Sample records for abnormal skin barrier

  1. Is the skin barrier abnormal in dogs with atopic dermatitis?


    Olivry, Thierry


    In mammalian skin, the stratum corneum exerts a barrier function that protects from transepidermal water loss and the penetration of exogenous molecules, such as allergens, from the environment. Recently, skin barrier defects have been shown to be of prime importance in the pathogenesis of human atopic dermatitis. In this review, we summarize the latest research data pertinent to the stratum corneum and barrier function of dogs with atopic dermatitis. At the time of this writing, there is increasing evidence that a skin barrier defect likely exists in dogs with atopic dermatitis. This barrier dysfunction is characterized by abnormal intercellular stratum corneum lipid lamellae, abnormal stratum corneum morphology, reduced and abnormal ceramide content and, in some but not all dogs, abnormal filaggrin expression. In association with these changes, there is higher transepidermal water loss in atopic than in normal canine skin. Furthermore, atopic inflammation appears to worsen transepidermal water loss and filaggrin expression. It remains unknown, however, if the changes observed are primary (i.e. of genetic origin) or secondary to atopic inflammation that also exists even in clinically normal skin. Finally, whether or not a therapeutic intervention aimed at restoring a dysfunctional skin barrier is of any clinical benefit to atopic dogs has not yet been proven unequivocally.

  2. Abnormal skin barrier in the etiopathogenesis of atopic dermatitis

    PubMed Central

    Elias, Peter M.; Schmuth, Matthias


    Purpose of review Many recent studies have revealed the key roles played by Th1/Th2 cell dysregulation, IgE production, mast cell hyperactivity, and dendritic cell signaling in the pathogenesis of atopic dermatitis. Accordingly, current therapy has been largely directed towards ameliorating Th2-mediated inflammation and/or pruritus. We will review here emerging evidence that the inflammation in atopic dermatitis results from inherited and acquired insults to the barrier and the therapeutic implications of this new paradigm. Recent findings Recent molecular genetic studies have shown a strong association between mutations in FILAGGRIN and atopic dermatitis, particularly in Northern Europeans. But additional acquired stressors to the barrier are required to initiate inflammation. Sustained hapten access through a defective barrier stimulates a Th1 → Th2 shift in immunophenotype, which in turn further aggravates the barrier. Secondary Staphylococcus aureus colonization not only amplifies inflammation but also further stresses the barrier in atopic dermatitis. Summary These results suggest a new ‘outside-to-inside, back to outside’ paradigm for the pathogenesis of atopic dermatitis. This new concept is providing impetus for the development of new categories of ‘barrier repair’ therapy. PMID:19550302

  3. Abnormal skin barrier in the etiopathogenesis of atopic dermatitis.


    Elias, Peter M; Schmuth, Matthias


    Prior studies revealed the key roles played by T-helper type 1 and type 2 (Th1/Th2) cell dysregulation, IgE production, mast cell hyperactivity, and dendritic cell signaling in the evolution of the chronic, pruritic, inflammatory dermatosis that characterizes atopic dermatitis (AD). Accordingly, current therapy has been largely directed toward ameliorating Th2-mediated inflammation and pruritus. This article reviews emerging evidence that the inflammation in AD results from inherited and acquired insults to the barrier, as well as the therapeutic implications of this new paradigm.

  4. Abnormalities in itch sensation and skin barrier function in atopic NC/Tnd mice.


    Amagai, Yosuke; Matsuda, Hiroshi; Tanaka, Akane


    Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by dryness and itchy skin. Genetic factors as well as other factors, including abnormality in skin barrier function, hypersensitivity of itch sensory nerves, and dysfunction of the immune system, strongly affect the onset and exacerbation of AD. Recently, it has become clear that itch sensation is closely related to pain sensation. By using NC/Tnd mice, a unique spontaneous animal model for human AD, we found abnormalities in sensitivity against external stimuli as compared to two standard strains, BALB/c and B6 mice. Particularly, in conventional NC/Tnd mice with AD, stimulation against transient receptor potential (TRP) V1 reduced the scratching behavior, suggesting the possibility of a TRPV1 modulator in the treatment of atopic itch. The review outlines observations regarding itch sensation and skin barrier function in NC/Tnd mice by using a novel itch quantification system for the laboratory animals, which may bring great progress in the future study of itch.

  5. Mechanisms of abnormal lamellar body secretion and the dysfunctional skin barrier in patients with atopic dermatitis.


    Elias, Peter M; Wakefield, Joan S


    I review how diverse inherited and acquired abnormalities in epidermal structural and enzymatic proteins converge to produce defective permeability barrier function and antimicrobial defense in patients with atopic dermatitis (AD). Although best known are mutations in filaggrin (FLG), mutations in other member of the fused S-100 family of proteins (ie, hornerin [hrn] and filaggrin 2 [flg-2]); the cornified envelope precursor (ie, SPRR3); mattrin, which is encoded by TMEM79 and regulates the assembly of lamellar bodies; SPINK5, which encodes the serine protease inhibitor lymphoepithelial Kazal-type trypsin inhibitor type 1; and the fatty acid transporter fatty acid transport protein 4 have all been linked to AD. Yet these abnormalities often only predispose to AD; additional acquired stressors that further compromise barrier function, such as psychological stress, low ambient humidity, or high-pH surfactants, often are required to trigger disease. T(H)2 cytokines can also compromise barrier function by downregulating expression of multiple epidermal structural proteins, lipid synthetic enzymes, and antimicrobial peptides. All of these inherited and acquired abnormalities converge on the lamellar body secretory system, producing abnormalities in lipid composition, secretion, and/or extracellular lamellar membrane organization, as well as antimicrobial defense. Finally, I briefly review therapeutic options that address this new pathogenic paradigm.

  6. Reevaluation of the non-lesional dry skin in atopic dermatitis by acute barrier disruption: an abnormal permeability barrier homeostasis with defective processing to generate ceramide.


    Sugiura, Ayumi; Nomura, Tsuyoshi; Mizuno, Atsuko; Imokawa, Genji


    Atopic dermatitis is characterized by disruption of the cutaneous barrier due to reduced ceramide levels even in non-lesional dry skin. Following further acute barrier disruption by repeated tape strippings, we re-characterized the non-lesional dry skin of subjects with atopic dermatitis, which shows significantly reduced levels of barrier function and ceramide but not of beta-glucocerebrosidase activity. For the first time, we report an abnormal trans-epidermal water loss homeostasis in which delayed recovery kinetics of trans-epidermal water loss occurred on the first day during the 4 days after acute barrier disruption compared with healthy control skin. Interestingly, whereas the higher ceramide level in the stratum corneum of healthy control skin was further significantly up-regulated at 4 days post-tape stripping, the lower ceramide level in the stratum corneum of subjects with atopic dermatitis was not significantly changed. In a parallel study, whereas beta-glucocerebrosidase activity at 4 days post-tape stripping was significantly up-regulated in healthy control skin compared with before tape stripping, the level of that activity remained substantially unchanged in atopic dermatitis. These findings indicate that subjects with atopic dermatitis have a defect in sphingolipid-metabolic processing that generates ceramide in the interface between the stratum corneum and the epidermis. The results also support the notion that the continued disruption of barrier function in atopic dermatitis non-lesional skin is associated with the impaired homeostasis of a ceramide-generating process, which underscores an atopy-specific inflammation-triggered ceramide deficiency that is distinct from other types of dermatitis.

  7. Skin barrier in rosacea.


    Addor, Flavia Alvim Sant'Anna


    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea.

  8. Skin barrier in rosacea*

    PubMed Central

    Addor, Flavia Alvim Sant'Anna


    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  9. Genetics of psoriasis: evidence for epistatic interaction between skin barrier abnormalities and immune deviation.


    Bergboer, Judith G M; Zeeuwen, Patrick L J M; Schalkwijk, Joost


    Psoriasis was until recently regarded as a T-cell-driven disease with presumed (auto)immune mechanisms as its primary cause. This view was supported by clinical data and genetic studies that identified risk factors functioning in adaptive and innate immunity, such as HLA-C*06, ERAP1, the IL-23 pathway, and NF-k B signaling. Candidate gene approaches and genome-wide association studies, however, have identified copy number polymorphisms of the b-defensin cluster and deletion of late cornified envelope (LCE) 3B and 3C genes (LCE3C_LCE3B-del) as psoriasis risk factors.As these genes are expressed in epithelial cells and not by the immune system, these findings may cause a change of paradigm for psoriasis, not unlike the reported filaggrin association that has profoundly changed the views on atopic dermatitis. In addition to genetic polymorphisms of the immune system, genetic variations affecting the skin barrier are likely to contribute to psoriasis. Recent studies have shown epistatic interactions involving HLA-C*06, ERAP1, and LCE3C_LCE3B-del, which makes psoriasis a unique model to investigate genetic and biological interactions of associated genes in a complex disease. We present a model for disease initiation and perpetuation, which integrates the available genetic, immunobiological, and clinical data.

  10. The Role of the Skin Barrier in Occupational Skin Diseases.


    Kasemsarn, Pranee; Bosco, Joanna; Nixon, Rosemary L


    Occupational skin diseases (OSDs) are the second most common occupational diseases worldwide. Occupational contact dermatitis (OCD) is the most frequent OSD, and comprises irritant contact dermatitis (ICD), allergic contact dermatitis (ACD), contact urticaria and protein contact dermatitis. There are many endogenous and exogenous factors which affect the development of OCD, including age, sex, ethnicity, atopic skin diathesis, certain occupations and environmental factors. One of the most important contributing causes is skin barrier dysfunction. The skin provides a first-line defense from environmental assaults and incorporates physical, chemical and biological protection. Skin barrier disturbance plays a crucial role in various skin diseases such as atopic dermatitis (AD), ichthyosis, ICD and ACD. Genetic factors, such as filaggrin gene (FLG) mutations, and external factors, such as skin irritants interfering with stratum corneum structure and composition, may lead to abnormalities in skin barrier function and increased vulnerability to skin diseases. FLG encodes the cornified envelope protein, filaggrin, which is involved in skin barrier function. FLG mutation is associated with the development of OCD. High-risk occupations for OCD include health care workers, hairdressers and construction workers. There are often multiple contributing causes to OCD, as workers are exposed to both irritants and allergens. AD is also associated with skin barrier disruption and plays an important role in OCD. ICD often precedes and facilitates the development of ACD, with impairment of the skin barrier contributing to the concurrence of ICD and ACD in many workers with OCD.

  11. Skin Barrier Function

    PubMed Central

    Elias, Peter M.


    Like other inflammatory dermatoses, the pathogenesis of atopic dermatitis (AD) has been largely attributed to abnormalities in adaptive immunity. T helper (Th) cell types 1 and 2 cell dysregulation, IgE production, mast cell hyperactivity, and dendritic cell signaling are thought to account for the chronic, pruritic, and inflammatory dermatosis that characterizes AD. Not surprisingly, therapy has been directed toward ameliorating Th2-mediated inflammation and pruritus. Here, we review emerging evidence that inflammation in AD occurs downstream to inherited and acquired insults to the barrier. Therapy based upon this new view of pathogenesis should emphasize approaches that correct the primary abnormality in barrier function, which drives downstream inflammation and allows unrestricted antigen access. PMID:18606081

  12. Treatments Improving Skin Barrier Function.


    Lodén, Marie


    Moisturizers affect the stratum corneum architecture and barrier homeostasis, i.e. topically applied ingredients are not as inert to the skin as one might expect. A number of different mechanisms behind the barrier-influencing effects of moisturizers have been suggested, such as simple deposition of lipid material outside the skin. Ingredients in the moisturizers may also change the lamellar organization and the packing of the lipid matrix and thereby skin permeability. Topically applied substances may also penetrate deeper into the skin and interfere with the production of barrier lipids and the maturation of corneocytes. Furthermore, moisturizing creams may influence the desquamatory proteases and alter the thickness of the stratum corneum.

  13. Filaggrin and Skin Barrier Function.


    Kezic, Sanja; Jakasa, Ivone


    The skin barrier function is greatly dependent on the structure and composition of the uppermost layer of the epidermis, the stratum corneum (SC), which is made up of flattened anucleated cells surrounded by highly organized and continuous lipid matrix. The interior of the corneocytes consists mainly of keratin filaments aggregated by filaggrin (FLG) protein. Next, together with several other proteins, FLG is cross-linked into a mechanically robust cornified cell envelope providing a scaffold for the extracellular lipid matrix. In addition to its role for the SC structural and mechanical integrity, FLG degradation products account in part for the water-holding capacity and maintenance of acidic pH of the SC, both crucial for the epidermal barrier homoeostasis by regulating activity of multiple enzymes that control desquamation, lipid synthesis and inflammation. The major determinant of FLG expression in the skin are loss-of-function mutations in FLG, the strongest genetic risk factor for atopic dermatitis (AD), an inflammatory skin disease characterized by a reduced skin barrier function. The prevalence of FLG mutations varies greatly among different populations and ranges from about 10% in Northern Europeans to less than 1% in the African populations. An impaired skin barrier facilitates absorption of potentially hazardous chemicals, which might cause adverse effects in the skin, such as contact dermatitis, or systemic toxicity after their passage into blood. In another direction, a leaky epidermal barrier will lead to enhanced loss of water from the skin. A recent study has shown that even subtle increase in epidermal water loss in newborns increases the risk for AD. Although there are multiple modes of action by which FLG might affect skin barrier it is still unclear whether and how FLG deficiency leads to the reduced skin barrier function. This chapter summarizes the current knowledge in this field obtained from clinical studies, and animal and in vitro models

  14. Irritants and Skin Barrier Function.


    Angelova-Fischer, Irena


    The barrier response to irritant challenge involves complex biologic events and can be modulated by various environmental, exposure and host-related factors. Irritant damage to the epidermal barrier elicits a cascade of homeostatic or pathologic responses that could be investigated by both in vitro and in vivo methods providing different information at biochemical and functional level. The present chapter summarizes the changes in key barrier function parameters following irritant exposure with focus on experimental controlled in vivo human skin studies.

  15. Standards for the Protection of Skin Barrier Function.


    Giménez-Arnau, Ana


    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function.

  16. Skin - abnormally dark or light


    ... Endocrine diseases such as Addison disease Hemochromatosis (iron overload) Sun exposure Pregnancy Causes of hypopigmentation include: Skin ... to achieve this important distinction for online health information and services. Learn more about A.D.A. ...

  17. Skin Barrier Function and Allergens.


    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan


    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization (CS) and allergy following increased penetration of potential allergens. However, the relationship between common dermatoses such as psoriasis, atopic dermatitis (AD) and irritant contact dermatitis (ICD) and the development of contact allergy (CA) is complex, and depends on immunologic responses and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due to increased levels of Th17 cells and its associated cytokines. As for AD, a positive association to CS has been established in epidemiological studies, but is still unresolved. Experimental studies show, however, an inverse relationship between AD and CS. The opposing and antagonistic influences of Th1 (CS) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen-presenting cells and promotes their migration to local lymph nodes, thus increasing the probability of CS and ultimately the development of CA.

  18. The Infant Skin Barrier: Can We Preserve, Protect, and Enhance the Barrier?

    PubMed Central

    Telofski, Lorena S.; Morello, A. Peter; Mack Correa, M. Catherine; Stamatas, Georgios N.


    Infant skin is different from adult in structure, function, and composition. Despite these differences, the skin barrier is competent at birth in healthy, full-term neonates. The primary focus of this paper is on the developing skin barrier in healthy, full-term neonates and infants. Additionally, a brief discussion of the properties of the skin barrier in premature neonates and infants with abnormal skin conditions (i.e., atopic dermatitis and eczema) is included. As infant skin continues to mature through the first years of life, it is important that skin care products (e.g., cleansers and emollients) are formulated appropriately. Ideally, products that are used on infants should not interfere with skin surface pH or perturb the skin barrier. For cleansers, this can be achieved by choosing the right type of surfactant, by blending surfactants, or by blending hydrophobically-modified polymers (HMPs) with surfactants to increase product mildness. Similarly, choosing the right type of oil for emollients is important. Unlike some vegetable oils, mineral oil is more stable and is not subject to oxidation and hydrolysis. Although emollients can improve the skin barrier, more studies are needed to determine the potential long-term benefits of using emollients on healthy, full-term neonates and infants. PMID:22988452

  19. Skin barrier in atopic dermatitis: beyond filaggrin*

    PubMed Central

    Zaniboni, Mariana Colombini; Samorano, Luciana Paula; Orfali, Raquel Leão; Aoki, Valéria


    Atopic dermatitis is a chronic inflammatory skin disease with a complex pathogenesis, where changes in skin barrier and imbalance of the immune system are relevant factors. The skin forms a mechanic and immune barrier, regulating water loss from the internal to the external environment, and protecting the individual from external aggressions, such as microorganisms, ultraviolet radiation and physical trauma. Main components of the skin barrier are located in the outer layers of the epidermis (such as filaggrin), the proteins that form the tight junction (TJ) and components of the innate immune system. Recent data involving skin barrier reveal new information regarding its structure and its role in the mechanic-immunological defense; atopic dermatitis (AD) is an example of a disease related to dysfunctions associated with this complex. PMID:27579743

  20. Skin barrier defects in atopic dermatitis.


    Agrawal, Rachana; Woodfolk, Judith A


    Atopic dermatitis (AD) is a chronic inflammatory skin condition with complex etiology that is dependent upon interactions between the host and the environment. Acute skin lesions exhibit the features of a Th2-driven inflammatory disorder, and many patients are highly atopic. The skin barrier plays key roles in immune surveillance and homeostasis, and in preventing penetration of microbial products and allergens. Defects that compromise the structural integrity or else the immune function of the skin barrier play a pivotal role in the pathogenesis of AD. This article provides an overview of the array of molecular building blocks that are essential to maintaining healthy skin. The basis for structural defects in the skin is discussed in relation to AD, with an emphasis on filaggrin and its genetic underpinnings. Aspects of innate immunity, including the role of antimicrobial peptides and proteases, are also discussed.

  1. Ceramides and barrier function in healthy skin.


    Mutanu Jungersted, Jakob; Hellgren, Lars I; Høgh, Julie K; Drachmann, T; Jemec, Gregor B E; Agner, Tove


    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found for men than for women (p = 0.02).

  2. Solar UV radiation reduces the barrier function of human skin.


    Biniek, Krysta; Levi, Kemal; Dauskardt, Reinhold H


    The ubiquitous presence of solar UV radiation in human life is essential for vitamin D production but also leads to skin photoaging, damage, and malignancies. Photoaging and skin cancer have been extensively studied, but the effects of UV on the critical mechanical barrier function of the outermost layer of the epidermis, the stratum corneum (SC), are not understood. The SC is the first line of defense against environmental exposures like solar UV radiation, and its effects on UV targets within the SC and subsequent alterations in the mechanical properties and related barrier function are unclear. Alteration of the SC's mechanical properties can lead to severe macroscopic skin damage such as chapping and cracking and associated inflammation, infection, scarring, and abnormal desquamation. Here, we show that UV exposure has dramatic effects on cell cohesion and mechanical integrity that are related to its effects on the SC's intercellular components, including intercellular lipids and corneodesmosomes. We found that, although the keratin-controlled stiffness remained surprisingly constant with UV exposure, the intercellular strength, strain, and cohesion decreased markedly. We further show that solar UV radiation poses a double threat to skin by both increasing the biomechanical driving force for damage while simultaneously decreasing the skin's natural ability to resist, compromising the critical barrier function of the skin.

  3. Stratum corneum barrier integrity controls skin homeostasis.


    Smith, W


    The stratum corneum water barrier controls structural and functional properties of both the epidermis and the dermis. Treatments which chronically disrupt the stratum corneum water barrier can induce changes similar to those seen with 'anti-aging' treatments such as (-Hydroxy acids (AHAs) and Retin Atrade mark. Barrier disruption via daily tape stripping increases epidermal and dermal thickness, superficial and integral skin firmness, and improves skin surface texture. Modest or transitory disruption did not produce such effects. Similar results were observed with topical application of AHAs, retinoids or mild irritants after about 4-6 weeks provided such treatments resulted in prolonged elevation in TEWL (trans-epidermal water loss). Treatments that did not chronically elevate TEWL could also produce positive cosmetic effects, but such effects were in general restricted to the skin surface or epidermis. Irritation, which was observed with some treatments, was not solely responsible for the positive effects observed.

  4. Matching the skin barrier to the skin type.


    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  5. Attachment, skin deep? Relationships between adult attachment and skin barrier recovery.


    Robles, Theodore F; Brooks, Kathryn P; Kane, Heidi S; Schetter, Christine Dunkel


    This study examined the relationship between individual differences in adult attachment and skin barrier recovery. Dating couples (N = 34) completed a self-report measure of attachment anxiety and avoidance, and during two separate laboratory visits, normal skin barrier function was disrupted using a tape-stripping procedure, followed by a 20 min discussion of personal concerns in one visit and relationship problems in the other, counterbalanced randomly across visits. Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 h after skin disruption. Multilevel modeling showed that skin barrier recovery did not differ between the personal concern or relationship problem discussions. Among women, greater attachment anxiety predicted faster skin barrier recovery across the two visits, while greater attachment avoidance predicted slower skin barrier recovery. Among men, greater attachment anxiety predicted slower skin barrier recovery during the personal concern discussion only. The observed effects remained significant after controlling for transepidermal water loss in undisturbed skin, suggesting that the relationship between attachment security and skin barrier recovery was not due to other skin-related factors like sweating. Cortisol changes, self-reported emotions, stress appraisals, and supportiveness ratings were tested as potential mediators, and none explained the relationships between attachment and skin barrier recovery. These findings are the first to demonstrate associations between individual differences in attachment style and restorative biological processes in the skin, even in a sample of young dating couples in satisfied relationships.

  6. Influence of skin penetration enhancers on skin barrier function and skin protease activity.


    Mohammed, Diar; Hirata, Kazumasa; Hadgraft, Jonathan; Lane, Majella E


    In order to overcome the skin's excellent barrier function formulation scientists often employ skin penetration enhancers (SPEs) in topical and transdermal formulations. The effects of these compounds on skin health is still not well understood at the molecular level. The aim of the present work was to probe the effects of some common SPEs on desquamatory protease activity in healthy skin. The SPEs studied were isopropyl myristate (IPM), propylene glycol, (PG), propylene glycol laurate (PGL) and Transcutol™ (TC). Occluded infinite doses of each SPE were applied to human volunteers for 24 h. Transepidermal water loss (TEWL) measurements were taken before and after application of SPEs. Tape strips were collected from the treated sites to determine protein content and the activity of two desquamatory proteases kallikrein 5 (KLK5) and kallikrein 7 (KLK7). TEWL values were also measured after tape stripping. PG was found to elevate both TEWL values and KLK7 activity to a significant extent (p<0.05). No significant effects were observed for the other SPEs. The ability of PG to alter the skin barrier at the macroscopic level and the influence of the molecule on protease activity reported here may have implications for its use in topical formulations used for the management of impaired skin barrier function such as atopic eczema or psoriasis.

  7. Using FLIM in the study of permeability barrier function of aged and young skin

    NASA Astrophysics Data System (ADS)

    Xu, P.; Choi, E. H.; Man, M. Q.; Crumrine, D.; Mauro, T.; Elias, P.


    Aged skin commonly is afflicted by inflammatory skin diseases or xerosis/eczema that can be triggered or exacerbated by impaired epidermal permeability barrier homeostasis. It has been previously described a permeability barrier defect in humans of advanced age (> 75 years), which in a murine analog >18 mos, could be attributed to reduced lipid synthesis synthesis. However, the functional abnormality in moderately aged mice is due not to decreased lipid synthesis, but rather to a specific defect in stratum corneum (SC) acidification causing impaired lipid processing processing. Endogenous Na +/H + antiporter (NHE1) level was found declined in moderately aged mouse epidermis. This acidification defect leads to perturbed permeability barrier homeostasis through more than one pathways, we addressed suboptimal activation of the essential, lipid-processing enzyme, β-glucocerebrosidase (BGC) is linked to elevated SC pH. Finally, the importance of the epidermis acidity is shown by the normalization of barrier function after exogenous acidification of moderately aged skin.

  8. New treatments for restoring impaired epidermal barrier permeability: skin barrier repair creams.


    Draelos, Zoe Diana


    Skin health depends on an intact barrier composed of protein-rich corneocytes surrounded by the lamellar intercellular lipids. This barrier provides waterproof protection for the body, preventing infection, regulating electrolyte balance, maintaining body temperature, and providing a mechanism for sensation. Damage to the skin barrier results in skin disease that can be treated by a variety of externally applied substances, such as ceramides, hyaluronic acid, licorice extracts, dimethicone, petrolatum, and paraffin wax. These substances are found in moisturizers that are sold as cosmetics and in prescriptions as 510(k) devices. This contribution examines the formulation and effect of skin barrier creams.

  9. A study on the quantitative evaluation of skin barrier function

    NASA Astrophysics Data System (ADS)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko


    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  10. Epidermal Permeability Barrier (EPB) measurement in mammalian skin

    PubMed Central

    Indra, Arup Kumar; Leid, Mark


    A defective skin epidermal permeability barrier (EPB) is responsible for a high mortality rate in premature infants, and is an important risk factor in inflammatory skin diseases such as eczema. We report here fast and accurate methods for measurement of EPB in animal models or in human patients using simple techniques that monitor diffusion of dyes (X-Gal or Lucifer Yellow) through the upper epidermis and measure transepidermal water loss (TEWL) resulting from a defective skin barrier. Accurate diagnosis and early detection of EPB defects in human patients are critical for effective treatment of certain classes of inflammatory skin diseases. PMID:21874444

  11. An update of the defensive barrier function of skin.


    Lee, Seung Hun; Jeong, Se Kyoo; Ahn, Sung Ku


    Skin, as the outermost organ in the human body, continuously confronts the external environment and serves as a primary defense system. The protective functions of skin include UV-protection, anti-oxidant and antimicrobial functions. In addition to these protections, skin also acts as a sensory organ and the primary regulator of body temperature. Within these important functions, the epidermal permeability barrier, which controls the transcutaneous movement of water and other electrolytes, is probably the most important. This permeability barrier resides in the stratum corneum, a resilient layer composed of corneocytes and stratum corneum intercellular lipids. Since the first realization of the structural and biochemical diversities involved in the stratum corneum, a tremendous amount of work has been performed to elucidate its roles and functions in the skin, and in humans in general. The perturbation of the epidermal permeability barrier, previously speculated to be just a symptom involved in skin diseases, is currently considered to be a primary pathophysiologic factor for many skin diseases. In addition, much of the evidence provides support for the idea that various protective functions in the skin are closely related or even co-regulated. In this review, the recent achievements of skin researchers focusing on the functions of the epidermal permeability barrier and their importance in skin disease, such as atopic dermatitis and psoriasis, are introduced.

  12. An Update of the Defensive Barrier Function of Skin

    PubMed Central

    Jeong, Se Kyoo; Ahn, Sung Ku


    Skin, as the outermost organ in the human body, continuously confronts the external environment and serves as a primary defense system. The protective functions of skin include UV-protection, anti-oxidant and antimicrobial functions. In addition to these protections, skin also acts as a sensory organ and the primary regulator of body temperature. Within these important functions, the epidermal permeability barrier, which controls the transcutaneous movement of water and other electrolytes, is probably the most important. This permeability barrier resides in the stratum corneum, a resilient layer composed of corneocytes and stratum corneum intercellular lipids. Since the first realization of the structural and biochemical diversities involved in the stratum corneum, a tremendous amount of work has been performed to elucidate its roles and functions in the skin, and in humans in general. The perturbation of the epidermal permeability barrier, previously speculated to be just a symptom involved in skin diseases, is currently considered to be a primary pathophysiologic factor for many skin diseases. In addition, much of the evidence provides support for the idea that various protective functions in the skin are closely related or even co-regulated. In this review, the recent achievements of skin researchers focusing on the functions of the epidermal permeability barrier and their importance in skin disease, such as atopic dermatitis and psoriasis, are introduced. PMID:16807977

  13. The antimicrobial skin barrier in patients with atopic dermatitis.


    Schittek, Birgit


    Keratinocytes represent the major cell population in the epithelial skin barrier and actively participate in innate immune responses by recognizing pathogenic microorganisms, followed by a fine-tuned production of cytokines, chemokines and antimicrobial peptides or proteins (AMPs). Patients with atopic dermatitis (AD) suffer from a defective permeability barrier which favors pathogen infection indicating that the permeability and antimicrobial barrier functions are interdependent. Several early studies showed that the inducible AMPs LL-37, HBD-2 and HBD-3 are expressed at lower levels in atopic skin compared to psoriatic skin. However, recent data indicate that AMP induction is not compromised in AD patients and that several AMPs are expressed at significantly higher amounts in AD compared to healthy skin. AD patients have an increased susceptibility to Staphylococcus aureus skin infection suggesting that AMP levels expressed by keratinocytes of AD patients might not be sufficient to combat pathogenic skin infection or that AMP function is disturbed. Increasing AMP expression in AD skin and repairing the skin barrier defect might have a therapeutic effect in AD patients enabling the skin to mount an enhanced response to pathogens.

  14. Skin barrier breakdown: a renaissance in emollient therapy.


    Cork, Michael J; Danby, Simon

    Breakdown of the skin barrier is the first event in the development of atopic eczema (atopic dermatitis). Research over the past five years has indicated that this arises as a result of the interaction of environmental agents such as soap and other detergents with the products of changes in several genes. These genetic changes predispose to the breakdown of the skin barrier, which allows the penetration of allergens, triggering a flare of atopic eczema. This new understanding of how breakdown of the skin barrier is the first event in the development of atopic eczema provides a rationale for a renaissance in the use of a complete emollient therapy regimen in atopic eczema and related skin barrier breakdown diseases, such as asteatotic eczema and irritant contact dermatitis.

  15. Fixing the skin barrier: past, present and future--man and dog compared.


    Marsella, Rosanna


    Skin barrier dysfunction exists in both human and canine atopic dermatitis, leading to increased water loss and potentially facilitating allergen penetration and sensitization. Both lipid (e.g. ceramides) and protein (e.g. filaggrin) abnormalities have been described. Some are genetically inherited (e.g. filaggrin mutations are one of the major risk factors in humans) and some are secondary and linked to inflammation. In humans, numerous studies have shown efficacy of emollients and moisturizers in barrier restoration, and this approach has been for years the mainstay of therapy. Recently, this strategy has shown promise as a preventative function. In veterinary medicine, evidence regarding skin barrier impairment is rapidly building. Decreased ceramides and filaggrin (in some subsets of dogs) have been described. Altered metabolism of ceramides has also been proposed. Despite these preliminary data and the availability of products marketed to improve the skin barrier, evidence regarding the clinical benefit of skin repair intervention is still limited. Preliminary studies have demonstrated that topical application of fatty acids and ceramides and systemic administration of fatty acids improve lipid deficiencies in the skin of dogs with atopic dermatitis, but limited clinical evidence exists. Disease remission in humans is paralleled by an improved skin barrier, both with calcineurin inhibitors and glucocorticoids. In veterinary medicine, a preliminary study on ciclosporin and prednisone failed to detect significant improvement of water loss, while successful immunotherapy correlated with an improved skin barrier. Controlled, large studies are needed to address the question of which skin repair approach is clinically most effective and whether this can be used as a preventative strategy.

  16. Unexpected skin barrier influence from nonionic emulsifiers.


    Bárány, E; Lindberg, M; Lodén, M


    Skin disorders are often treated with creams containing various active substances. The creams also contain emulsifiers, which are surface-active ingredients used to stabilize the emulsion. Emulsifiers are potential irritants and in the present study the influence of stearic acid, glyceryl stearate, PEG-2, -9, -40, and -100 stearate, steareth-2, -10 and -21 on normal as well as on irritated skin have been evaluated with non-invasive measurements. Test emulsions were created by incorporating 5% emulsifiers in a water/mineral oil mixture (50:50). The emulsions and their vehicle were then applied to normal skin for 48 h and to sodium lauryl sulfate (SLS) damaged skin for 17 h in aluminum chambers. Twenty-four hours after removal of the chambers the test sites were evaluated for degree of irritation. In normal skin, the emulsifiers induced significant differences in TEWL but not in skin blood flow. Five of the emulsifiers increased TEWL. In SLS-damaged skin an aggravation of the irritation was expected. However, no differences regarding skin blood flow was noted from the emulsifiers. Furthermore, three emulsifiers unexpectedly decreased TEWL. These results highlight the possibility of absorption of these emulsifiers into the lipid bilayer, which increase TEWL in normal skin and decrease TEWL in damaged skin.

  17. A long-standing hyperglycaemic condition impairs skin barrier by accelerating skin ageing process.


    Park, Hwa-Young; Kim, Jae-Hong; Jung, Minyoung; Chung, Choon Hee; Hasham, Rosnani; Park, Chang Seo; Choi, Eung Ho


    Uncontrolled chronic hyperglycaemia including type 2 diabetes mellitus (DM) induces many skin problems related to chronic impaired skin barrier state. However, little is known about the skin barrier state of chronic hyperglycaemia patients, the dysfunction of which may be a major cause of their skin problems. In this study, we investigated whether a long-standing hyperglycaemic condition including type 2 DM impairs skin barrier homoeostasis in proportion to the duration and its pathomechanism. We utilized the Otsuka Long-Evans Tokushima Fatty (OLETF) rats as an animal model of long-standing hyperglycaemia and Long-Evans Tokushima Otsuka rats as a control strain. We confirmed that a long-standing hyperglycaemia delayed skin barrier homoeostasis, which correlated with haemoglobin A1c levels. OLETF rats as a long-standing hyperglycaemia model exhibited decreased epidermal lipid synthesis and antimicrobial peptide expression with increasing age. Decreased epidermal lipid synthesis accounted for decreased lamellar body production. In addition, OLETF rats had significantly higher serum levels of advanced glycation end products (AGEs) and elevated levels of the receptor for AGE in the epidermis. A long-standing hyperglycaemic condition impairs skin barrier function including permeability and antimicrobial barriers by accelerating skin ageing process in proportion to the duration of hyperglycaemia, which could be a major pathophysiology underlying cutaneous complications of DM.

  18. Effect of glove occlusion on the skin barrier.


    Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe; Angelova-Fischer, Irena; Kezic, Sanja; Agner, Tove


    Wet work tasks are the most common exposures leading to occupational irritant contact dermatitis. Use of liquid-proof gloves is recommended when performing wet work, however, gloves may also contribute to impairment of the skin barrier and development of irritant contact dermatitis. The aim of this study is to review the literature on the effects of glove occlusion on skin barrier function. The PubMed database was searched up to 1 February 2015 for articles on the association between glove occlusion and skin barrier function, including human studies only and in English. Only experimental studies including assessment of the skin barrier function were included in the data analysis. Thirteen articles were identified, 8 with focus on occlusion alone, 7 with focus on occlusion in combination with irritant exposure (some overlapping), and 2 field studies. In conclusion, data from the literature showed that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused by detergents/soaps in a dose-response fashion.

  19. Sebaceous gland, hair shaft, and epidermal barrier abnormalities in keratosis pilaris with and without filaggrin deficiency.


    Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M; Mauldin, Elizabeth A; Thyssen, Jacob P; Brandner, Johanna M; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M


    Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities.

  20. Sebaceous Gland, Hair Shaft, and Epidermal Barrier Abnormalities in Keratosis Pilaris with and without Filaggrin Deficiency

    PubMed Central

    Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.


    Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180

  1. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation.


    Chidgey, M; Brakebusch, C; Gustafsson, E; Cruchley, A; Hail, C; Kirk, S; Merritt, A; North, A; Tselepis, C; Hewitt, J; Byrne, C; Fassler, R; Garrod, D


    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation.

  2. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.


    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo


    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  3. Unravelling the skin barrier: a new paradigm for atopic dermatitis and house dust mites.


    Marsella, Rosanna; Samuelson, Don


    Atopic dermatitis (AD) is a chronic relapsing inflammatory skin disease caused by complex interactions between genetics and environmental factors. In human beings, impairment of the skin barrier is demonstrated and thought to be responsible for enhanced penetration of allergens and increased risk for allergic sensitization. Once inflammation is triggered, further impairment of the skin barrier occurs, leading to self-perpetuating cycles of sensitizations. Canine AD appears to share many similarities with the human counterpart, clinically and immunologically. It is hypothesized that a primary defect of skin barrier function also exists in subsets of atopic dogs (e.g. in an experimental model using high IgE-producing beagles), particularly in young dogs, and in sites predisposed to the development of lesions. This impairment is present in clinically normal skin, worsens with development of lesions and can be quantified by measurement of transepidermal water loss. Therefore, the distribution of lesions in AD may be linked to a primary skin barrier defect in those sites and not simply due to contact with allergens, and increased susceptibility to penetration of allergen may exist early in life. Ultrastructurally, transmission electron microscopy reveals that clinically normal skin in atopic dogs has abnormalities in lamellar body secretion and extracellular lamellar bilayer structure when compared with normal dogs. Development of lesions worsens these changes (e.g. widening of intercellular spaces, release of lamellar bodies, and disorganization of lipid lamellae). It is proposed that the paradigm of canine AD as primarily due to immunologic aberration ('inside/outside') should be shifted to include a primary defect in barrier function ('outside/inside').

  4. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.


    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W


    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized.

  5. Harlequin ichthyosis model mouse reveals alveolar collapse and severe fetal skin barrier defects.


    Yanagi, Teruki; Akiyama, Masashi; Nishihara, Hiroshi; Sakai, Kaori; Nishie, Wataru; Tanaka, Shinya; Shimizu, Hiroshi


    Harlequin ichthyosis (HI), which is the most severe genodermatosis, is caused by loss-of-function mutations in ABCA12, a member of the ATP-binding cassette transporter family. To investigate the pathomechanism of HI and the function of the ABCA12 protein, we generated ABCA12-deficient mice (Abca12(-/-)) by targeting Abca12. Abca12(-/-) mice closely reproduce the human HI phenotype, showing marked hyperkeratosis with eclabium and skin fissure. Lamellar granule abnormalities and defective ceramide distribution were remarkable in the epidermis. Skin permeability assay of Abca12(-/-) fetuses revealed severe skin barrier dysfunction after the initiation of keratinization. Surprisingly, the Abca12(-/-) mice also demonstrated lung alveolar collapse immediately after birth. Lamellar bodies in alveolar type II cells of the Abca12(-/-) mice lacked normal lamellar structures. The level of surfactant protein B, an essential component of alveolar surfactant, was reduced in the Abca12(-/-) mice. Fetal therapeutic trials with systemic administration of retinoid or dexamethasone, which are effective for HI and respiratory distress, respectively, to the pregnant mother mice neither improved the skin phenotype nor extended the survival period. Our HI model mice reproduce the human HI skin phenotype soon after the initiation of fetal skin keratinization and provide evidence that ABCA12 plays pivotal roles in lung and skin barrier functions.

  6. Short-chain ceramides decrease skin barrier properties.


    Novotný, J; Janůsová, B; Novotný, M; Hrabálek, A; Vávrová, K


    Stratum corneum ceramides are major determinants of skin barrier function. Although their physiological and pathological role has been widely investigated, to date no structure-activity relationships have been established. In this study, a series of short-chain ceramide analogues with polar head structure identical to ceramide NS, a sphingosine length of 12 carbons and an acyl chain length of 2-12 carbons was synthesized. Their effect on skin permeability was evaluated using porcine skin and two model drugs, theophylline and indomethacin, and compared to that of a physiological ceramide NS. The results showed that the ceramide chain length was crucial for their barrier properties. Ceramides with a 4- to 8-carbon acyl chain were able to increase skin permeability for both drugs up to 10.8 times with maximum effect at a 6-carbon acyl chain. No increase in permeability was found for ceramide analogues with 2- and 12-carbon acyl chains and ceramide NS. The same relationships were obtained for skin concentrations of the model drugs. The relationship between ceramide acyl chain length and its ability to perturb skin barrier showed striking similarity to the behavior of short-chain ceramides in sphingomyelin/phospholipid membranes and confirmed that short-chain ceramides do not act as natural ceramides and their use as experimental tools should be cautious.

  7. Effect of microplasma irradiation on skin barrier function

    NASA Astrophysics Data System (ADS)

    Shimizu, Kazuo; Tran, An N.; Blajan, Marius


    In this paper, we introduce the feasibility of atmospheric-pressure argon microplasma irradiation (AAMI) to promote percutaneous absorption. A hairless Yucatan micropig skin was used for this ex vivo study. After AAMI, the disturbance in the stratum corneum (SC) lipids was observed using attenuated total reflectance-Fourier transform infrared spectroscopy. Also, an increase in transepidermal water loss and no physical damage on pig skins were confirmed by microscopic observation. These results of AAMI were compared with those of a plasma jet irradiation (PJI) and a tape stripping test (TST) leading to the conclusion that AAMI reduces the barrier function of the skin and could also enhance the transdermal absorption of drugs.


    PubMed Central

    Man, Mao-Qiang; Lin, Tzu-Kai; Santiago, Juan Luis; Celli, Anna; Zhong, Lily; Huang, Zhi-Ming; Roelandt, Truus; Hupe, Melanie; Sundberg, John P.; Silva, Kathleen A.; Crumrine, Debra; Martin-Ezquerra, Gemma; Trullas, Carles; Sun, Richard; Wakefield, Joan S.; Wei, Maria L.; Feingold, Kenneth R.; Mauro, Theodora M.; Elias, Peter M.


    Humans with darkly-pigmented skin display superior permeability barrier function in comparison to humans with lightly-pigmented skin. The reduced pH of the stratum corneum (SC) of darkly-pigmented skin could account for enhanced function, because acidifying lightly-pigmented human SC resets barrier function to darkly-pigmented levels. In SKH1 (non-pigmented) vs. SKH2/J (pigmented) hairless mice, we evaluated how a pigment-dependent reduction in pH could influence epidermal barrier function. Permeability barrier homeostasis is enhanced in SKH2/J vs. SKH1 mice, correlating with a reduced pH in the lower SC that co-localizes with the extrusion of melanin granules. Darkly-pigmented human epidermis also shows substantial melanin extrusion in the outer epidermis. Both acute barrier disruption and topical basic pH challenges accelerate re-acidification of SKH2/J (but not SKH1) SC, while inducing melanin extrusion. SKH2/J mice also display enhanced expression of the SC acidifying enzyme, secretory phospholipase A2f (sPLA2f). Enhanced barrier function of SKH2/J mice could be attributed to enhanced activity of two acidic pH-dependent, ceramide-generating enzymes, β-glucocerebrosidase and acidic sphingomyelinase, leading to accelerated maturation of SC lamellar bilayers. Finally, organotypic cultures of darkly-pigmented-bearing human keratinocytes display enhanced barrier function in comparison to lightly-pigmented cultures. Together, these results suggest that the superior barrier function of pigmented epidermis can be largely attributed to the pH-lowering impact of melanin persistence/extrusion and enhanced sPLA2f expression. PMID:24732399

  9. Increased retinoic acid levels through ablation of Cyp26b1 determine the processes of embryonic skin barrier formation and peridermal development.


    Okano, Junko; Lichti, Ulrike; Mamiya, Satoru; Aronova, Maria; Zhang, Guofeng; Yuspa, Stuart H; Hamada, Hiroshi; Sakai, Yasuo; Morasso, Maria I


    The process by which the periderm transitions to stratified epidermis with the establishment of the skin barrier is unknown. Understanding the cellular and molecular processes involved is crucial for the treatment of human pathologies, where abnormal skin development and barrier dysfunction are associated with hypothermia and perinatal dehydration. For the first time, we demonstrate that retinoic acid (RA) levels are important for periderm desquamation, embryonic skin differentiation and barrier formation. Although excess exogenous RA has been known to have teratogenic effects, little is known about the consequences of elevated endogenous retinoids in skin during embryogenesis. Absence of cytochrome P450, family 26, subfamily b, polypeptide 1 (Cyp26b1), a retinoic-acid-degrading enzyme, results in aberrant epidermal differentiation and filaggrin expression, defective cornified envelopes and skin barrier formation, in conjunction with peridermal retention. We show that these alterations are RA dependent because administration of exogenous RA in vivo and to organotypic skin cultures phenocopy Cyp26b1(-/-) skin abnormalities. Furthermore, utilizing the Flaky tail (Ft/Ft) mice, a mouse model for human ichthyosis, characterized by mutations in the filaggrin gene, we establish that proper differentiation and barrier formation is a prerequisite for periderm sloughing. These results are important in understanding pathologies associated with abnormal embryonic skin development and barrier dysfunction.

  10. The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.


    Del Rosso, James Q; Kircik, Leon H


    Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

  11. Skin barrier dysfunction and systemic sensitization to allergens through the skin.


    Strid, Jessica; Strobel, Stephan


    Most allergic, atopic and hypersensitive reactions are associated with Th2-biased immune responses and allergen-specific IgE antibodies. Pathological allergic disorders are on an alarming increase in the industrialized world. Understanding the mechanism of primary sensitization to allergens is important in elucidating the pathogenesis of these diseases and for possibly preventing their development. In this article, we review recent information supporting that epidermal allergen exposure may contribute to systemic allergic diseases and that atopy may be secondary to skin barrier dysfunction in some dermatoses. The skin is an active immunological organ, which functions as a primary defence and biosensor to the external environment. The critical permeability barrier function is mediated by the outmost layer of the epidermis, the stratum corneum. Perturbation of the stratum corneum initiates a chain of event, which activates homeostatic responses in the underlying epidermis. Repeated barrier-disruption, whether environmentally or genetically determined, may however stimulate signaling cascades that lead to inflammation and epidermal hyperplasia. Skin barrier dysfunction may also allow entry of allergens, which can lead to primary systemic sensitization. The altered epidermal microenvironment in barrier-disrupted skin appears to be particularly well suited for the induction of potent Th2-type responses with production of allergen-specific IgE. Epidermal exposure to food antigens can prevent the normal induction of oral tolerance and also lead to airway eosinophilia following inhalation. Exposure to allergens on barrier-disrupted skin may as such serve as a natural sensitization pathway for food allergy and respiratory allergic disease.

  12. A controlled, three-part trial to investigate the barrier function and skin hydration properties of six skin protectants.


    Hoggarth, Andrew; Waring, Mike; Alexander, James; Greenwood, Amanada; Callaghan, Theresa


    In the treatment of incontinence dermatitis, a skin protectant primarily prevents skin breakdown due to moisture and biological irritants in urine and feces. To assess the barrier and skin hydration properties of six currently available skin protectants with different formulations, a controlled, three-phase study was conducted at a research facility in the UK among 18 healthy volunteers. The study addressed each product's efficacy against insult from a known irritant (sodium lauryl sulphate), skin hydration potential, and maintenance of skin barrier and barrier efficacy against maceration. Using white petrolatum (glycerin) as the positive control and untreated sites as the negative control, the results show that each one of the products tested has different performance properties. Products containing petrolatum demonstrated protection against irritants (P = 0.006 at 24 hours) and maceration (P < 0.005) and provided some skin hydration. Products containing dimethicone varied in protection against irritants (P < 0.005, or P > or = 0.806 at 24 hours) and have good skin hydration potential and low barrier efficacy (P > 0.500). Zinc oxide-based products showed protection against irritants (P < 0.005) but poor skin hydration and barrier properties to prevent maceration (P = 0.262). Overall, only the water-in-oil petrolatum- based product performed effectively within all the parameters tested. This study suggests that skin barrier protection involves more than the inclusion of an active barrier ingredient. Further testing and use of barrier products in the clinical setting will provide additional evidence for appropriate product selection.

  13. Effect of Skin-To-Skin Contact on Preterm Infant Skin Barrier Function and Hospital-Acquired Infection

    PubMed Central

    Abouelfettoh, Amel; Ludington-Hoe, Susan M.; Burant, Chris J.; Visscher, Marty O.


    Background The preterm infants' skin is structurally and functionally immature at birth because of immature stratum corneum barrier function, leading to problems with fluid loses, thermoregulation, and infection. Two parameters of barrier function can be non-invasively assessed: Stratum Corneum Hydration (SCH) and Transepidermal Water Loss (TEWL). Skin-to-Skin Care (SSC) is the proposed independent variable that might affect barrier function by decreasing TEWL and increasing SCH, thereby improving stratum corneum barrier function and consequently decreasing the rate of infection. No study of SSC's effects on TEWL and SCH of preterm infants could be found. The purpose of the study was to determine the effect of 5 daily Skin-to-Skin Contact sessions on infant skin hydration (SCH), transepidermal evaporated water loss (TEWL), and on SCH when TEWL was controlled, and on the presence of hospital acquired infection. Methods A one-group pretest-test-posttest design with 10 preterm infants (28 - 30 wks GA < 32 wks postmenstrual age, and no infection at entry). Test = 90 minutes of SSC; pre-test and post-test = 30 minutes each of prone positioning in an incubator. SCH and TEWL were taken on Days 1 and 5 at the beginning, middle and end of each period using Multi-Probe Adaptor. A 3 X 3 X 2 Repeated Measures Mixed Models Design, including a covariate, was used to analyze level of Skin Hydration. Specifically, the model tested comparisons in SCH made across repetitions, time, and days, as well as all possible interactions while controlling for TEWL. Descriptive statistics described the number of positive blood cultures during hospitalization and the presence of infections four weeks post-discharge. Results Significant differences in skin hydration were found across TIME (Pre-SSC, SSC, Post-SSC) (F = 21.86; p < 0.001). One infant had a positive blood culture during hospitalization; no infants had signs of infection by 4 weeks post-discharge. Conclusions The study has begun

  14. [Normal and abnormal human skin color: from research to esthetics].


    Ortonne, J-P


    Skin color is controlled by pigmentary genes that regulate constitutive skin pigmentation and by environmental factors, the most obvious of them being solar U.V. At this time, more than 130 distinct pigmentary genes are known. They affect embryogenesis and survival of the melanocyte system, mélanosome biogenesis, melanogenesis, mélanosome transport and transfer, eumelanins/pheomelanins ratio and epidermal mélanosome turn-over and elimination. The pigmentary disorders of the skin are common and represent an important part of dermatologist activity. They concern at the same time the general dermatology and the aesthetic dermatology.

  15. Abnormal thermal hyperaemia in the skin in paraplegia.


    Barbenel, J C; Cui, Z F


    Surface insulation, together with laser Doppler flowmetry, was used to assess the skin microcirculation of paraplegic patients. Two control groups of five male and five female subjects were used to establish the response of normals with which to compare the results obtained from six paraplegic subjects. No significant sex related difference was revealed from this study. It was found that in normal subjects, surface insulation resulted in a significant increase in both skin temperature and skin blood flow. In paraplegic patients, the temperature increase was significantly less than in the normal subjects and there was no significant thermally induced hyperaemia after surface insulation.

  16. Characterization of the canine skin barrier restoration following acute disruption by tape stripping.


    Vidémont, Emilie; Mariani, Claire; Vidal, Stéphanie; Pin, Didier


    The stratum corneum (SC) forms the main part of the permeability barrier of the skin. In mice and in humans, cutaneous barrier disruption can be generated by removing the SC with tape stripping (TS) and the skin barrier function can be assessed by measurement of transepidermal water loss (TEWL). The aim of the present study was to characterize the skin barrier restoration in the dog following mechanical disruption and to analyse the correlation between the skin barrier recovery and TEWL measurement. Thirty sequential TS were performed on 12 sites on four healthy beagle dogs. The number of TS was chosen to ensure a sufficient barrier disruption with a slow recovery. Skin repair was assessed for 72 h by clinical and histological examinations, and TEWL measurements. The results showed that performing 30 TS was adequate to disrupt the skin barrier in the dog. The homeostatic repair response, initiated in the skin, was rapid and characterized by complete restoration of the SC within 72 h, accompanied by greater basal cell proliferation, and dermal eosinophilic inflammation. TEWL was significantly increased by complete removal of the SC but recovered along with restoration of the SC (Scheffe test, P ≤ 0.05). Characterization of a canine model of barrier disruption and restoration and assessment of the skin barrier function by TEWL measurements could help better understand the events implied in skin barrier function. Development of this canine model is also necessary for future studies on the effects of treatments aimed at restoring the skin barrier.

  17. Loss of ceramide synthase 3 causes lethal skin barrier disruption.


    Jennemann, Richard; Rabionet, Mariona; Gorgas, Karin; Epstein, Sharon; Dalpke, Alexander; Rothermel, Ulrike; Bayerle, Aline; van der Hoeven, Franciscus; Imgrund, Silke; Kirsch, Joachim; Nickel, Walter; Willecke, Klaus; Riezman, Howard; Gröne, Hermann-Josef; Sandhoff, Roger


    The stratum corneum as the outermost epidermal layer protects against exsiccation and infection. Both the underlying cornified envelope (CE) and the intercellular lipid matrix contribute essentially to these two main protective barriers. Epidermis-unique ceramides with ultra-long-chain acyl moities (ULC-Cers) are key components of extracellular lipid lamellae (ELL) and are bound to CE proteins, thereby contributing to the cornified lipid envelope (CLE). Here, we identified human and mouse ceramide synthase 3 (CerS3), among CerS1-6, to be exclusively required for the ULC-Cer synthesis in vitro and of mouse CerS3 in vivo. Deficiency of CerS3 in mice results in complete loss of ULC-Cers (≥C26), lack of continuous ELL and a non-functional CLE. Consequently, newborn mutant mice die shortly after birth from transepidermal water loss. Mutant skin is prone to Candida albicans infection highlighting ULC-Cers to be pivotal for both barrier functions. Persistent periderm, hyperkeratosis and deficient cornification are hallmarks of mutant skin demonstrating loss of Cers to trigger a keratinocyte maturation arrest at an embryonic pre-barrier stage.

  18. The outcomes of barrier protection in periwound skin and stoma care.


    Stephen-Haynes, Jackie

    This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

  19. In vivo measurements of skin barrier: comparison of different methods and advantages of laser scanning microscopy

    NASA Astrophysics Data System (ADS)

    Patzelt, A.; Sterry, W.; Lademann, J.


    A major function of the skin is to provide a protective barrier at the interface between external environment and the organism. For skin barrier measurement, a multiplicity of methods is available. As standard methods, the determination of the transepidermal water loss (TEWL) as well as the measurement of the stratum corneum hydration, are widely accepted, although they offer some obvious disadvantages such as increased interference liability. Recently, new optical and spectroscopic methods have been introduced to investigate skin barrier properties in vivo. Especially, laser scanning microscopy has been shown to represent an excellent tool to study skin barrier integrity in many areas of relevance such as cosmetology, occupation, diseased skin, and wound healing.

  20. The Role of Cutaneous Microbiota Harmony in Maintaining a Functional Skin Barrier.


    Baldwin, Hilary E; Bhatia, Neal D; Friedman, Adam; Eng, Richard Martin; Seite, Sophie


    The skin is constantly exposed to various endogenous and exogenous factors that may impact its barrier function at the physical, mechanical, immunological, and microbial levels. These factors have the potential to initiate or exacerbate a variety of inflammatory skin conditions, especially those associated with barrier dysfunction. The barrier function of the skin depends upon a symbiotic relationship between resident microbial communities and host tissue. This symbiosis results from complex signals involved in both the innate and adaptive immune responses. Recent research indicates that both bacterial diversity and the relative abundance of different microbes present on and in the skin, may contribute to skin barrier stability or dysfunction. The objectives of this review are to discuss the relationship between the skin microbiota and skin barrier function and to consider mechanisms that may help its preservation. J Drugs Dermatol. 2017;16(1):12-18..

  1. Imaging mass spectrometry visualizes ceramides and the pathogenesis of dorfman-chanarin syndrome due to ceramide metabolic abnormality in the skin.


    Goto-Inoue, Naoko; Hayasaka, Takahiro; Zaima, Nobuhiro; Nakajima, Kimiko; Holleran, Walter M; Sano, Shigetoshi; Uchida, Yoshikazu; Setou, Mitsutoshi


    Imaging mass spectrometry (IMS) is a useful cutting edge technology used to investigate the distribution of biomolecules such as drugs and metabolites, as well as to identify molecular species in tissues and cells without labeling. To protect against excess water loss that is essential for survival in a terrestrial environment, mammalian skin possesses a competent permeability barrier in the stratum corneum (SC), the outermost layer of the epidermis. The key lipids constituting this barrier in the SC are the ceramides (Cers) comprising of a heterogeneous molecular species. Alterations in Cer composition have been reported in several skin diseases that display abnormalities in the epidermal permeability barrier function. Not only the amounts of different Cers, but also their localizations are critical for the barrier function. We have employed our new imaging system, capable of high-lateral-resolution IMS with an atmospheric-pressure ionization source, to directly visualize the distribution of Cers. Moreover, we show an ichthyotic disease pathogenesis due to abnormal Cer metabolism in Dorfman-Chanarin syndrome, a neutral lipid storage disorder with ichthyosis in human skin, demonstrating that IMS is a novel diagnostic approach for assessing lipid abnormalities in clinical setting, as well as for investigating physiological roles of lipids in cells/tissues.

  2. Quantification of quantum dot murine skin penetration with UVR barrier impairment

    PubMed Central

    Mortensen, Luke J.; Jatana, Samreen; Gelein, Robert; De Benedetto, Anna; De Mesy Bentley, Karen L.; Beck, Lisa; Elder, Alison; DeLouise, Lisa A.


    Ultraviolet radiation (UVR) skin exposure is a common exogenous insult that can alter skin barrier and immune functions. With the growing presence of nanoparticles (NPs) in consumer goods and technological applications the potential for NPs to contact UVR exposed skin is increasing. Therefore it is important to understand the effect of UVR on NP skin penetration and potential for systemic translocation. Previous studies qualitatively showed that UVR skin exposure can increase the penetration of NPs below the stratum corneum. In the present work, an in vivo mouse model was used to quantitatively examine the skin penetration of carboxylated (CdSe/ZnS, core/shell) quantum dots (QDs) through intact and UVR barrier disrupted murine skin by organ Cd mass analysis. Transepidermal water loss was used to measure the magnitude of the skin barrier defect as a function of dose and time post UVR exposure. QDs were applied to mice 3-4 days post UVR exposure at the peak of the skin barrier disruption. Our results reveal unexpected trends that suggest these negative charged QDs can penetrate barrier intact skin and that penetration and systemic transport depends on the QD application time post UVR exposure. The effect of UVR on skin resident dendritic cells and their role in the systemic translocation of these QDs are described. Our results suggest that NP skin penetration and translocation may depend on the specific barrier insult and the inflammatory status of the skin. PMID:23078247

  3. Effect of microplasma irradiation on skin barrier function

    NASA Astrophysics Data System (ADS)

    Shimizu, Kazuo; Tran, Nhat An; Blajan, Marius


    This study investigates the feasibility of atmospheric-pressure argon microplasma irradiation (AAMI) to promote drug delivery through skin. Yucatan micropig skin was used as a biological object for evaluation of in vitro percutaneous absorption. The changes in lipids, proteins and water content of the pig stratum corneum (SC) after AAMI were compared to those of a tape stripping test (TST) and plasma jet irradiation (PJI) using attenuated total reflection-Fourier transform infrared spectroscopy analysis. The significant reduction in the methylene stretching modes absorbance resulted in the disturbance in the SC lipids caused by AAMI was observed at 2850 and 2920 cm-1. Moreover, as the result of TST, trans-epidermal water loss (TEWL) after both AAMI and PJI were also increased, that could lead to a decrease of barrier function of SC, and could enhance the transdermal absorption of drugs. Under the conditions of this study, TEWL value of 5 minutes AAMI (35.92 +/- 3.48 g/m2h) was approximately the same as that value of 10 times TST (34.30 +/- 3.54 g/m2h), that makes the effect of these manipulations on the surfaces is considered to be at the same levels. Furthermore, unlike the obtained microscopic observation from PJI, there was no thermal damage observed on the skins after AAMI.

  4. Biological Variation in Skin Barrier Function: From A (Atopic Dermatitis) to X (Xerosis).


    Danby, Simon G


    The skin barrier, formed by the stratum corneum, envelops our bodies and provides an essential protective function. However, this barrier function differs between individuals due to biological variation. This variation arises as a result of inherited genetic variants, negative environmental or extrinsic factors, and age. A multitude of genetic changes determine a person's predisposition to a skin barrier defect and consequently their risk of developing a dry skin condition, such as atopic dermatitis. Extrinsic factors, including the weather and detrimental skin care practices, interact with these genetic changes to determine the severity of the defect and additively increase the risk of developing dry skin conditions. How these dry skin conditions present clinically, and how they persist and progress depends very much on a person's age. Understanding how the skin barrier varies between individuals, how it differs based on clinical presentation, and how it alters with age is important in developing optimum therapies to maintain healthy skin that provides the best protection.

  5. Increased Bacterial Load and Expression of Antimicrobial Peptides in Skin of Barrier-Deficient Mice with Reduced Cancer Susceptibility.


    Natsuga, Ken; Cipolat, Sara; Watt, Fiona M


    Mice lacking three epidermal barrier proteins-envoplakin, periplakin, and involucrin (EPI-/- mice)-have a defective cornified layer, reduced epidermal γδ T cells, and increased dermal CD4(+) T cells. They are also resistant to developing skin tumors. The tumor-protective mechanism involves signaling between Rae-1 expressing keratinocytes and the natural killer group 2D receptor on immune cells, which also plays a role in host defenses against infection. Given the emerging link between bacteria and cancer, we investigated whether EPI-/- mice have an altered skin microbiota. The bacterial phyla were similar in wild-type and EPI-/- skin. However, bacteria were threefold more abundant in EPI-/- skin and penetrated deeper into the epidermis. The major epithelial defense mechanism against bacteria is production of antimicrobial proteins (AMPs). EPI-/- skin exhibited enhanced expression of antimicrobial peptides. However, reducing the bacterial load by antibiotic treatment or breeding mice under specific pathogen-free conditions did not reduce AMP expression or alleviate the abnormalities in T-cell populations. We conclude that the atopic characteristics of EPI-/- skin are a consequence of the defective barrier rather than a response to the increased bacterial load. It is therefore unlikely that the increase in skin microbiota contributes directly to the observed cancer resistance.

  6. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.


    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika


    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds.

  7. Sensations of skin infestation linked to abnormal frontolimbic brain reactivity and differences in self-representation.


    Eccles, J A; Garfinkel, S N; Harrison, N A; Ward, J; Taylor, R E; Bewley, A P; Critchley, H D


    Some patients experience skin sensations of infestation and contamination that are elusive to proximate dermatological explanation. We undertook a functional magnetic resonance imaging study of the brain to demonstrate, for the first time, that central processing of infestation-relevant stimuli is altered in patients with such abnormal skin sensations. We show differences in neural activity within amygdala, insula, middle temporal lobe and frontal cortices. Patients also demonstrated altered measures of self-representation, with poorer sensitivity to internal bodily (interoceptive) signals and greater susceptibility to take on an illusion of body ownership: the rubber hand illusion. Together, these findings highlight a potential model for the maintenance of abnormal skin sensations, encompassing heightened threat processing within amygdala, increased salience of skin representations within insula and compromised prefrontal capacity for self-regulation and appraisal.

  8. Abnormal lymphocyte response to ultraviolet radiation in multiple skin cancer

    SciTech Connect

    Munch-Petersen, B.; Frentz, G.; Squire, B.; Wallevik, K.; Horn, C.C.; Reymann, F.; Faber, M. )


    The lymphocyte response to ultraviolet radiation (254 nm) was investigated by two different methods in 29 unselected patients with multiple epidermal cancer. The ultraviolet-induced DNA synthesis was determined as the increase in incorporation of (/sup 3/H)thymidine in irradiated cells compared with non-irradiated cells after incubation for 2 h. The ultraviolet tolerance was measured as the ultraviolet dose necessary for 50% reduction in phytohemagglutinin-stimulated lymphocyte proliferation. Patients with both squamous cell differentiated tumours and basal cell carcinomas had very high ultraviolet-induced DNA synthesis values. The ultraviolet tolerance in patient lymphocytes was considerably lower than in control lymphocytes with the lowest values occurring in patients with clinical sun intolerance. These investigations may be of predictive value in skin carcinogenesis.

  9. Harlequin ichthyosis: ABCA12 mutations underlie defective lipid transport, reduced protease regulation and skin-barrier dysfunction.


    Scott, Claire A; Rajpopat, Shefali; Di, Wei-Li


    Harlequin ichthyosis (HI) is a devastating autosomal recessive congenital skin disease. It has been vital to elucidate the biological importance of the protein ABCA12 in skin-barrier permeability, following the discovery that ABCA12 gene mutations can result in this rare disease. ATP-binding cassette transporter A12 (ABCA12) is a member of the subfamily of ATP-binding cassette transporters and functions to transport lipid glucosylceramides (GlcCer) to the extracellular space through lamellar granules (LGs). GlcCer are hydrolysed into hydroxyceramides extracellularly and constitute a portion of the extracellular lamellar membrane, lipid envelope and lamellar granules. In HI skin, loss of function of ABCA12 due to null mutations results in impaired lipid lamellar membrane formation in the cornified layer, leading to defective permeability of the skin barrier. In addition, abnormal lamellar granule formation (distorted shape, reduced in number or absent) could further cause aberrant production of LG-associated desquamation enzymes, which are likely to contribute to the impaired skin barrier in HI. This article reviews current opinions on the patho-mechanisms of ABCA12 action in HI and potential therapeutic interventions based on targeted molecular therapy and gene therapy strategies.

  10. Potential skin involvement in ALS: revisiting Charcot's observation - a review of skin abnormalities in ALS.


    Paré, Bastien; Gros-Louis, François


    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease affecting motor neurons of the brain and spinal cord, leading to progressive paralysis and death. Interestingly, many skin changes have been reported in ALS patients, but never as yet fully explained. These observations could be due to the common embryonic origin of the skin and neural tissue known as the ectodermal germ layer. Following the first observation in ALS patients' skin by Dr Charcot in the 19th century, in the absence of bedsores unlike other bedridden patients, other morphological and molecular changes have been observed. Thus, the skin could be of interest in the study of ALS and other neurodegenerative diseases. This review summarizes skin changes reported in the literature over the years and discusses about a novel in vitro ALS tissue-engineered skin model, derived from patients, for the study of ALS.

  11. Skin Barrier Recovery by Protease-Activated Receptor-2 Antagonist Lobaric Acid

    PubMed Central

    Joo, Yeon Ah; Chung, Hyunjin; Yoon, Sohyun; Park, Jong Il; Lee, Ji Eun; Myung, Cheol Hwan; Hwang, Jae Sung


    Atopic dermatitis (AD) results from gene and environment interactions that lead to a range of immunological abnormalities and breakdown of the skin barrier. Protease-activated receptor 2 (PAR2) belongs to a family of G-protein coupled receptors and is expressed in suprabasal layers of the epidermis. PAR2 is activated by both trypsin and a specific agonist peptide, SLIGKV-NH2 and is involved in both epidermal permeability barrier homeostasis and epithelial inflammation. In this study, we investigated the effect of lobaric acid on inflammation, keratinocyte differentiation, and recovery of the skin barrier in hairless mice. Lobaric acid blocked trypsin-induced and SLIGKV-NH2-induced PAR2 activation resulting in decreased mobilization of intracellular Ca2+ in HaCaT keratinocytes. Lobaric acid reduced expression of interleukin-8 induced by SLIGKV-NH2 and thymus and activation regulated chemokine (TARC) induced by tumor necrosis factor-a (TNF-α) and IFN-γ in HaCaT keratinocytes. Lobaric acid also blocked SLIGKV-NH2-induced activation of ERK, which is a downstream signal of PAR2 in normal human keratinocytes (NHEKs). Treatment with SLIGKV-NH2 downregulated expression of involucrin, a differentiation marker protein in HaCaT keratinocytes, and upregulated expression of involucrin, transglutamase1 and filaggrin in NHEKs. However, lobaric acid antagonized the effect of SLIGKV-NH2 in HaCaT keratinocytes and NHEKs. Topical application of lobaric acid accelerated barrier recovery kinetics in a SKH-1 hairless mouse model. These results suggested that lobaric acid is a PAR2 antagonist and could be a possible therapeutic agent for atopic dermatitis. PMID:27169822

  12. Epidermal barrier defects link atopic dermatitis with altered skin cancer susceptibility.


    Cipolat, Sara; Hoste, Esther; Natsuga, Ken; Quist, Sven R; Watt, Fiona M


    Atopic dermatitis can result from loss of structural proteins in the outermost epidermal layers, leading to a defective epidermal barrier. To test whether this influences tumour formation, we chemically induced tumours in EPI-/- mice, which lack three barrier proteins-Envoplakin, Periplakin, and Involucrin. EPI-/- mice were highly resistant to developing benign tumours when treated with 7,12-dimethylbenz(a)anthracene (DMBA) and 12-O-tetradecanoylphorbol-13-acetate (TPA). The DMBA response was normal, but EPI-/- skin exhibited an exaggerated atopic response to TPA, characterised by abnormal epidermal differentiation, a complex immune infiltrate and elevated serum thymic stromal lymphopoietin (TSLP). The exacerbated TPA response could be normalised by blocking TSLP or the immunoreceptor NKG2D but not CD4+ T cells. We conclude that atopy is protective against skin cancer in our experimental model and that the mechanism involves keratinocytes communicating with cells of the immune system via signalling elements that normally protect against environmental assaults.DOI:

  13. Non-invasive in vivo methods for investigation of the skin barrier physical properties.


    Darlenski, R; Sassning, S; Tsankov, N; Fluhr, J W


    Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. Novel methods such as in vivo confocal Raman microspectroscopy offer the possibility for precise and detailed characterization of the skin barrier. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

  14. Barriers to Follow-Up for Abnormal Papanicolaou Smears among Female Sex Workers in Lima, Peru

    PubMed Central

    Aharon, Devora; Calderon, Martha; Solari, Vicky; Alarcon, Patricia; Zunt, Joseph


    Background Cervical cancer is the most prevalent cancer among Peruvian women. Female sex workers (FSW) in Peru are at elevated risk for HPV infection, and receive annual Papanicolaou screening. The objective of this study was to identify barriers to follow-up for abnormal Pap smears among FSW in Peru. Methods 97 FSW attending the Alberto Barton Health Center in Lima were surveyed regarding their STI screening history. 17 women with a history of an abnormal Pap smear were interviewed about their experiences regarding follow-up care. Results Of the 27 HPV-positive women, only 8 (30%) received follow-up treatment. Of the 19 women who did not receive follow-up, 7 (37%) had not been informed of their abnormal result. Qualitative interviews revealed that the major barrier to follow-up was lack of knowledge about HPV and potential health consequences of an abnormal Pap smear. Conclusion HPV infection is highly prevalent in Peruvian FSW, yet only 30% of FSW with abnormal Pap smears receive follow-up care. The predominant barriers to follow-up were lack of standardization in recording and communicating results and insufficient FSW knowledge regarding health consequences of HPV infection. Standardization of record-keeping and distribution of educational pamphlets have been implemented to improve follow-up for HPV. PMID:28060937

  15. Inflammation-induced alterations in the skin barrier function: implications in atopic dermatitis.


    Vestergaard, Christian; Hvid, Malene; Johansen, Claus; Kemp, Kaare; Deleuran, Bent; Deleuran, Mette


    The pathogenesis of atopic dermatitis (AD) is very complex, but best characterized by an inflammatory reaction in the skin and a disrupted skin barrier. Until recently, these two factors have been studied as separate entities; however, it has been shown that inflammatory cytokines can regulate filaggrin, a very important component of the skin barrier, as well as proteins involved in the processing and maturation of filaggrin. Therefore, inflammation itself may be able to induce a functional skin barrier dysfunction and thereby aggravate the eczematous reaction in AD.

  16. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function.


    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part - stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  17. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    PubMed Central

    Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function. PMID:26985171

  18. Epidermal barrier abnormalities in exfoliative ichthyosis with a novel homozygous loss-of-function mutation in CSTA.


    Moosbrugger-Martinz, V; Jalili, A; Schossig, A S; Jahn-Bassler, K; Zschocke, J; Schmuth, M; Stingl, G; Eckl, K M; Hennies, H C; Gruber, R


    Autosomal recessive exfoliative ichthyosis (AREI) results from mutations in CSTA, encoding cysteine protease inhibitor A (cystatin A). We present a 25-year-old man from Iran with consanguineous parents, who presented with congenital erythroderma, hyperhidrosis and diffuse hyperkeratosis with coarse palmoplantar peeling of the skin, aggravated by exposure to water and by occlusion. Candidate gene analysis revealed a previously unknown homozygous loss-of-function mutation c.172C>T (p.Arg58Ter) in CSTA, and immunostaining showed absence of epidermal cystatin A, confirming the diagnosis of AREI. Ultrastructural analysis by transmission electron microscopy showed normal degradation of corneodesmosomes, mild intercellular oedema in the spinous layer but not in the basal layer, normal-appearing desmosomes, and prominent keratin filaments within basal keratinocytes. Thickness of cornified envelopes was reduced, lamellar lipid bilayers were disturbed, lamellar body secretion occurred prematurely and processing of secreted lamellar body contents was delayed. These barrier abnormalities were reminiscent of (albeit less severe than in) Netherton syndrome, which results from a deficiency of the serine protease inhibitor LEKTI. This work describes ultrastructural findings with evidence of epidermal barrier abnormalities in AREI.

  19. The coordinated Response of the Physical and Antimicrobial Peptide Barriers of the Skin

    PubMed Central

    Borkowski, Andrew W.; Gallo, Richard L.


    Antimicrobial peptides (AMPs) are an essential and multifunctional element for immune defense of the skin during infection and injury. In this issue, Ahrens et al. characterize the response of β-defensins, a class of AMPs, following acute and chronic challenges to the permeability barrier of the skin. Their findings suggest that the antimicrobial and permeability barriers of the skin are closely linked. PMID:21228809

  20. Corneodesmosin gene ablation induces lethal skin-barrier disruption and hair-follicle degeneration related to desmosome dysfunction.


    Leclerc, Emilie A; Huchenq, Anne; Mattiuzzo, Nicolas R; Metzger, Daniel; Chambon, Pierre; Ghyselinck, Norbert B; Serre, Guy; Jonca, Nathalie; Guerrin, Marina


    Corneodesmosin (CDSN) is specific to desmosomes of epithelia undergoing cornification, mainly the epidermis and the inner root sheath of the hair follicles. CDSN nonsense mutations are associated with hypotrichosis simplex of the scalp, a rare disease that leads to complete baldness in young adults. CDSN displays adhesive properties, mostly attributable to its N-terminal glycine-rich domain, and is sequentially proteolyzed as corneocytes migrate towards the skin surface. K14-promoter driven Cre-mediated deletion of Cdsn in mice resulted in neonatal death as a result of epidermal tearing upon minor mechanical stress. Ultrastructural analyses revealed a desmosomal break at the interface between the living and cornified layers. After grafting onto nude mice, knockout skin showed a chronic defect in the epidermal permeability barrier. The epidermis was first hyperproliferative with a thick cornified layer, then, both the epidermis and the hair follicles degenerated. In adults, Cdsn deletion resulted in similar histological abnormalities and in a lethal barrier defect. We demonstrate that Cdsn is not essential for skin-barrier formation in utero, but is vital throughout life to preserve this barrier by maintaining desmosome integrity. The strong adhesive function that the protein confers on corneodesmosomes also seems necessary for maintaining the architecture of the hair follicle.

  1. Reducing Friction on Skin at Risk: The Use of 3M™ Cavilon™ No Sting Barrier Film

    PubMed Central

    Bernatchez, Stéphanie F.; Mengistu, Golie E.; Ekholm, Bruce P.; Sanghi, Shilpi; Theiss, Steven D.


    Objective: To compare the coefficient of friction (CoF) of skin against fabric when the skin is covered with a liquid barrier film versus a silicone dressing, relative to a bare skin baseline. Approach: A laboratory instrument allowing the measurement of friction between two surfaces was used to compare the CoF between a fabric representing bed linen (100% cotton) and the skin of two laboratory operators, either bare (dry or hydrated) or covered with a liquid barrier film or a silicone dressing. Results: The CoF of hydrated skin was over twice the value found for dry skin. The liquid barrier film product reduced the CoF of hydrated skin to a greater extent than the silicone dressing. Innovation and Conclusion: Silicone dressings have recently been promoted to help prevent pressure ulcers. Published data have shown that their CoF is lower than other dressings, but the data were not compared to bare skin. We found that a liquid barrier film provided a greater reduction in the CoF of skin against linen than a silicone dressing. In the context of preventative use (e.g., application on intact skin) to reduce the risk of pressure ulcers, applying a liquid barrier film may reduce friction better than a silicone dressing. PMID:26634182

  2. Novel Functions of the Anticoagulant Activated Protein C in Maintaining Skin Barrier Integrity to Impact on Skin Disease.


    Xue, Meilang; Jackson, Christopher John


    The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. When the barrier is disrupted any of a number of diseases, such as chronic wounds, psoriasis, pemphigus, atopic dermatitis or toxic epidermal necrolysis, can take hold. Activated protein C (APC) or its precursor, protein C, is abundantly expressed by skin epidermal keratinocytes and stimulates their proliferation and migration, and inhibits apoptosis and inflammation, leading to a healing phenotype. Importantly, APC also increases the barrier function of keratinocytes by promoting expression and cell-cell contact redistribution of tight junction proteins. These cytoprotective properties of APC on epidermal keratinocytes place it as an exciting new therapy for skin disorders associated with the disruption of barrier function and inflammation.

  3. Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.


    Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian


    Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

  4. Impaired skin barrier function in mice with colon carcinoma induced by azoxymethane and dextran sodium sulfate.


    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya


    We have previously reported that impaired skin barrier function was induced by small intestinal injury in mice. Therefore, we postulated that other intestinal diseases might also influence skin barrier function. In this study, we evaluated the skin barrier function of hairless mice with colon carcinoma that was induced by azoxymethane (AOM) and dextran sodium sulfate (DSS). In mice treated with these drugs, we observed elevated transepidermal water loss and reduced skin hydration levels, compared to those in the control mice. In addition, plasma nitrogen di/trioxide (NO2(-)/NO3(-)) levels were significantly elevated, and expression of type I collagen was significantly reduced in the treated mice, compared to those in control. These results suggest that impaired skin barrier function occurs in mice when colon carcinoma is present.

  5. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

    PubMed Central

    Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David


    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

  6. Skin Barrier Function and Its Importance at the Start of the Atopic March

    PubMed Central

    Hogan, Mary Beth; Peele, Kathy; Wilson, Nevin W.


    Atopic dermatitis can be due to a variety of causes from nonatopic triggers to food allergy. Control of egress of water and protection from ingress of irritants and allergens are key components of cutaneous barrier function. Current research suggests that a degraded barrier function of the skin allows the immune system inappropriate access to environmental allergens. Epidermal aeroallergen exposure may allow sensitization to allergen possibly initiating the atopic march. Further research into connections between epidermal barrier function and possible allergen sensitization will be important to undertake. Future clinical trials focused on skin barrier protection may be of value as a possible intervention in prevention of the initiation of the atopic march. PMID:22619686

  7. Toll-like receptor 3 activation is required for normal skin barrier repair following UV damage.


    Borkowski, Andrew W; Kuo, I-Hsin; Bernard, Jamie J; Yoshida, Takeshi; Williams, Michael R; Hung, Nai-Jung; Yu, Benjamin D; Beck, Lisa A; Gallo, Richard L


    UV damage to the skin leads to the release of noncoding RNA (ncRNA) from necrotic keratinocytes that activates Toll-like receptor 3 (TLR3). This release of ncRNA triggers inflammation in the skin following UV damage. Recently, TLR3 activation was also shown to aid wound repair and increase the expression of genes associated with permeability barrier repair. Here, we sought to test whether skin barrier repair after UVB damage is dependent on the activation of TLR3. We observed that multiple ncRNAs induced expression of skin barrier repair genes, that the TLR3 ligand Poly (I:C) also induced expression and function of tight junctions, and that the ncRNA U1 acts in a TLR3-dependent manner to induce expression of skin barrier repair genes. These observations were shown to have functional relevance as Tlr3-/- mice displayed a delay in skin barrier repair following UVB damage. Combined, these data further validate the conclusion that recognition of endogenous RNA by TLR3 is an important step in the program of skin barrier repair.

  8. Toll-like receptor 3 activation is required for normal skin barrier repair following UV damage

    PubMed Central

    Borkowski, Andrew W.; Kuo, I-Hsin; Bernard, Jamie J.; Yoshida, Takeshi; Williams, Michael R.; Hung, Nai-Jung; Yu, Benjamin D.; Beck, Lisa A.; Gallo, Richard L.


    Ultraviolet (UV) damage to the skin leads to the release of noncoding RNA (ncRNA) from necrotic keratinocytes that activates toll-like receptor 3 (TLR3). This release of ncRNA triggers inflammation in the skin following UV damage. Recently, TLR3 activation was also shown to aid wound repair and increase expression of genes associated with permeability barrier repair. Here, we sought to test if skin barrier repair after UVB damage is dependent on the activation of TLR3. We observed that multiple ncRNAs induced expression of skin barrier repair genes, that the TLR3 ligand Poly (I:C) also induced expression and function of tight junctions, and that the ncRNA U1 acts in a TLR3-dependent manner to induce expression of skin barrier repair genes. These observations were shown to have functional relevance as Tlr3−/− mice displayed a delay in skin barrier repair following UVB damage. Combined, these data further validate the conclusion that recognition of endogenous RNA by TLR3 is an important step in the program of skin barrier repair. PMID:25118157

  9. Kinetin Improves Barrier Function of the Skin by Modulating Keratinocyte Differentiation Markers

    PubMed Central

    An, Sungkwan; Cha, Hwa Jun; Ko, Jung-Min; Han, Hyunjoo; Kim, Su Young; Kim, Kyung-Suk; Lee, Song Jeong; An, In-Sook; Kim, Sangwon; Youn, Hae Jeong


    Background Kinetin is a plant hormone that regulates growth and differentiation. Keratinocytes, the basic building blocks of the epidermis, function in maintaining the skin barrier. Objective We examined whether kinetin induces skin barrier functions in vitro and in vivo. Methods To evaluate the efficacy of kinetin at the cellular level, expression of keratinocyte differentiation markers was assessed. Moreover, we examined the clinical efficacy of kinetin by evaluating skin moisture, transepidermal water loss (TEWL), and skin surface roughness in patients who used kinetin-containing cream. We performed quantitative real-time polymerase chain reaction to measure the expression of keratinocyte differentiation markers in HaCaT cells following treatment. A clinical trial was performed to assess skin moisture, TEWL, and evenness of skin texture in subjects who used kinetin-containing cream for 4 weeks. Results Kinetin increased involucrin, and keratin 1 mRNA in HaCaT cells. Moreover, use of a kinetin-containing cream improved skin moisture and TEWL while decreasing roughness of skin texture. Conclusion Kinetin induced the expression of keratinocyte differentiation markers, suggesting that it may affect differentiation to improve skin moisture content, TEWL, and other signs of skin aging. Therefore, kinetin is a potential new component for use in cosmetics as an anti-aging agent that improves the barrier function of skin. PMID:28223740

  10. Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.


    Kawano, Ken-Ichi; Umemura, Kazuo


    The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function.

  11. Impairment of skin barrier function via cholinergic signal transduction in a dextran sulphate sodium-induced colitis mouse model.


    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya


    Dry skin has been clinically associated with visceral diseases, including liver disease, as well as for our previously reported small intestinal injury mouse model, which have abnormalities in skin barrier function. To clarify this disease-induced skin disruption, we used a dextran sulphate sodium (DSS)-induced colitis mouse model. Following treatment with DSS, damage to the colon and skin was monitored using histological and protein analysis methods as well as the detection of inflammatory mediators in the plasma. Notably, transepidermal water loss was higher, and skin hydration was lower in DSS-treated mice compared to controls. Tumor necrosis factor-alpha (TNF-α), interleukin 6 and NO2-/NO3- levels were also upregulated in the plasma, and a decrease in body weight and colon length was observed in DSS-treated mice. However, when administered TNF-α antibody or an iNOS inhibitor, no change in skin condition was observed, indicating that another signalling mechanism is utilized. Interestingly, the number of tryptase-expressing mast cells, known for their role in immune function via cholinergic signal transduction, was elevated. To evaluate the function of cholinergic signalling in this context, atropine (a muscarinic cholinoceptor antagonist) or hexamethonium (a nicotinic cholinergic ganglion-blocking agent) was administered to DSS-treated mice. Our data indicate that muscarinic acetylcholine receptors (mAChRs) are the primary receptors functioning in colon-to-skin signal transduction, as DSS-induced skin disruption was suppressed by atropine. Thus, skin disruption is likely associated with DSS-induced colitis, and the activation of mast cells via mAChRs is critical to this association.

  12. Genetic background of skin barrier dysfunction in the pathogenesis of psoriasis vulgaris.


    Stawczyk-Macieja, Marta; Szczerkowska-Dobosz, Aneta; Rębała, Krzysztof; Purzycka-Bohdan, Dorota


    Psoriasis is a common inflammatory skin disease. It is known to be a complex condition with multifactorial mode of inheritance, however the associations between particular pathogenic pathways remain unclear. A novel report on the pathogenesis of psoriasis has recently included the genetic determination of the skin barrier dysfunction. In this paper, we focus on specific genetic variants associated with formation of the epidermal barrier and their role in the complex pathogenesis of the disease.

  13. Hypo-osmotic shock-induced subclinical inflammation of skin in a rat model of disrupted skin barrier function.


    Kishi, Chihiro; Minematsu, Takeo; Huang, Lijuan; Mugita, Yuko; Kitamura, Aya; Nakagami, Gojiro; Yamane, Takumi; Yoshida, Mikako; Noguchi, Hiroshi; Funakubo, Megumi; Mori, Taketoshi; Sanada, Hiromi


    Aging disrupts skin barrier function and induces xerosis accompanied by pruritus. In many cases, elderly patients complain of pruritus during skin hygiene care, a condition called aquagenic pruritus of the elderly (APE). To date, the pathophysiology and mechanism of action of APE have not been elucidated. We conducted the present study to test the hypothesis that hypo-osmotic shock of epidermal cells induces skin inflammation and elongation of C-fibers by nerve growth factor β (NGFβ) as a basic mechanism of APE. The dorsal skin of HWY rats, which are a model for disrupted skin barrier function, was treated with distilled water (hypotonic treatment [Hypo] group) or normal saline (isotonic treatment [Iso] group) by applying soaked gauze for 7 days. Untreated rats were used as a control (no-treatment [NT] group). Histochemical and immunohistochemical analyses revealed inflammatory responses in the epidermis and the dermal papillary layer in the Hypo group, while no alterations were observed in the Iso or NT groups. Induction of expression and secretion of NGFβ and elongation of C-fibers into the epidermis were found in the Hypo group. In contrast, secretion of NGFβ was significantly lower and elongation of C-fibers was not observed in the Iso group. These results suggest that hypo-osmotic shock-induced inflammatory reactions promote hypersensitivity to pruritus in skin with disrupted barrier function.

  14. Determination of the thickness and structure of the skin barrier by in vivo laser scanning microscopy

    NASA Astrophysics Data System (ADS)

    Lademann, J.; Richter, H.; Astner, S.; Patzelt, A.; Knorr, F.; Sterry, W.; Antoniou, Ch


    Normal skin barrier function is an essential aspect of skin homeostasis and regeneration. Dynamic inflammatory, proliferative and neoplastic skin processes such as wound healing, psoriasis and contact dermatitis are associated with a significant disruption of the skin barrier. In recent years, there has been increasing interest in evaluating cosmetic and pharmacologic products for their ability to restore these protective properties. The gold standard for characterization of barrier function has been the measurement of the transepidermal water loss, however the disadvantage of this method is its interference with several endogenous and exogenous factors such as hydration, perspiration and topically applied substances. This study was aimed to test the clinical applicability of a fluorescence confocal laser scanning microscope (LSM) for a systematic morphologic analysis of the structure, integrity and thickness of the stratum corneum in 10 otherwise healthy volunteers. The influence of skin treatment with commercial moisturizing cream on skin barrier function was evaluated in serial non-invasive examinations. Our findings showed that in vivo LSM may represent a simple and efficient method for the characterization of skin barrier properties, such as the thickness and hydration of the stratum corneum.

  15. Evaluation of moisture penetration through skin protectant barriers by paper chromatography.


    Shah, S; Cornell, M; Ward, A J


    Currently, there is no convenient and safe experimental method in the literature to evaluate skin protectant formulations for barrier properties. A novel and simple experimental method, based on paper chromatography, was developed to screen a broad spectrum of skin protectants available for moisture penetration. The method involves the use of paper chromatography for determining the Moisture Penetration Rate through a thin barrier film of a given skin protectant product. It is simple, inexpensive, convenient, and safe and was used to evaluate 12 products currently used as skin protectants. This method can be used by formulators in their development efforts and by caregivers to determine the barrier properties of various products in a short period of time without expensive instrumentation or extensive time commitments. Skin irritation resulting from fecal and urinary incontinence is a common problem for geriatric patients (Fiers & Siebert, 1993, Talbot, 1994). Various products on the market today are used as protective barriers to prevent skin irritation from moisture penetration. However, from the caregiver's perspective, there is a need for identifying the best product or the relative ranking of products based on suitable test methods. There is a lack of suitable in vitro test methods to screen skin protectant barriers (Guillemin, Murset, Lob, & Riquez, 1974; Pigatto, Bigardi, Legori, Altomare, & Finzi, 1993) on the market. For any method to be acceptable it must be convenient, simple, reproducible, and safe for use on human volunteers. More importantly, it must have clinical relevance.

  16. Cichorium intybus root extract: A "vitamin D-like" active ingredient to improve skin barrier function.


    Maia Campos, P M B G; G Mercurio, D; O Melo, M; Closs-Gonthier, B


    During the aging process, the human skin suffers many alterations including dryness, skin barrier function damage. The skin barrier function is important to the prevention of skin alterations and maintenance of homeostasis. So, the objective of this study was to assess the clinical efficacy on skin barrier function of Cichorium intybus root extract in cosmetic formulations with or without UV filters. Fifty women, aged between 45 and 60 years, were divided into two groups. One group received vehicle formulations containing UV filters, and the other group received formulations without UV filters. Both groups received a formulation containing the extract and the vehicle. The formulations were applied twice daily to the upper arms after washing with sodium lauryl sulphate. Transepidermal water loss (TEWL) and skin microrelief were evaluated before and after a 14- and 28-day period of treatment. The control regions and regions where the vehicles were applied showed an increase in the TEWL. For the formulations containing the extract, decreased TEWL and improved microrelief were observed when compared to the vehicle and control areas after a 28-day period. In conclusion, Cichorium intybus root extract showed protective and restructuring effects on the skin and stands out as an innovative ingredient to improve skin barrier function.

  17. In vivo Raman Confocal Spectroscopy in the Investigation of the Skin Barrier.


    Darlenski, Razvigor; Fluhr, Joachim W


    The epidermal barrier, predominantly attributed to the stratum corneum (SC), is the outermost part of our body that comprises multiple defensive functions against exogenous attacks and the loss of body substances, e.g. water. A novel investigative method, in vivo Raman confocal spectroscopy (RCS), is employed to study the composition of the epidermal barrier and compounds penetrating the epidermis both in a space-resolved manner. By using this method, a semiquantitative analysis of skin barrier constituents can be evaluated, namely SC lipids, natural moisturizing factor components and sweat constituents. The technique enables to examine epidermal barrier impairment in experimental settings as well as the penetration of exogenous substances into the epidermis, e.g. retinol. RCS can reveal microcompositional changes in the skin barrier as a function of age. We also review the use of RCS in studying antioxidant defense components. This chapter discusses the application of in vivo RCS in the investigation of the epidermal barrier.

  18. The effect of pimecrolimus on expression of genes associated with skin barrier dysfunction in atopic dermatitis skin lesions.


    Grzanka, Alicja; Zebracka-Gala, Jadwiga; Rachowska, Regina; Bozek, Andrzej; Kowalska, Małgorzata; Jarzab, Jerzy


    The mechanism of action of pimecrolimus (PIM) on atopic lesions is still under consideration. Thus far, we have evidence of its anti-inflammatory and immunomodulatory activity, and recent papers focus on its effect on epidermal barrier function. This study analysed changes in the expression of genes associated with skin barrier dysfunction in atopic dermatitis (AD) skin lesions after 2 weeks of exposure to PIM 1% cream. A real-time quantitative PCR analysis of selected epidermal differentiation complex genes and three alternative pathway keratins was performed in skin biopsies from 11 individuals with AD before and after PIM exposure. The real-time quantitative PCR analysis was compared to non-lesional skin in the same patients. Involucrin, a small proline-rich region (SPRR) 2C gene, and alternative pathway keratin 16 showed significant over-expression in lesional skin followed by significant decrease after PIM therapy. The SPRR1A gene, S100A9, and keratin 6A were also increased; however, the decrease after PIM treatment was not significant. The changes in S100 A2, A7 and A8 followed a similar course with borderline significance. SPRR4 had a significant decrease in expression in lesional versus non-lesional skin, which persisted after PIM treatment. No significant changes were detected in mRNA expression levels of filaggrin and loricrin. Our results suggest that PIM can be effective in restoring the epidermal barrier in patients with AD at least in part by its impact on expression of genes, which are important for the normal barrier function of skin.

  19. Bathing in a magnesium-rich Dead Sea salt solution improves skin barrier function, enhances skin hydration, and reduces inflammation in atopic dry skin.


    Proksch, Ehrhardt; Nissen, Hans-Peter; Bremgartner, Markus; Urquhart, Colin


    Magnesium salts, the prevalent minerals in Dead Sea water, are known to exhibit favorable effects in inflammatory diseases. We examined the efficacy of bathing atopic subjects in a salt rich in magnesium chloride from deep layers of the Dead Sea (Mavena(R) Dermaline Mg(46) Dead Sea salt, Mavena AG, Belp, Switzerland). Volunteers with atopic dry skin submerged one forearm for 15 min in a bath solution containing 5% Dead Sea salt. The second arm was submerged in tap water as control. Before the study and at weeks 1-6, transepidermal water loss (TEWL), skin hydration, skin roughness, and skin redness were determined. We found one subgroup with a normal and one subgroup with an elevated TEWL before the study. Bathing in the Dead Sea salt solution significantly improved skin barrier function compared with the tap water-treated control forearm in the subgroup with elevated basal TEWL. Skin hydration was enhanced on the forearm treated with the Dead Sea salt in each group, which means the treatment moisturized the skin. Skin roughness and redness of the skin as a marker for inflammation were significantly reduced after bathing in the salt solution. This demonstrates that bathing in the salt solution was well tolerated, improved skin barrier function, enhanced stratum corneum hydration, and reduced skin roughness and inflammation. We suggest that the favorable effects of bathing in the Dead Sea salt solution are most likely related to the high magnesium content. Magnesium salts are known to bind water, influence epidermal proliferation and differentiation, and enhance permeability barrier repair.

  20. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides.


    Jungersted, Jakob Mutanu; Høgh, Julie K; Hellgren, Lars I; Jemec, Gregor B E; Agner, Tove


    Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate the effect of systemic alitretinoin on skin barrier function and response to irritants, a secondary objective was to determine if changes occur in the lipid profile of stratum corneum after treatment with systemic alitretinoin. We conducted an open clinical intervention study on eight people ascribed to systemic alitretinoin treatment. The criteria for being ascribed to alitretinoin were chronic hand eczema and insufficient therapeutic response to potent topical corticosteroids. Before initiation and after 2 months of systemic treatment with 30 mg alitretinoin, a challenge with sodium lauryl sulphate (SLS) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months. No significant changes in stratum corneum lipids were found after 2 months of treatment. In conclusion, systemic alitretinoin does not influence skin susceptibility to irritants or the ceramide profile of stratum corneum.

  1. Current evidence of skin barrier dysfunction in human and canine atopic dermatitis.


    Marsella, Rosanna; Olivry, Thierry; Carlotti, Didier-Noel


    Atopic dermatitis (AD) is a multifaceted disease resulting from a complex interaction between environmental and genetic factors. Both of these factors can shape skin barrier function and the immunological response of predisposed patients. There is increasing evidence that an impaired skin barrier plays a role in both human and canine AD. Although many primary skin barrier defects had already been documented in the past in humans, the recent identification of the filaggrin mutations and the fact that such mutations are now considered the most important risk factor for development of AD have further emphasized the relevance of epidermal dysfunction in human AD. Much less is known in veterinary medicine, but evidence is rapidly building to support a role for skin barrier dysfunction in canine AD. Canine AD shares many clinical and immunological similarities with its human counterpart. The similar distribution of clinical lesions and the importance of the epicutaneous route of allergen exposure provided the incentive to investigate the role of skin barrier impairments in canine AD. The purpose of this comparative review is to present the current evidence of barrier dysfunction in both human and canine AD.

  2. Control of the Physical and Antimicrobial Skin Barrier by an IL-31-IL-1 Signaling Network.


    Hänel, Kai H; Pfaff, Carolina M; Cornelissen, Christian; Amann, Philipp M; Marquardt, Yvonne; Czaja, Katharina; Kim, Arianna; Lüscher, Bernhard; Baron, Jens M


    Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cytokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31-dependent gene expression was determined in three-dimensional organotypic skin models. IL-31-regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier. Moreover, by interfering with IL-31, a currently evaluated drug target, we will have to consider that low doses of IL-31 promote the antimicrobial barrier, and thus a complete inhibition of IL-31 signaling may be undesirable.

  3. Elastase 2 is expressed in human and mouse epidermis and impairs skin barrier function in Netherton syndrome through filaggrin and lipid misprocessing.


    Bonnart, Chrystelle; Deraison, Céline; Lacroix, Matthieu; Uchida, Yoshikazu; Besson, Céline; Robin, Aurélie; Briot, Anaïs; Gonthier, Marie; Lamant, Laurence; Dubus, Pierre; Monsarrat, Bernard; Hovnanian, Alain


    The human epidermis serves 2 crucial barrier functions: it protects against water loss and prevents penetration of infectious agents and allergens. The physiology of the epidermis is maintained by a balance of protease and antiprotease activities, as illustrated by the rare genetic skin disease Netherton syndrome (NS), in which impaired inhibition of serine proteases causes severe skin erythema and scaling. Here, utilizing mass spectrometry, we have identified elastase 2 (ELA2), which we believe to be a new epidermal protease that is specifically expressed in the most differentiated layer of living human and mouse epidermis. ELA2 localized to keratohyalin granules, where it was found to directly participate in (pro-)filaggrin processing. Consistent with the observation that ELA2 was hyperactive in skin from NS patients, transgenic mice overexpressing ELA2 in the granular layer of the epidermis displayed abnormal (pro-)filaggrin processing and impaired lipid lamellae structure, which are both observed in NS patients. These anomalies led to dehydration, implicating ELA2 in the skin barrier defect seen in NS patients. Thus, our work identifies ELA2 as a major new epidermal protease involved in essential pathways for skin barrier function. These results highlight the importance of the control of epidermal protease activity in skin homeostasis and designate ELA2 as a major protease driving the pathogenesis of NS.

  4. Language Barriers, Location of Care and Delays in Follow-up of Abnormal Mammograms

    PubMed Central

    Karliner, LS; Ma, L; Hofmann, M; Kerlikowske, K


    Background Breast cancer is frequently diagnosed after an abnormal mammography result. Language barriers can complicate communication of those results. Objectives We evaluated the association of non-English language with delay in follow-up. Methods: Retrospective cohort study of women at three mammography facilities participating in the San Francisco Mammography Registry (SFMR) with an abnormal mammogram result from 1997-2008. We measured median time from report of abnormal result to first follow-up test. Results Of 13,014 women with 16,109 abnormal mammograms, 4,027 (31%) had a non-English patient language. Clinical facilities differed in proportion of non-English-speakers and in time to first follow-up test: facility A (38%; 25 days), facility B (18%; 14 days), facility C (51%; 41 days). Most (67%) mammography examinations had BIRADS 0 (incomplete) assessment, requiring radiographic follow-up. At 30 days of follow-up 67% of all English speakers with incomplete assessments had a follow-up exam compared with 50% of all non-English speakers (p<.0001). The facility with the least delay and the lowest proportion of non-English speakers, had the biggest difference by language; compared to English speakers and adjusting for education, non-English speakers had twice the odds of >30 day delay in follow-up (OR 2.3; 95 CI 1.4-3.9). Conclusions There are considerable differences among facilities in delays in diagnostic follow-up of abnormal mammography results. More attention must be paid to understanding mammography facility factors, such as wait time to schedule diagnostic mammography and radiology workload, in order to improve rates of timely follow-up, particularly for those facilities disproportionately serving vulnerable non-English speaking patients. PMID:21993060

  5. Barrier Properties of an N/TERT-Based Human Skin Equivalent

    PubMed Central

    van Drongelen, Vincent; Danso, Mogbekeloluwa O.; Mulder, Aat; Mieremet, Arnout; van Smeden, Jeroen


    Human skin equivalents (HSEs) can be considered a valuable tool to study aspects of human skin, including the skin barrier, or to perform chemical or toxicological screenings. HSEs are three-dimensional skin models that are usually established using primary keratinocytes and closely mimic human skin. The use of primary keratinocytes has several drawbacks, including a limited in vitro life span and large donor–donor variation. This makes them less favorable for in vitro toxicity screenings. Usage of an established keratinocyte cell line circumvents these drawbacks and enables the generation of easy-to-generate and reproducible HSEs, which can be used for pharmacological and/or toxicological screenings. For such screenings, a proper barrier function is required. In this study, we investigated the barrier properties of HSEs established with the keratinocyte cell line N/TERT (N-HSEs). N-HSEs showed comparable tissue morphology and expression of several epidermal proteins compared with HSEs established with primary keratinocytes. Our results clearly demonstrate that N-HSEs not only contain several stratum corneum (SC) barrier properties similar to HSEs, including the presence of the long periodicity phase and a comparable SC permeability, but also show some differences in lipid composition. Nonetheless, the similarities in barrier properties makes N/TERT cells a promising alternative for primary keratinocytes to generate HSEs. PMID:24819925

  6. Skin Barrier Recovery is not Associated with Self-Perceived Stress.


    Benham, Grant


    The primary aim of the current study was to examine the association between self-perceived stress and skin-barrier recovery. From an initial sample of 410 students, 19 high-stress and 12 low-stress Hispanic women completed a behavioural survey and were assessed for recovery of skin barrier following a tape-stripping procedure. No association was found between self-perceived stress and skin barrier recovery at either the 30-min or 3.15-h recovery period. Supplemental analysis showed a positive correlation between skin barrier recovery and self-reported sleep quantity at both recovery periods. Barrier repair reflects a single, minimally invasive, measure of wound healing; thus, our findings do not necessarily contradict the notion that stress measures can be used to predict wound healing more broadly defined. Supplemental analysis demonstrated an intriguing relationship between barrier recovery and the number of hours slept, but these findings are considered tentative and will require replication with more rigorous measures of sleep quantity and quality. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice

    PubMed Central

    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice. PMID:27846299

  8. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice.


    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice.

  9. Topical apigenin improves epidermal permeability barrier homoeostasis in normal murine skin by divergent mechanisms.


    Hou, Maihua; Sun, Richard; Hupe, Melanie; Kim, Peggy L; Park, Kyungho; Crumrine, Debra; Lin, Tzu-Kai; Santiago, Juan Luis; Mauro, Theodora M; Elias, Peter M; Man, Mao-Qiang


    The beneficial effects of certain herbal medicines on cutaneous function have been appreciated for centuries. Among these agents, chrysanthemum extract, apigenin, has been used for skin care, particularly in China, for millennia. However, the underlying mechanisms by which apigenin benefits the skin are not known. In this study, we first determined whether topical apigenin positively influences permeability barrier homoeostasis, and then the basis thereof. Hairless mice were treated topically with either 0.1% apigenin or vehicle alone twice daily for 9 days. At the end of the treatments, permeability barrier function was assessed with either an electrolytic water analyzer or a Tewameter. Our results show that topical apigenin significantly enhanced permeability barrier homoeostasis after tape stripping, although basal permeability barrier function remained unchanged. Improved barrier function correlated with enhanced filaggrin expression and lamellar body production, which was paralleled by elevated mRNA levels for the epidermal ABCA12. The mRNA levels for key lipid synthetic enzymes also were upregulated by apigenin. Finally, both cathelicidin-related peptide and mouse beta-defensin 3 immunostaining were increased by apigenin. We conclude that topical apigenin improves epidermal permeability barrier function by stimulating epidermal differentiation, lipid synthesis and secretion, as well as cutaneous antimicrobial peptide production. Apigenin could be useful for the prevention and treatment of skin disorders characterized by permeability barrier dysfunction, associated with reduced filaggrin levels and impaired antimicrobial defenses, such as atopic dermatitis.

  10. Improved epidermal barrier formation in human skin models by chitosan modulated dermal matrices

    PubMed Central

    Mieremet, Arnout; Rietveld, Marion; Absalah, Samira; van Smeden, Jeroen


    Full thickness human skin models (FTMs) contain an epidermal and a dermal equivalent. The latter is composed of a collagen dermal matrix which harbours fibroblasts. Current epidermal barrier properties of FTMs do not fully resemble that of native human skin (NHS), which makes these human skin models less suitable for barrier related studies. To further enhance the resemblance of NHS for epidermal morphogenesis and barrier formation, we modulated the collagen dermal matrix with the biocompatible polymer chitosan. Herein, we report that these collagen-chitosan FTMs (CC-FTMs) possess a well-organized epidermis and maintain both the early and late differentiation programs as in FTMs. Distinctively, the epidermal cell activation is reduced in CC-FTMs to levels observed in NHS. Dermal-epidermal interactions are functional in both FTM types, based on the formation of the basement membrane. Evaluation of the barrier structure by the organization of the extracellular lipid matrix of the stratum corneum revealed an elongated repeat distance of the long periodicity phase. The ceramide composition exhibited a higher resemblance of the NHS, based on the carbon chain-length distribution and subclass profile. The inside-out barrier functionality indicated by the transepidermal water loss is significantly improved in the CC-FTMs. The expression of epidermal barrier lipid processing enzymes is marginally affected, although more restricted to a single granular layer. The novel CC-FTM resembles the NHS more closely, which makes them a promising tool for epidermal barrier related studies. PMID:28333992

  11. Influence of sportive activity on skin barrier function: a quantitative evaluation of 60 athletes.


    Luebberding, Stefanie; Kolbe, Lea; Kerscher, Martina


    While sports-related diseases are well documented in the literature, no study regarding the physiology of athlete's skin has been published yet. However, some evidence is given for impairment of the skin barrier due to sportive activity accompanied by an increase in sweating. In this explorative study, we investigated the effect of sportive activity on skin physiology, namely stratum corneum hydration, skin surface pH, and sebum content. A total of 60 healthy Caucasian volunteers (35 females, 25 males; mean 27.35 ± 4.09) were enrolled in this study. Measurements were done before and after 45 minutes of endurance cardio training at forehead, chest, forearm, and armpits. Hydration level, sebum secretion, and pH value of hydrolipid acid film were measured with worldwide-acknowledged biophysical measuring methods. Stratum corneum hydration significantly increased after sportive activity. The increase was about 51.9% at the forearm and 31.9% at the chest. Sebum content at the forehead significantly decreased during exercising, from 87.36 μg/cm2 to 62.41 μg/cm2. At all investigated body sites, measured values for skin surface pH increased after sportive activity. Highest pH value was measured in armpits (pH 5.64-5.98) and lowest at forearm (pH 4.75-4.93). Sportive activity is accompanied by significant changes of skin physiology that could stress the barrier function of the skin. Higher skin surface pH and hyperhydration of the stratum corneum as well as increased lipid content on the skin surface are probably caused by an increased sweat production. The impaired skin barrier may also be the reason for some reported sports-related dermatoses.

  12. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.


    Lee, S H; Choi, E H; Feingold, K R; Jiang, S; Ahn, S K


    Iontophoresis increases the delivery of drugs across the stratum corneum, but the pathway by which ionized drugs transit the stratum corneum is unknown. In this study we examined the effect of iontophoresis on the skin barrier and the epidermal calcium gradient. Hairless mice were subjected to iontophoresis for 5-120 min and skin specimens were prepared for electron microscopy. Neither positive nor negative iontophoresis affected transepidermal water loss. Lacunar dilatation and partial distention of the intercellular layers of the stratum corneum were observed in rough proportion to applied time in iontophoresis skin as well as control skin. Additionally, using calcium capture cytochemistry, we demonstrated that both positive and negative iontophoresis caused the disappearance of the epidermal calcium gradient with marked decrease in calcium content in the upper epidermis. Positive iontophoresis was associated with increased calcium in the stratum basale and dermis, whereas negative iontophoresis increased calcium in the stratum corneum. Moreover, as previously shown after barrier disruption and sonophoresis, the decrease in calcium content in the upper epidermis was associated with an increase in lamellar body secretion and the build up of lamellar material at the stratum corneum-stratum granulosum interface. In conclusion, iontophoresis on the skin of hairless mice may induce the change of ionized molecules in the epidermis, as the loss of the calcium gradient, which causes the decrease of skin impedence, gives charged drugs the ability to cross the skin more easily. Also, the structural changes, such as lacunar dilatation, whether they result from hydration or occlusion, may help the transport of charged drugs across the stratum corneum.

  13. In vitro permeation and disposition of niacinamide in silicone and porcine skin of skin barrier-mimetic formulations.


    Haque, Tasnuva; Lane, Majella E; Sil, Bruno C; Crowther, Jonathan M; Moore, David J


    Niacinamide (NIA) is an amide form of vitamin B3 which is used in cosmetic formulations to improve various skin conditions and it has also been shown to increase stratum corneum thickness following repeated application. In this study, three doses (5, 20 and 50μL per cm(2)) of two NIA containing oil-in-water skin barrier-mimetic formulations were evaluated in silicone membrane and porcine ear skin and compared with a commercial control formulation. Permeation studies were conducted over 24h in Franz cells and at the end of the experiment membranes were washed and niacinamide was extracted. For the three doses, retention or deposition of NIA was generally higher in porcine skin compared with silicone membrane, consistent with the hydrophilic nature of the active. Despite the control containing a higher amount of active, comparable amounts of NIA were deposited in skin for all formulations for all doses; total skin absorption values (permeation and retention) of NIA were also comparable across all formulations. For infinite (50μL) and finite (5μL) doses the absolute permeation of NIA from the control formulation was significantly higher in porcine skin compared with both test formulations. This likely reflects differences in formulation components and/or presence of skin penetration enhancers in the formulations. Higher permeation for the 50 and 20μL dose was also evident in porcine skin compared with silicone membrane but the opposite is the case for the finite dose. The findings point to the critical importance of dose and occlusion when evaluating topical formulations in vitro and also the likelihood of exaggerated effects of excipients on permeation at infinite and pseudo-finite dose applications.

  14. Standardized diaper care regimen: a prospective, randomized pilot study on skin barrier function and epidermal IL-1α in newborns.


    Garcia Bartels, Natalie; Massoudy, Lida; Scheufele, Ramona; Dietz, Ekkehart; Proquitté, Hans; Wauer, Roland; Bertin, Christiane; Serrano, José; Blume-Peytavi, Ulrike


    Adaptation of skin barrier function and interleukin-1α (IL-1α) content in diapered and nondiapered skin are poorly characterized in newborns receiving standard skin care. In a monocentric, prospective pilot study 44 healthy, full-term neonates were randomly assigned to skin care with baby wipes (n = 21) or water-moistened washcloth (n = 23) at each diaper change. Transepidermal water loss (TEWL), skin hydration, skin-pH, IL-1α, and epidermal desquamation were measured on days 2, 14, and 28 postpartum. Microbiological colonization was evaluated at baseline and on day 28. Significantly lower TEWL was found on the buttock in the group using baby wipes compared to water. IL-1α and skin hydration significantly increased and pH decreased independent of skin care regimen. IL-1α was significantly higher in diapered skin compared to nondiapered skin. Although skin care with wipes seems to stabilize TEWL better than using water, the skin condition and microbiological colonization were comparable using both cleansing procedures. Increase of epidermal IL-1α may reflect postnatal skin barrier maturation. These data suggest that neither of the two cleansing procedures harms skin barrier maturation within the first four weeks postpartum. Longer observations on larger populations could provide more insight into postnatal skin barrier maturation.

  15. The role of filaggrin in the skin barrier and disease development.


    Armengot-Carbo, M; Hernández-Martín, Á; Torrelo, A


    Filaggrin is a structural protein that is fundamental in the development and maintenance of the skin barrier. The function of filaggrin and its involvement in various cutaneous and extracutaneous disorders has been the subject of considerable research in recent years. Mutations in FLG, the gene that encodes filaggrin, have been shown to cause ichthyosis vulgaris, increase the risk of atopic dermatitis and other atopic diseases, and exacerbate certain conditions. The present article reviews the current knowledge on the role of filaggrin in the skin barrier, FLG mutations, and the consequences of filaggrin deficiency.

  16. Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

    PubMed Central

    van den Bogaard, Ellen H.; Bergboer, Judith G.M.; Vonk-Bergers, Mieke; van Vlijmen-Willems, Ivonne M.J.J.; Hato, Stanleyson V.; van der Valk, Pieter G.M.; Schröder, Jens Michael; Joosten, Irma; Zeeuwen, Patrick L.J.M.; Schalkwijk, Joost


    Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte–mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular mechanism of coal tar therapy is unknown. Using organotypic skin models with primary keratinocytes from AD patients and controls, we found that coal tar activated the aryl hydrocarbon receptor (AHR), resulting in induction of epidermal differentiation. AHR knockdown by siRNA completely abrogated this effect. Coal tar restored filaggrin expression in FLG-haploinsufficient keratinocytes to wild-type levels, and counteracted Th2 cytokine–mediated downregulation of skin barrier proteins. In AD patients, coal tar completely restored expression of major skin barrier proteins, including filaggrin. Using organotypic skin models stimulated with Th2 cytokines IL-4 and IL-13, we found coal tar to diminish spongiosis, apoptosis, and CCL26 expression, all AD hallmarks. Coal tar interfered with Th2 cytokine signaling via dephosphorylation of STAT6, most likely due to AHR-regulated activation of the NRF2 antioxidative stress pathway. The therapeutic effect of AHR activation herein described opens a new avenue to reconsider AHR as a pharmacological target and could lead to the development of mechanism-based drugs for AD. PMID:23348739

  17. Skin Barrier Function Is Not Impaired and Kallikrein 7 Gene Polymorphism Is Frequently Observed in Korean X-linked Ichthyosis Patients Diagnosed by Fluorescence in Situ Hybridization and Array Comparative Genomic Hybridization.


    Lee, Noo Ri; Yoon, Na Young; Jung, Minyoung; Kim, Ji-Yun; Seo, Seong Jun; Wang, Hye-Young; Lee, Hyeyoung; Sohn, Young Bae; Choi, Eung Ho


    X-linked ichthyosis (XLI) is a recessively inherited ichthyosis. Skin barrier function of XLI patients reported in Western countries presented minimally abnormal or normal. Here, we evaluated the skin barrier properties and a skin barrier-related gene mutation in 16 Korean XLI patients who were diagnosed by fluorescence in situ hybridization and array comparative genomic hybridization analysis. Skin barrier properties were measured, cytokine expression levels in the stratum corneum (SC) were evaluated with the tape stripped specimen from skin surface, and a genetic test was done on blood. XLI patients showed significantly lower SC hydration, but normal basal trans-epidermal water loss and skin surface pH as compared to a healthy control group. Histopathology of ichthyosis epidermis showed no acanthosis, and levels of the pro-inflammatory cytokines in the corneal layer did not differ between control and lesional/non-lesional skin of XLI patients. Among the mutations in filaggrin (FLG), kallikrein 7 (KLK7), and SPINK5 genes, the prevalence of KLK7 gene mutations was significantly higher in XLI patients (50%) than in controls (0%), whereas FLG and SPINK5 prevalence was comparable. Korean XLI patients exhibited unimpaired skin barrier function and frequent association with the KLK7 gene polymorphism, which may differentiate them from Western XLI patients.

  18. Skin Barrier Function Is Not Impaired and Kallikrein 7 Gene Polymorphism Is Frequently Observed in Korean X-linked Ichthyosis Patients Diagnosed by Fluorescence in Situ Hybridization and Array Comparative Genomic Hybridization

    PubMed Central


    X-linked ichthyosis (XLI) is a recessively inherited ichthyosis. Skin barrier function of XLI patients reported in Western countries presented minimally abnormal or normal. Here, we evaluated the skin barrier properties and a skin barrier-related gene mutation in 16 Korean XLI patients who were diagnosed by fluorescence in situ hybridization and array comparative genomic hybridization analysis. Skin barrier properties were measured, cytokine expression levels in the stratum corneum (SC) were evaluated with the tape stripped specimen from skin surface, and a genetic test was done on blood. XLI patients showed significantly lower SC hydration, but normal basal trans-epidermal water loss and skin surface pH as compared to a healthy control group. Histopathology of ichthyosis epidermis showed no acanthosis, and levels of the pro-inflammatory cytokines in the corneal layer did not differ between control and lesional/non-lesional skin of XLI patients. Among the mutations in filaggrin (FLG), kallikrein 7 (KLK7), and SPINK5 genes, the prevalence of KLK7 gene mutations was significantly higher in XLI patients (50%) than in controls (0%), whereas FLG and SPINK5 prevalence was comparable. Korean XLI patients exhibited unimpaired skin barrier function and frequent association with the KLK7 gene polymorphism, which may differentiate them from Western XLI patients. PMID:27478344

  19. A comparison of cost and efficacy of three incontinence skin barrier products.


    Zehrer, Cindy L; Lutz, James B; Hedblom, Edwin C; Ding, Li


    Maintaining healthy, intact perineal skin in nursing home residents with incontinence is a challenge. Their condition puts them at risk for developing incontinence dermatitis, possibly predisposing them to develop pressure ulcers. To examine the cost-effectiveness of three perineal skin barriers (a polymer-based barrier film and two petrolatum ointments) used to prevent incontinence dermatitis, a 6-month descriptive study was conducted among residents (N = 250) from four long-term care facilities (nursing homes) in the upper Midwestern US. All residents were incontinent and had intact perineal skin when they enrolled in the study. An economic analysis was performed using time-motion data from a convenience sample of enrolled residents and their caregivers. Residents had an average of 4.1 (+/-2.307) incontinent episodes per day, the occurrence of incontinence dermatitis was 3.3 % and not significantly different between the different protocols of care (P = 0.4448). Results of the economic analysis showed that daily barrier application costs ranged from $0.17 for the barrier film to $0.76 for the ointments evaluated. With labor included in the analysis, costs were also lower for the barrier film that required the least frequent application ($0.26) compared to ointments that required more frequent application ($1.40). Results of this study suggest that the daily or three times weekly barrier film protocols are affordable alternatives to using petrolatum ointments in the prevention of incontinence dermatitis.

  20. Murine filaggrin-2 is involved in epithelial barrier function and down-regulated in metabolically induced skin barrier dysfunction.


    Hansmann, Britta; Ahrens, Kerstin; Wu, Zhihong; Proksch, Ehrhardt; Meyer-Hoffert, Ulf; Schröder, Jens-Michael


    The S100 fused-type proteins (SFTPs) are thought to be involved in the barrier formation and function of the skin. Mutations in the profilaggrin gene, one of the best investigated members of this family, are known to be the major risk factors for ichthyosis vulgaris and atopic dermatitis. Recently, we identified human filaggrin-2 as a new member of the SFTP family. To achieve further insight into its function, here the murine filaggrin-2 was analysed as a possible orthologue. The 5' and 3' ends of the mouse filaggrin-2 cDNA of the BALB/c strain were sequenced and confirmed an organization typical for SFTPs. Murine filaggrin-2 showed an expression pattern mainly in keratinizing epithelia in the upper cell layers on both mRNA and protein levels. The expression in cultured mouse keratinocytes was increased upon elevated Ca(2+) levels. Immunoblotting experiments indicated an intraepidermal processing of the 250-kDa full-length protein. In metabolically (essential fatty acid-deficient diet) induced skin barrier dysfunction, filaggrin-2 expression was significantly reduced, whereas filaggrin expression was up-regulated. In contrast, mechanical barrier disruption with acetone treatment did not affect filaggrin-2 mRNA expression. These results suggest that filaggrin-2 may contribute to epidermal barrier function and its regulation differs, at least in parts, from that of filaggrin.

  1. The Effect of an Emollient Containing Urea, Ceramide NP, and Lactate on Skin Barrier Structure and Function in Older People with Dry Skin.


    Danby, Simon G; Brown, Kirsty; Higgs-Bayliss, Tim; Chittock, John; Albenali, Lujain; Cork, Michael J


    Xerosis affects up to 75% of older people and develops as a result of a skin barrier defect. Emollients are widely used to treat xerosis; however, there is limited understanding of the differences between them and their effects on the skin barrier in older people. This study aimed to compare the effect of a commercially available emollient containing 5% urea, ceramide NP and lactate (test emollient) to an alternative emollient without these additives (control emollient) on the properties of the skin barrier in older people. Two cohorts of 21 volunteers aged >60 years with dry skin were recruited. The first applied the test emollient to one forearm and no treatment to the other for 28 days. The second compared the test emollient to the control emollient observing the same parameters. Effects on the skin barrier were determined by measuring skin barrier function, hydration, skin surface pH and by analysing Fourier transform infrared spectra before and after treatment. A third cohort of 6 young adults was recruited to investigate the effect of a single treatment with the test emollient on the molecular structure of the skin barrier at greater depths by employing the tape-stripping technique. The test emollient hydrated the skin to a significantly greater extent and for a longer period of time compared to the control emollient, an effect associated with a significant elevation of carboxylate groups (a marker of natural moisturizing factor content) within the stratum corneum. Furthermore, the test emollient imparted additional benefits to the structure and function of the skin barrier not exhibited by the control emollient. In conclusion, the test emollient addressed the pathological features of xerotic aged skin, supporting its use as first-line therapy for xerotic skin conditions in this population.

  2. A suction blister model reliably assesses skin barrier restoration and immune response.


    Smith, Tracey J; Wilson, Marques A; Young, Andrew J; Montain, Scott J


    Skin wound healing models can be used to detect changes in immune function in response to interventions. This study used a test-retest format to assess the reliability of a skin suction blister procedure for quantitatively evaluating human immune function in repeated measures type studies. Up to eight suction blisters (~30 mm(2)) were induced via suction on each participant's left and right forearm (randomized order; blister session 1 and 2), separated by approximately one week. Fluid was sampled from each blister, and the top layer of each blister was removed to reveal up to eight skin wounds. Fluid from each wound was collected 4, 7 and 24h after blisters were induced, and proinflammatory cytokines were measured. Transepidermal water loss (TEWL), to assess skin barrier recovery, was measured daily at each wound site until values were within 90% of baseline values (i.e., unbroken skin). Sleep, stress and inflammation (i.e., factors that affect wound healing and immune function), preceding the blister induction, were assessed via activity monitors (Actical, Philips Respironics, Murrysville, Pennsylvania), the Perceived Stress Scale (PSS) and C-reactive protein (CRP), respectively. Area-under-the-curve and TEWL, between blister session 1 and 2, were compared using Pearson correlations and partial correlations (controlling for average nightly sleep, PSS scores and CRP). The suction blister method was considered reliable for assessing immune response and skin barrier recovery if correlation coefficients reached 0.7. Volunteers (n=16; 12 M; 4F) were 23 ± 5 years [mean ± SD]. Time to skin barrier restoration was 4.9 ± 0.8 and 4.8 ± 0.9 days for sessions 1 and 2, respectively. Correlation coefficients for skin barrier restoration, IL-6, IL-8 and MIP-1α were 0.9 (P<0.0001), 0.7 (P=0.008) and 0.9 (P<0.0001), respectively. When average nightly sleep, PSS scores and CRP (i.e., percent difference between sessions 1 and 2) were taken into consideration, correlations in

  3. Abnormal barrier function in the pathogenesis of ichthyosis: Therapeutic implications for lipid metabolic disorders☆

    PubMed Central

    Elias, Peter M.; Williams, Mary L.; Feingold, Kenneth R.


    Ichthyoses, including inherited disorders of lipid metabolism, display a permeability barrier abnormality in which the severity of the clinical phenotype parallels the prominence of the barrier defect. The pathogenesis of the cutaneous phenotype represents the consequences of the mutation for epidermal function, coupled with a “best attempt” by affected epidermis to generate a competent barrier in a terrestrial environment. A compromised barrier in normal epidermis triggers a vigorous set of metabolic responses that rapidly normalizes function, but ichthyotic epidermis, which is inherently compromised, only partially succeeds in this effort. Unraveling mechanisms that account for barrier dysfunction in the ichthyoses has identified multiple, subcellular, and biochemical processes that contribute to the clinical phenotype. Current treatment of the ichthyoses remains largely symptomatic: directed toward reducing scale or corrective gene therapy. Reducing scale is often minimally effective. Gene therapy is impeded by multiple pitfalls, including difficulties in transcutaneous drug delivery, high costs, and discomfort of injections. We have begun to use information about disease pathogenesis to identify novel, pathogenesis-based therapeutic strategies for the ichthyoses. The clinical phenotype often reflects not only a deficiency of pathway end product due to reduced-function mutations in key synthetic enzymes but often also accumulation of proximal, potentially toxic metabolites. As a result, depending upon the identified pathomechanism(s) for each disorder, the accompanying ichthyosis can be treated by topical provision of pathway product (eg, cholesterol), with or without a proximal enzyme inhibitor (eg, simvastatin), to block metabolite production. Among the disorders of distal cholesterol metabolism, the cutaneous phenotype in Congenital Hemidysplasia with Ichthyosiform Erythroderma and Limb Defects (CHILD syndrome) and X-linked ichthyosis reflect metabolite

  4. Barriers to Seeking Help for Skin Cancer Detection in Rural Australia

    PubMed Central

    Fennell, Kate M.; Martin, Kimberley; Wilson, Carlene J.; Trenerry, Camilla; Sharplin, Greg; Dollman, James


    This study explores rural South Australians’ barriers to help-seeking for skin cancer detection. A total of 201 randomly selected rural adults (18–94 years, 66% female) were presented with a skin-cancer-related scenario via telephone and were asked the extent to which various barriers would impede their help-seeking, based on an amended version of the Barriers to Help-Seeking Scale. Older (≥63 years) and less educated participants endorsed barriers more strongly than their younger, more educated counterparts in the following domains; “Concrete barriers and distrust of caregivers”, “Emotional control”, “Minimising problem and Normalisation”, “Need for control and self-reliance” (every domain other than “Privacy”). Socioeconomic disadvantage, gender, and farmer status did not predict stronger overall barriers, but some gender and occupation-related differences were detected at the item level. Farmers were also more likely to endorse the “Minimising problem and normalization” domain than their non-farmer working rural counterparts. Widely endorsed barriers included the tendency to minimise the problem, a desire to remain in control/not be influenced by others, reluctance to show emotion or complain, and having concerns about privacy or waiting times. PMID:28208803

  5. Incontinence pad absorption and skin barrier creams: a non-patient study.


    Dykes, Peter; Bradbury, Sarah


    Exposure of the skin to excessive moisture, such as in cases of incontinence, can damage its natural barrier function and lead to tissue damage and breakdown. Common methods for managing incontinence and preventing related skin damage include the use of incontinence pads and the application of skin barrier creams to reduce exposure to moisture and irritants. Previous reports have indicated that barrier creams can transfer onto incontinence pads from the skin and reduce their absorbency, and thus the efficacy of both products. This study, using non-patient volunteers, investigated the effect on incontinence pad absorbency of Medi Derma-S and Medi Derma-Pro; two products from the Medi Skin Protection range, in comparison with other market-leading products. Results indicated that, while there was a small degree of product transfer onto the incontinence pads, this did not have a major impact on the absorption of synthetic urine. Medi Derma-S and Medi Derma-Pro performed consistently with other similar market-leading products.

  6. Dimethicone barrier cream prevents infection of human skin by schistosome cercariae: evidence from Franz cell studies.


    Ingram, R J; Bartlett, A; Brown, M B; Marriott, C; Whiffield, R J


    One approach to the prevention of schistosomiasis is the use of topical formulations to inhibit cercarial penetration of skin. A number of formulations containing either cercaricidal ingredients or components designed to inhibit penetration have been studied, but with variable results. Such studies have rarely considered the persistence of inhibitory effects through time, and to date, there have been no systematic investigations of barrier formulations. The aim of this study was to use Franz cells to investigate the effect of such barrier creams on the penetration of S. mansoni cercariae into human skin. The results show that a single application of a barrier cream based on dimethicone offers a high level of protection against penetration that is sustained for at least 48 hr.

  7. The effect of environmental humidity and temperature on skin barrier function and dermatitis.


    Engebretsen, K A; Johansen, J D; Kezic, S; Linneberg, A; Thyssen, J P


    Physicians are aware that climatic conditions negatively affect the skin. In particular, people living in equator far countries such as the Northern parts of Europe and North America are exposed to harsh weather during the winter and may experience dry and itchy skin, or deterioration of already existing dermatoses. We searched the literature for studies that evaluated the mechanisms behind this phenomenon. Commonly used meteorological terms such as absolute humidity, relative humidity and dew point are explained. Furthermore, we review the negative effect of low humidity, low temperatures and different seasons on the skin barrier and on the risk of dermatitis. We conclude that low humidity and low temperatures lead to a general decrease in skin barrier function and increased susceptible towards mechanical stress. Since pro-inflammatory cytokines and cortisol are released by keratinocytes, and the number of dermal mast cells increases, the skin also becomes more reactive towards skin irritants and allergens. Collectively, published data show that cold and dry weather increase the prevalence and risk of flares in patients with atopic dermatitis.

  8. The role of the skin barrier in modulating the effects of common skin microbial species on the inflammation, differentiation and proliferation status of epidermal keratinocytes

    PubMed Central


    Background Skin resident microbial species are often thought of either as pathogenic or commensal. However, little is known about the role of the skin barrier in modulating their potential for causing disease. To investigate this question we measured the effects of three microbial species commonly found on the skin (Staphylococcus epidermidis, Staphylococcus aureus, and Propionibacterium acnes) on a reconstructed human epidermal model by either applying the bacteria on the model surface (intact barrier) or adding them to the culture medium (simulating barrier breach). Results When added to the medium, all of the tested species induced inflammatory responses and keratinocyte cell death with species-specific potency. P. acnes and S. epidermidis induced specific alterations in the expression of keratinocyte differentiation and proliferation markers, suggesting a barrier reparation response. S. aureus induced complete keratinocyte cell death. On the contrary, topically applied S. epidermidis and P. acnes caused no inflammatory response even when tested at high concentrations, while topical S. aureus induced a weak reaction. None of the tested species were able to alter the expression of keratinocyte differentiation or expression markers, when applied topically. Conclusions We show that the skin barrier prevents the effects of common skin bacteria on epidermal keratinocyte inflammation, differentiation and proliferation and highlight the importance of skin barrier in defending against the pathogenic effects of common skin bacteria. PMID:24245826

  9. Effect of olive and sunflower seed oil on the adult skin barrier: implications for neonatal skin care.


    Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J


    Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research.

  10. Moisturizers change the mRNA expression of enzymes synthesizing skin barrier lipids.


    Buraczewska, Izabela; Berne, Berit; Lindberg, Magnus; Lodén, Marie; Törmä, Hans


    In a previous study, 7-week treatment of normal human skin with two test moisturizers, Complex cream and Hydrocarbon cream, was shown to affect mRNA expression of certain genes involved in keratinocyte differentiation. Moreover, the treatment altered transepidermal water loss (TEWL) in opposite directions. In the present study, the mRNA expression of genes important for formation of barrier lipids, i.e., cholesterol, free fatty acids and ceramides, was examined. Treatment with Hydrocarbon cream, which increased TEWL, also elevated the gene expression of GBA, SPTLC2, SMPD1, ALOX12B, ALOXE3, and HMGCS1. In addition, the expression of PPARG was decreased. On the other hand, Complex cream, which decreased TEWL, induced only the expression of PPARG, although not confirmed at the protein level. Furthermore, in the untreated skin, a correlation between the mRNA expression of PPARG and ACACB, and TEWL was found, suggesting that these genes are important for the skin barrier homeostasis. The observed changes further demonstrate that long-term treatment with certain moisturizers may induce dysfunctional skin barrier, and as a consequence several signaling pathways are altered.

  11. Fabrication of pseudo-ceramide-based lipid microparticles for recovery of skin barrier function.


    Kim, Do-Hoon; Park, Woo Ram; Kim, Jeong Hwan; Cho, Eun Chul; An, Eun Jung; Kim, Jin-Woong; Oh, Seong-Geun


    The recovery of skin barrier functions was investigated with pseudo-ceramide-based lipid microparticles. The microparticles were prepared by using a fluid bed technique where lipid components (a pseudo-ceramide, cholesterol and a fatty acid) were coated on a sugar seed, and a polymer was subsequently coated on the lipid microparticles. The microparticles contained large amount of pseudo-ceramide, and the pseudo-ceramide was in the form of lamellar structures mixed with other lipid components. In addition, the microparticles were stably dispersed in aqueous media or emulsion systems without any disruption of the microparticles' structures, thereby supplying sufficient amount of the pseudo-ceramide to skins for improving skin barrier functions such as preventing water loss. Such a role of the microparticles was proven by evaluating in vivo the efficacy of the lipid microparticles in reducing a trans-epidermal water loss (TEWL) of impaired murine skins. As a result, the novel pseudo-ceramide-based lipid microparticles for barrier recovery may potentially be applied in the field of dermatology, cosmetics and pharmaceuticals.

  12. Niacinamide-containing facial moisturizer improves skin barrier and benefits subjects with rosacea.


    Draelos, Zoe Diana; Ertel, Keith; Berge, Cindy


    A growing body of literature suggests that some moisturizers can improve stratum corneum barrier function, as well as ameliorate dry skin. The clinical signs and symptoms of rosacea, which include increased facial skin dryness and sensitivity, suggest a possible role for such moisturizers as an adjuvant in the management of this condition. This randomized, investigator-blind, controlled observational study (N = 50) was designed to assess whether a niacinamide-containing facial moisturizer would improve the stratum corneum barrier and thus provide a clinical benefit to subjects with rosacea. Subjects with rosacea applied the test moisturizer to their face and to one forearm twice daily for 4 weeks. The other forearm remained untreated as a control. Barrier function on the forearms was assessed instrumentally and using a dimethyl sulfoxide (DMSO) chemical probe. Stratum corneum hydration also was measured instrumentally. The dermatologist investigator evaluated each subject's rosacea condition over the course of the study, and subjects self-assessed their facial skin condition at study end. Instruments provided objective measures of stratum corneum barrier function and hydration on the face.

  13. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier

    PubMed Central

    Dreier, Jes; Sørensen, Jens A.; Brewer, Jonathan R.


    In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers. PMID:26751684

  14. The role of ceramide chain length distribution on the barrier properties of the skin lipid membranes.


    Mojumdar, E H; Kariman, Z; van Kerckhove, L; Gooris, G S; Bouwstra, J A


    The skin barrier function is provided by the stratum corneum (SC). The lipids in the SC are composed of three lipid classes: ceramides (CERs), cholesterol (CHOL) and free fatty acids (FFAs) which form two crystalline lamellar structures. In the present study, we investigate the effect of CER chain length distribution on the barrier properties of model lipid membranes mimicking the lipid composition and organization of SC. The membranes were prepared with either isolated pig CERs (PCERs) or synthetic CERs. While PCERs have a wide chain length distribution, the synthetic CERs are quite uniform in chain length. The barrier properties were examined by means of permeation studies using hydrocortisone as a model drug. Our studies revealed a reduced barrier in lipid membranes prepared with PCERs compared to synthetic CERs. Additional studies revealed that a wider chain length distribution of PCERs results in an enhanced hexagonal packing and increased conformational disordering of the lipid tails compared to synthetic CERs, while the lamellar phases did not change. This demonstrates that the chain length distribution affects the lipid barrier by reducing the lipid ordering and density within the lipid lamellae. In subsequent studies, the effect of increased levels of FFAs or CERs with a long acyl chain in the PCERs membranes was also studied. These changes in lipid composition enhanced the level of orthorhombic packing, reduced the conformational disordering and increased the barrier of the lipid membranes. In conclusion, the CER chain length distribution is an important key factor for maintaining a proper barrier.

  15. IL-25 induces both inflammation and skin barrier dysfunction in atopic dermatitis.


    Deleuran, Mette; Hvid, Malene; Kemp, Kaare; Christensen, Gitte B; Deleuran, Bent; Vestergaard, Christian


    Atopic dermatitis (AD) is a chronic relapsing skin disease characterized by having both an epidermal and a dermal component, shown as a barrier deficiency and inflammation. The mechanisms resulting in skewing the immune response in a Th2 direction in AD are still not fully elucidated. We suggest that IL-25 could be a major target in AD. IL-25 is produced by cells within the dermis of AD patients, and we suggest these to be dendritic cells (DCs). Furthermore, we show that IL-25 can inhibit filaggrin synthesis in keratinocytes. These results point towards a central role of IL-25 producing DCs that can induce both a Th2 response and inhibit filaggrin synthesis. We believe this strongly supports a role for IL-25 in AD, bridging the gap between inflammation and impaired skin barrier function.

  16. Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.


    Tanaka, Reiko J; Ono, Masahiro; Harrington, Heather A


    Atopic dermatitis (AD) is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema) to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs), whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical) stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier in AD and

  17. Investigating the barrier function of skin lipid models with varying compositions.


    Groen, Daniël; Poole, Dana S; Gooris, Gert S; Bouwstra, Joke A


    The lipids in the uppermost layer of the skin, the stratum corneum (SC), play an important role in the barrier function. The main lipid classes in stratum corneum are ceramides, cholesterol, and free fatty acids. In previous publications, a lipid model was presented, referred to as the stratum corneum substitute (SCS), that closely mimics the SC lipid organization and SC barrier function. In the present study, we use the SCS to study the effect of changes in lipid organization on the lipid barrier function using benzoic acid as permeation compound. First, in the SCS, we increased the level of one of the three major lipid classes keeping the ratio between the other lipid classes constant. An increased cholesterol level resulted in an increase in phase-separated cholesterol and a reduction in the permeability. An increase in ceramide or free fatty acid level resulted in the formation of additional phases, but had no significant influence on the permeability. We also examined models that mimic selected changes in lipid composition reported for dry or diseased skin. The SCS that mimics the composition in recessive X-linked ichthyosis skin displayed a twofold increase in permeability. This increase is possibly related to the formation of an additional, less ordered phase in this model.

  18. Intercellular skin barrier lipid composition and organization in Netherton syndrome patients.


    van Smeden, Jeroen; Janssens, Michelle; Boiten, Walter A; van Drongelen, Vincent; Furio, Laetitia; Vreeken, Rob J; Hovnanian, Alain; Bouwstra, Joke A


    Netherton syndrome (NTS) is a rare genetic skin disease caused by mutations in the serine protease inhibitor Kazal-type 5 gene, which encodes the lympho-epithelial Kazal-type-related inhibitor. NTS patients have profoundly impaired skin barrier function. As stratum corneum (SC) lipids have a crucial role in the skin barrier function, we investigated the SC lipid composition and organization in NTS patients. We studied the SC lipid composition by means of mass spectrometry, and the lipid organization was examined by infrared spectroscopy and X-ray diffraction. Decreased free fatty acid (FFA) chain length and increased levels of monounsaturated FFAs were observed in the SC of NTS patients compared with controls. Furthermore, the level of short-chain ceramides (CERs) was enhanced in NTS patients and a strong reduction in long-chain CER levels was seen in several patients. The changes in lipid composition modified the lipid organization leading to an increased disordering of the lipids compared with the controls. In addition, in a subgroup of patients the organization of the lipid layers changed dramatically. The altered FFA and CER profiles in NTS patients corresponded to changes in the expression of enzymes involved in SC lipid processing. The observed changes in lipid composition, lipid organization, and enzyme expression are likely to contribute to the barrier dysfunction in NTS.

  19. Profile of skin barrier proteins and cytokines in adults with atopic dermatitis.


    Orfali, Raquel L; Zaniboni, Mariana C; Aoki, Valeria


    Atopic dermatitis (AD), an inflammatory skin disorder with chronic course and characterized by intense pruritus, is a dermatosis of high prevalence of childhood. However, persistence of the disease in adolescents and adults may occur, and more studies regarding the interactions of the complex triggering factors, especially between the adaptive and innate immune alterations and skin barrier defects are needed. In this review the authors summarize the major novel findings of a dysfunctional skin barrier in AD, with emphasis on tight junction components, such as claudins and on proteins of the keratinocyte differentiation, such as filaggrin. This review also provides an update on the characterization of immune response in adults with atopic dermatitis. The adaptive immune dysfunction in AD, classically known as a Th2/Th1 model, has changed its profile, with recent reported cytokines such as interleukins 17, 22, and 31; as for the innate immune system scenario in AD, the characterization of skin microbiome opens new frontiers for the understanding of such a complex inflammatory disease.

  20. Analysis of gene expression dynamics revealed delayed and abnormal epidermal repair process in aged compared to young skin.


    Sextius, Peggy; Marionnet, Claire; Tacheau, Charlotte; Bon, François-Xavier; Bastien, Philippe; Mauviel, Alain; Bernard, Bruno A; Bernerd, Françoise; Dubertret, Louis


    With aging, epidermal homeostasis and barrier function are disrupted. In a previous study, we analyzed the transcriptomic response of young skin epidermis after stratum corneum removal, and obtained a global kinetic view of the molecular processes involved in barrier function recovery. In the present study, the same analysis was performed in aged skin in order to better understand the defects which occur with aging. Thirty healthy male volunteers (67 ± 4 years old) were involved. Tape-strippings were carried out on the inner face of one forearm, the other unstripped forearm serving as control. At 2, 6, 18, 30 and 72 h after stripping, TEWL measurements were taken, and epidermis samples were collected. Total RNA was extracted and analyzed using DermArray(®) cDNA microarrays. The results highlighted that barrier function recovery and overall kinetics of gene expression were delayed following stripping in aged skin. Indeed, the TEWL measurements showed that barrier recovery in the young group appeared to be dramatically significant during the overall kinetics, while there were no significant evolution in the aged group until 30 h. Moreover, gene expression analysis revealed that the number of modulated genes following tape stripping increased as a function of time and reached a peak at 6 h after tape stripping in young skin, while it was at 30 h in aged skin, showing that cellular activity linked to the repair process may be engaged earlier in young epidermis than in aged epidermis. A total of 370 genes were modulated in the young group. In the aged group, 382 genes were modulated, whose 184 were also modulated in the young group. Only eight genes that were modulated in both groups were significantly differently modulated. The characterization of these genes into 15 functional families helped to draw a scenario for the aging process affecting epidermal repair capacity.

  1. PNPLA1 has a crucial role in skin barrier function by directing acylceramide biosynthesis

    PubMed Central

    Hirabayashi, Tetsuya; Anjo, Tatsuki; Kaneko, Arisa; Senoo, Yuuya; Shibata, Akitaka; Takama, Hiroyuki; Yokoyama, Kohei; Nishito, Yasumasa; Ono, Tomio; Taya, Choji; Muramatsu, Kazuaki; Fukami, Kiyoko; Muñoz-Garcia, Agustí; Brash, Alan R.; Ikeda, Kazutaka; Arita, Makoto; Akiyama, Masashi; Murakami, Makoto


    Mutations in patatin-like phospholipase domain-containing 1 (PNPLA1) cause autosomal recessive congenital ichthyosis, but the mechanism involved remains unclear. Here we show that PNPLA1, an enzyme expressed in differentiated keratinocytes, plays a crucial role in the biosynthesis of ω-O-acylceramide, a lipid component essential for skin barrier. Global or keratinocyte-specific Pnpla1-deficient neonates die due to epidermal permeability barrier defects with severe transepidermal water loss, decreased intercellular lipid lamellae in the stratum corneum, and aberrant keratinocyte differentiation. In Pnpla1−/− epidermis, unique linoleate-containing lipids including acylceramides, acylglucosylceramides and (O-acyl)-ω-hydroxy fatty acids are almost absent with reciprocal increases in their putative precursors, indicating that PNPLA1 catalyses the ω-O-esterification with linoleic acid to form acylceramides. Moreover, acylceramide supplementation partially rescues the altered differentiation of Pnpla1−/− keratinocytes. Our findings provide valuable insight into the skin barrier formation and ichthyosis development, and may contribute to novel therapeutic strategies for treatment of epidermal barrier defects. PMID:28248300

  2. Involvement of skin barrier dysfunction in itch-related scratching in special diet-fed hairless mice.


    Fujii, Masanori; Nabe, Takeshi; Tomozawa, Junko; Kohno, Shigekatsu


    HR-1 hairless mice fed with a special diet develop atopic-like dry skin, characterized by increased transepidermal water loss, and prolonged bouts of spontaneous scratching. In this study, the role of the skin barrier dysfunction in the prolongation of scratching was evaluated. Although the prolonged scratching was dose-dependently inhibited by opioid receptor antagonist naloxone, neither H(1) receptor antagonist, mepyramine, nor 5-HT(1/2) receptor antagonist, methysergide, affected it. Thus, the prolonged scratching could be itch-related response independent of histamine and serotonin. The application of petrolatum ointment on the skin temporarily alleviated the increase of transepidermal water loss for 60 min after treatment. Due to this alleviation in barrier dysfunction, the prolongation of scratching was significantly suppressed. However, when the barrier dysfunction relapsed, the scratching worsened. Taken together, a skin barrier dysfunction is associated with the itch-related response.

  3. Barriers to healthcare contribute to delays in follow-up among women with abnormal cancer screening: data from the Patient Navigation Research Program

    PubMed Central

    Ramachandran, Ambili; Snyder, Frederick; Katz, Mira L.; Darnell, Julie; Dudley, Donald; Patierno, Steven R.; Sanders, Mechelle R; Valverde, Patricia A; Simon, Melissa A; Warren-Mears, Victoria; Battaglia, Tracy A.


    Background There is limited understanding of the association between barriers to care and clinical outcomes within patient navigation programs. Methods Secondary analyses of data from the intervention arms of the Patient Navigation Research Program (PNRP), including navigated participants with abnormal breast and cervical cancer screening tests from 2007 to 2010. Independent variables were (a) number of unique barriers to care (0, 1, 2, or 3+) documented during patient navigation encounters and (b) presence of socio-legal barriers originating from social policy (yes/no). Median time to diagnostic resolution of index screening abnormalities was estimated using Kaplan-Meier cumulative incidence curves. Multivariable Cox proportional hazards regression examined the impact of barriers on time to resolution, controlling for socio-demographics and stratifying by study center. Results Among 2600 breast participants, three-quarters had barriers to care (25% 1 barrier, 16% 2 barriers and 34% 3+ barriers). Among 1387 cervical participants, more than half had barriers (31% 1 barrier, 11% 2 barriers, and 13% 3+ barriers). Among breast participants, the presence of barriers was associated with less timely resolution for any number of barriers compared to no barriers. Among cervical participants, only the presence of 2 or more barriers was associated with less timely resolution. Both types of barriers, socio-legal and other barriers, were associated with delay among breast and cervical participants. Conclusions Navigated women with barriers resolve cancer screening abnormalities at a slower rate compared to navigated women with no barriers. Further innovations in navigation care are necessary to maximize the impact of patient navigation programs nationwide. PMID:26385420

  4. Gender-Based Differences and Barriers in Skin Protection Behaviors in Melanoma Survivors.


    Chen, Jeffrey; Shih, Johnny; Tran, Andrew; Mullane, Aaron; Thomas, Christina; Aydin, Nail; Misra, Subhasis


    Purpose. Skin protection behaviors and environmental exposure play a crucial role in the development and subsequent management of melanoma. This study investigates gender-based differences in skin protection behaviors after melanoma treatment. Methods. Patients diagnosed and surgically treated for cutaneous melanomas over the last six years in a geographically high risk area were surveyed over telephone using a standardized script. Results. Of 150 survey results obtained, there were 82 males and 68 females. Overall, 87% of participants reported skin self-examination for abnormal markings more often and 94% reported wearing skin protective clothing more often, with females being more than males. Females limited outdoor activity more often than males, 79% to 54%, p < 0.05. When outside, females sought shade more often than males, 75% to 56%, p < 0.05. However, males wore a wide brim hat more often than females, 52% to 28%, p < 0.05. Interestingly, 60% of participants reported wearing SPF 30 sunscreen less often, p < 0.05. Conclusion. Larger percentage of females adopted behavioral changes to prevent future melanoma. Those living in high risk areas and with outdoor occupations need particular attention to skin care. Population based screening should be adopted to deal with this rising public health crisis.

  5. Gender-Based Differences and Barriers in Skin Protection Behaviors in Melanoma Survivors

    PubMed Central


    Purpose. Skin protection behaviors and environmental exposure play a crucial role in the development and subsequent management of melanoma. This study investigates gender-based differences in skin protection behaviors after melanoma treatment. Methods. Patients diagnosed and surgically treated for cutaneous melanomas over the last six years in a geographically high risk area were surveyed over telephone using a standardized script. Results. Of 150 survey results obtained, there were 82 males and 68 females. Overall, 87% of participants reported skin self-examination for abnormal markings more often and 94% reported wearing skin protective clothing more often, with females being more than males. Females limited outdoor activity more often than males, 79% to 54%, p < 0.05. When outside, females sought shade more often than males, 75% to 56%, p < 0.05. However, males wore a wide brim hat more often than females, 52% to 28%, p < 0.05. Interestingly, 60% of participants reported wearing SPF 30 sunscreen less often, p < 0.05. Conclusion. Larger percentage of females adopted behavioral changes to prevent future melanoma. Those living in high risk areas and with outdoor occupations need particular attention to skin care. Population based screening should be adopted to deal with this rising public health crisis. PMID:27648306

  6. In vivo barrier challenge and long-term recovery in human facial skin.


    Gorcea, Mihaela; Hadgraft, Jonathan; Lane, Majella E; Moore, David J


    Recently, we developed a biophysical approach to characterize in vivo facial cheek skin as a function of stratum corneum (SC) depth, barrier function and during a 24-h recovery period. The current study extends this work and characterizes the human facial cheek after barrier challenge and, for the first time, facial SC barrier recovery over a 4-week period. Changes in the corneocyte size over the 4-week recovery period, and correlations with changes in Trans-Epidermal Water Loss (TEWL) were monitored. This approach allows complete characterization of SC barrier function after a full biological regeneration of the SC barrier following tape stripping. The structural and compositional changes in facial cheek were investigated using Attenuated Total Reflectance-Fourier Transform Infra Red (ATR-FTIR) spectroscopy, tape stripping, TEWL measurements and image analysis combined with optical microscopy to characterize the SC depth profile during the tape stripping stress and over 4-week recovery period. TEWL increased significantly from baseline after sequential tape stripping. Corneocyte size decreased with successive tape stripping. An inverse direct correlation was determined between TEWL and corneocyte surface area. After 4 weeks, the corneocyte size and TEWL for the facial cheek recovered 100% from the tape stripping procedure. The in vivo ATR-FTIR data demonstrated that lipid and sebum components on the surface of the facial cheek SC recovered within 24 h post tape stripping, whereas protein (Amide II) and water components recovered after 1 week.

  7. Electrical, magnetic, photomechanical and cavitational waves to overcome skin barrier for transdermal drug delivery.


    Wong, Tin Wui


    Transdermal drug delivery is hindered by the barrier property of the stratum corneum. It limits the route to transport of drugs with a log octanol-water partition coefficient of 1 to 3, molecular weight of less than 500Da and melting point of less than 200°C. Active methods such as iontophoresis, electroporation, sonophoresis, magnetophoresis and laser techniques have been investigated for the past decades on their ability, mechanisms and limitations in modifying the skin microenvironment to promote drug diffusion and partition. Microwave, an electromagnetic wave characterized by frequencies range between 300MHz and 300GHz, has recently been reported as the potential skin permeation enhancer. Microwave has received a widespread application in food, engineering and medical sectors. Its potential use to facilitate transdermal drug transport is still in its infancy stage of evaluation. This review provides an overview and update on active methods utilizing electrical, magnetic, photomechanical and cavitational waves to overcome the skin barrier for transdermal drug administration with insights into mechanisms and future perspectives of the latest microwave technique described.

  8. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.


    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D


    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  9. Loss of sirtuin 1 (SIRT1) disrupts skin barrier integrity and sensitizes mice to epicutaneous allergen challenge

    PubMed Central

    Ming, Mei; Zhao, Baozhong; Shea, Christopher R.; Shah, Palak; Qiang, Lei; White, Steven R.; Sims, Diane M.; He, Yu-Ying


    Background Skin barrier integrity requires a highly coordinated molecular system involving the structural protein filaggrin. Mutational loss of the skin barrier protein filaggrin predisposes individuals to the development of atopic dermatitis (AD). Objective to determine the role of SIRT1 in skin barrier function, filaggrin expression, and the development of AD. Methods Skin histology of mice with skin-specific SIRT1 deletion and wild-type controls was examined by Hematoxyline and Eosin (H&E). Protein and mRNA abundance was analyzed by immunoblot, immunohistochemistry, immunofluorescence, and RT-PCR. Serum antibody levels were assessed by ELISA. Results Here we show that filaggrin is regulated by the protein deacetylase SIRT1, and that SIRT1 is critical for skin barrier integrity. Epidermis-specific SIRT1 ablation causes AD-like skin lesions in mice, and mice with epidermal SIRT1 deletion are sensitive to percutaneous challenge by the protein allergen ovalbumin. In normal human keratinocytes and mouse skin, SIRT1 knockdown or genetic deletion down-regulates filaggrin, and regulation of filaggrin expression by SIRT1 requires the deacetylase activity of SIRT1. SIRT1 also promotes the activation of the aryl hydrocarbon receptor (AhR), and the AhR ligand restores filaggrin expression in SIRT1-inhibited cells. As compared with normal human skin, SIRT1 is down-regulated in the lesions of atopic dermatitis as well as non-atopic dermatitis. Conclusion Our findings demonstrate a critical role of SIRT1 in skin barrier maintenance, open up new opportunities to use SIRT1 as a pharmacological target, and may facilitate the development of mechanism-based agents for AD prevention and therapy. PMID:25445829

  10. Efficacy of Topical Application of Emu Oil on Areola Skin Barrier in Breastfeeding Women.


    Zanardo, Vincenzo; Giarrizzo, David; Maiolo, Luigi; Straface, Gianluca


    Appropriate hydration and skin surface pH are of fundamental importance in preventing areola skin barrier damage and breastfeeding success. We studied the dermal effects of emu oil on areola skin soon after birth in 70 at-term breastfeeding mothers by noninvasive bioengineering method. Emu oil-based cream was found to be effective in improving stratum corneum hydration of breast areolae (mean ± standard deviation, from 56.9 ± 18.2 to 65.0 ± 17.2 conventional units, P < .003) and did not affect skin pH, temperature, or elasticity. The significant improvement in hydration values was more pronounced in the puerperae presenting with basal hydration in the lower quartiles (mean ± standard deviation, from 41.6 ± 17.2 to 59.6 ± 21.2 conventional units, P < .001). Further studies are warranted to confirm the long-term beneficial effects of this preparation in a very sensitive patient population.

  11. Safety evaluation of perfluoropolyethers, liquid polymers used in barrier creams and other skin-care products.


    Malinverno, G; Pantini, G; Bootman, J


    Fomblin HC products are a 'family' of high-purity perfluoropolyethers manufactured for barrier cream and other personal care applications which involve direct application to the skin. To confirm the safety of such use, representative Fomblin HC products were tested in experimental animals for acute toxicity, primary and repeated insult irritancy, sensitization and photosensitization, subacute oral toxicity and comedogenicity; mutagenicity was examined in vitro, and irritancy or sensitization was also investigated on human skin (in patch tests with volunteers). A high molecular weight Fomblin HC only was tested in rats for subacute oral toxicity and in man for dermal effects. Single oral doses of 15 g/kg body weight were without evident toxicity to rats, as were single dermal applications or an ip injection at 5 g/kg. No primary irritant action was seen in rabbits or man, and similarly there was no evidence of skin sensitization or photosensitization in guinea pigs, or sensitization in man. No mutagenic action on Salmonella strains of tester bacteria was seen. In repeat dose irritancy or oral toxicity tests in rabbits or rats, no adverse effects of Fomblin HC products were noted; in particular, daily oral administration (1000 mg/kg/day) to rats over 28 days produced no significant reaction. No comedogenic action was found. From the known chemistry of the perfluoropolyethers, the test programme reported here and the limited published data, it is concluded that the intended use of Fomblin HC products in formulations applied to human skin has a high margin of safety.

  12. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.


    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor


    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  13. The effect of damaged skin barrier induced by subclinical irritation on the sequential irritant contact dermatitis.


    Yan-yu, Wu; Xue-min, Wang; Yi-Mei, Tan; Ying, Cheng; Na, Liu


    Skin damage caused by a single specific stimulus has been extensively studied. However, many additional mild skin irritants are experienced every day before obvious irritant contact dermatitis (ICD) appears. The effect that these previously experienced mild irritations have on the incidence and severity of sequential ICD remains undefined. The purpose of this work was to explore whether the effects of skin barrier damage induced by either the open patch test with 1% sodium lauryl sulfate (SLS), tape stripping test (TAP) (10×), or irradiation with 0.75 median erythemal dose UVB (MED) will affect the severity of sequential irritant dermatitis induced by a 0.5% SLS occlusive patch test (PT). Nine treatments were applied to nine different locations of the ventral forearm of each subject at random. The nine treatment types were as follows: open patch test with 1% SLS; 10× TAP; UVB irradiation with 0.75 MED; open patch test with 1% SLS + PT with 0.5% SLS (SLSPT); 10× TAP + PT with 0.5% SLS (TAPPT); UVB irradiation with 0.75 MED + PT with 0.5% SLS (UVPT); PT with distilled water (DISPT); PT with 0.5% SLS (PT); and the CONTROL (no treatment). After 5 days of subclinical irritation, the PT was applied on day 6. Transepidermal water loss (TEWL), capacitance (CAP), and skin color (a*) were measured at baseline and on days 6, 7, and 8. After the PT, indices of irritancy of PT, UVPT, SLSPT, and TAPPT were 60, 80, 87 and 100%, respectively. The index of irritancy of TAPPT and SLSPT were significantly higher than that of PT (p < 0.05). Clinical scores of SLSPT and TAPPT were also significantly higher than PT (p < 0.05). After 5 days of irritation, TEWL of SLS, TAP, SLSPT, and TAPPT were increased significantly compared to that of baseline. After the PT, D-value of TEWL between day 8 and day 6 ((≥6-8)TEWL) of SLSPT and TAPPT were greater than that of PT, and D-value of TEWL between day 8 and day 7 ((≥7-8)TEWL) of SLSPT and TAPPT were less than that of PT values. After the

  14. Nicotinic Acid Receptor Abnormalities in Human Skin Cancer: Implications for a Role in Epidermal Differentiation

    PubMed Central

    Bermudez, Yira; Benavente, Claudia A.; Meyer, Ralph G.; Coyle, W. Russell; Jacobson, Myron K.; Jacobson, Elaine L.


    Background Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through Gi-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells. Results Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional Gi-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional. Conclusions The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s) of nicotinic acid receptors in human skin homeostasis. PMID:21655214

  15. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.


    van Smeden, Jeroen; Bouwstra, Joke A


    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  16. The effects of polar excipients transcutol and dexpanthenol on molecular mobility, permeability, and electrical impedance of the skin barrier.


    Björklund, Sebastian; Pham, Quoc Dat; Jensen, Louise Bastholm; Knudsen, Nina Østergaard; Nielsen, Lars Dencker; Ekelund, Katarina; Ruzgas, Tautgirdas; Engblom, Johan; Sparr, Emma


    In the development of transdermal and topical products it is important to understand how formulation ingredients interact with the molecular components of the upper layer of the skin, the stratum corneum (SC), and thereby influence its macroscopic barrier properties. The aim here was to investigate the effect of two commonly used excipients, transcutol and dexpanthenol, on the molecular as well as the macroscopic properties of the skin membrane. Polarization transfer solid-state NMR methods were combined with steady-state flux and impedance spectroscopy measurements to investigate how these common excipients influence the molecular components of SC and its barrier function at strictly controlled hydration conditions in vitro with excised porcine skin. The NMR results provide completely new molecular insight into how transcutol and dexpanthenol affect specific molecular segments of both SC lipids and proteins. The presence of transcutol or dexpanthenol in the formulation at fixed water activity results in increased effective skin permeability of the model drug metronidazole. Finally, impedance spectroscopy data show clear changes of the effective skin capacitance after treatment with transcutol or dexpanthenol. Based on the complementary data, we are able to draw direct links between effects on the molecular properties and on the macroscopic barrier function of the skin barrier under treatment with formulations containing transcutol or dexpanthenol.

  17. Effect of diaper cream and wet wipes on skin barrier properties in infants: a prospective randomized controlled trial.


    Garcia Bartels, Natalie; Lünnemann, Lena; Stroux, Andrea; Kottner, Jan; Serrano, José; Blume-Peytavi, Ulrike


    The effect of different diaper care procedures on skin barrier function in infants has been minimally investigated and may be assessed using objective methods. In a single-center, prospective trial, 89 healthy 9-month-old infants (±8 wks) were randomly assigned to three diaper care regimens: group I used water-moistened washcloths at diaper changes (n = 30), group II additionally applied diaper cream twice daily (n = 28), and group III used wet wipes and diaper cream twice daily (n = 31). Transepidermal water loss (TEWL), skin hydration (SCH), skin pH, interleukin 1α (IL-1α) levels, and microbiologic colonization were measured in diapered skin (upper outer quadrant of the buttocks), nondiapered skin (upper leg), and if diaper dermatitis (DD) occurred, using the most affected skin area at day 1 and weeks 4 and 8. Skin condition was assessed utilizing a neonatal skin condition score and diaper rash grade. On diapered skin, SCH decreased in groups II and III, whereas TEWL values were reduced in group II only. Skin pH increased in groups II and III. In general, SCH, skin pH, and IL-1α levels were higher in healthy diapered skin than in nondiapered skin. The incidence and course of DD was comparable in all groups. Areas with DD had greater TEWL and skin pH than unaffected skin areas. Infants who received diaper cream had lower SCH and TEWL and higher pH levels in the diapered area than on nondiapered skin. No correlation with the occurrence of DD was found.

  18. Emollient enhancement of the skin barrier from birth offers effective atopic dermatitis prevention

    PubMed Central

    Simpson, Eric L.; Chalmers, Joanne R.; Hanifin, Jon M.; Thomas, Kim S.; Cork, Michael J.; McLean, W.H. Irwin; Brown, Sara J.; Chen, Zunqiu; Chen, Yiyi; Williams, Hywel C.


    Background Atopic dermatitis (atopic eczema) is a chronic inflammatory skin disease that has reached epidemic proportions in children worldwide and is increasing in prevalence. Because of the significant socioeconomic effect of atopic dermatitis and its effect on the quality of life of children and families, there have been decades of research focused on disease prevention, with limited success. Recent advances in cutaneous biology suggest skin barrier defects might be key initiators of atopic dermatitis and possibly allergic sensitization. Objective Our objective was to test whether skin barrier enhancement from birth represents a feasible strategy for reducing the incidence of atopic dermatitis in high-risk neonates. Methods We performed a randomized controlled trial in the United States and United Kingdom of 124 neonates at high risk for atopic dermatitis. Parents in the intervention arm were instructed to apply full-body emollient therapy at least once per day starting within 3 weeks of birth. Parents in the control arm were asked to use no emollients. The primary feasibility outcome was the percentage of families willing to be randomized. The primary clinical outcome was the cumulative incidence of atopic dermatitis at 6 months, as assessed by a trained investigator. Results Forty-two percent of eligible families agreed to be randomized into the trial. All participating families in the intervention arm found the intervention acceptable. A statistically significant protective effect was found with the use of daily emollient on the cumulative incidence of atopic dermatitis with a relative risk reduction of 50% (relative risk, 0.50; 95% CI, 0.28-0.9; P = .017). There were no emollient-related adverse events and no differences in adverse events between groups. Conclusion The results of this trial demonstrate that emollient therapy from birth represents a feasible, safe, and effective approach for atopic dermatitis prevention. If confirmed in larger trials

  19. Effect of occupational exposure to rayon manufacturing chemicals on skin barrier to evaporative water loss.


    Chou, Tzu-Chieh; Shih, Tung-Sheng; Tsai, Jui-Chen; Wu, Jyun-De; Sheu, Hamm-Min; Chang, Ho-Yuan


    To evaluate the effects of the occupational exposure to rayon manufacturing chemicals (RMC, containing predominantly carbon disulfide (CS(2)) and minor sulfuric acid) in a rayon factory on the basal transepidermal water loss (TEWL), barrier integrity (BI), and sequential increasing TEWL profiles. Six Thais and five Chinese workers in the spinning department of a rayon manufacturing plant and five healthy unexposed controls were recruited as the test subjects. An area of 4.5 x 5.5 cm on the mid-side of the volar forearm on the right hand was stripped by means of moderate pressure with commercially available adhesive tape by the same technician throughout the experiment. The skin was progressively stripped until glistening. TEWL was measured at every three and five tape strips on the right hand. The corresponding site on the left hand was measured parallel as the self-control. We found significant differences in basal TEWL and in BI between Chinese workers and Chinese controls, and between Thai workers and Chinese workers, respectively. Two-stage patterns of progressive TEWL profiles were found in such a chronic and repeated occupational exposure to RMC containing CS(2). The occupational exposure to RMC could result in the perturbation of the skin barrier function. Basal TEWL might be more sensitive to chronic skin irritant exposure. The TEWL profile achieved to the glistening stage might be necessary to avoid erroneous pattern estimation. Due to the lack of Thais control in this study, the racial difference in response to the RMC warrants further study.

  20. mTORC1 and mTORC2 regulate skin morphogenesis and epidermal barrier formation

    PubMed Central

    Ding, Xiaolei; Bloch, Wilhelm; Iden, Sandra; Rüegg, Markus A.; Hall, Michael N.; Leptin, Maria; Partridge, Linda; Eming, Sabine A.


    Mammalian target of rapamycin (mTOR), a regulator of growth in many tissues, mediates its activity through two multiprotein complexes, mTORC1 or mTORC2. The role of mTOR signalling in skin morphogenesis and epidermal development is unknown. Here we identify mTOR as an essential regulator in skin morphogenesis by epidermis-specific deletion of Mtor in mice (mTOREKO). mTOREKO mutants are viable, but die shortly after birth due to deficits primarily during the early epidermal differentiation programme and lack of a protective barrier development. Epidermis-specific loss of Raptor, which encodes an essential component of mTORC1, confers the same skin phenotype as seen in mTOREKO mutants. In contrast, newborns with an epidermal deficiency of Rictor, an essential component of mTORC2, survive despite a hypoplastic epidermis and disruption in late stage terminal differentiation. These findings highlight a fundamental role for mTOR in epidermal morphogenesis that is regulated by distinct functions for mTORC1 and mTORC2. PMID:27807348

  1. Effects of various grit-containing cleansers on skin barrier function.


    Wigger-Alberti, W; Fischer, T; Greif, C; Maddern, P; Elsner, P


    Products intended for individuals in contact with strongly adhering dirt often contain grit. Various clinical test methods have been developed for evaluating the potential of personal washing products to induce skin irritation. In the present study, differences in the irritant effects of washing products containing naturally-derived grit and synthetic grit were investigated in a forearm wash test. The forearms of 16 test subjects were washed in a total of 18 treatments (4 per day for 4 days, with 2 treatments on the 5th day). Treatment consisted of continuous washing for 2 min by a technician, who gently slid his fingertips with the lather up and down the forearm. Non-invasive instrumental measurements of skin barrier function were performed. Repetitive washing for 1 week lead to increased TEWL values, skin redness and decreased stratum corneum hydration. Results indicate differences in irritancy potential due to different types of grit, their surface and concentration. It is concluded that the repeated wash test seems to be adequate for rating personal washing products that contain grit.

  2. The effect of obesity on skin disease and epidermal permeability barrier status in children.


    Nino, Massimiliano; Franzese, Adriana; Ruggiero Perrino, Nunzia; Balato, Nicola


    Obese adult patients have many dermatoses, such as skin tags, candida infection, cellulite, and intertrigo, but only limited data have been published on obese children and the barrier function of their skin. Sixty-five overweight and obese children (n = 40, BMI 85th-95th percentile; n = 25, BMI > 95th percentile) (aged 8-15; mean age 11.6) and 30 normal-weight controls (aged 7-15; mean age 11.1) underwent a clinical evaluation and calculation of transepidermal water loss (TEWL). Higher weight percentile was associated with a higher incidence of some dermatoses. Skin tags were found in 40% of subjects in the 95th percentile and 2.5% of those in the 85th percentile. Striae distensae were observed in 32% of patients in the 95th percentile and 22.5% of those in the 85th percentile. Plantar hyperkeratosis was observed only in 20% of the 95th percentile subjects and was not observed in the other groups. TEWL values at the forearm site were significantly higher (p < 0.05) in obese children than in the control group, but no significant differences in TEWL values according to BMI level were found between the two groups of obese children. Degree of obesity influences the incidence of some associated dermatoses; skin tags, striae distensae, and plantar hyperkeratosis were more frequent in children in the 95th percentile of BMI. Obesity increases the TEWL rate, suggesting that obese children might become more easily overheated as weight increases, with more profuse sweating because of the thick layers of subcutaneous fat.

  3. Correlation between the chemical composition of thermoresponsive nanogels and their interaction with the skin barrier.


    Giulbudagian, Michael; Rancan, Fiorenza; Klossek, André; Yamamoto, Kenji; Jurisch, Jana; Neto, Victor Colombo; Schrade, Petra; Bachmann, Sebastian; Rühl, Eckart; Blume-Peytavi, Ulrike; Vogt, Annika; Calderón, Marcelo


    In this paper we present a comprehensive study for the ability of thermoresponsive nanogels (tNG) to act as cutaneous penetration enhancers. Given the unique properties of such molecular architectures with regard to their chemical composition and thermoresponsive properties, we propose a particular mode of penetration enhancement mechanism, i.e. hydration of the stratum corneum. Different tNG were fabricated using dendritic polyglycerol as a multifunctional crosslinker and three different kinds of thermoresponsive polymers as linear counterpart: poly(N-isopropylacrylamide) (pNIPAM), p(di(ethylene glycol) methyl ether methacrylate - co - oligo ethylene glycol methacrylate) (DEGMA-co-OEGMA475), and poly(glycidyl methyl ether - co - ethyl glycidyl ether) (tPG). Excised human skin was investigated by means of fluorescence microscopy, which enabled the detection of significant increment in the penetration of tNG as well as the encapsulated fluorescein. The morphology of the treated skin samples was thoroughly investigated by transmission electron microscopy and stimulated Raman spectromicroscopy. We found that tNG can perturbate the organization of both proteins and lipids in the skin barrier, which was attributed to tNG hydration effects. Interestingly, different drug delivery properties were detected and the ability of each investigated tNG to enhance skin penetration correlated well with the degree of induced stratum corneum hydration. The differences in the penetration enhancements could be attributed to the chemical structures of the nanogels used in this study. The most effective stratum corneum hydration was detected for nanogels having additional or more exposed polyether structure in their chemical composition.

  4. Molecular interactions of plant oil components with stratum corneum lipids correlate with clinical measures of skin barrier function

    PubMed Central

    Mack Correa, Mary Catherine; Mao, Guangru; Saad, Peter; Flach, Carol R; Mendelsohn, Richard; Walters, Russel M


    Plant-derived oils consisting of triglycerides and small amounts of free fatty acids (FFAs) are commonly used in skincare regimens. FFAs are known to disrupt skin barrier function. The objective of this study was to mechanistically study the effects of FFAs, triglycerides and their mixtures on skin barrier function. The effects of oleic acid (OA), glyceryl trioleate (GT) and OA/GT mixtures on skin barrier were assessed in vivo through measurement of transepidermal water loss (TEWL) and fluorescein dye penetration before and after a single application. OA's effects on stratum corneum (SC) lipid order in vivo were measured with infrared spectroscopy through application of perdeuterated OA (OA-d34). Studies of the interaction of OA and GT with skin lipids included imaging the distribution of OA-d34 and GT ex vivo with IR microspectroscopy and thermodynamic analysis of mixtures in aqueous monolayers. The oil mixtures increased both TEWL and fluorescein penetration 24 h after a single application in an OA dose-dependent manner, with the highest increase from treatment with pure OA. OA-d34 penetrated into skin and disordered SC lipids. Furthermore, the ex vivo IR imaging studies showed that OA-d34 permeated to the dermal/epidermal junction while GT remained in the SC. The monolayer experiments showed preferential interspecies interactions between OA and SC lipids, while the mixing between GT and SC lipids was not thermodynamically preferred. The FFA component of plant oils may disrupt skin barrier function. The affinity between plant oil components and SC lipids likely determines the extent of their penetration and clinically measurable effects on skin barrier functions. PMID:24372651

  5. Skin pH Is the Master Switch of Kallikrein 5-Mediated Skin Barrier Destruction in a Murine Atopic Dermatitis Model.


    Jang, Hyosun; Matsuda, Akira; Jung, Kyungsook; Karasawa, Kaoru; Matsuda, Kenshiro; Oida, Kumiko; Ishizaka, Saori; Ahn, Ginnae; Amagai, Yosuke; Moon, Changjong; Kim, Sung-Ho; Arkwright, Peter D; Takamori, Kenji; Matsuda, Hiroshi; Tanaka, Akane


    Elevated skin surface pH has been reported in patients with atopic dermatitis. In this study, we explored the role of skin pH in the pathogenesis of atopic dermatitis using the NC/Tnd murine atopic dermatitis model. Alkalinization of the skin of asymptomatic NC/Tnd mice housed in specific pathogen-free conditions induced kallikrein 5 and activated protease-activated receptor 2, resulting in thymic stromal lymphopoietin secretion and a cutaneous T-helper 2 allergic response. This was associated with increased transepidermal water loss and development of eczematous lesions in these specific pathogen-free NC/Tnd mice, which normally do not suffer from atopic dermatitis. Injection of recombinant thymic stromal lymphopoietin also induced scratching behavior in the specific pathogen-free NC/Tnd mice. Thymic stromal lymphopoietin production and dermatitis induced by alkalinization of the skin could be blocked by the protease-activated receptor 2 antagonist ENMD-1068. In contrast, weak acidification of eczematous skin in conventionally housed NC/Tnd mice reduced kallikrein 5 activity and ameliorated the dermatitis. Onset of the dermatitis was associated with increased epidermal filaggrin expression and impaired activity of the sodium/hydrogen exchanger 1, a known regulator of skin pH. We conclude that alterations in skin pH directly modulate kallikrein 5 activity leading to skin barrier dysfunction, itch, and dermatitis via the protease-activated receptor 2-thymic stromal lymphopoietin pathway.

  6. Risk Factors in Patients with Venous Stasis-Related Skin Lesions without Major Abnormalities on Duplex Ultrasonography.


    Suehiro, Kotaro; Morikage, Noriyasu; Yamashita, Osamu; Harada, Takasuke; Samura, Makoto; Takeuchi, Yuriko; Mizoguchi, Takahiro; Hamano, Kimikazu


    Purpose: To clarify the risk factors for venous stasis-related skin lesions in the legs in patients without major abnormalities on duplex ultrasonography (DUS). Methods: Fifty patients (nine males and 41 females, age 27-93 years) with symptoms of C4 or greater according to the Clinical, Etiological, Anatomical, Pathological (CEAP) classification, but having no abnormalities on DUS were reviewed for known risk factors for chronic venous insufficiency (CVI) such as older age (>70 years), obesity (body mass index [BMI] >30 kg/m(2)), short walking distance (<200 m/day), reduced ankle range of motion (<20°), and occupation requiring prolonged standing (>8h per day). Results: The risk factor was different between male and female patients; although all patients had at least one of the above risk factors, the most commonly found risk factor in male patients was occupation requiring prolonged standing (63%), while advanced age (78%) and limited walking distance (83%) were risk factors in female patients. Conclusions: Although male and female patients had different risk factors, insufficient walking seemed to be closely related to the development of venous stasis-related skin lesions.

  7. Risk Factors in Patients with Venous Stasis-Related Skin Lesions without Major Abnormalities on Duplex Ultrasonography

    PubMed Central

    Morikage, Noriyasu; Yamashita, Osamu; Harada, Takasuke; Samura, Makoto; Takeuchi, Yuriko; Mizoguchi, Takahiro; Hamano, Kimikazu


    Purpose: To clarify the risk factors for venous stasis-related skin lesions in the legs in patients without major abnormalities on duplex ultrasonography (DUS). Methods: Fifty patients (nine males and 41 females, age 27–93 years) with symptoms of C4 or greater according to the Clinical, Etiological, Anatomical, Pathological (CEAP) classification, but having no abnormalities on DUS were reviewed for known risk factors for chronic venous insufficiency (CVI) such as older age (>70 years), obesity (body mass index [BMI] >30 kg/m2), short walking distance (<200 m/day), reduced ankle range of motion (<20°), and occupation requiring prolonged standing (>8h per day). Results: The risk factor was different between male and female patients; although all patients had at least one of the above risk factors, the most commonly found risk factor in male patients was occupation requiring prolonged standing (63%), while advanced age (78%) and limited walking distance (83%) were risk factors in female patients. Conclusions: Although male and female patients had different risk factors, insufficient walking seemed to be closely related to the development of venous stasis-related skin lesions. PMID:27738462

  8. Vibrational spectroscopy and microscopic imaging: novel approaches for comparing barrier physical properties in native and human skin equivalents

    NASA Astrophysics Data System (ADS)

    Yu, Guo; Zhang, Guojin; Flach, Carol R.; Mendelsohn, Richard


    Vibrational spectroscopy and imaging have been used to compare barrier properties in human skin, porcine skin, and two human skin equivalents, Epiderm 200X with an enhanced barrier and Epiderm 200 with a normal barrier. Three structural characterizations were performed. First, chain packing and conformational order were compared in isolated human stratum corneum (SC), isolated porcine SC, and in the Epiderm 200X surface layers. The infrared (IR) spectrum of isolated human SC revealed a large proportion of orthorhombically packed lipid chains at physiological temperatures along with a thermotropic phase transition to a state with hexagonally packed chains. In contrast, the lipid phase at physiological temperatures in both porcine SC and in Epiderm 200X, although dominated by conformationally ordered chains, lacked significant levels of orthorhombic subcell packing. Second, confocal Raman imaging of cholesterol bands showed extensive formation of cholesterol-enriched pockets within the human skin equivalents (HSEs). Finally, IR imaging tracked lipid barrier dimensions as well as the spatial disposition of ordered lipids in human SC and Epiderm 200X. These approaches provide a useful set of experiments for exploring structural differences between excised human skin and HSEs, which in turn may provide a rationale for the functional differences observed among these preparations.

  9. The topical use of non-thermal dielectric barrier discharge (DBD): nitric oxide related effects on human skin.


    Heuer, Kiara; Hoffmanns, Martin A; Demir, Erhan; Baldus, Sabrina; Volkmar, Christine M; Röhle, Mirco; Fuchs, Paul C; Awakowicz, Peter; Suschek, Christoph V; Opländer, Christian


    Dielectric barrier discharge (DBD) devices generate air plasma above the skin containing active and reactive species including nitric oxide (NO). Since NO plays an essential role in skin physiology, a topical application of NO by plasma may be useful in the treatment of skin infections, impaired microcirculation and wound healing. Thus, after safety assessments of plasma treatment using human skin specimen and substitutes, NO-penetration through the epidermis, the loading of skin tissue with NO-derivates in vitro and the effects on human skin in vivo were determined. After the plasma treatment (0-60 min) of skin specimen or reconstructed epidermis no damaging effects were found (TUNEL/MTT). By Franz diffusion cell experiments plasma-induced NO penetration through epidermis and dermal enrichment with NO related species (nitrite 6-fold, nitrate 7-fold, nitrosothiols 30-fold) were observed. Furthermore, skin surface was acidified (~pH 2.7) by plasma treatment (90 s). Plasma application on the forearms of volunteers increased microcirculation fourfold in 1-2 mm and twofold in 6-8 mm depth in the treated skin areas. Regarding the NO-loading effects, skin acidification and increase in dermal microcirculation, plasma devices represent promising tools against chronic/infected wounds. However, efficacy of plasma treatment needs to be quantified in further studies and clinical trials.

  10. Abnormal Collagen Metabolism in Cultured Skin Fibroblasts from Patients with Duchenne Muscular Dystrophy

    NASA Astrophysics Data System (ADS)

    Rodemann, H. Peter; Bayreuther, Klaus


    Total collagen synthesis is decreased by about 29% (P < 0.01) in skin fibroblasts established in vitro from male patients with Duchenne muscular dystrophy (DMD) as compared with that in normal male skin fibroblasts in vitro. The reduction in collagen synthesis is associated with an approximately 2-fold increase in collagen degradation in DMD fibroblasts. Correlated to these alterations in the metabolism of collagen, DMD fibroblasts express a significantly higher hydroxyproline/proline ratio (DMD: 1.36-1.45; P < 0.01) than do normal fibroblasts (controls: 0.86-0.89). The increased hydroxylation of proline residues of collagen (composed of type I and type III) could be the cause for the enhanced degradation of collagen in DMD fibroblasts.

  11. Use of lanthanum to detect changes in the permeability barrier of rat skin after dermal exposure to organic chemicals

    SciTech Connect

    Mattie, D.R.; McDougal, J.N.; Chase, M.R.; Hixson, C.J.


    Occupational dermal exposures to organic solvents are of importance due to local effects in the skin and systematic toxicity if penetration occurs through the skin. Repeated or prolonged contact with organic solvents have been shown to penetrate the skin; little information is available however, concerning effects on the barrier properties of skin after dermal exposure to solvents. This investigation examines the ultrastructural changes in rat skin after exposure of 3 organic chemicals and to correlate changes with the location of an electron-dense tracer, lanthanum, which is normally excluded by the permeability barrier in the stratum corneum. Male rats were exposed for 24 h to sterile saline, trichloroethylene (TCE), perchloroethylene (PERC), or toluene using dermal-exposure cells developed in this laboratory. Rat skin exposed to saline for 24 h appeared normal. Rat skin exposed to neat TCE, PERC or toluene for 24 h caused acute, coagulative necrosis of the epidermis and upper 1/2 to 1/3 of the dermis.

  12. Reflectance near-infrared measurements for determining changes in skin barrier function and scattering in relation to moisturizer application.


    Qassem, Meha; Kyriacou, Panayiotis A


    Skin moisture relates to the state of multiple skin constituents and aspects, but unfortunately, a device which could provide comprehensive and in vivo analysis is not available. Nevertheless, several reports have demonstrated accurate estimations of dermal water content using near-infrared spectroscopy (NIRS), and the potential of employing this technique in skin analysis. We aim to investigate whether NIRS could detect changes in skin barrier function through evaluation of skin water uptake in relation to moisturizer application. NIR and capacitance data were collected from 20 volunteers at both forearms, prior to and after seven days of regular moisturizer use. Results indicated lower peak intensities at the 1940-nm minima and higher intensities at the 1450-nm equivalent minima with moisturizer abstinence, while the opposite was true with regular moisturizer application. As the light beam would have traveled deeper into the skin at 1450 nm, it has been concluded that long-term, frequent moisturizer use had limited the penetration of extrinsic water. Partial least squares analysis showed that separation of sample’s scores increased with abstinence of moisturizer use. Thus, NIRS can provide valuable information not only on dermal water contents but also on additional parameters such as skin barrier function.

  13. The effects of heat on skin barrier function and in vivo dermal absorption.


    Oliveira, Gabriela; Leverett, Jesse C; Emamzadeh, Mandana; Lane, Majella E


    Enhanced delivery of ingredients across the stratum corneum (SC) is of great interest for improving the efficacy of topically applied formulations. Various methods for improving dermal penetration have been reported including galvanic devices and micro-needles. From a safety perspective it is important that such approaches do not compromise SC barrier function. This study investigates the influence of topically applied heat in vivo on the dermal uptake and penetration of a model active, allantoin from gel and lotion formulations. A custom designed device was used to deliver 42°C for 30s daily to human subjects after application of two formulations containing allantoin. The results were compared with sites treated with formulations containing no active and no heat, and a control site. In addition to penetration of allantoin, the integrity of the SC was monitored using trans-epidermal water loss (TEWL) measurements. The results showed that just 30s of 42°C topically applied heat was enough to cause significantly more penetration of allantoin from the lotion formulation compared with no application of heat. TEWL data indicated that the integrity of the skin was not compromised by the treatment. However, the application of heat did not promote enhanced penetration of the active from the gel formulation. Vehicle composition is therefore an important factor when considering thermal enhancement strategies for targeting actives to the skin.

  14. In vitro model systems for studying the impact of organic chemicals on the skin barrier lipids.


    Groen, Daniël; Berthaud, Fabienne; Bouwstra, Joke A; Chapuis, Christian; Gooris, Gert S; Boncheva, Mila


    This paper describes two synthetic lipid models designed to replace human stratum corneum (SC) in studies of the impact of volatile organic chemicals on the molecular organization of the skin barrier lipids. The models built upon previously developed self-assembled lipid membranes which have composition and 3D organization similar to those of the lipid matrix in SC. In one model the target chemicals were incorporated in the lipids before their self-assembly, and in the other one they were applied on top of a preformed lipid membrane. The chemicals could be incorporated within the model membranes in quantities close to those reached within human SC upon heavy surface loading. The dose-dependent effects of the chemicals on the lateral molecular organization in the models were qualitatively identical to those observed by infrared spectroscopy in human SC. The models facilitated the interpretation of X-ray diffraction profiles used to determine the nature of the interactions between the chemicals and the lipid lamellae and the position of the exogenous molecules within the unit cell of the lipid phases. These model systems are suitable for in vitro studies in the areas of skin biophysics, dermatology, transdermal drug delivery, and risk assessment.

  15. Effect of "rose essential oil" inhalation on stress-induced skin-barrier disruption in rats and humans.


    Fukada, Mika; Kano, Eri; Miyoshi, Michio; Komaki, Ryoichi; Watanabe, Tatsuo


    In stressed animals, several brain regions (e.g., hypothalamic paraventricular nucleus [PVN]) exhibit neuronal activation, which increases plasma adrenocorticotropic hormone (ACTH) and glucocorticoids. We previously reported that so-called "green odor" inhibits stress-induced activation of the hypothalamo-pituitary-adrenocortical axis (HPA axis) and thereby prevents the chronic stress-induced disruption of the skin barrier. Here, we investigated whether rose essential oil, another sedative odorant, inhibits the stress-induced 1) increases in PVN neuronal activity in rats and plasma glucocorticoids (corticosterone [CORT] in rats and cortisol in humans) and 2) skin-barrier disruption in rats and humans. The results showed that in rats subjected to acute restraint stress, rose essential oil inhalation significantly inhibited the increase in plasma CORT and reduced the increases in the number of c-Fos-positive cells in PVN. Inhalation of rose essential oil significantly inhibited the following effects of chronic stress: 1) the elevation of transepidermal water loss (TEWL), an index of the disruption of skin-barrier function, in both rats and humans and 2) the increase in the salivary concentration of cortisol in humans. These results suggest that in rats and humans, chronic stress-induced disruption of the skin barrier can be limited or prevented by rose essential oil inhalation, possibly through its inhibitory effect on the HPA axis.

  16. Cell surface abnormality in clones of skin fibroblasts from a carrier of Duchenne muscular dystrophy.

    PubMed Central

    Hillier, J; Jones, G E; Statham, H E; Witkowski, J A; Dubowitz, V


    We have previously reported that skin fibroblasts from patients with Duchenne muscular dystrophy (DMD) have a lower intercellular adhesiveness than control cells, and that cells from carriers of DMD have normal adhesiveness instead of the expected intermediate value. We have now cloned skin fibroblasts from a carrier of DMD (subject AS) who is also heterozygous for G6PD B/G6PD Mediterranean and determined the intercellular adhesiveness and G6PD phenotypes of the clones. G6PD activity was determined using the 2d-G6P/G6P ratio method. Normal cells had a percentage utilisation of 7.31% and uncloned cells from AS a value of 25.16%. Of 16 clones, 15 had normal values (mean 8.72%) while one clone was G6PD Med with a value of 57.5%. Mean intercellular adhesiveness of normal and uncloned cells from AS were 2.95 and 2.90 respectively. Of 11 clones tested, nine had normal values of adhesiveness (mean 3.1) and all these clones were G6PD B. The single G6PD Med clone had a value of 0.88, compared with 1.39 for DMD cells. We have no explanation at present for the single clone that was G6PD B but DMD-like on aggregation. PMID:3989823

  17. FGFR2 abnormalities underlie a spectrum of bone, skin, and cancer pathologies.


    Katoh, Masaru


    Fibroblast growth factor receptor (FGFR)2 is regulated on the basis of the balance of FGFs, heparan-sulfate proteoglycans, FGFR2 isoforms, endogenous inhibitors, and microRNAs. FGFR2 signals cross-talk with hedgehog, bone morphogenetic protein, and other regulatory networks. Some cases of congenital skeletal disorders with an FGFR2 mutation show skin phenotypes, including acne, cutis gyrata, and acanthosis nigricans. Gain-of-function mutations or variations of human FGFR2 occur in estrogen receptor-positive breast cancer, diffuse-type gastric cancer, and endometrial uterine cancer. Oral administration of AZD2171 or Ki23057 inhibits in vivo proliferation of cancer cells with aberrant FGFR2 activation in rodent therapeutic models. However, loss-of-function mutations of FGFR2 are reported in human melanoma. Conditional Fgfr2b knockout in the rodent epidermis leads to increased macrophage infiltration to the dermis and adipose tissue, epidermal thickening accompanied by basal-layer dysplasia and parakeratosis, and the promotion of chemically induced squamous-cell carcinoma. Dysregulation of FGFR2 results in a spectrum of bone and skin pathologies and several types of cancer.

  18. Skin ceramide alterations in first-episode schizophrenia indicate abnormal sphingolipid metabolism.


    Smesny, Stefan; Schmelzer, Christian E H; Hinder, Anke; Köhler, Alexandra; Schneider, Christiane; Rudzok, Maria; Schmidt, Ulrike; Milleit, Berko; Milleit, Christine; Nenadic, Igor; Sauer, Heinrich; Neubert, Reinhard H H; Fluhr, Joachim W


    There is considerable evidence for specific pathology of lipid metabolism in schizophrenia, affecting polyunsaturated fatty acids and in particular sphingolipids. These deficits are assumed to interfere with neuronal membrane functioning and the development and maintenance of myelin sheaths. Recent studies suggest that some of these lipid pathologies might also be detected in peripheral skin tests. In this study, we examined different skin lipids and their relation to schizophrenia. We assessed epidermal lipid profiles in 22 first-episode antipsychotic-naïve schizophrenia patients and 22 healthy controls matched for age and gender using a hexan/ethanol extraction technique and combined high-performance thin-layer chromatography/gas-chromatography. We found highly significant increase of ceramide AH and NH/AS classes in patients and decrease of EOS and NP ceramide classes. This is the first demonstration of specific peripheral sphingolipid alterations in schizophrenia. The results support recent models of systemic lipid pathology and in particular of specific sphingolipids, which are crucial in neuronal membrane integrity. Given recent findings showing amelioration of psychopathology using fatty acid supplementation, our findings also bear relevance for sphingolipids as potential biomarkers of the disease.

  19. White Matter Abnormalities in Skin Picking Disorder: A Diffusion Tensor Imaging Study

    PubMed Central

    Grant, Jon E; Odlaug, Brian L; Hampshire, Adam; Schreiber, Liana RN; Chamberlain, Samuel R


    Skin picking disorder (SPD) is characterized by the repetitive and compulsive picking of skin, resulting in tissue damage. Neurocognitive findings in SPD implicate difficulty with response inhibition (suppression of pre-potent motor responses). This function is dependent on the integrity of the right frontal gyrus and the anterior cingulate cortices, and white-matter tracts connecting such neural nodes. It was hypothesized that SPD would be associated with reduced fractional anisotropy in regions implicated in top-down response suppression, particularly white-matter tracts in proximity of the bilateral anterior cingulate and right frontal (especially orbitofrontal and inferior frontal) cortices. 13-subjects meeting proposed SPD criteria for DSM-5 free from other current psychiatric comorbidities, and 12 healthy comparison subjects underwent MRI with a 3-T system. Between-group comparisons of imaging data underwent voxelwise analysis with permutation modeling and cluster correction. Fractional anisotropy (measured using diffusion tensor imaging) was the primary outcome measure. Subjects with SPD exhibited significantly reduced fractional anisotropy in tracts distributed bilaterally, which included the anterior cingulate cortices. Fractional anisotropy did not correlate significantly with SPD disease severity, or depressive or anxiety scores. These findings implicate disorganization of white-matter tracts involved in motor generation and suppression in the pathophysiology of SPD, findings remarkably similar to those previously reported in trichotillomania. This study adds considerable support to the notion that—in addition to the phenomenological and comorbid overlap between SPD and trichotillomania—these disorders likely share overlapping neurobiology. PMID:23303052

  20. Psychosocial Barriers to Follow-up Adherence After an Abnormal Cervical Cytology Test Result Among Low-Income, Inner-City Women

    PubMed Central

    Hui, Siu-kuen Azor; Miller, Suzanne M.; Wen, Kuang-Yi; Fang, Zhu; Li, Tianyu; Buzaglo, Joanne; Hernandez, Enrique


    Objectives Low-income, inner-city women bear a disproportionate burden of cervical cancer in both incidence and mortality rates in the United States, largely because of low adherence to follow-up recommendations after an abnormal cervical cytology result in the primary care setting. The goals of the present study were to delineate the theory-based psychosocial barriers underlying these persistent low follow-up rates and their sociodemographic correlates. Methods Guided by a well-validated psychosocial theory of health behaviors, this cross-sectional, correlational study assessed the barriers to follow-up adherence among underserved women (N = 210) who received an abnormal cervical cytology result. Participants were recruited through an inner-city hospital colposcopy clinic, and were assessed by telephone prior to the colposcopy appointment. Results Participants were largely of African American race (82.2%), lower than high school completion education (58.7%), single, never married (67.3%), and without full-time employment (64.1%). Knowledge barriers were most often endorsed (68%, M = 3.22), followed by distress barriers (64%, M = 3.09), and coping barriers (36%, M = 2.36). Forty-six percent reported more than one barrier category. Less education and being unemployed were correlated with higher knowledge barriers (P < .0001 and P < .01, respectively) and more coping barriers (P < .05 and P < .05, respectively). Women who were younger than 30 years displayed greater distress barriers (P < .05). Conclusion In the primary care setting, assessing and addressing knowledge and distress barriers after feedback of an abnormal cervical cytology result may improve adherence to follow-up recommendations. The use of structured counseling protocols and referral to navigational and other resources may facilitate this process and thereby reduce disparities in cervical cancer. PMID:24718518

  1. The human skin barrier is organized as stacked bilayers of fully extended ceramides with cholesterol molecules associated with the ceramide sphingoid moiety.


    Iwai, Ichiro; Han, HongMei; den Hollander, Lianne; Svensson, Stina; Ofverstedt, Lars-Göran; Anwar, Jamshed; Brewer, Jonathan; Bloksgaard, Maria; Laloeuf, Aurelie; Nosek, Daniel; Masich, Sergej; Bagatolli, Luis A; Skoglund, Ulf; Norlén, Lars


    The skin barrier is fundamental to terrestrial life and its evolution; it upholds homeostasis and protects against the environment. Skin barrier capacity is controlled by lipids that fill the extracellular space of the skin's surface layer--the stratum corneum. Here we report on the determination of the molecular organization of the skin's lipid matrix in situ, in its near-native state, using a methodological approach combining very high magnification cryo-electron microscopy (EM) of vitreous skin section defocus series, molecular modeling, and EM simulation. The lipids are organized in an arrangement not previously described in a biological system-stacked bilayers of fully extended ceramides (CERs) with cholesterol molecules associated with the CER sphingoid moiety. This arrangement rationalizes the skin's low permeability toward water and toward hydrophilic and lipophilic substances, as well as the skin barrier's robustness toward hydration and dehydration, environmental temperature and pressure changes, stretching, compression, bending, and shearing.

  2. Oral collagen-derived dipeptides, prolyl-hydroxyproline and hydroxyprolyl-glycine, ameliorate skin barrier dysfunction and alter gene expression profiles in the skin.


    Shimizu, Jun; Asami, Naoto; Kataoka, Aya; Sugihara, Fumihito; Inoue, Naoki; Kimira, Yoshifumi; Wada, Masahiro; Mano, Hiroshi


    Oral supplementation with collagen hydrolysate (CH) has been shown to improve the condition of the skin in humans and experimental animals. Several hydroxyproline-containing oligo-peptides were previously detected in human peripheral blood after the ingestion of CH, and the two dipeptides, prolyl-hydroxyproline (PO) and hydroxyprolyl-glycine (OG), have been proposed to have beneficial effects on human health. When HR-1 hairless mice were fed a HR-AD diet, which lacked magnesium and zinc, transepidermal water loss (TEWL) increased and water content of stratum corneum decreased. In the present study, we investigated the effects of dietary PO and OG on skin barrier dysfunction in HR-1 hairless mice. Mice were fed a HR-AD diet with or without PO (0.15%) and OG (0.15%) for 35 consecutive days. The administration of PO and OG significantly decreased TEWL, and significantly increased water content of stratum corneum. A DNA microarray analysis of the dorsal skin revealed differences in gene expression between the group administered PO and OG and the control group. We also identified muscle-related Gene Ontology as a result of analyzing the up-regulated genes. These results suggested that the administration of PO and OG improved skin barrier dysfunction and altered muscle-related gene expression.

  3. Effects of a novel formulation of fluocinonide 0.1% cream on skin barrier function in atopic dermatitis

    PubMed Central

    Woods, Matthew T.; Brown, Peter A.; Baig-Lewis, Shahana F.; Simpson, Eric L.


    Objective To determine the effect of a novel formulation of fluocinonide cream on skin barrier function in subjects with atopic dermatitis. Design The authors performed an open-label, investigator-blinded, side-by-side, controlled trial examining skin barrier function before and after a two-week course of a class I, super-potent topical steroid. Setting Outpatient university-based dermatology clinic in Portland, Oregon. Subjects Twenty-five subjects aged 12 or older with a diagnosis of moderate, severe, or very severe AD were recruited for this study. Intervention Fluocinonide 0.1% cream, a novel formulation of a class I super-potent topical steroid, was applied to all affected areas, except a control site, once daily tor two weeks or until clear. The control target site was treated with the vehicle once daily. Main Outcome Measure(s) The study’s primary outcome was change in skin barrier function as measured by basal transepidermal water loss (TEWL) in acute lesional skin from baseline as measured at two weeks. Results TEWL readings significantly decreased (reflecting improved barrier function) in both the active and control target sites. The active target site decreased 14.35 ± 16 mg/cm2 per hour; 95 percent confidence interval, P<0.001. The control target site decreased 8.75 ± 11.80 mg/cm2 per hour in 25 subjects; 95 per cent confidence interval, P<0.001. Skin electrical capacitance also improved significantly, reflecting improved stratum corneum hydration with therapy. Pruritus, clinical severity, and quality of life scores all showed significant improvement by the end of the study. Conclusion The authors have shown that short-term treatment with a novel formulation of 0.1% fluocinonide led to significantly improved barrier function as measured by basal TEWL in subjects with active moderate to severe AD. These data suggest short-term treatment with AD with a super-potent corticosteroid improves skin barrier function. PMID:21283922

  4. In vitro Percutaneous Absorption of Niacinamide and Phytosterols and in vivo Evaluation of their Effect on Skin Barrier Recovery.


    Offerta, Alessia; Bonina, Francesco; Gasparri, Franco; Zanardi, Andrea; Micicche, Lucia; Puglia, Carmelo


    In this study, we evaluated different strategies to optimize the percutaneous absorption of niacinamide (NA) and soy phytosterols (FITO) by making use of solid lipid nanoparticles (SLN) and penetration enhancers, such as the hydrogenated lecithin. The evaluation of the skin permeation of NA and FITO has been effected in vitro using excised human skin (i.e., stratum corneum-epidermis or SCE). Furthermore, we evaluated the in vivo effect that NA and FITO has on skin barrier recovery after the topical application; using the extent of methyl nicotinate (MN)-induced erythema in damaged skin as a parameter to determine the rate of stratum corneum recovery. Results pointed out the importance of these strategies as valid tools for NA and FITO topical delivery. In fact, soy lecithin based formulations were able to increase the percutaneous absorption of the two active ingredients, while SLN guaranteed an interesting delayed and sustained release of FITO. In vivo evaluation showed clearly that the formulation containing both the actives (NA and FITO) is able to recover about 95% of skin barrier integrity eight days after tape stripping. This effect is probably due to the "synergistic effect" of NA and FITO.

  5. Consumption of functional fermented milk containing borage oil, green tea and vitamin E enhances skin barrier function.


    Puch, Florence; Samson-Villeger, Sandrine; Guyonnet, Denis; Blachon, Jean-Luc; Rawlings, Anthony Vincent; Lassel, Taous


    As emerging studies show that skin functioning can be improved with orally imbibed ingredients, we decided to investigate a mixture of borage oil, catechins, vitamin E and probiotics, all known for their reported effects on epidermal function, in a fermented dairy product, for the first time. Gamma-linolenic acid (GLA) and catechins bioavailability and their effects on skin functionality have not been previously investigated from a fermented dairy product. Firstly, we assessed the bioavailability of GLA and catechins mixed in a fermented dairy matrix by measuring their levels in chylomicrons and plasma samples respectively. For the GLA contained in the dairy matrix, the area under the curve and time for maximal absorption were significantly different to the same kinetic parameters compared with absorption from the free oil indicating improved oral bioavailability. However, the overall absorption of catechins over the 6-h period was identical for both product forms. These results were sufficiently promising to warrant a 24 week skin nutrition intervention study in female volunteers having dry and sensitive skin. The product improved stratum corneum barrier function compared with a control product as early as 6 weeks after the consumption which continued throughout the rest of the study. The reduction in transepidermal water loss relative to control was maintained throughout the trial despite seasonal changes. Moreover, as a result of the enhanced bioavailability, a much greater effect on skin barrier function occurred than reported previously for the individual ingredients. Nevertheless, body mass index significantly influenced various outcome measurements of this study.

  6. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense

    PubMed Central

    Jantsch, Jonathan; Schatz, Valentin; Friedrich, Diana; Schröder, Agnes; Kopp, Christoph; Siegert, Isabel; Maronna, Andreas; Wendelborn, David; Linz, Peter; Binger, Katrina J.; Gebhardt, Matthias; Heinig, Matthias; Neubert, Patrick; Fischer, Fabian; Teufel, Stefan; David, Jean-Pierre; Neufert, Clemens; Cavallaro, Alexander; Rakova, Natalia; Küper, Christoph; Beck, Franz-Xaver; Neuhofer, Wolfgang; Muller, Dominik N.; Schuler, Gerold; Uder, Michael; Bogdan, Christian; Luft, Friedrich C.; Titze, Jens


    Summary Immune cells regulate a hypertonic microenvironment in the skin; however, the biological advantage of increased skin Na+ concentrations is unknown. We found that Na+ accumulated at the site of bacterial skin infections in humans and in mice. We used the protozoan parasite Leishmania major as a model of skin-prone macrophage infection to test the hypothesis that skin-Na+ storage facilitates antimicrobial host defense. Activation of macrophages in the presence of high NaCl concentrations modified epigenetic markers and enhanced p38 mitogen-activated protein kinase (p38/MAPK)-dependent nuclear factor of activated T cells 5 (NFAT5) activation. This high-salt response resulted in elevated type-2 nitric oxide synthase (Nos2)-dependent NO production and improved Leishmania major control. Finally, we found that increasing Na+ content in the skin by a high-salt diet boosted activation of macrophages in an Nfat5-dependent manner and promoted cutaneous antimicrobial defense. We suggest that the hypertonic microenvironment could serve as a barrier to infection. PMID:25738463

  7. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense.


    Jantsch, Jonathan; Schatz, Valentin; Friedrich, Diana; Schröder, Agnes; Kopp, Christoph; Siegert, Isabel; Maronna, Andreas; Wendelborn, David; Linz, Peter; Binger, Katrina J; Gebhardt, Matthias; Heinig, Matthias; Neubert, Patrick; Fischer, Fabian; Teufel, Stefan; David, Jean-Pierre; Neufert, Clemens; Cavallaro, Alexander; Rakova, Natalia; Küper, Christoph; Beck, Franz-Xaver; Neuhofer, Wolfgang; Muller, Dominik N; Schuler, Gerold; Uder, Michael; Bogdan, Christian; Luft, Friedrich C; Titze, Jens


    Immune cells regulate a hypertonic microenvironment in the skin; however, the biological advantage of increased skin Na(+) concentrations is unknown. We found that Na(+) accumulated at the site of bacterial skin infections in humans and in mice. We used the protozoan parasite Leishmania major as a model of skin-prone macrophage infection to test the hypothesis that skin-Na(+) storage facilitates antimicrobial host defense. Activation of macrophages in the presence of high NaCl concentrations modified epigenetic markers and enhanced p38 mitogen-activated protein kinase (p38/MAPK)-dependent nuclear factor of activated T cells 5 (NFAT5) activation. This high-salt response resulted in elevated type-2 nitric oxide synthase (Nos2)-dependent NO production and improved Leishmania major control. Finally, we found that increasing Na(+) content in the skin by a high-salt diet boosted activation of macrophages in a Nfat5-dependent manner and promoted cutaneous antimicrobial defense. We suggest that the hypertonic microenvironment could serve as a barrier to infection.

  8. PNPLA1 is a transacylase essential for the generation of the skin barrier lipid ω-O-acylceramide

    PubMed Central

    Ohno, Yusuke; Kamiyama, Nozomi; Nakamichi, Shota; Kihara, Akio


    Lipids are the primary components of the skin permeability barrier, which is the body's most powerful defensive mechanism against pathogens. Acylceramide (ω-O-acylceramide) is a specialized lipid essential for skin barrier formation. Here, we identify PNPLA1 as the long-sought gene involved in the final step of acylceramide synthesis, esterification of ω-hydroxyceramide with linoleic acid, by cell-based assays. We show that increasing triglyceride levels by overproduction of the diacylglycerol acyltransferase DGAT2 stimulates acylceramide production, suggesting that triglyceride may act as a linoleic acid donor. Indeed, the in vitro analyses confirm that PNPLA1 catalyses acylceramide synthesis using triglyceride as a substrate. Mutant forms of PNPLA1 found in patients with ichthyosis exhibit reduced or no enzyme activity in either cell-based or in vitro assays. Altogether, our results indicate that PNPLA1 is directly involved in acylceramide synthesis as a transacylase, and provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis. PMID:28248318

  9. Epidermal Permeability Barrier Defects and Barrier Repair Therapy in Atopic Dermatitis

    PubMed Central

    Lee, Hae-Jin


    Atopic dermatitis (AD) is a multifactorial inflammatory skin disease perpetuated by gene-environmental interactions and which is characterized by genetic barrier defects and allergic inflammation. Recent studies demonstrate an important role for the epidermal permeability barrier in AD that is closely related to chronic immune activation in the skin during systemic allergic reactions. Moreover, acquired stressors (e.g., Staphylococcus aureus infection) to the skin barrier may also initiate inflammation in AD. Many studies involving patients with AD revealed that defective skin barriers combined with abnormal immune responses might contribute to the pathophysiology of AD, supporting the outside-inside hypothesis. In this review, we discuss the recent advances in human and animal models, focusing on the defects of the epidermal permeability barrier, its immunologic role and barrier repair therapy in AD. PMID:24991450

  10. Regulation of caspase 14 expression in keratinocytes by inflammatory cytokines--a possible link between reduced skin barrier function and inflammation?


    Hvid, Malene; Johansen, Claus; Deleuran, Bent; Kemp, Kaare; Deleuran, Mette; Vestergaard, Christian


    Caspase 14 is a unique member of the cysteinyl aspartate-specific proteinase family. Its expression is confined primarily to cornified epithelium such as the skin. Caspase 14 has been associated with the processing of filaggrin monomers and the development of natural moisturising factors of the skin, and thus, it could be speculated that caspase 14 dysregulation is implicated in the development of an impaired skin barrier function. We have investigated the regulation of caspase 14 transcription in cultured primary keratinocytes following stimulation with a number of factors present in inflamed skin, including T(H)1- and T(H)2-associated cytokines in addition to LPS and peptidoglycan. In particular, we found that T(H)2-associated cytokines reduced the caspase 14 mRNA level significantly. Furthermore, we found that the expression of caspase 14 was reduced in skin biopsies from patients with atopic dermatitis (AD), psoriasis and contact dermatitis, further supporting a role for this kinase in inflammatory skin conditions. Hence, the regulation of caspase 14 levels provides a possible link between impaired skin barrier function and inflammatory reactions in skin diseases such as AD and may offer an explanation to the skin barrier dysfunction in inflamed skin lesions.

  11. GPHR-dependent functions of the Golgi apparatus are essential for the formation of lamellar granules and the skin barrier.


    Tarutani, Masahito; Nakajima, Kimiko; Uchida, Yoshikazu; Takaishi, Mikiro; Goto-Inoue, Naoko; Ikawa, Masahito; Setou, Mitsutoshi; Kinoshita, Taroh; Elias, Peter M; Sano, Shigetoshi; Maeda, Yusuke


    The lumen of the Golgi apparatus is regulated to be weakly acidic, which is critical for its functions. The Golgi pH regulator (GPHR) is an anion channel essential for normal acidification of the Golgi apparatus, and is therefore required for its functions. The Golgi apparatus has been thought to be the origin of lamellar granules in the skin. To study the functional role(s) of GPHR in the skin, we established keratinocyte-specific GPHR-knockout mice using the Cre-loxP system. These mutant mice exhibited hypopigmented skin, hair loss, and scaliness. Histological examination of GPHR-knockout mice showed ballooning of the basal cells and follicular dysplasia. In addition, inflammatory cells were seen in the dermis. The expression of trans-Golgi network 46, a marker for lamellar bodies, and kallikrein 7, a protein within lamellar bodies, is diminished in GPHR-knockout mouse skin. Examination by electron microscopy revealed that keratinocytes produced aberrant lamellar bodies. The transepidermal water loss of these knockout mice was increased compared with wild-type mice. Moreover, expression of cathelicidin-related antimicrobial peptide (CRAMP) in the skin was diminished. These results suggest that GPHR is essential for the homeostasis of the epidermis including the formation of lamellar bodies and for the barrier function.

  12. Activation of epidermal toll-like receptor 2 enhances tight junction function – Implications for atopic dermatitis and skin barrier repair

    PubMed Central

    Kuo, I-Hsin; Carpenter-Mendini, Amanda; Yoshida, Takeshi; McGirt, Laura Y.; Ivanov, Andrei I.; Barnes, Kathleen C.; Gallo, Richard L.; Borkowski, Andrew W.; Yamasaki, Kenshi; Leung, Donald Y.; Georas, Steve N.; De Benedetto, Anna; Beck, Lisa A.


    Atopic dermatitis (AD) is characterized by epidermal tight junction (TJ) defects and a propensity for Staphylococcus aureus (S. aureus) skin infections. S. aureus is sensed by many pattern recognition receptors including toll-like receptor (TLR) 2. We hypothesized that an effective innate immune response will include skin barrier repair and that this response is impaired in AD subjects. S. aureus-derived peptidoglycan (PGN) and synthetic TLR2 agonists enhanced TJ barrier and increased expression of TJ proteins, CLDN1, CLDN23, occludin and ZO-1 in primary human keratinocytes. A TLR2 agonist enhanced skin barrier recovery in human epidermis wounded by tape-stripping. Tlr2−/− mice had a delayed and incomplete barrier recovery following tape-stripping. AD subjects had reduced epidermal TLR2 expression as compared to nonatopic (NA) subjects, which inversely correlated (r= 0.654, P= 0.0004) with transepidermal water loss (TEWL). These observations indicate that TLR2 activation enhances skin barrier in murine and human skin and is an important part of a wound repair response. Reduced epidermal TLR2 expression observed in AD patients may play a role in their incompetent skin barrier. PMID:23223142

  13. Nucleophilic addition to olefins. 19. Abnormally high intrinsic barrier in the reaction of piperidine and morpholine with benzylideneacetylacetone

    SciTech Connect

    Bernasconi, C.F.; Kanavarioti, A.


    The title reaction leads to the formation of the zwitterionic Michael adduct T/sup +/-/ (PhCH(R/sub 2/NH/sup +/)C(COCH/sub 3/)/sub 2//sup -/) which is in rapid acid-base equilibrium with its anionic form T/sup -/ (PhCH(R/sub 2/N)C(COCH/sub 3/)/sub 2//sup -/). Rate (K/sub 1/, k/sub -1/) and equilibrium constants (K/sub 1/) for nucleophilic addition and the pK/sub a/ of the T/sup +/-/-adducts were determined in 50% Me/sub 2/SO-50% water at 20/sup 0/C. From an interpolation of the rate constants to K/sub 1/ = 1 an intrinsic rate constant, log k/sub 0/ = 0.3, was determined. This value deviates negatively by approximately 2.5 log units from a correlation of log k/sub 0/ for amine addition to five olefins of the type PhCH=CXY, with log k/sub 0/ for the deprotonation of the corresponding carbon acids CH/sub 2/XY. Two major factors are believed to contribute to this depressed intrinsic rate constant or enhanced intrinsic barrier: (1) steric inhibition of resonance in T/sup +/-/ with the steric effect developing ahead of C-N bond formation (this conclusion is supported by an X-ray crystallographic study of p-methoxybenzylideneacetylacetone which shows that steric hindrance to optimal ..pi..-overlap in the adduct T/sup+/-/ is already present in the substrate); (2) intramolecular hydrogen bonding in T/sup +/-/, which is inferred from abnormally high pK/sub a/ values and whose development lags behind C-N bond formation. These effects are shown to be manifestations of the Principle of Nonperfect Synchronization.

  14. δ-Aminolevulinate synthase is required for apical transcellular barrier formation in the skin of the Drosophila larva.


    Shaik, Khaleelulla Saheb; Meyer, Frauke; Vázquez, Angel Vizoso; Flötenmeyer, Matthias; Cerdán, Maria Esperanza; Moussian, Bernard


    Animals construct a layered skin to prevent dehydration and pathogen entrance. The barrier function of the skin relies on the extensive cross-linking of specialised components. In insects, for instance, epidermal cells produce an apical extracellular cuticle that consists of a network of proteins, chitin and lipids. We have identified mutations in the Drosophila gene coding for the δ-aminolevulinate synthase (Alas) that cause massive water loss. The cuticle of alas mutant larvae detaches from the epidermis and its basal region is frayed suggesting that an Alas dependent pathway is needed to organise the contact between the cuticle and the epidermis and anchor the cuticle to the apical surface of epidermal cells. Concomitantly, reduction of Alas function results in weakening of the extracellular dityrosines network in the cuticle, whereas glutamyl-lysine isopeptide bonds are not affected. The lateral septate junctions of epidermal cells that serve as a paracellular plug are intact, as well. Taken together, we hypothesise that Alas activity, which initiates heme biosynthesis in the mitochondrion, is needed for the formation of a dityrosine-based barrier that confers resistance to the internal hydrostatic pressure protecting both the cuticle from transcellular infiltration of body fluid and the animal from dehydration. We conclude that at least two modules--an apical protein-chitin lattice and the lateral septate junctions, act in parallel to ensure Drosophila skin impermeability.

  15. Orally administered ethanol: transepidermal pathways and effects on the human skin barrier.


    Jacobi, Ute; Bartoll, Jens; Sterry, Wolfram; Lademann, Jürgen


    Ethanol intake is associated with a variety of skin diseases. The aim of the present study was (1) to identify the pathways of release of orally administered ethanol through the skin, and (2) to investigate the effects of a single oral dose of ethanol on the penetration of topically applied substances into the skin. Ethanol evaporation via the skin was measured using the new technique of ion mobility spectrometry (IMS). Transepidermal water loss (TEWL) and skin surface temperature were simultaneously measured before and after ethanol consumption. Measurements were performed on skin sites with different stratum corneum (SC) thickness, and density of follicles and sweat glands. These appendages were selectively sealed to investigate their participation in ethanol evaporation. The penetration of a topically applied UV filter substance was studied before and after ethanol consumption after removing the SC with adhesive tape. Ethanol evaporation was measured within 5 min of consumption, while the skin surface temperature remained nearly constant. The sealing of the appendages did not have a significant effect on ethanol evaporation. On the forehead, a higher TEWL value was measured than on the forearm. On both skin sites, an increase in TEWL was observed after ethanol ingestion. No influence of orally administered ethanol on the penetration of the topically applied UV filter substance was observed. The results indicate that ethanol evaporation occurs via the lipid layers without a significant effect on the penetration of the topically applied substance.

  16. Transepidermal water loss for probing full-thickness skin barrier function: correlation with tritiated water flux, sensitivity to punctures and diverse surfactant exposures.


    Elmahjoubi, Eman; Frum, Yakov; Eccleston, Gillian M; Wilkinson, Simon C; Meidan, Victor M


    Skin barrier function is a key parameter to consider when performing in vitro percutaneous absorption studies. Whilst tritiated water flux measurements were often used to assess skin integrity, recent decades have witnessed the emergence of the more rapid and user-friendly transepidermal water loss (TEWL) approach. Yet to date, the nature of the correlation between TEWL and skin barrier function in vitro has still not been comprehensively established. In this study, a novel TEWL device, operating on a cold-induced vapour sink principle, was used to probe the barrier function of full-thickness porcine skin. The method was sufficiently sensitive to show the influence of punctures on barrier function although the observed non-linear pattern suggested tissue swelling processes and/or capillary action could be occurring. The results of various surfactant application experiments strongly suggested that TEWL was indeed largely predictive of skin sample integrity. A key finding was that basal TEWL was linearly correlated with basal tritiated water flux (r(2)=0.80, n=63). Thus, a dedicated TEWL method can be used as a good alternative to water flux measurements for assessing full-thickness skin barrier function.

  17. In vivo methods for the analysis of the penetration of topically applied substances in and through the skin barrier.


    Lademann, J; Meinke, M C; Schanzer, S; Richter, H; Darvin, M E; Haag, S F; Fluhr, J W; Weigmann, H-J; Sterry, W; Patzelt, A


    The efficacy of a drug is characterized by its action mechanism and its ability to pass the skin barrier. In this article, different methods are discussed, which permit this penetration process to be analysed non-invasively. Providing qualitative and quantitative information, tape stripping is one of the oldest procedures for penetration studies. Although single cell layers of corneocytes are removed from the skin surface, this procedure is considered as non-invasive and is applicable exclusively to the stratum corneum. Recently, optical and spectroscopic methods have been used to investigate the penetration process. Fluorescence-labelled drugs can be easily detected in the skin by laser scanning microscopy. This method has the disadvantage that the dye labelling changes the molecular structures of the drug and consequently might influence the penetration properties. The penetration process of non-fluorescent substances can be analysed by Raman spectroscopy, electron paramagnetic resonance, CARS and multiphoton microscopic measurements. Using these methods, the concentration of the topically applied formulations in different depths of the stratum corneum can be detected by moving the laser focus from the skin surface deeper into the stratum corneum. The advantages and disadvantages of these methods will be discussed in this article.

  18. Ranking of aqueous surfactant-humectant systems based on an analysis of in vitro and in vivo skin barrier perturbation measurements.


    Ghosh, Saswata; Hornby, Sidney; Grove, Gary; Zerwick, Charles; Appa, Yohini; Blankschtein, Daniel


    We propose that skin electrical current measurements can be used in vitro to effectively rank aqueous solutions containing surfactants and humectants (the enhancer) contacting the skin, relative to a PBS aqueous solution (the control) contacting the skin, based on their ability to perturb the skin aqueous pores. Specifically, we develop an in vitro ranking metric using the increase in the skin electrical current induced by an enhancer relative to the control. Aqueous contacting solutions containing (i) surfactants [SDS (sodium dodecyl sulfate)] and C(12)E(6) [dodecyl hexa (ethylene oxide)], (ii) humectants (glycerol and propylene glycol), and (iii) a control (PBS) were studied. Utilizing the new in vitro ranking metric, these aqueous contacting solutions were ranked as follows (from the mildest to the harshest): glycerol < propylene glycol < PBS < C(12)E(6) < SDS. In order to further develop this ranking methodology, which can potentially lead to the reduction, or elimination, of costly and time-consuming procedures, such as human and animal testing and trial-and-error screening in vivo, it was important to correlate the findings of the in vitro ranking metric with direct in vivo skin barrier measurements. For this purpose, in vivo soap chamber measurements, including transepidermal water loss, visual skin dryness, and chromameter erythema measurements, were carried out on human volunteers using the aqueous surfactant-humectant solutions described above. The results of these in vivo measurements were found to be consistent with the ranking results obtained using the in vitro ranking metric. To further explore the validity of our model and to verify the skin barrier mitigating effect of glycerol, in vivo soap chamber measurements were carried out for aqueous SDS solutions containing 10 wt% added glycerol. These in vivo measurements support our recent in vitro finding that glycerol reduces the average radius and the pore number density of the skin aqueous pores, such

  19. Skin barrier disruptions in tape stripped and allergic dermatitis models have no effect on dermal penetration and systemic distribution of AHAPS-functionalized silica nanoparticles.


    Ostrowski, Anja; Nordmeyer, Daniel; Boreham, Alexander; Brodwolf, Robert; Mundhenk, Lars; Fluhr, Joachim W; Lademann, Jürgen; Graf, Christina; Rühl, Eckart; Alexiev, Ulrike; Gruber, Achim D


    The skin is a potential site of entry for nanoparticles (NP) but the role of disease-associated barrier disturbances on the path and extent of skin penetration of NP remains to be characterized. Silica nanoparticles (SiO2-NP) possess promising potential for various medical applications. Here, effects of different skin barrier disruptions on the penetration of N-(6-aminohexyl)-aminopropyltrimethoxysilane (AHAPS) functionalized SiO2-NP were studied. AHAPS-SiO2-NP (55±6 nm diameter) were topically applied on intact, tape stripped or on inflamed skin of SKH1 mice with induced allergic contact dermatitis for one or five consecutive days, respectively. Penetration of AHAPS-SiO2-NP through the skin was not observed regardless of the kind of barrier disruption. However, only after subcutaneous injection, AHAPS-SiO2-NP were incorporated by macrophages and transported to the regional lymph node only. Adverse effects on cells or tissues were not observed. In conclusion, AHAPS-SiO2-NP seem to not cross the normal or perturbed mouse skin. From the clinical editor: Skin is a potential site of entry for nanoparticles; however, it is poorly understood how skin diseases may alter this process. In tape-stripped skin and allergic contact dermatitis models the delivery properties of AHAPS-SiO2 nanoparticles remained unchanged, and in neither case were these NP-s able to penetrate the skin. No adverse effects were noted on the skin in these models and control mice.

  20. Role of Micronutrients in Skin Health and Function

    PubMed Central

    Park, Kyungho


    Skin is the first line of defense for protecting our bodies against external perturbations, including ultraviolet (UV) irradiation, mechanical/chemical stress, and bacterial infection. Nutrition is one of many factors required for the maintenance of overall skin health. An impaired nutritional status alters the structural integrity and biological function of skin, resulting in an abnormal skin barrier. In particular, the importance of micronutrients (such as certain vitamins and minerals) for skin health has been highlighted in cell culture, animal, and clinical studies. These micronutrients are employed not only as active compounds in therapeutic agents for treating certain skin diseases, but also as ingredients in cosmetic products. Here, the author describes the barrier function of the skin and the general nutritional requirements for skin health. The goal of this review is to discuss the potential roles and current knowledge of selected micronutrients in skin health and function. PMID:25995818

  1. Role of micronutrients in skin health and function.


    Park, Kyungho


    Skin is the first line of defense for protecting our bodies against external perturbations, including ultraviolet (UV) irradiation, mechanical/chemical stress, and bacterial infection. Nutrition is one of many factors required for the maintenance of overall skin health. An impaired nutritional status alters the structural integrity and biological function of skin, resulting in an abnormal skin barrier. In particular, the importance of micronutrients (such as certain vitamins and minerals) for skin health has been highlighted in cell culture, animal, and clinical studies. These micronutrients are employed not only as active compounds in therapeutic agents for treating certain skin diseases, but also as ingredients in cosmetic products. Here, the author describes the barrier function of the skin and the general nutritional requirements for skin health. The goal of this review is to discuss the potential roles and current knowledge of selected micronutrients in skin health and function.

  2. Relationship between skin barrier function in early neonates and diaper dermatitis during the first month of life: a prospective observational study.


    Yonezawa, Kaori; Haruna, Megumi; Shiraishi, Mie; Matsuzaki, Masayo; Sanada, Hiromi


    Diaper dermatitis, a common skin problem in newborn infants, is characterized by poor functioning of the skin barrier. This study aimed to elucidate the relationship between skin barrier function in 4-day-old infants and the occurrence of diaper dermatitis during the first month of life. We recruited healthy Japanese infants born at 35 weeks of gestation or more. We measured indicators of skin barrier function, namely skin pH and transepidermal water loss, in 4-day-old infants on four places on the body. Individual characteristics were recorded from the infants' medical charts. The presence of diaper dermatitis was judged using the diaper rash and erythema scoring scale, which was based on daily recording of the infants' skin condition by their parents. The parents also filled out a questionnaire 1 month after birth regarding stool frequency and certain external factors. The association between diaper dermatitis and skin barrier function was assessed using multiple logistic regression analysis. The analysis included 88 infants. The incidence of diaper dermatitis was 25.0%. After adjusting for stool frequency for 1 month we noted that high pH on the inner arm skin in 4-day-old infants increased the risk of diaper dermatitis during the first month of life (adjusted odds ratio 3.35 [95% confidence interval = 1.12, 10.04]). Early neonatal skin pH may predict the risk of diaper dermatitis during the first month of life. Our results may be useful in devising strategies to prevent diaper dermatitis.

  3. The absence of a microbiota enhances TSLP expression in mice with defective skin barrier but does not affect the severity of their allergic inflammation.


    Yockey, Laura J; Demehri, Shadmehr; Turkoz, Mustafa; Turkoz, Ahu; Ahern, Philip P; Jassim, Omar; Manivasagam, Sindhu; Kearney, John F; Gordon, Jeffrey I; Kopan, Raphael


    Evidence is accumulating to suggest that our indigenous microbial communities (microbiota) may have a role in modulating allergic and immune disorders of the skin. To examine the link between the microbiota and atopic dermatitis (AD), we examined a mouse model of defective cutaneous barrier function with an AD-like disease due to loss of Notch signaling. Comparisons of conventionally raised and germ-free (GF) mice revealed a similar degree of allergic skin inflammation, systemic atopy, and airway hypersensitivity. GF mutant animals expressed significantly higher levels of thymic stromal lymphopoietin, a major proinflammatory cytokine released by skin with defective barrier function, resulting in a more severe B-lymphoproliferative disorder that persisted into adulthood. These findings suggest a role for the microbiota in ameliorating stress signals released by keratinocytes in response to perturbation in cutaneous barrier function.

  4. Keratin 76 is required for tight junction function and maintenance of the skin barrier.


    DiTommaso, Tia; Cottle, Denny L; Pearson, Helen B; Schlüter, Holger; Kaur, Pritinder; Humbert, Patrick O; Smyth, Ian M


    Keratins are cytoskeletal intermediate filament proteins that are increasingly being recognised for their diverse cellular functions. Here we report the consequences of germ line inactivation of Keratin 76 (Krt76) in mice. Homozygous disruption of this epidermally expressed gene causes neonatal skin flaking, hyperpigmentation, inflammation, impaired wound healing, and death prior to 12 weeks of age. We show that this phenotype is associated with functionally defective tight junctions that are characterised by mislocalization of the integral protein CLDN1. We further demonstrate that KRT76 interacts with CLDN1 and propose that this interaction is necessary to correctly position CLDN1 in tight junctions. The mislocalization of CLDN1 has been associated in various dermopathies, including the inflammatory disease, psoriasis. These observations establish a previously unknown connection between the intermediate filament cytoskeleton network and tight junctions and showcase Krt76 null mice as a possible model to study aberrant tight junction driven skin diseases.

  5. Keratin 76 Is Required for Tight Junction Function and Maintenance of the Skin Barrier

    PubMed Central

    DiTommaso, Tia; Cottle, Denny L.; Pearson, Helen B.; Schlüter, Holger; Kaur, Pritinder; Humbert, Patrick O.; Smyth, Ian M.


    Keratins are cytoskeletal intermediate filament proteins that are increasingly being recognised for their diverse cellular functions. Here we report the consequences of germ line inactivation of Keratin 76 (Krt76) in mice. Homozygous disruption of this epidermally expressed gene causes neonatal skin flaking, hyperpigmentation, inflammation, impaired wound healing, and death prior to 12 weeks of age. We show that this phenotype is associated with functionally defective tight junctions that are characterised by mislocalization of the integral protein CLDN1. We further demonstrate that KRT76 interacts with CLDN1 and propose that this interaction is necessary to correctly position CLDN1 in tight junctions. The mislocalization of CLDN1 has been associated in various dermopathies, including the inflammatory disease, psoriasis. These observations establish a previously unknown connection between the intermediate filament cytoskeleton network and tight junctions and showcase Krt76 null mice as a possible model to study aberrant tight junction driven skin diseases. PMID:25340345

  6. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.


    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y


    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  7. Synthesis and characterization of O-acylated-ω-hydroxy fatty acids as skin-protecting barrier lipids.


    Pérez, B; Dahlgaard, S E; Bulsara, P; Rawlings, A V; Jensen, M M; Dong, M; Glasius, M; Clarke, M J; Guo, Z


    A series of O-acylated-ω-hydroxy fatty acids (Acyl acids) of up to 34 carbons were synthesized and characterized through DSC, FTIR and Langmuir isotherm measurements to identify potential replacements to petrolatum, a highly used occlusive technology that if unrefined, it can potentially be classified as carcinogenic. Fourier transform infrared spectroscopy studies demonstrated that long acyl acids engender orthorhombic packing; packing behavior that is predominant in the lipid matrix of healthy stratum corneum, the outmost layer of the skin. In addition, Differential Scanning Calorimetry (DSC) and Langmuir isotherm studies suggested that the length of the hydrocarbon chain and the position of the ester bond influence the molecular organization of the acyl acids. For instance, 16-(tetradecanoyloxy)hexadecanoic acid (30 carbons) displayed a higher melting point (mp=68°C) than 10-(stearoyloxy)decanoic acid (28 carbons; mp=63°C) and 10-(tetradecanoyloxy)decanoic acid (24 carbons; mp=55°C) according to DSC. Moreover, Langmuir isotherm studies showed that mixtures of acyl acid with distearoylphosphatidylcholine improved packing behavior. Finally, Water Vapor Transmission Rate (WVTR) measurements showed that the compounds in fact decrease WVTR compared to untreated control (P<0.001) which demonstrates the potential of these ingredients as occlusive technologies to combat skin barrier diseases.

  8. Mechanical and metabolic injury to the skin barrier leads to increased expression of murine β-defensin-1, -3, and -14.


    Ahrens, Kerstin; Schunck, Michael; Podda, Graziella-Francesca; Meingassner, Josef; Stuetz, Anton; Schröder, Jens-Michael; Harder, Jürgen; Proksch, Ehrhardt


    Protection of the skin against microbiological infection is provided by the permeability barrier and by antimicrobial proteins. We asked whether the expression of murine β-defensins (mBDs)-1, -3, and -14-orthologs of human β-defensins hBD-1, -2, and -3, respectively--is stimulated by mechanically/physicochemically (tape stripping or acetone treatment) or metabolically (essential fatty acid-deficient (EFAD) diet) induced skin barrier dysfunction. Both methods led to a moderate induction of mBD-1 and mBD-14 and a pronounced induction of mBD-3 mRNA. Protein expression of the mBDs was increased as shown by immunohistology and by western blotting. Artificial barrier repair by occlusion significantly reduced the increased expression of mBD-14 after mechanical injury and of all three mBDs in EFAD mice, supporting an interrelationship between permeability and the antimicrobial barrier. mBD-3 expression was stimulated in vitro by tumor necrosis factor-α (TNF-α), and a neutralizing anti-TNF-α antibody significantly reduced increased mBD-3 expression after barrier injury in mouse skin, indicating that induction of mBD-3 expression is mediated by cytokines. The expression of mBD-14 was stimulated by transforming growth factor-α and not by TNF-α. In summary, we demonstrated upregulation of mBD1, -3, and -14 after mechanically and metabolically induced skin barrier disruption, which may be an attempt to increase defense in the case of permeability barrier dysfunction.

  9. Randomized, Controlled Trial Evaluating a Baby Wash Product on Skin Barrier Function in Healthy, Term Neonates

    PubMed Central

    Lavender, Tina; Bedwell, Carol; Roberts, Stephen A; Hart, Anna; Turner, Mark A; Carter, Lesley-Anne; Cork, Michael J


    Objectives To examine the hypothesis that the use of a wash product formulated for newborn (<1 month of age) bathing is not inferior (no worse) to bathing with water only. Design Assessor-blinded, randomized, controlled, noninferiority trial. Setting A teaching hospital in the Northwest of England and in participants’ homes. Participants Three-hundred-and-seven healthy, term infants recruited within 48 hours of birth. Method We compared bathing with a wash product (n = 159) to bathing with water alone (n = 148). The primary outcome was transepidermal water loss (TEWL) at 14 days postbirth; the predefined difference deemed to be unimportant was 1.2. Secondary outcomes comprised changes in stratum corneum hydration, skin surface pH, clinical observations of the skin, and maternal views. Results Complete TEWL data were obtained for 242 (78.8%) infants. Wash was noninferior to water alone in terms of TEWL (intention-to-treat analysis: 95% confidence interval [CI] for difference [wash–water, adjusted for family history of eczema, neonate state, and baseline] −1.24, 1.07; per protocol analysis: 95% CI −1.42, 1.09). No significant differences were found in secondary outcomes. Conclusion We were unable to detect any differences between the newborn wash product and water. These findings provide reassurance to parents who choose to use the test newborn wash product or other technically equivalent cleansers and provide the evidence for health care professionals to support parental choice. PMID:23421327

  10. Beneficial effects of a skin tolerance-tested moisturizing cream on the barrier function in experimentally-elicited irritant and allergic contact dermatitis.


    De Paépe, K; Hachem, J P; Vanpee, E; Goossens, A; Germaux, M A; Lachapelle, J M; Lambert, J; Matthieu, L; Roseeuw, D; Suys, E; Van Hecke, E; Rogiers, V


    In experimentally-induced irritant (ICD) and allergic (ACD) contact dermatitis, an oil-in-water (o/w) cream was applied to investigate its effects on a disturbed barrier function compared to untreated physiological barrier repair. Transepidermal water loss (TEWL) measurements were performed. Before the start of the experiments, the skin tolerance of the cream was examined, revealing the non-irritating characteristics of the ingredients and the absence of any contact allergic patch test reaction. In the ICD study, sodium lauryl sulfate (SLS) patches were applied to the forearms of young female volunteers. Consequently, it was observed that repeated cream application (14 days, 2x/day) significantly improved the TEWL of SLS-damaged skin, leading to a complete recovery on day 15. In the ACD study, disruption of skin barrier function was obtained by a nickel-mediated contact allergy patch (CAP) test. The cream was then applied 2x/day for 4 consecutive days. Assessment of TEWL clearly showed that recovery of the disrupted skin significantly improved after cream application in comparison to untreated barrier repair.

  11. Essential role of the cytochrome P450 CYP4F22 in the production of acylceramide, the key lipid for skin permeability barrier formation.


    Ohno, Yusuke; Nakamichi, Shota; Ohkuni, Aya; Kamiyama, Nozomi; Naoe, Ayano; Tsujimura, Hisashi; Yokose, Urara; Sugiura, Kazumitsu; Ishikawa, Junko; Akiyama, Masashi; Kihara, Akio


    A skin permeability barrier is essential for terrestrial animals, and its impairment causes several cutaneous disorders such as ichthyosis and atopic dermatitis. Although acylceramide is an important lipid for the skin permeability barrier, details of its production have yet to be determined, leaving the molecular mechanism of skin permeability barrier formation unclear. Here we identified the cytochrome P450 gene CYP4F22 (cytochrome P450, family 4, subfamily F, polypeptide 22) as the long-sought fatty acid ω-hydroxylase gene required for acylceramide production. CYP4F22 has been identified as one of the autosomal recessive congenital ichthyosis-causative genes. Ichthyosis-mutant proteins exhibited reduced enzyme activity, indicating correlation between activity and pathology. Furthermore, lipid analysis of a patient with ichthyosis showed a drastic decrease in acylceramide production. We determined that CYP4F22 was a type I membrane protein that locates in the endoplasmic reticulum (ER), suggesting that the ω-hydroxylation occurs on the cytoplasmic side of the ER. The preferred substrate of the CYP4F22 was fatty acids with a carbon chain length of 28 or more (≥C28). In conclusion, our findings demonstrate that CYP4F22 is an ultra-long-chain fatty acid ω-hydroxylase responsible for acylceramide production and provide important insights into the molecular mechanisms of skin permeability barrier formation. Furthermore, based on the results obtained here, we proposed a detailed reaction series for acylceramide production.

  12. Ultradeformable lipid vesicles can penetrate the skin and other semi-permeable barriers unfragmented. Evidence from double label CLSM experiments and direct size measurements.


    Cevc, Gregor; Schätzlein, Andreas; Richardsen, Holger


    The stability of various aggregates in the form of lipid bilayer vesicles was tested by three different methods before and after crossing different semi-permeable barriers. First, polymer membranes with pores significantly smaller than the average aggregate diameter were used as the skin barrier model; dynamic light scattering was employed to monitor vesicle size changes after barrier passage for several lipid mixtures with different bilayer elasticities. This revealed that vesicles must adapt their size and/or shape, dependent on bilayer stability and elasto-mechanics, to overcome an otherwise confining pore. For the mixed lipid aggregates with highly flexible bilayers (Transfersomes), the change is transient and only involves vesicle shape and volume adaptation. The constancy of ultradeformable vesicle size before and after pores penetration proves this. This is remarkable in light of the very strong aggregate deformation during an enforced barrier passage. Simple phosphatidylcholine vesicles, with less flexible bilayers, lack such capability and stability. Conventional liposomes are therefore fractured during transport through a semi-permeable barrier; as reported by other researchers, liposomes are fragmented to the size of a narrow pore if sufficient pressure is applied across the barrier; otherwise, liposomes clog the pores. The precise outcome depends on trans-barrier flux and/or on relative vesicle vs. pore size. Lipid vesicles applied on the skin behave accordingly. Mixed lipid vesicles penetrate the skin if they are sufficiently deformable. If this is the case, they cross inter-cellular constrictions in the organ without significant composition or size modification. To prove this, we labelled vesicles with two different fluorescent markers and applied the suspension on intact murine skin without occlusion. The confocal laser scanning microscopy (CLSM) of the skin then revealed a practically indistinguishable distribution of both labels in the stratum

  13. Developing food allergy: a potential immunologic pathway linking skin barrier to gut

    PubMed Central

    Wang, Yui-Hsi


    Immunoglobulin E (IgE)-mediated food allergy is an adverse reaction to foods and is driven by uncontrolled type-2 immune responses. Current knowledge cannot explain why only some individuals among those with food allergy are prone to develop life-threatening anaphylaxis. It is increasingly evident that the immunologic mechanisms involved in developing IgE-mediated food allergy are far more complex than allergic sensitization. Clinical observations suggest that patients who develop severe allergic reactions to food are often sensitized through the skin in early infancy. Environmental insults trigger epidermal thymic stromal lymphopoietin and interleukin-33 (IL-33) production, which endows dendritic cells with the ability to induce CD4 +TH2 cell-mediated allergic inflammation. Intestinal IL-25 propagates the allergic immune response by enhancing collaborative interactions between resident type-2 innate lymphoid cells and CD4 +TH2 cells expanded by ingested antigens in the gastrointestinal tract. IL-4 signaling provided by CD4 +TH2 cells induces emigrated mast cell progenitors to become multi-functional IL-9-producing mucosal mast cells, which then expand greatly after repeated food ingestions. Inflammatory cytokine IL-33 promotes the function and maturation of IL-9-producing mucosal mast cells, which amplify intestinal mastocytosis, resulting in increased clinical reactivity to ingested food allergens. These findings provide the plausible view that the combinatorial signals from atopic status, dietary allergen ingestions, and inflammatory cues may govern the perpetuation of allergic reactions from the skin to the gut and promote susceptibility to life-threatening anaphylaxis. Future in-depth studies of the molecular and cellular factors composing these stepwise pathways may facilitate the discovery of biomarkers and therapeutic targets for diagnosing, preventing, and treating food allergy. PMID:27853507

  14. Compound heterozygous desmoplakin mutations result in a phenotype with a combination of myocardial, skin, hair, and enamel abnormalities.


    Mahoney, My G; Sadowski, Sara; Brennan, Donna; Pikander, Pekka; Saukko, Pekka; Wahl, James; Aho, Heikki; Heikinheimo, Kristiina; Bruckner-Tuderman, Leena; Fertala, Andrzej; Peltonen, Juha; Uitto, Jouni; Peltonen, Sirkku


    Desmoplakin (DP) anchors the intermediate filament cytoskeleton to the desmosomal cadherins and thereby confers structural stability to tissues. In this study, we present a patient with extensive mucocutaneous blisters, epidermolytic palmoplantar keratoderma, nail dystrophy, enamel dysplasia, and sparse woolly hair. The patient died at the age of 14 years from undiagnosed cardiomyopathy. The skin showed hyperplasia and acantholysis in the mid- and lower epidermal layers, whereas the heart showed extensive fibrosis and fibrofatty replacement in both ventricles. Immunofluorescence microscopy showed a reduction in the C-terminal domain of DP in the skin and oral mucosa. Sequencing of the DP gene showed undescribed mutations in the maternal and paternal alleles. Both mutations affected exon 24 encoding the C-terminal domain. The paternal mutation, c.6310delA, leads to a premature stop codon. The maternal mutation, c.7964 C to A, results in a substitution of an aspartic acid for a conserved alanine residue at amino acid 2655 (A2655D). Structural modeling indicated that this mutation changes the electrostatic potential of the mutated region of DP, possibly altering functions that depend on intermolecular interactions. To conclude, we describe a combination of DP mutation phenotypes affecting the skin, heart, hair, and teeth. This patient case emphasizes the importance of heart examination of patients with desmosomal genodermatoses.

  15. Skin Biomes.


    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A


    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  16. ADAM17/EGFR axis promotes transglutaminase-dependent skin barrier formation through phosholipase C γ1 and protein kinase C pathways

    PubMed Central

    Wolf , Cristina; Qian, Yawen; Brooke, Matthew A.; Kelsell, David P.; Franzke, Claus-Werner


    The vitally important skin barrier is formed by extensive cross-linking activity of transglutaminases (TGs) during terminal epidermal differentiation. We have previously shown that epidermal deficiency of a disintegrin and metalloproteinase 17 (ADAM17), the principal EGFR ligand sheddase, results in postnatal skin barrier defects in mice due to impeded TG activity. However, the mechanism by which ADAM17/EGFR signalling maintains TG activity during epidermal differentiation remains elusive. Here we demonstrate that ADAM17-dependent EGFR signalling promotes TG activity in keratinocytes committed to terminal differentiation by direct induction of TG1 expression. Restored TG1 expression of EGF-stimulated differentiated Adam17−/− keratinocytes was strongly repressed by inhibitors for PLCγ1 or protein kinase C (PKC) pathways, while treatment with the PKC stimulator 12-O-tetradecanoylphorbol-13-acetate restored TG activity in the epidermis of keratinocyte-specific Adam17−/− (AD17ΔKC) mice. Further investigations emphasized the expression of PKCη, a mediator of TGM1 transcription, to be sensitive to EGFR activation. In agreement, topical skin application of cholesterol sulfate, an activator of PKCη, significantly improved TG activity in epidermis of AD17ΔKC mice. Our results suggest ADAM17/EGFR-driven PLCγ1 and PKC pathways as important promoters of TG1 expression during terminal keratinocyte differentiation. These findings may help to identify new therapeutic targets for inflammatory skin diseases related to epidermal barrier defects. PMID:28004780

  17. Sensitive skin: an overview.


    Berardesca, E; Farage, M; Maibach, H


    Sensitive skin is a condition of subjective cutaneous hyper-reactivity to environmental factors. Subjects experiencing this condition report exaggerated reactions when their skin is in contact with cosmetics, soaps and sun screens, and they often report worsening after exposure to dry and cold climate. Although no sign of irritation is commonly detected, itching, burning, stinging and a tight sensation are constantly present. Generally substances that are not commonly considered irritants are involved in this abnormal response.Sensitive skin and subjective irritation are widespread but still far from being completely defined and understood. A correlation between sensitive skin and constitutional anomalies and/or other triggering factors such as occupational skin diseases or chronic exposure to irritants has been hypothesized. Recent findings suggest that higher sensitivity can be due to different mechanisms. Hyper-reactors may have a thinner stratum corneum with a reduced corneocyte area causing a higher transcutaneous penetration of water-soluble chemicals. Alterations in vanilloid receptors and changes in neuronal transmission have been described. Monitoring skin parameters such as barrier function, proclivity to irritation, corneocyte size and sensorial transmission can also be useful to identify regional differences in skin sensitivity.

  18. Dietary Cerebroside from Sea Cucumber (Stichopus japonicus): Absorption and Effects on Skin Barrier and Cecal Short-Chain Fatty Acids.


    Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya


    Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.

  19. Penicillamine-induced elastosis perforans serpiginosa with abnormal "lumpy-bumpy" elastic fibers in lesional and non-lesional skin.


    Khatu, Swapna S; Dhurat, Rachita S; Nayak, Chitra S; Pereira, Rickson R; Kagne, Rucha B


    Four types of elastosis perforans serpiginosa (EPS) have been described in literature: 1) idiopathic EPS, 2) reactive perforating elastosis associated with connective tissue disorders, 3) in some instances of pseudoxanthoma elasticum (PXE), disease-specific calcified elastic tissue is extruded, producing a clinical picture indistinguishable from other types, may also be seen in patients undergoing hemodialysis and 4) EPS induced by long-term treatment with D-penicillamine is observed in patients suffering from Wilson's disease. Long term D-penicillamine therapy causes an alteration in the dermal elastic tissue. D-penicillamine induced EPS has a distinctive histopathologic feature - serrated appearance of elastic fibers due to perpendicular budding from their surface giving a "lumpy-bumpy" look. D-penicillamine induced elastic fiber alteration may not always manifest clinically as EPS. We report a case of D-penicillamine induced widespread alteration in skin elastic tissue with distinct histopathologic features.

  20. Tight junctional abnormality in multiple sclerosis white matter affects all calibres of vessel and is associated with blood-brain barrier leakage and active demyelination.


    Kirk, John; Plumb, Jonnie; Mirakhur, Meenakshi; McQuaid, Stephen


    Blood-brain barrier (BBB) hyperpermeability in multiple sclerosis (MS) is associated with lesion pathogenesis and has been linked to pathology in microvascular tight junctions (TJs). This study quantifies the uneven distribution of TJ pathology and its association with BBB leakage. Frozen sections from plaque and normal-appearing white matter (NAWM) in 14 cases were studied together with white matter from six neurological and five normal controls. Using single and double immunofluorescence and confocal microscopy, the TJ-associated protein zonula occludens-1 (ZO-1) was examined across lesion types and tissue categories, and in relation to fibrinogen leakage. Confocal image data sets were analysed for 2198 MS and 1062 control vessels. Significant differences in the incidence of TJ abnormalities were detected between the different lesion types in MS and between MS and control white matter. These were frequent in oil-red O (ORO)(+) active plaques, affecting 42% of vessel segments, but less frequent in ORO(-) inactive plaques (23%), NAWM (13%), and normal (3.7%) and neurological controls (8%). A similar pattern was found irrespective of the vessel size, supporting a causal role for diffusible inflammatory mediators. In both NAWM and inactive lesions, dual labelling showed that vessels with the most TJ abnormality also showed most fibrinogen leakage. This was even more pronounced in active lesions, where 41% of vessels in the highest grade for TJ alteration showed severe leakage. It is concluded that disruption of TJs in MS, affecting both paracellular and transcellular paths, contributes to BBB leakage. TJ abnormality and BBB leakage in inactive lesions suggests either failure of TJ repair or a continuing pathological process. In NAWM, it suggests either pre-lesional change or secondary damage. Clinically inapparent TJ pathology has prognostic implications and should be considered when planning disease-modifying therapy.

  1. Use of reflectance near-infrared spectroscopy to investigate the effects of daily moisturizer application on skin optical response and barrier function.


    Qassem, Meha; Kyriacou, Panayiotis


    A number of noninvasive techniques and instruments have emerged over the years allowing much progress toward clarifying the structure and function of human skin and studying the effects of various applied substances. All of this research has provided great insight into the interactions between skin and various products through quantitative and qualitative measurements. Such methods include near-infrared spectroscopy (NIRS), a technique which has gained popularity over the years and has often been employed to accurately determine the moisture levels and water content of skin based on its sensitivity to hydrogen bonding. NIRS has also been applied in many studies to report the efficacy of moisturizing products and assess their benefits to the skin. However, many of these studies have reported an increase in skin water content following moisturizer application while some have challenged the benefits of long-term moisturizer use, particularly on normal skin, and even suggested that it can increase the skin's susceptibility to irritants. This paper reports the results of a pilot in vivo study carried out on the skin of 20 healthy volunteers, categorized into groups depending on their skin type and frequency of moisturizer use, in order to investigate the optical response of human skin after direct short-term contact with water followed by application of a moisturizer. The measurements were obtained using a highly advanced spectrophotometer in the region of 900 to 2100 nm equipped with a customized reflectance fiber optic handheld probe. Scatter graphs of group results and second derivative spectra have shown an interesting pattern between frequent users of moisturizers and individuals who do not use moisturizers, suggesting that long-term daily moisturization may have an effect on skin barrier function. The results also raise some questions regarding the optical characteristics of different skin types, as well as the varying response between different water bands in the

  2. Probing the role of the ceramide acyl chain length and sphingosine unsaturation in model skin barrier lipid mixtures by (2)H solid-state NMR spectroscopy.


    Stahlberg, Sören; Školová, Barbora; Madhu, Perunthiruthy K; Vogel, Alexander; Vávrová, Kateřina; Huster, Daniel


    We investigated equimolar mixtures of ceramides with lignoceric acid and cholesterol as models for the human stratum corneum by differential scanning calorimetry and (2)H solid-state NMR spectroscopy. Our reference system consisted of lignoceroyl sphingosine (Cer[NS24]), which represents one of the ceramides in the human stratum corneum. Furthermore, the effect of ceramide acyl chain truncation to 16 carbons as in Cer[NS16] and the loss of the C4 trans double bond as in dihydroceramide Cer[NDS24] were studied. Fully relaxed (2)H NMR spectra were acquired for each deuterated component of each mixture separately, allowing the quantitative determination of the individual lipid phases. At skin temperature, the reference system containing Cer[NS24] is characterized by large portions of each component of the mixture in a crystalline phase, which largely restricts the permeability of the skin lipid barrier. The loss of the C4 trans double bond in Cer[NDS24] leads to the replacement of more than 25% of the crystalline phase by an isotropic phase of the dihydroceramide that shows the importance of dihydroceramide desaturation in the formation of the skin lipid barrier. The truncated Cer[NS16] is mostly found in the gel phase at skin temperature, which may explain its negative effect on the transepidermal water loss in atopic dermatitis patients. These significant alterations in the phase behavior of all lipids are further reflected at elevated temperatures. The molecular insights of our study may help us to understand the importance of the structural parameters of ceramides in healthy and compromised skin barriers.

  3. TRP Channels in Skin Biology and Pathophysiology

    PubMed Central

    Caterina, Michael J.; Pang, Zixuan


    Ion channels of the Transient Receptor Potential (TRP) family mediate the influx of monovalent and/or divalent cations into cells in response to a host of chemical or physical stimuli. In the skin, TRP channels are expressed in many cell types, including keratinocytes, sensory neurons, melanocytes, and immune/inflammatory cells. Within these diverse cell types, TRP channels participate in physiological processes ranging from sensation to skin homeostasis. In addition, there is a growing body of evidence implicating abnormal TRP channel function, as a product of excessive or deficient channel activity, in pathological skin conditions such as chronic pain and itch, dermatitis, vitiligo, alopecia, wound healing, skin carcinogenesis, and skin barrier compromise. These diverse functions, coupled with the fact that many TRP channels possess pharmacologically accessible sites, make this family of proteins appealing therapeutic targets for skin disorders. PMID:27983625

  4. Urban particulate matter down-regulates filaggrin via COX2 expression/PGE2 production leading to skin barrier dysfunction

    PubMed Central

    Lee, Chiang-Wen; Lin, Zih-Chan; Hu, Stephen Chu-Sung; Chiang, Yao-Chang; Hsu, Lee-Fen; Lin, Yu-Ching; Lee, I-Ta; Tsai, Ming-Horng; Fang, Jia-You


    We explored the regulation of filaggrin, cyclooxygenase 2 (COX2) and prostaglandin E2 (PGE2) expression induced by urban particulate matter (PM) in human keratinocytes. In addition, we investigated the signaling pathways involved in PM-induced effects on COX2/PGE2 and filaggrin. PMs induced increases in COX2 expression and PGE2 production, and decreased filaggrin expression. These effects were attenuated by pretreatment with COX2 inhibitor and PGE2 receptor antagonist, or after transfection with siRNAs of the aryl hydrocarbon receptor (AhR), gp91phox and p47phox. Furthermore, PM-induced generation of reactive oxygen species (ROS) and NADPH oxidase activity was attenuated by pretreatment with an AhR antagonist (AhRI) or antioxidants. Moreover, Nox-dependent ROS generation led to phosphorylation of ERK1/2, p38, and JNK, which then activated the downstream molecules NF-κB and AP-1, respectively. In vivo studies in PMs-treated mice showed that AhRI and apocynin (a Nox2 inhibitor) had anti-inflammatory effects by decreasing COX2 and increasing filaggrin expression. Our results reveal for the first time that PMs-induced ROS generation is mediated through the AhR/p47 phox/NADPH oxidase pathway, which in turn activates ERK1/2, p38/NF-κB and JNK/AP-1, and which ultimately induces COX2 expression and filaggrin downregulation. Up-regulated expression of COX2 and production of PGE2 may lead to impairment of skin barrier function. PMID:27313009

  5. Urban particulate matter down-regulates filaggrin via COX2 expression/PGE2 production leading to skin barrier dysfunction.


    Lee, Chiang-Wen; Lin, Zih-Chan; Hu, Stephen Chu-Sung; Chiang, Yao-Chang; Hsu, Lee-Fen; Lin, Yu-Ching; Lee, I-Ta; Tsai, Ming-Horng; Fang, Jia-You


    We explored the regulation of filaggrin, cyclooxygenase 2 (COX2) and prostaglandin E2 (PGE2) expression induced by urban particulate matter (PM) in human keratinocytes. In addition, we investigated the signaling pathways involved in PM-induced effects on COX2/PGE2 and filaggrin. PMs induced increases in COX2 expression and PGE2 production, and decreased filaggrin expression. These effects were attenuated by pretreatment with COX2 inhibitor and PGE2 receptor antagonist, or after transfection with siRNAs of the aryl hydrocarbon receptor (AhR), gp91phox and p47phox. Furthermore, PM-induced generation of reactive oxygen species (ROS) and NADPH oxidase activity was attenuated by pretreatment with an AhR antagonist (AhRI) or antioxidants. Moreover, Nox-dependent ROS generation led to phosphorylation of ERK1/2, p38, and JNK, which then activated the downstream molecules NF-κB and AP-1, respectively. In vivo studies in PMs-treated mice showed that AhRI and apocynin (a Nox2 inhibitor) had anti-inflammatory effects by decreasing COX2 and increasing filaggrin expression. Our results reveal for the first time that PMs-induced ROS generation is mediated through the AhR/p47 phox/NADPH oxidase pathway, which in turn activates ERK1/2, p38/NF-κB and JNK/AP-1, and which ultimately induces COX2 expression and filaggrin downregulation. Up-regulated expression of COX2 and production of PGE2 may lead to impairment of skin barrier function.

  6. Sensitive skin.


    Misery, L; Loser, K; Ständer, S


    Sensitive skin is a clinical condition defined by the self-reported facial presence of different sensory perceptions, including tightness, stinging, burning, tingling, pain and pruritus. Sensitive skin may occur in individuals with normal skin, with skin barrier disturbance, or as a part of the symptoms associated with facial dermatoses such as rosacea, atopic dermatitis and psoriasis. Although experimental studies are still pending, the symptoms of sensitive skin suggest the involvement of cutaneous nerve fibres and neuronal, as well as epidermal, thermochannels. Many individuals with sensitive skin report worsening symptoms due to environmental factors. It is thought that this might be attributed to the thermochannel TRPV1, as it typically responds to exogenous, endogenous, physical and chemical stimuli. Barrier disruptions and immune mechanisms may also be involved. This review summarizes current knowledge on the epidemiology, potential mechanisms, clinics and therapy of sensitive skin.

  7. Gain of 11q/cyclin D1 overexpression is an essential early step in skin cancer development and causes abnormal tissue organization and differentiation.


    Burnworth, B; Popp, S; Stark, H-J; Steinkraus, V; Bröcker, E B; Hartschuh, W; Birek, C; Boukamp, P


    Non-melanoma skin cancers, in particular keratoacanthomas (KAs) and squamous cell carcinomas (SCCs), have become highly frequent tumor types especially in immune-suppressed transplant patients. Nevertheless, little is known about essential genetic changes. As a paradigm of 'early' changes, that is, changes still compatible with tumor regression, we studied KAs by comparative genomic hybridization and show that gain of chromosome 11q is not only one of the most frequent aberration (8/18), but in four tumors also the only aberration. Furthermore, 11q gain correlated with amplification of the cyclin D1 locus (10/14), as determined by fluorescence in situ hybridization, and overexpression of cyclin D1 protein (25/31), as detected by immunohistochemistry. For unraveling the functional consequence, we overexpressed cyclin D1 in HaCaT skin keratinocytes. These cells only gained little growth advantage in conventional and in organotypic co-cultures. However, although the control vector-transfected cells formed a well-stratified and orderly differentiated epidermis-like epithelium, they showed deregulation of tissue architecture with an altered localization of proliferation and impaired differentiation. The most severe phenotype was seen in a clone that additionally upregulated cdk4 and p21. These cells lacked terminal differentiation, exhibited a more autonomous growth in vitro and in vivo and even formed tumors in two injection sites with a growth pattern resembling that of human KAs. Thus, our results identify 11q13 gain/cyclin D1 overexpression as an important step in KA formation and point to a function that exceeds its known role in proliferation by disrupting tissue organization and thereby allowing abnormal growth.

  8. Effect of a water-based no-sting, protective barrier formulation and a solvent-containing similar formulation on skin protection from medical adhesive trauma.


    Shannon, Ronald J; Chakravarthy, Debashish


    Trauma to the skin from repeated removal of adhesive-based medical products can cause pain, anxiety, risk of secondary infections and additional health care costs. Skin barrier formulations are used to protect the integrity from such trauma. However, not all formulations are equally protective. We report the results of a randomised controlled study comparing a solvent-free (SF) formulation and a solvent-containing (SC) formulation to the skin of 12 healthy volunteers aged 18-55 years. Treatments were applied at baseline to two of the four test sites on the back of each subject and repeated for 5 days. Measurements of pain, discomfort, erythema and skin water loss were taken 24 hours after each application. The SF formulation is associated with lower mean scores for erythema (day 5, P < 0.05) and lower values for transepidermal water loss (day 5, P < 0.05) and redness (days 4 and 5, P < 0.05) when compared with either no treatment or daily treatment with a SC formulation. There were no significant differences between subject responses when pain on application of the test formulation or discomfort associated with removal of the medical adhesive tapes were rated. We conclude that a SF formulation provides better security against adhesive-derived skin trauma than a SC formulation.

  9. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes

    PubMed Central

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan


    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing. PMID:25866745

  10. Pilot Study to Evaluate the Effect of Topical Dimethicone on Clinical Signs and Skin Barrier Function in Dogs with Naturally Occurring Atopic Dermatitis

    PubMed Central

    Pellicoro, C.; Marsella, R.; Ahrens, K.


    This study investigated the effects of a skin protectant solution (dimethicone 2%) on clinical signs and skin barrier function in canine atopic dermatitis (AD). Eighteen dogs with AD were randomly divided into two groups, one received dimethicone and the other received the vehicle (cyclomethicone) on selected areas (pinnae, groin, and axillae) daily for 4 weeks. Owners and investigators were blinded regarding group allocation. Clinical efficacy was evaluated using a scoring system and skin barrier by measuring the transepidermal water loss. Twelve dogs completed the study (50% drop rate in the vehicle and 20% in the dimethicone). For clinical signs, analysis of variance showed an effect of time (P < 0.005; day 0 > day 28) and region (axillae < groin < pinnae) but no effect of group or group × time interaction. For transepidermal water loss, analysis of variance showed only a main effect of region (axillae > pinnae > groin). Pearson found no correlation between transepidermal water loss and clinical scores. In this pilot study dimethicone had no significant effect on clinical signs and transepidermal water loss in canine atopic dermatitis. PMID:23710417

  11. Pilot study to evaluate the effect of topical dimethicone on clinical signs and skin barrier function in dogs with naturally occurring atopic dermatitis.


    Pellicoro, C; Marsella, R; Ahrens, K


    This study investigated the effects of a skin protectant solution (dimethicone 2%) on clinical signs and skin barrier function in canine atopic dermatitis (AD). Eighteen dogs with AD were randomly divided into two groups, one received dimethicone and the other received the vehicle (cyclomethicone) on selected areas (pinnae, groin, and axillae) daily for 4 weeks. Owners and investigators were blinded regarding group allocation. Clinical efficacy was evaluated using a scoring system and skin barrier by measuring the transepidermal water loss. Twelve dogs completed the study (50% drop rate in the vehicle and 20% in the dimethicone). For clinical signs, analysis of variance showed an effect of time (P < 0.005; day 0 > day 28) and region (axillae < groin < pinnae) but no effect of group or group × time interaction. For transepidermal water loss, analysis of variance showed only a main effect of region (axillae > pinnae > groin). Pearson found no correlation between transepidermal water loss and clinical scores. In this pilot study dimethicone had no significant effect on clinical signs and transepidermal water loss in canine atopic dermatitis.

  12. Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi's Granuloma: The Consequences of Skin Barrier Dysfunction.


    Wang, Tao; Xu, Chenchen; Zhou, Xiping; Li, Chunjia; Zhang, Hongbing; Lian, Bill Q; Lee, Jonathan J; Shen, Jun; Liu, Yuehua; Lian, Christine Guo


    Non-bullous congenital ichthyosiform erythroderma (NBCIE) is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272*) in ALOXE3 (NM_001165960.1) in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband's skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi's granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi's granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

  13. Iontophoresis and sonophoresis stimulate epidermal cytokine expression at energies that do not provoke a barrier abnormality: lamellar body secretion and cytokine expression are linked to altered epidermal calcium levels.


    Choi, Eung Ho; Kim, Min Jung; Yeh, Byung-Il; Ahn, Sung Ku; Lee, Seung Hun


    We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1alpha (IL-1alpha), tumor necrosis factor-alpha (TNF-alpha), and transforming growth factor-beta in the epidermis and for immunohistochemical stain with primary antibodies to IL-1alpha and TNF-alpha. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1alpha and TNF-alpha immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function.

  14. Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.


    Shah, D K; Khandavilli, S; Panchagnula, R


    Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

  15. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  16. Eruca sativa and its flavonoid components, quercetin and isorhamnetin, improve skin barrier function by activation of peroxisome proliferator-activated receptor (PPAR)-α and suppression of inflammatory cytokines.


    Kim, Bora; Choi, Yoon-E; Kim, Hyun-Soo


    Atopic dermatitis, which is related to dermatologic disorders and is associated with skin barrier dysfunction, represents an epidemic problem demanding effective therapeutic strategies. In the present study, we showed that the treatment with Eruca sativa extract resulted in a significant increase in the transactivation activity of peroxisome proliferator-activated receptor (PPAR) response element such as PPAR-α and suppression in the expression of inflammatory cytokine and antimicrobial peptides. In addition, E. sativa extract promotes the expression of filaggrin related to skin barrier protection. Quercetin and isorhamnetin, flavonoids' constituents of E. sativa, also promoted PPAR-α activity. These results indicate that E. sativa extract may be an appropriate material for improving skin barrier function as a skin therapeutic agent for atopic dermatitis.

  17. Application of Topical Acids Improves Atopic Dermatitis in Murine Model by Enhancement of Skin Barrier Functions Regardless of the Origin of Acids

    PubMed Central

    Lee, Noo Ri; Lee, Hae-Jin; Yoon, Na Young; Kim, Donghye; Jung, Minyoung


    Background The acidic pH of the stratum corneum (SC) is important for epidermal permeability barrier homeostasis. Acidification of the skin surface has been suggested as a therapeutic strategy for skin disorders such as atopic dermatitis (AD). Objective We performed an animal study to evaluate the usefulness of acidification of SC for inhibition of AD lesions and to find out if the therapeutic effect of vinegar is attributable to its herbal contents, rather than its acidity. Methods Five groups of six oxazolone-treated (Ox)-AD mice were treated for three weeks with creams of different acidity: vehicle cream alone (pH 5.5), neutralized vinegar cream (pH 7.4), pH 5.0 vinegar cream, pH 3.5 vinegar cream, and pH 3.5 hydrogen chloride (HCl) cream. Also, we have compared two groups of Ox-AD mice treated with pH 5.5 vehicle cream or pH 5.5 vinegar cream. Results Ox-AD mice treated with acidic creams exhibited fewer AD-like lesions, had significantly lower eczema scores, decreased basal by transepidermal water loss (TEWL), and increased SC hydration compared to the groups given only vehicle and neutral cream. There was no significant difference between the acidic vinegar and HCl groups. Between the groups treated with vehicle and pH 5.5 vinegar cream, there was no difference in eczema score, basal TEWL and SC hydration. Conclusion Application of topical acids, regardless of their source materials, inhibits the development of AD lesions by maintenance of skin surface pH and skin barrier function in murine model. PMID:27904267



    Arshad, Atif I; Khan, Shoaib H M; Akhtar, Naveed


    The prime objective of current investigation was to develop a topical skin care cream (w/o) loaded with Ananas comosus extract versus placebo control, and evaluated non-invasively for changes in skin barrier function i.e., epidermal hydration levels and transepidermal water loss (TEWL), on healthy human volunteers. Active cream carrying 2% extract of Ananas comosus in the internal phase of w/o emulsion was prepared while placebo contained no extract. Stability assessment of both creams was performed at various storage conditions 8, 25, 40 degrees C, 40 degrees C + 75% RH (relative humidity) and 50 degrees C. Effects on epidermal hydration and TEWL were observed by applying active cream at one side and placebo on the other side of face by 11 healthy human volunteers during 12 weeks period using Corneometer MPA5 and Tewameter MPA5. Results indicated that both creams (active and placebo) remained stable at all storage conditions. All samples manifested non-Newtonian, shear thinning behavior with increasing shear rate, whereas statistical interpretation indicated that effects of active cream were superior than placebo, as it significantly (p = 0.05) improves the epidermal hydration levels up to 56.74% and reduces TEWL up to -73.19% at the end of study period compared to baseline value. The surface evaluation of living skin (SELS) parameters SEr, SEsc, SEsm, SEw were also assessed and indicated a significant (p = 0.05) reduction. Conclusively, creams loaded with Ananas comosus extract exhibit better physicochemical stability and represent a propitious improvement in skin barrier function, used as a functional moisturizing and anti-aging ingredient in topical skincare products.

  19. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Rα1.


    Zeng, Yue-Ping; Nguyen, Giang Huong; Jin, Hong-Zhong


    Atopic dermatitis is a chronic inflammatory skin disease characterized by the dysregulation of the epidermal barrier and the immune system. Interleukin (IL)-13, a key T helper 2 cytokine, has been shown to impair the epidermal barrier function via downregulating epidermal barrier proteins. MicroRNAs are small noncoding RNAs of approximately 22 nucleotides that act as negative regulators of gene expression at posttranscriptional levels. MicroRNA-143 is known to be a tumor suppressor in various tumors; however, its role in the regulation of allergic diseases including atopic dermatitis remains elusive. In this study, we investigated whether IL-13Rα1 was a microRNA-143 target to regulate the effects of IL-13 on epidermal barrier function. After the stimulation of IL-13 in human epidermal keratinocytes, the level of microRNA-143 was decreased. The luciferase activity of the vector containing 3'UTR of IL-13Rα1 was decreased in keratinocytes transfected with microRNA-143 mimic compared to those of the corresponding controls. The forced expression of microRNA-143 mimic blocked the IL-13-induced downregulation of filaggrin, loricrin, and involucrin in epidermal keratinocytes. Collectively, these data suggest that microRNA-143 suppresses IL-13 activity and inflammation through targeting of IL-13Rα1 in epidermal keratinocytes. MicroRNA-143 may serve as a potential preventive and therapeutic target in atopic dermatitis.

  20. The role of the trans double bond in skin barrier sphingolipids: permeability and infrared spectroscopic study of model ceramide and dihydroceramide membranes.


    Skolová, Barbora; Jandovská, Kateřina; Pullmannová, Petra; Tesař, Ondřej; Roh, Jaroslav; Hrabálek, Alexandr; Vávrová, Kateřina


    Dihydroceramides (dCer) are members of the sphingolipid family that lack the C4 trans double bond in their sphingoid backbone. In addition to being precursors of ceramides (Cer) and phytoceramides, dCer have also been found in the extracellular lipid membranes of the epidermal barrier, the stratum corneum. However, their role in barrier homeostasis is not known. We studied how the lack of the trans double bond in dCer compared to Cer influences the permeability, lipid chain order, and packing of multilamellar membranes composed of the major skin barrier lipids: (d)Cer, fatty acids, cholesterol, and cholesteryl sulfate. The permeability of the membranes with long-chain dCer was measured using various markers and was either comparable to or only slightly greater than (by up to 35%, not significant) that of the Cer membranes. The dCer were less sensitive to acyl chain shortening than Cer (the short dCer membranes were up to 6-fold less permeable that the corresponding short Cer membranes). Infrared spectroscopy showed that long dCer mixed less with fatty acids but formed more thermally stable ordered domains than Cer. The key parameter explaining the differences in permeability in the short dCer and Cer was the proportion of the orthorhombic phase. Our results suggest that the presence of the trans double bond in Cer is not crucial for the permeability of skin lipid membranes and that dCer may be underappreciated members of the stratum corneum lipid barrier that increase its heterogeneity.

  1. Skin-identical lipids versus petrolatum in the treatment of tape-stripped and detergent-perturbed human skin.


    Lodén, M; Bárány, E


    The cutaneous permeability barrier is localized to the stratum corneum interstices and is mediated by lamellar bilayers enriched in cholesterol, free fatty acids and ceramides. Topically applied lipids may interfere with the skin barrier function and formulations containing "skin-identical lipids" have been suggested to facilitate normalization of damaged skin. The aim of the present study was to compare the ability of "skin-identical lipids" in a petrolatum-rich cream base and pure petrolatum to facilitate barrier repair in detergent- and tape-stripped-perturbed human skin. Barrier recovery and inflammation were instrumentally monitored for 14 days as transepidermal water loss and skin blood flow, using an Evaporimeter and a laser Doppler flowmeter, respectively. Treatment with the 2 different products gave no indication that "skin-identical lipids" in a cream base are more efficient than pure petrolatum at promoting normalization in either of the 2 experimentally perturbed areas. This finding may support the hypothesis that different types of skin abnormality should be treated according to the underlying damage.

  2. Congenital Abnormalities


    ... Listen Español Text Size Email Print Share Congenital Abnormalities Page Content Article Body About 3% to 4% ... of congenital abnormalities earlier. 5 Categories of Congenital Abnormalities Chromosome Abnormalities Chromosomes are structures that carry genetic ...

  3. Antimicrobial Peptides, Skin Infections and Atopic Dermatitis

    PubMed Central

    Hata, Tissa R.; Gallo, Richard L.


    The innate immune system evolved over 2 billion years ago to first recognize pathogens then eradicate them. Several distinct defects in this ancient but rapidly responsive element of human immune defense account for the increased incidence of skin infections in atopics. These defects include abnormalities in the physical barrier of the epidermis, alterations in microbial pattern recognition receptors such as toll receptors and NOD, and a diminished capacity to increase the expression of antimicrobial peptides during inflammation. Several antimicrobial peptides are affected including; cathelicidin, HBD-2, and HBD-3, which are lower in lesional skin of atopics compared to other inflammatory skin diseases, and dermcidin, which is decreased in sweat. Other defects in the immune defense barrier of atopics include a relative deficiency in plasmacytoid dendritic cells. In the future, understanding the cause of these defects may allow therapeutic intervention to reduce the incidence of infection in atopic individuals and potentially decrease the severity of this disorder. PMID:18620136

  4. Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

    SciTech Connect

    J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari


    The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

  5. Effects of Hydroxydecine(®) (10-hydroxy-2-decenoic acid) on skin barrier structure and function in vitro and clinical efficacy in the treatment of UV-induced xerosis.


    Duplan, Hélène; Questel, Emmanuel; Hernandez-Pigeon, Hélène; Galliano, Marie Florence; Caruana, Antony; Ceruti, Isabelle; Ambonati, Marco; Mejean, Carine; Damour, Odile; Castex-Rizzi, Nathalie; Bessou-Touya, Sandrine; Schmitt, Anne-Marie


    10-Hydroxy-2-decenoic acid, a natural fatty acid only found in royal jelly, may be of value in correcting skin barrier dysfunction. We evaluated the activity of Hydroxydecine(®), its synthetic counterpart, in vitro on the regulation of epidermal differentiation markers, ex vivo on the inflammatory response and restoration of skin barrier function, and in vivo on UV-induced xerosis in healthy human volunteers. In cultured normal human keratinocytes, Hydroxydecine(®) induced involucrin, transglutaminase-1 and filaggrin protein production. In topically Hydroxydecine(®)-treated skin equivalents, immunohistochemical analysis revealed an increase in involucrin, transglutaminase-1 and filaggrin staining. In a model of thymic stromal lymphopoietin (TSLP)-induced inflamed epidermis, a Hydroxydecine(®)-containing emulsion inhibited TSLP release. In a model of inflammation and barrier impairment involving human skin explants maintained alive, Hydroxydecine(®) balm restored stratum corneum cohesion and significantly increased filaggrin expression, as shown by immunohistochemistry. It also decreased pro-inflammatory cytokine secretion (IL-4, IL-5 and IL-13). In healthy volunteers with UV-induced xerosis, the hydration index increased by +28.8% (p<0.01) and +60.4% (p<0.001) after 7 and 21 days of treatment with Hydroxydecine(®) cream, respectively. Hydroxydecine(®) thus proved its efficacy in activating keratinocyte differentiation processes in vitro, restoring skin barrier function and reducing inflammation ex vivo, and hydrating dry skin in vivo.

  6. Kallikrein-related Peptidase-8 (KLK8) Is an Active Serine Protease in Human Epidermis and Sweat and Is Involved in a Skin Barrier Proteolytic Cascade

    PubMed Central

    Eissa, Azza; Amodeo, Vanessa; Smith, Christopher R.; Diamandis, Eleftherios P.


    Kallikrein-related peptidase-8 (KLK8) is a relatively uncharacterized epidermal protease. Although proposed to regulate skin-barrier desquamation and recovery, the catalytic activity of KLK8 was never demonstrated in human epidermis, and its regulators and targets remain unknown. Herein, we elucidated for the first time KLK8 activity in human non-palmoplantar stratum corneum and sweat ex vivo. The majority of stratum corneum and sweat KLK8 was catalytically active, displaying optimal activity at pH 8.5 and considerable activity at pH 5. We also showed that KLK8 is a keratinocyte-specific protease, not secreted by human melanocytes or dermal fibroblasts. KLK8 secretion increased significantly upon calcium induction of terminal keratinocyte differentiation, suggesting an active role for this protease in upper epidermis. Potential activators, regulators, and targets of KLK8 activity were identified by in vitro kinetic assays using pro-KLK8 and mature KLK8 recombinant proteins produced in Pichia pastoris. Mature KLK8 activity was enhanced by calcium and magnesium ions and attenuated by zinc ions and by autocleavage after Arg164. Upon screening KLK8 cleavage of a library of FRET-quenched peptides, trypsin-like specificity was observed with the highest preference for (R/K)(S/T)(A/V) at P1-P1′-P2′. We also demonstrated that KLK5 and lysyl endopeptidase activate latent pro-KLK8, whereas active KLK8 targets pro-KLK11, pro-KLK1, and LL-37 antimicrobial peptide activation in vitro. Together, our data identify KLK8 as a new active serine protease in human stratum corneum and sweat, and we propose regulators and targets that augment its involvement in a skin barrier proteolytic cascade. The implications of KLK8 elevation and hyperactivity in desquamatory and inflammatory skin disease conditions remain to be studied. PMID:20940292

  7. An Aluminum Magnesium Hydroxide Stearate-based Skin Barrier Protection Cream Used for the Management of Eczematous Dermatitis

    PubMed Central

    Bhambri, Sanjay; Michaels, Brent


    Eczematous dermatoses can often be very difficult to treat. An aluminum magnesium hydroxide stearate-based cream has recently become available for clinical use. Aluminum magnesium hydroxide stearate-based cream provides an alternative option in treating these dermatoses while providing barrier protection against external allergens and irritants. This article reviews various studies evaluating aluminum magnesium hydroxide stearate-based cream. PMID:21212843

  8. Topical application of TRPM8 agonists accelerates skin permeability barrier recovery and reduces epidermal proliferation induced by barrier insult: role of cold-sensitive TRP receptors in epidermal permeability barrier homoeostasis.


    Denda, Mitsuhiro; Tsutsumi, Moe; Denda, Sumiko


    TRPA1 and TRPM8 receptors are activated at low temperature (A1: below 17 degrees C and M8: below 22 degrees C). Recently, we observed that low temperature (below 22 degrees C) induced elevation of intracellular calcium in keratinocytes. Moreover, we demonstrated that topical application of TRPA1 agonists accelerated the recovery of epidermal permeability barrier function after disruption. In this study, we examined the effect of topical application of TRPM8 modulators on epidermal permeability barrier homoeostasis. Immunohistochemical study and RT-PCR confirmed the expression of TRPM8 or TRPM8-like protein in epidermal keratinocytes. Topical application of TRPM8 agonists, menthol and WS 12 accelerated barrier recovery after tape stripping. The effect of WS12 was blocked by a non-selective TRP antagonist, Ruthenium Red, and a TRPM8-specific antagonist, BTCT. Topical application of WS12 also reduced epidermal proliferation associated with barrier disruption under low humidity, and this effect was blocked by BTCT. Our results indicate that TRPM8 or a closely related protein in epidermal keratinocytes plays a role in epidermal permeability barrier homoeostasis and epidermal proliferation after barrier insult.

  9. Natural considerations for skin of color.


    Baumann, Leslie; Rodriguez, David; Taylor, Susan C; Wu, Jessica


    Changing US demographics indicate that dermatologists will treat an increasing number of individuals of color. Early research on cutaneous anatomy and physiology was performed mostly in white populations. However, new research is elucidating similarities and differences in skin of color and white skin with regard to skin barrier, pigmentation, and sensitivity. Two of the most important issues are skin lightening and brightening. Products for use on skin of color typically should be gentle because of the proclivity of more deeply pigmented skin to develop pigmentary abnormalities in response to skin irritation or trauma. Increasing patient interest in natural remedies has been matched by research on the use of natural ingredients in dermatology. The relative gentleness of many of these products, coupled with excellent efficacy, makes natural ingredients such as soy and licorice excellent choices in the treatment of disorders such as postinflammatory hyperpigmentation (PIH) and melasma. For daily skin care, ingredients such as oatmeal and feverfew are good choices for gentle cleansing and moisturizing of dry, sensitive, or ashy skin. Sun protection is an increasing concern due to rising rates of melanoma. Several botanical products are useful in augmenting photoprotection with conventional sunscreens.

  10. Skin aging and dry skin.


    Hashizume, Hideo


    Skin aging appears to be the result of both scheduled and continuous "wear and tear" processes that damage cellular DNA and proteins. Two types of aging, chronological skin aging and photoaging, have distinct clinical and histological features. Chronological skin aging is a universal and inevitable process characterized primarily by physiologic alterations in skin function. In this case, keratinocytes are unable to properly terminally differentiate to form a functional stratum corneum, and the rate of formation of neutral lipids that contribute to the barrier function slows, causing dry, pale skin with fine wrinkles. In contrast, photoaging results from the UVR of sunlight and the damage thus becomes apparent in sun-exposed skin. Characteristics of this aging type are dry and sallow skin displaying fine wrinkles as well as deep furrows, resulting from the disorganization of epidermal and dermal components associated with elastosis and heliodermatitis. Understanding of the functions of the skin and the basic principles of moisturizer use and application is important for the prevention of skin aging. Successful treatment of dry skin with appropriate skin care products gives the impression of eternal youth.

  11. Epirubicin-loaded superparamagnetic iron-oxide nanoparticles for transdermal delivery: cancer therapy by circumventing the skin barrier.


    Rao, Yue-feng; Chen, Wei; Liang, Xing-guang; Huang, Yong-zhuo; Miao, Jing; Liu, Lin; Lou, Yan; Zhang, Xing-guo; Wang, Ben; Tang, Rui-kang; Chen, Zhong; Lu, Xiao-yang


    The transdermal administration of chemotherapeutic agents is a persistent challenge for tumor treatments. A model anticancer agent, epirubicin (EPI), is attached to functionalized superparamagnetic iron-oxide nanoparticles (SPION). The covalent modification of the SPION results in EPI-SPION, a potential drug delivery vector that uses magnetism for the targeted transdermal chemotherapy of skin tumors. The spherical EPI-SPION composite exhibits excellent magnetic responsiveness with a saturation magnetization intensity of 77.8 emu g(-1) . They feature specific pH-sensitive drug release, targeting the acidic microenvironment typical in common tumor tissues or endosomes/lysosomes. Cellular uptake studies using human keratinocyte HaCaT cells and melanoma WM266 cells demonstrate that SPION have good biocompatibility. After conjugation with EPI, the nanoparticles can inhibit WM266 cell proliferation; its inhibitory effect on tumor proliferation is determined to be dose-dependent. In vitro transdermal studies demonstrate that the EPI-SPION composites can penetrate deep inside the skin driven by an external magnetic field. The magnetic-field-assisted SPION transdermal vector can circumvent the stratum corneum via follicular pathways. The study indicates the potential of a SPION-based vector for feasible transdermal therapy of skin cancer.

  12. Barrier-Restoring Therapies in Atopic Dermatitis: Current Approaches and Future Perspectives

    PubMed Central

    Valdman-Grinshpoun, Y.; Ben-Amitai, D.; Zvulunov, A.


    Atopic dermatitis is a multifactorial, chronic relapsing, inflammatory disease, characterized by xerosis, eczematous lesions, and pruritus. The latter usually leads to an “itch-scratch” cycle that may compromise the epidermal barrier. Skin barrier abnormalities in atopic dermatitis may result from mutations in the gene encoding for filaggrin, which plays an important role in the formation of cornified cytosol. Barrier abnormalities render the skin more permeable to irritants, allergens, and microorganisms. Treatment of atopic dermatitis must be directed to control the itching, suppress the inflammation, and restore the skin barrier. Emollients, both creams and ointments, improve the barrier function of stratum corneum by providing it with water and lipids. Studies on atopic dermatitis and barrier repair treatment show that adequate lipid replacement therapy reduces the inflammation and restores epidermal function. Efforts directed to develop immunomodulators that interfere with cytokine-induced skin barrier dysfunction, provide a promising strategy for treatment of atopic dermatitis. Moreover, an impressive proliferation of more than 80 clinical studies focusing on topical treatments in atopic dermatitis led to growing expectations for better therapies. PMID:22956938

  13. Leukotriene B4 receptor type 2 (BLT2) enhances skin barrier function by regulating tight junction proteins.


    Ishii, Yumiko; Saeki, Kazuko; Liu, Min; Sasaki, Fumiyuki; Koga, Tomoaki; Kitajima, Keiko; Meno, Chikara; Okuno, Toshiaki; Yokomizo, Takehiko


    GPCRs are involved in numerous physiologic functions and are important drug targets. Although the epithelial barrier is important for protection from invading pathogens, the correlation between GPCRs and epithelial barrier function remains unknown. Leukotriene B4 (LTB4) receptor type 2 (BLT2), mainly expressed in epithelial cells, is a GPCR for 12(S)-hydroxyheptadeca-5Z,8E,10E-trienoic acid (12-HHT) and LTB4. In our study, BLT2 localized at the lateral membrane in BLT2-overexpressing Madin-Darby canine kidney (MDCK) II cells and in the small intestine of BLT2-transgenic mice. BLT2-deficient mice exhibited higher transepidermal water loss and were more sensitive to epicutaneous sensitization. MDCK-BLT2 cells recovered transepithelial electrical resistance (TER) after a calcium switch faster than did MDCK-Mock cells, and 12-HHT stimulation accelerated TER recovery only in MDCK-BLT2 cells. Quantitative PCR and immunoblot analyses revealed that the 12-HHT/BLT2 axis up-regulated claudin-4 (CLDN4) expression in MDCK-BLT2 cells and human primary keratinocytes, and CLDN4 knockdown abolished 12-HHT-dependent TER recovery. Acceleration of TER recovery and induction of CLDN4 expression by 12-HHT stimulation were abolished by inhibition of Gαi protein or p38 MAPK. These results show that 12-HHT/BLT2 enhances epithelial barrier function by increasing CLDN4 expression via the Gαi protein-p38 MAPK pathway.

  14. Disruption of the Sjögren-Larsson Syndrome Gene Aldh3a2 in Mice Increases Keratinocyte Growth and Retards Skin Barrier Recovery.


    Naganuma, Tatsuro; Takagi, Shuyu; Kanetake, Tsukasa; Kitamura, Takuya; Hattori, Satoko; Miyakawa, Tsuyoshi; Sassa, Takayuki; Kihara, Akio


    The fatty aldehyde dehydrogenase (FALDH) ALDH3A2 is the causative gene of Sjögren Larsson syndrome (SLS). To date, the molecular mechanism underlying the symptoms characterizing SLS has been poorly understood. Using Aldh3a2(-/-) mice, we found here that Aldh3a2 was the major FALDH active in undifferentiated keratinocytes. Long-chain base metabolism was greatly impaired in Aldh3a2(-/-) keratinocytes. Phenotypically, the intercellular spaces were widened in the basal layer of the Aldh3a2(-/-) epidermis due to hyperproliferation of keratinocytes. Furthermore, oxidative stress-induced genes were up-regulated in Aldh3a2(-/-) keratinocytes. Upon keratinocyte differentiation, the activity of another FALDH, Aldh3b2, surpassed that of Aldh3a2 As a result, Aldh3a2(-/-) mice were indistinguishable from wild-type mice in terms of their whole epidermis FALDH activity, and their skin barrier function was uncompromised under normal conditions. However, perturbation of the stratum corneum caused increased transepidermal water loss and delayed barrier recovery in Aldh3a2(-/-) mice. In conclusion, Aldh3a2(-/-) mice replicated some aspects of SLS symptoms, especially at the basal layer of the epidermis. Our results suggest that hyperproliferation of keratinocytes via oxidative stress responses may partly contribute to the ichthyosis symptoms of SLS.

  15. Barrier protective use of skin care to prevent chemotherapy-induced cutaneous symptoms and to maintain quality of life in patients with breast cancer

    PubMed Central

    Wohlrab, Johannes; Bangemann, Nikola; Kleine-Tebbe, Anke; Thill, Marc; Kümmel, Sherko; Grischke, Eva-Maria; Richter, Rainer; Seite, Sophie; Lüftner, Diana


    Purpose Chemotherapy with anthracyclines, taxanes, or alkylating agents often causes cutaneous side effects. Nonspecific inhibition of the proliferative activity of keratinocytes has antidifferentiation effects that lead to defects in the barrier function and, thus, to dry, itchy, and irritable skin. These cutaneous symptoms reduce the quality of life of the patients considerably. Conditioning with topical application of niacinamide uses the cytoprotective and barrier stabilizing effect of vitamin B3. Patients and methods A multicenter randomized crossover study investigated the influence of the test preparation on the quality of life compared to standard care for 73 patients with breast cancer undergoing adjuvant or neoadjuvant cytostatic therapy. Primary target parameter was the Dermatology Life Quality Index with its respective subscales after 6 weeks of a twice-daily application of the respective preparations. Additionally, specific symptoms such as pruritus, dryness, and irritability have been assessed using visual analog scales. Results Regarding the total score of the Dermatology Life Quality Index, no relevant differences could be observed. However, the results for the “symptoms and feelings” subscale show a significant advantage in favor of the test preparation. Significant superiority of the test preparation could also be observed in the secondary target parameters, the visual analog scales (P<0.05). Conclusion The results show for the first time a significant superiority of prophylactic application of niacinamide for maintaining quality of life while undergoing cytostatic treatment. PMID:25114589

  16. Skin Barrier Function and Staphylococcus aureus Colonization in Vestibulum Nasi and Fauces in Healthy Infants and Infants with Eczema: A Population-Based Cohort Study.


    Berents, Teresa Løvold; Carlsen, Karin Cecilie Lødrup; Mowinckel, Petter; Skjerven, Håvard Ove; Kvenshagen, Bente; Rolfsjord, Leif Bjarte; Bradley, Maria; Lieden, Agne; Carlsen, Kai-Håkon; Gaustad, Peter; Gjersvik, Petter


    Atopic eczema (AE) is associated with Staphylococcus aureus (S. aureus) colonization and skin barrier dysfunction, often measured by increased transepidermal water loss (TEWL). In the present study, the primary aim was to see whether S. aureus colonization in the vestibulum nasi and/or fauces was associated with increased TEWL in infants with healthy skin and infants with eczema. Secondarily, we aimed to investigate whether TEWL measurements on non-lesional skin on the lateral upper arm is equivalent to volar forearm in infants. In 167 of 240 infants, recruited from the general population, TEWL measurements on the lateral upper arm and volar forearm, using a DermaLab USB, fulfilled our environmental requirements. The mean of three TEWL measurements from each site was used for analysis. The infants were diagnosed with no eczema (n = 110), possible AE (n = 28) or AE (n = 29). DNA samples were analysed for mutations in the filaggrin gene (FLG). Bacterial cultures were reported positive with the identification of at least one culture with S. aureus from vestibulum nasi and/or fauces. S. aureus colonization, found in 89 infants (53%), was not associated with increased TEWL (i.e. TEWL in the upper quartile), neither on the lateral upper arm or volar forearm (p = 0.08 and p = 0.98, respectively), nor with AE (p = 0.10) or FLG mutation (p = 0.17). TEWL was significantly higher on both measuring sites in infants with AE compared to infants with possible AE and no eczema. FLG mutation was significantly associated with increased TEWL, with a 47% difference in TEWL. We conclude that S. aureus in vestibulum nasi and/or fauces was not associated with TEWL, whereas TEWL measurements on the lateral upper arm and volar forearm appear equally appropriate in infants.

  17. The Precise Structures and Stereochemistry of Trihydroxy-linoleates Esterified in Human and Porcine Epidermis and Their Significance in Skin Barrier Function

    PubMed Central

    Chiba, Takahito; Thomas, Christopher P.; Calcutt, M. Wade; Boeglin, William E.; O'Donnell, Valerie B.; Brash, Alan R.


    Creation of an intact skin water barrier, a prerequisite for life on dry land, requires the lipoxygenase-catalyzed oxidation of the essential fatty acid linoleate, which is esterified to the ω-hydroxyl of an epidermis-specific ceramide. Oxidation of the linoleate moiety by lipoxygenases is proposed to facilitate enzymatic cleavage of the ester bond, releasing free ω-hydroxyceramide for covalent binding to protein, thus forming the corneocyte lipid envelope, a key component of the epidermal barrier. Herein, we report the transformations of esterified linoleate proceed beyond the initial steps of oxidation and epoxyalcohol synthesis catalyzed by the consecutive actions of 12R-LOX and epidermal LOX3. The major end product in human and porcine epidermis is a trihydroxy derivative, formed with a specificity that implicates participation of an epoxide hydrolase in converting epoxyalcohol to triol. Of the 16 possible triols arising from hydrolysis of 9,10-epoxy-13-hydroxy-octadecenoates, using LC-MS and chiral analyses, we identify and quantify specifically 9R,10S,13R-trihydroxy-11E-octadecenoate as the single major triol esterified in porcine epidermis and the same isomer with lesser amounts of its 10R diastereomer in human epidermis. The 9R,10S,13R-triol is formed by SN2 hydrolysis of the 9R,10R-epoxy-13R-hydroxy-octadecenoate product of the LOX enzymes, a reaction specificity characteristic of epoxide hydrolase. The high polarity of triol over the primary linoleate products enhances the concept that the oxidations disrupt corneocyte membrane lipids, promoting release of free ω-hydroxyceramide for covalent binding to protein and sealing of the waterproof barrier. PMID:27151221

  18. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    SciTech Connect

    Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne


    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

  19. Factors influencing adverse skin responses in rats receiving repeated subcutaneous injections and potential impact on neurobehavior

    PubMed Central

    Levoe, S. Nikki; Flannery, Brenna M.; Brignolo, Laurie; Imai, Denise M.; Koehne, Amanda; Austin, Adam T.; Bruun, Donald A.; Tancredi, Daniel J.; Lein, Pamela J.


    Repeated subcutaneous (s.c.) injection is a common route of administration in chronic studies of neuroactive compounds. However, in a pilot study we noted a significant incidence of skin abnormalities in adult male Long-Evans rats receiving daily s.c. injections of peanut oil (1.0 ml/kg) in the subscapular region for 21 d. Histopathological analyses of the lesions were consistent with a foreign body reaction. Subsequent studies were conducted to determine factors that influenced the incidence or severity of skin abnormalities, and whether these adverse skin reactions influenced a specific neurobehavioral outcome. Rats injected daily for 21 d with food grade peanut oil had an earlier onset and greater incidence of skin abnormalities relative to rats receiving an equal volume (1.0 ml/kg/d) of reagent grade peanut oil or triglyceride of coconut oil. Skin abnormalities in animals injected daily with peanut oil were increased in animals housed on corncob versus paper bedding. Comparison of animals obtained from different barrier facilities exposed to the same injection paradigm (reagent grade peanut oil, 1.0 ml/kg/d s.c.) revealed significant differences in the severity of skin abnormalities. However, animals from different barrier facilities did not perform differently in a Pavlovian fear conditioning task. Collectively, these data suggest that environmental factors influence the incidence and severity of skin abnormalities following repeated s.c. injections, but that these adverse skin responses do not significantly influence performance in at least one test of learning and memory. PMID:25705100

  20. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy


    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  1. Alveolar abnormalities


    ... page: // Alveolar abnormalities To use the sharing features on this page, please enable JavaScript. Alveolar abnormalities are changes in the tiny air sacs in ...

  2. Nail abnormalities


    Beau's lines; Fingernail abnormalities; Spoon nails; Onycholysis; Leukonychia; Koilonychia; Brittle nails ... 2012:chap 71. Zaiac MN, Walker A. Nail abnormalities associated with systemic pathologies. Clin Dermatol . 2013;31: ...

  3. Continuous illumination through larval development suppresses dopamine synthesis in the suprachiasmatic nucleus, causing activation of α-MSH synthesis in the pituitary and abnormal metamorphic skin pigmentation in flounder.


    Itoh, Kae; Washio, Youhei; Fujinami, Yuichiro; Shimizu, Daisuke; Uji, Susumu; Yokoi, Hayato; Suzuki, Tohru


    In order to better understand the endocrine aberrations related to abnormal metamorphic pigmentation that appear in flounder larvae reared in tanks, this study examined the effects of continuous 24-h illumination (LL) through larval development on the expression of tyrosine hydroxylase-1 (th1), proopiomelanocortin (pomc), α-melanophore-stimulating hormone (α-MSH) and melanin concentrating hormone (MCH), which are known to participate in the control of background adaptation of body color. We observed two conspicuous deviations in the endocrine system under LL when compared with natural light conditions (LD). First, LL severely suppressed th1 expression in the dopaminergic neurons in the anterior diencephalon, including the suprachiasmatic nucleus (SCN). Second, pomc and α-MSH expression in the pars intermedia melanotrophs was enhanced by LL. Skin color was paler under LL than LD before metamorphic pigmentation, and abnormal metamorphic pigmentation occurred at a higher ratio in LL. We therefore hypothesize that continuous LL inhibited dopamine synthesis in the SCN, which resulted in up-regulation of pomc mRNA expression in the melanotrophs. In spite of the up-regulation of pomc in the melanotrophs, larval skin was adjusted to be pale by MCH which was not affected by LL. Accumulation of α-MSH in the melanotrophs is caused by uncoupling of α-MSH synthesis and secretion due to inhibitory role of MCH on α-MSH secretion, which results in abnormal metamorphic pigmentation by affecting differentiation of adult-type melanophores. Our data demonstrate that continuous illumination at the post-embryonic stage has negative effects on the neuroendocrine system and pituitary in flounder.

  4. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway.


    Zhao, Hengguang; Li, Shuang; Luo, Fuling; Tan, Qian; Li, Hui; Zhou, Weikang


    Psoriasis affects 2-4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients.

  5. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    PubMed Central



    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  6. The Ontogeny of Skin

    PubMed Central

    Visscher, Marty; Narendran, Vivek


    Significance: During gestation, fetal skin progresses from a single layer derived from ectoderm to a complex, multi-layer tissue with the stratum corneum (SC) as the outermost layer. Innate immunity is a conferred complex process involving a balance of pro- and anti-inflammatory cytokines, structural proteins, and specific antigen-presenting cells. The SC is a part of the innate immune system as an impermeable physical barrier containing anti-microbial lipids and host defense proteins. Postnatally, the epidermis continually replenishes itself, provides a protective barrier, and repairs injuries. Recent Advances: Vernix caseosa protects the fetus during gestation and facilitates development of the SC in the aqueous uterine environment. The anti-infective, hydrating, acidification, and wound-healing properties post birth provide insights for the development of strategies that facilitate SC maturation and repair in the premature infant. Critical Issues: Reduction of infant mortality is a global health priority. Premature infants have an incompetent skin barrier putting them at risk for irritant exposure, skin compromise and life-threatening infections. Effective interventions to accelerate skin barrier maturation are compelling. Future Directions: Investigations to determine the ontogeny of barrier maturation, that is, SC structure, composition, cohesiveness, permeability, susceptibility to injury, and microflora, as a function of gestational age are essential. Clinicians need to know when the premature skin barrier becomes fully competent and comparable to healthy newborn skin. This will guide the development of innovative strategies for optimizing skin barrier development. PMID:24761361

  7. Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

    SciTech Connect

    Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.


    A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.

  8. Meiotic abnormalities

    SciTech Connect


    Chapter 19, describes meiotic abnormalities. These include nondisjunction of autosomes and sex chromosomes, genetic and environmental causes of nondisjunction, misdivision of the centromere, chromosomally abnormal human sperm, male infertility, parental age, and origin of diploid gametes. 57 refs., 2 figs., 1 tab.

  9. Lipid-colloid dressing shows improved reepithelialization, pain relief, and corneal barrier function in split-thickness skin-graft donor wound healing.


    Tanaka, Katsuya; Akita, Sadanori; Yoshimoto, Hiroshi; Houbara, Seiji; Hirano, Akiyoshi


    Donor-site wound healing was tested with a nonadherent petrolatum- and hydrocolloid-impregnated polyester, a lipid-colloid dressing, and a nonadherent polyester dressing, supplemented with petrolatum manually by a physician onsite. Ten patients, 1 woman and 9 men (22 to 79 years old; average 58.4 ± 17.54 years), were enrolled in this prospective comparison study. The split-thickness skin graft was 14.5 ± 7.49 cm long × 8.2 ± 4.07 cm wide (5.5-27 cm long and 4.0-14.0 wide) and 14/1000 inches (0.356 mm) deep. The degree of reepithelialization in lipid-colloid dressing was significantly better than that in polyester mesh dressing, with 1.7 ± 1.00 and 2.8 ± 0.83 for the lipid-colloid dressing and polyester mesh dressing, respectively (P < .05), and degree of pain was significantly lower in lipid-colloid dressing than that in polyester dressing, 1.7 ± 1.11 and 2.9 ± 1.12 for the lipid-colloid dressing and polyester mesh dressing, respectively (P < .01). In moisture meter analyses, the values of effective contact coefficient and corneal thickness in lipid-colloid at wound healing was significantly smaller than those in polyester mesh (effective contact coefficient: 11.7 ± 1.87% and 15.6 ± 3.09% for lipid-colloid and polyester mesh, respectively, P < .05; corneal thickness: 31.1 ± 6.65 µm and 40.7 ± 8.69 µm for lipid-colloid and polyester mesh, respectively, P < .05). No significant difference was observed at 1 month after healing. The nonadherent lipid-colloid polyester dressing has superior wound healing and pain relief and demonstrates better corneal barrier function delineated by effective contact coefficient and corneal thickness at healing in split-thickness donors.

  10. Study of surfactant-skin interactions by skin impedance measurements.


    Lu, Guojin; Moore, David J


    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation.

  11. Topical Corticosteroid Application and the Structural and Functional Integrity of the Epidermal Barrier

    PubMed Central

    Cash, Kimberly


    Topical corticosteroids are a very important part of the treatment of many skin disorders, especially eczematous dermatoses. When utilized properly and judiciously these agents often achieve excellent results in clearing or markedly improving many dermatological disorders. As some studies have shown, topical corticosteroids, despite their ability to decrease inflammation through several mechanisms, induce abnormalities in lipid synthesis and intercellular bilayer structure in the stratum corneum, which appear to prolong epidermal barrier recovery. These adverse effects may contribute to eariier eczematous flaring if measures to provide barrier repair are not undertaken. In addition, although topical corticosteroids are applied only to sites affected by the skin eruption, the incorporation of “barrier friendly” excipients into the vehicle that improve stratum corneum permeability barrier function and integrity is very rational. PMID:24307921

  12. Lymphoblastoid lines and skin fibroblasts from patients with tuberous sclerosis are abnormally sensitive to ionizing radiation and to a radiomimetic chemical

    SciTech Connect

    Scudiero, D.A.; Moshell, A.N.; Scarpinato, R.G.; Meyer, S.A.; Clatterbuck, B.E.; Tarone, R.E.; Robbins, J.H.


    Lymphoblastoid lines, derived by transforming peripheral blood lymphocytes with Epstein-Barr virus, and skin fibroblast lines were established from two patients with tuberous sclerosis. The number of viable lymphoblastoid cells was determined by their ability to exclude the vital dye trypan blue after their irradiation with x-rays or 254 nm ultraviolet light. The growth of fibroblasts was determined by their ability to form colonies after treatment with the radiomimetic, DNA-damaging chemical N-methyl-N'-nitro-N-nitrosoguanidine. The tuberous sclerosis lymphoblastoid lines were hypersensitive to x-rays but had normal sensitivity to the ultraviolet radiation. The tuberous sclerosis fibroblast lines were hypersensitive to the N-methyl-N'-nitro-N-nitrosoguanidine. The hypersensitivity of tuberous sclerosis cells to x-rays and to N-methyl-N'-nitro-N-nitrosoguanidine is believed to reflect defective repair of DNA damaged by these agents and may provide the basis for in vitro, including prenatal, diagnostic tests for tuberous sclerosis.

  13. Skin protection for hairdressers.


    Skudlik, Christoph; John, Swen Malte


    The application of protective creams in the hairdressing trade forms part of a complex concept for the prevention of occupational skin disorders. To date, no comparative controlled intervention studies have been carried out using different skin-protective creams. Previously published skin protection plans concerning barrier creams for the hairdressing trade are fairly general or rudimentary, reflecting our still limited knowledge on the subject. Bioengineering studies have even demonstrated a paradoxical effect of a certain skin-protective foam designed for hairdressers. Regarding other barrier creams, a certain protective effect could however be shown in studies concerning exposure to wetness and detergents. Pre-exposition skin protection seems to be of particular relevance. Thus, in principle, the regular application of adequate skin protection creams can be recommended in the hairdressing trade, although the protective effect should not be overvalued.

  14. Skin Dictionary


    ... your skin, hair, and nails Skin dictionary Camp Discovery Good Skin Knowledge lesson plans and activities Video library Find a ... your skin, hair, and nails Skin dictionary Camp Discovery Good Skin Knowledge lesson plans and activities Video library Find a ...

  15. Leukocyte abnormalities.


    Gabig, T G


    Certain qualitative abnormalities in neutrophils and blood monocytes are associated with frequent, severe, and recurrent bacterial infections leading to fatal sepsis, while other qualitative defects demonstrated in vitro may have few or no clinical sequelae. These qualitative defects are discussed in terms of the specific functions of locomotion, phagocytosis, degranulation, and bacterial killing.

  16. Staphylococcus aureus exploits epidermal barrier defects in atopic dermatitis to trigger cytokine expression

    PubMed Central

    Nakatsuji, Teruaki; Chen, Tiffany H.; Two, Aimee M.; Chun, Kimberly A.; Narala, Saisindhu; Geha, Raif S.; Hata, Tissa R.; Gallo, Richard L.


    Patients with atopic dermatitis (AD) have an abnormal skin barrier and are frequently colonized by S. aureus. In this study we investigated if S. aureus penetrates the epidermal barrier of subjects with AD and sought to understand the mechanism and functional significance of this entry. S. aureus was observed to be more abundant in the dermis of lesional skin from AD patients. Bacterial entry past the epidermis was observed in cultured human skin equivalents and in mice, but found to be increased in the skin of cathelicidin knockout (Camp−/−) and ovalbumin-sensitized filaggrin mutant (FLGft/ft) mice. S. aureus penetration through the epidermis was dependent on bacterial viability and protease activity as killed bacteria or a protease-null mutant strain of S. aureus was unable to penetrate. Entry of S. aureus directly correlated with increased expression of IL4, IL13, IL22, TSLP and other cytokines associated with AD, and with decreased expression of cathelicidin. These data illustrate how abnormalities of the epidermal barrier in AD can alter the balance of S. aureus entry into the dermis and provides an explanation for how such dermal dysbiosis results in increased inflammatory cytokines and exacerbation of disease. PMID:27381887

  17. Expression of IL-22 in the Skin Causes Th2-Biased Immunity, Epidermal Barrier Dysfunction, and Pruritus via Stimulating Epithelial Th2 Cytokines and the GRP Pathway.


    Lou, Hongfei; Lu, Jingning; Choi, Eun Byul; Oh, Min Hee; Jeong, Mingeum; Barmettler, Sara; Zhu, Zhou; Zheng, Tao


    Increased expression of Th22 cytokine IL-22 is a characteristic finding in atopic dermatitis (AD). However, the specific role of IL-22 in the pathogenesis of AD in vivo has yet to be elucidated. Consistent with observations in human AD, IL-22 was significantly increased in the AD skin of mice after epicutaneous sensitization to house dust mite allergen. Utilizing a skin-specific inducible transgenic system, we show in the present study that expression of IL-22 in the skin of mice caused an AD-like phenotype characterized by chronic pruritic dermatitis associated with Th2-biased local and systemic immune responses, downregulation of epidermal differentiation complex genes, and enhanced dermatitis upon epicutaneous allergen exposure. IL-22 potently induced the expression of gastrin-releasing peptide (GRP), a neuropeptide pruritogen, in dermal immune cells and sensory afferents and in their skin-innervating sensory neurons. IL-22 also differentially upregulated the expression of GRP receptor (GRPR) on keratinocytes of AD skin. The number of GRP(+) cells in the skin correlated with the AD severity and the intensity of pruritus. IL-22 directly upregulated the expression of epithelial-derived type 2 cytokines (thymic stromal lymphopoietin and IL-33) and GRP in primary keratinocytes. Furthermore, GRP not only strongly induced thymic stromal lymphopoietin but it also increased the expression of IL-33 and GRPR synergistically with IL-22. Importantly, we found that the expression of GRP was strikingly increased in the skin of patients with AD. These results indicate that IL-22 plays important pathogenic roles in the initiation and development of AD, in part through inducing keratinocyte production of type 2 cytokines and activation of the GRP/GRPR pathway.

  18. Skin Diseases: Skin Health and Skin Diseases


    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  19. Nicotinamide for skin cancer chemoprevention.


    Damian, Diona L


    Nicotinamide (vitamin B3 ) has a range of photoprotective effects in vitro and in vivo; it enhances DNA repair, reduces UV radiation-induced suppression of skin immune responses, modulates inflammatory cytokine production and skin barrier function and restores cellular energy levels after UV exposure. Pharmacological doses of nicotinamide have been shown to reduce actinic keratoses and nonmelanoma skin cancer incidence in high-risk individuals, making this a nontoxic and accessible option for skin cancer chemoprevention in this population.

  20. Interaction of O and OH radicals with a simple model system for lipids in the skin barrier: a reactive molecular dynamics investigation for plasma medicine

    NASA Astrophysics Data System (ADS)

    Van der Paal, Jonas; Aernouts, Stefaan; van Duin, Adri C. T.; Neyts, Erik C.; Bogaerts, Annemie


    Plasma medicine has been claimed to provide a novel route to heal wounds and regenerate skin, although very little is currently known about the elementary processes taking place. We carried out a series of ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of O and OH radicals with lipids, more specifically with α-linolenic acid as a model for the free fatty acids present in the upper skin layer. Our calculations predict that the O and OH radicals most typically abstract a H atom from the fatty acids, which can lead to the formation of a conjugated double bond, but also to the incorporation of alcohol or aldehyde groups, thereby increasing the hydrophilic character of the fatty acids and changing the general lipid composition of the skin. Within the limitations of the investigated model, no formation of possibly toxic products was observed.

  1. Dietary Yeast Cell Wall Extract Alters the Proteome of the Skin Mucous Barrier in Atlantic Salmon (Salmo salar): Increased Abundance and Expression of a Calreticulin-Like Protein.


    Micallef, Giulia; Cash, Phillip; Fernandes, Jorge M O; Rajan, Binoy; Tinsley, John W; Bickerdike, Ralph; Martin, Samuel A M; Bowman, Alan S


    In order to improve fish health and reduce use of chemotherapeutants in aquaculture production, the immunomodulatory effect of various nutritional ingredients has been explored. In salmon, there is evidence that functional feeds can reduce the abundance of sea lice. This study aimed to determine if there were consistent changes in the skin mucus proteome that could serve as a biomarker for dietary yeast cell wall extract. The effect of dietary yeast cell wall extract on the skin mucus proteome of Atlantic salmon was examined using two-dimensional gel electrophoresis. Forty-nine spots showed a statistically significant change in their normalised volumes between the control and yeast cell wall diets. Thirteen spots were successfully identified by peptide fragment fingerprinting and LC-MS/MS and these belonged to a variety of functions and pathways. To assess the validity of the results from the proteome approach, the gene expression of a selection of these proteins was studied in skin mRNA from two different independent feeding trials using yeast cell wall extracts. A calreticulin-like protein increased in abundance at both the protein and transcript level in response to dietary yeast cell wall extract. The calreticulin-like protein was identified as a possible biomarker for yeast-derived functional feeds since it showed the most consistent change in expression in both the mucus proteome and skin transcriptome. The discovery of such a biomarker is expected to quicken the pace of research in the application of yeast cell wall extracts.

  2. Dietary Yeast Cell Wall Extract Alters the Proteome of the Skin Mucous Barrier in Atlantic Salmon (Salmo salar): Increased Abundance and Expression of a Calreticulin-Like Protein

    PubMed Central

    Micallef, Giulia; Cash, Phillip; Fernandes, Jorge M. O.; Rajan, Binoy; Tinsley, John W.; Bickerdike, Ralph


    In order to improve fish health and reduce use of chemotherapeutants in aquaculture production, the immunomodulatory effect of various nutritional ingredients has been explored. In salmon, there is evidence that functional feeds can reduce the abundance of sea lice. This study aimed to determine if there were consistent changes in the skin mucus proteome that could serve as a biomarker for dietary yeast cell wall extract. The effect of dietary yeast cell wall extract on the skin mucus proteome of Atlantic salmon was examined using two-dimensional gel electrophoresis. Forty-nine spots showed a statistically significant change in their normalised volumes between the control and yeast cell wall diets. Thirteen spots were successfully identified by peptide fragment fingerprinting and LC-MS/MS and these belonged to a variety of functions and pathways. To assess the validity of the results from the proteome approach, the gene expression of a selection of these proteins was studied in skin mRNA from two different independent feeding trials using yeast cell wall extracts. A calreticulin-like protein increased in abundance at both the protein and transcript level in response to dietary yeast cell wall extract. The calreticulin-like protein was identified as a possible biomarker for yeast-derived functional feeds since it showed the most consistent change in expression in both the mucus proteome and skin transcriptome. The discovery of such a biomarker is expected to quicken the pace of research in the application of yeast cell wall extracts. PMID:28046109

  3. Acral peeling skin syndrome.


    Hashimoto, K; Hamzavi, I; Tanaka, K; Shwayder, T


    Peeling skin syndrome is a rare autosomal recessive disease characterized by widespread painless peeling of the skin in superficial sheets. We describe a 34-year-old man with a lifelong history of spontaneous asymptomatic peeling skin limited to the acral surfaces. This patient probably represents a localized variant of peeling skin syndrome, which has previously been described as a generalized condition. Light and electron microscopic studies of biopsy specimens taken before and after immersion in water were performed. It was concluded that this patient has abnormal keratohyalin granules and inadequate aggregation of keratin filaments that caused the separation of the epidermis in the stratum corneum through the clear zone. Alternatively, unknown keratin species expressed in the clear zone may also cause the abnormality. (J Am Acad Dermatol 2000;43:1112-9.).

  4. An Aluminum Magnesium Hydroxide Stearate-based Skin Barrier Protection Cream Used for the Management of Eczematous Dermatitis: A Summary of Completed Studies.


    Del Rosso, James Q; Bhambri, Sanjay; Michaels, Brent


    Eczematous dermatoses can often be very difficult to treat. An aluminum magnesium hydroxide stearate-based cream has recently become available for clinical use. Aluminum magnesium hydroxide stearate-based cream provides an alternative option in treating these dermatoses while providing barrier protection against external allergens and irritants. This article reviews various studies evaluating aluminum magnesium hydroxide stearate-based cream.

  5. The repair of impaired epidermal barrier function in rats by the cutaneous application of linoleic acid.


    Prottey, C; Hartop, P J; Black, J G; McCormack, J I


    Epidermal barrier function in rats was experimentally impaired by two separate means, namely, by rendering the animals deficient in essential fatty acids and by evoking a primary cutaneous irritant response by treating with a solution of sodium laurate. Impaired barrier function was manifested by a greatly increased rate of transepidermal water loss. Application to the skin of sunflower seed oil, which is rich in linoleic acid, rapidly restored to normal the abnormally high rates of transepidermal water loss in both experimental cases, and it was shown with the essential fatty acid-deficient rats that there was a concomitant incorporation of linoleic acid of the sunflower seed oil into epidermal lipids. Cutaneous application of olive oil, which is low in linoleic acid but rich in the non-essential oleic acid, did not influence epidermal barrier function. A close relationship of barrier function and essential fatty acids is indicated.

  6. Effect of the composition of lecithin/n-propanol/isopropyl myristate/water microemulsions on barrier properties of mice skin for transdermal permeation of tetracaine hydrochloride: in vitro.


    Changez, Mohammad; Varshney, Manoj; Chander, Jadish; Dinda, Amit Kumar


    Effect of composition of lecithin water-in-oil and oil-in-water microemulsion on in vitro transdermal permeation of tetracaine hydrochloride was studied on mice model. The results were compared with an aqueous solution of tetracaine hydrochloride (2.7 mg/ml). In vitro skin flux and permeability coefficients were obtained using the Franz diffusion cell. Differential scanning calorimetry (DSC), transmission electron microscopy (TEM) and confocal laser scanning microscopy (CLSM) were used to study the mechanism of action of the microemulsion. Micrographs of TEM and CLSM studies were analyzed by using Image Pro Plus image software. Skin flux of tetracaine hydrochloride was found to be dependent on the composition of lecithin/n-propanol/isopropyl myristate/water microemulsions. At lower Km ratio (i.e. 0.5:1 and 0.8:1) of microemulsion, the rate of permeation of tetracaine hydrochloride was higher when compared to the microemulsion of higher Km ratio (1:1 and 1.5:1). Image analysis of TEM micrograph, 6h after application of lecithin microemulsion, showed 3.5+/-0.75-fold (p<0.001) increase in the intercellular space in the epidermis and 3.8+/-0.4-fold (p<0.001) enhancement in upper dermis. CLMS results show that sweat gland and hair follicles also provided path for permeation of the drug through the skin.

  7. The structure, function, and importance of ceramides in skin and their use as therapeutic agents in skin-care products.


    Meckfessel, Matthew H; Brandt, Staci


    Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function.

  8. Skin Cancer


    ... version of this page please turn Javascript on. Skin Cancer What is Skin Cancer? Skin cancer is the most common type ... of approximately 9,480 Americans in 2013. Can Skin Cancer Be Treated? Most basal cell and squamous ...

  9. Conservative procedures in skin reconstitution

    PubMed Central

    Wollina, Uwe


    Skin exerts a number of essential protective functions ensuring homeostasis of the whole body. In the present review barrier function of skin and its expression of antimicrobial peptides are discussed. Barrier function is provided by the dynamic stratum corneum structure composed of lipids and corneocytes. Stratum corneum is a conditio sine qua non for terrestrial life. Impairment of barrier function can be due to injury and inflammatory skin diseases. Therapeutic options are discussed with special emphasis of radiodermatitis and irritant contact dermatitis in patients with hearing device. The use of antimicrobial peptides is illustrated by facial inflammatory skin diseases. In wound healing new developments include biotechnological developments of matrix- and growth factors and tissue-engineered skin substitutes. In everyday wound care of chronic wounds the concept of wound bed preparation (TIME) constitutes the base of successful treatment. PMID:22073065

  10. Inflammatory peeling skin syndrome caused a novel mutation in CDSN.


    Telem, Dana Fuchs; Israeli, Shirli; Sarig, Ofer; Sprecher, Eli


    Generalized peeling skin syndrome (PSS) is a rare autosomal recessive dermatosis manifesting with continuous exfoliation of the stratum corneum. The inflammatory (type B) subtype of PSS was recently found to be caused by deleterious mutations in the CDSN gene encoding corneodesmosin, a major component of desmosomal junctions in the uppermost layers of the epidermis. In the present study, we assessed a 10-month-old baby, who presented with generalized superficial peeling of the skin. Using PCR amplification and direct sequencing, we identified the third PSS-associated mutation in CDSN, a homozygous 4 bp duplication in the second exon of the gene (c.164_167dup GCCT; p.Thr57ProfsX6). These data further support the notion that corneodesmosin deficiency impairs cell-cell adhesion in the upper epidermis, paving the way for an abnormal inflammatory response due to epidermal barrier disruption.

  11. The relationship between skin maturation and electrical skin impedance.


    Emery, M M; Hebert, A A; Aguirre Vila-Coro, A; Prager, T C


    When performing electrophysiological testing, high electrical impedance values are sometimes found in neonates. Since excessive impedance can invalidate test results, a study was conducted to delineate the relationship between skin maturation and electrical skin impedance. This study investigated the skin impedance in 72 infants ranging from 196 to 640 days of age from conception. Regression analyses demonstrated a significant relationship between impedance and age, with the highest impedance centered around full-term gestation with values falling precipitously at time points on either side. Clinically, impedance values fall to normal levels at approximately four months following full-term gestation. Skin impedance values are low in premature infants, but rapidly increase as the age approaches that of full-term neonates. Low impedance values in premature infants are attributed to greater skin hydration which results from immature skin conditions such as 1) thinner epidermal layers particularly at the transitional and cornified layers; 2) more blood flow to the skin; and 3) higher percentage of water composition. These factors facilitate the diffusion of water vapor through the skin. As the physical barrier to skin water loss matures with gestational age, the skin impedance reaches a maximum value at full term neonatal age. After this peak, a statistically significant inverse relationship exists between electrical skin impedance and age in the first year of life. This drop in skin impedance is attributed to an increase in skin hydration as a result of the greater functional maturity of eccrine sweat glands.

  12. Skin Conditions


    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  13. Aging Skin


    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from Varicose Veins ...

  14. Detecting Skin Burns Induced by Surface Electrodes

    DTIC Science & Technology


    density image were taken, the electrode peeled off the skin, and a photograph taken to complete the post-burn dataset. Finally, the used electrodes were...suggesting the breakdown of the barrier layer capacitance in the skin epidermis . Line monitoring of the skin impedance can predict the onset of the burns

  15. Skin abscess


    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  16. Skin moisturization mechanisms: new data.


    Bonté, F


    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials.

  17. An elastic second skin

    NASA Astrophysics Data System (ADS)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert


    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (<40%), and that withstands elongations exceeding 250%, elastically recoiling with minimal strain-energy loss on repeated deformation. The application of XPL to the herniated lower eyelid fat pads of 12 subjects resulted in an average 2-grade decrease in herniation appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  18. Fat in the skin

    PubMed Central

    Radner, Franz PW; Grond, Susanne; Haemmerle, Guenter; Lass, Achim


    Keratinocyte differentiation is essential for skin development and the formation of the skin permeability barrier. This process involves an orchestrated remodeling of lipids. The cleavage of precursor lipids from lamellar bodies by β-glucocerebrosidase, sphingomyelinase, phospholipases and sterol sulfatase generates ceramides, non-esterified fatty acids and cholesterol for the lipid-containing extracellular matrix, the lamellar membranes in the stratum corneum. The importance of triacylglycerol (TAG) hydrolysis for the formation of a functional permeability barrier was only recently appreciated. Mice with defects in TAG synthesis (acyl-CoA:diacylglycerol acyltransferase-2-knock-out) or TAG catabolism (comparative gene identification-58, -CGI-58-knock-out) develop severe permeability barrier defects and die soon after birth because of desiccation. In humans, mutations in the CGI-58 gene also cause (non-lethal) neutral lipid storage disease with ichthyosis. As a result of defective TAG synthesis or catabolism, humans and mice lack ω-(O)-acylceramides, which are essential lipid precursors for the formation of the corneocyte lipid envelope. This structure plays an important role in linking the lipid-enriched lamellar membranes to highly cross-linked corneocyte proteins. This review focuses on the current knowledge of biochemical mechanisms that are essential for epidermal neutral lipid metabolism and the formation of a functional skin permeability barrier. PMID:21695016

  19. Diffusion barriers

    NASA Technical Reports Server (NTRS)

    Nicolet, M. A.


    The choice of the metallic film for the contact to a semiconductor device is discussed. One way to try to stabilize a contact is by interposing a thin film of a material that has low diffusivity for the atoms in question. This thin film application is known as a diffusion barrier. Three types of barriers can be distinguished. The stuffed barrier derives its low atomic diffusivity to impurities that concentrate along the extended defects of a polycrystalline layer. Sacrificial barriers exploit the fact that some (elemental) thin films react in a laterally uniform and reproducible fashion. Sacrificial barriers have the advantage that the point of their failure is predictable. Passive barriers are those most closely approximating an ideal barrier. The most-studied case is that of sputtered TiN films. Stuffed barriers may be viewed as passive barriers whose low diffusivity material extends along the defects of the polycrystalline host.

  20. Stem Cells behind the Barrier

    PubMed Central

    Cangkrama, Michael; Ting, Stephen B.; Darido, Charbel


    Epidermal stem cells sustain the adult skin for a lifetime through self-renewal and the production of committed progenitors. These stem cells generate progeny that will undergo terminal differentiation leading to the development of a protective epidermal barrier. Whereas the molecular mechanisms that govern epidermal barrier repair and renewal have been extensively studied, pathways controlling stem cell differentiation remain poorly understood. Asymmetric cell divisions, small non-coding RNAs (microRNAs), chromatin remodeling complexes, and multiple differentiation factors tightly control the balance of stem and progenitor cell proliferation and differentiation, and disruption of this balance leads to skin diseases. In this review, we summarize and discuss current advances in our understanding of the mechanisms regulating epidermal stem and progenitor cell differentiation, and explore new relationships for maintenance of skin barrier function. PMID:23812084

  1. Advanced Skin Care – A Novel Ingredient

    PubMed Central

    Fleck, Cynthia Ann; Newman, Mackenzie


    The skin provides the human body with protection and a major barrier to environmental assault. Caring for skin is sometimes an afterthought. In other words, if something isn't broken, don't fix it. However, in the case of the integument, nothing could be further from the truth. Intact skin is paramount to health and well-being. This article will review skin care, specifically, advanced skin care, uncovering novel ingredients, and their importance for prevention and treatment as well as delving into the caring for the skin from the outside in. PMID:26199880

  2. Bifidobacterium fermented milk and galacto-oligosaccharides lead to improved skin health by decreasing phenols production by gut microbiota.


    Miyazaki, K; Masuoka, N; Kano, M; Iizuka, R


    A questionnaire survey found that women suffering from abnormal bowel movements have many skin problems such as a high frequency of dry skin. Although there are similarities between the structure and barrier function mechanism of the gut and skin, experimental data are insufficient to show an association between the intestinal environment and skin conditions. Phenols, for example phenol and p-cresol, as metabolites of aromatic amino acids produced by gut bacteria, are regarded as bioactive toxins and serum biomarkers of a disturbed gut environment. Recent studies have demonstrated that phenols disturb the differentiation of monolayer-cultured keratinocytes in vitro, and that phenols produced by gut bacteria accumulate in the skin via the circulation and disrupt keratinocyte differentiation in hairless mice. Human studies have demonstrated that restriction of probiotics elevated serum free p-cresol levels and harmed skin conditions (reduced skin hydration, disrupted keratinisation). In contrast, daily intake of the prebiotic galacto-oligosaccharides (GOS) restored serum free p-cresol levels and skin conditions in adult women. Moreover, a double-blind placebo-controlled trial demonstrated that the daily intake of fermented milk containing the probiotic Bifidobacterium breve strain Yakult and prebiotic GOS reduced serum total phenol levels and prevented skin dryness and disruption of keratinisation in healthy adult women. It is concluded that phenols produced by gut bacteria are one of the causes of skin problems. Probiotics and/or prebiotics, such as B. breve strain Yakult and/or GOS, are expected to help maintain a healthy skin by decreasing phenols production by gut microbiota. These findings support the hypothesis that probiotics and prebiotics provide health benefits to the skin as well as the gut.

  3. Psoriasis genetics: breaking the barrier

    PubMed Central

    Roberson, Elisha D.O.; Bowcock, Anne M.


    Psoriasis is a common incurable inflammatory skin disease affecting 2–3% of the European population. Psoriatic skin contains large numbers of immune cells which produce many cytokines, chemokines and inflammatory molecules. The epidermis divides much faster than normal and has a defective outer layer or barrier which under normal circumstances protects from infection and dehydration. Psoriatic skin is characterized by a distinct set of inflammation and epidermal proliferation and differentiation markers, and it has not been clear if the genetic basis of psoriasis is due to defects of the immune system or the skin. One genetic determinant lies within the major histocompatibility complex class 1 region. Genome-wide association studies have revealed genetic susceptibility factors that play a role in the formation of immune cells found in psoriasis lesions. Others affect epidermal proliferation and the formation of the skin’s barrier. Hence, genetic components of both the immune system and the epidermis predispose to disease. PMID:20692714

  4. Advanced therapies of skin injuries.


    Maver, Tina; Maver, Uroš; Kleinschek, Karin Stana; Raščan, Irena Mlinarič; Smrke, Dragica Maja


    The loss of tissue is still one of the most challenging problems in healthcare. Efficient laboratory expansion of skin tissue to reproduce the skins barrier function can make the difference between life and death for patients with extensive full-thickness burns, chronic wounds, or genetic disorders such as bullous conditions. This engineering has been initiated based on the acute need in the 1980s and today, tissue-engineered skin is the reality. The human skin equivalents are available not only as models for permeation and toxicity screening, but are frequently applied in vivo as clinical skin substitutes. This review aims to introduce the most important recent development in the extensive field of tissue engineering and to describe already approved, commercially available skin substitutes in clinical use.

  5. Nail abnormalities in patients with vitiligo*

    PubMed Central

    Topal, Ilteris Oguz; Gungor, Sule; Kocaturk, Ozgur Emek; Duman, Hatice; Durmuscan, Mustafa


    Background Vitiligo is an acquired pigmentary skin disorder affecting 0.1-4% of the general population. The nails may be affected in patients with an autoimmune disease such as psoriasis, and in those with alopecia areata. It has been suggested that nail abnormalities should be apparent in vitiligo patients. Objective We sought to document the frequency and clinical presentation of nail abnormalities in vitiligo patients compared to healthy volunteers. We also examined the correlations between nail abnormalities and various clinical parameters. Methods This study included 100 vitiligo patients and 100 healthy subjects. Full medical histories were collected from the subjects, who underwent thorough general and nail examinations. All nail changes were noted. In the event of clinical suspicion of a fungal infection, additional mycological investigations were performed. Results Nail abnormalities were more prevalent in the patients (78%) than in the controls (55%) (p=0.001). Longitudinal ridging was the most common finding (42%), followed by (in descending order): leukonychia, an absent lunula, onycholysis, nail bed pallor, onychomycosis, splinter hemorrhage and nail plate thinning. The frequency of longitudinal ridging was significantly higher in patients than in controls (p<0.001). Conclusions Nail abnormalities were more prevalent in vitiligo patients than in controls. Systematic examination of the nails in such patients is useful because nail abnormalities are frequent. However, the causes of such abnormalities require further study. Longitudinal ridging and leukonychia were the most common abnormalities observed in this study. PMID:27579738

  6. Urine - abnormal color


    ... Urine - abnormal color To use the sharing features on this page, please enable JavaScript. The usual color of urine is straw-yellow. Abnormally colored urine ...

  7. Tooth - abnormal colors


    ... Tooth - abnormal colors To use the sharing features on this page, please enable JavaScript. Abnormal tooth color is any color other than white to yellowish- ...

  8. Abnormal Head Position


    ... cause. Can a longstanding head turn lead to any permanent problems? Yes, a significant abnormal head posture could cause permanent ... occipitocervical synostosis and unilateral hearing loss. Are there any ... postures? Yes. Abnormal head postures can usually be improved depending ...

  9. Skeletal limb abnormalities


    ... Skeletal limb abnormalities To use the sharing features on this page, please enable JavaScript. Skeletal limb abnormalities refers to a variety of bone structure problems ...

  10. Testosterone perturbs epidermal permeability barrier homeostasis.


    Kao, J S; Garg, A; Mao-Qiang, M; Crumrine, D; Ghadially, R; Feingold, K R; Elias, P M


    Although there are no known gender-related differences in permeability barrier function in adults, estrogens accelerate whereas testosterone retards barrier development in fetal skin, and male fetuses demonstrate slower barrier development than female littermates. Moreover, prenatal administration of the androgen receptor antagonist, flutamide, equalizes developmental rates in male and female fetuses. Therefore, we evaluated the effects of changes in testosterone on barrier homeostasis in adult murine and human skin. Hypogonadal mice (whether by castration or by treatment with systemic flutamide) displayed significantly faster barrier recovery at 3, 6, and 12 h than did controls, and testosterone replacement slowed barrier recovery in castrated mice. Moreover, testosterone directly effects the skin, as topical flutamide also accelerated barrier recovery in normal male mice. These findings appear to be of physiologic significance, since prepubertal male mice (age 5 wk) displayed accelerated barrier recovery in comparison with adult postpubertal (11 wk) males. These studies also appear to be relevant for humans, as a hypopituitary human subject demonstrated repeated changes in barrier recovery in parallel with peaks and nadirs in serum testosterone levels during intermittent testosterone replacement. Mechanistic studies showed that differences in epidermal lipid synthesis do not account for the testosterone-induced functional alterations. Instead, epidermal lamellar body (LB) formation and secretion both decrease, resulting in decreased extracellular lamellar bilayers in testosterone-replete animals. These studies demonstrate that fluctuations in testosterone modulate barrier function, and that testosterone repletion can have negative consequences for permeability barrier homeostasis.

  11. Skin Infections


    ... to the touch may have yellow drainage Of cellulitis: a red, inflamed area on the skin that is tender to the touch may occur in an area of a scratch or cut redness often spreads rapidly over the skin's surface ...

  12. Skin Pigment


    ... Diseases Take Big Slice Out of America's Health, Economy (News) Health Tip: Use Caution When Applying Hair Dye Additional ... Skin Diseases Take Big Slice Out of America's Health, Economy THURSDAY, March 2, 2017 (HealthDay News) -- Skin diseases ...

  13. Sagging Skin


    ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ...

  14. Update on skin allergy.


    Schlapbach, C; Simon, D


    Skin diseases with an allergic background such as atopic dermatitis, allergic contact dermatitis, and urticaria are very common. Moreover, diseases arising from a dysfunction of immune cells and/or their products often manifest with skin symptoms. This review aims to summarize recently published articles in order to highlight novel research findings, clinical trial results, and current guidelines on disease management. In recent years, an immense progress has been made in understanding the link between skin barrier dysfunction and allergic sensitization initiating the atopic march. In consequence, new strategies for treatment and prevention have been developed. Novel pathogenic insights, for example, into urticaria, angioedema, mastocytosis, led to the development of new therapeutic approaches and their implementation in daily patient care. By understanding distinct pathomechanisms, for example, the role of IL-1, novel entities such as autoinflammatory diseases have been described. Considerable effort has been made to improve and harmonize patient management as documented in several guidelines and position papers.

  15. Abnormal Uterine Bleeding FAQ


    ... PROBLEMS Abnormal Uterine Bleeding • What is a normal menstrual cycle? • When is bleeding abnormal? • At what ages is ... treat abnormal bleeding? •Glossary What is a normal menstrual cycle? The normal length of the menstrual cycle is ...

  16. Skin Aging


    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  17. Older people and skin: challenging perceptions.


    Cowdell, Fiona; Garrett, Dawne

    In this article we set out to challenge perceptions about older people and skin. We examine current portrayals of older people and skin, both in the media and in the nursing literature. We describe the ‘normal’ process of skin ageing and highlight the importance of maintaining skin integrity and effective barrier function for health and wellbeing, particularly in older people. One element of maintaining skin integrity is ensuring that personal hygiene and emollient needs are met. Effective skin hygiene and emollient care will reduce the risk of breakdown, with all its burdensome and costly consequences. We therefore offer a summary of the current evidence base for skin-hygiene practice. We make a case for nurses considering skin health from a wider societal and human perspective, and identify opportunities to enhance nursing practice through skin-care advice and health education for all older people.

  18. Male skin and ingredients relevant to male skin care.


    Draelos, Z D


    Male skin care needs are heavily influenced by the need to remove facial hair on a regular basis. Facial skin issues associated with poor hair removal approaches are common and include razor burn and irritation. This paper evaluates current research on shaving technology and how careful ingredient selection can contribute to male skin health. The importance of maintaining hair softness during the shave and restoring facial hydration post-shave is discussed. Data are presented on how post-shave moisturizers containing glycerine and emollients can create an environment for improved barrier function which can be further improved by incorporating specific ingredients such as niacinamide.

  19. Sensitive skin: mechanisms and diagnosis.


    Primavera, G; Berardesca, E


    Sensitive skin is a condition of subjective cutaneous hyperreactivity to environmental factors. Subjects experiencing this condition report exaggerated reactions when their skin is in contact with cosmetics, soaps and sunscreens, and they often report worsening after exposure to dry and cold climate. Although no sign of irritation is commonly detected, itching, burning, stinging and a tight sensation are constantly present. Generally substances that are not commonly considered irritants are involved in this abnormal response. They include many ingredients of cosmetics such as: dimethyl sulfoxide, benzoyl peroxide preparations, salicylic acid, propylene glycol, amyldimethylaminobenzoic acid and 2-ethoxyethyl methoxycinnamate. Sensitive skin and subjective irritation are widespread but still far from being completely defined and understood. The aim of this paper is to summarize the relevant literature in order to elucidate the underlying mechanisms of sensitive skin and the best testing methodologies for investigation of sensitive skin.

  20. Roentgenographic abnormalities in Rocky Mountain Spotted Fever.


    McCook, T A; Briley, C; Ravin, C E


    Rock Mountain spotted fever (RMSF) is a tick-borne rickettsial disease which produces a widespread vasculitis. A mortality of 7% to 13% has been reported in the United States which is due at least in part to delay in diagnosis and appropriate treatment. The classic features of this disease include a history of tick bite with the clinical presentation of skin rash and fever in association with thrombocytopenia. Few reports have emphasized the radiologic chest abnormalities in this disease or their relationship to thrombocytopenia. We review 70 cases of RMSF with abnormal roentgenographic features and their pathologic correlation.

  1. Hygiene of the skin: when is clean too clean?

    PubMed Central

    Larson, E.


    Skin hygiene, particularly of the hands, is a primary mechanism for reducing contact and fecal-oral transmission of infectious agents. Widespread use of antimicrobial products has prompted concern about emergence of resistance to antiseptics and damage to the skin barrier associated with frequent washing. This article reviews evidence for the relationship between skin hygiene and infection, the effects of washing on skin integrity, and recommendations for skin care practices. PMID:11294712

  2. Vehicle barrier


    Hirsh, Robert A.


    A vehicle security barrier which can be conveniently placed across a gate opening as well as readily removed from the gate opening to allow for easy passage. The security barrier includes a barrier gate in the form of a cable/gate member in combination with laterally attached pipe sections fixed by way of the cable to the gate member and lateral, security fixed vertical pipe posts. The security barrier of the present invention provides for the use of cable restraints across gate openings to provide necessary security while at the same time allowing for quick opening and closing of the gate areas without compromising security.

  3. Epidermal barrier in hereditary ichthyoses, atopic dermatitis, and psoriasis.


    Schmuth, Matthias; Blunder, Stefan; Dubrac, Sandrine; Gruber, Robert; Moosbrugger-Martinz, Verena


    Several skin disorders are associated with impaired skin barrier function. Primary dysfunction is caused by monogenic defects in key components of the epidermis (for example ichthyoses). Secondary barrier impairment occurs in inflammatory dermatoses marked by disturbed epidermal homeostasis (eczema, psoriasis, etc.). In these disorders, inflammation impedes the synthesis or maintenance of skin barrier components. Recent evidence suggests a combination of primary and secondary barrier dysfunction in atopic dermatitis and, to a lesser extent, also in psoriasis. In the future, subtypes of atopic dermatitis may likely be defined, in which one or the other is prevalent.

  4. Skin optics

    SciTech Connect

    van Gemert, M.J.; Jacques, S.L.; Sterenborg, H.J.; Star, W.M.


    Quantitative dosimetry in the treatment of skin disorders with (laser) light requires information on propagation of light in the skin related to the optical properties of the individual skin layers. This involves the solution of the integro-differential equation of radiative transfer in a model representing skin geometry, as well as experimental methods to determine the optical properties of each skin layer. These activities are unified under the name skin optics. This paper first reviews the current status of tissue optics, distinguishing between the cases of: dominant absorption, dominant scattering, and scattering about equal to absorption. Then, previously published data as well as some current unpublished data on (human) stratum corneum, epidermis and dermis, have been collected and/or (re)analyzed in terms of absorption coefficient, scattering coefficient, and anisotropy factor of scattering. The results are that the individual skin layers show strongly forward scattering (anisotropy factors between 0.7 and 0.9). The absorption and scattering data show that for all wavelengths considered scattering is much more important than absorption. Under such circumstances, solutions to the transport equation for a multilayer skin model and finite beam laser irradiation are currently not yet available. Hence, any quantitative dosimetry for skin treated with (laser) light is currently lacking.

  5. Autoimmune and infectious skin diseases that target desmogleins

    PubMed Central

    AMAGAI, Masayuki


    Desmosomes are intercellular adhesive junctions of epithelial cells that contain two major transmembrane components, the desmogleins (Dsg) and desmocollins (Dsc), which are cadherin-type cell–cell adhesion molecules and are anchored to intermediate filaments of keratin through interactions with plakoglobin and desmoplakin. Desmosomes play an important role in maintaining the proper structure and barrier function of the epidermis and mucous epithelia. Four Dsg isoforms have been identified to date, Dsg1–Dsg4, and are involved in several skin and heart diseases. Dsg1 and Dsg3 are the two major Dsg isoforms in the skin and mucous membranes, and are targeted by IgG autoantibodies in pemphigus, an autoimmune disease of the skin and mucous membranes. Dsg1 is also targeted by exfoliative toxin (ET) released by Staphylococcus aureus in the infectious skin diseases bullous impetigo and staphylococcal scalded skin syndrome (SSSS). ET is a unique serine protease that shows lock and key specificity to Dsg1. Dsg2 is expressed in all tissues possessing desmosomes, including simple epithelia and myocardia, and mutations in this gene are responsible for arrhythmogenic right ventricular cardiomyopathy/dysplasia. Dsg4 plays an important adhesive role mainly in hair follicles, and Dsg4 mutations cause abnormal hair development. Recently, an active disease model for pemphigus was generated by a unique approach using autoantigen-deficient mice that do not acquire tolerance against the defective autoantigen. Adoptive transfer of Dsg3−/− lymphocytes into mice expressing Dsg3 induces stable anti-Dsg3 IgG production with development of the pemphigus phenotype. This mouse model is a valuable tool with which to investigate immunological mechanisms of harmful IgG autoantibody production in pemphigus. Further investigation of desmoglein molecules will continue to provide insight into the unsolved pathophysiological mechanisms of diseases and aid in the development of novel therapeutic

  6. The dynamic anatomy and patterning of skin.


    Wong, Richard; Geyer, Stefan; Weninger, Wolfgang; Guimberteau, Jean-Claude; Wong, Jason K


    The skin is often viewed as a static barrier that protects the body from the outside world. Emphasis on studying the skin's architecture and biomechanics in the context of restoring skin movement and function is often ignored. It is fundamentally important that if skin is to be modelled or developed, we do not only focus on the biology of skin but also aim to understand its mechanical properties and structure in living dynamic tissue. In this review, we describe the architecture of skin and patterning seen in skin as viewed from a surgical perspective and highlight aspects of the microanatomy that have never fully been realized and provide evidence or concepts that support the importance of studying living skin's dynamic behaviour. We highlight how the structure of the skin has evolved to allow the body dynamic form and function, and how injury, disease or ageing results in a dramatic changes to the microarchitecture and changes physical characteristics of skin. Therefore, appreciating the dynamic microanatomy of skin from the deep fascia through to the skin surface is vitally important from a dermatological and surgical perspective. This focus provides an alternative perspective and approach to addressing skin pathologies and skin ageing.

  7. Connexins and pannexins in the integumentary system: the skin and appendages.


    Faniku, Chrysovalantou; Wright, Catherine S; Martin, Patricia E


    The integumentary system comprises the skin and its appendages, which includes hair, nails, feathers, sebaceous and eccrine glands. In this review, we focus on the expression profile of connexins and pannexins throughout the integumentary system in mammals, birds and fish. We provide a picture of the complexity of the connexin/pannexin network illustrating functional importance of these proteins in maintaining the integrity of the epidermal barrier. The differential regulation and expression of connexins and pannexins during skin renewal, together with a number of epidermal, hair and nail abnormalities associated with mutations in connexins, emphasize that the correct balance of connexin and pannexin expression is critical for maintenance of the skin and its appendages with both channel and non-channel functions playing profound roles. Changes in connexin expression during both hair and feather regeneration provide suggestions of specialized communication compartments. Finally, we discuss the potential use of zebrafish as a model for connexin skin biology, where evidence mounts that differential connexin expression is involved in skin patterning and pigmentation.

  8. Skin findings in newborns


    Newborn skin characteristics; Infant skin characteristics; Neonatal care - skin ... the first few weeks of the baby's life. Newborn skin will vary, depending on the length of the pregnancy. Premature infants have thin, transparent skin. The skin of a ...

  9. Newborn infant skin: physiology, development, and care.


    Visscher, Marty O; Adam, Ralf; Brink, Susanna; Odio, Mauricio


    Infant skin is critical to the newborn child's transition from the womb environment to the journey to self-sufficiency. This review provides an integrative perspective on the skin development in full term and premature infants. There is a particular focus on the role of vernix caseosa and on the implications of skin development for epidermal penetration of exogenous compounds. Healthy full-term newborn skin is well-developed and functional at birth, with a thick epidermis and well-formed stratum corneum (SC) layers. Transepidermal water loss is very low at birth, equal to, or lower than adults, indicating a highly effective skin barrier. Vernix facilitates SC development in full-term infants through a variety of mechanisms including physical protection from amniotic fluid and enzymes, antimicrobial effects, skin surface pH lowering, provision of lipids, and hydration. Premature infants, particularly those of very low birth weight, have a poor skin barrier with few cornified layers and deficient dermal proteins. They are at increased risk for skin damage, increased permeability to exogenous agents and infection. The SC barrier develops rapidly after birth but complete maturation requires weeks to months. The best methods for caring for infant skin, particularly in the diaper region, are described and related to these developmental changes.

  10. Structurally abnormal human autosomes

    SciTech Connect


    Chapter 25, discusses structurally abnormal human autosomes. This discussion includes: structurally abnormal chromosomes, chromosomal polymorphisms, pericentric inversions, paracentric inversions, deletions or partial monosomies, cri du chat (cat cry) syndrome, ring chromosomes, insertions, duplication or pure partial trisomy and mosaicism. 71 refs., 8 figs.

  11. [New insights into the pathogenesis of sensitive skin].


    Proksch, E; Weidinger, S


    Many persons in the developed countries report sensitive skin. Persons with sensitive skin have a predisposition to several skin diseases, most importantly dry skin, but also atopy, seborrheic dermatitis, acne vulgaris, rosacea, and perioral dermatitis. Their complaints may be triggered by environmental factors such as low temperature, wind, high temperature, sun exposure and stress. Various skin care products and cosmetics are not tolerated. A disturbed skin barrier function and reduced stratum corneum water content are most important in the pathophysiology of sensitive skin. Environmental factors and cosmetics may induce irritation of the skin because of the disturbed skin barrier. Of further importance for the pathogenesis are neurogenic factors including stress and hyper-excitability. Mechanisms in signal transduction involve cytokines and neurotransmitters, but the exact pathways are unknown.

  12. Skin Infections


    ... it can get infected by them. Some common types of skin infections are Bacterial: Cellulitis and impetigo. Staphylococcal infections can also affect the skin. Viral: Shingles, warts, and herpes simplex Fungal: Athlete's foot and yeast infections Parasitic: Body lice, head lice, and scabies ...

  13. Morphological abnormalities among lampreys

    USGS Publications Warehouse

    Manion, Patrick J.


    The experimental control of the sea lamprey (Petromyzon marinus) in the Great Lakes has required the collection of thousands of lampreys. Representatives of each life stage of the four species of the Lake Superior basin were examined for structural abnormalities. The most common aberration was the presence of additional tails. The accessory tails were always postanal and smaller than the normal tail. The point of origin varied; the extra tails occurred on dorsal, ventral, or lateral surfaces. Some of the extra tails were misshaped and curled, but others were normal in shape and pigment pattern. Other abnormalities in larval sea lampreys were malformed or twisted tails and bodies. The cause of the structural abnormalities is unknown. The presence of extra caudal fins could be genetically controlled, or be due to partial amputation or injury followed by abnormal regeneration. Few if any lampreys with structural abnormalities live to sexual maturity.

  14. Barrier-repair prescription moisturizers: do we really need them? Facts and controversies.


    Wolf, Ronni; Parish, Lawrence Charles


    There is now scientific evidence of genetically driven skin-barrier anomalies in atopic patients. These barrier anomalies facilitate sustained antigen ingress through the defective barrier, which can bring about a Th2-dominant response. It enhances the transepidermal water loss, resulting in dry skin and leading to the release of preformed proinflammatory cytokines and to a cascade of events ending up in inflammation.

  15. Moisturizing Different Racial Skin Types

    PubMed Central

    Wong, Victor W.; Longaker, Michael T.; Yang, George P.


    The skin is a complex organ involved in thermoregulation, gas exchange, protection against pathogens, and barrier function to maintain proper hydration. When dry, the ability for skin to execute these tasks becomes impaired. Dry skin affects almost everyone as we age, but it is also dependent on external factors, such as dry climate, colder temperatures, and repeated washing. In addition, increasing evidence has shown racial variability in the physiological properties of skin, which directly impacts water content of the stratum corneum and sensitivity to exogenously applied agents. A multitude of products have been developed to treat dry skin, and as a group, moisturizers have been designed to either impart or restore hydration in the stratum corneum. Given the large number of moisturizers presently available, depending on individual components, several different mechanisms may be employed to promote skin hydration. As there exists dramatic racial variability in skin properties, certain moisturizers may thus be more effective in some and less effective in others to treat the common condition of dry skin. PMID:25013536

  16. Electrochemical Skin Conductance Correlates with Skin Nerve Fiber Density

    PubMed Central

    Novak, Peter


    Purpose: Electrochemical skin conductance (ESC) using reverse iontophoresis and chronoamperometry has been used to evaluate abnormal function of small fibers. How ESC correlates with loss of small fibers in skin is unclear. Methods: This was a prospective, blinded study. The primary outcome measure was the correlation between ESC at the feet and results of skin biopsies including epidermal nerve fiber density (ENFD) and sweat gland nerve fiber density (SGNFD) at the distal leg. ESC, ENFD, and SGNFD data were normalized by adjusting for weight. The secondary outcome measures were the correlation between ESC and the following variables: quantitative sudomotor axon reflex test (QSART) and symptom scales (neuropathy, pain and autonomic). Results: Eighty-one patients (mean ± sd): age = 53.3 ± 17.3, men/women = 25/56 were enrolled in the study. ESC was reduced in subjects with abnormally low ENFD (ENFD normal/abnormal, ESC = 1.17 ± 0.27/0.87 ± 0.34 μSiemens/kg, p < 0.0008) and abnormally low SGNFD (SGNFD normal/abnormal ESC = 1.09 ± 0.34/0.78 ± 0.3 μSiemens/kg, p < 0.0003). ESC correlated with ENFD (ρ = 0.73, p = 0.0001) and SGNFD (ρ = 0.64, p = 0.0001). ESC did not correlate with symptom scales. Conclusion: ESC is diminished in subjects who have a reduced number of small fibers in the skin and the ESC reduction is proportional to ENFD and SGNFD. ESC can be useful in detecting loss of small nerve fibers. PMID:27605912

  17. Estimating physiological skin parameters from hyperspectral signatures.


    Vyas, Saurabh; Banerjee, Amit; Burlina, Philippe


    We describe an approach for estimating human skin parameters, such as melanosome concentration, collagen concentration, oxygen saturation, and blood volume, using hyperspectral radiometric measurements (signatures) obtained from in vivo skin. We use a computational model based on Kubelka-Munk theory and the Fresnel equations. This model forward maps the skin parameters to a corresponding multiband reflectance spectra. Machine-learning-based regression is used to generate the inverse map, and hence estimate skin parameters from hyperspectral signatures. We test our methods using synthetic and in vivo skin signatures obtained in the visible through the short wave infrared domains from 24 patients of both genders and Caucasian, Asian, and African American ethnicities. Performance validation shows promising results: good agreement with the ground truth and well-established physiological precepts. These methods have potential use in the characterization of skin abnormalities and in minimally-invasive prescreening of malignant skin cancers.

  18. Estimating physiological skin parameters from hyperspectral signatures

    NASA Astrophysics Data System (ADS)

    Vyas, Saurabh; Banerjee, Amit; Burlina, Philippe


    We describe an approach for estimating human skin parameters, such as melanosome concentration, collagen concentration, oxygen saturation, and blood volume, using hyperspectral radiometric measurements (signatures) obtained from in vivo skin. We use a computational model based on Kubelka-Munk theory and the Fresnel equations. This model forward maps the skin parameters to a corresponding multiband reflectance spectra. Machine-learning-based regression is used to generate the inverse map, and hence estimate skin parameters from hyperspectral signatures. We test our methods using synthetic and in vivo skin signatures obtained in the visible through the short wave infrared domains from 24 patients of both genders and Caucasian, Asian, and African American ethnicities. Performance validation shows promising results: good agreement with the ground truth and well-established physiological precepts. These methods have potential use in the characterization of skin abnormalities and in minimally-invasive prescreening of malignant skin cancers.

  19. TRP channels in the skin.


    Tóth, Balázs I; Oláh, Attila; Szöllősi, Attila Gábor; Bíró, Tamás


    Emerging evidence suggests that transient receptor potential (TRP) ion channels not only act as 'polymodal cellular sensors' on sensory neurons but are also functionally expressed by a multitude of non-neuronal cell types. This is especially true in the skin, one of the largest organs of the body, where they appear to be critically involved in regulating various cutaneous functions both under physiological and pathophysiological conditions. In this review, we focus on introducing the roles of several cutaneous TRP channels in the regulation of the skin barrier, skin cell proliferation and differentiation, and immune functions. Moreover, we also describe the putative involvement of several TRP channels in the development of certain skin diseases and identify future TRP channel-targeted therapeutic opportunities.

  20. Disruption of barrier function in dermatophytosis and pityriasis versicolor.


    Lee, Weon Ju; Kim, Jun Young; Song, Chang Hyun; Jung, Hong Dae; Lee, Su Hyun; Lee, Seok-Jong; Kim, Do Won


    Dermatophytes have the ability to form molecular attachments to keratin and use it as a source of nutrients, colonizing keratinized tissues, including the stratum corneum of the skin. Malassezia species also affect the stratum corneum of the skin. Therefore, dermatophytosis and pityriasis versicolor of the skin are thought to be important factors of profound changes in skin barrier structure and function. We aimed to describe the changes in transepidermal water loss (TEWL), stratum corneum hydration, and skin pH in the lesions of the dermatophytosis and pityriasis versicolor. Thirty-six patients with dermatophytosis (14 with tinea cruris, 13 with tinea corporis and nine with tinea pedis or tinea manus) and 11 patients with pityriasis versicolor were included in this study. TEWL, stratum corneum conductance and skin pH were determined by biophysical methods to examine whether our patients exhibited changes in barrier function. Dermatophytosis and pityriasis versicolor except tinea pedis and tinea manus showed highly significant increase in TEWL compared with adjacent infection-free skin. Hydration was significantly reduced in lesional skin compared with adjacent infection-free skin. From this study, infections with dermatophytes and Malassezia species on the body can alter biophysical properties of the skin, especially the function of stratum corneum as a barrier to water loss. On the contrary, infections with dermatophytes on the palms and soles little affect the barrier function of the skin.

  1. Skin irritation and sensitization: mechanisms and new approaches for risk assessment. 1. Skin irritation.


    Fluhr, J W; Darlenski, R; Angelova-Fischer, I; Tsankov, N; Basketter, D


    Cutaneous irritation presents a major health problem with serious social and occupational impact. The interaction between an irritant and the human skin depends on multiple factors: the intrinsic properties and the nature of the irritant itself, and specific individual- and environment-related variables. The main pathological mechanisms of irritancy include skin barrier disruption, induction of a cytokine cascade and involvement of the oxidative stress network; all of them resulting in a visible or subclinical inflammatory reaction. In vivo, different non-invasive parameters for the evaluation of skin irritation and irritant potential of compounds and their specific formulations have been introduced, such as epidermal barrier function, skin hydration, surface pH, lipid composition, skin colour and skin blood flow. The diverse physiological changes caused by irritating agents require implementation of a multiparametric approach in the evaluation of cutaneous irritancy.

  2. "Jeopardy" in Abnormal Psychology.

    ERIC Educational Resources Information Center

    Keutzer, Carolin S.


    Describes the use of the board game, Jeopardy, in a college level abnormal psychology course. Finds increased student interaction and improved application of information. Reports generally favorable student evaluation of the technique. (CFR)

  3. Skin Cancer


    ... exposure to ultraviolet light, which is found in sunlight and in lights used in tanning salons.What ... the safe-sun guidelines.1. Avoid the sun.Sunlight damages your skin. The sun is strongest during ...

  4. Skin graft


    ... that need skin grafts to heal Venous ulcers, pressure ulcers , or diabetic ulcers that do not heal Very ... chap 17. Read More Burns Patient Instructions Preventing pressure ulcers Surgical wound care - open Review Date 3/13/ ...

  5. Your Skin


    ... wear sunscreen and protective clothing, such as a hat, to prevent painful sunburns. Protecting your skin now ... happens in a split second, without you ever thinking about it. previous continue Dermis = Lots of Blood ...

  6. Skin Cancer


    ... States. The two most common types are basal cell cancer and squamous cell cancer. They usually form on the head, face, ... If not treated, some types of skin cancer cells can spread to other tissues and organs. Treatments ...

  7. Senescent Skin

    PubMed Central

    Kushniruk, William


    The cutaneous surface is continually influenced by aging and environmental factors. A longer life span is accompanied by an increase in the frequency of problems associated with aging skin. Although most of these changes and lesions are not life threatening, the premalignant lesions must be recognized and treated. The common aging and actinic skin changes are discussed and appropriate management is described. ImagesFig. 1Fig. 2Fig. 3Fig. 4 PMID:20469067

  8. Skin Physiology of the Neonate and Infant: Clinical Implications

    PubMed Central

    Oranges, Teresa; Dini, Valentina; Romanelli, Marco


    Significance: The skin is a complex and dynamic organ that performs several vital functions. The maturation process of the skin starts at birth with the adaption of the skin to the comparatively dry environment compared to the in utero milieu. This adaptive flexibility results in the unique properties of infant skin. To deliver appropriate care to infant skin, it is necessary to understand that it is evolving with unique characteristics. Recent Advances: The role of biophysical noninvasive techniques in the assessment of skin development underlines the importance of an objective evaluation of skin physiology parameters. Skin hydration, transepidermal water loss, and pH values are measurable with specific instruments that give us an accurate and reproducible assessment during infant skin maturation. The recording of these values, following standard measurement procedures, allows us to evaluate the integrity of the skin barrier and to monitor the functionality of the maturing skin over time. Critical Issues: During the barrier development, impaired skin function makes the skin vulnerable to chemical damage, microbial infections, and skin diseases, possibly compromising the general health of the infant. Preterm newborns, during the first weeks of life, have an even less developed skin barrier and, therefore, are even more at risk. Thus, it is extremely important to evaluate the risk of infection, skin breakdown, topical agent absorption, and the risk of thermoregulation failure. Future Directions: Detailed and objective evaluations of infant skin maturation are necessary to improve infant skin care. The results of these evaluations should be formed into general protocols that will allow doctors and caregivers to give more personalized care to full-term newborns, preterm newborns, and infants. PMID:26487977

  9. Skin microbiome and skin disease: the example of rosacea.


    Picardo, Mauro; Ottaviani, Monica


    The imbalance and/or the perturbation of the microbial populations that colonize the skin and that contribute to its defense may represent one of the causes of the development of noninfectious skin diseases. Atopic dermatitis, psoriasis, acne, and rosacea can be listed among these kinds of pathologies. In particular, considering that microbes have been long addressed as having a role in rosacea, this common dermatosis can be an interesting model to evaluate the correlation between microbiome alterations and the occurrence of clinical manifestations. Different microorganisms have been suggested to have a role in rosacea, but no direct correlation with the incidence of the pathology has been clearly defined. Skin microbiome composition is crucial for the correct skin immune functions and recent findings indicate an abnormal activation of innate immune system associated with the rosacea. The enhanced expression of toll-like receptor 2 in the epidermis of rosacea patients can represent a possible explanation for the amplified inflammatory response to external stimuli observed during the disease. In addition, significantly higher small intestinal bacterial overgrowth prevalence in rosacea subjects has been found and its eradication has been associated with a regression of the skin lesions. In conclusion, both skin and gut microbiome seem to have a role, even if synergistic with other factors, in the pathogenesis of rosacea. A deeper knowledge of human microbiome composition and microbe-host interactions will contribute to clarify the mechanism of development of rosacea and possibly will provide innovative therapeutic approaches.

  10. Progress and opportunities for tissue-engineered skin

    NASA Astrophysics Data System (ADS)

    MacNeil, Sheila


    Tissue-engineered skin is now a reality. For patients with extensive full-thickness burns, laboratory expansion of skin cells to achieve barrier function can make the difference between life and death, and it was this acute need that drove the initiation of tissue engineering in the 1980s. A much larger group of patients have ulcers resistant to conventional healing, and treatments using cultured skin cells have been devised to restart the wound-healing process. In the laboratory, the use of tissue-engineered skin provides insight into the behaviour of skin cells in healthy skin and in diseases such as vitiligo, melanoma, psoriasis and blistering disorders.

  11. Epidermal barrier dysfunction and cutaneous sensitization in atopic diseases.


    Kubo, Akiharu; Nagao, Keisuke; Amagai, Masayuki


    Classic atopic dermatitis is complicated by asthma, allergic rhinitis, and food allergies, cumulatively referred to as atopic diseases. Recent discoveries of mutations in the filaggrin gene as predisposing factors for atopic diseases have refocused investigators' attention on epidermal barrier dysfunction as a causative mechanism. The skin's barrier function has three elements: the stratum corneum (air-liquid barrier), tight junctions (liquid-liquid barrier), and the Langerhans cell network (immunological barrier). Clarification of the molecular events underpinning epidermal barrier function and dysfunction should lead to a better understanding of the pathophysiological mechanisms of atopic diseases.

  12. Language barriers

    PubMed Central

    Ngwakongnwi, Emmanuel; Hemmelgarn, Brenda R.; Musto, Richard; King-Shier, Kathryn M.; Quan, Hude


    Abstract Objective To assess use of regular medical doctors (RMDs), as well as awareness and use of telephone health lines or telehealth services, by official language minorities (OLMs) in Canada. Design Analysis of data from the 2006 postcensal survey on the vitality of OLMs. Setting Canada. Participants In total, 7691 English speakers in Quebec and 12 376 French speakers outside Quebec, grouped into those who experienced language barriers and those with no language barriers. Main outcome measures Health services utilization (HSU) by the presence of language barriers; HSU measures included having an RMD, use of an RMD’s services, and awareness of and use of telephone health lines or telehealth services. Multivariable models examined the associations between HSU and language barriers. Results After adjusting for age and sex, English speakers residing in Quebec with limited proficiency in French were less likely to have RMDs (adjusted odds ratio [AOR] 0.66, 95% CI 0.50 to 0.87) and to use the services of their RMDs (AOR 0.65, 95% CI 0.50 to 0.86), but were more likely to be aware of the existence of (AOR 1.50, 95% CI 1.16 to 1.93) and to use (AOR 1.43, 95% CI 0.97 to 2.11) telephone health lines or telehealth services. This pattern of having and using RMDs and telehealth services was not observed for French speakers residing outside of Quebec. Conclusion Overall we found variation in HSU among the language barrier populations, with lower use observed in Quebec. Age older than 45 years, male sex, being married or in common-law relationships, and higher income were associated with having RMDs for OLMs. PMID:23242902

  13. Development and validation of an alternative disturbed skin model by mechanical abrasion to study drug penetration

    PubMed Central

    Schlupp, P.; Weber, M.; Schmidts, T.; Geiger, K.; Runkel, F.


    Pharmaceuticals and cosmetics for dermal application are usually tested on healthy skin, although the primary permeation barrier, the stratum corneum, is often impaired by skin diseases or small skin lesions, especially on the hands. These skin conditions can considerably influence the permeation of chemicals and drugs. Furthermore, risk assessment for example of nanoparticles should be performed under various skin conditions to reflect the true circumstances. Therefore, an alternative and reproducible method for a high throughput of skin samples with impaired skin barrier was developed and verified by skin permeation studies (25 h) of caffeine, sorbic acid and testosterone compared to healthy (untreated) and tape-stripped skin. Skin barrier disruption was controlled by TEWL measurement. Skin permeation of the three substances was increased in tape-stripped and abraded skin compared to untreated skin due to the reduced barrier integrity. Enhancement of drug uptake was highest for the most hydrophilic substance, caffeine, followed by sorbic acid and lipophilic testosterone. No significant difference in drug uptake studies was observed between the new abrasion method with an aluminum-coated sponge and the tape-stripping method. The obtained results demonstrate that this abrasion method is an alternative way to achieve a disturbed skin barrier for drug and chemical uptake studies. PMID:25756004

  14. [The relativity of abnormity].


    Nilson, Annika


    In the late 19th century and in the beginning of the 20th century, mental diseases and abnormal behavior was considered to be a great danger to culture and society. "Degeneration" was the buzzword of the time, used and misused by artists and scientists alike. At the same time, some scientists saw abnormity as the key to unlock the mysteries of the ordinary mind. Naturalistic curiosity left Pandoras box open when religion declined in Darwins wake. Two swedish scientists, the physician Bror Gadelius (1862-1938) and his friend the philosopher Axel Herrlin (1870-1937), inspired by the French psychologist Theodule Ribots (1839-1916) "psychology without a soul", denied all fixed demarcation lines between abnormity and normality. All humans are natures creatures ruled by physiological laws, not ruled by God or convention. Even ordinary morality was considered to be an utterly backward explanation and guideline for complex human behavior. Different forms of therapy, not various kinds of penalties for wicked and disturbing behavior, are the now the solution for lots of people, "normal" as well as "abnormal". Psychiatry is expanding.

  15. Abnormalities of gonadal differentiation.


    Berkovitz, G D; Seeherunvong, T


    Gonadal differentiation involves a complex interplay of developmental pathways. The sex determining region Y (SRY) gene plays a key role in testis determination, but its interaction with other genes is less well understood. Abnormalities of gonadal differentiation result in a range of clinical problems. 46,XY complete gonadal dysgenesis is defined by an absence of testis determination. Subjects have female external genitalia and come to clinical attention because of delayed puberty. Individuals with 46,XY partial gonadal dysgenesis usually present in the newborn period for the valuation of ambiguous genitalia. Gonadal histology always shows an abnormality of seminiferous tubule formation. A diagnosis of 46,XY true hermaphroditism is made if the gonads contain well-formed testicular and ovarian elements. Despite the pivotal role of the SRY gene in testis development, mutations of SRY are unusual in subjects with a 46,XY karyotype and abnormal gonadal development. 46,XX maleness is defined by testis determination in an individual with a 46,XX karyotype. Most affected individuals have a phenotype similar to that of Klinefelter syndrome. In contrast, subjects with 46,XX true hermaphroditism usually present with ambiguous genitalia. The majority of subjects with 46,XX maleness have Y sequences including SRY in genomic DNA. However, only rare subjects with 46,XX true hermaphroditism have translocated sequences encoding SRY. Mosaicism and chimaerism involving the Y chromosome can also be associated with abnormal gonadal development. However, the vast majority of subjects with 45,X/46,XY mosaicism have normal testes and normal male external genitalia.

  16. Skin lumps


    ... DM. Dermal and subcutaneous tumors. In: James WD, Berger TG, Elston DM, eds. Andrews' Diseases of the Skin: Clinical ... Review provided by VeriMed Healthcare Network. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the ...

  17. Reduced barrier efficiency in axillary stratum corneum.


    Watkinson, A; Lee, R S; Moore, A E; Pudney, P D A; Paterson, S E; Rawlings, A V


    The skin of the axilla is cosmetically important with millions of consumers daily applying antiperspirant/deodorant products. Despite this, we know virtually nothing about axillary skin or how antiperspirant (AP) use impacts upon it. To characterize the axillary stratum corneum and determine whether this is a unique skin type, we have looked at stratum corneum composition and function, particularly its barrier properties, and compared it with other body sites. Transepidermal water loss (TEWL) and corneosurfametry (CSM) revealed a reduced barrier function in the axilla. HPTLC analysis of the stratum corneum lipids demonstrated statistically elevated levels of fatty acids, ceramides, and particularly cholesterol in the axilla. Both ceramide and cholesterol did not appear to change with depth, indicating that they were predominantly of stratum corneum origin. On the other hand, at least some of the fatty acid had a sebaceous origin. We hypothesized that the reduced barrier function might be owing to the changes in the crucial ceramide : cholesterol ratio. To address this, we used a combination of attenuated total reflectance-Fourier-transformed infrared spectroscopy (ATR-FTIR) with cyanoacrylate sampling. These results demonstrated more ordered lipid-lamellae phase behaviour in the axilla, suggesting that the elevated cholesterol might form crystal microdomains within the lipid lamellae, allowing an increase in water flux. Since an exaggerated application of antiperspirant had no effect upon the axilla barrier properties, it is concluded that this region of skin physiologically has a reduced barrier function.

  18. Chlorpromazine-induced skin pigmentation with corneal and lens opacities.


    Huff, Laura S; Prado, Renata; Pederson, Jon F; Dunnick, Cory A; Lucas, Lisa M


    Chlorpromazine is known to cause abnormal oculocutaneous pigmentation in sun-exposed areas. We present the case of a psychiatric patient who developed blue-gray pigmentation of the skin as well as corneal and lens opacities following 7 years of chlorpromazine treatment. Ten months after discontinuation of chlorpromazine, the skin discoloration and anterior lens deposits showed partial improvement, but the corneal deposits remained unchanged. A review of the literature on the reversibility of chlorpromazine-induced abnormal oculocutaneous pigmentation also is provided.

  19. Sexual hormones in human skin.


    Zouboulis, C C; Chen, W-C; Thornton, M J; Qin, K; Rosenfield, R


    The skin locally synthesizes significant amounts of sexual hormones with intracrine or paracrine actions. The local level of each sexual steroid depends upon the expression of each of the androgen- and estrogen-synthesizing enzymes in each cell type, with sebaceous glands and sweat glands being the major contributors. Sebocytes express very little of the key enzyme, cytochrome P450c17, necessary for synthesis of the androgenic prohormones dehydroepiandrosterone and androstenedione, however, these prohormones can be converted by sebocytes and sweat glands, and probably also by dermal papilla cells, into more potent androgens like testosterone and dihydrotestosterone. Five major enzymes are involved in the activation and deactivation of androgens in skin. Androgens affect several functions of human skin, such as sebaceous gland growth and differentiation, hair growth, epidermal barrier homeostasis and wound healing. Their effects are mediated by binding to the nuclear androgen receptor. Changes of isoenzyme and/or androgen receptor levels may have important implications in the development of hyperandrogenism and the associated skin diseases such as acne, seborrhoea, hirsutism and androgenetic alopecia. On the other hand, estrogens have been implicated in skin aging, pigmentation, hair growth, sebum production and skin cancer. Estrogens exert their actions through intracellular receptors or via cell surface receptors, which activate specific second messenger signaling pathways. Recent studies suggest specific site-related distribution of ERalpha and ERbeta in human skin. In contrast, progestins play no role in the pathogenesis of skin disorders. However, they play a major role in the treatment of hirsutism and acne vulgaris, where they are prescribed as components of estrogen-progestin combination pills and as anti-androgens. These combinations enhance gonadotropin suppression of ovarian androgen production. Estrogen-progestin treatment can reduce the need for shaving

  20. Heritable bovine fetal abnormalities.


    Whitlock, B K; Kaiser, L; Maxwell, H S


    The etiologies for congenital bovine fetal anomalies can be divided into heritable, toxic, nutritional, and infectious categories. Although uncommon in most herds, inherited congenital anomalies are probably present in all breeds of cattle and propagated as a result of specific trait selection that inadvertently results in propagation of the defect. In some herds, the occurrence of inherited anomalies has become frequent, and economically important. Anomalous traits can affect animals in a range of ways, some being lethal or requiring euthanasia on humane grounds, others altering structure, function, or performance of affected animals. Veterinary practitioners should be aware of the potential for inherited defects, and be prepared to investigate and report animals exhibiting abnormal characteristics. This review will discuss the morphologic characteristics, mode of inheritance, breeding lines affected, and the availability of genetic testing for selected heritable bovine fetal abnormalities.

  1. Liver abnormalities in pregnancy.


    Than, Nwe Ni; Neuberger, James


    Abnormalities of liver function (notably rise in alkaline phosphatase and fall in serum albumin) are common in normal pregnancy, whereas rise in serum bilirubin and aminotransferase suggest either exacerbation of underlying pre-existing liver disease, liver disease related to pregnancy or liver disease unrelated to pregnancy. Pregnant women appear to have a worse outcome when infected with Hepatitis E virus. Liver diseases associated with pregnancy include abnormalities associated hyperemesis gravidarum, acute fatty liver disease, pre-eclampsia, cholestasis of pregnancy and HELLP syndrome. Prompt investigation and diagnosis is important in ensuring a successful maternal and foetal outcome. In general, prompt delivery is the treatment of choice for acute fatty liver, pre-eclampsia and HELLP syndrome and ursodeoxycholic acid is used for cholestasis of pregnancy although it is not licenced for this indication.

  2. Skin Cancer Foundation


    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  3. Skin Pigmentation Disorders


    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  4. Morphological abnormalities in elasmobranchs.


    Moore, A B M


    A total of 10 abnormal free-swimming (i.e., post-birth) elasmobranchs are reported from The (Persian-Arabian) Gulf, encompassing five species and including deformed heads, snouts, caudal fins and claspers. The complete absence of pelvic fins in a milk shark Rhizoprionodon acutus may be the first record in any elasmobranch. Possible causes, including the extreme environmental conditions and the high level of anthropogenic pollution particular to The Gulf, are briefly discussed.

  5. Anatomical Abnormalities in Autism?


    Haar, Shlomi; Berman, Sigal; Behrmann, Marlene; Dinstein, Ilan


    Substantial controversy exists regarding the presence and significance of anatomical abnormalities in autism spectrum disorders (ASD). The release of the Autism Brain Imaging Data Exchange (∼1000 participants, age 6-65 years) offers an unprecedented opportunity to conduct large-scale comparisons of anatomical MRI scans across groups and to resolve many of the outstanding questions. Comprehensive univariate analyses using volumetric, thickness, and surface area measures of over 180 anatomically defined brain areas, revealed significantly larger ventricular volumes, smaller corpus callosum volume (central segment only), and several cortical areas with increased thickness in the ASD group. Previously reported anatomical abnormalities in ASD including larger intracranial volumes, smaller cerebellar volumes, and larger amygdala volumes were not substantiated by the current study. In addition, multivariate classification analyses yielded modest decoding accuracies of individuals' group identity (<60%), suggesting that the examined anatomical measures are of limited diagnostic utility for ASD. While anatomical abnormalities may be present in distinct subgroups of ASD individuals, the current findings show that many previously reported anatomical measures are likely to be of low clinical and scientific significance for understanding ASD neuropathology as a whole in individuals 6-35 years old.

  6. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin.


    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan


    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  7. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin

    NASA Astrophysics Data System (ADS)

    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan


    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  8. A life history perspective on skin cancer and the evolution of skin pigmentation.


    Osborne, Daniel L; Hames, Raymond


    The ancestral state of human skin pigmentation evolved in response to high ultraviolet radiation (UVR) stress. Some argue that pigmentation evolved to limit folate photolysis, therein limiting neural tube defects. Pigmentation also protects against sunburn which decreases the efficiency of sweating and potentiates skin infection. Pigmentation increases the efficacy of skin as a barrier to infection. Skin cancer has been rejected or minimized as a selective pressure because it is believed to have little or no effect on mortality during reproductive years. This argument ignores evidence of human longevity as a derived life history trait and the adaptive value of investment in offspring and kin, particularly during the post-reproductive lifespan. Opponents argue that lifespan in prehistoric hunter-gatherers was too short to be relevant to the evolution of skin pigmentation. This argument is flawed in that it relies on estimates of longevity at birth rather than adolescence. When appropriate estimates are used, it is clear that human longevity has a deep evolutionary history. We use a life history perspective to demonstrate the value of skin pigmentation as an adaptation to skin cancer with the following points: UVR exposure increases dysregulation of gene expression in skin cells leading to immortal cell lines; cutaneous malignant melanoma (CMM) affects individuals throughout reproductive years; and lifespan was longer than has previously been acknowledged, providing the opportunity for kin selection. This hypothesis is not at odds with the folate or barrier hypotheses. We stress that the evolution of skin pigmentation is complex and is an ongoing process.

  9. Defense against dermal exposures is only skin deep: significantly increased penetration through slightly damaged skin.


    Nielsen, Jesper Bo; Nielsen, Flemming; Sørensen, Jens Ahm


    The OECD guideline for studies on percutaneous penetration to be used in hazard and risk evaluations prescribes experimental conditions with optimal barrier integrity of the skin, which in many occupational settings probably is not true. Thus, workers may have compromised skin due to chemical or mechanical damage, due to different medical conditions (eczema, dermatitis, skin irritation) or related to occupational scenarios involving prolonged wet work. The present study used the OECD guideline procedures to study the in vitro percutaneous penetration through human skin of a number of model substances (glyphosat, caffeine, benzoic acid, malathion) covering a range of solubilities. Further, we studied the extent to which a slightly damaged skin would change the rate, the amount absorbed during dermal exposure and the distribution of chemical deposition between epidermis and dermis. The present study demonstrates that a limited damage to the skin significantly increases the permeability coefficient (K (p)) as well as total percutaneous penetration of chemicals, and most significantly for those compounds that due to their physicochemical characteristics (the most hydrophilic as well as the most lipophilic) have low penetration rates through intact skin. The present experiment not only confirms the proportionality between lipophilicity and potential for percutaneous penetration, but also illustrates that at a certain degree of lipophilicity of a model compound, the different skin compartments become more attractive for temporary deposition of model compounds. Moreover, a clear change from epidermal deposition towards a dominating dermis deposition of chemicals temporarily deposited within the skin is seen following damage to the skin barrier. Thus, the distribution of chemicals within the skin compartments is affected by the physicochemical characteristics of the chemicals as well as by the integrity of the skin. This observation may have implications when evaluating

  10. Abnormal pressures as hydrodynamic phenomena

    USGS Publications Warehouse

    Neuzil, C.E.


    So-called abnormal pressures, subsurface fluid pressures significantly higher or lower than hydrostatic, have excited speculation about their origin since subsurface exploration first encountered them. Two distinct conceptual models for abnormal pressures have gained currency among earth scientists. The static model sees abnormal pressures generally as relict features preserved by a virtual absence of fluid flow over geologic time. The hydrodynamic model instead envisions abnormal pressures as phenomena in which flow usually plays an important role. This paper develops the theoretical framework for abnormal pressures as hydrodynamic phenomena, shows that it explains the manifold occurrences of abnormal pressures, and examines the implications of this approach. -from Author

  11. Cutaneous skin tag


    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  12. Amino acid composition, including key derivatives of eccrine sweat: potential biomarkers of certain atopic skin conditions.


    Mark, Harker; Harding, Clive R


    The free amino acid (AA) composition of eccrine sweat is different from other biological fluids, for reasons which are not properly understood. We undertook the detailed analysis of the AA composition of freshly isolated pure human eccrine sweat, including some of the key derivatives of AA metabolism, to better understand the key biological mechanisms governing its composition. Eccrine sweat was collected from the axillae of 12 healthy subjects immediately upon formation. Free AA analysis was performed using an automatic AA analyser after ninhydrin derivatization. Pyrrolidine-5-carboxylic acid (PCA) and urocanic acid (UCA) levels were determined using GC/MS. The free AA composition of sweat was dominated by the presence of serine accounting for just over one-fifth of the total free AA composition. Glycine was the next most abundant followed by PCA, alanine, citrulline and threonine, respectively. The data obtained indicate that the AA content of sweat bears a remarkable similarity to the AA composition of the epidermal protein profilaggrin. This protein is the key source of free AAs and their derivatives that form a major part of the natural moisturizing factor (NMF) within the stratum corneum (SC) and plays a major role in maintaining the barrier integrity of human skin. As perturbations in the production of NMF can lead to abnormal barrier function and can arise as a consequence of filaggrin genotype, we propose the quantification of AAs in sweat may serve as a non-invasive diagnostic biomarker for certain atopic skin conditions, that is, atopic dermatitis (AD).

  13. [Molecular abnormalities in lymphomas].


    Delsol, G


    Numerous molecular abnormalities have been described in lymphomas. They are of diagnostic and prognostic value and are taken into account for the WHO classification of these tumors. They also shed some light on the underlying molecular mechanisms involved in lymphomas. Overall, four types of molecular abnormalities are involved: mutations, translocations, amplifications and deletions of tumor suppressor genes. Several techniques are available to detect these molecular anomalies: conventional cytogenetic analysis, multicolor FISH, CGH array or gene expression profiling using DNA microarrays. In some lymphomas, genetic abnormalities are responsible for the expression of an abnormal protein (e.g. tyrosine-kinase, transcription factor) detectable by immunohistochemistry. In the present review, molecular abnormalities observed in the most frequent B, T or NK cell lymphomas are discussed. In the broad spectrum of diffuse large B-cell lymphomas microarray analysis shows mostly two subgroups of tumors, one with gene expression signature corresponding to germinal center B-cell-like (GCB: CD10+, BCL6 [B-Cell Lymphoma 6]+, centerine+, MUM1-) and a subgroup expressing an activated B-cell-like signature (ABC: CD10-, BCL6-, centerine-, MUM1+). Among other B-cell lymphomas with well characterized molecular abnormalies are follicular lymphoma (BCL2 deregulation), MALT lymphoma (Mucosa Associated Lymphoid Tissue) [API2-MALT1 (mucosa-associated-lymphoid-tissue-lymphoma-translocation-gene1) fusion protein or deregulation BCL10, MALT1, FOXP1. MALT1 transcription factors], mantle cell lymphoma (cycline D1 [CCND1] overexpression) and Burkitt lymphoma (c-Myc expression). Except for ALK (anaplastic lymphoma kinase)-positive anaplastic large cell lymphoma, well characterized molecular anomalies are rare in lymphomas developed from T or NK cells. Peripheral T cell lymphomas not otherwise specified are a heterogeneous group of tumors with frequent but not recurrent molecular abnormalities

  14. Considerations on photoprotection and skin disorders.


    Cestari, T Ferreira; Oliveira, F Bazanella de; Boza, J Catucci


    Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection.

  15. Feeling Abnormal: Simulation of Deviancy in Abnormal and Exceptionality Courses.

    ERIC Educational Resources Information Center

    Fernald, Charles D.


    Describes activity in which student in abnormal psychology and psychology of exceptional children classes personally experience being judged abnormal. The experience allows the students to remember relevant research, become sensitized to the feelings of individuals classified as deviant, and use caution in classifying individuals as abnormal.…

  16. Barrier Formation

    PubMed Central

    Lyaruu, D.M.; Medina, J.F.; Sarvide, S.; Bervoets, T.J.M.; Everts, V.; DenBesten, P.; Smith, C.E.; Bronckers, A.L.J.J.


    Enamel fluorosis is an irreversible structural enamel defect following exposure to supraoptimal levels of fluoride during amelogenesis. We hypothesized that fluorosis is associated with excess release of protons during formation of hypermineralized lines in the mineralizing enamel matrix. We tested this concept by analyzing fluorotic enamel defects in wild-type mice and mice deficient in anion exchanger-2a,b (Ae2a,b), a transmembrane protein in maturation ameloblasts that exchanges extracellular Cl− for bicarbonate. Defects were more pronounced in fluorotic Ae2a,b−/− mice than in fluorotic heterozygous or wild-type mice. Phenotypes included a hypermineralized surface, extensive subsurface hypomineralization, and multiple hypermineralized lines in deeper enamel. Mineral content decreased in all fluoride-exposed and Ae2a,b−/− mice and was strongly correlated with Cl−. Exposure of enamel surfaces underlying maturation-stage ameloblasts to pH indicator dyes suggested the presence of diffusion barriers in fluorotic enamel. These results support the concept that fluoride stimulates hypermineralization at the mineralization front. This causes increased release of protons, which ameloblasts respond to by secreting more bicarbonates at the expense of Cl− levels in enamel. The fluoride-induced hypermineralized lines may form barriers that impede diffusion of proteins and mineral ions into the subsurface layers, thereby delaying biomineralization and causing retention of enamel matrix proteins. PMID:24170372

  17. Skin Findings in Williams Syndrome

    PubMed Central

    Kozel, Beth A.; Bayliss, Susan J.; Berk, David R.; Waxler, Jessica L; Knutsen, Russell H.; Danback, Joshua R.; Pober, Barbara R.


    Previous examination in a small number of individuals with Williams syndrome (also referred to as Williams-Beuren syndrome) has shown subtly softer skin and reduced deposition of elastin, an elastic matrix protein important in tissue recoil. No quantitative information about skin elasticity in individuals with Williams syndrome is available; nor has there been a complete report of dermatologic findings in this population. To fill this knowledge gap, 94 patients with Williams syndrome aged 7-50 years were recruited as part of the Skin and Vascular Elasticity (WS-SAVE) study. They underwent either a clinical dermatologic assessment by trained dermatologists (2010 WSA family meeting) or measurement of biomechanical properties of the skin with the DermaLab™ suction cup (2012 WSA family meeting). Clinical assessment confirmed that soft skin is common in this population (83%), as is premature graying of the hair (80% of those 20 years or older), while wrinkles (92%) and abnormal scarring (33%) were detected in larger than expected proportions. Biomechanical studies detected statistically significant differences in dP (the pressure required to lift the skin), dT (the time required to raise the skin through a prescribed gradient), VE (viscoelasticity) and E (Young’s modulus) relative to matched controls. The RT (retraction time) also trended longer but was not significant. The biomechanical differences noted in these patients did not correlate with the presence of vascular defects also attributable to elastin insufficiency (vascular stiffness, hypertension, and arterial stenosis) suggesting the presence of tissue specific modifiers that modulate the impact of elastin insufficiency in each tissue. PMID:24920525

  18. Exercises to Improve Gait Abnormalities


    ... Home About iChip Articles Directories Videos Resources Contact Exercises to Improve Gait Abnormalities Home » Article Categories » Exercise and Fitness Font Size: A A A A Exercises to Improve Gait Abnormalities Next Page The manner ...

  19. Abnormal human sex chromosome constitutions

    SciTech Connect


    Chapter 22, discusses abnormal human sex chromosome constitution. Aneuploidy of X chromosomes with a female phenotype, sex chromosome aneuploidy with a male phenotype, and various abnormalities in X chromosome behavior are described. 31 refs., 2 figs.

  20. [The usefulness of protective creams on fragile and aged skin].


    Rueda López, Justo; Guerrero Palmero, Alberto; Muñoz Bueno, Ana Maria; Esquius i Carbonell, Jacint; Rosell Moreno, Carmen


    The ADDERMIS protective cream has these properties: it prevents skin maceration, exercises a regenerative effect, has bacteriostatic and bactericide activity, possesses a noted anti-inflammatory effect and reduces the risk of mycotic infections. Its application is indicated for use in cases of: skin lesions, such as bed sores or leg ulcers, which require the use of a barrier product; dermatitis lesions in zones of skin folds or due to diaper use; to prevent friction zones; fragile skin; peeling, zones where cracks in the skin appear...and to use for cases of incontinence when diapers are required.

  1. Leopard syndrome associated with hyperelastic skin: analysis of collagen metabolism in cultured skin fibroblasts.


    Ohkura, T; Ohnishi, Y; Kawada, A; Tajima, S; Ishibashi, A; Ono, K


    We present a patient with Leopard syndrome and hyperelastic skin. Biochemical analysis using cultured skin fibroblasts showed normal type III and V collagen synthesis, lysyl hydroxylation level of type I procollagen and processing of pro-alpha(1) and alpha(2)(I). Our results suggest that molecular defects of hyperelasticity in Leopard syndrome are not related to abnormal collagen metabolism, although not all steps of collagen synthesis have been investigated.

  2. Advances in allergic skin disease, anaphylaxis, and hypersensitivity reactions to foods, drugs, and insects in 2011.


    Sicherer, Scott H; Leung, Donald Y M


    This review highlights some of the research advances in anaphylaxis; hypersensitivity reactions to foods, drugs, and insects; and allergic skin diseases that were reported in the Journal in 2011. Food allergy appears to be increasing in prevalence and carries a strong economic burden. Risk factors can include dietary ones, such as deficiency of vitamin D and timing of complementary foods, and genetic factors, such as filaggrin loss-of-function mutations. Novel mechanisms underlying food allergy include the role of invariant natural killer T cells and influences of dietary components, such as isoflavones. Among numerous preclinical and clinical treatment studies, promising observations include the efficacy of sublingual and oral immunotherapy, a Chinese herbal remedy showing promising in vitro results, the potential immunotherapeutic effects of having children ingest foods with baked-in milk if they tolerate it, and the use of anti-IgE with or without concomitant immunotherapy. Studies of allergic skin diseases, anaphylaxis, and hypersensitivity to drugs and insect venom are elucidating cellular mechanisms, improved diagnostics, and potential targets for future treatment. The role of skin barrier abnormalities, as well as the modulatory effects of the innate and adaptive immune responses, are major areas of investigation.

  3. Skin Keratins

    PubMed Central

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A.


    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin. PMID:26795476

  4. Epilepsy and chromosomal abnormalities

    PubMed Central


    Background Many chromosomal abnormalities are associated with Central Nervous System (CNS) malformations and other neurological alterations, among which seizures and epilepsy. Some of these show a peculiar epileptic and EEG pattern. We describe some epileptic syndromes frequently reported in chromosomal disorders. Methods Detailed clinical assessment, electrophysiological studies, survey of the literature. Results In some of these congenital syndromes the clinical presentation and EEG anomalies seems to be quite typical, in others the manifestations appear aspecific and no strictly linked with the chromosomal imbalance. The onset of seizures is often during the neonatal period of the infancy. Conclusions A better characterization of the electro clinical patterns associated with specific chromosomal aberrations could give us a valuable key in the identification of epilepsy susceptibility of some chromosomal loci, using the new advances in molecular cytogenetics techniques - such as fluorescent in situ hybridization (FISH), subtelomeric analysis and CGH (comparative genomic hybridization) microarray. However further studies are needed to understand the mechanism of epilepsy associated with chromosomal abnormalities. PMID:20438626

  5. Research in practice: Antimicrobial peptides of the skin.


    Gläser, Regine


    Antimicrobial peptides represent evolutionary ancient molecules whose importance became evident within the last years. These highly effective peptides protect the skin and other epithelia against infection and form a fast acting "chemical barrier" also regulating the normal flora of the skin and mucosa. In the Department of Dermatology, University Hospital Kiel, various antimicrobial peptides have been discovered, characterized and investigated in healthy persons as well as in different skin diseases. Everyday clinical observations formed the background for several interesting hypotheses and findings.

  6. Skin-cleansing and care principles for special pediatric populations.


    Horowitz, Paul; McLeod, Renee P; Eichenfield, Lawrence F; Fowler, Joseph F; Elias, Peter M


    Good skin care has two overall goals: to support and maintain healthy stratum corneum function and to help restore barrier function perturbed by disease processes or injuries. In this article, we discuss the special attention that is required in the initial skin care of newborns, and we address what measures, beyond the basic skin care principles, are required for patients with conditions such as atopic dermatitis, acne, contact and allergic dermatitis, and diaper rash.

  7. In vitro permeation of platinum through African and Caucasian skin.


    Franken, A; Eloff, F C; du Plessis, J; Badenhorst, C J; Du Plessis, J L


    The majority of the South African workforce are Africans, therefore potential racial differences should be considered in risk and exposure assessments in the workplace. Literature suggests African skin to be a superior barrier against permeation and irritants. Previous in vitro studies on metals only included skin from Caucasian donors, whereas this study compared the permeation of platinum through African and Caucasian skin. A donor solution of 0.3 mg/ml of potassium tetrachloroplatinate (K₂PtCl₄) dissolved in synthetic sweat was applied to the vertical Franz diffusion cells with full thickness abdominal skin. Skin from three female African and three female Caucasian donors were included (n=21). The receptor solution was removed at various intervals during the 24 h experiment, and analysed with high resolution inductively coupled plasma-mass spectrometry (ICP-MS). Skin was digested and analysed by inductively coupled plasma-optical emission spectrometry (ICP-OES). Significantly higher permeation of platinum through intact African skin (p=0.044), as well as a significantly higher mass of platinum retention in African skin in comparison with Caucasian skin (p=0.002) occurred. Significant inter-donor variation was found in both racial groups (p<0.02). Results indicate that African workers have increased risk of dermal permeation and therefore possible sensitisation caused by dermal exposure to platinum salts. These results are contradictory to limited literature suggesting a superior barrier in African skin and further investigation is necessary to explain the higher permeation through African skin.

  8. Stimulation of the penetration of particles into the skin by plasma tissue interaction

    NASA Astrophysics Data System (ADS)

    Lademann, O.; Richter, H.; Kramer, A.; Patzelt, A.; Meinke, M. C.; Graf, C.; Gao, Q.; Korotianskiy, E.; Rühl, E.; Weltmann, K.-D.; Lademann, J.; Koch, S.


    A high number of treatments in dermatology are based on the penetration of topically applied drugs through the skin barrier. This process is predominantly inefficient, on account of the strong protection properties of the upper skin layer - the stratum corneum. If the skin barrier is damaged, the penetration efficiency of topically applied drugs increases. Therefore, different methods have been developed to influence the barrier properties of the skin. Recently, it could be demonstrated that a cold tissue tolerable plasma (TTP) produced by a plasma-jet can strongly enhance drug delivery through the skin. These investigations were performed by using a solution of fluorescent dye as a model drug. In the present study, these investigations were carried out using fluorescent silica particles at different sizes. The aim of the study was to investigate whether or not there is a limitation in size for topically applied substances to pass through the skin barrier after plasma treatment.

  9. Skeletal abnormalities in homocystinuria.

    PubMed Central

    Brenton, D. P.


    The skeletal changes of thirty-four patients with the biochemical and clinical features of cystathionine synthase deficiency are described. It is emphasized that there is clinical evidence of excessive bone growth and the formation for bone which is structurally weaker than normal. The similarities and differences between this condition and Marfan's syndrome are stressed and the possible nature of the connective tissue defect leading to the skeletal changes discussed. The most characteristic skeletal changes in homocystinuria are the skeletal disproportion (pubis-heel length greater than crown-pubis length), the abnormal vertebrae, sternal deformities, genu valgum and large metaphyses and epiphyses. Images Fig. 2 Fig. 3 Fig. 4 Fig. 8 Fig. 9 Fig. 10 PMID:917963

  10. Eye movement abnormalities.


    Moncayo, Jorge; Bogousslavsky, Julien


    Generation and control of eye movements requires the participation of the cortex, basal ganglia, cerebellum and brainstem. The signals of this complex neural network finally converge on the ocular motoneurons of the brainstem. Infarct or hemorrhage at any level of the oculomotor system (though more frequent in the brain-stem) may give rise to a broad spectrum of eye movement abnormalities (EMAs). Consequently, neurologists and particularly stroke neurologists are routinely confronted with EMAs, some of which may be overlooked in the acute stroke setting and others that, when recognized, may have a high localizing value. The most complex EMAs are due to midbrain stroke. Horizontal gaze disorders, some of them manifesting unusual patterns, may occur in pontine stroke. Distinct varieties of nystagmus occur in cerebellar and medullary stroke. This review summarizes the most representative EMAs from the supratentorial level to the brainstem.

  11. Skin (Pressure) Sores


    ... Treatments and Side Effects Managing Cancer-related Side Effects Skin Problems Pressure Sores A skin or pressure sore ... Content Usage Policy . Skin Problems Dry Skin Itching Skin Color Changes Pressure Sores Scars ... and Paying for Treatment Treatments and Side Effects Survivorship: During and After Treatment Caregivers and Family ...

  12. The top skin-associated genes: a comparative analysis of human and mouse skin transcriptomes.


    Gerber, Peter Arne; Buhren, Bettina Alexandra; Schrumpf, Holger; Homey, Bernhard; Zlotnik, Albert; Hevezi, Peter


    The mouse represents a key model system for the study of the physiology and biochemistry of skin. Comparison of skin between mouse and human is critical for interpretation and application of data from mouse experiments to human disease. Here, we review the current knowledge on structure and immunology of mouse and human skin. Moreover, we present a systematic comparison of human and mouse skin transcriptomes. To this end, we have recently used a genome-wide database of human gene expression to identify genes highly expressed in skin, with no, or limited expression elsewhere - human skin-associated genes (hSAGs). Analysis of our set of hSAGs allowed us to generate a comprehensive molecular characterization of healthy human skin. Here, we used a similar database to generate a list of mouse skin-associated genes (mSAGs). A comparative analysis between the top human (n=666) and mouse (n=873) skin-associated genes (SAGs) revealed a total of only 30.2% identity between the two lists. The majority of shared genes encode proteins that participate in structural and barrier functions. Analysis of the top functional annotation terms revealed an overlap for morphogenesis, cell adhesion, structure, and signal transduction. The results of this analysis, discussed in the context of published data, illustrate the diversity between the molecular make up of skin of both species and grants a probable explanation, why results generated in murine in vivo models often fail to translate into the human.

  13. Tumors of the skin and soft tissues

    SciTech Connect

    Weller, R.E.


    The majority of the body surface is covered by the skin. Many internal disorders are reflected in the condition of the skin. One of the major functions of the skin is protection of the other organ systems from a variety of environmental insults. In this role, the skin itself is exposed to factors that can ultimately cause chronic diseases and cancer. Since it is relatively easy to recognize skin abnormalities, most skin cancers are brought to professional attention sooner than other types of cancer. However, due to the close resemblance between many skin neoplasms and noncancerous dermatologic disorders, these neoplasms may be mistreated for months or even years. In veterinary oncology, as in human medicine, most cancers can be effectively treated or cured following an accurate diagnosis. Once diagnosed, skin neoplasms should be aggressively treated. If causal factors are known, exposure to these factors should be limited through removal of the agent (for chemical carcinogens) or limiting exposure to the agent (for other carcinogens such as sunlight). 10 tabs. (MHB)

  14. The skin and hypercoagulable states.


    Thornsberry, Laura A; LoSicco, Kristen I; English, Joseph C


    Hypercoagulable states (HS) are inherited or acquired conditions that predispose an individual to venous and/or arterial thrombosis. The dermatologist can play a vital role in diagnosing a patient's HS by recognizing the associated cutaneous manifestations, such as purpura, purpura fulminans, livedo reticularis, livedo vasculopathy (atrophie blanche), anetoderma, chronic venous ulcers, and superficial venous thrombosis. The cutaneous manifestations of HS are generally nonspecific, but identification of an abnormal finding can warrant a further workup for an underlying thrombophilic disorder. This review will focus on the basic science of hemostasis, the evaluation of HS, the skin manifestations associated with hypercoagulability, and the use of antiplatelet and anticoagulant therapy in dermatology.

  15. Topically applied ceramide accumulates in skin glyphs

    PubMed Central

    Zhang, Qihong; Flach, Carol R; Mendelsohn, Richard; Mao, Guangru; Pappas, Apostolos; Mack, M Catherine; Walters, Russel M; Southall, Michael D


    Ceramides (CERs), structural components of the stratum corneum (SC), impart essential barrier properties to this thin outer layer of the epidermis. Variations in CER species within this layer have been linked to several skin diseases. A recent proliferation of CER-containing topical skin-care products warrants the elucidation of CER penetration profiles in both healthy and diseased skin. In the current study, the spatial distributions of CER concentration profiles, following topical application of two species of CER, were tracked using infrared imaging. Suspensions of single-chain perdeuterated sphingosine and phytosphingosine CER in oleic acid were applied, in separate experiments, to the surface of healthy intact ex vivo human skin using Franz diffusion cells. Following either a 24- or 48-hour incubation period at 34°C, infrared images were acquired from microtomed skin sections. Both CER species accumulated in glyph regions of the skin and penetrated into the SC, to a limited extent, only in these regions. The concentration profiles observed herein were independent of the CER species and incubation time utilized in the study. As a result, a very heterogeneous, sparse, spatial distribution of CERs in the SC was revealed. In contrast, oleic acid was found to be fairly homogeneously distributed throughout the SC and viable epidermis, albeit at lower concentrations in the latter. A more uniform, lateral distribution of CERs in the SC would likely be important for barrier efficacy or enhancement. PMID:26170709

  16. A Bioengineered Human Skin Equivalent (HSE) for the Evaluation of Protectants

    DTIC Science & Technology


    full thickness skin equivalent that has been optimized by addition of various growth factors, such as ascorbic acid, lipids and a PPAR-α agonist. It...has been characterized for morphology, lipid composition and barrier properties and compared to the commercially available skin equivalents...Compared to these, the HSE possesses closer lipid composition and barrier properties to human skin . The morphology shows a highly differentiated epidermis

  17. Stages of Skin Cancer


    ... Skin Cancer Skin color and being exposed to sunlight can increase the risk of nonmelanoma skin cancer ... carcinoma include the following: Being exposed to natural sunlight or artificial sunlight (such as from tanning beds) ...

  18. Skin Cancer Treatment


    ... Skin Cancer Skin color and being exposed to sunlight can increase the risk of nonmelanoma skin cancer ... carcinoma include the following: Being exposed to natural sunlight or artificial sunlight (such as from tanning beds) ...

  19. Basal cell skin cancer


    ... occur on skin that is regularly exposed to sunlight or other ultraviolet radiation. This type of skin ... skin cancer is to reduce your exposure to sunlight . Always use sunscreen: Apply sunscreen with sun protection ...

  20. Skin Condition Finder


    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  1. Skin Complications of IBD


    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  2. Scalded skin syndrome


    Ritter disease; Staphylococcal scalded skin syndrome (SSS) ... Scalded skin syndrome (SSS) is caused by infection with certain strains of Staphylococcus bacteria. The bacteria produce a toxin that causes the skin ...

  3. Skin Allergy Quiz


    ... time. Some common medications that can cause skin allergy include penicillin, sulfa drugs, barbiturates and anticonvulsants just to mention a few. Some of the symptoms from drug allergies might be hives, skin rash, itchy skin or ...

  4. Learning about Skin Cancer


    ... Why Deadly Skin Cancers Spread 2000 News Release Learning About Skin Cancer What are the most common ... skin surface. When a melanoma becomes thick and deep, the disease often spreads to other parts of ...

  5. TRP channels in the skin

    PubMed Central

    Tóth, Balázs I; Oláh, Attila; Szöllősi, Attila Gábor; Bíró, Tamás


    Emerging evidence suggests that transient receptor potential (TRP) ion channels not only act as ‘polymodal cellular sensors’ on sensory neurons but are also functionally expressed by a multitude of non-neuronal cell types. This is especially true in the skin, one of the largest organs of the body, where they appear to be critically involved in regulating various cutaneous functions both under physiological and pathophysiological conditions. In this review, we focus on introducing the roles of several cutaneous TRP channels in the regulation of the skin barrier, skin cell proliferation and differentiation, and immune functions. Moreover, we also describe the putative involvement of several TRP channels in the development of certain skin diseases and identify future TRP channel-targeted therapeutic opportunities. Linked Articles This article is part of a themed section on the pharmacology of TRP channels. To view the other articles in this section visit PMID:24372189

  6. Dermocosmetics for dry skin: a new role for botanical extracts.


    Casetti, F; Wölfle, U; Gehring, W; Schempp, C M


    Dry skin is associated with a disturbed skin barrier and reduced formation of epidermal proteins and lipids. During recent years, skin-barrier-reinforcing properties of some botanical compounds have been described. Searching the PubMed database revealed 9 botanical extracts that specifically improve skin barrier and/or promote keratinocyte differentiation in vivo after topical application. The topical application of Aloe vera (leaf gel), Betula alba (birch bark extract), Helianthus annuus (sunflower oleodistillate), Hypericum perforatum (St. John's wort extract), Lithospermum erythrorhizon (root extract), Piptadenia colubrina (angico-branco extract) and Simarouba amara (bitter wood extract) increased skin hydration, reduced the transepidermal water loss, or promoted keratinocyte differentiation in humans in vivo. The topical application of Rubia cordifolia root extract and rose oil obtained from Rosa spp. flowers stimulated keratinocyte differentiation in mouse models. The underlying mechanisms of these effects are discussed. It is concluded that some botanical compounds display skin-barrier-reinforcing properties that may be used in dermocosmetics for dry skin. However, more investigations on the mode of action and more vehicle-controlled studies are required.

  7. Self-Improvement of Keratinocyte Differentiation Defects During Skin Maturation in ABCA12-Deficient Harlequin Ichthyosis Model Mice

    PubMed Central

    Yanagi, Teruki; Akiyama, Masashi; Nishihara, Hiroshi; Ishikawa, Junko; Sakai, Kaori; Miyamura, Yuki; Naoe, Ayano; Kitahara, Takashi; Tanaka, Shinya; Shimizu, Hiroshi


    Harlequin ichthyosis (HI) is caused by loss-of-function mutations in the keratinocyte lipid transporter ABCA12. The patients often die in the first 1 or 2 weeks of life, although HI survivors’ phenotypes improve within several weeks after birth. In order to clarify the mechanisms of phenotypic recovery, we studied grafted skin and keratinocytes from Abca12-disrupted (Abca12−/−) mice showing abnormal lipid transport. Abca12−/− neonatal epidermis showed significantly reduced total ceramide amounts and aberrant ceramide composition. Immunofluorescence and immunoblotting of Abca12−/− neonatal epidermis revealed defective profilaggrin/filaggrin conversion and reduced protein expression of the differentiation-specific molecules, loricrin, kallikrein 5, and transglutaminase 1, although their mRNA expression was up-regulated. In contrast, Abca12−/− skin grafts kept in a dry environment exhibited dramatic improvements in all these abnormalities. Increased transepidermal water loss, a parameter representing barrier defect, was remarkably decreased in grafted Abca12−/− skin. Ten-passage sub-cultured Abca12−/− keratinocytes showed restoration of intact ceramide distribution, differentiation-specific protein expression and profilaggrin/filaggrin conversion, which were defective in primary-cultures. Using cDNA microarray analysis, lipid transporters including four ATP-binding cassette transporters were up-regulated after sub-culture of Abca12−/− keratinocytes compared with primary-culture. These results indicate that disrupted keratinocyte differentiation during the fetal development is involved in the pathomechanism of HI and, during maturation, Abca12−/− epidermal keratinocytes regain normal differentiation processes. This restoration may account for the skin phenotype improvement observed in HI survivors. PMID:20489143

  8. Impaired Tight Junctions in Atopic Dermatitis Skin and in a Skin-Equivalent Model Treated with Interleukin-17

    PubMed Central

    Yuki, Takuo; Tobiishi, Megumi; Kusaka-Kikushima, Ayumi; Ota, Yukiko; Tokura, Yoshiki


    Tight junction (TJ) dysfunction in the stratum granulosum leads to aberrant barrier function of the stratum corneum (SC) in the epidermis. However, it is unclear whether TJs are perturbed in atopic dermatitis (AD), a representative aberrant SC-related skin disease, and whether some factors related to AD pathogenesis induce TJ dysfunction. To address these issues, we investigated the alterations of TJs in AD skin and the effects of Th2 and Th17 cytokines on TJs in a skin-equivalent model. The levels of TJ proteins were determined in the epidermis of nonlesional and lesional skin sites of AD. Western blot and immunohistochemical analyses revealed that the levels of zonula occludens 1 were decreased in the nonlesional sites of AD, and the levels of zonula occludens 1 and claudin-1 were decreased in the lesional sites relative to the levels in skin from healthy subjects. Next, we examined the effects of interleukin (IL)-4, tumor necrosis factor-α, IL-17, and IL-22 on the TJ barrier in a skin-equivalent model. Only IL-17 impaired the TJ barrier. Furthermore, we observed a defect in filaggrin monomer degradation in the IL-17–treated skin model. Thus, TJs are dysfunctional in AD, at least partly, due to the effect of IL-17, which may result in an aberrant SC barrier. PMID:27588419

  9. Skin microbiota: overview and role in the skin diseases acne vulgaris and rosacea.


    Murillo, Nathalia; Raoult, Didier


    As the first barrier to environmental exposures, human skin has developed an integrated immune system to protect the inner body from chemical, physical or microbial insults. Microorganisms inhabiting superficial skin layers are known as skin microbiota and include bacteria, viruses, archaea and fungi. The microbiota composition is crucial in the instruction and support of the skin's immune system. Changes in microbiota can be due to individual, environmental or behavioral factors, such as age, climate, hygiene or antibiotic consumption, which can cause dysbiosis. The contribution of skin microbiota to disease development is known in atopic dermatitis, where there is an increase in Staphylococcus aureus. Culture-independent studies have enabled more accurate descriptions of this complex interplay. Microbial imbalance is associated with the development of various diseases. This review focuses on microbial imbalances in acne vulgaris and rosacea.

  10. Skin to skin care:heat balance.

    PubMed Central

    Karlsson, H


    Skin to skin care has been practised in primitive and high technology cultures for body temperature preservation in neonates. Regional skin temperature and heat flow was measured in moderately hypothermic term neonates to quantitate the heat transfer occurring during one hour of skin to skin care. Nine healthy newborns with a mean rectal temperature of 36.3 degrees C were placed skin to skin on their mothers' chests. The mean (SD) rectal temperature increased by 0.7 (0.4) degrees C to 37.0 degrees C. The heat loss was high (70 Wm-2) from the unprotected skin of the head to the surrounding air. Minute heat losses occurred from covered areas; and heat was initially gained from areas in contact with the mother's skin. The total dry heat loss during skin to skin care corresponded to heat loss during incubator care at 32-32.5 degrees C. The reduced heat loss, and to a minor extent, the initial heat flux from the mothers allowed heat to be conserved, leading to rewarming. PMID:8949698

  11. Maintaining skin integrity in the aged: a systematic review.


    Kottner, J; Lichterfeld, A; Blume-Peytavi, U


    Ageing is associated with structural and functional changes of the skin that result in increased vulnerability. The aim of this systematic review is to synthesize empirical evidence about the efficacy and effectiveness of basic skin care interventions for maintaining skin integrity in the aged. The databases Medline, EMBASE, CINAHL (1990-2012), Scopus, SCI (February 2013) and reference lists were searched. Inclusion criteria were primary intervention studies using skin care products in physiologically aged skin (lower age limit 50 years). Study and sample characteristics, interventions and outcomes were extracted. The methodological quality was assessed and a level of evidence was assigned. From 1535 screened articles 188 were read in full text. From these, 33 articles were included reporting results on treating dry skin conditions, and preventing incontinence-associated dermatitis and superficial ulcerations. Most studies had lower levels of evidence of 3 or 4. Skin-cleansing products containing syndets or amphoteric surfactants compared with standard soap and water washing improved skin dryness and demonstrated skin-protecting effects. Moisturizers containing humectants consistently showed statistically significant improvements in skin dryness. Skin barrier products containing occlusives reduced the occurrence of skin injuries compared with standard or no treatment. Owing to methodological limitations the current evidence base for basic skin care in the aged is weak. Using low-irritating cleansing products and humectant- or occlusive-containing moisturizers seems to be the best strategy for maintaining the skin barrier function and integrity. We know little about the effects of cleansing regimens and about the benefits of moisturizers when compared with each other.

  12. Abnormal pressure in hydrocarbon environments

    USGS Publications Warehouse

    Law, B.E.; Spencer, C.W.


    Abnormal pressures, pressures above or below hydrostatic pressures, occur on all continents in a wide range of geological conditions. According to a survey of published literature on abnormal pressures, compaction disequilibrium and hydrocarbon generation are the two most commonly cited causes of abnormally high pressure in petroleum provinces. In young (Tertiary) deltaic sequences, compaction disequilibrium is the dominant cause of abnormal pressure. In older (pre-Tertiary) lithified rocks, hydrocarbon generation, aquathermal expansion, and tectonics are most often cited as the causes of abnormal pressure. The association of abnormal pressures with hydrocarbon accumulations is statistically significant. Within abnormally pressured reservoirs, empirical evidence indicates that the bulk of economically recoverable oil and gas occurs in reservoirs with pressure gradients less than 0.75 psi/ft (17.4 kPa/m) and there is very little production potential from reservoirs that exceed 0.85 psi/ft (19.6 kPa/m). Abnormally pressured rocks are also commonly associated with unconventional gas accumulations where the pressuring phase is gas of either a thermal or microbial origin. In underpressured, thermally mature rocks, the affected reservoirs have most often experienced a significant cooling history and probably evolved from an originally overpressured system.

  13. Systemic abnormalities in liver disease

    PubMed Central

    Minemura, Masami; Tajiri, Kazuto; Shimizu, Yukihiro


    Systemic abnormalities often occur in patients with liver disease. In particular, cardiopulmonary or renal diseases accompanied by advanced liver disease can be serious and may determine the quality of life and prognosis of patients. Therefore, both hepatologists and non-hepatologists should pay attention to such abnormalities in the management of patients with liver diseases. PMID:19554648

  14. Increased in vivo skin penetration of quantum dots with UVR and in vitro quantum dot cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mortensen, Luke; Zheng, Hong; Faulknor, Renea; De Benedetto, Anna; Beck, Lisa; DeLouise, Lisa A.


    The growing presence of quantum dots (QD) in a variety of biological, medical, and electronics applications means an increased risk of human exposure in manufacturing, research, and consumer use. However, very few studies have investigated the susceptibility of skin to penetration of QD - the most common exposure route- and the results of those that exist are conflicting. This suggests that a technique allowing determination of skin barrier status and prediction of skin permeability to QD would be of crucial interest as recent findings have provided evidence of in vitro cytotoxicity and long-term in vivo retention in the body for most QD surface chemistries. Our research focuses on barrier status of the skin (intact and with ultraviolet radiation induced barrier defect) and its impact on QD skin penetration. These model studies are particularly relevant to the common application condition of NP containing sunscreen and SPF cosmetics to UV exposed skin. Herein we present our initial efforts to develop an in vivo model of nanoparticle skin penetration using the SKH-1 hairless mouse with transepidermal water loss (TEWL) to evaluate skin barrier status and determine its ability to predict QD penetration. Our results show that ultraviolet radiation increases both TEWL and skin penetration of QD. Additionally, we demonstrate cytotoxic potential of QD to skin cells using a metastatic melanoma cell line. Our research suggests future work in specific targeting of nanoparticles, to prevent or enhance penetration. This knowledge will be used to develop powerful therapeutic agents, decreased penetration cosmetic nanoparticles, and precise skin cancer imaging modalities.

  15. Grenz ray-induced nonmelanoma skin cancer

    SciTech Connect

    Frentz, G.


    In 28 patients, nonmelanoma skin cancers developed in areas previously exposed to grenz rays. In 17 patients who did not have psoriasis, no other relevant carcinogenic exposure could be incriminated. Women were more often affected than men. Most of the tumors were basal cell cancers, and most of the patients had multiple tumors. No threshold dose could be established. The distribution of the latency time among patients without psoriasis was strictly normal (median 18 years). These observations suggest that usual therapeutic doses of grenz rays, as a single agent, are capable of causing skin cancer, but only in those persons who are abnormally sensitive to x-rays. 9 references.

  16. Cutaneous abnormalities in rheumatoid arthritis compared with non‐inflammatory rheumatic conditions

    PubMed Central

    Douglas, K M J; Ladoyanni, E; Treharne, G J; Hale, E D; Erb, N; Kitas, G D


    Background Cutaneous abnormalities are common in rheumatoid arthritis, but exact prevalence estimates are yet to be established. Some abnormalities may be independent and coincidental, whereas others may relate to rheumatoid arthritis or its treatment. Objectives To determine the exact nature and point prevalence of cutaneous abnormalities in patients with rheumatoid arthritis compared with those in patients with non‐inflammatory rheumatic disease. Methods 349 consecutive outpatients for rheumatology (205 with rheumatoid arthritis and 144 with non‐inflammatory rheumatic conditions) were examined for skin and nail signs by a dermatologist. Histories of rheumatology, dermatology, drugs and allergy were noted in detail. Results Skin abnormalities were reported by more patients with rheumatoid arthritis (61%) than non‐inflammatory controls (47%). More patients with rheumatoid arthritis (39%) than controls (10%) attributed their skin abnormality to drugs. Cutaneous abnormalities observed by the dermatologist were also more common in patients with rheumatoid arthritis (76%) than in the group with non‐inflammatory disease (60%). Specifically, bruising, athlete's foot, scars, rheumatoid nodules and vasculitic lesions were more common in patients with rheumatoid arthritis than in controls. The presence of bruising was predicted only by current steroid use. The presence of any other specific cutaneous abnormalities was not predicted by any of the variables assessed. In the whole group, current steroid use and having rheumatoid arthritis were the only important predictors of having any cutaneous abnormality. Conclusions Self‐reported and observed cutaneous abnormalities are more common in patients with rheumatoid arthritis than in controls with non‐inflammatory disease. These include cutaneous abnormalities related to side effects of drugs or to rheumatoid arthritis itself and other abnormalities previously believed to be independent but which may be of clinical

  17. Skin Care and Aging


    ... version of this page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It becomes thinner, ... to make it feel and look better. Dry Skin and Itching Click for more information Many older ...

  18. Acne in ethnic skin.


    Halder, Rebat M; Brooks, Howard L; Callender, Valerie D


    Acne is the most common disorder observed in ethnic skin. Clinical presentation is different than in white skin. Postinflammatory hyperpigmentation is a common sequelae of acne in darker skin. The management of acne in ethnic skin is based largely on the prevention and treatment of hyperpigmentation.

  19. Patient experiences living with split thickness skin grafts.


    Burnett, L N; Carr, E; Tapp, D; Raffin Bouchal, S; Horch, J D; Biernaskie, J; Gabriel, V


    The standard of care for deep burns is autologous split thickness skin grafting. Although adequate to resurface a deep wound, the resulting skin is chronically abnormal. The purpose of this study was to describe the experience of patients with split thickness skin grafts to help guide future investigations related to skin regeneration. In this study, an interpretive description qualitative methodology was employed. Subjects participated in a two-part single patient interview that was recorded and transcribed. A nurse with experience in clinical burn care coded and interpreted the data. Participants were recruited through presentation to a university based outpatient burn clinic for follow up from autologous split thickness skin grafting. Eight male patients and four female patients 20-62 years old ranging 2-29 months post-skin grafting were enrolled in the study. The most significant concerns voiced by patients were identified and organized into five themes: (1) a new normal, (2) split thickness skin graft symptoms, (3) appearance of new skin, (4) coping, and (5) participation in future clinical trials. Participants reported that the abnormalities related to their split thickness skin grafts were significant enough that they would be willing to participate in a future clinical trial investigating new cell-based therapies.

  20. Operative treatment of functional facial skin disorders.


    Scheithauer, Marc Oliver; Rettinger, Gerhard


    The skin is the principal interface between the body and the surrounding world and thus serves as a protective barrier against trauma, temperature extremes and radiation. With receptors for pressure, movement, heat and cold, it also acts as sensory organ and through sweat secretion plays a role in thermoregulation and electrolyte metabolism. Not all of these functions are relevant to facial skin, however, cosmetic aspects are of vital importance.Disorders primarily affect the protective skin function in defect and scar areas. For operative correction, the following principles should be applied: Minimization of scar development by adherence to indicated incision lines in the face, preferred use of local skin flaps for defect coverage in order to obtain optimal results regarding texture, complexion and sensitivity of skin, as well as consideration of aesthetic units. Recent developments in this field are tissue culture, occlusive dressings, and the use of growth factors. Age-related skin changes with impairment of cosmetic function are characterized by the development of creases and looseness of skin. Rejuvenation has become an important segment of skin surgery. For surface treatment, especially of creases and acne scars, various types of laser treatment are employed. Deeper lines can be filled with filler materials. The integration of the superficial musculoaponeurotic system (SMAS) into face lift procedures has lead to more viable and natural results. Due to protruding tissue, blepharoplasty of the upper lid is often carried out in combination with forehead lift and eyebrow lift procedures.The optimized use of growth factors and synthetic materials, which serve as a matrix, are aimed at skin replacement which mimics the quality and functions of skin as closely as possible. On the whole, however, the reconstruction of defect through local tissue transfer is still considered as the treatment of choice.

  1. Operative treatment of functional facial skin disorders

    PubMed Central

    Scheithauer, Marc Oliver; Rettinger, Gerhard


    The skin is the principal interface between the body and the surrounding world and thus serves as a protective barrier against trauma, temperature extremes and radiation. With receptors for pressure, movement, heat and cold, it also acts as sensory organ and through sweat secretion plays a role in thermoregulation and electrolyte metabolism. Not all of these functions are relevant to facial skin, however, cosmetic aspects are of vital importance. Disorders primarily affect the protective skin function in defect and scar areas. For operative correction, the following principles should be applied: Minimization of scar development by adherence to indicated incision lines in the face, preferred use of local skin flaps for defect coverage in order to obtain optimal results regarding texture, complexion and sensitivity of skin, as well as consideration of aesthetic units. Recent developments in this field are tissue culture, occlusive dressings, and the use of growth factors. Age-related skin changes with impairment of cosmetic function are characterized by the development of creases and looseness of skin. Rejuvenation has become an important segment of skin surgery. For surface treatment, especially of creases and acne scars, various types of laser treatment are employed. Deeper lines can be filled with filler materials. The integration of the superficial musculoaponeurotic system (SMAS) into face lift procedures has lead to more viable and natural results. Due to protruding tissue, blepharoplasty of the upper lid is often carried out in combination with forehead lift and eyebrow lift procedures. The optimized use of growth factors and synthetic materials, which serve as a matrix, are aimed at skin replacement which mimics the quality and functions of skin as closely as possible. On the whole, however, the reconstruction of defect through local tissue transfer is still considered as the treatment of choice. PMID:22073066

  2. Moisturizers: reality and the skin benefits.


    Nolan, Katherine; Marmur, Ellen


    The function of the skin as a barrier protects underlying tissues from infection, desiccation, chemicals, and mechanical stress. Disruption of this function results in increased transepidermal water loss or TEWL and is associated with conditions like atopic dermatitis and other chronic skin diseases. Moisturizers have been shown to improve these conditions through restoration of the integrity of the stratum corneum, acting as a barrier to water loss and replacement of skin lipids and other compounds. Also, moisturizers are commonly used to reduce fine lines and make skin appear smooth and soft. While many products make extensive claims of skin rejuvenation, many of the beneficial effects of these products are actually due to the moisturizers they contain: ingredients like glycerin, petrolatum, and dimethicone. Some newer formulations like prescription-device moisturizers, which received 510 K approval on the basis of reducing TEWL, are significantly more expensive than traditional moisturizers and recent literature does not indicate that they are more effective than their over-the-counter counterparts.

  3. Diffusion of (2-/sup 14/C)diazepam across hairless mouse skin and human skin

    SciTech Connect

    Koch, R.L.; Palicharla, P.; Groves, M.J.


    The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. (/sup 14/C)Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the /sup 14/C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber.

  4. Skin physiology and textiles - consideration of basic interactions.


    Wollina, U; Abdel-Naser, M B; Verma, S


    The skin exerts a number of essential protective functions ensuring homeostasis of the whole body. In the present review barrier function of the skin, thermoregulation, antimicrobial defence and the skin-associated immune system are discussed. Barrier function is provided by the dynamic stratum corneum structure composed of lipids and corneocytes. The stratum corneum is a conditio sine qua non for terrestrial life. Impairment of barrier function can be due to injury and inflammatory skin diseases. Textiles, in particular clothing, interact with skin functions in a dynamic pattern. Mechanical properties like roughness of fabric surface are responsible for non-specific skin reactions like wool intolerance or keratosis follicularis. Thermoregulation, which is mediated by local blood flow and evaporation of sweat, is an important subject for textile-skin interactions. There are age-, gender- and activity-related differences in thermoregulation of skin that should be considered for the development of specifically designed fabrics. The skin is an important immune organ with non-specific and specific activities. Antimicrobial textiles may interfere with non-specific defence mechanisms like antimicrobial peptides of skin or the resident microflora. The use of antibacterial compounds like silver, copper or triclosan is a matter of debate despite their use for a very long period. Macromolecules with antimicrobial activity like chitosan that can be incorporated into textiles or inert material like carbon fibres or activated charcoal seem to be promising agents. Interaction of textiles with the specific immune system of skin is a rare event but may lead to allergic contact dermatitis. Electronic textiles and other smart textiles offer new areas of usage in health care and risk management but bear their own risks for allergies.

  5. Chromosomal abnormalities and mental illness.


    MacIntyre, D J; Blackwood, D H R; Porteous, D J; Pickard, B S; Muir, W J


    Linkage studies of mental illness have provided suggestive evidence of susceptibility loci over many broad chromosomal regions. Pinpointing causative gene mutations by conventional linkage strategies alone is problematic. The breakpoints of chromosomal abnormalities occurring in patients with mental illness may be more direct pointers to the relevant gene locus. Publications that describe patients where chromosomal abnormalities co-exist with mental illness are reviewed along with supporting evidence that this may amount to an association. Chromosomal abnormalities are considered to be of possible significance if (a) the abnormality is rare and there are independent reports of its coexistence with psychiatric illness, or (b) there is colocalisation of the abnormality with a region of suggestive linkage findings, or (c) there is an apparent cosegregation of the abnormality with psychiatric illness within the individual's family. Breakpoints have been described within many of the loci suggested by linkage studies and these findings support the hypothesis that shared susceptibility factors for schizophrenia and bipolar disorder may exist. If these abnormalities directly disrupt coding regions, then combining molecular genetic breakpoint cloning with bioinformatic sequence analysis may be a method of rapidly identifying candidate genes. Full karyotyping of individuals with psychotic illness especially where this coexists with mild learning disability, dysmorphism or a strong family history of mental disorder is encouraged.

  6. Chromosomal abnormalities in human sperm

    SciTech Connect

    Martin, R.H.


    The ability to analyze human sperm chromosome complements after penetration of zona pellucida-free hamster eggs provides the first opportunity to study the frequency and type of chromosomal abnormalities in human gametes. Two large-scale studies have provided information on normal men. We have studied 1,426 sperm complements from 45 normal men and found an abnormality rate of 8.9%. Brandriff et al. (5) found 8.1% abnormal complements in 909 sperm from 4 men. The distribution of numerical and structural abnormalities was markedly dissimilar in the 2 studies. The frequency of aneuploidy was 5% in our sample and only 1.6% in Brandriff's, perhaps reflecting individual variability among donors. The frequency of 24,YY sperm was low: 0/1,426 and 1/909. This suggests that the estimates of nondisjunction based on fluorescent Y body data (1% to 5%) are not accurate. We have also studied men at increased risk of sperm chromosomal abnormalities. The frequency of chromosomally unbalanced sperm in 6 men heterozygous for structural abnormalities varied dramatically: 77% for t11;22, 32% for t6;14, 19% for t5;18, 13% for t14;21, and 0% for inv 3 and 7. We have also studied 13 cancer patients before and after radiotherapy and demonstrated a significant dose-dependent increase of sperm chromosome abnormalities (numerical and structural) 36 months after radiation treatment.

  7. Haematological abnormalities in mitochondrial disorders

    PubMed Central

    Finsterer, Josef; Frank, Marlies


    INTRODUCTION This study aimed to assess the kind of haematological abnormalities that are present in patients with mitochondrial disorders (MIDs) and the frequency of their occurrence. METHODS The blood cell counts of a cohort of patients with syndromic and non-syndromic MIDs were retrospectively reviewed. MIDs were classified as ‘definite’, ‘probable’ or ‘possible’ according to clinical presentation, instrumental findings, immunohistological findings on muscle biopsy, biochemical abnormalities of the respiratory chain and/or the results of genetic studies. Patients who had medical conditions other than MID that account for the haematological abnormalities were excluded. RESULTS A total of 46 patients (‘definite’ = 5; ‘probable’ = 9; ‘possible’ = 32) had haematological abnormalities attributable to MIDs. The most frequent haematological abnormality in patients with MIDs was anaemia. 27 patients had anaemia as their sole haematological problem. Anaemia was associated with thrombopenia (n = 4), thrombocytosis (n = 2), leucopenia (n = 2), and eosinophilia (n = 1). Anaemia was hypochromic and normocytic in 27 patients, hypochromic and microcytic in six patients, hyperchromic and macrocytic in two patients, and normochromic and microcytic in one patient. Among the 46 patients with a mitochondrial haematological abnormality, 78.3% had anaemia, 13.0% had thrombopenia, 8.7% had leucopenia and 8.7% had eosinophilia, alone or in combination with other haematological abnormalities. CONCLUSION MID should be considered if a patient’s abnormal blood cell counts (particularly those associated with anaemia, thrombopenia, leucopenia or eosinophilia) cannot be explained by established causes. Abnormal blood cell counts may be the sole manifestation of MID or a collateral feature of a multisystem problem. PMID:26243978

  8. Skin-Specific Deletion of Mis18α Impedes Proliferation and Stratification of Epidermal Keratinocytes.


    Park, Koog Chan; Lee, Minkyoung; Jeon, Yoon; Jeon, Raok; Baek, Sung Hee; Lee, Ho; Kim, Keun Il


    The Mis18 proteins (Mis18α, Mis18β, and M18BP1) are pivotal to the deposition of CENP-A at the centromere during cell cycle progression and are indispensable for embryonic development. Here, we show that Mis18α is critical for the proliferation of keratinocytes and stratification of the epidermis. Mice lacking Mis18α in the epidermis died shortly after birth, showing skin abnormalities like thin and translucent skin and defective skin barrier functions. The epidermis of newborn Mis18α-deficient mice lacked distinct stratification and mature hair follicles, with a reduction in the number of proliferating cells and increased cell death in the basal layer. Earlier expression of the Cre recombinase from keratin-14 promoter in the ventral region resulted in earlier keratinocyte death in the ventral part compared with the dorsal part in the absence of Mis18α, leading to more severe malformation of the ventral epidermal layers. As observed in Mis18α-deficient mouse keratinocytes, knockdown of Mis18α in HaCaT cells caused marked loss of centromeric CENP-A dots and chromosomal misalignment. Overall, we propose that Mis18α is important for epidermal cell proliferation and stratification, because it is required for the deposition of CENP-A at the centromeric nucleosomes.

  9. Hand hygiene and skin health.


    Kownatzki, E


    The high rate of hand problems associated with the hand hygiene of medical professions is due to a combination of damaging factors: (1) the removal of barrier lipids by detergent cleaning and alcohol antisepsis followed by a loss of moisturizers and stratum corneum water and (2) the overhydration of the stratum corneum by sweat trapped within gloves. Together the facilitate the invasion of irritants and allergens which elicit inflammatory responses in the dermis. Among the lipids and water-soluble substances removed are natural antibacterials. Their loss leads to increased growth of transient and pathogenic micro-organisms which jeapordizes the very intention of skin hygiene. The kinetics of damage and its repair, and epidemiological evidence suggest that modern synthetic detergents as used in foaming liquid cleansers are the major offender. Conversely, the replacement of detergents with non-detergent emulsion cleansers has been shown to be effective in reducing the prevalence of hand problems among hospital staff. Presently recommended hand antisepsis reduces the risks to patients, but puts the burden on the health care provider. Rather than fighting micro-organisms at the expense of the skin's health, the skin and its own defences should be considered a collaborator in combating infectious diseases.

  10. Estrogens and aging skin

    PubMed Central

    Thornton, M. Julie


    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity. Its protective function becomes compromised and aging is associated with impaired wound healing, hair loss, pigmentary changes and skin cancer.   Skin aging can be significantly delayed by the administration of estrogen. This paper reviews estrogen effects on human skin and the mechanisms by which estrogens can alleviate the changes due to aging. The relevance of estrogen replacement, selective estrogen receptor modulators (SERMs) and phytoestrogens as therapies for diminishing skin aging is highlighted. Understanding estrogen signaling in skin will provide a basis for interventions in aging pathologies. PMID:24194966

  11. Aspects on the physiology of human skin: studies using particle probe analysis.


    Forslind, B; Lindberg, M; Roomans, G M; Pallon, J; Werner-Linde, Y


    final differentiation step between the stratum granulosum level and the stratum corneum represents a particular aspect of programmed cell death. The importance of the balance between calcium and zinc in apoptosis has been clearly demonstrated in a number of cellular systems, but we have still to clarify the validity of topical treatment with Zn ointments in different skin conditions. Substantial iron (Fe) losses via psoriatic lesions were demonstrated more than two decades ago, and these data were given new meaning when we found that a more discrete loss occurs in clinically normal-looking psoriatic skin. Obviously, such findings stress the importance of understanding the relation between the elemental content and normal and abnormal physiology. The ultimate goal of particle probe studies is to provide an understanding of the formation of a mature stratum corneum with a functional barrier reflected in physiological/biochemical mechanisms behind the properties of changed skin in patients afflicted with skin disorders of genetic or constitutional origin. This paper aims to give an overview of the state of the art in skin physiology made possible through the use of particle probes.

  12. Effects of air pollution on the skin: A review.


    Puri, Poonam; Nandar, Shashi Kumar; Kathuria, Sushruta; Ramesh, V


    The increase in air pollution over the years has had major effects on the human skin. Various air pollutants such as ultraviolet radiation, polycyclic aromatic hydrocarbons, volatile organic compounds, oxides, particulate matter, ozone and cigarette smoke affect the skin as it is the outermost barrier. Air pollutants damage the skin by inducing oxidative stress. Although human skin acts as a biological shield against pro-oxidative chemicals and physical air pollutants, prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure to ultraviolet radiation has been associated with extrinsic skin aging and skin cancers. Cigarette smoke contributes to premature aging and an increase in the incidence of psoriasis, acne and skin cancers. It is also implicated in allergic skin conditions such as atopic dermatitis and eczema. Polyaromatic hydrocarbons are associated with extrinsic skin aging, pigmentation, cancers and acneiform eruptions. Volatile organic compounds have been associated with atopic dermatitis. Given the increasing levels of air pollution and its detrimental effects on the skin, it is advisable to use strategies to decrease air pollution.

  13. Papulopustular rosacea, skin immunity and Demodex: pityriasis folliculorum as a missing link.


    Forton, F M N


    Papulopustular rosacea (PPR) is a common facial skin disease, characterized by erythema, telangiectasia, papules and pustules. Its physiopathology is still being discussed, but recently several molecular features of its inflammatory process have been identified: an overproduction of Toll-Like receptors 2, of a serine protease, and of abnormal forms of cathelicidin. The two factors which stimulate the Toll-like receptors to induce cathelicidin expression are skin infection and cutaneous barrier disruption: these two conditions are, at least theoretically, fulfilled by Demodex, which is present in high density in PPR and creates epithelial breaches by eating cells. So, the major pathogenic mechanisms of Demodex and its role in PPR are reviewed here in the context of these recent discoveries. In this review, the inflammatory process of PPR appears to be a consequence of the proliferation of Demodex, and strongly supports the hypothesis that: (1) in the first stage a specific (innate or acquired) immune defect against Demodex allows the proliferation of the mite; (2) in the second stage, probably when some mites penetrate into the dermis, the immune system is suddenly stimulated and gives rise to an exaggerated immune response against the Demodex, resulting in the papules and the pustules of the rosacea. In this context, it would be very interesting to study the immune molecular features of this first stage, named "pityriasis folliculorum", where the Demodex proliferate profusely with no, or a low immune reaction from the host: this entity appears to be a missing link in the understanding of rosacea.

  14. Congenital abnormalities and selective abortion.


    Seller, M J


    The technique of amniocentesis, by which an abnormal fetus can be detected in utero, has brought a technological advance in medical science but attendant medical and moral problems. Dr Seller describes those congenital disabilities which can be detected in the fetus before birth, for which the "remedy" is selective abortion. She then discusses the arguments for and against selective abortion, for the issue is not simple, even in the strictly genetic sense of attempting to ensure a population free of congenital abnormality.

  15. Host-pathogen interactions between the skin and Staphylococcus aureus.


    Krishna, Sheila; Miller, Lloyd S


    Staphylococcus aureus is responsible for the vast majority of bacterial skin infections in humans. The propensity for S. aureus to infect skin involves a balance between cutaneous immune defense mechanisms and virulence factors of the pathogen. The tissue architecture of the skin is different from other epithelia especially since it possesses a corneal layer, which is an important barrier that protects against the pathogenic microorganisms in the environment. The skin surface, epidermis, and dermis all contribute to host defense against S. aureus. Conversely, S. aureus utilizes various mechanisms to evade these host defenses to promote colonization and infection of the skin. This review will focus on host-pathogen interactions at the skin interface during the pathogenesis of S. aureus colonization and infection.

  16. Natural and sun-induced aging of human skin.


    Rittié, Laure; Fisher, Gary J


    With worldwide expansion of the aging population, research on age-related pathologies is receiving growing interest. In this review, we discuss current knowledge regarding the decline of skin structure and function induced by the passage of time (chronological aging) and chronic exposure to solar UV irradiation (photoaging). Nearly every aspect of skin biology is affected by aging. The self-renewing capability of the epidermis, which provides vital barrier function, is diminished with age. Vital thermoregulation function of eccrine sweat glands is also altered with age. The dermal collagenous extracellular matrix, which comprises the bulk of skin and confers strength and resiliency, undergoes gradual fragmentation, which deleteriously impacts skin mechanical properties and dermal cell functions. Aging also affects wound repair, pigmentation, innervation, immunity, vasculature, and subcutaneous fat homeostasis. Altogether, age-related alterations of skin lead to age-related skin fragility and diseases.

  17. Natural and Sun-Induced Aging of Human Skin

    PubMed Central

    Rittié, Laure; Fisher, Gary J.


    With worldwide expansion of the aging population, research on age-related pathologies is receiving growing interest. In this review, we discuss current knowledge regarding the decline of skin structure and function induced by the passage of time (chronological aging) and chronic exposure to solar UV irradiation (photoaging). Nearly every aspect of skin biology is affected by aging. The self-renewing capability of the epidermis, which provides vital barrier function, is diminished with age. Vital thermoregulation function of eccrine sweat glands is also altered with age. The dermal collagenous extracellular matrix, which comprises the bulk of skin and confers strength and resiliency, undergoes gradual fragmentation, which deleteriously impacts skin mechanical properties and dermal cell functions. Aging also affects wound repair, pigmentation, innervation, immunity, vasculature, and subcutaneous fat homeostasis. Altogether, age-related alterations of skin lead to age-related skin fragility and diseases. PMID:25561721

  18. Barrier products in the treatment of incontinence-associated dermatitis.


    Lian, Yaping


    This article reviews contemporary primary research studies to establish the evidence supporting the use of barrier products and evaluate practice regarding their use in the acute hospital setting. Six primary research studies investigating the use of barrier products for preventing and managing incontinence-associated dermatitis were reviewed. The aim was to identify the most effective treatments for incontinence-associated dermatitis to enhance the quality of life of patients. The studies identified that there is no significant difference in efficacy between petrolatum, zinc oxide oil and a polymer-based barrier film, and that a polymer-based barrier film is more cost-effective than petrolatum or zinc oxide. However, further robust research studies are required to inform practice. The efficacy and cost-effectiveness of barrier products can be enhanced by providing education in clinical practice on consistent skin care regimens and effective use of barrier products.

  19. Mitochondrial dysfunction: a neglected component of skin diseases.


    Feichtinger, René G; Sperl, Wolfgang; Bauer, Johann W; Kofler, Barbara


    Aberrant mitochondrial structure and function influence tissue homeostasis and thereby contribute to multiple human disorders and ageing. Ten per cent of patients with primary mitochondrial disorders present skin manifestations that can be categorized into hair abnormalities, rashes, pigmentation abnormalities and acrocyanosis. Less attention has been paid to the fact that several disorders of the skin are linked to alterations of mitochondrial energy metabolism. This review article summarizes the contribution of mitochondrial pathology to both common and rare skin diseases. We explore the intriguing observation that a wide array of skin disorders presents with primary or secondary mitochondrial pathology and that a variety of molecular defects can cause dysfunctional mitochondria. Among them are mutations in mitochondrial- and nuclear DNA-encoded subunits and assembly factors of oxidative phosphorylation (OXPHOS) complexes; mutations in intermediate filament proteins involved in linking, moving and shaping of mitochondria; and disorders of mitochondrial DNA metabolism, fatty acid metabolism and heme synthesis. Thus, we assume that mitochondrial involvement is the rule rather than the exception in skin diseases. We conclude the article by discussing how improving mitochondrial function can be beneficial for aged skin and can be used as an adjunct therapy for certain skin disorders. Consideration of mitochondrial energy metabolism in the skin creates a new perspective for both dermatologists and experts in metabolic disease.

  20. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    PubMed Central

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.


    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (<20 cigarettes/day) or heavy smokers (≥20 cigarettes/day). An MPA5 was used to measure SC hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

  1. Overexposed: The Skin and the Sun

    PubMed Central

    Arlette, John P.


    Sunlight produces many changes on our skin. Some of these we appreciate as cosmetically important, and some we see as medically destructive. Changes such as the appearance of wrinkling and skin cancer can come from the long-term direct effects of solar radiation. The sun has indirect effects on the skin which are mediated by disease processes, medications, immune reactants, and biochemical abnormalities. Understanding the nature of sun, how it produces its changes, and the wide variety of these manifestations is an important part of medical practice. By understanding the nature of sunlight, we are able to protect ourselves from its effects and to treat our patients. ImagesFigure 2Figure 3Figure 4Figure 5 PMID:21263953

  2. Building Epithelial Tissues from Skin Stem Cells

    PubMed Central

    Fuchs, E.; Nowak, J.A.


    The skin epidermis and its appendages provide a protective barrier that guards against loss of fluids, physical trauma, and invasion by harmful microbes. To perform these functions while confronting the harsh environs of the outside world, our body surface undergoes constant rejuvenation through homeostasis. In addition, it must be primed to repair wounds in response to injury. The adult skin maintains epidermal homeostasis, hair regeneration, and wound repair through the use of its stem cells. What are the properties of skin stem cells, when do they become established during embryogenesis, and how are they able to build tissues with such remarkably distinct architectures? How do stem cells maintain tissue homeostasis and repair wounds and how do they regulate the delicate balance between proliferation and differentiation? What is the relationship between skin cancer and mutations that perturbs the regulation of stem cells? In the past 5 years, the field of skin stem cells has bloomed as we and others have been able to purify and dissect the molecular properties of these tiny reservoirs of goliath potential. We report here progress on these fronts, with emphasis on our laboratory’s contributions to the fascinating world of skin stem cells. PMID:19022769

  3. Puncture detecting barrier materials


    Hermes, R.E.; Ramsey, D.R.; Stampfer, J.F.; Macdonald, J.M.


    A method and apparatus for continuous real-time monitoring of the integrity of protective barrier materials, particularly protective barriers against toxic, radioactive and biologically hazardous materials has been developed. Conductivity, resistivity or capacitance between conductive layers in the multilayer protective materials is measured by using leads connected to electrically conductive layers in the protective barrier material. The measured conductivity, resistivity or capacitance significantly changes upon a physical breach of the protective barrier material. 4 figs.

  4. Puncture detecting barrier materials


    Hermes, Robert E.; Ramsey, David R.; Stampfer, Joseph F.; Macdonald, John M.


    A method and apparatus for continuous real-time monitoring of the integrity of protective barrier materials, particularly protective barriers against toxic, radioactive and biologically hazardous materials has been developed. Conductivity, resistivity or capacitance between conductive layers in the multilayer protective materials is measured by using leads connected to electrically conductive layers in the protective barrier material. The measured conductivity, resistivity or capacitance significantly changes upon a physical breach of the protective barrier material.

  5. Disruption of Supv3L1 damages the skin, and causes sarcopenia, loss of fat, and death

    PubMed Central

    Paul, Erin; Cronan, Rachel; Weston, Paula J.; Boekelheide, Kim; Sedivy, John M.; Lee, Sang-Yun; Wiest, David L.; Resnick, Murray B.; Klysik, Jan E.


    Supv3L1 is a conserved and ubiquitously expressed helicase found in numerous tissues and cell types of many species. In human cells, SUPV3L1 was shown to suppress apoptotic death, sister chromatid exchange, and impair mitochondrial RNA metabolism and protein synthesis. In vitro experiments revealed binding of SUPV3L1 to BLM and WRN proteins suggesting a role in genome maintenance processes. Disruption of the Supv3L1 gene in the mouse has been reported to be embryonic lethal at early developmental stages. We generated a conditional mouse in which the phenotypes associated with the removal of exon 14 can be tested in a variety of tissues. Disruption mediated by a Mx1 promoter-driven Cre displayed a postnatal growth delay, reduced life span, loss of adipose tissue, muscle mass, and severe skin abnormalities manifesting as ichthyosis, thickening of the epidermis, and atrophy of the dermis and subcutaneous tissue. Using a tamoxifen-activatable Esr1/Cre driver, Supv3L1 disruption resulted in growth retardation and aging phenotypes including loss of adipose tissue, muscle mass, kyphosis, cachexia and premature death. Many of the abnormalities seen in the Mx1-Cre mice, such as hyperkeratosis characterized by profound scaling of feet and tail, could also be detected in tamoxifen-inducible Cre mice. Conditional ablation of Supv3L1 in keratinocytes confirmed atrophic changes in the skin and ichthyosis-like changes. Together, these data indicate that Supv3L1 is important for the maintenance of the skin barrier. Additionally, loss of Supv3L1 function leads to accelerated aging-like phenotypes. PMID:19145458

  6. Skin care in nursing: A critical discussion of nursing practice and research.


    Kottner, Jan; Surber, Christian


    Skin (self-)care is part of human life from birth until death. Today many different skin care practices, preferences, traditions and routines exist in parallel. In addition, preventive and therapeutic skin care is delivered in nursing and healthcare by formal and informal caregivers. The aim of this contribution is a critical discussion about skin care in the context of professional nursing practice. An explicit skin assessment using accurate diagnostic statements is needed for clinical decision making. Special attention should be paid on high risk skin areas, which may be either too dry or too moist. From a safety perspective the protection and maintenance of skin integrity should have the highest priority. Skin cleansing is the removal of unwanted substances from the skin surface. Despite cleansing efficacy soap, other surfactants and water will inevitably always result in the destruction of the skin barrier. Thousands of products are available to hydrate, moisturize, protect and restore skin properties dependent upon their formulation and the concentration of ingredients. These products intended to left in contact with skin exhibit several actions on and in the skin interfering with skin biology. Unwanted side effects include hyper-hydration and disorganization of lipid bilayers in the stratum corneum, a dysfunctional barrier, increased susceptibility to irritants and allergies, and increases of skin surface pH. Where the skin barrier is impaired appropriate interventions, e.g. apply lipophilic products in sufficient quantity to treat dry skin or protect the skin from exposure to irritants should be provided. A key statement of this contribution is: every skin care activity matters. Every time something is placed on the skin, a functional and structural response is provoked. This response can be either desired or undesired, beneficial or harmful. The choice of all skin care interventions in nursing and healthcare practice must be based on an accurate assessment

  7. [Diagnosticum of abnormalities of plant meiotic division].


    Shamina, N V


    Abnormalities of plant meiotic division leading to abnormal meiotic products are summarized schematically in the paper. Causes of formation of monads, abnormal diads, triads, pentads, polyads, etc. have been observed in meiosis with both successive and simultaneous cytokinesis.

  8. Vehicle influence on permeation through intact and compromised skin.


    Gujjar, Meera; Banga, Ajay K


    The purpose of this study was to compare the transdermal permeation of a model compound, diclofenac diethylamine, from a hydrophilic and lipophilic vehicle across in vitro models simulating compromised skin. Mineral oil served as a lipophilic vehicle while 10mM phosphate buffered saline served as a hydrophilic vehicle. Compromised skin was simulated by tape stripping, delipidization, or microneedle application and compared with intact skin as a control. Transepidermal water loss was measured to assess barrier function. Skin compromised with tape stripping and delipidization significantly (p<0.05) increased permeation of diclofenac diethylamine compared to intact and microneedle treated skin with phosphate buffered saline vehicle. A similar trend in permeation was observed with mineral oil as the vehicle. For both vehicles, permeation across skin increased in the same order and correlated with degree of barrier impairment as indicated by transepidermal water loss values: intactskin compared to mineral oil vehicle for all simulated models of compromised skin.

  9. Radiation therapy - skin care


    ... numbness Skin sores Most of these symptoms will go away after your treatments have stopped. However, your skin may remain darker, drier, and more sensitive to the sun. When your hair grows back, it may be different than before.

  10. Squamous cell skin cancer


    ... occur on skin that is regularly exposed to sunlight or other ultraviolet radiation. The earliest form of ... skin cancer is to reduce your exposure to sunlight . Always use sunscreen: Apply sunscreen with sun protection ...

  11. Components of skin

    MedlinePlus Videos and Cool Tools

    ... skin layers from the outside environment and contains cells that make keratin, a substance that waterproofs and strengthens the skin. The epidermis also has cells that contain melanin, the dark pigment that gives ...

  12. Skin, Hair, and Nails


    ... thousands of cells and hundreds of sweat glands, oil glands, nerve endings, and blood vessels. Skin is ... empty into hair follicles and pores, produce the oil sebum that lubricates the skin and hair. Sebaceous ...

  13. Bleeding into the skin


    Protect aging skin. Avoid trauma such as bumping or pulling on skin areas. For a cut or scrape, use direct pressure to stop the bleeding. If you have a drug reaction, ask your provider about stopping the drug. Otherwise, follow ...

  14. Bacterial Skin Infections


    ... Diseases Take Big Slice Out of America's Health, Economy (News) Health Tip: Use Caution When Applying Hair Dye Additional ... Skin Diseases Take Big Slice Out of America's Health, Economy THURSDAY, March 2, 2017 (HealthDay News) -- Skin diseases ...

  15. Necrotizing Skin Infections


    ... Diseases Take Big Slice Out of America's Health, Economy (News) Health Tip: Use Caution When Applying Hair Dye Additional ... Skin Diseases Take Big Slice Out of America's Health, Economy THURSDAY, March 2, 2017 (HealthDay News) -- Skin diseases ...

  16. Neuromodulators for Aging Skin


    ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ...

  17. PPD skin test


    ... is a method used to diagnose silent (latent) tuberculosis (TB) infection. PPD stands for purified protein derivative. ... skin test; Tuberculin skin test; Mantoux test Images Tuberculosis in the kidney Tuberculosis in the lung Positive ...

  18. Examine Your Skin

    MedlinePlus Videos and Cool Tools

    ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... video. UPDATED: November 23, 2016 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ...

  19. The Barriers Project.

    ERIC Educational Resources Information Center

    Confederation Coll. of Applied Arts and Technology, Thunder Bay (Ontario).

    In 1987, the Barriers Project was initiated by Confederation College of Applied Arts and Technology to engage 31 selected community colleges in Canada in an organized self-appraisal of institutional barriers to the enrollment of part-time credit students. From the outset, colleges were encouraged to limit their investigation to barriers over which…

  20. In vivo skin treatment with tissue-tolerable plasma influences skin physiology and antioxidant profile in human stratum corneum.


    Fluhr, Joachim W; Sassning, Sven; Lademann, Olaf; Darvin, Maxim E; Schanzer, Sabine; Kramer, Axel; Richter, Heike; Sterry, Wolfram; Lademann, Juergen


    The antimicrobial treatment of wounds is still a major problem. Tissue-tolerable electrical plasma (TTP) is a new approach for topical microbial disinfection of the skin surface. The aim of the present study was to investigate the influence of TTP on a carotenoid profile in relation to skin physiology parameters (epidermal barrier function, stratum corneum (SC) hydration, surface temperature and irritation parameters). We were interested in the interaction of TTP and the antioxidative network, as well as the consequences for skin physiology parameters. These parameters are also indicative of TTP safety in vivo. For plasma application, 'Kinpen 09' was used (surface exposure 30-43°C) for 3 s. Beta-carotene and water profiles were assessed by in vivo Raman microspectroscopy (skin composition analyzer 3510). Skin physiology parameters were measured with Tewameter TM 300, Corneometer CM 825, skin thermometer and Chromameter CR 300. All parameters were assessed non-invasively on seven healthy volunteers before and after plasma application in vivo. We could show that TTP application leads to a decrease in beta-carotene especially in the superficial SC. Skin-surface temperature increased by 1.74°C, while the transepidermal water loss (TEWL) increase indicated an impaired barrier function. SC hydration decreased as seen in water profile especially in the superficial layers and capacitance values. A slight increase in skin redness was measurable. The induction of reactive oxygen species is probably the major contributor of TTP efficacy in skin disinfection. Skin physiology parameters were influenced without damaging the skin or skin functions, indicating the safety of TTP under in vivo conditions.

  1. Measurement of diffusion of fluorescent compounds and autofluorescence in skin in vivo using a confocal instrument

    NASA Astrophysics Data System (ADS)

    Buttenschoen, K. K.; Sutton, E. E.; Daly, D.; Girkin, J. M.


    Using compact and affordable instrumentation based upon fluorescent confocal imaging we have tracked the movement of autofluorescent compounds through skin in near real time with high temporal and spatial resolution and sensitivity. The ability to measure the diffusion of compounds through skin with such resolution plays an important role for applications such as monitoring the penetration of pharmaceuticals applied to skin and assessing the integrity of the skin barrier. Several measurement methods exist, but they suffer from a number of problems such as being slow, expensive, non-portable and lacking sensitivity. To address these issues, we adapted a technique that we previously developed for tracking fluorescent compounds in the eye to measure the autofluorescence and the diffusion of externally applied fluorescent compounds in skin in vivo. Results are presented that show the change in autofluorescence of the volar forearm over the course of a week. We furthermore demonstrate the ability of the instrument to measure the diffusion speed and depth of externally applied fluorescent compounds both in healthy skin and after the skin barrier function has been perturbed. The instrument is currently being developed further for increased sensitivity and multi-wavelength excitation. We believe that the presented instrument is suitable for a large number of applications in fields such as assessment of damage to the skin barrier, development of topical and systemic medication and tracking the diffusion of fluorescent compounds through skin constructs as well as monitoring effects of skin products and general consumer products which may come into contact with the skin.

  2. Immunology and Skin in Health and Disease

    PubMed Central

    Richmond, Jillian M.; Harris, John E.


    The skin is a complex organ that, in addition to providing a strong barrier against external insults, serves as an arena for a wide variety of inflammatory processes, including immunity against infections, tumor immunity, autoimmunity, and allergy. A variety of cells collaborate to mount functional immune responses, which are initiated by resident populations and evolve through the recruitment of additional cell populations to the skin. Inflammatory responses are quite diverse, resulting in a wide range of signs and symptoms that depend on the initiating signals, characteristics of the infiltrating cell populations, and cytokines that are produced (cytokines are secreted protein that allows for cell–cell communication; usually refers to communication between immune–immune cells or stromal–immune cells). In this work, we will review the skin architecture and resident and recruited cell populations and discuss how these populations contribute to inflammation using human diseases and treatments when possible to illustrate their importance within a clinical context. PMID:25452424

  3. Ultrasound skin imaging.


    Alfageme Roldán, F


    The interaction of high-frequency ultrasound waves with the skin provides the basis for noninvasive, fast, and accessible diagnostic imaging. This tool is increasingly used in skin cancer and inflammatory conditions as well as in cosmetic dermatology. This article reviews the basic principles of skin ultrasound and its applications in the different areas of dermatology.

  4. Skin self-exam


    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Cancer Institute. What You Need To Know About Melanoma and Other Skin Cancers: How To Check Your ...

  5. Psychoneuroimmunology and the Skin.


    Honeyman, Juan F


    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  6. Biology of Skin Color.

    ERIC Educational Resources Information Center

    Corcos, Alain


    Information from scientific journals on the biology of skin color is discussed. Major areas addressed include: (1) biology of melanin, melanocytes, and melanosomes; (2) melanosome and human diversity; (3) genetics of skin color; and (4) skin color, geography, and natural selection. (JN)

  7. Prevention and management of incontinence-associated dermatitis using a barrier cream.


    Holroyd, Sharon; Graham, Katriona


    Incontinence-associated dermatitis (IAD) is a common skin disorder affecting patients with urinary and/or faecal incontinence. Maintaining the skin's integrity is a challenge, particularly in the elderly and individuals with medical or surgical comorbidities. It is widely reported that the issue is complex and recognition is inconsistent, with symptoms often being confused with those of pressure ulcers. This article explores the causes of IAD, looking at the structure of healthy skin and the pathology that occurs during skin breakdown. It identifies risk factors and prevention and management strategies, including the use of barrier creams. The article then presents the results of a large product evaluation that took place with Cavilon Durable Barrier Cream (3M). The barrier cream was shown to be more effective in treating and managing patients with IAD than the previous product that patients had been using. A case study is also included to demonstrate the efficacy of the newest version of Cavilon Durable Barrier Cream.

  8. Extremal surface barriers

    NASA Astrophysics Data System (ADS)

    Engelhardt, Netta; Wall, Aron C.


    We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy.

  9. Anyone Can Get Skin Cancer

    No matter if your skin is light, dark, or somewhere in between, everyone is at risk for skin cancer. Learn what skin cancer looks like, how to find it early, and how to lower the chance of skin cancer.

  10. Abnormal insulin levels and vertigo.


    Proctor, C A


    Fifty patients with unexplained vertigo (36) or lightheadedness (14) are evaluated, all of whom had abnormal ENGs and normal audiograms. Five hour insulin glucose tolerance tests were performance on all patients, with insulin levels being obtained fasting and at one-half, one, two, and three hours. The results of this investigation were remarkable. Borderline or abnormal insulin levels were discovered in 82% of patients; 90% were found to have either an abnormal glucose tolerance test or at least borderline insulin levels. The response to treatment in these dizzy patients was also startling, with appropriate low carbohydrate diets improving the patient's symptoms in 90% of cases. It is, therefore, apparent that the earliest identification of carbohydrate imbalance with an insulin glucose tolerance test is extremely important in the work-up of the dizzy patients.

  11. Complex patterns of abnormal heartbeats

    NASA Technical Reports Server (NTRS)

    Schulte-Frohlinde, Verena; Ashkenazy, Yosef; Goldberger, Ary L.; Ivanov, Plamen Ch; Costa, Madalena; Morley-Davies, Adrian; Stanley, H. Eugene; Glass, Leon


    Individuals having frequent abnormal heartbeats interspersed with normal heartbeats may be at an increased risk of sudden cardiac death. However, mechanistic understanding of such cardiac arrhythmias is limited. We present a visual and qualitative method to display statistical properties of abnormal heartbeats. We introduce dynamical "heartprints" which reveal characteristic patterns in long clinical records encompassing approximately 10(5) heartbeats and may provide information about underlying mechanisms. We test if these dynamics can be reproduced by model simulations in which abnormal heartbeats are generated (i) randomly, (ii) at a fixed time interval following a preceding normal heartbeat, or (iii) by an independent oscillator that may or may not interact with the normal heartbeat. We compare the results of these three models and test their limitations to comprehensively simulate the statistical features of selected clinical records. This work introduces methods that can be used to test mathematical models of arrhythmogenesis and to develop a new understanding of underlying electrophysiologic mechanisms of cardiac arrhythmia.

  12. Vitamin D in the skin physiology and pathology.


    Piotrowska, Anna; Wierzbicka, Justyna; Żmijewski, Michał A


    Vitamin D plays important, pleiotropic role in the maintenance of global homeostasis. Its influence goes far beyond the regulation of calcium and phosphorus balance, as diverse activities of vitamin D and its natural metabolites assure proper functioning of major human organs, including skin. Recently, we reviewed the current understanding of vitamin D impact on human health from historical perspective (Wierzbicka et al. (2014) The renaissance of vitamin D. Acta Biochim Pol 61: 679-686). This article focuses on its functions in the skin. The skin and its appendages, creates a platform connecting and protecting internal organs against, usually harmful, external environment. It uppermost layer - epidermis in order to maintain a protective barrier undergoes a constant exchange of cornified keratinocytes layer. Its disturbance leads to development of serious skin disorders including psoriasis, vitiligo, atopic dermatitis and skin cancer. All of those dermatopathologies have a huge impact on modern societies, affecting not only the physical, but also mental state of patients as well as their social status. Furthermore, multiple human systemic diseases (autoimmune, blood and digestive diseases) have skin manifestation, thus "condition of the skin" often reflects the condition and pathological changes within the internal organs. In humans, the skin is the natural source of vitamin D, which is produced locally from 7-dehydrocholesterol in photoreaction induced by ultraviolet B (UVB) radiation from the sun. It is also well established, that the process of proliferation and differentiation of keratinocytes is tightly regulated by calcium and the active form of vitamin D (1,25(OH)2D3). Thus, the skin physiology is inseparably connected with vitamin D production and activity. Unfortunately, UVB, which is required for vitamin D production, is also known as the main cause of a skin cancer, including melanoma. Here, we are going to review benefits of vitamin D and its analogues

  13. Surface Dielectric Barrier Discharge Jet for Skin Disinfection

    NASA Astrophysics Data System (ADS)

    Creyghton, Yves; Meijer, Rogier; Verweij, Paul; van der Zanden, Frank; Leenders, Paul

    A consortium consisting of the research institute TNO, the medical ­university and hospital St Radboud and two industrial enterprises is working on a non-thermal plasma treatment method for hand disinfection. The group is seeking for cooperation, in particular in the field of validation methods and potential ­standardization for plasma based disinfection procedures. The present paper describes technical progress in plasma source development together with initial microbiological data. Particular properties of the sheet shaped plasma volume are the possibility of treating large irregular surfaces in a short period of time, effective plasma produced species transfer to the surface together with high controllability of the nature of plasma species by means of temperature conditioning.

  14. Ectodermal dysplasia and abnormal thumbs.


    Lucky, A W; Esterly, N B; Tunnessen, W W


    Two unrelated children, a girl and a boy, with alopecia, anomalous cutaneous pigmentation, abnormal thumbs, and endocrine disorders, including short stature and delayed bone age in one patient and juvenile onset diabetes mellitus in the other, are described. In one instance, the mother and the maternal grandmother had similar abnormalities, although of a less severe nature. Both children had normal nails and no unusual susceptibility to infections. We believe these two patients represent a previously undescribed syndrome of ectodermal dysplasia that may be inherited as an autosomal-dominant trait.

  15. Immediate or early skin-to-skin contact after a Caesarean section: a review of the literature.


    Stevens, Jeni; Schmied, Virginia; Burns, Elaine; Dahlen, Hannah


    The World Health Organization and the United Nations International Children's Emergency Fund recommends that mothers and newborns have skin-to-skin contact immediately after a vaginal birth, and as soon as the mother is alert and responsive after a Caesarean section. Skin-to-skin contact can be defined as placing a naked infant onto the bare chest of the mother. Caesarean birth is known to reduce initiation of breastfeeding, increase the length of time before the first breastfeed, reduce the incidence of exclusive breastfeeding, significantly delay the onset of lactation and increase the likelihood of supplementation. The aim of this review is to evaluate evidence on the facilitation of immediate (within minutes) or early (within 1 h) skin-to-skin contact following Caesarean section for healthy mothers and their healthy term newborns, and identify facilitators, barriers and associated maternal and newborn outcomes. A range of electronic databases were searched for papers reporting research findings published in English between January 2003 and October 2013. Seven papers met the criteria. This review has provided some evidence that with appropriate collaboration skin-to-skin contact during Caesarean surgery can be implemented. Further evidence was provided, albeit limited, that immediate or early skin-to-skin contact after a Caesarean section may increase breastfeeding initiation, decrease time to the first breastfeed, reduce formula supplementation in hospital, increase bonding and maternal satisfaction, maintain the temperature of newborns and reduce newborn stress.

  16. Near-IR fluorescence and reflectance confocal microscopy for imaging of quantum dots in mammalian skin

    PubMed Central

    Mortensen, Luke J.; Glazowski, Christopher E.; Zavislan, James M.; DeLouise, Lisa A.


    Understanding the skin penetration of nanoparticles (NPs) is an important concern due to the increasing presence of NPs in consumer products, including cosmetics. Technical challenges have slowed progress in evaluating skin barrier and NP factors that contribute to skin penetration risk. To limit sampling error and other problems associated with histological processing, many researchers are implementing whole tissue confocal or multiphoton microscopies. This work introduces a fluorescence and reflectance confocal microscopy system that utilizes near-IR excitation and emission to detect near-IR lead sulfide quantum dots (QDs) through ex vivo human epidermis. We provide a detailed prediction and experimental analysis of QD detection sensitivity and demonstrate detection of QD skin penetration in a barrier disrupted model. The unique properties of near-IR lead-based QDs will enable future studies that examine the impact of further barrier-disrupting agents on skin penetration of QDs and elucidate mechanistic insight into QD tissue interactions at the cellular level. PMID:21698023

  17. Sensitive skin: an overview.


    Inamadar, Arun C; Palit, Aparna


    Sensitive skin is less tolerant to frequent and prolonged use of cosmetics and toiletries. It is self-diagnosed and typically unaccompanied by any obvious physical signs of irritation. With the change in lifestyle and also with increased opportunity to use many new brands of cosmetics and toiletries, there has been an increase in females complaining of unique sensation in their facial skin. Sensitive skin presents as smarting, burning, stinging, itching, and/or tight sensation in their facial skin. The condition is found in more than 50% of women and 40% of men, creating a sizable demand for products designed to minimize skin sensitivity. Good numbers of invasive and non-invasive tests are designed to evaluate and predict the sensitive skin. Management includes guidelines for selecting suitable cosmetics and toiletries in sensitive skin individuals.

  18. Pursuing prosthetic electronic skin

    NASA Astrophysics Data System (ADS)

    Chortos, Alex; Liu, Jia; Bao, Zhenan


    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals.

  19. [Skin diseases and obesity].


    Guerra-Segovia, Carolina; Ocampo-Candiani, Jorge


    Obesity is a public health problem worldwide. It predominates in industrialized countries; however, it is prevalent in all nations. It is defined as a condition of excess adipose tissue and is the result of changes in lifestyle, excessive consumption of energy-dense foods with poor nutritional value, physical inactivity and the reduction of open space where one can practice a sport. Although obesity is associated with multiple diseases, it is important to stress that the metabolic changes caused by it affect skin physiology and play a predisposing factor for the development of skin diseases. Very little has been studied on the impact of obesity on the skin. The purpose of this article is to review the most frequently skin diseases in obesity. Some skin pathologies in obesity are caused by changes in skin physiology, others are related to insulin resistance or constitute an exacerbating factor for dermatitis. This article covers the clinical features of obesity related skin disease and its management.

  20. Clinical approaches to skin cleansing of the diaper area: practice and challenges.


    Coughlin, Carrie C; Frieden, Ilona J; Eichenfield, Lawrence F


    Cleansing and care of the diaper area require special consideration to maintain barrier function of the skin in this area and repair the barrier when it is compromised. Diaper dermatitis occurs commonly; understanding and modification of predisposing factors are imperative for caregivers. In this paper, we review important factors in diaper area care, including skin pH, the local microbiome, irritant and allergic potential of contactants, and application of topical agents.

  1. The important role of stratum corneum lipids for the cutaneous barrier function.


    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A


    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias.

  2. Prevention of Cutaneous Penetration and CD1c+ Uptake of Pollen Allergens by a Barrier-Enhancing Formulation.


    Meinke, Martina Claudia; Schanzer, Sabine; Richter, Heike; Rippke, Frank; Filbry, Alexander; Bohnsack, Kerstin; Patzelt, Alexa; Lademann, Jürgen


    Recent studies have shown that pollen proteins can penetrate the impaired skin barrier of atopic patients and exacerbate their disease. In the presented study the effect of a topically applied barrier-enhancing formulation was investigated for its preventive effect on the uptake of pollen allergens into CD1c+ epidermal cells. The pollen proteins were fluorescence labelled and applied on barrier-disrupted excised human skin. CD1c+ cells were selected after magnetic cell sorting and analysed using laser scanning microscopy. In untreated disrupted skin, 81% of the CD1c+ cells contained the fluorescence-labelled pollen allergens. In formulation-pretreated skin only 12% of the CD1c+ cells showed an uptake of pollen allergens. These results encourage the treatment of atopic patients with barrier-enhancing formulations to reduce the impact of pollen on air-exposed skin areas and hence the exacerbation of cutaneous symptoms.

  3. Normal and abnormal US findings at the mastectomy site.


    Kim, Sun Mi; Park, Jeong Mi


    Evaluation of a mastectomy site is more effective with ultrasonography (US) than with either mammography or chest computed tomography because abnormalities are usually small and close to the skin surface. US does not involve the use of ionizing radiation and has a multiplanar scanning capability. The technique is readily available and inexpensive, and it allows real-time monitoring of needle tip placement during biopsy of a lesion. Normal US anatomy of the chest wall after mastectomy usually consists of four layers: skin, subcutaneous fat, pectoral muscles, and rib and intercostal muscle. The axilla is changed in appearance after lymph node dissection, but it remains the same in patients who have undergone simple mastectomy. US can accurately depict benign and malignant conditions in the mastectomy site, including fluid collection, fibrosis, local recurrent tumor, and metastatic lymphadenopathy, and can enable accurate diagnosis based on findings at fine needle aspiration biopsy.

  4. Vestibular abnormalities in congenital disorders.


    Sando, I; Orita, Y; Miura, M; Balaban, C D


    This paper reviews the histopathologic features of vestibular abnormalities in congenital disorders affecting the inner ear, based upon a comprehensive literature survey and a review of cases in our temporal bone collection. The review proceeds in three systematic steps. First, we surveyed associated diseases with the major phenotypic features of congenital abnormalities of the inner ear (including the internal auditory canal and otic capsule). Second, the vestibular anomalies are examined specifically. Finally, the anomalies are discussed from a developmental perspective. Among vestibular anomalies, a hypoplastic endolymphatic duct and sac are observed most frequently. Anomalies of the semicircular canals are also often observed. From embryological and clinical viewpoints, many of these resemble the structural features from fetal stages and appear to be associated with vestibular dysfunction. It is expected that progress in genetic analysis and accumulation of temporal bone specimens with vestibular abnormalities in congenital diseases will provide crucial information not only for pathology of those diseases, but also for genetic factors that are responsible for the specific vestibular abnormalities.

  5. Abnormal pigmentation within cutaneous scars: A complication of wound healing

    PubMed Central

    Chadwick, Sarah; Heath, Rebecca; Shah, Mamta


    Abnormally pigmented scars are an undesirable consequence of cutaneous wound healing and are a complication every single individual worldwide is at risk of. They present a challenge for clinicians, as there are currently no definitive treatment options available, and render scars much more noticeable making them highly distressing for patients. Despite extensive research into both wound healing and the pigment cell, there remains a scarcity of knowledge surrounding the repigmentation of cutaneous scars. Pigment production is complex and under the control of many extrinsic and intrinsic factors and patterns of scar repigmentation are unpredictable. This article gives an overview of human skin pigmentation, repigmentation following wounding and current treatment options. PMID:23162241

  6. Skin stem cells: rising to the surface.


    Fuchs, Elaine


    The skin epidermis and its appendages provide a protective barrier that is impermeable to harmful microbes and also prevents dehydration. To perform their functions while being confronted with the physicochemical traumas of the environment, these tissues undergo continual rejuvenation through homeostasis, and, in addition, they must be primed to undergo wound repair in response to injury. The skin's elixir for maintaining tissue homeostasis, regenerating hair, and repairing the epidermis after injury is its stem cells, which reside in the adult hair follicle, sebaceous gland, and epidermis. Stem cells have the remarkable capacity to both self-perpetuate and also give rise to the differentiating cells that constitute one or more tissues. In recent years, scientists have begun to uncover the properties of skin stem cells and unravel the mysteries underlying their remarkable capacity to perform these feats. In this paper, I outline the basic lineages of the skin epithelia and review some of the major findings about mammalian skin epithelial stem cells that have emerged in the past five years.

  7. Atopic dermatitis and skin allergies - update and outlook.


    Wollenberg, A; Feichtner, K


    During the last few years, an impressive amount of experimental studies and clinical trials have dealt with a variety of distinct topics in allergic skin diseases - especially atopic dermatitis. In this update, we discuss selected recent data that provide relevant insights into clinical and pathophysiological aspects of allergic skin diseases or discuss promising targets and strategies for the future treatment of skin allergy. This includes aspects of barrier malfunction and inflammation as well as the interaction of the cutaneous immune system with the skin microbiome and diagnostic procedures for working up atopic dermatitis patients. Additionally, contact dermatitis, urticaria, and drug reactions are addressed in this review. This update summarizes novel evidence, highlighting current areas of uncertainties and debates that will stimulate scientific discussions and research activities in the field of atopic dermatitis and skin allergies in the future.

  8. Influence of polyphenols on the physiological processes in the skin.


    Ratz-Łyko, Anna; Arct, Jacek; Majewski, Sławomir; Pytkowska, Katarzyna


    In the last decade antioxidants from a group of polyphenols have been proposed as one of the most effective functional ingredients of anti-ageing properties that counteract the effects of oxidative damage to the skin. It has been shown that the use of polyphenols affects skin protection and mitigates inflammatory conditions of the skin. Numerous studies have confirmed that polyphenols by neutralizing free radicals, antioxidant activity and by their ability to chelate ions of transition metals can effectively reduce the level of nonprotein inflammatory mediators. The biological activity of polyphenols in the skin is primarily determined by their physicochemical properties and the ability to overcome the epidermal barrier as they try to reach appropriate receptors. This study reviews literature on the effects of polyphenols relating to the physiological processes in the skin and role of the major plant polyphenols in cosmetology and dermatology.

  9. Retinoids suppress cysteine-rich protein 61 (CCN1), a negative regulator of collagen homeostasis, in skin equivalent cultures and aged human skin in vivo.


    Quan, Taihao; Qin, Zhaoping; Shao, Yuan; Xu, Yiru; Voorhees, John J; Fisher, Gary J


    Alterations in connective tissue collagen are prominent features of both chronologically aged and photoaged (ageing because of sun exposure) human skin. These age-related abnormalities are mediated in part by cysteine-rich protein 61 (CCN1). CCN1 is elevated in the dermis of both chronologically aged and photoaged human skin in vivo and promotes aberrant collagen homeostasis by down-regulating type I collagen, the major structural protein in skin, and promoting collagen degradation. Vitamin A and its metabolites have been shown to improve chronologically aged and photoaged skin by promoting deposition of new collagen and preventing its degradation. Here, we investigated regulation of CCN1 expression by retinoids in skin equivalent cultures and chronologically aged and photoaged human skin in vivo. In skin equivalent cultures, all-trans retinoic acid (RA), the major bioactive form of vitamin A in skin, significantly increased type I procollagen and reduced collagenase (matrix metalloproteinases-1, MMP-1). Addition of recombinant human CCN1 to skin equivalent cultures significantly reduced type I procollagen and increased MMP-1. Importantly, RA significantly reduced CCN1 expression in skin equivalent cultures. Topical treatment with retinol (vitamin A, 0.4%) for 7days significantly reduced CCN1 mRNA and protein expression in both chronologically aged (80+years) and photoaged human skin in vivo, compared to vehicle-treated skin. These data indicate that the mechanism by which retinoids improve aged skin, through increased collagen production, involves down-regulation of CCN1.

  10. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.


    Hsiao, Elaine Y; McBride, Sara W; Hsien, Sophia; Sharon, Gil; Hyde, Embriette R; McCue, Tyler; Codelli, Julian A; Chow, Janet; Reisman, Sarah E; Petrosino, Joseph F; Patterson, Paul H; Mazmanian, Sarkis K


    Neurodevelopmental disorders, including autism spectrum disorder (ASD), are defined by core behavioral impairments; however, subsets of individuals display a spectrum of gastrointestinal (GI) abnormalities. We demonstrate GI barrier defects and microbiota alterations in the maternal immune activation (MIA) mouse model that is known to display features of ASD. Oral treatment of MIA offspring with the human commensal Bacteroides fragilis corrects gut permeability, alters microbial composition, and ameliorates defects in communicative, stereotypic, anxiety-like and sensorimotor behaviors. MIA offspring display an altered serum metabolomic profile, and B. fragilis modulates levels of several metabolites. Treating naive mice with a metabolite that is increased by MIA and restored by B. fragilis causes certain behavioral abnormalities, suggesting that gut bacterial effects on the host metabolome impact behavior. Taken together, these findings support a gut-microbiome-brain connection in a mouse model of ASD and identify a potential probiotic therapy for GI and particular behavioral symptoms in human neurodevelopmental disorders.

  11. Multilayer moisture barrier


    Pankow, Joel W; Jorgensen, Gary J; Terwilliger, Kent M; Glick, Stephen H; Isomaki, Nora; Harkonen, Kari; Turkulainen, Tommy


    A moisture barrier, device or product having a moisture barrier or a method of fabricating a moisture barrier having at least a polymer layer, and interfacial layer, and a barrier layer. The polymer layer may be fabricated from any suitable polymer including, but not limited to, fluoropolymers such as polyethylene terephthalate (PET) or polyethylene naphthalate (PEN), or ethylene-tetrafluoroethylene (ETFE). The interfacial layer may be formed by atomic layer deposition (ALD). In embodiments featuring an ALD interfacial layer, the deposited interfacial substance may be, but is not limited to, Al.sub.2O.sub.3, AlSiO.sub.x, TiO.sub.2, and an Al.sub.2O.sub.3/TiO.sub.2 laminate. The barrier layer associated with the interfacial layer may be deposited by plasma enhanced chemical vapor deposition (PECVD). The barrier layer may be a SiO.sub.xN.sub.y film.

  12. Barriers to screening mammography.


    Sarma, Elizabeth A


    Breast cancer (BRCA) is the second most commonly diagnosed cancer among women in the USA, and mammography is an effective means for the early detection of BRCA. Identifying the barriers to screening mammography can inform research, policy and practice aiming to increase mammography adherence. A literature review was conducted to determine common barriers to screening mammography adherence. PsycINFO and PubMed databases were searched to identify studies published between 2000 and 2012 that examined barriers associated with reduced mammography adherence. Three thematic groups of barriers, based on social ecology, were identified from the literature: healthcare system-level, social and individual-level barriers. Researchers must consider screening behaviour in context and, therefore, should simultaneously consider each level of barriers when attempting to understand screening behaviour and create interventions to increase mammography adherence.

  13. Abnormal Neuroimaging in a Case of Infant Botulism.


    Good, Ryan J; Messacar, Kevin; Stence, Nicholas V; Press, Craig A; Carpenter, Todd C


    We present the first case of abnormal neuroimaging in a case of infant botulism. The clinical findings of the patient with constipation, bulbar weakness, and descending, symmetric motor weakness are consistent with the classic findings of infant botulism. Magnetic resonance imaging (MRI), however, revealed restricted diffusion in the brain and enhancement of the cervical nerve roots. Traditionally, normal neuroimaging was used to help differentiate infant botulism from other causes of weakness in infants. Abnormal neuroimaging is seen in other causes of weakness in an infant including metabolic disorders and hypoxic-ischemic injury, but these diagnoses did not fit the clinical findings in this case. The explanation for the MRI abnormalities in the brain and cervical nerve roots is unclear as botulinum toxin acts at presynaptic nerve terminals and does not cross the blood-brain barrier. Possible explanations for the findings include inflammation from the botulinum toxin at the synapse, alterations in sensory signaling and retrograde transport of the botulinum toxin. The patient was treated with human botulism immune globulin and had rapid recovery in weakness. A stool sample from the patient was positive for Type A Clostridium botulinum toxin eventually confirming the diagnosis of infant botulism. The findings in this case support use of human botulism immune globulin when the clinical findings are consistent with infant botulism despite the presence of MRI abnormalities in the brain and cervical nerve roots.

  14. Effects of glycerol on human skin damaged by acute sodium lauryl sulphate treatment.


    Atrux-Tallau, Nicolas; Romagny, Céline; Padois, Karine; Denis, Alain; Haftek, Marek; Falson, Françoise; Pirot, Fabrice; Maibach, Howard I


    Glycerol, widely used as humectant, is known to protect against irritants and to accelerate recovery of irritated skin. However, most studies were done with topical formulations (i.e. emulsions) containing glycerol in relatively high amounts, preventing drawing conclusions from direct effects. In this study, acute chemical irritations were performed on the forearm with application of a 10% sodium lauryl sulphate (SLS) aqueous solution under occlusion for 3 h. Then, glycerol aqueous solutions from 1 to 10% were applied under occlusion for 3 h. After elimination of moist excess consecutive to occlusive condition, in ambient air for 15 and 30 min, skin barrier function was investigated by dual measurement of skin hydration and transepidermal water loss (TEWL). Treatments with SLS solution under occlusion significantly increased TEWL and decreased skin hydration as assessed by capacitance measurements. The SLS irritant property was raised by the occlusion and the water barrier function as well as water content appeared impaired. Recovery with glycerol at low doses was remarkable through a mechanism that implies its hygroscopic properties and which is saturable. This precocious effect acts through skin rehydration by enhancing water-holding capacity of stratum corneum that would facilitate the late physiological repair of impaired skin barrier. Thus, glycerol appears to substitute for natural moisturizing factors that have been washed out by the detergent action of SLS, enhancing skin hydration but without restoring skin barrier function as depicted by TEWL values that remained high. Thus, irritant contact dermatitis treated with glycerol application compensate for skin dehydration, favouring physiological process to restore water barrier function of the impaired skin. Empirical use of glycerol added topical formulations onto detergent altered skin was substantiated in the present physicochemical approach.

  15. Comparison of structure and organization of cutaneous lipids in a reconstructed skin model and human skin: spectroscopic imaging and chromatographic profiling.


    Tfayli, Ali; Bonnier, Franck; Farhane, Zeineb; Libong, Danielle; Byrne, Hugh J; Baillet-Guffroy, Arlette


    The use of animals for scientific research is increasingly restricted by legislation, increasing the demand for human skin models. These constructs present comparable bulk lipid content to human skin. However, their permeability is significantly higher, limiting their applicability as models of barrier function, although the molecular origins of this reduced barrier function remain unclear. This study analyses the stratum corneum (SC) of one such commercially available reconstructed skin model (RSM) compared with human SC by spectroscopic imaging and chromatographic profiling. Total lipid composition was compared by chromatographic analysis (HPLC). Raman spectroscopy was used to evaluate the conformational order, lateral packing and distribution of lipids in the surface and skin/RSM sections. Although HPLC indicates that all SC lipid classes are present, significant differences are observed in ceramide profiles. Raman imaging demonstrated that the RSM lipids are distributed in a non-continuous matrix, providing a better understanding of the limited barrier function.

  16. Spin Transfer in Polymer Degradation of Abnormal Linkage

    NASA Astrophysics Data System (ADS)

    Yu, Tianrong; Tian, Chuanjin; Liu, Xizhe; Wang, Jia; Gao, Yang; Wang, Zhigang


    The degradation of polymer materials plays an important role in production and life. In this work, the degradation mechanism of poly-α-methylstyrene (PAMS) tetramers with abnormal linkage was investigated by using density functional theory (DFT). Calculated results indicate that the head-to-head and the tail-to-tail reactions needed to overcome the energy barriers are about 0.15 eV and about 1.26 eV, respectively. The broken C-C bond at the unsaturated end of the chain leads to the dissociation of alpha-methylstyrene (AMS) monomers one by one. Furthermore, the analyses of bond characteristics are in good agreement with the results of energy barriers. In addition, the spin population analysis presents an interesting net spin transfer process in depolymerization reactions. We hope that the current theoretical results provide useful help to understand the degradation mechanism of polymers.

  17. Interaction of nanoparticles and cell-penetrating peptides with skin for transdermal drug delivery