea can be compared to identify key immunological mechanisms that underlie angiogenesis and graft rejection. This protocol can also be adapted to the growing repertoire of genetic models available in the mouse, and is a valuable tool to elucidate molecular mechanisms mediating acceptance or failure of corneal graft. The model could be used to assess the potential of therapeutic molecules to enhance graft survival in vivo. PMID:26550579
Leukocyte susceptibility and immune response against Vibrio parahaemolyticus in Totoaba macdonaldi.
Reyes-Becerril, Martha; Alamillo, Erika; Sánchez-Torres, Luvia; Ascencio-Valle, Felipe; Perez-Urbiola, Juan C; Angulo, Carlos
2016-12-01
Vibrio parahaemolyticus is a serious pathogen that affects aquaculture. Nonetheless, to the best of our knowledge, no studies have focused on its immunological implications in Totoaba macdonaldi. Thus, the early immune response to V. parahaemolyticus in juveniles of totoaba was studied at 24 h post-infection with an in vivo study. In addition, changes in cellular innate immune parameters - phagocytosis, respiratory burst activity and viability (annexin V/propidium iodide) - were evaluated in vitro in head-kidney, spleen and thymus leukocytes at 6 and 24 h after bacterial stimulation by flow cytometry. Simultaneously, the expression levels of two immune-relevant genes (IL-1β and IL-8) were measured by using real time PCR. During in vivo study, mRNA transcripts of IL-1β were highly expressed in spleen, thymus and intestine and down-regulated in liver after 24 h post-infection. IL-8 gene expression was upregulated in spleen, intestine and liver compared to that of non-infected fish and down-regulated in thymus after 24 h post-infection. Generally, the results showed a significant decrease in cellular immune responses during the infection, principally in phagocytic ability and respiratory burst. The survival or viability of stimulated leukocytes was significantly reduced causing necrosis and apoptosis, indicating a robust killing response by V. parahaemolyticus. Finally the in vitro analysis showed that transcript levels of IL-1β and IL-8 were up-regulated during stimulation with V. parahaemolyticus in head-kidney, spleen and intestine and down-regulated in thymus at any time of the experiment. Although V. parahaemolyticus has been reported to be an important pathogen for many aquatic organisms, to our knowledge this might be the first report of early-immune response in juvenile totoaba and these immune parameters may be reliable indicators and can be useful in the health control of this species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Helminth Infections: Recognition and Modulation of the Immune Response by Innate Immune Cells
Motran, Claudia Cristina; Silvane, Leonardo; Chiapello, Laura Silvina; Theumer, Martin Gustavo; Ambrosio, Laura Fernanda; Volpini, Ximena; Celias, Daiana Pamela; Cervi, Laura
2018-01-01
The survival of helminths in the host over long periods of time is the result of a process of adaptation or dynamic co-evolution between the host and the parasite. However, infection with helminth parasites causes damage to the host tissues producing the release of danger signals that induce the recruitment of various cells, including innate immune cells such as macrophages (Mo), dendritic cells (DCs), eosinophils, basophils, and mast cells. In this scenario, these cells are able to secrete soluble factors, which orchestrate immune effector mechanisms that depend on the different niches these parasites inhabit. Here, we focus on recent advances in the knowledge of excretory-secretory products (ESP), resulting from helminth recognition by DCs and Mo. Phagocytes and other cells types such as innate lymphocyte T cells 2 (ILC2), when activated by ESP, participate in an intricate cytokine network to generate innate and adaptive Th2 responses. In this review, we also discuss the mechanisms of innate immune cell-induced parasite killing and the tissue repair necessary to assure helminth survival over long periods of time. PMID:29670630
Cortical stimulation evokes abnormal responses in the dopamine-depleted rat basal ganglia.
Kita, Hitoshi; Kita, Takako
2011-07-13
The motor cortex (MC) sends massive projections to the basal ganglia. Motor disabilities in patients and animal models of Parkinson's disease (PD) may be caused by dopamine (DA)-depleted basal ganglia that abnormally process the information originating from MC. To study how DA depletion alters signal transfer in the basal ganglia, MC stimulation-induced (MC-induced) unitary responses were recorded from the basal ganglia of control and 6-hydroxydopamine-treated hemi-parkinsonian rats anesthetized with isoflurane. This report describes new findings about how DA depletion alters MC-induced responses. MC stimulation evokes an excitation in normally quiescent striatal (Str) neurons projecting to the globus pallidus external segment (GPe). After DA-depletion, the spontaneous firing of Str-GPe neurons increases, and MC stimulation evokes a shorter latency excitation followed by a long-lasting inhibition that was invisible under normal conditions. The increased firing activity and the newly exposed long inhibition generate tonic inhibition and a disfacilitation in GPe. The disfacilitation in GPe is then amplified in basal ganglia circuitry and generates a powerful long inhibition in the basal ganglia output nucleus, the globus pallidus internal segment. Intra-Str injections of a behaviorally effective dose of DA precursor l-3,4-dihydroxyphenylalanine effectively reversed these changes. These newly observed mechanisms also support the generation of pauses and burst activity commonly observed in the basal ganglia of parkinsonian subjects. These results suggest that the generation of abnormal response sequences in the basal ganglia contributes to the development of motor disabilities in PD and that intra-Str DA supplements effectively suppress abnormal signal transfer.
Immune Response to Electromagnetic Fields through Cybernetic Modeling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Godina-Nava, J. J.; Segura, M. A. Rodriguez; Cadena, S. Reyes
We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.
Immune Response to Electromagnetic Fields through Cybernetic Modeling
NASA Astrophysics Data System (ADS)
Godina-Nava, J. J.; Segura, M. A. Rodríguez; Cadena, S. Reyes; Sierra, L. C. Gaitán
2008-08-01
We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.
Deng, Shu-xuan; Cai, Ming-sheng; Cui, Wei; Huang, Jin-lu; Li, Mei-li
2014-01-01
Goose parvovirus (GPV) is a highly contagious and deadly disease for goslings and Muscovy ducklings. To compare the differences in immune response of geese immunized with GPV-VP1 DNA-based and live attenuated vaccines. Shitou geese were immunized once with either 20 μg pcDNA-GPV-VP1 DNA gene vaccine by gene gun bombardment via intramuscular injection, or 300 μg by i.m. injection, or 300 μL live attenuated vaccine by i.m. injection, whereas 300 μg pcDNA3.1 (+) i.m. or 300 μL saline i.m. were used as positive and negative controls, respectively. Each group comprised 28 animals. Peripheral blood samples were collected from 2-210 days after immunization and the proliferation of T lymphocytes, the number of CD4(+) and CD8(+) T cells and the level of IgG assessed. Statistical analysis was performed using a one-way analysis of variance with group multiple comparisons via Tukey's test. The pcDNA-GPV-VP1 DNA and attenuated vaccine induced cellular and humoral responses, and there were no differences between the 20 and 300 μg group in the responses of proliferation of T lymphocyte and the CD8(+) T-cell. However, as to CD4(+) T-cell response and humoral immunity, the 20 μg group performed better than the 300 μg group, which induced better cellular and humoral immunity than live attenuated vaccine. This study showed that it is possible to induce both cellular and humoral response using DNA-based vaccines and that the pcDNA-GPV-VP1 DNA gene vaccine induced better cellular and humoral immunity than live attenuated vaccine.
Dolan, Brian P.; Fisher, Kathleen M.; Colvin, Michael E.; Benda, Susan E.; Peterson, James T.; Kent, Michael L.; Schreck, Carl B.
2016-01-01
Adult Chinook salmon (Oncorhynchus tshawytscha) migrate from salt water to freshwater streams to spawn. Immune responses in migrating adult salmon are thought to diminish in the run up to spawning, though the exact mechanisms for diminished immune responses remain unknown. Here we examine both adaptive and innate immune responses as well as pathogen burdens in migrating adult Chinook salmon in the Upper Willamette River basin. Messenger RNA transcripts encoding antibody heavy chain molecules slightly diminish as a function of time, but are still present even after fish have successfully spawned. In contrast, the innate anti-bacterial effector proteins present in fish plasma rapidly decrease as spawning approaches. Fish also were examined for the presence and severity of eight different pathogens in different organs. While pathogen burden tended to increase during the migration, no specific pathogen signature was associated with diminished immune responses. Transcript levels of the immunosuppressive cytokines IL-10 and TGF beta were measured and did not change during the migration. These results suggest that loss of immune functions in adult migrating salmon are not due to pathogen infection or cytokine-mediated immune suppression, but is rather part of the life history of Chinook salmon likely induced by diminished energy reserves or hormonal changes which accompany spawning.
Tailored immune responses: novel effector helper T cell subsets in protective immunity.
Kara, Ervin E; Comerford, Iain; Fenix, Kevin A; Bastow, Cameron R; Gregor, Carly E; McKenzie, Duncan R; McColl, Shaun R
2014-02-01
Differentiation of naïve CD4⁺ cells into functionally distinct effector helper T cell subsets, characterised by distinct "cytokine signatures," is a cardinal strategy employed by the mammalian immune system to efficiently deal with the rapidly evolving array of pathogenic microorganisms encountered by the host. Since the T(H)1/T(H)2 paradigm was first described by Mosmann and Coffman, research in the field of helper T cell biology has grown exponentially with seven functionally unique subsets having now been described. In this review, recent insights into the molecular mechanisms that govern differentiation and function of effector helper T cell subsets will be discussed in the context of microbial infections, with a focus on how these different helper T cell subsets orchestrate immune responses tailored to combat the nature of the pathogenic threat encountered.
The Immune System’s Role in Sepsis Progression, Resolution and Long-Term Outcome
Delano, Matthew J.; Ward, Peter A.
2016-01-01
SUMMARY Sepsis occurs when an infection exceeds local tissue containment and induces a series of dysregulated physiologic responses that result in organ dysfunction. A subset of patients with sepsis progress to septic shock, defined by profound circulatory, cellular, and metabolic abnormalities, and associated with a greater mortality. Historically, sepsis-induced organ dysfunction and lethality were attributed to the complex interplay between the initial inflammatory and later anti-inflammatory responses. With advances in intensive care medicine and goal-directed interventions, early 30-day sepsis mortality has diminished, only to steadily escalate long after “recovery” from acute events. Since so many sepsis survivors succumb later to persistent, recurrent, nosocomial and secondary infections, many investigators have turned their attention to the long-term sepsis-induced alterations in cellular immune function. Sepsis clearly alters the innate and adaptive immune responses for sustained periods of time after clinical recovery, with immune suppression, chronic inflammation, and persistence of bacterial representing such alterations. Understanding that sepsis-associated immune cell defects correlate with long-term mortality, more investigations have centered on the potential for immune modulatory therapy to improve long term patient outcomes. These efforts are focused on more clearly defining and effectively reversing the persistent immune cell dysfunction associated with long-term sepsis mortality. PMID:27782333
Potential for Cell-Mediated Immune Responses in Mouse Models of Pelizaeus-Merzbacher Disease
Southwood, Cherie M.; Fykkolodziej, Bozena; Dachet, Fabien; Gow, Alexander
2013-01-01
Although activation of the innate and adaptive arms of the immune system are undoubtedly involved in the pathophysiology of neurodegenerative diseases, it is unclear whether immune system activation is a primary or secondary event. Increasingly, published studies link primary metabolic stress to secondary inflammatory responses inside and outside of the nervous system. In this study, we show that the metabolic stress pathway known as the unfolded protein response (UPR) leads to secondary activation of the immune system. First, we observe innate immune system activation in autopsy specimens from Pelizaeus-Merzbacher disease (PMD) patients and mouse models stemming from PLP1 gene mutations. Second, missense mutations in mildly- and severely-affected Plp1-mutant mice exhibit immune-associated expression profiles with greater disease severity causing an increasingly proinflammatory environment. Third, and unexpectedly, we find little evidence for dysregulated expression of major antioxidant pathways, suggesting that the unfolded protein and oxidative stress responses are separable. Together, these data show that UPR activation can precede innate and/or adaptive immune system activation and that neuroinflammation can be titrated by metabolic stress in oligodendrocytes. Whether or not such activation leads to autoimmune disease in humans is unclear, but the case report of steroid-mitigated symptoms in a PMD patient initially diagnosed with multiple sclerosis lends support. PMID:24575297
Perkins, R B; Hall, J E; Martin, K A
1999-06-01
To characterize the neuroendocrine patterns of abnormal GnRH secretion in hypothalamic amenorrhea (HA), 49 women with primary and secondary HA underwent frequent sampling of LH in a total of 72 baseline studies over 12-24 h. A subset of women participated in more than one study to address 1) the variability of LH pulse patterns over time; and 2) the impact of modulating opioid, dopaminergic, and adrenergic tone on LH secretory patterns. The frequency and amplitude of LH secretion was compared with that seen in the early follicular phase (EFP) of normally cycling women. The spectrum of abnormalities of LH pulses was 8% apulsatile, 27% low frequency/low amplitude, 8% low amplitude/normal frequency, 43% low frequency/normal amplitude, 14% normal frequency/normal amplitude. Of patients studied overnight, 45% demonstrated a pubertal pattern of augmented LH secretion during sleep. Of patients studied repeatedly, 75% demonstrated at least 2 different patterns of LH secretion, and 33% reverted at least once to a normal pattern of secretion. An increase in LH pulse frequency was seen in 12 of 15 subjects in response to naloxone (opioid receptor antagonist). Clonidine (alpha-2 adrenergic agonist) was associated with a decrease in mean LH in 3 of 3 subjects. An increase in LH pulse frequency was seen in 4 of 8 subjects in response to metoclopramide (dopamine receptor antagonist), but the response was not statistically significant. Baseline abnormalities in LH secretion did not appear to influence response to neurotransmitter modulation. 1) HA represents a spectrum of disordered GnRH secretion that can vary over time; 2) LH pulse patterns at baseline do not appear to influence the ability to respond to neurotransmitter modulation; 3) Opioid and adrenergic tone appear to influence the hypothalamic GnRH pulse generator in some individuals with HA.
Clozapine-induced EEG abnormalities and clinical response to clozapine.
Risby, E D; Epstein, C M; Jewart, R D; Nguyen, B V; Morgan, W N; Risch, S C; Thrivikraman, K V; Lewine, R L
1995-01-01
The authors hypothesized that patients who develop gross EEG abnormalities during clozapine treatment would have a less favorable outcome than patients who did not develop abnormal EEGs. The clinical EEGs and the Brief Psychiatric Rating Scale (BPRS) scores of 12 patients with schizophrenia and 4 patients with schizoaffective disorder were compared before and during treatment with clozapine. Eight patients developed significant EEG abnormalities on clozapine; 1 showed worsening of an abnormal pre-clozapine EEG; none of these subjects had clinical seizures. BPRS scores improved significantly in the group of patients who developed abnormal EEGs but not in the group who did not. Findings are consistent with previous reports of a high incidence of clozapine-induced EEG abnormalities and a positive association between these abnormalities and clinical improvement.
Sejian, Veerasamy; Srivastava, Rajendra Swaroop
2010-12-01
The purpose of the investigation was to observe the pineal-adrenal-immune system relationships and their influence on non-specific immune response in female goats under short-term thermal stress. Six female goats had been exposed to 40°C and 60% relative humidity in the psychrometric chamber for 17 days. Blood samples were obtained on days 0 and 10 to establish control and thermal stress effects, respectively. Chemical adrenalectomy was achieved by injecting metyrapone (100 mg/kg body weight) followed by exogenous melatonin treatment (0.1 mg/kg body weight) from 11th to 17th day of experiment. Thermal stress significantly (P≤0.05) altered the physiological responses. Metyrapone and melatonin treatment significantly (P≤0.05) reduced the thermal-stress-induced increase in plasma concentrations of cortisol and corticosterone while significantly (P≤0.05) increased the plasma melatonin on days 11 and 17. Furthermore, these treatments significantly (P<0.05) increased the phagocytic activity of neutrophils as compared to both control and thermal exposure values from 11-17 days of experiment. The data generated from this study help us to understand the functional relationship between pineal, adrenal, and immune system, and how this relationship modifies the non-specific immune response for the well being of goats during thermal stress.
The metabolic cost of mounting an immune response in male brown anoles (Anolis sagrei).
Cox, Christian L; Peaden, Robert T; Cox, Robert M
2015-09-09
The tradeoff between reproduction and survival is central to life-history theory and is thought to reflect underlying energetic tradeoffs between reproduction and self-maintenance. Immune responses to parasites and pathogens are important components of self-maintenance in many species, but whether these defenses impose significant energetic costs has only been tested in a handful of organisms. We tested for a metabolic cost of mounting an immune response in the male brown anole (Anolis sagrei), a lizard in which we have previously shown that reproduction causes a marked reduction in immune response to the novel antigen phytohaemagglutinin (PHA). We treated captive male anoles with a subcutaneous injection of either PHA, which induces an immune response that manifests as localized swelling, or saline vehicle as a control. Prior to injection and at 24, 48, and 72 hr post-injection, we measured swelling at the site of injection and whole-animal resting metabolic rate (RMR) using stop-flow respirometry. Although we detected a robust swelling response to PHA at 24, 48, and 72 hr post-injection, mean RMR did not differ between treatments at any of these time points. However, within the PHA treatment group, RMR increased with the extent of swelling, suggesting a variable metabolic cost that scales with the magnitude of the induced immune response. Although individual anoles varied considerably in the extent to which they responded to PHA challenge, our results suggest that an immune response can impose a substantial metabolic cost (potentially as much as 63% above baseline RMR) for individuals that do respond maximally. J. Exp. Zool. 9999A:XX-XX, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma
NASA Astrophysics Data System (ADS)
Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen
2014-09-01
Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.
Abnormal stress responsivity in a rodent developmental disruption model of schizophrenia.
Zimmerman, Eric C; Bellaire, Mark; Ewing, Samuel G; Grace, Anthony A
2013-10-01
Although numerous studies have implicated stress in the pathophysiology of schizophrenia, less is known about how the effects of stress interact with genetic, developmental, and/or environmental determinants to promote disease progression. In particular, it has been proposed that in humans, stress exposure in adolescence could combine with a predisposition towards increased stress sensitivity, leading to prodromal symptoms and eventually psychosis. However, the neurobiological substrates for this interaction are not fully characterized. Previous work in our lab has demonstrated that rats born to dams administered with the DNA-methylating agent methylazoxymethanol acetate (MAM) at gestational day 17 exhibit as adults behavioral and anatomical abnormalities consistent with those observed in patients with schizophrenia. Here, we examined behavioral and neuroendocrine responses to stress in the MAM model of schizophrenia. MAM-treated male rats were exposed to acute and repeated footshock stress at prepubertal, peripubteral, and adult ages. Ultrasonic vocalizations (USVs), freezing, and corticosterone responses were quantified. We found that juvenile MAM-treated rats emitted significantly more calls, spent more time vocalizing, emitted calls at a higher rate, and showed more freezing in response to acute footshock stress when compared with their saline (SAL) treated counterparts, and that this difference is not present in older animals. In addition, adolescent MAM-treated animals displayed a blunted HPA axis corticosterone response to acute footshock that did not adapt after 10 days of stress exposure. These data demonstrate abnormal stress responsivity in the MAM model of schizophrenia and suggest that these animals are more sensitive to the effects of stress in youth.
Abnormal cardiovascular response to exercise in hypertension: contribution of neural factors.
Mitchell, Jere H
2017-06-01
During both dynamic (e.g., endurance) and static (e.g., strength) exercise there are exaggerated cardiovascular responses in hypertension. This includes greater increases in blood pressure, heart rate, and efferent sympathetic nerve activity than in normal controls. Two of the known neural factors that contribute to this abnormal cardiovascular response are the exercise pressor reflex (EPR) and functional sympatholysis. The EPR originates in contracting skeletal muscle and reflexly increases sympathetic efferent nerve activity to the heart and blood vessels as well as decreases parasympathetic efferent nerve activity to the heart. These changes in autonomic nerve activity cause an increase in blood pressure, heart rate, left ventricular contractility, and vasoconstriction in the arterial tree. However, arterial vessels in the contracting skeletal muscle have a markedly diminished vasoconstrictor response. The markedly diminished vasoconstriction in contracting skeletal muscle has been termed functional sympatholysis. It has been shown in hypertension that there is an enhanced EPR, including both its mechanoreflex and metaboreflex components, and an impaired functional sympatholysis. These conditions set up a positive feedback or vicious cycle situation that causes a progressively greater decrease in the blood flow to the exercising muscle. Thus these two neural mechanisms contribute significantly to the abnormal cardiovascular response to exercise in hypertension. In addition, exercise training in hypertension decreases the enhanced EPR, including both mechanoreflex and metaboreflex function, and improves the impaired functional sympatholysis. These two changes, caused by exercise training, improve the muscle blood flow to exercising muscle and cause a more normal cardiovascular response to exercise in hypertension. Copyright © 2017 the American Physiological Society.
Immune responses to invasive aspergillosis: new understanding and therapeutic opportunities
Hohl, Tobias M.
2017-01-01
Purpose of review Invasive aspergillosis is a worldwide disease that primarily affects immune-compromised patients, agricultural workers with corneal abrasions, individuals with structural lung disease, and patients with primary immune deficiency. The critical function of the immune system is to prevent the germination of airborne conidia into tissue-invasive hyphae. This review covers recent advances that shape our understanding of anti-Aspergillus immunity at the molecular and cellular level. Recent findings Host defense against conidia and hyphae occurs via distinct molecular mechanisms that involve intracellular and extracellular killing pathways, as well as cooperation between different myeloid cell subsets. The strength and efficacy of the host response is shaped by the tissue microenvironment. In preclinical models of disease, host immune augmentation strategies have yielded benefits, yet translating these insights into therapeutic strategies in humans remains challenging. Summary Although advances in early diagnostic strategies and in antifungal drugs have ameliorated clinical outcomes of invasive aspergillosis, further improvements depend on gaining deeper insight into and translating advances in anti-Aspergillus immunity. PMID:28509673
Eichmann, Klaus; Braun, Dietmar G.; Krause, Richard M.
1971-01-01
Selective breeding of rabbits immunized with Group C and Group A streptococcal vaccines was employed to reveal genetic influences on the magnitude and on the restriction in heterogeneity of the immune response to the group-specific carbohydrates. After two generations of selective breeding, complete segregation was achieved between a high-response population (>18 mg precipitins/ml serum, average 33 mg/ml) and a low-response population (<13 mg precipitins/ml serum, average 7.5 mg/ml) to Group C carbohydrate. This suggests that a limited number of genes controls the magnitude of the immune response to this antigen. Selective breeding of rabbits which were representative of heterogeneous, restricted, and monoclonal responses revealed that the degree of antibody heterogeneity in the parental rabbits is reflected in the offspring. More than 95% of the offspring derived from rabbits which had a heterogeneous immune response developed heterogeneous antibodies. 33% of the offspring derived from rabbits which had restricted and monoclonal immune responses developed monoclonal antibodies. This suggests that the degree of heterogeneity of the antibody response to the streptococcal carbohydrates is under genetic control. The degree of heterogeneity and the magnitude of the immune response appear to be independent variables. PMID:5558071
Emerging role of lipid droplets in Aedes aegypti immune response against bacteria and Dengue virus
Barletta, Ana Beatriz Ferreira; Alves, Liliane Rosa; Nascimento Silva, Maria Clara L.; Sim, Shuzhen; Dimopoulos, George; Liechocki, Sally; Maya-Monteiro, Clarissa M.; Sorgine, Marcos H. Ferreira
2016-01-01
In mammals, lipid droplets (LDs) are ubiquitous organelles that modulate immune and inflammatory responses through the production of lipid mediators. In insects, it is unknown whether LDs play any role during the development of immune responses. We show that Aedes aegypti Aag2 cells – an immune responsive cell lineage – accumulates LDs when challenged with Enterobacter cloacae, Sindbis, and Dengue viruses. Microarray analysis of Aag2 challenged with E.cloacae or infected with Dengue virus revealed high transcripts levels of genes associated with lipid storage and LDs biogenesis, correlating with the increased LDs numbers in those conditions. Similarly, in mosquitoes, LDs accumulate in midgut cells in response to Serratia marcescens and Sindbis virus or when the native microbiota proliferates, following a blood meal. Also, constitutive activation of Toll and IMD pathways by knocking-down their respective negative modulators (Cactus and Caspar) increases LDs numbers in the midgut. Our results show for the first time an infection-induced LDs accumulation in response to both bacterial and viral infections in Ae. Aegypti, and we propose a role for LDs in mosquito immunity. These findings open new venues for further studies in insect immune responses associated with lipid metabolism. PMID:26887863
Type 2 responses at the interface between immunity and fat metabolism.
Odegaard, Justin I; Chawla, Ajay
2015-10-01
Adipose tissue resident leukocytes are often cast solely as the effectors of obesity and its attendant pathologies; however, recent observations have demonstrated that these cells support and effect 'healthy' physiologic function as well as pathologic dysfunction. Importantly, these two disparate outcomes are underpinned by similarly disparate immune programs; type 2 responses instruct and promote metabolic normalcy, while type 1 responses drive tissue dysfunction. In this Review, we summarize the literature regarding type 2 immunity's role in adipose tissue physiology and allude to its potential therapeutic implications. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cross, Martin L; Lambeth, Matthew R; Aldwell, Frank E
2010-02-01
Oral delivery of live Mycobacterium bovis BCG in a lipid matrix invokes cell-mediated immune (CMI) responses in mice and consequent protection against pulmonary challenge with virulent mycobacteria. To investigate the influence of prior BCG sensitization on oral vaccine efficacy, we assessed CMI responses and BCG colonization of the alimentary tract lymphatics 5 months after oral vaccination, in both previously naive mice and in mice that had been sensitized to BCG by injection 6 months previously. CMI responses did not differ significantly between mice that received subcutaneous BCG followed by oral BCG and those that received either injected or oral BCG alone. In vivo BCG colonization was predominant in the mesenteric lymph nodes after oral vaccination; this colonizing ability was not influenced by prior BCG sensitization. From this murine model study, we conclude that although prior parenteral-route BCG sensitization does not detrimentally affect BCG colonization after oral vaccination, there is no significant immune-boosting effect of the oral vaccine either.
Rodríguez, Airam; Broggi, Juli; Alcaide, Miguel; Negro, Juan José; Figuerola, Jordi
2014-08-01
Individual immune responses are likely affected by genetic, physiological, and environmental determinants. We studied the determinants and short-term consequences of Phytohaemagglutinin (PHA) induced immune response, a commonly used immune challenge eliciting both innate and acquired immunity, on lesser kestrel (Falco naumanni) nestlings in semi-captivity conditions and with a homogeneous diet composition. We conducted a repeated measures analyses of a set of blood parameters (carotenoids, triglycerides, β-hydroxybutyrate, cholesterol, uric acid, urea, total proteins, and total antioxidant capacity), metabolic (resting metabolic rate), genotypic (MHC class II B heterozygosity), and biometric (body mass) variables. PHA challenge did not affect the studied physiological parameters on a short-term basis (<12 hr), except plasma concentrations of triglycerides and carotenoids, which decreased and increased, respectively. Uric acid was the only physiological parameter correlated with the PHA induced immune response (skin swelling), but the change of body mass, cholesterol, total antioxidant capacity, and triglycerides between sessions (i.e., post-pre treatment) were also positively correlated to PHA response. No relationships were detected between MHC gene heterozygosity or resting metabolic rate and PHA response. Our results indicate that PHA response in lesser kestrel nestlings growing in optimal conditions does not imply a severe energetic cost 12 hr after challenge, but is condition-dependent as a rapid mobilization of carotenoids and decrease of triglycerides is elicited on a short-term basis. © 2014 Wiley Periodicals, Inc.
Chitin and Its Effects on Inflammatory and Immune Responses.
Elieh Ali Komi, Daniel; Sharma, Lokesh; Dela Cruz, Charles S
2018-04-01
Chitin, a potential allergy-promoting pathogen-associated molecular pattern (PAMP), is a linear polymer composed of N-acetylglucosamine residues which are linked by β-(1,4)-glycosidic bonds. Mammalians are potential hosts for chitin-containing protozoa, fungi, arthropods, and nematodes; however, mammalians themselves do not synthetize chitin and thus it is considered as a potential target for recognition by mammalian immune system. Chitin is sensed primarily in the lungs or gut where it activates a variety of innate (eosinophils, macrophages) and adaptive immune cells (IL-4/IL-13 expressing T helper type-2 lymphocytes). Chitin induces cytokine production, leukocyte recruitment, and alternative macrophage activation. Intranasal or intraperitoneal administration of chitin (varying in size, degree of acetylation and purity) to mice has been applied as a routine approach to investigate chitin's priming effects on innate and adaptive immunity. Structural chitin present in microorganisms is actively degraded by host true chitinases, including acidic mammalian chitinases and chitotriosidase into smaller fragments that can be sensed by mammalian receptors such as FIBCD1, NKR-P1, and RegIIIc. Immune recognition of chitin also involves pattern recognition receptors, mainly via TLR-2 and Dectin-1, to activate immune cells to induce cytokine production and creation of an immune network that results in inflammatory and allergic responses. In this review, we will focus on various immunological aspects of the interaction between chitin and host immune system such as sensing, interactions with immune cells, chitinases as chitin degrading enzymes, and immunologic applications of chitin.
Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen
2018-06-21
Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.
Berretta, Sabina; Pantazopoulos, Harry; Markota, Matej; Brown, Christopher; Batzianouli, Eleni T
2015-09-01
Perineuronal nets (PNNs) were shown to be markedly altered in subjects with schizophrenia. In particular, decreases of PNNs have been detected in the amygdala, entorhinal cortex and prefrontal cortex. The formation of these specialized extracellular matrix (ECM) aggregates during postnatal development, their functions, and association with distinct populations of GABAergic interneurons, bear great relevance to the pathophysiology of schizophrenia. PNNs gradually mature in an experience-dependent manner during late stages of postnatal development, overlapping with the prodromal period/age of onset of schizophrenia. Throughout adulthood, PNNs regulate neuronal properties, including synaptic remodeling, cell membrane compartmentalization and subsequent regulation of glutamate receptors and calcium channels, and susceptibility to oxidative stress. With the present paper, we discuss evidence for PNN abnormalities in schizophrenia, the potential functional impact of such abnormalities on inhibitory circuits and, in turn, cognitive and emotion processing. We integrate these considerations with results from recent genetic studies showing genetic susceptibility for schizophrenia associated with genes encoding for PNN components, matrix-regulating molecules and immune system factors. Notably, the composition of PNNs is regulated dynamically in response to factors such as fear, reward, stress, and immune response. This regulation occurs through families of matrix metalloproteinases that cleave ECM components, altering their functions and affecting plasticity. Several metalloproteinases have been proposed as vulnerability factors for schizophrenia. We speculate that the physiological process of PNN remodeling may be disrupted in schizophrenia as a result of interactions between matrix remodeling processes and immune system dysregulation. In turn, these mechanisms may contribute to the dysfunction of GABAergic neurons. Copyright © 2015. Published by Elsevier B.V.
Photodynamic therapy mediates innate immune responses via fibroblast-macrophage interactions.
Zulaziz, N; Azhim, A; Himeno, N; Tanaka, M; Satoh, Y; Kinoshita, M; Miyazaki, H; Saitoh, D; Shinomiya, N; Morimoto, Y
2015-10-01
Antibacterial photodynamic therapy (PDT) has come to attract attention as an alternative therapy for drug-resistant bacteria. Recent reports revealed that antibacterial PDT induces innate immune response and stimulates abundant cytokine secretion as a part of inflammatory responses. However, the underlying mechanism how antibacterial PDT interacts with immune cells responsible for cytokine secretion has not been well outlined. In this study, we aimed to clarify the difference in gene expression and cytokine secretion between combined culture of fibroblasts and macrophages and their independent cultures. SCRC-1008, mouse fibroblast cell line and J774, mouse macrophage-like cell line were co-cultured and PDT treatments with different parameters were carried out. After various incubation periods (1-24 h), cells and culture medium were collected, and mRNA and protein levels for cytokines were measured using real-time PCR and ELISA, respectively. Our results showed that fibroblasts and macrophages interact with each other to mediate the immune response. We propose that fibroblasts initially respond to PDT by expressing Hspa1b, which regulates the NF-κB pathway via Tlr2 and Tlr4. Activation of the NF-κB pathway then results in an enhanced secretion of pro-inflammatory cytokines (TNF-α, IL-6 and IL-1β) and neutrophil chemoattractant MIP-2 and KC from macrophages.
Rezende, Taia Maria Berto; Vieira, Leda Quercia; Sobrinho, Antônio Paulino Ribeiro; Oliveira, Ricardo Reis; Taubman, Martin A; Kawai, Toshihisa
2008-09-01
This study assessed the influence of mineral trioxide aggregate (MTA) on adaptive immune responses. BALB/c mice were immunized with heat-killed Fusobacterium nucleatum (Fn) in MTA or other control adjuvants, and serum IgG responses to Fn were measured. Either Fn- or Peptostreptococcus anaerobius (Pa)-reactive memory T cells (Tm) were preincubated in vitro with/without MTA and restimulated with Fn or Pa. Tm proliferation and cytokine production were assessed. Compared with control groups, immunoglobulin G-antibody responses were upregulated in mice immunized with Fn in MTA in a similar manner to animals immunized with Fn in Freund's adjuvant or aluminum hydroxide adjuvant. Although MTA did not affect the upregulated expression of interleukin 10, tumor necrosis factor alpha, or RANKL by Tm, it suppressed the proliferation of Pa- or Fn-Tm and inhibited their production of Th1- or Th2-signature cytokines. MTA upregulated the adaptive humoral immune responses but had little or no effect on pro- or anti-inflammatory cytokine production by Tm.
Borcherding, Nicholas; Kolb, Ryan; Gullicksrud, Jodi; Vikas, Praveen; Zhu, Yuwen; Zhang, Weizhou
2018-07-06
Immune checkpoints are a diverse set of inhibitory signals to the immune system that play a functional role in adaptive immune response and self-tolerance. Dysregulation of these pathways is a vital mechanism in the avoidance of immune destruction by tumor cells. Immune checkpoint blockade (ICB) refers to targeted strategies to disrupt the tumor co-opted immune suppression to enhance anti-tumor immunity. Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) and programmed cell death 1 (PD-1) are two immune checkpoints that have the widest range of antibody-based therapies. These therapies have gone from promising approaches to Food and Drug Administration-approved first- and second-line agents for a number of immunogenic cancers. The burgeoning investigations of ICB efficacy in blood and solid cancers have underscored the importance of identifying the predictors of response and resistance to ICB. Identification of response correlates is made complicated by the observations of mixed reactions, or different responses in multiple lesions from the same patient, and delayed responses that can occur over a year after the induction therapy. Factors that can influence response and resistance in ICB can illuminate underlying molecular mechanisms of immune activation and suppression. These same response predictors can guide the identification of patients who would benefit from ICB, reduce off-target immune-relate adverse events, and facilitate the use of combinatorial therapies to increase efficacy. Here we review the underlying principles of immune checkpoint therapy and results of single-agent ICB clinical trials, and summarize the predictors of response and resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.
Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis
Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-hua; Xue, Dongbo
2017-01-01
Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including “immune response” as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma. PMID:28355233
Altered Innate and Lymphocytic Immune Responses in Mouse Splenocytes Post-Flight
NASA Technical Reports Server (NTRS)
Hwang, ShenAn; Crucian, Brian E.; Sams, Clarence F.; Actor, Jeffrey K.
2011-01-01
Space flight is known to affect immune responses of astronauts and animals, decreasing lymphocytic responses to mitogenic stimuli, delayed typed hypersensitivity reactions, and T-cell activation. Despite changes in immune suppression, there are no reports of consistent adverse clinical events post flight. To further investigate the spectrum of affected immune responses, murine splenocytes were stimulated immediately post-shuttle flight (14 days on STS-135) with T-cell stimulators or toll-like receptor agonists. Comparisons were made to ground control splenocytes from age-matched mice. Cell phenotypes were assessed, as well as activation markers and associated cytokine production. The CD4+ population decreased with no concurrent decrease in CD8+ cells from shuttle mice post flight compared to ground controls. Regarding antigen presenting cell populations, the number of CD11c+ cells were slightly elevated post flight, compared to ground controls, with increased MHC Class I expression (I-A(sup b)) and no change in Class II expression (H-2K(sup b)). CD86+ populations were also significantly diminished. However, the decreased markers did not correlate with activity. Stimulation of splenocytes post flight showed significant increase in bead uptake, increased Class I expression, increased TNF-alpha and IL-6 production in response to TLR-2 (zymosan) and TLR-4 (LPS) agonists. While most activated (ConA or anti-CD3/anti-CD28) CD4+ cells showed markedly diminished responses (reduced IL-2 production), non-specific T cell responses to superantigen (SEA/SEB) increased post flight as determined by expression of early activation markers. Production of additional cytokines was also dysregulated postflight. Overall, persistent immune changes during space flight could represent unique clinical risks for exploration class missions. The consequences of pathogenic encounter remain an important concern that should be addressed.
Santos Rocha, Clarissa; Hirao, Lauren A; Weber, Mariana G; Méndez-Lagares, Gema; Chang, W L William; Jiang, Guochun; Deere, Jesse D; Sparger, Ellen E; Roberts, Jeffrey; Barry, Peter A; Hartigan-O'Connor, Dennis J; Dandekar, Satya
2018-04-18
Subclinical viral infections (SVI) including cytomegalovirus (CMV) are highly prevalent in humans, resulting in life-long persistence. However, the impact of SVI on the interplay between the host immunity and gut microbiota in the context of environmental exposures is not well defined. We utilized the preclinical nonhuman primate (NHP) model consisting of SVI-free (SPF) rhesus macaques and compared them to the animals with SVI (non-SPF) acquired through natural exposure and investigated the impact of SVI on immune cell distribution and function as well as on gut microbiota. These changes were examined in animals housed in the outdoor environment as compared to the controlled indoor environment. We report that SVI are associated with altered immune cell subsets and gut microbiota composition in animals housed in the outdoor environment. Non-SPF animals harbored a higher proportion of potential butyrate-producing Firmicutes and higher numbers of lymphocytes, effector T cells and cytokine-producing T cells. Surprisingly, these differences diminished following their transfer to the controlled indoor environment, suggesting that non-SPFs had increased responsiveness to environmental exposures. An experimental infection of indoor SPF animals with CMV resulted in an increased abundance of butyrate-producing bacteria, validating that CMV enhanced colonization of butyrate-producing commensals. Finally, non-SPF animals displayed lower antibody responses to influenza vaccination as compared to SPF animals. Our data show that subclinical CMV infection heightens host immunity and gut microbiota changes in response to environmental exposures. This may contribute to the heterogeneity in host immune response to vaccines and environmental stimuli at the population level. IMPORTANCE Humans harbor several latent viruses that modulate host immunity and commensal microbiota, thus introducing heterogeneity in their responses to pathogens, vaccines and environmental exposures. Most of
Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun
2015-10-01
Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.
JP-8 jet fuel exposure suppresses the immune response to viral infections.
Harris, D T; Sakiestewa, D; Titone, D; He, X; Hyde, J; Witten, M
2008-05-01
The US Air Force has implemented the widespread use of JP-8 jet fuel in its operations, although a thorough understanding of its potential effects upon exposed personnel is unclear. Previous work has reported that JP-8 exposure is immunosuppressive. Exposure of mice to JP-8 for 1A h/day resulted in immediate secretion of two immunosuppressive agents, namely, interleukin-10 and prostaglandin E2. Thus, it was of interest to determine if jet fuel exposure might alter the immune response to infectious agents. The Hong Kong influenza model was used for these studies. Mice were exposed to 1000A mg/m(3) JP-8 (1A h/day) for 7A days before influenza viral infection. Animals were infected intra-nasally with virus and followed in terms of overall survival as well as immune responses. All surviving animals were killed 14A days after viral infection. In the present study, JP-8 exposure increased the severity of the viral infection by suppressing the anti-viral immune responses. That is, exposure of mice to JP-8 for 1A h/day for 7A days before infection resulted in decreased immune cell viability after exposure and infection, a greater than fourfold decrease in immune proliferative responses to mitogens, as well as an overall loss of CD3(+), CD4(+), and CD8(+) T cells from the lymph nodes, but not the spleens, of infected animals. These changes resulted in decreased survival of the exposed and infected mice, with only 33% of animals surviving as compared with 50% of mice infected but not jet fuel-exposed (and 100% of mice exposed only to JP-8). Thus, short-term, low-concentration JP-8 jet fuel exposures have significant suppressive effects on the immune system which can result in increased severity of viral infections.
Akundi, Ravi S; Huang, Zhenyu; Eason, Joshua; Pandya, Jignesh D; Zhi, Lianteng; Cass, Wayne A; Sullivan, Patrick G; Büeler, Hansruedi
2011-01-13
PTEN-induced kinase 1 (PINK1) is linked to recessive Parkinsonism (EOPD). Pink1 deletion results in impaired dopamine (DA) release and decreased mitochondrial respiration in the striatum of mice. To reveal additional mechanisms of Pink1-related dopaminergic dysfunction, we studied Ca²+ vulnerability of purified brain mitochondria, DA levels and metabolism and whether signaling pathways implicated in Parkinson's disease (PD) display altered activity in the nigrostriatal system of Pink1⁻/⁻ mice. Purified brain mitochondria of Pink1⁻/⁻ mice showed impaired Ca²+ storage capacity, resulting in increased Ca²+ induced mitochondrial permeability transition (mPT) that was rescued by cyclosporine A. A subpopulation of neurons in the substantia nigra of Pink1⁻/⁻ mice accumulated phospho-c-Jun, showing that Jun N-terminal kinase (JNK) activity is increased. Pink1⁻/⁻ mice 6 months and older displayed reduced DA levels associated with increased DA turnover. Moreover, Pink1⁻/⁻ mice had increased levels of IL-1β, IL-12 and IL-10 in the striatum after peripheral challenge with lipopolysaccharide (LPS), and Pink1⁻/⁻ embryonic fibroblasts showed decreased basal and inflammatory cytokine-induced nuclear factor kappa-β (NF-κB) activity. Quantitative transcriptional profiling in the striatum revealed that Pink1⁻/⁻ mice differentially express genes that (i) are upregulated in animals with experimentally induced dopaminergic lesions, (ii) regulate innate immune responses and/or apoptosis and (iii) promote axonal regeneration and sprouting. Increased mitochondrial Ca²+ sensitivity and JNK activity are early defects in Pink1⁻/⁻ mice that precede reduced DA levels and abnormal DA homeostasis and may contribute to neuronal dysfunction in familial PD. Differential gene expression in the nigrostriatal system of Pink1⁻/⁻ mice supports early dopaminergic dysfunction and shows that Pink1 deletion causes aberrant expression of genes that regulate innate
Akundi, Ravi S.; Huang, Zhenyu; Eason, Joshua; Pandya, Jignesh D.; Zhi, Lianteng; Cass, Wayne A.; Sullivan, Patrick G.; Büeler, Hansruedi
2011-01-01
Background PTEN-induced kinase 1 (PINK1) is linked to recessive Parkinsonism (EOPD). Pink1 deletion results in impaired dopamine (DA) release and decreased mitochondrial respiration in the striatum of mice. To reveal additional mechanisms of Pink1-related dopaminergic dysfunction, we studied Ca2+ vulnerability of purified brain mitochondria, DA levels and metabolism and whether signaling pathways implicated in Parkinson's disease (PD) display altered activity in the nigrostriatal system of Pink1−/− mice. Methods and Findings Purified brain mitochondria of Pink1−/− mice showed impaired Ca2+ storage capacity, resulting in increased Ca2+ induced mitochondrial permeability transition (mPT) that was rescued by cyclosporine A. A subpopulation of neurons in the substantia nigra of Pink1−/− mice accumulated phospho-c-Jun, showing that Jun N-terminal kinase (JNK) activity is increased. Pink1−/− mice 6 months and older displayed reduced DA levels associated with increased DA turnover. Moreover, Pink1−/− mice had increased levels of IL-1β, IL-12 and IL-10 in the striatum after peripheral challenge with lipopolysaccharide (LPS), and Pink1−/− embryonic fibroblasts showed decreased basal and inflammatory cytokine-induced nuclear factor kappa-β (NF-κB) activity. Quantitative transcriptional profiling in the striatum revealed that Pink1−/− mice differentially express genes that (i) are upregulated in animals with experimentally induced dopaminergic lesions, (ii) regulate innate immune responses and/or apoptosis and (iii) promote axonal regeneration and sprouting. Conclusions Increased mitochondrial Ca2+ sensitivity and JNK activity are early defects in Pink1−/− mice that precede reduced DA levels and abnormal DA homeostasis and may contribute to neuronal dysfunction in familial PD. Differential gene expression in the nigrostriatal system of Pink1−/− mice supports early dopaminergic dysfunction and shows that Pink1 deletion causes aberrant
Serologic and mucosal immune response to rotavirus infection in the rabbit model.
Conner, M E; Gilger, M A; Estes, M K; Graham, D Y
1991-01-01
We examined the humoral immune response to rotavirus infection in specific pathogen-free rabbits inoculated and challenged orally with rabbit Ala rotavirus (7.5 x 10(5) to 1 x 10(7) PFU). The humoral immune response in both serologic and mucosal samples was monitored by using total antibody enzyme-linked immunosorbent assays (ELISAs), isotype-specific ELISAs, and plaque reduction neutralization assays. Following a primary infection, all rabbits shed virus and serologic and mucosal antibody responses were initially detected by 1 week postinoculation. Intestinal immunoglobulin M was detected by 3 days postinoculation, and secretory immunoglobulin A was detected by 6 days postinoculation. Following challenge, rabbits were protected (no detectable virus shedding) from infection. An anamnestic immune response was observed only with mucosal neutralizing antibodies, and all serologic and mucosal immune responses persisted at high levels until at least 175 days postchallenge (204 days postinoculation). Detection of neutralization responses was influenced by the virus strain used in the neutralization assay; all inoculated rabbits developed detectable serum and intestinal neutralizing antibodies against the infecting (Ala) virus strain. Neutralization activity in both serum and mucosal samples was generally, but not exclusively, homotypic (VP7 serotype 3) after both primary and challenge inoculations with Ala virus. Heterotypic serum neutralization activity was observed with serotype 8 (9 of 12 rabbits) and 9 (12 of 12 rabbits) viruses and may be based on reactivity with the outer capsid protein VP4 or on a shared epitope in the C region of VP7. Comparisons of heterologous (serotype 3) and heterotypic neutralizing responses in mucosal and serologic samples revealed that 43% (21 of 49) of the responses were discordant. In 19 of 49 (39%) of these cases, a heterotypic serologic response was seen in the absence of a heterotypic mucosal response, but in 2 of 49 (4%) instances, a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pinto, Ligia A.; Viscidi, Raphael; Harro, Clayton D.
Human papillomavirus-like particles (HPV VLP) are candidate vaccines that have shown to be efficacious in reducing infection and inducing robust antiviral immunity. Neutralizing antibodies generated by vaccination are largely type-specific, but little is known about the type-specificity of cellular immune responses to VLP vaccination. To determine whether vaccination with HPV-16 L1VLP induces cellular immunity to heterologous HPV types (HPV-18, HPV-31, and HPV-53), we examined proliferative and cytokine responses in vaccine (n = 11) and placebo (n = 5) recipients. Increased proliferative and cytokine responses to heterologous types were observed postvaccination in some individuals. The proportion of women responding to heterologousmore » types postvaccination (36%-55%) was lower than that observed in response to HPV-16 (73%). Response to HPV-16 VLP predicted response to other types. The strongest correlations in response were observed between HPV-16 and HPV-31, consistent with their phylogenetic relatedness. In summary, PBMC from HPV-16 VLP vaccine recipients can respond to L1VLP from heterologous HPV types, suggesting the presence of conserved T cell epitopes.« less
Kumar, Anoop
2016-01-01
Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.
Neuroendocrine and Immune System Responses with Spaceflights
NASA Technical Reports Server (NTRS)
Tipton, Charles M.; Greenleaf, John E.; Jackson, Catherine G. R.
1996-01-01
Despite the fact that the first human was in space during 1961 and individuals have existed in a microgravity environment for more than a year, there are limited spaceflight data available on the responses of the neuroendocrine and immune systems. Because of mutual interactions between these respective integrative systems, it is inappropriate to assume that the responses of one have no impact on functions of the other. Blood and plasma volume consistently decrease with spaceflight; hence, blood endocrine and immune constituents will be modified by both gravitational and measurement influences. The majority of the in-flight data relates to endocrine responses that influence fluids and electrolytes during the first month in space. Adrenocorticotropin (ACTH), aldo-sterone. and anti-diuretic hormone (ADH) appear to be elevated with little change in the atrial natriuretic peptides (ANP). Flight results longer than 60 d show increased ADH variability with elevations in angiotensin and cortisol. Although post-flight results are influenced by reentry and recovery events, ACTH and ADH appear to be consistently elevated with variable results being reported for the other hormones. Limited in-flight data on insulin and growth hormone levels suggest they are not elevated to counteract the loss in muscle mass. Post-flight results from short- and long-term flights indicate that thyroxine and insulin are increased while growth hormone exhibits minimal change. In-flight parathyroid hormone (PTH) levels are variable for several weeks after which they remain elevated. Post-flight PTH was increased on missions that lasted either 7 or 237 d, whereas calcitonin concentrations were increased after 1 wk but decreased after longer flights. Leukocytes are elevated in flights of various durations because of an increase in neutrophils. The majority of post-flight data indicates immunoglobulin concentrations are not significantly changed from pre-flight measurements. However, the numbers of T
Inhibition of Innate Immune Responses Is Key to Pathogenesis by Arenaviruses.
Meyer, Bjoern; Ly, Hinh
2016-04-01
Mammalian arenaviruses are zoonotic viruses that cause asymptomatic, persistent infections in their rodent hosts but can lead to severe and lethal hemorrhagic fever with bleeding and multiorgan failure in human patients. Lassa virus (LASV), for example, is endemic in several West African countries, where it is responsible for an estimated 500,000 infections and 5,000 deaths annually. There are currently no FDA-licensed therapeutics or vaccines available to combat arenavirus infection. A hallmark of arenavirus infection (e.g., LASV) is general immunosuppression that contributes to high viremia. Here, we discuss the early host immune responses to arenavirus infection and the recently discovered molecular mechanisms that enable pathogenic viruses to suppress host immune recognition and to contribute to the high degree of virulence. We also directly compare the innate immune evasion mechanisms between arenaviruses and other hemorrhagic fever-causing viruses, such as Ebola, Marburg, Dengue, and hantaviruses. A better understanding of the immunosuppression and immune evasion strategies of these deadly viruses may guide the development of novel preventative and therapeutic options. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
James McNeil; Diana Cox-Foster; James Slavicek; Kelli Hoover
2010-01-01
How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...
Lombardo, Fabrizio; Ghani, Yasmeen; Kafatos, Fotis C.; Christophides, George K.
2013-01-01
Reverse genetics in the mosquito Anopheles gambiae by RNAi mediated gene silencing has led in recent years to an advanced understanding of the mosquito immune response against infections with bacteria and malaria parasites. We developed RNAi screens in An. gambiae hemocyte-like cells using a library of double-stranded RNAs targeting 109 genes expressed highly or specifically in mosquito hemocytes to identify novel regulators of the hemocyte immune response. Assays included phagocytosis of bacterial bioparticles, expression of the antimicrobial peptide CEC1, and basal and induced expression of the mosquito complement factor LRIM1. A cell viability screen was also carried out to assess dsRNA cytotoxicity and to identify genes involved in cell growth and survival. Our results identify 22 novel immune regulators, including proteins putatively involved in phagosome assembly and maturation (Ca2+ channel, v-ATPase and cyclin-dependent protein kinase), pattern recognition (fibrinogen-domain lectins and Nimrod), immune modulation (peptidase and serine protease homolog), immune signaling (Eiger and LPS-induced factor), cell adhesion and communication (Laminin B1 and Ninjurin) and immune homeostasis (Lipophorin receptor). The development of robust functional cell-based assays paves the way for genome-wide functional screens to study the mosquito immune response to infections with human pathogens. PMID:23382679
In vivo Ebola virus infection leads to a strong innate response in circulating immune cells.
Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H
2016-09-05
Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.
Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.
Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita
2007-04-01
The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.
Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish
Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita
2010-01-01
Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783
Human leukocyte antigens and cellular immune responses to anthrax vaccine adsorbed.
Ovsyannikova, Inna G; Pankratz, V Shane; Vierkant, Robert A; Pajewski, Nicholas M; Quinn, Conrad P; Kaslow, Richard A; Jacobson, Robert M; Poland, Gregory A
2013-07-01
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a "heterozygote advantage." Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥ 4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
Evaluation of the humoral immune response of children with low level lead exposure
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reigart, J.R.; Graber, C.D.
1976-07-01
Twelve lead-exposed children, with evidence of metabolic impairment, and seven non-lead exposed children were examined for evidence of impairment of their immunological response. There were no differences between the control group and the lead exposed group with reference to complement levels, immunoglobulins, or anamnestic response to the tetanus toxoid antigen. It remains to be demonstrated whether or not there is deficient response to primary immunization, whether other antigens are more affected by lead, or whether impairment of humoral immune response requires a more serious degree of lead intoxication.
USDA-ARS?s Scientific Manuscript database
The parasite Ichthyophthirius multifiliis (Ich) infects various freshwater fishes worldwide and results in heavy losses in aquaculture. The fish surviving natural infections or vaccinated with live theronts develop strong immune responses. Little is known about how immune genes are induced or how ...
Anti-tumor immune response induced by nanosecond pulsed streamer discharge in mice
NASA Astrophysics Data System (ADS)
Mizuno, Kazue; Yonetamari, Kenta; Shirakawa, Yuki; Akiyama, Taketoshi; Ono, Ryo
2017-03-01
Plasma is known to activate immune cells in vitro; however, its effect on cancer immunotherapy is not well understood in vivo. In this study, we report B16-F10 tumor growth suppression at a non-irradiated site on a mouse leg after a nanosecond pulsed streamer discharge was applied to the tumor on the other leg. The tumor growth suppression at non-irradiated remote sites was observed from the day next to that of plasma irradiation: the rapid abscopal effect suggests innate immune response activation. Additionally, the production of inflammatory cytokines from splenocytes was enhanced after plasma irradiation. This suggests the activation of adaptive immune response specific to B16-F10 melanoma by plasma irradiation.
Regulatory immune cells in regulation of intestinal inflammatory response to microbiota.
Sun, M; He, C; Cong, Y; Liu, Z
2015-09-01
The intestinal lumen harbors nearly 100 trillion commensal bacteria that exert crucial function for health. An elaborate balance between immune responses and tolerance to intestinal microbiota is required to maintain intestinal homeostasis. This process depends on diverse regulatory mechanisms, including both innate and adaptive immunity. Dysregulation of the homeostasis between intestinal immune systems and microbiota has been shown to be associated with the development of inflammatory bowel diseases (IBD) in genetically susceptible populations. In this review, we discuss the recent progress reported in studies of distinct types of regulatory immune cells in the gut, including intestinal intraepithelial lymphocytes, Foxp3(+) regulatory T cells, regulatory B cells, alternatively activated macrophages, dendritic cells, and innate lymphoid cells, and how dysfunction of this immune regulatory system contributes to intestinal diseases such as IBD. Moreover, we discuss the manipulation of these regulatory immune cells as a potential therapeutic method for management of intestinal inflammatory disorders.
Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.
Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T
1999-06-01
Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.
Effect of adjuvants on the humoral immune response to congopain in mice and cattle.
Kateregga, John; Lubega, George W; Lindblad, Erik B; Authié, Edith; Coetzer, Theresa Helen Taillefer; Boulangé, Alain François Vincent
2012-05-23
We investigated several adjuvants for their effects on the humoral immune response in both mice and cattle using the central domain of congopain (C2), the major cysteine protease of Trypanosoma congolense, as a model for developing a vaccine against animal trypanosomosis. The magnitude and sustainability of the immune response against C2 and the occurrence of a booster effect of infection, an indirect measure of the presence of memory cells, were determined by ELISA, while spectrofluorometry was used to determine and measure the presence of enzyme-inhibiting antibodies. Mice immunized with recombinant C2 in TiterMax™, Adjuphos™, purified saponin Quil A™ or Gerbu™ showed the best response according to the evaluation criteria and the latter three were chosen for the cattle vaccination study. The cattle were challenged with T. congolense four and a half months after the last booster. Cattle immunized with recombinant C2 in purified saponin Quil A™ showed the best antibody response according to the measured parameters. We identified purified saponin Quil A™ as a good adjuvant for immunizations with C2. The results from this study will be useful in future attempts to develop an effective anti-disease vaccine against African trypanosomosis.
Lambert, Nathaniel D; Ovsyannikova, Inna G; Pankratz, V Shane; Jacobson, Robert M; Poland, Gregory A
2012-08-01
Annual vaccination against seasonal influenza is recommended to decrease disease-related mortality and morbidity. However, one population that responds suboptimally to influenza vaccine is adults over the age of 65 years. The natural aging process is associated with a complex deterioration of multiple components of the host immune system. Research into this phenomenon, known as immunosenescence, has shown that aging alters both the innate and adaptive branches of the immune system. The intricate mechanisms involved in immune response to influenza vaccine, and how these responses are altered with age, have led us to adopt a more encompassing systems biology approach to understand exactly why the response to vaccination diminishes with age. Here, the authors review what changes occur with immunosenescence, and some immunogenetic factors that influence response, and outline the systems biology approach to understand the immune response to seasonal influenza vaccination in older adults.
HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin
Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago
2014-01-01
AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN
Predictors of responses to immune checkpoint blockade in advanced melanoma.
Jacquelot, N; Roberti, M P; Enot, D P; Rusakiewicz, S; Ternès, N; Jegou, S; Woods, D M; Sodré, A L; Hansen, M; Meirow, Y; Sade-Feldman, M; Burra, A; Kwek, S S; Flament, C; Messaoudene, M; Duong, C P M; Chen, L; Kwon, B S; Anderson, A C; Kuchroo, V K; Weide, B; Aubin, F; Borg, C; Dalle, S; Beatrix, O; Ayyoub, M; Balme, B; Tomasic, G; Di Giacomo, A M; Maio, M; Schadendorf, D; Melero, I; Dréno, B; Khammari, A; Dummer, R; Levesque, M; Koguchi, Y; Fong, L; Lotem, M; Baniyash, M; Schmidt, H; Svane, I M; Kroemer, G; Marabelle, A; Michiels, S; Cavalcanti, A; Smyth, M J; Weber, J S; Eggermont, A M; Zitvogel, L
2017-09-19
Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs. Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we retrospectively observed, in eight cohorts enrolling 190 MMel patients treated with ipilimumab, that PD-L1 expression on peripheral T cells was prognostic on overall and progression-free survival. Moreover, detectable CD137 on circulating CD8 + T cells was associated with the disease-free status of resected stage III MMel patients after adjuvant ipilimumab + nivolumab (but not nivolumab alone). These biomarkers should be validated in prospective trials in MMel.The clinical management of metastatic melanoma requires predictors of the response to checkpoint blockade. Here, the authors use immunological assays to identify potential prognostic/predictive biomarkers in circulating blood cells and in tumor-infiltrating lymphocytes from patients with resected stage III melanoma.
Spectroscopic techniques to study the immune response in human saliva
NASA Astrophysics Data System (ADS)
Nepomnyashchaya, E.; Savchenko, E.; Velichko, E.; Bogomaz, T.; Aksenov, E.
2018-01-01
Studies of the immune response dynamics by means of spectroscopic techniques, i.e., laser correlation spectroscopy and fluorescence spectroscopy, are described. The laser correlation spectroscopy is aimed at measuring sizes of particles in biological fluids. The fluorescence spectroscopy allows studying of the conformational and other structural changings in immune complex. We have developed a new scheme of a laser correlation spectrometer and an original signal processing algorithm. We have suggested a new fluorescence detection scheme based on a prism and an integrating pin diode. The developed system based on the spectroscopic techniques allows studies of complex process in human saliva and opens some prospects for an individual treatment of immune diseases.
[Innate immune response to RNA virus infection].
Oshiumi, Hiroyuki; Matsumoto, Misako; Seya, Tsukasa
2011-12-01
Viral RNA is recognized by RIG-I-like receptors and Toll-like receptors. RIG-I is a cytoplasmic viral RNA sensor. High Mobility Group Box (HMGB) proteins and DExD/H box RNA helicases, such as DDX3 and 60, associate with viral RNA. Those proteins promotes the RIG-I binding to viral RNA. RIG-I triggers the signal via IPS-1 adaptor molecule to induce type I IFN. RIG-I harbors Lys63-linked polyubiquitination by Riplet and TRIM25 ubiquitin ligases. The polyubiquitination is essential for RIG-I-mediated signaling. Toll-like receptors are located in endosome. TLR3 recognizes viral double-stranded RNA, and TLR7 and 8 recognize single-strand RNA. Virus has the ability to suppress these innate immune response. For example, to inhibit RIG-I-mediated signaling, HCV core protein suppresses the function of DDX3. In addition, HCV NS3-4A protein cleaves IPS-1 to inhibit the signal. Molecular mechanism of how viral RNA is recognized by innate immune system will make great progress on our understanding of how virus escapes from host immune system.
Martin, C E; Paibomesai, M A; Emam, S M; Gallienne, J; Hine, B C; Thompson-Crispi, K A; Mallard, B A
2016-03-01
Genetic selection for enhanced immune response has been shown to decrease disease occurrence in dairy cattle. Cows can be classified as high (H), average, or low responders based on antibody-mediated immune response (AMIR), predominated by type-2 cytokine production, and cell-mediated immune response (CMIR) through estimated breeding values for these traits. The purpose of this study was to identify in vitro tests that correlate with in vivo immune response phenotyping in dairy cattle. Blood mononuclear cells (BMC) isolated from cows classified as H-AMIR and H-CMIR through estimated breeding values for immune response traits were stimulated with concanavalin A (ConA; Sigma Aldrich, St. Louis, MO) and gene expression, cytokine production, and cell proliferation was determined at multiple time points. A repeated measures model, which included the effects of immune response group, parity, and stage of lactation, was used to compare differences between immune response phenotype groups. The H-AMIR cows produced more IL-4 protein than H-CMIR cows at 48 h; however, no difference in gene expression of type-2 transcription factor GATA3 or IL4 was noted. The BMC from H-CMIR cows had increased production of IFN-γ protein at 48, 72, and 96 h compared with H-AMIR animals. Further, H-CMIR cows had increased expression of the IFNG gene at 16, 24, and 48 h post-treatment with ConA, although expression of the type-1 transcription factor gene TBX21 did not differ between immune response groups. Although proliferation of BMC increased from 24 to 72 h after ConA stimulation, no differences were found between the immune response groups. Overall, stimulation of H-AMIR and H-CMIR bovine BMC with ConA resulted in distinct cytokine production profiles according to genetically defined groups. These distinct cytokine profiles could be used to define disease resistance phenotypes in dairy cows according to stimulation in vitro; however, other immune response phenotypes should be assessed
Host-Toxoplasma gondii Coadaptation Leads to Fine Tuning of the Immune Response.
Brasil, Thaís Rigueti; Freire-de-Lima, Celio Geraldo; Morrot, Alexandre; Vetö Arnholdt, Andrea Cristina
2017-01-01
Toxoplasma gondii has successfully developed strategies to evade host's immune response and reach immune privileged sites, which remains in a controlled environment inside quiescent tissue cysts. In this review, we will approach several known mechanisms used by the parasite to modulate mainly the murine immune system at its favor. In what follows, we review recent findings revealing interference of host's cell autonomous immunity and cell signaling, gene expression, apoptosis, and production of microbicide molecules such as nitric oxide and oxygen reactive species during parasite infection. Modulation of host's metalloproteinases of extracellular matrix is also discussed. These immune evasion strategies are determinant to parasite dissemination throughout the host taking advantage of cells from the immune system to reach brain and retina, crossing crucial hosts' barriers.
Chitosan nanoparticles: A positive modulator of innate immune responses in plants
NASA Astrophysics Data System (ADS)
Chandra, Swarnendu; Chakraborty, Nilanjan; Dasgupta, Adhiraj; Sarkar, Joy; Panda, Koustubh; Acharya, Krishnendu
2015-10-01
The immunomodulatory role of the natural biopolymer, chitosan, has already been demonstrated in plants, whilst its nanoparticles have only been examined for biomedical applications. In our present study, we have investigated the possible ability and mechanism of chitosan nanoparticles (CNP) to induce and augment immune responses in plants. CNP-treatment of leaves produced significant improvement in the plant’s innate immune response through induction of defense enzyme activity, upregulation of defense related genes including that of several antioxidant enzymes as well as elevation of the levels of total phenolics. It is also possible that the extracellular localization of CNP may also play a role in the observed upregulation of defense response in plants. Nitric oxide (NO), an important signaling molecule in plant defense, was also observed to increase following CNP treatment. However, such CNP-mediated immuno-stimulation was significantly mitigated when NO production was inhibited, indicating a possible role of NO in such immune induction. Taken together, our results suggest that CNP may be used as a more effective phytosanitary or disease control agent compared to natural chitosan for sustainable organic cultivation.
Anti-Gluten Immune Response following Toxoplasma gondii Infection in Mice
Severance, Emily G.; Kannan, Geetha; Gressitt, Kristin L.; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V.; Yolken, Robert H.
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002–0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders. PMID:23209841
Cram, Dominic L; Blount, Jonathan D; York, Jennifer E; Young, Andrew J
2015-01-01
The immune system provides vital protection against pathogens, but extensive evidence suggests that mounting immune responses can entail survival and fecundity costs. The physiological mechanisms that underpin these costs remain poorly understood, despite their potentially important role in shaping life-histories. Recent studies involving laboratory models highlight the possibility that oxidative stress could mediate these costs, as immune-activation can increase the production of reactive oxygen species leading to oxidative stress. However, this hypothesis has rarely been tested in free-ranging wild populations, where natural oxidative statuses and compensatory strategies may moderate immune responses and their impacts on oxidative status. Furthermore, the possibility that individuals scale their immune responses according to their oxidative status, conceivably to mitigate such costs, remains virtually unexplored. Here, we experimentally investigate the effects of a phytohaemagglutinin (PHA) immune-challenge on oxidative status in wild male and female white-browed sparrow weavers, Plocepasser mahali. We also establish whether baseline oxidative status prior to challenge predicts the scale of the immune responses. Contrary to previous work on captive animals, our findings suggest that PHA-induced immune-activation does not elicit oxidative stress. Compared with controls (n = 25 birds), PHA-injected birds (n = 27 birds) showed no evidence of a differential change in markers of oxidative damage or enzymatic and non-enzymatic antioxidant protection 24 hours after challenge. We did, however, find that the activity of a key antioxidant enzyme (superoxide dismutase, SOD) prior to immune-activation predicted the scale of the resulting swelling: birds with stronger initial SOD activity subsequently produced smaller swellings. Our findings (i) suggest that wild birds can mount immune responses without suffering from systemic oxidative stress, and (ii) lend support to
Immune Response in a Wild Bird Is Predicted by Oxidative Status, but Does Not Cause Oxidative Stress
Cram, Dominic L.; Blount, Jonathan D.; York, Jennifer E.; Young, Andrew J.
2015-01-01
The immune system provides vital protection against pathogens, but extensive evidence suggests that mounting immune responses can entail survival and fecundity costs. The physiological mechanisms that underpin these costs remain poorly understood, despite their potentially important role in shaping life-histories. Recent studies involving laboratory models highlight the possibility that oxidative stress could mediate these costs, as immune-activation can increase the production of reactive oxygen species leading to oxidative stress. However, this hypothesis has rarely been tested in free-ranging wild populations, where natural oxidative statuses and compensatory strategies may moderate immune responses and their impacts on oxidative status. Furthermore, the possibility that individuals scale their immune responses according to their oxidative status, conceivably to mitigate such costs, remains virtually unexplored. Here, we experimentally investigate the effects of a phytohaemagglutinin (PHA) immune-challenge on oxidative status in wild male and female white-browed sparrow weavers, Plocepasser mahali. We also establish whether baseline oxidative status prior to challenge predicts the scale of the immune responses. Contrary to previous work on captive animals, our findings suggest that PHA-induced immune-activation does not elicit oxidative stress. Compared with controls (n = 25 birds), PHA-injected birds (n = 27 birds) showed no evidence of a differential change in markers of oxidative damage or enzymatic and non-enzymatic antioxidant protection 24 hours after challenge. We did, however, find that the activity of a key antioxidant enzyme (superoxide dismutase, SOD) prior to immune-activation predicted the scale of the resulting swelling: birds with stronger initial SOD activity subsequently produced smaller swellings. Our findings (i) suggest that wild birds can mount immune responses without suffering from systemic oxidative stress, and (ii) lend support to
Human Innate Immune Responses to Hexamethylene Diisocyanate (HDI) and HDI-Albumin Conjugates
Wisnewski, Adam V.; Liu, Qing; Liu, Jian; Redlich, Carrie A.
2011-01-01
Background Isocyanates, a leading cause of occupational asthma, are known to induce adaptive immune responses; however, innate immune responses, which generally precede and regulate adaptive immunity, remain largely uncharacterized. Objective Identify and characterize cellular, molecular and systemic innate immune responses induced by hexamethylene diisocyanate (HDI). Methods Human peripheral blood mononuclear cells (PBMCs) were stimulated in vitro with HDI-albumin conjugates or control antigen, and changes in phenotype, gene, and protein expression were characterized by flow cytometry, microarray, Western blot and ELISA. Cell uptake of isocyanate was visualized microscopically using HDI-albumin conjugates prepared with fluorescently-labeled albumin. In vivo, human HDI exposure was performed via specific inhalation challenge, and subsequent changes in PBMCs and serum proteins were measured by flow cytometry and ELISA. Genotypes were determined by PCR. Results Human monocytes take-up HDI-albumin conjugates and undergo marked changes in morphology and gene/protein expression in vitro. The most significant (p 0.007 – 0.05) changes in mircoarray gene expression were noted in lysosomal genes, especially peptidases and proton pumps involved in antigen processing. Chemokines that regulate monocyte/macrophage trafficking (MIF, MCP-1), and pattern recognition receptors that bind chitin (chitinases) and oxidized low-density lipoprotein (CD68) were also increased following isocyanate-albumin exposure. In vivo, HDI exposed subjects exhibited an acute increase in the percentage of PBMCs with the same HDI-albumin responsive phenotype characterized in vitro (HLA-DR+/CD11c+ with altered light scatter properties). An exposure-dependent decrease (46±11%; p<0.015) in serum concentrations of chitinase-3-like-1 was also observed, in individuals that lack the major (type 1) human chitinase (due to genetic polymorphism), but not in individuals possessing at least one functional
ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.
2009-01-01
Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune
Brown, Aisling F.; Leech, John M.; Rogers, Thomas R.; McLoughlin, Rachel M.
2014-01-01
In apparent contrast to its invasive potential Staphylococcus aureus colonizes the anterior nares of 20–80% of the human population. The relationship between host and microbe appears particularly individualized and colonization status seems somehow predetermined. After decolonization, persistent carriers often become re-colonized with their prior S. aureus strain, whereas non-carriers resist experimental colonization. Efforts to identify factors facilitating colonization have thus far largely focused on the microorganism rather than on the human host. The host responds to S. aureus nasal colonization via local expression of anti-microbial peptides, lipids, and cytokines. Interplay with the co-existing microbiota also influences colonization and immune regulation. Transient or persistent S. aureus colonization induces specific systemic immune responses. Humoral responses are the most studied of these and little is known of cellular responses induced by colonization. Intriguingly, colonized patients who develop bacteremia may have a lower S. aureus-attributable mortality than their non-colonized counterparts. This could imply a staphylococcal-specific immune “priming” or immunomodulation occurring as a consequence of colonization and impacting on the outcome of infection. This has yet to be fully explored. An effective vaccine remains elusive. Anti-S. aureus vaccine strategies may need to drive both humoral and cellular immune responses to confer efficient protection. Understanding the influence of colonization on adaptive response is essential to intelligent vaccine design, and may determine the efficacy of vaccine-mediated immunity. Clinical trials should consider colonization status and the resulting impact of this on individual patient responses. We urgently need an increased appreciation of colonization and its modulation of host immunity. PMID:24409186
Schrank, C.S.; Cook, M.E.; Hansen, W.R.
1990-01-01
The ability of two in vivo tests to assay immune competence of mallard ducks (Anas platyrhynchos) treated with various immunomodulatory agents was examined. Skin responses to phytohemagglutinin-P (PHA-P) injected intradermally and serum antibody levels produced in response to sheep red blood cells (SRBC) were measured. As measured by the skin response to PHA-P, ducks injected intramuscularly with cyclophosphamide or cyclosporine did not respond differently from control-injected ducks. Dexamethasone injected intramuscularly significantly suppressed the skin response to PHA-P. As measured by antibody levels in response to SRBC, ducks injected intramuscularly with cyclophosphamide responded with antibody titers similar to controls. Cyclosporine injected intramuscularly reduced the level of immunoglobulin (Ig) G significantly in one of two experiments. Dexamethasone injected intramuscularly reduced peak total and IgG titers. These experiments provide information on the viability of these two in vivo tests to reflect immune competence of mallard ducks.
Effect of tape stripping and adjuvants on immune response after intradermal DNA electroporation.
Vandermeulen, Gaëlle; Daugimont, Liévin; Richiardi, Hervé; Vanderhaeghen, Marie-Lise; Lecouturier, Nathalie; Ucakar, Bernard; Préat, Véronique
2009-07-01
DNA vaccines require both efficient delivery methods and appropriate adjuvants. Based on their mechanisms of action, we hypothesised that some adjuvants could enhance vaccine immunogenicity or direct the response towards Th1 profile after intradermal DNA electroporation. After intradermal electroporation of plasmid DNA encoding luciferase, mice received hyaluronidase, imiquimod, monophosphoryl lipid A or were tape stripped in order to modulate the immune response against the encoded protein. We measured total immunoglobulin G, IgG1, IgG2a titres and the cytokines produced by splenocyte cultures to assess both humoral and cellular response. The effect of tape stripping on the response against intradermally delivered ovalbumin protein was also assessed. Neither hyaluronidase nor imiquimod improved the immune response against the encoded luciferase. Monophosphoryl lipid A did not modify the cytokines production but increased the anti-luciferase IgG2a titres. Tape stripping significantly increased anti-luciferase IgG2a and IFN-gamma responses. It also enhanced the humoral response after intradermal injection of the ovalbumin protein. Tape stripping is able to increase the Th1 immune response against both DNA and protein vaccines. Therefore, tape stripping appears to have interesting adjuvant effect on intradermal vaccination.
Injury and immune response: applying the danger theory to mosquitoes
Moreno-García, Miguel; Recio-Tótoro, Benito; Claudio-Piedras, Fabiola; Lanz-Mendoza, Humberto
2014-01-01
The insect immune response can be activated by the recognition of both non-self and molecular by-products of tissue damage. Since pathogens and tissue damage usually arise at the same time during infection, the specific mechanisms of the immune response to microorganisms, and to tissue damage have not been unraveled. Consequently, some aspects of damage caused by microorganisms in vector-borne arthropods have been neglected. We herein reassess the Anopheles–Plasmodium interaction, incorporating Matzinger’s danger/damage hypothesis and George Salt’s injury assumptions. The invasive forms of the parasite cross the peritrophic matrix and midgut epithelia to reach the basal lamina and differentiate into an oocyst. The sporozoites produced in the oocyst are released into the hemolymph, and from there enter the salivary gland. During parasite development, wounds to midgut tissue and the basement membrane are produced. We describe the response of the different compartments where the parasite interacts with the mosquito. In the midgut, the response includes the expression of antimicrobial peptides, production of reactive oxygen species, and possible activation of midgut regenerative cells. In the basal membrane, wound repair mainly involves the production of molecules and the recruitment of hemocytes. We discuss the susceptibility to damage in tissues, and how the place and degree of damage may influence the differential response and the expression of damage associated molecular patterns (DAMPs). Knowledge about damage caused by parasites may lead to a deeper understanding of the relevance of tissue damage and the immune response it generates, as well as the origins and progression of infection in this insect–parasite interaction. PMID:25250040
The innate immune response to Aspergillus fumigatus at the alveolar surface.
Margalit, Anatte; Kavanagh, Kevin
2015-09-01
Aspergillus fumigatus is an ubiquitous, saprophytic mould that forms and releases airborne conidia which are inhaled by humans on a daily basis. When the immune system is compromised (e.g. immunosuppressive therapy prior to organ transplantation) or there is pre-existing pulmonary malfunction (e.g. asthma, cystic fibrosis, TB lesions), A. fumigatus exploits weaknesses in the host defenses which can result in the development of saphrophytic, allergic or invasive aspergillosis. If not effectively eliminated by the innate immune response, conidia germinate and form invasive hyphae which can penetrate pulmonary tissues. The innate immune response to A. fumigatus is stage-specific and various components of the host's defenses are recruited to challenge the different cellular forms of the pathogen. In immunocompetent hosts, anatomical barriers (e.g. the mucociliary elevator) and professional phagocytes such as alveolar macrophages (AM) and neutrophils prevent the development of aspergillosis by inhibiting the growth of conidia and hyphae. The recognition of inhaled conidia by AM leads to the intracellular degradation of the spores and the secretion of proinflammatory mediators which recruit neutrophils to assist in fungal clearance. During the later stages of infection, dendritic cells activate a protective A. fumigatus-specific adaptive immune response which is driven by Th1 CD4(+) T cells. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
The Hepatitis C Virus Glycan Shield and Evasion of the Humoral Immune Response
Helle, François; Duverlie, Gilles; Dubuisson, Jean
2011-01-01
Despite the induction of effective immune responses, 80% of hepatitis C virus (HCV)-infected individuals progress from acute to chronic hepatitis. In contrast to the cellular immune response, the role of the humoral immune response in HCV clearance is still subject to debate. Indeed, HCV escapes neutralizing antibodies in chronically infected patients and reinfection has been described in human and chimpanzee. Studies of antibody-mediated HCV neutralization have long been hampered by the lack of cell-culture-derived virus and the absence of a small animal model. However, the development of surrogate models and recent progress in HCV propagation in vitro now enable robust neutralization assays to be performed. These advances are beginning to shed some light on the mechanisms of HCV neutralization. This review summarizes the current state of knowledge of the viral targets of anti-HCV-neutralizing antibodies and the mechanisms that enable HCV to evade the humoral immune response. The recent description of the HCV glycan shield that reduces the immunogenicity of envelope proteins and masks conserved neutralizing epitopes at their surface constitutes the major focus of this review. PMID:22069522
An Investigation of the Memory Response of the Local Immune System to Shigella Antigens.
1985-12-31
kAD-A±75 215 AN INVESTIOATION OF THE MEMORY RESPONSE OF THE LOCAL L/1 I IMMUNE SYSTEM TO SHIGELLA ANTIGENS(U) MICHIGAN UNIV ANN I RBOR D F KEREN 31...IMMUNE SYSTEM TO SHIGELLA ANTIGENS ANNUAL REPORT DAVID F. KEREN, M.D. DECEMBER 31, 1985 FOR THE PERIOD DECEMBER 1, 1984 - NOVEMBER 30, 1985 SUPPORTED...Security Classification) An Investigation of the Memory Response of the Local Immune System to Shigella Antigens 12 PERSONAL AUTHOR(S) Keren, David F
Overview of the immune response to phytonutrient in poultry
USDA-ARS?s Scientific Manuscript database
Overview of the immune response to phytonutrient in poultry. Lillehoj, Hyun S. Animal Biosciences and Biotechnology Laboratory, Beltsville Agricultural Research Center, Agricultural Research Service, USDA, Beltsville, MD 20705, USA Phytochemicals are non-nutritive, plant-derived chemicals, many w...
Synthetic Rhamnolipid Bolaforms trigger an innate immune response in Arabidopsis thaliana.
Luzuriaga-Loaiza, W Patricio; Schellenberger, Romain; De Gaetano, Yannick; Obounou Akong, Firmin; Villaume, Sandra; Crouzet, Jérôme; Haudrechy, Arnaud; Baillieul, Fabienne; Clément, Christophe; Lins, Laurence; Allais, Florent; Ongena, Marc; Bouquillon, Sandrine; Deleu, Magali; Dorey, Stephan
2018-06-04
Stimulation of plant innate immunity by natural and synthetic elicitors is a promising alternative to conventional pesticides for a more sustainable agriculture. Sugar-based bolaamphiphiles are known for their biocompatibility, biodegradability and low toxicity. In this work, we show that Synthetic Rhamnolipid Bolaforms (SRBs) that have been synthesized by green chemistry trigger Arabidopsis innate immunity. Using structure-function analysis, we demonstrate that SRBs, depending on the acyl chain length, differentially activate early and late immunity-related plant defense responses and provide local increase in resistance to plant pathogenic bacteria. Our biophysical data suggest that SRBs can interact with plant biomimetic plasma membrane and open the possibility of a lipid driven process for plant-triggered immunity by SRBs.
Mannose Receptor Mediates the Immune Response to Ganoderma atrum Polysaccharides in Macrophages.
Li, Wen-Juan; Tang, Xiao-Fang; Shuai, Xiao-Xue; Jiang, Cheng-Jia; Liu, Xiang; Wang, Le-Feng; Yao, Yu-Fei; Nie, Shao-Ping; Xie, Ming-Yong
2017-01-18
The ability of mannose receptor (MR) to recognize the carbohydrate structures is well-established. Here, we reported that MR was crucial for the immune response to a Ganoderma atrum polysaccharide (PSG-1), as evidenced by elevation of MR in association with increase of phagocytosis and concentrations of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) in normal macrophages. Elevation of MR triggered by PSG-1 also led to control lipopolysaccharide (LPS)-triggered inflammatory response via the increase of interleukin-10 (IL-10) and inhibition of phagocytosis and IL-1β. Anti-MR antibody partly attenuated PSG-1-mediated anti-inflammatory responses, while it could not affect TNF-α secretion, suggesting that another receptor was involved in PSG-1-triggered immunomodulatory effects. MR and toll-like receptor (TLR)4 coordinated the influences on the TLR4-mediated signaling cascade by the nuclear factor-κB (NF-κB) pathway in LPS-stimulated macrophages subjected to PSG-1. Collectively, immune response to PSG-1 required recognition by MR in macrophages. The NF-κB pathway served as a central role for the coordination of MR and TLR4 to elicit immune response to PSG-1.
Effects of inbreeding on potential and realized immune responses in Tenebrio molitor.
Rantala, Markus J; Viitaniemi, Heidi; Roff, Derek A
2011-06-01
Although numerous studies on vertebrates suggest that inbreeding reduces their resistance against parasites and pathogens, studies in insects have found contradictory evidence. In this study we tested the effect of 1 generation of brother-sister mating (inbreeding) on potential and realized immune responses and other life-history traits in Tenebrio molitor. We found that inbreeding reduced adult mass, pre-adult survival and increased development time, suggesting that inbreeding reduced the condition of the adults and thus potentially made them more susceptible to physiological stress. However, we found no significant effect of inbreeding on the potential immune response (encapsulation response), but inbreeding reduced the realized immune response (resistance against the entomopathogenic fungi, Beauveria bassiana). There was a significant family effect on encapsulation response, but no family effect on the resistance against the entomopathogenic fungi. Given that this latter trait showed significant inbreeding depression and that the sample size for the family-effect analysis was small it is likely that the lack of a significant family effect is due to reduced statistical power, rather than the lack of a heritable basis to the trait. Our study highlights the importance of using pathogens and parasites in immunoecological studies.
Intersections between immune responses and morphological regulation in plants.
Uchida, Naoyuki; Tasaka, Masao
2010-06-01
Successful plant pathogens have developed strategies to interfere with the defence mechanisms of their host plants through evolution. Conversely, host plants have evolved systems to counteract pathogen attack. Some pathogens induce pathogenic symptoms on plants that include morphological changes in addition to interference with plant growth. Recent studies, based on molecular biology and genetics using Arabidopsis thaliana, have revealed that factors derived from pathogens can modulate host systems and/or host factors that play important roles in the morphological regulation of host plants. Other reports, meanwhile, have shown that factors known to have roles in plant morphology also function in plant immune responses. Evolutionary conservation of these factors and systems implies that host-pathogen interactions and the evolution they drive have yielded tight links between morphological processes and immune responses. In this review, recent findings about these topics are introduced and discussed.
Affective immunology: where emotions and the immune response converge.
D'Acquisto, Fulvio
2017-03-01
Affect and emotion are defined as "an essential part of the process of an organism's interaction with stimuli." Similar to affect, the immune response is the "tool" the body uses to interact with the external environment. Thanks to the emotional and immunological response, we learn to distinguish between what we like and what we do not like, to counteract a broad range of challenges, and to adjust to the environment we are living in. Recent compelling evidence has shown that the emotional and immunological systems share more than a similarity of functions. This review article will discuss the crosstalk between these two systems and the need for a new scientific area of research called affective immunology. Research in this field will allow a better understanding and appreciation of the immunological basis of mental disorders and the emotional side of immune diseases.
Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.
2013-01-01
Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.
Summerfield, Artur; Guzylack-Piriou, Laurence; Harwood, Lisa; McCullough, Kenneth C
2009-03-15
Foot-and-mouth disease (FMD) represents one of the most economically important diseases of farm animals. The basis for the threat caused by this virus is the high speed of replication, short incubation time, high contagiousness, and high mutation rate resulting in constant antigenic changes. Thus, although protective immune responses against FMD virus (FMDV) can be efficacious, the rapidity of virus replication and spread can outpace immune defence development and overrun the immune system. FMDV can also evade innate immune responses through its ability to shut down cellular protein synthesis, including IFN type I, in susceptible epithelial cells. This is important for virus evolution, as FMDV is quite sensitive to the action of IFN. Despite this, innate immune responses are probably induced in vivo, although detailed studies on this subject are lacking. Accordingly, this interaction of FMDV with cells of the innate immune system is of particular interest. Dendritic cells (DC) can be infected by FMDV and support viral RNA replication, and viral protein synthesis but the latter is inefficient or abortive, leading most often to incomplete replication and progeny virus release. As a result DC can be activated, and particularly in the case of plasmacytoid DC (pDC), this is manifest in terms of IFN-alpha release. Our current state of knowledge on innate immune responses induced by FMDV is still only at a relatively early stage of understanding. As we progress, the investigations in this area will help to improve the design of current vaccines and the development of novel control strategies against FMD.
Jiang, Jing; Chen, Xinchun; An, Hongjuan; Yang, Bingfen; Zhang, Fuping; Cheng, Xiaoxing
2016-09-02
The functions of MAIT cells at the site of Mycobacterium tuberculosis infection in humans are still largely unknown. In this study, the phenotypes and immune response of MAIT cells from tuberculous pleural effusions and peripheral blood were investigated. MAIT cells in tuberculous pleural effusions had greatly enhanced IFN-γ, IL-17F and granzyme B response compared with those in peripheral blood. The level of IFN-γ response in MAIT cells from tuberculous pleural effusions was inversely correlated with the extent of tuberculosis infection (p = 0.0006). To determine whether cytokines drive the immune responses of MAIT cells at the site of tuberculosis infection, the role of IL-1β, IL-2, IL-7, IL-12, IL-15 and IL-18 was investigated. Blockade of IL-2, IL-12 or IL-18 led to significantly reduced production of IFN-γ and/or granzyme B in MAIT cells from tuberculous pleural effusions. Majority of IL-2-producing cells (94.50%) in tuberculous pleural effusions had phenotype of CD3(+)CD4(+), and most IL-12p40-producing cells (91.39%) were CD14(+) cells. MAIT cells had significantly elevated expression of γc receptor which correlated with enhanced immune responses of MAIT cells. It is concluded that MAIT cells from tuberculous pleural effusions exhibited highly elevated immune response to Mtb antigens, which are controlled by cytokines produced by innate/adaptive immune cells.
Jiang, Jing; Chen, Xinchun; An, Hongjuan; Yang, Bingfen; Zhang, Fuping; Cheng, Xiaoxing
2016-01-01
The functions of MAIT cells at the site of Mycobacterium tuberculosis infection in humans are still largely unknown. In this study, the phenotypes and immune response of MAIT cells from tuberculous pleural effusions and peripheral blood were investigated. MAIT cells in tuberculous pleural effusions had greatly enhanced IFN-γ, IL-17F and granzyme B response compared with those in peripheral blood. The level of IFN-γ response in MAIT cells from tuberculous pleural effusions was inversely correlated with the extent of tuberculosis infection (p = 0.0006). To determine whether cytokines drive the immune responses of MAIT cells at the site of tuberculosis infection, the role of IL-1β, IL-2, IL-7, IL-12, IL-15 and IL-18 was investigated. Blockade of IL-2, IL-12 or IL-18 led to significantly reduced production of IFN-γ and/or granzyme B in MAIT cells from tuberculous pleural effusions. Majority of IL-2-producing cells (94.50%) in tuberculous pleural effusions had phenotype of CD3+CD4+, and most IL-12p40-producing cells (91.39%) were CD14+ cells. MAIT cells had significantly elevated expression of γc receptor which correlated with enhanced immune responses of MAIT cells. It is concluded that MAIT cells from tuberculous pleural effusions exhibited highly elevated immune response to Mtb antigens, which are controlled by cytokines produced by innate/adaptive immune cells. PMID:27586092
Sedimentation rapidly induces an immune response and depletes energy stores in a hard coral
NASA Astrophysics Data System (ADS)
Sheridan, C.; Grosjean, Ph.; Leblud, J.; Palmer, C. V.; Kushmaro, A.; Eeckhaut, I.
2014-12-01
High sedimentation rates have been linked to reduced coral health within multiple systems; however, whether this is a direct result of compromised coral immunity has not been previously investigated. The potential effects of sedimentation on immunity of the hard coral Montipora patula were examined by comparing physiological responses of coral fragments inoculated with sterilized marine sediments and those under control conditions. Sediments were collected from terrestrial runoff-affected reefs in SW Madagascar and applied cyclically for a total of 24 h at a rate observed during precipitation-induced sedimentation events. Coral health was determined 24 h after the onset of the sedimentation stress through measuring metabolic proxies of O2 budget and lipid ratios. Immune response of the melanin synthesis pathway was measured by quantifying phenoloxidase activity and melanin deposits. Sedimentation induced both immune and metabolic responses in M. patula. Both phenoloxidase activity and melanin deposition were significantly higher in the sediment treatment compared to controls, indicating an induced immune response. Sediment-treated corals also showed a tendency towards increased respiration (during the night) and decreased photosynthesis (during the day) and a significant depletion of energy reserves as compared to controls. These data highlight that short-term (24 h) sedimentation, free of live microorganisms, compromises the health of M. patula. The energetically costly immune response, potentially elicited by residual endotoxins and other inflammatory particles associated with the sterile sediments, likely contributes to the energy depletion. Overall, exposure to sedimentation adversely affects coral health and continued exposure may lead to resource depletion and an increased susceptibility to disease.
Age-related immune response to experimental infection with Eimeria ninakohlyakimovae in goat kids.
Matos, L; Muñoz, M C; Molina, J M; Rodríguez, F; Pérez, D; López, A M; Hermosilla, C; Taubert, A; Ruiz, A
2018-06-01
Both the immune response developed in ruminants against Eimeria spp. and the ability to bear patent infections seems to be dependent on the age of the host. In the present study we have evaluated the influence of the age in the development of protective immune responses against Eimeria ninakohlyakimovae. For this purpose, 3, 4 and 5-week-old goat kids were infected with sporulated oocysts and subjected to a homologous challenge 3 weeks later. Goat kids primary infected at 6, 7 and 8 weeks of age served as challenge controls, and uninfected animals were used as negative controls. The protective immunity was assessed by clinical, haematological, parasitological, immunological and pathological parameters. Altogether, the results demonstrate that goat kids of either 3, 4 or 5 weeks of age are able to develop patent infections and immunoprotective responses against E. ninakohlyakimovae, as all age groups: (i) released significantly less oocysts after challenge, which was associated to milder clinical signs; (ii) displayed a local immune response, with significant increase of numerous cellular populations; and (iii) had increased levels of IgG and IgM, and mainly of local IgA. Nevertheless, detailed analysis of the data showed some differences between the three age groups, related both to the Eimeria infection outcome and the resulting immune response, suggesting that youngest goat kids are not fully immunocompetent. This finding may be of interest for the design of immunoprophylactic approaches and/or prophylactic/methaphylactic treatments against goat coccidiosis. Copyright © 2018 Elsevier Ltd. All rights reserved.
Piret, Jocelyne; Boivin, Guy
2015-09-01
Herpes simplex viruses are large double-stranded DNA viruses. These viruses have the ability to establish a lifelong latency in sensory ganglia and to invade and replicate in the CNS. Apart from relatively benign mucosal infections, HSV is responsible for severe illnesses including HSV encephalitis (HSE). HSE is the most common cause of sporadic, potentially fatal viral encephalitis in Western countries. If left untreated, the mortality rate associated with HSE is approximately 70%. Despite antiviral therapy, the mortality is still higher than 30%, and almost 60% of surviving individuals develop neurological sequelae. It is suggested that direct virus-related and indirect immune-mediated mechanisms contribute to the damages occurring in the CNS during HSE. In this manuscript, we describe the innate immune response to HSV, the development of HSE in mice knock-out for proteins of the innate immune system as well as inherited deficiencies in key components of the signaling pathways involved in the production of type I interferon that could predispose individuals to develop HSE. Finally, we review several immunomodulatory strategies aimed at modulating the innate immune response at a critical time after infection that were evaluated in mouse models and could be combined with antiviral therapy to improve the prognosis of HSE. In conclusion, the cerebral innate immune response that develops during HSE is a "double-edged sword" as it is critical to control viral replication in the brain early after infection, but, if left uncontrolled, may also result in an exaggerated inflammatory response that could be detrimental to the host. Copyright © 2015 John Wiley & Sons, Ltd.
Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries
2015-04-21
Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.