Science.gov

Sample records for abnormal tau protein

  1. The abnormal phosphorylation of tau protein at Ser-202 in Alzheimer disease recapitulates phosphorylation during development.

    PubMed

    Goedert, M; Jakes, R; Crowther, R A; Six, J; Lübke, U; Vandermeeren, M; Cras, P; Trojanowski, J Q; Lee, V M

    1993-06-01

    Tau is a neuronal phosphoprotein whose expression is developmentally regulated. A single tau isoform is expressed in fetal human brain but six isoforms are expressed in adult brain, with the fetal isoform corresponding to the shortest of the adult isoforms. Phosphorylation of tau is also developmentally regulated, as fetal tau is phosphorylated at more sites than adult tau. In Alzheimer disease, the six adult tau isoforms become abnormally phosphorylated and form the paired helical filament, the major fibrous component of the characteristic neurofibrillary lesions. We show here that Ser-202 (in the numbering of the longest human brain tau isoform) is a phosphorylation site that distinguishes fetal from adult tau and we identify it as one of the abnormal phosphorylation sites in Alzheimer disease. The abnormal phosphorylation of tau at Ser-202 in Alzheimer disease thus recapitulates normal phosphorylation during development.

  2. [Phosphorylation of tau protein].

    PubMed

    Uchida, T; Ishiguro, K

    1990-05-01

    In aged human brain and particularly in Alzheimer's disease brain, paired helical filaments (PHFs) accumulate in the neuronal cell. Recently, it has been found that the highly phosphorylated tau protein, one of the microtubule-associated proteins (MAPs), is a component of PHF. The authors attempted to clarify the mechanism underlying the accumulation of PHF from the following two aspects; 1) What is the mechanism of phosphorylation of tau protein? 2) Is the highly phosphorylated tau protein capable of forming PHFs? From rat or bovine microtubule proteins we partially purified and characterized a novel protein kinase that specifically phosphorylated tau and MAP2 among many proteins in the brain extract, and which formed a PHF epitope on the phosphorylated human tau. This enzyme was one of the protein serine/threonine kinases and was independent of known second messengers. The phosphorylation of tau by this enzyme was stimulated by tubulin under the condition of microtubule formation, suggesting that the phosphorylation of tau could occur concomitantly with microtubule formation in the brain. Since this kinase was usually bound to tau but not directly to tubulin, the enzyme was associated with microtubules through tau. From these properties related to tau, this kinase is designated as tau protein kinase. The tau that been phosphorylated with this kinase using [gamma-32P]ATP as a phosphate donor, was digested by endoprotinase Lys-C to produce three labeled fragments, K1, K2 and K3. These three fragments were sequenced and the phosphorylation sites on tau by this kinase were identified. The K2 fragment overlapped with the tau-1 site known to be one of the phosphorylation site in PHF. This result strengthens the possibility that tau protein phosphorylated by tau protein kinase is incorporated into PHF. Tubulin binding sites on tau were located between K1 and K3 fragments, while K2 fragment was located in the neighboring to N-terminus of K1. No phosphorylated sites were

  3. Cytoplasmic Retention of Protein Phosphatase 2A Inhibitor 2 (I2PP2A) Induces Alzheimer-like Abnormal Hyperphosphorylation of Tau*

    PubMed Central

    Arif, Mohammad; Wei, Jianshe; Zhang, Qi; Liu, Fei; Basurto-Islas, Gustavo; Grundke-Iqbal, Inge; Iqbal, Khalid

    2014-01-01

    Abnormal hyperphosphorylation of Tau leads to the formation of neurofibrillary tangles, a hallmark of Alzheimer disease (AD), and related tauopathies. The phosphorylation of Tau is regulated by protein phosphatase 2A (PP2A), which in turn is modulated by endogenous inhibitor 2 (I2PP2A). In AD brain, I2PP2A is translocated from neuronal nucleus to cytoplasm, where it inhibits PP2A activity and promotes abnormal phosphorylation of Tau. Here we describe the identification of a potential nuclear localization signal (NLS) in the C-terminal region of I2PP2A containing a conserved basic motif, 179RKR181, which is sufficient for directing its nuclear localization. The current study further presents an inducible cell model (Tet-Off system) of AD-type abnormal hyperphosphorylation of Tau by expressing I2PP2A in which the NLS was inactivated by 179RKR181 → AAA along with 168KR169 → AA mutations. In this model, the mutant NLS (mNLS)-I2PP2A (I2PP2AAA-AAA) was retained in the cell cytoplasm, where it physically interacted with PP2A and inhibited its activity. Inhibition of PP2A was associated with the abnormal hyperphosphorylation of Tau, which resulted in microtubule network instability and neurite outgrowth impairment. Expression of mNLS-I2PP2A activated CAMKII and GSK-3β, which are Tau kinases regulated by PP2A. The immunoprecipitation experiments showed the direct interaction of I2PP2A with PP2A and GSK-3β but not with CAMKII. Thus, the cell model provides insights into the nature of the potential NLS and the mechanistic relationship between I2PP2A-induced inhibition of PP2A and hyperphosphorylation of Tau that can be utilized to develop drugs preventing Tau pathology. PMID:25128526

  4. Discoveries of tau, abnormally hyperphosphorylated tau and others of neurofibrillary degeneration: a personal historical perspective.

    PubMed

    Iqbal, Khalid; Grundke-Iqbal, Inge

    2006-01-01

    Alzheimer disease was described by Alois Alzheimer in 1907, but it was not until approximately 60-70 years later that any new significant developments were reported on the pathology of this disease. The discoveries that laid down the foundation for the exciting research that has been carried out during the last approximately 20 years and that have significantly enhanced our understanding of the disease are the ultrastructure of neurofibrillary tangles and neuritic (senile) plaques, the clinical-pathological correlation of these lesions to the presence of dementia, and the bulk isolation and protein composition of paired helical filaments and plaque amyloid. We discovered tau as the major protein subunit of paired helical filaments/neurofibrillary tangles, the abnormal hyperphosphorylation of this protein in this lesion and in Alzheimer brain cytosol and the gain of toxic function by the cytosolic abnormally hyperphosphorylated tau in Alzheimer brain. Here we present a personal historical account of the work in our laboratories that led, in 1986, to the discoveries of tau and its abnormal hyperphosphorylation in paired helical filaments and Alzheimer brain cytosol. This article also describes several major findings which subsequently resulted from the abnormal hyperphosphorylation of tau and in a large part account for the current understanding of the role of this lesion in Alzheimer disease and other tauopathies.

  5. Tau protein and tau aggregation inhibitors.

    PubMed

    Bulic, Bruno; Pickhardt, Marcus; Mandelkow, Eva-Maria; Mandelkow, Eckhard

    2010-01-01

    Alzheimer disease is characterized by pathological aggregation of two proteins, tau and Abeta-amyloid, both of which are considered to be toxic to neurons. In this review we summarize recent advances on small molecule inhibitors of protein aggregation with emphasis on tau, with activities mediated by the direct interference of self-assembly. The inhibitors can be clustered in several compound classes according to their chemical structure, with subsequent description of the structure-activity relationships, showing that hydrophobic interactions are prevailing. The description is extended to the pharmacological profile of the compounds in order to evaluate their drug-likeness, with special attention to toxicity and bioavailability. The collected data indicate that following the improvements of the in vitro inhibitory potencies, the consideration of the in vivo pharmacokinetics is an absolute prerequisite for the development of compounds suitable for a transfer from bench to bedside.

  6. Pericellular innervation of neurons expressing abnormally hyperphosphorylated tau in the hippocampal formation of Alzheimer's disease patients.

    PubMed

    Blazquez-Llorca, Lidia; Garcia-Marin, Virginia; Defelipe, Javier

    2010-01-01

    Neurofibrillary tangles (NFT) represent one of the main neuropathological features in the cerebral cortex associated with Alzheimer's disease (AD). This neurofibrillary lesion involves the accumulation of abnormally hyperphosphorylated or abnormally phosphorylated microtubule-associated protein tau into paired helical filaments (PHF-tau) within neurons. We have used immunocytochemical techniques and confocal microscopy reconstructions to examine the distribution of PHF-tau-immunoreactive (ir) cells, and their perisomatic GABAergic and glutamatergic innervations in the hippocampal formation and adjacent cortex of AD patients. Furthermore, correlative light and electron microscopy was employed to examine these neurons and the perisomatic synapses. We observed two patterns of staining in PHF-tau-ir neurons, pattern I (without NFT) and pattern II (with NFT), the distribution of which varies according to the cortical layer and area. Furthermore, the distribution of both GABAergic and glutamatergic terminals around the soma and proximal processes of PHF-tau-ir neurons does not seem to be altered as it is indistinguishable from both control cases and from adjacent neurons that did not contain PHF-tau. At the electron microscope level, a normal looking neuropil with typical symmetric and asymmetric synapses was observed around PHF-tau-ir neurons. These observations suggest that the synaptic connectivity around the perisomatic region of these PHF-tau-ir neurons was apparently unaltered.

  7. Pericellular Innervation of Neurons Expressing Abnormally Hyperphosphorylated Tau in the Hippocampal Formation of Alzheimer's Disease Patients

    PubMed Central

    Blazquez-Llorca, Lidia; Garcia-Marin, Virginia; DeFelipe, Javier

    2010-01-01

    Neurofibrillary tangles (NFT) represent one of the main neuropathological features in the cerebral cortex associated with Alzheimer's disease (AD). This neurofibrillary lesion involves the accumulation of abnormally hyperphosphorylated or abnormally phosphorylated microtubule-associated protein tau into paired helical filaments (PHF-tau) within neurons. We have used immunocytochemical techniques and confocal microscopy reconstructions to examine the distribution of PHF-tau-immunoreactive (ir) cells, and their perisomatic GABAergic and glutamatergic innervations in the hippocampal formation and adjacent cortex of AD patients. Furthermore, correlative light and electron microscopy was employed to examine these neurons and the perisomatic synapses. We observed two patterns of staining in PHF-tau-ir neurons, pattern I (without NFT) and pattern II (with NFT), the distribution of which varies according to the cortical layer and area. Furthermore, the distribution of both GABAergic and glutamatergic terminals around the soma and proximal processes of PHF-tau-ir neurons does not seem to be altered as it is indistinguishable from both control cases and from adjacent neurons that did not contain PHF-tau. At the electron microscope level, a normal looking neuropil with typical symmetric and asymmetric synapses was observed around PHF-tau-ir neurons. These observations suggest that the synaptic connectivity around the perisomatic region of these PHF-tau-ir neurons was apparently unaltered. PMID:20631843

  8. Tau Protein and Adult Hippocampal Neurogenesis

    PubMed Central

    Fuster-Matanzo, Almudena; Llorens-Martín, María; Jurado-Arjona, Jerónimo; Avila, Jesús; Hernández, Félix

    2012-01-01

    Tau protein is a microtubule-associated protein found in the axonal compartment that stabilizes neuronal microtubules under normal physiological conditions. Tau metabolism has attracted much attention because of its role in neurodegenerative disorders called tauopathies, mainly Alzheimer disease. Here, we review recent findings suggesting that axonal outgrowth in subgranular zone during adult hippocampal neurogenesis requires a dynamic microtubule network and tau protein facilitates to maintain that dynamic cytoskeleton. Those functions are carried out in part by tau isoform with only three microtubule-binding domains (without exon 10) and by presence of hyperphosphorylated tau forms. Thus, tau is a good marker and a valuable tool to study new axons in adult neurogenesis. PMID:22787440

  9. Oligomer Formation of Tau Protein Hyperphosphorylated in Cells*

    PubMed Central

    Tepper, Katharina; Biernat, Jacek; Kumar, Satish; Wegmann, Susanne; Timm, Thomas; Hübschmann, Sabrina; Redecke, Lars; Mandelkow, Eva-Maria; Müller, Daniel J.; Mandelkow, Eckhard

    2014-01-01

    Abnormal phosphorylation (“hyperphosphorylation”) and aggregation of Tau protein are hallmarks of Alzheimer disease and other tauopathies, but their causative connection is still a matter of debate. Tau with Alzheimer-like phosphorylation is also present in hibernating animals, mitosis, or during embryonic development, without leading to pathophysiology or neurodegeneration. Thus, the role of phosphorylation and the distinction between physiological and pathological phosphorylation needs to be further refined. So far, the systematic investigation of highly phosphorylated Tau was difficult because a reliable method of preparing reproducible quantities was not available. Here, we generated full-length Tau (2N4R) in Sf9 cells in a well defined phosphorylation state containing up to ∼20 phosphates as judged by mass spectrometry and Western blotting with phospho-specific antibodies. Despite the high concentration in living Sf9 cells (estimated ∼230 μm) and high phosphorylation, the protein was not aggregated. However, after purification, the highly phosphorylated protein readily formed oligomers, whereas fibrils were observed only rarely. Exposure of mature primary neuronal cultures to oligomeric phospho-Tau caused reduction of spine density on dendrites but did not change the overall cell viability. PMID:25339173

  10. Tau Protein Modifications and Interactions: Their Role in Function and Dysfunction

    PubMed Central

    Mietelska-Porowska, Anna; Wasik, Urszula; Goras, Marcelina; Filipek, Anna; Niewiadomska, Grazyna

    2014-01-01

    Tau protein is abundant in the central nervous system and involved in microtubule assembly and stabilization. It is predominantly associated with axonal microtubules and present at lower level in dendrites where it is engaged in signaling functions. Post-translational modifications of tau and its interaction with several proteins play an important regulatory role in the physiology of tau. As a consequence of abnormal modifications and expression, tau is redistributed from neuronal processes to the soma and forms toxic oligomers or aggregated deposits. The accumulation of tau protein is increasingly recognized as the neuropathological hallmark of a number of dementia disorders known as tauopathies. Dysfunction of tau protein may contribute to collapse of cytoskeleton, thereby causing improper anterograde and retrograde movement of motor proteins and their cargos on microtubules. These disturbances in intraneuronal signaling may compromise synaptic transmission as well as trophic support mechanisms in neurons. PMID:24646911

  11. Paired helical filaments from Alzheimer disease brain induce intracellular accumulation of Tau protein in aggresomes.

    PubMed

    Santa-Maria, Ismael; Varghese, Merina; Ksiezak-Reding, Hanna; Dzhun, Anastasiya; Wang, Jun; Pasinetti, Giulio M

    2012-06-08

    Abnormal folding of tau protein leads to the generation of paired helical filaments (PHFs) and neurofibrillary tangles, a key neuropathological feature in Alzheimer disease and tauopathies. A specific anatomical pattern of pathological changes developing in the brain suggests that once tau pathology is initiated it propagates between neighboring neuronal cells, possibly spreading along the axonal network. We studied whether PHFs released from degenerating neurons could be taken up by surrounding cells and promote spreading of tau pathology. Neuronal and non-neuronal cells overexpressing green fluorescent protein-tagged tau (GFP-Tau) were treated with isolated fractions of human Alzheimer disease-derived PHFs for 24 h. We found that cells internalized PHFs through an endocytic mechanism and developed intracellular GFP-Tau aggregates with attributes of aggresomes. This was particularly evident by the perinuclear localization of aggregates and redistribution of the vimentin intermediate filament network and retrograde motor protein dynein. Furthermore, the content of Sarkosyl-insoluble tau, a measure of abnormal tau aggregation, increased 3-fold in PHF-treated cells. An exosome-related mechanism did not appear to be involved in the release of GFP-Tau from untreated cells. The evidence that cells can internalize PHFs, leading to formation of aggresome-like bodies, opens new therapeutic avenues to prevent propagation and spreading of tau pathology.

  12. Paired Helical Filaments from Alzheimer Disease Brain Induce Intracellular Accumulation of Tau Protein in Aggresomes*

    PubMed Central

    Santa-Maria, Ismael; Varghese, Merina; Ksiȩżak-Reding, Hanna; Dzhun, Anastasiya; Wang, Jun; Pasinetti, Giulio M.

    2012-01-01

    Abnormal folding of tau protein leads to the generation of paired helical filaments (PHFs) and neurofibrillary tangles, a key neuropathological feature in Alzheimer disease and tauopathies. A specific anatomical pattern of pathological changes developing in the brain suggests that once tau pathology is initiated it propagates between neighboring neuronal cells, possibly spreading along the axonal network. We studied whether PHFs released from degenerating neurons could be taken up by surrounding cells and promote spreading of tau pathology. Neuronal and non-neuronal cells overexpressing green fluorescent protein-tagged tau (GFP-Tau) were treated with isolated fractions of human Alzheimer disease-derived PHFs for 24 h. We found that cells internalized PHFs through an endocytic mechanism and developed intracellular GFP-Tau aggregates with attributes of aggresomes. This was particularly evident by the perinuclear localization of aggregates and redistribution of the vimentin intermediate filament network and retrograde motor protein dynein. Furthermore, the content of Sarkosyl-insoluble tau, a measure of abnormal tau aggregation, increased 3-fold in PHF-treated cells. An exosome-related mechanism did not appear to be involved in the release of GFP-Tau from untreated cells. The evidence that cells can internalize PHFs, leading to formation of aggresome-like bodies, opens new therapeutic avenues to prevent propagation and spreading of tau pathology. PMID:22496370

  13. Tau Proteins Cross the Blood-Brain Barrier.

    PubMed

    Banks, William A; Kovac, Andrej; Majerova, Petra; Bullock, Kristin M; Shi, Min; Zhang, Jing

    2017-01-01

    Tauopathies are a hallmark of many neurodegenerative diseases, including Alzheimer's disease and traumatic brain injuries. It has been demonstrated that amyloid-beta peptides, alpha-synuclein, and prion proteins cross the blood-brain barrier (BBB), contributing to their abilities to induce disease. Very little is known about whether tau proteins can cross the BBB. Here we systematically characterized several key forms of tau proteins to cross the BBB, including Tau-441 (2N4R), Tau-410 (2N3R), truncated tau 151-391 (0N4R), and truncated tau 121-227. All of these tau proteins crossed the BBB readily and bidirectonally; however, only Tau-410 had a saturable component to its influx. The tau proteins also entered the blood after their injection into the brain, with Tau 121-227 having the slowest exit from brain. The tau proteins varied in regards to their enzymatic stability in brain and blood and in their peripheral pharmacokinetics. These results show that blood-borne tau proteins could contribute to brain tauopathies. The result also suggest that the CNS can contribute to blood levels of tau, raising the possibility that, as suggested for other misfolded proteins, blood levels of tau proteins could be used as a biomarker of CNS disease.

  14. The role of the VQIVYK peptide in tau protein phosphorylation.

    PubMed

    Perez, Mar; Santa-María, Ismael; Tortosa, Elena; Cuadros, Raquel; Del Valle, Mercedes; Hernández, Felix; Moreno, Francisco J; Avila, Jesús

    2007-11-01

    Although it remains unclear whether they are related to one another, tau aggregation and phosphorylation are the main pathological hallmarks of the neuronal disorders known as tauopathies. The capacity to aggregate is impaired in a variant of the tau 3R isoform that lacks residues 306-311 (nomenclature for the largest CNS tau isoform) and hence, we have taken advantage of this feature to study how phosphorylation and aggregation may be related as well as the role of this six amino acid peptide (VQIVYK). Through these analyses, we found that the phosphorylation of the tau variant was higher than that of the complete tau protein and that not only the deletion of these residues, but also the interaction of these residues, in tau 3R, with thioflavin-S augmented tau phosphorylation by glycogen synthase kinase 3. In addition, the binding of the peptide containing the residues 306-311 to the whole tau protein provoked an increase in tau phosphorylation. This observation could be physiologically relevant as may suggest that tau-tau interactions, through those residues, facilitate tau phosphorylation. In summary, our data indicate that deletion of residues VQIVYK, in tau protein produces an increase in tau phosphorylation, without tau aggregation, because the VQIVYK peptide, that favors aggregation, is missing. On the other hand, when the whole tau protein interacts with thioflavin-S or the peptide VQIVYK, an increase in both aggregation and phosphorylation occurs.

  15. Deletion of endogenous Tau proteins is not detrimental in Drosophila

    PubMed Central

    Burnouf, Sylvie; Grönke, Sebastian; Augustin, Hrvoje; Dols, Jacqueline; Gorsky, Marianna Karina; Werner, Jennifer; Kerr, Fiona; Alic, Nazif; Martinez, Pedro; Partridge, Linda

    2016-01-01

    Human Tau (hTau) is a highly soluble and natively unfolded protein that binds to microtubules within neurons. Its dysfunction and aggregation into insoluble paired helical filaments is involved in the pathogenesis of Alzheimer’s disease (AD), constituting, together with accumulated β-amyloid (Aβ) peptides, a hallmark of the disease. Deciphering both the loss-of-function and toxic gain-of-function of hTau proteins is crucial to further understand the mechanisms leading to neurodegeneration in AD. As the fruit fly Drosophila melanogaster expresses Tau proteins (dTau) that are homologous to hTau, we aimed to better comprehend dTau functions by generating a specific tau knock-out (KO) fly line using homologous recombination. We observed that the specific removal of endogenous dTau proteins did not lead to overt, macroscopic phenotypes in flies. Indeed, survival, climbing ability and neuronal function were unchanged in tau KO flies. In addition, we did not find any overt positive or negative effect of dTau removal on human Aβ-induced toxicity. Altogether, our results indicate that the absence of dTau proteins has no major functional impact on flies, and suggests that our tau KO strain is a relevant model to further investigate the role of dTau proteins in vivo, thereby giving additional insights into hTau functions. PMID:26976084

  16. Interaction of tau protein with model lipid membranes induces tau structural compaction and membrane disruption

    PubMed Central

    Jones, Emmalee M.; Dubey, Manish; Camp, Phillip J.; Vernon, Briana C.; Biernat, Jacek; Mandelkow, Eckhard; Majewski, Jaroslaw; Chi, Eva Y.

    2012-01-01

    The misfolding and aggregation of the intrinsically disordered, microtubule-associated tau protein into neurofibrillary tangles is implicated in the pathogenesis of Alzheimer's disease. However, the mechanisms of tau aggregation and toxicity remain unknown. Recent work has shown that lipid membrane can induce tau aggregation and that membrane permeabilization may serve as a pathway by which protein aggregates exert toxicity, suggesting that the plasma membrane may play dual roles in tau pathology. This prompted our investigation to assess tau's propensity to interact with membranes and to elucidate the mutually disruptive structural perturbations the interactions induce in both tau and the membrane. We show that although highly charged and soluble, the full-length tau (hTau40) is also highly surface active, selectively inserts into anionic DMPG lipid monolayers and induces membrane morphological changes. To resolve molecular-scale structural details of hTau40 associated with lipid membranes, X-ray and neutron scattering techniques are utilized. X-ray reflectivity indicates hTau40's presence underneath a DMPG monolayer and penetration into the lipid headgroups and tailgroups, whereas grazing incidence X-ray diffraction shows that hTau40 insertion disrupts lipid packing. Moreover, both air/water and DMPG lipid membrane interfaces induce the disordered hTau40 to partially adopt a more compact conformation with density similar to that of a folded protein. Neutron reflectivity shows that tau completely disrupts supported DMPG bilayers while leaving the neutral DPPC bilayer intact. Our results show that hTau40's strong interaction with anionic lipids induces tau structural compaction and membrane disruption, suggesting possible membrane-based mechanisms of tau aggregation and toxicity in neurodegenerative diseases. PMID:22401494

  17. Abnormal tau phosphorylation in the thorny excrescences of CA3 hippocampal neurons in patients with Alzheimer's disease.

    PubMed

    Blazquez-Llorca, Lidia; Garcia-Marin, Virginia; Merino-Serrais, Paula; Ávila, Jesús; DeFelipe, Javier

    2011-01-01

    A key symptom in the early stages of Alzheimer's disease (AD) is the loss of declarative memory. The anatomical substrate that supports this kind of memory involves the neural circuits of the medial temporal lobe, and in particular, of the hippocampal formation and adjacent cortex. A main feature of AD is the abnormal phosphorylation of the tau protein and the presence of tangles. The sequence of cellular changes related to tau phosphorylation and tangle formation has been studied with an antibody that binds to diffuse phosphotau (AT8). Moreover, another tau antibody (PHF-1) has been used to follow the pathway of neurofibrillary (tau aggregation) degeneration in AD. We have used a variety of quantitative immunocytochemical techniques and confocal microscopy to visualize and characterize neurons labeled with AT8 and PHF-1 antibodies. We present here the rather unexpected discovery that in AD, there is conspicuous abnormal phosphorylation of the tau protein in a selective subset of dendritic spines. We identified these spines as the typical thorny excrescences of hippocampal CA3 neurons in a pre-tangle state. Since thorny excrescences represent a major synaptic target of granule cell axons (mossy fibers), such aberrant phosphorylation may play an essential role in the memory impairment typical of AD patients.

  18. Antisense-mediated Exon Skipping Decreases Tau Protein Expression: A Potential Therapy For Tauopathies.

    PubMed

    Sud, Reeteka; Geller, Evan T; Schellenberg, Gerard D

    2014-07-29

    In Alzheimer's disease, progressive supranuclear palsy, and a number of other neurodegenerative diseases, the microtubule associated protein tau aggregates to form intracellular neurofibrillary tangles and glial tangles, abnormal structures that are part of disease pathogenesis. Disorders with aggregated tau are called tauopathies. Presently, there are no disease-modifying treatments for this disease class. Tau is encoded by the MAPT gene. We propose that reducing MAPT expression and thus the amount of tau protein made could prevent aggregation, and potentially be an approach to treat tauopathies. We tested 31 morpholinos, complementary to the sense strand of the MAPT gene to identify oligonucleotides that can downregulate MAPT expression and reduce the amount of tau protein produced. Oligonucleotides were tested in human neuroblastoma cell lines SH-SY5Y and IMR32. We identified several morpholinos that reduced MAPT mRNA expression up to 50% and tau protein levels up to ~80%. The two most potent oligonucleotides spanned the 3' boundary of exons 1 and 5, masking the 5'-splice sites of these exons. Both morpholinos induced skipping of the targeted exons. These in vitro findings were confirmed in mice transgenic for the entire human MAPT gene and that express human tau protein. These studies demonstrate the feasibility of using modified oligonucleotides to alter tau expression.

  19. In Silico Modelling of Novel Drug Ligands Associated with Abnormal Tau Phosphorylation: Implications for Concussion Associated Tauopathy Intervention†

    PubMed Central

    Zhao, Wei; Ho, Lap; Wang, Jun; Bi, Weina; Yemul, Shrishailam; Ward, Libby; Freire, Daniel; Mazzola, Paolo; Brathwaite, Justin; Mezei, Mihaly; Sanchez, Roberto; Elder, Gregory A.; Pasinetti, Giulio Maria

    2016-01-01

    The objective of this study was to develop an in silico screening model for characterization of potential novel ligands from commercial drug libraries able to functionally activate certain olfactory receptors (ORs), which are members of the class A rhodopsin-like family of G protein couple receptors (GPCRs), in the brain of murine models of concussion. We previously found that concussions may significantly influence expression of certain ORs, e.g. OR4M1 in subjects with a history of concussion/traumatic brain injury (TBI). In this study we built a 3-D OR4M1 model and used it in in silico screening of potential novel ligands from commercial drug libraries. We report that in vitro activation of OR4M1 with the commercially available ZINC library compound 10915775 led to a significant attenuation of abnormal tau phosphorylation in embryonic cortico-hippocampal neuronal cultures derived from NSE-OR4M1 transgenic mice, possibly through modulation of the JNK signaling pathway. The attenuation of abnormal tau phosphorylation was rather selective since ZINC10915775 significantly decreased tau phosphorylation on tau Ser202/T205 (AT8 epitope) and tau Thr212/Ser214 (AT100 epitope), but not on tau Ser396/404 (PHF-1 epitope). Moreover, no response of ZINC10915775 was found in control hippocampal neuronal cultures derived from wild type littermates. Our in silico model provides novel means to pharmacologically modulate select ubiquitously expressed ORs in the brain through high affinity ligand activation to prevent and eventually to treat concussion induced down regulation of ORs and subsequent cascade of tau pathology. PMID:26910498

  20. Abnormal interaction of VDAC1 with amyloid beta and phosphorylated tau causes mitochondrial dysfunction in Alzheimer's disease

    PubMed Central

    Manczak, Maria; Reddy, P. Hemachandra

    2012-01-01

    The purpose of our study was to determine the relationship between voltage-dependent anion channel 1 protein (VDAC1) and amyloid beta (Aβ) and phosphorylated tau in Alzheimer's disease (AD). Using brain specimens from AD patients, control subjects and 6-, 12- and 24-month-old Aβ precursor protein (APP) transgenic mice, we studied VDAC1 protein levels. Further, we also studied the interaction between VDAC1 and Aβ (monomers and oligomers) and phosphorylated tau, using cortical issues from AD patients, control subjects, APP, APP/PS1 and 3XTg.AD mice. We also studied age- and VDAC1-linked, mutant APP/Aβ-induced mitochondrial dysfunction in APP and non-transgenic wild-type (WT) mice. We found progressively increased levels of VDAC1 in the cortical tissues from the brains of patients with AD, relative to control subjects, and significantly increased levels of VDAC1 in the cerebral cortices of 6-, 12- and 24-month-old APP transgenic mice, relative to the age-matched control WT mice. Interestingly, we found VDAC1 interacted with Aβ and phosphorylated tau in the brains from AD patients and from APP, APP/PS1 and 3XTg.AD mice. We found progressively increased mitochondrial dysfunction in APP mice relative to WT mice. These observations led us to conclude that VDAC1 interacts with Aβ, and phosphorylated tau may in turn block mitochondrial pores, leading to mitochondrial dysfunction in AD pathogenesis. Based on current study observations, we propose that reduced levels of VDAC1, Aβ and phosphorylated tau may reduce the abnormal interaction between VDAC1 and APP, VDAC1 and Aβ, and VDAC1 and phosphorylated tau; and that reduced levels of VDAC1, Aβ and phosphorylated tau may maintain normal mitochondrial pore opening and pore closure, ultimately leading to normal mitochondrial function, mitochondria supplying ATP to nerve terminals and boosting synaptic and cognitive function in AD. PMID:22926141

  1. Abnormally phosphorylated tau is associated with neuronal and axonal loss in experimental autoimmune encephalomyelitis and multiple sclerosis.

    PubMed

    Anderson, J M; Hampton, D W; Patani, R; Pryce, G; Crowther, R A; Reynolds, R; Franklin, R J M; Giovannoni, G; Compston, D A S; Baker, D; Spillantini, M G; Chandran, S

    2008-07-01

    The pathological correlate of clinical disability and progression in multiple sclerosis is neuronal and axonal loss; however, the underlying mechanisms are unknown. Abnormal phosphorylation of tau is a common feature of some neurodegenerative disorders, such as Alzheimer's disease. We investigated the presence of tau hyperphosphorylation and its relationship with neuronal and axonal loss in chronic experimental autoimmune encephalomyelitis (CEAE) and in brain samples from patients with secondary progressive multiple sclerosis. We report the novel finding of abnormal tau phosphorylation in CEAE. We further show that accumulation of insoluble tau is associated with both neuronal and axonal loss that correlates with progression from relapsing-remitting to chronic stages of EAE. Significantly, analysis of secondary progressive multiple sclerosis brain tissue also revealed abnormally phosphorylated tau and the formation of insoluble tau. Together, these observations provide the first evidence implicating abnormal tau in the neurodegenerative phase of tissue injury in experimental and human demyelinating disease.

  2. Discodermolide interferes with the binding of tau protein to microtubules.

    PubMed

    Kar, Santwana; Florence, Gordon J; Paterson, Ian; Amos, Linda A

    2003-03-27

    We investigated whether discodermolide, a novel antimitotic agent, affects the binding to microtubules of tau protein repeat motifs. Like taxol, the new drug reduces the proportion of tau that pellets with microtubules. Despite their differing structures, discodermolide, taxol and tau repeats all bind to a site on beta-tubulin that lies within the microtubule lumen and is crucial in controlling microtubule assembly. Low concentrations of tau still bind strongly to the outer surfaces of preformed microtubules when the acidic C-terminal regions of at least six tubulin dimers are available for interaction with each tau molecule; otherwise binding is very weak.

  3. Tau isoforms imbalance impairs the axonal transport of the amyloid precursor protein in human neurons.

    PubMed

    Lacovich, Valentina; Espindola, Sonia L; Alloatti, Matías; Pozo Devoto, Victorio; Cromberg, Lucas; Čarná, Mária; Forte, Giancarlo; Gallo, Jean-Marc; Bruno, Luciana; Stokin, Gorazd B; Avale, M Elena; Falzone, Tomás L

    2016-11-11

    Tau, as a microtubule-associated protein, participates in key neuronal functions such as the regulation of microtubule dynamics, axonal transport and neurite outgrowth. Alternative splicing of exon 10 in the tau primary transcript gives rise to protein isoforms with three (3R) or four (4R) microtubule binding repeats. While tau isoforms are balanced in the normal adult human brain, imbalances in 3R:4R ratio have been tightly associated to the pathogenesis of several neurodegenerative disorders, yet the underlying molecular mechanisms remain elusive. Several studies exploiting tau overexpression and/or mutations suggested that perturbations in tau metabolism impair axonal transport. Nevertheless, no physiological model has yet demonstrated the consequences of altering the endogenous relative content of tau isoforms over axonal transport regulation. Here we addressed this question using a trans-splicing strategy that allows modulating tau exon 10 inclusion/exclusion in differentiated human-derived neurons. Upon changes in 3R:4R tau relative content neurons showed no morphological changes, but live imaging studies revealed that the dynamics of the amyloid precursor protein (APP) were significantly impaired. Single trajectories analyses of the moving vesicles showed that predominance of 3R tau favored the anterograde movement of APP-vesicles, increasing anterograde run lengths and reducing retrograde runs and segmental velocities. Contrarely, the imbalance towards the 4R isoform promoted a retrograde bias by a significant reduction of anterograde velocities. These findings suggest that changes in 3R:4R tau ratio has an impact on the regulation of axonal transport and specifically in APP dynamics, which might link tau isoforms imbalances with APP abnormal metabolism in neurodegenerative processes.

  4. Tau Isoforms Imbalance Impairs the Axonal Transport of the Amyloid Precursor Protein in Human Neurons.

    PubMed

    Lacovich, Valentina; Espindola, Sonia L; Alloatti, Matías; Pozo Devoto, Victorio; Cromberg, Lucas E; Čarná, Mária E; Forte, Giancarlo; Gallo, Jean-Marc; Bruno, Luciana; Stokin, Gorazd B; Avale, M Elena; Falzone, Tomás L

    2017-01-04

    Tau, as a microtubule (MT)-associated protein, participates in key neuronal functions such as the regulation of MT dynamics, axonal transport, and neurite outgrowth. Alternative splicing of exon 10 in the tau primary transcript gives rise to protein isoforms with three (3R) or four (4R) MT binding repeats. Although tau isoforms are balanced in the normal adult human brain, imbalances in 3R:4R ratio have been tightly associated with the pathogenesis of several neurodegenerative disorders, yet the underlying molecular mechanisms remain elusive. Several studies exploiting tau overexpression and/or mutations suggested that perturbations in tau metabolism impair axonal transport. Nevertheless, no physiological model has yet demonstrated the consequences of altering the endogenous relative content of tau isoforms over axonal transport regulation. Here, we addressed this issue using a trans-splicing strategy that allows modulating tau exon 10 inclusion/exclusion in differentiated human-derived neurons. Upon changes in 3R:4R tau relative content, neurons showed no morphological changes, but live imaging studies revealed that the dynamics of the amyloid precursor protein (APP) were significantly impaired. Single trajectory analyses of the moving vesicles showed that predominance of 3R tau favored the anterograde movement of APP vesicles, increasing anterograde run lengths and reducing retrograde runs and segmental velocities. Conversely, the imbalance toward the 4R isoform promoted a retrograde bias by a significant reduction of anterograde velocities. These findings suggest that changes in 3R:4R tau ratio has an impact on the regulation of axonal transport and specifically in APP dynamics, which might link tau isoform imbalances with APP abnormal metabolism in neurodegenerative processes.

  5. Global Conformation of Tau Protein Mapped by Raman Spectroscopy.

    PubMed

    Gorantla, Nalini Vijay; Khandelwal, Puneet; Poddar, Pankaj; Chinnathambi, Subashchandrabose

    2017-01-01

    Alzheimer's disease (AD) is one of the neurodegenerative disease characterized by progressive neuronal loss in the brain. Its two major hallmarks are extracellular senile plaques and intracellular neurofibrillary tangles (NFTs), formed by aggregation of amyloid β-42 (Aβ-42) and Tau protein respectively. Aβ-42 is a transmembrane protein, which is produced after the sequential action of β- and γ-secretases, thus obtained peptide is released extracellularly and gets deposited on the neuron forming senile plaques. NFTs are composed of microtubule-associated protein-Tau (MAPT). Tau protein's major function is to stabilize the microtubule that provides a track on which the cargo proteins are shuttled and the stabilized microtubule also maintains shape and integrity of the neuronal cell. Tau protein is subjected to various modifications such as phosphorylation, ubiquitination, glycation, acetylation, truncation, glycosylation, deamination, and oxidation; these modifications ultimately lead to its aggregation. Phosphorylation is the major modification and is extensively studied with respect to Tau protein. Tau protein, however, undergoes certain level of phosphorylation and dephosphorylation, which regulates its affinity for microtubule and ultimately leading to microtubule assembly and disassembly. Our main aim was to study the native state of longest isoform of Tau (hTau40WT-4R2N) and its shortest isoform, (hTau23WT-3R0N), at various temperatures such as 10, 25, and 37 °C. Raman spectroscopic results suggested that the proportion of random coils or unordered structure depends on the temperature of the protein environment. Upon increase in the temperature from 10 to 37 °C, the proportion of random coils or unordered structures increased in the case of hTau40WT. However, we did not find a significant effect of temperature on the structure of hTau23WT. This current approach enables one to analyze the global conformation of soluble Tau in solution.

  6. Tau Protein Hyperphosphorylation and Aggregation in Alzheimer's Disease and Other Tauopathies, and Possible Neuroprotective Strategies.

    PubMed

    Šimić, Goran; Babić Leko, Mirjana; Wray, Selina; Harrington, Charles; Delalle, Ivana; Jovanov-Milošević, Nataša; Bažadona, Danira; Buée, Luc; de Silva, Rohan; Di Giovanni, Giuseppe; Wischik, Claude; Hof, Patrick R

    2016-01-06

    Abnormal deposition of misprocessed and aggregated proteins is a common final pathway of most neurodegenerative diseases, including Alzheimer's disease (AD). AD is characterized by the extraneuronal deposition of the amyloid β (Aβ) protein in the form of plaques and the intraneuronal aggregation of the microtubule-associated protein tau in the form of filaments. Based on the biochemically diverse range of pathological tau proteins, a number of approaches have been proposed to develop new potential therapeutics. Here we discuss some of the most promising ones: inhibition of tau phosphorylation, proteolysis and aggregation, promotion of intra- and extracellular tau clearance, and stabilization of microtubules. We also emphasize the need to achieve a full understanding of the biological roles and post-translational modifications of normal tau, as well as the molecular events responsible for selective neuronal vulnerability to tau pathology and its propagation. It is concluded that answering key questions on the relationship between Aβ and tau pathology should lead to a better understanding of the nature of secondary tauopathies, especially AD, and open new therapeutic targets and strategies.

  7. Dimer model for Tau proteins bound in microtubule bundles

    NASA Astrophysics Data System (ADS)

    Hall, Natalie; Kluber, Alexander; Hayre, N. Robert; Singh, Rajiv; Cox, Daniel

    2013-03-01

    The microtubule associated protein tau is important in nucleating and maintaining microtubule spacing and structure in neuronal axons. Modification of tau is implicated as a later stage process in Alzheimer's disease, but little is known about the structure of tau in microtubule bundles. We present preliminary work on a proposed model for tau dimers in microtubule bundles (dimers are the minimal units since there is one microtubule binding domain per tau). First, a model of tau monomer was created and its characteristics explored using implicit solvent molecular dynamics simulation. Multiple simulations yield a partially collapsed form with separate positively/negatively charged clumps, but which are a factor of two smaller than required by observed microtubule spacing. We argue that this will elongate in dimer form to lower electrostatic energy at a cost of entropic ``spring'' energy. We will present preliminary results on steered molecular dynamics runs on tau dimers to estimate the actual force constant. Supported by US NSF Grant DMR 1207624.

  8. Electrochemical detection of anti-tau antibodies binding to tau protein and inhibition of GSK-3β-catalyzed phosphorylation.

    PubMed

    Esteves-Villanueva, Jose O; Martic-Milne, Sanela

    2016-03-01

    Tau protein hyperphosphorylation triggers tau aggregation and its toxicity, leading to neuronal death and cell-to-cell toxicity. Hence, inhibition of protein kinases is a viable tool toward reduction of tau toxicity. By targeting various epitopes of Tau441 protein immobilized on Au surface, the protein kinase inhibition by anti-tau antibodies was measured by surface electrochemistry. The electrochemical impedance spectroscopy was used to measure the charge transfer resistance (Rct) of nonphosphorylated tau-Au film (nTau-Au) and compared with the phosphorylated tau-Au film (pTau-Au). The pTau-Au films were characterized by X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (TOF-SIMS), which indicated high phosphorus content. The Rct factor was used as the measure of inhibition efficacies by anti-tau antibodies (D8, A10, P262, and Tau46) in addition to antibody formulation intravenous immunoglobulin (IVIG). The Rct factor for pTau-Au in the absence of antibodies was 0.25 ± 0.08, indicating a dramatic decrease in Rct on phosphorylation. The Rct factors for Tau46 and A10 were 0.57 ± 0.22 and 0.65 ± 0.26, respectively, indicating phosphorylation inhibition. All antibodies exhibited similar binding to nTau-Au. The proposed electrochemical assay may be used for detection of other posttranslational modifications.

  9. Psychotic Alzheimer's disease is associated with gender-specific tau phosphorylation abnormalities.

    PubMed

    Koppel, Jeremy; Acker, Chris; Davies, Peter; Lopez, Oscar L; Jimenez, Heidy; Azose, Miriam; Greenwald, Blaine S; Murray, Patrick S; Kirkwood, Caitlin M; Kofler, Julia; Sweet, Robert A

    2014-09-01

    Converging evidence suggests that psychotic Alzheimer's disease (AD + P) is associated with an acceleration of frontal degeneration, with tau pathology playing a primary role. Previous histopathologic and biomarker studies have specifically implicated tau pathology in this condition. To precisely quantify tau abnormalities in the frontal cortex in AD + P, we used a sensitive biochemical assay of total tau and 4 epitopes of phospho-tau relevant in AD pathology in a postmortem sample of AD + P and AD - P. Samples of superior frontal gyrus from 26 AD subjects without psychosis and 45 AD + P subjects with psychosis were analyzed. Results of enzyme-linked immunosorbent assay demonstrate that AD + P females, but not males, had significantly higher levels of phosphorylated tau in the frontal cortex. In males, but not females, AD + P was associated with the presence of α-synuclein pathology. These results support a gender dissociation of pathology in AD + P. The design of future studies aimed at the elucidation of cognitive and/or functional outcomes; regional brain metabolic deficits; or genetic correlates of AD + P should take gender into consideration.

  10. Cellular factors modulating the mechanism of tau protein aggregation

    PubMed Central

    Fontaine, Sarah N.; Sabbagh, Jonathan J.; Baker, Jeremy; Martinez-Licha, Carlos R.; Darling, April

    2015-01-01

    Pathological accumulation of the microtubule-associated protein tau, in the form of neurofibrillary tangles, is a major hallmark of Alzheimer’s disease, the most prevalent neurodegenerative condition worldwide. In addition to Alzheimer’s disease, a number of neurodegenerative diseases, called tauopathies, are characterized by the accumulation of aggregated tau in a variety of brain regions. While tau normally plays an important role in stabilizing the microtubule network of the cytoskeleton, its dissociation from microtubules and eventual aggregation into pathological deposits is an area of intense focus for therapeutic development. Here we discuss the known cellular factors that affect tau aggregation, from post-translational modifications to molecular chaperones. PMID:25666877

  11. Human protein tau represses DNA replication in vitro.

    PubMed

    Li, Wen; Wang, Xing Sheng; Qu, M H; Liu, Ying; He, Rong Qiao

    2005-11-30

    Here, in the experiments of both PCR and real-time PCR, a repression of DNA amplification was observed in the presence of protein tau. Furthermore, a strong repression appeared when an in vitro DNA replication assay was performed at the physiological temperature (37 degrees C). The incorporation of dNTP was markedly decreased to approximately 12% of control by the presence of tau23 and to approximately 15% by tau40. In the competitive experiments, the PCR product could be restored when the competitor DNA was added, indicating that the association of tau with the template gave rise to the repression. However, tau did not repress the yield of RNA in transcription, suggesting that tau was replaced or ejected from the template by the elongating T7 RNA polymerase.

  12. Tau pathology involves protein phosphatase 2A in Parkinsonism-dementia of Guam

    PubMed Central

    Arif, Mohammad; Kazim, Syed Faraz; Grundke-Iqbal, Inge; Garruto, Ralph M.; Iqbal, Khalid

    2014-01-01

    Parkinsonism-dementia (PD) of Guam is a neurodegenerative disease with parkinsonism and early-onset Alzheimer-like dementia associated with neurofibrillary tangles composed of hyperphosphorylated microtubule-associated protein, tau. β-N-methylamino-l-alanine (BMAA) has been suspected of being involved in the etiology of PD, but the mechanism by which BMAA leads to tau hyperphosphorylation is not known. We found a decrease in protein phosphatase 2A (PP2A) activity associated with an increase in inhibitory phosphorylation of its catalytic subunit PP2Ac at Tyr307 and abnormal hyperphosphorylation of tau in brains of patients who had Guam PD. To test the possible involvement of BMAA in the etiopathogenesis of PD, we studied the effect of this environmental neurotoxin on PP2A activity and tau hyperphosphorylation in mouse primary neuronal cultures and metabolically active rat brain slices. BMAA treatment significantly decreased PP2A activity, with a concomitant increase in tau kinase activity resulting in elevated tau hyperphosphorylation at PP2A favorable sites. Moreover, we found an increase in the phosphorylation of PP2Ac at Tyr307 in BMAA-treated rat brains. Pretreatment with metabotropic glutamate receptor 5 (mGluR5) and Src antagonists blocked the BMAA-induced inhibition of PP2A and the abnormal hyperphosphorylation of tau, indicating the involvement of an Src-dependent PP2A pathway. Coimmunoprecipitation experiments showed that BMAA treatment dissociated PP2Ac from mGluR5, making it available for phosphorylation at Tyr307. These findings suggest a scenario in which BMAA can lead to tau pathology by inhibiting PP2A through the activation of mGluR5, the consequent release of PP2Ac from the mGluR5–PP2A complex, and its phosphorylation at Tyr307 by Src. PMID:24395787

  13. Mass Spectrometry Analysis of Lysine Posttranslational Modifications of Tau Protein from Alzheimer's Disease Brain.

    PubMed

    Thomas, Stefani N; Yang, Austin J

    2017-01-01

    Recent advances in mass spectrometry (MS)-based proteomics have greatly facilitated the robust identification and quantification of posttranslational modifications (PTMs), including those that are present at substoichiometric site occupancies. The abnormal posttranslational modification and accumulation of the microtubule-associated protein tau has been implicated in the pathogenesis of Alzheimer's disease (AD), and it is thought that the primary mode of regulation of tau occurs through PTMs. Several studies have been published regarding tau phosphorylation; however, other tau PTMs such as ubiquitylation, acetylation, methylation, oxidation, sumoylation, nitration, and glycosylation have not been analyzed as extensively. The comprehensive detection and delineation of these PTMs is critical for drug target discovery and validation. Lysine-directed PTMs including ubiquitylation, acetylation, and methylation play key regulatory roles with respect to the rates of tau turnover and aggregation. MS-based analytical approaches have been used to gain insight into the tau lysine-directed PTM signature that is most closely associated with neurofibrillary lesion formation. This chapter provides details pertaining to the liquid chromatography tandem mass spectrometry (LC-MS/MS)-based analysis of the lysine-directed posttranslational modification of tau.

  14. Mass Spectrometry Analysis of Lysine Posttranslational Modifications of Tau Protein from Alzheimer’s Disease Brain

    PubMed Central

    Thomas, Stefani N.; Yang, Austin J.

    2017-01-01

    Recent advances in mass spectrometry (MS)-based proteomics have greatly facilitated the robust identification and quantification of posttranslational modifications (PTMs), including those that are present at substoichiometric site occupancies. The abnormal posttranslational modification and accumulation of the microtubule-associated protein tau has been implicated in the pathogenesis of Alzheimer’s disease (AD), and it is thought that the primary mode of regulation of tau occurs through PTMs. Several studies have been published regarding tau phosphorylation; however, other tau PTMs such as ubiquitylation, acetylation, methylation, oxidation, sumoylation, nitration, and glycosylation have not been analyzed as extensively. The comprehensive detection and delineation of these PTMs is critical for drug target discovery and validation. Lysine-directed PTMs including ubiquitylation, acetylation, and methylation play key regulatory roles with respect to the rates of tau turnover and aggregation. MS-based analytical approaches have been used to gain insight into the tau lysine-directed PTM signature that is most closely associated with neurofibrillary lesion formation. This chapter provides details pertaining to the liquid chromatography tandem mass spectrometry (LC-MS/MS)-based analysis of the lysine-directed posttranslational modification of tau. PMID:27975250

  15. Tau protein in frontotemporal dementia linked to chromosome 3 (FTD-3).

    PubMed

    Yancopoulou, Despina; Crowther, R Anthony; Chakrabarti, Lisa; Gydesen, Susanne; Brown, Jeremy M; Spillantini, Maria Grazia

    2003-08-01

    Recent work on frontotemporal dementia (FTD) has revealed the existence of at least 3 genetically distinct groups of inherited FTD: FTDP-17, FTD and motor neuron disease linked to chromosome 9, and FTD linked to chromosome 3 (FTD-3). Tau, on chromosome 17, is the only gene where mutations have been identified and its involvement in FTD has been firmly established. The genes on chromosome 9 and chromosome 3 associated with familial forms of FTD remain to be identified. Abnormal aggregates of tau protein characterize the brain lesions of FTDP-17 patients and ubiquitin inclusions have been found in FTD with motor neuron disease linked to chromosome 9. In this study the frontal cortices of 3 FTD-3 patients from a unique Danish family were examined for characteristic neuropathological features. In these brains tau inclusions were present in neurons and some glial cells in the absence of beta-amyloid deposits. The presence of filamentous tau protein in the frontal cortex of these patients suggests a possible link between tau and the genetic defect present on chromosome 3 and associated with FTD-3, although the limited amount of tau deposits observed makes it difficult to define this as a tauopathy.

  16. Inhibitory effect of corcin on aggregation of 1N/4R human tau protein in vitro

    PubMed Central

    Karakani, Ali Mohammadi; Riazi, Gholamhossein; Mahmood Ghaffari, Seyed; Ahmadian, Shahin; Mokhtari, Farzad; Jalili Firuzi, Mahshad; Zahra Bathaie, Seyedeh

    2015-01-01

    Objective(s): Alzheimer’s disease (AD) is the most common age-related neurodegenerative disorder. One of the hallmarks of AD is an abnormal accumulation of fibril forms of tau protein which is known as a microtubule associated protein. In this regard, inhibition of tau aggregation has been documented to be a potent therapeutic approach in AD and tauopathies. Unfortunately, the available synthetic drugs have modest beneficial efficacy with several side effects. Therefore, pipeline drugs from natural sources with anti-aggregation properties can be useful in the prevention and treatment of AD. Among medicinal plants, saffron (Crocus sativus, L.), as a traditional herbal medicine has different pharmacological properties and can be used as treatment for several nervous system impairment including depression and dementia. Crocin as a major constituent of saffron is the glycosylated form of crocetin. Materials and Methods: In this study, we investigated the inhibitory effect of crocin on aggregation of recombinant human tau protein 1N/4R isoform using biochemical methods and cell culture. Results: Results revealed that tau protein under the fibrillation condition and in the presence of crocin had enough stability with low tendency for aggregation. Crocin inhibited tau aggregation with IC50 of 100 µg/ml. Furthermore, transmission electron microscopy images confirmed that crocin could suppress the formation of tau protein filaments. Conclusion: Inhibitory effect of crocin could be related to its interference with nucleation phase that led to increases in monomer species of tau protein. Based on our results, crocin is recommended as a proper candidate to be used in AD treatment. PMID:26124935

  17. Mammalian target of rapamycin (mTor) mediates tau protein dyshomeostasis: implication for Alzheimer disease.

    PubMed

    Tang, Zhi; Bereczki, Erika; Zhang, Haiyan; Wang, Shan; Li, Chunxia; Ji, Xinying; Branca, Rui M; Lehtiö, Janne; Guan, Zhizhong; Filipcik, Peter; Xu, Shaohua; Winblad, Bengt; Pei, Jin-Jing

    2013-05-31

    Previous evidence from post-mortem Alzheimer disease (AD) brains and drug (especially rapamycin)-oriented in vitro and in vivo models implicated an aberrant accumulation of the mammalian target of rapamycin (mTor) in tangle-bearing neurons in AD brains and its role in the formation of abnormally hyperphosphorylated tau. Compelling evidence indicated that the sequential molecular events such as the synthesis and phosphorylation of tau can be regulated through p70 S6 kinase, the well characterized immediate downstream target of mTor. In the present study, we further identified that the active form of mTor per se accumulates in tangle-bearing neurons, particularly those at early stages in AD brains. By using mass spectrometry and Western blotting, we identified three phosphoepitopes of tau directly phosphorylated by mTor. We have developed a variety of stable cell lines with genetic modification of mTor activity using SH-SY5Y neuroblastoma cells as background. In these cellular systems, we not only confirmed the tau phosphorylation sites found in vitro but also found that mTor mediates the synthesis and aggregation of tau, resulting in compromised microtubule stability. Changes of mTor activity cause fluctuation of the level of a battery of tau kinases such as protein kinase A, v-Akt murine thymoma viral oncogene homolog-1, glycogen synthase kinase 3β, cyclin-dependent kinase 5, and tau protein phosphatase 2A. These results implicate mTor in promoting an imbalance of tau homeostasis, a condition required for neurons to maintain physiological function.

  18. Early growth response 1 (Egr-1) regulates phosphorylation of microtubule-associated protein tau in mammalian brain.

    PubMed

    Lu, Yifan; Li, Tong; Qureshi, Hamid Y; Han, Dong; Paudel, Hemant K

    2011-06-10

    In the normal brain, tau protein is phosphorylated at a number of proline- and non-proline directed sites, which reduce tau microtubule binding and thus regulate microtubule dynamics. In Alzheimer disease (AD), tau is abnormally hyperphosphorylated, leading to neurofibrillary tangle formation and microtubule disruption, suggesting a loss of regulatory mechanisms controlling tau phosphorylation. Early growth response 1 (Egr-1) is a transcription factor that is significantly up-regulated in AD brain. The pathological significance of this up-regulation is not known. In this study, we found that lentivirus-mediated overexpression of Egr-1 in rat brain hippocampus and primary neurons in culture activates proline-directed kinase Cdk5, inactivates PP1, promotes tau phosphorylation at both proline-directed Ser(396/404) and non-proline-directed Ser(262) sites, and destabilizes microtubules. Furthermore, in Egr-1(-/-) mouse brain, Cdk5 activity was decreased, PP1 activity was increased, and tau phosphorylation was reduced at both proline-directed and non-proline-directed sites. By using nerve growth factor-exposed PC12 cells, we determined that Egr-1 activates Cdk5 to promote phosphorylation of tau and inactivates PP1 via phosphorylation. When Cdk5 was inhibited, tau phosphorylation at both proline- and non-proline directed sites and PP1 phosphorylation were blocked, indicating that Egr-1 acts through Cdk5. By using an in vitro kinase assay and HEK-293 cells transfected with tau, PP1, and Cdk5, we found that Cdk5 phosphorylates Ser(396/404) directly. In addition, by phosphorylating and inactivating PP1, Cdk5 promotes tau phosphorylation at Ser(262) indirectly. Our results indicate that Egr-1 is an in vivo regulator of tau phosphorylation and suggest that in AD brain increased levels of Egr-1 aberrantly activate an Egr-1/Cdk5/PP1 pathway, leading to accumulation of hyperphosphorylated tau, thus destabilizing the microtubule cytoskeleton.

  19. Oligomerization of the protein tau in the Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Larini, Luca

    The Alzheimer's disease is characterized by the formation of protein aggregates both within and outside of the brain's cells, the neurons. Within the neurons, the aggregation of the microtubule associated protein tau leads to the destruction of the microtubules in the axon of the neuron. Tau is extremely flexible and is classified as an intrinsically disordered protein due to its low propensity to form secondary structure. Tau promotes tubulin assembly into microtubules, which are an essential component of the cytoskeleton of the axon. The microtubule binding region of tau consists of 4 pseudo-repeats that are critical for aggregation as well. In this study, we focus on the aggregation propensity of different segments of the microtubule binding region as well as post-translational modifications that can alter tau dynamics and structure. We have performed replica exchange molecular dynamics simulations to characterize the ensemble of conformations of the monomer and small oligomers as well as how these structures are stabilized or destabilized by mutations and post-translational modifications.

  20. Tau Protein Hyperphosphorylation and Aggregation in Alzheimer’s Disease and Other Tauopathies, and Possible Neuroprotective Strategies

    PubMed Central

    Šimić, Goran; Babić Leko, Mirjana; Wray, Selina; Harrington, Charles; Delalle, Ivana; Jovanov-Milošević, Nataša; Bažadona, Danira; Buée, Luc; de Silva, Rohan; Di Giovanni, Giuseppe; Wischik, Claude; Hof, Patrick R.

    2016-01-01

    Abnormal deposition of misprocessed and aggregated proteins is a common final pathway of most neurodegenerative diseases, including Alzheimer’s disease (AD). AD is characterized by the extraneuronal deposition of the amyloid β (Aβ) protein in the form of plaques and the intraneuronal aggregation of the microtubule-associated protein tau in the form of filaments. Based on the biochemically diverse range of pathological tau proteins, a number of approaches have been proposed to develop new potential therapeutics. Here we discuss some of the most promising ones: inhibition of tau phosphorylation, proteolysis and aggregation, promotion of intra- and extracellular tau clearance, and stabilization of microtubules. We also emphasize the need to achieve a full understanding of the biological roles and post-translational modifications of normal tau, as well as the molecular events responsible for selective neuronal vulnerability to tau pathology and its propagation. It is concluded that answering key questions on the relationship between Aβ and tau pathology should lead to a better understanding of the nature of secondary tauopathies, especially AD, and open new therapeutic targets and strategies. PMID:26751493

  1. Aggregation propensity of critical regions of the protein Tau

    NASA Astrophysics Data System (ADS)

    Muthee, Micaiah; Ahmed, Azka; Larini, Luca

    The Alzheimer's disease is an irreversible, progressive brain disorder that slowly destroys memory and thinking skills, which eventually leads to the ability to not able to carry out the simplest tasks. The Alzheimer's disease is characterized by the formation of protein aggregates both within and outside of the brain's cells, the neurons. Within the neurons, the aggregation of the protein tau leads to the destruction of the microtubules in the axon of the neuron. Tau belongs to a group of proteins referred to as Microtubule-Associated Proteins. It is extremely flexible and is classified as an intrinsically unstructured protein due to its low propensity to form secondary structure. Tau promotes tubulin assembly into microtubules thereby stabilizing the cytoskeleton of the axon of the neurons. The microtubule binding region of tau consists of 4 pseudo-repeats. In this study, we will focus on the aggregation propensity of two fragments. In this study we will focus on the PHF43 fragment that contains the third pseudo-repeat and has been shown experimentally to aggregate readily. Another fragment that contains the second pseudo-repeat will be considered as well. Mutations in this region are associated with various form of dementia and for this reason we will consider the mutant P301L.

  2. Loss of Tau protein affects the structure, transcription and repair of neuronal pericentromeric heterochromatin

    PubMed Central

    Mansuroglu, Zeyni; Benhelli-Mokrani, Houda; Marcato, Vasco; Sultan, Audrey; Violet, Marie; Chauderlier, Alban; Delattre, Lucie; Loyens, Anne; Talahari, Smail; Bégard, Séverine; Nesslany, Fabrice; Colin, Morvane; Souès, Sylvie; Lefebvre, Bruno; Buée, Luc; Galas, Marie-Christine; Bonnefoy, Eliette

    2016-01-01

    Pericentromeric heterochromatin (PCH) gives rise to highly dense chromatin sub-structures rich in the epigenetic mark corresponding to the trimethylated form of lysine 9 of histone H3 (H3K9me3) and in heterochromatin protein 1α (HP1α), which regulate genome expression and stability. We demonstrate that Tau, a protein involved in a number of neurodegenerative diseases including Alzheimer’s disease (AD), binds to and localizes within or next to neuronal PCH in primary neuronal cultures from wild-type mice. Concomitantly, we show that the clustered distribution of H3K9me3 and HP1α, two hallmarks of PCH, is disrupted in neurons from Tau-deficient mice (KOTau). Such altered distribution of H3K9me3 that could be rescued by overexpressing nuclear Tau protein was also observed in neurons from AD brains. Moreover, the expression of PCH non-coding RNAs, involved in PCH organization, was disrupted in KOTau neurons that displayed an abnormal accumulation of stress-induced PCH DNA breaks. Altogether, our results demonstrate a new physiological function of Tau in directly regulating neuronal PCH integrity that appears disrupted in AD neurons. PMID:27605042

  3. Lost after translation: missorting of Tau protein and consequences for Alzheimer disease.

    PubMed

    Zempel, Hans; Mandelkow, Eckhard

    2014-12-01

    Tau is a microtubule-associated-protein that is sorted into neuronal axons in physiological conditions. In Alzheimer disease (AD) and other tauopathies, Tau sorting mechanisms fail and Tau becomes missorted into the somatodendritic compartment. In AD, aberrant amyloid-β (Aβ) production might trigger Tau missorting. The physiological axonal sorting of Tau depends on the developmental stage of the neuron, the phosphorylation state of Tau and the microtubule cytoskeleton. Disease-associated missorting of Tau is connected to increased phosphorylation and aggregation of Tau, and impaired microtubule interactions. Disease-causing mechanisms involve impaired transport, aberrant kinase activation, non-physiological interactions of Tau, and prion-like spreading. In this review we focus on the physiological and pathological (mis)sorting of Tau, the underlying mechanisms, and effects in disease.

  4. Tau proteins harboring neurodegeneration-linked mutations impair kinesin translocation in vitro.

    PubMed

    Yu, Dezhi; LaPointe, Nichole E; Guzman, Elmer; Pessino, Veronica; Wilson, Leslie; Feinstein, Stuart C; Valentine, Megan T

    2014-01-01

    We tested the hypothesis that mutant tau proteins that cause neurodegeneration and dementia differentially alter kinesin translocation along microtubules (MTs) relative to normal tau in vitro. We employed complementary in vitro motility assays using purified recombinant kinesin, purified recombinant tau, and purified bovine brain α:β tubulin to isolate interactions among these components without any contribution by cellular regulatory mechanisms. We found that kinesin translocates slower along MTs assembled by any of three independent tau mutants (4-repeat P301L tau, 4-repeat ΔN296 tau, and 4-repeat R406W tau) relative to its translocation rate along MTs assembled by normal, 4-repeat wild type (WT) tau. Moreover, the R406W mutation exhibited isoform specific effects; while kinesin translocation along 4-repeat R406W tau assembled MTs is slower than along MTs assembled by 4-repeat WT tau, the R406W mutation had no effect in the 3-repeat tau context. These data provide strong support for the notion that aberrant modulation of kinesin translocation is a component of tau-mediated neuronal cell death and dementia. Finally, we showed that assembling MTs with taxol before coating them with mutant tau obscured effects of the mutant tau that were readily apparent using more physiologically relevant MTs assembled with tau alone, raising important issues regarding the use of taxol as an experimental reagent and novel insights into therapeutic mechanisms of taxol action.

  5. Changes in microtubule-associated protein tau during peripheral nerve injury and regeneration

    PubMed Central

    Zha, Guang-bin; Shen, Mi; Gu, Xiao-song; Yi, Sheng

    2016-01-01

    Tau, a primary component of microtubule-associated protein, promotes microtubule assembly and/or disassembly and maintains the stability of the microtubule structure. Although the importance of tau in neurodegenerative diseases has been well demonstrated, whether tau is involved in peripheral nerve regeneration remains unknown. In the current study, we obtained sciatic nerve tissue from adult rats 0, 1, 4, 7, and 14 days after sciatic nerve crush and examined tau mRNA and protein expression levels and the location of tau in the sciatic nerve following peripheral nerve injury. The results from our quantitative reverse transcription polymerase chain reaction analysis showed that compared with the uninjured control sciatic nerve, mRNA expression levels for both tau and tau tubulin kinase 1, a serine/threonine kinase that regulates tau phosphorylation, were decreased following peripheral nerve injury. Our western blot assay results suggested that the protein expression levels of tau and phosphorylated tau initially decreased 1 day post nerve injury but then gradually increased. The results of our immunohistochemical labeling showed that the location of tau protein was not altered by nerve injury. Thus, these results showed that the expression of tau was changed following sciatic nerve crush, suggesting that tau may be involved in peripheral nerve repair and regeneration. PMID:27857758

  6. Reduced miR-512 and the Elevated Expression of Its Targets cFLIP and MCL1 Localize to Neurons With Hyperphosphorylated Tau Protein in Alzheimer Disease.

    PubMed

    Mezache, Louisa; Mikhail, Madison; Garofalo, Michela; Nuovo, Gerard J

    2015-10-01

    The cause for the neurofibrillary tangles and plaques in Alzheimer disease likely relates to an abnormal accumulation of their key components, which include β-amyloid and hyperphosphorylated tau protein. We segregated Alzheimer brain sections from people with end-stage disease into those with abundant hyperphosphorylated tau protein and those without and compared each to normal brains for global microRNA patterns. A significant reduced expression of several microRNAs, including miR-512, was evident in the Alzheimer brain sections with abundant hyperphosphorylated tau. Immunohistochemistry documented that 2 known targets of microRNA-512, cFLIP and MCL1, were significantly over expressed and each colocalized to neurons with the abnormal tau protein. Analysis for apoptosis including activated caspase-3, increased caspase-4 and caspase-8, apoptosis initiating factor, APAF-1 activity, and the TUNEL assay was negative in the areas where neurons showed hyperphosphorylated tau. MCM2 expression, a marker of neuroprogenitor cells, was significantly reduced in the Alzheimer sections that contained the hyperphosphorylated tau. These results suggest that a basic defect in Alzheimer disease may be the reduced microRNA-driven increased expression of proteins that may alter the apoptotic/antiapoptotic balance of neurons. This, in turn, could lead to the accumulation of key Alzheimer proteins such as hyperphosphorylated tau that ultimately prevent normal neuronal function and lead to disease symptomatology.

  7. A novel tubulin-dependent protein kinase forming a paired helical filament epitope on tau.

    PubMed

    Ishiguro, K; Ihara, Y; Uchida, T; Imahori, K

    1988-09-01

    From rat brain microtubule proteins, we purified a protein kinase that phosphorylated tau, one of microtubule-associated proteins. The electrophoretic mobility of the phosphorylated tau on SDS-polyacrylamide gel decreased. The enzyme was not activated by cyclic nucleotides, calmodulin, or phospholipids, and was inhibited by the calcium ions. The kinase bound to tau. The phosphorylation of tau was stimulated by tubulin under the condition of microtubule formation. From these results we propose an idea that the phosphorylation could occur concomitantly with microtubule formation in the brain. Human tau phosphorylated by the kinase carried an epitope of the paired helical filaments that accumulate in the brain in Alzheimer's disease.

  8. PACSIN1, a Tau-interacting protein, regulates axonal elongation and branching by facilitating microtubule instability.

    PubMed

    Liu, Yingying; Lv, Kaosheng; Li, Zenglong; Yu, Albert C H; Chen, Jianguo; Teng, Junlin

    2012-11-16

    Tau is a major member of the neuronal microtubule-associated proteins. It promotes tubulin assembly and stabilizes axonal microtubules. Previous studies have demonstrated that Tau forms cross-bridges between microtubules, with some particles located on cross-bridges, suggesting that some proteins interact with Tau and might be involved in regulating Tau-related microtubule dynamics. This study reports that PACSIN1 interacts with Tau in axon. PACSIN1 blockade results in impaired axonal elongation and a higher number of primary axonal branches in mouse dorsal root ganglia neurons, which is induced by increasing the binding ability of Tau to microtubules. In PACSIN1-blocked dorsal root ganglia neurons, a greater amount of Tau is inclined to accumulate in the central domain of growth cones, and it promotes the stability of the microtubule network. Taken together, these results suggest that PACSIN1 is an important Tau binding partner in regulating microtubule dynamics and forming axonal plasticity.

  9. Thermodynamics of the interaction between Alzheimer's disease related tau protein and DNA.

    PubMed

    Camero, Sergio; Benítez, María J; Cuadros, Raquel; Hernández, Félix; Avila, Jesús; Jiménez, Juan S

    2014-01-01

    Tau hyperphosphorylation can be considered as one of the hallmarks of Alzheimer's disease and other tauophaties. Besides its well-known role as a microtubule associated protein, Tau displays a key function as a protector of genomic integrity in stress situations. Phosphorylation has been proven to regulate multiple processes including nuclear translocation of Tau. In this contribution, we are addressing the physicochemical nature of DNA-Tau interaction including the plausible influence of phosphorylation. By means of surface plasmon resonance (SPR) we measured the equilibrium constant and the free energy, enthalpy and entropy changes associated to the Tau-DNA complex formation. Our results show that unphosphorylated Tau binding to DNA is reversible. This fact is in agreement with the protective role attributed to nuclear Tau, which stops binding to DNA once the insult is over. According to our thermodynamic data, oscillations in the concentration of dephosphorylated Tau available to DNA must be the variable determining the extent of Tau binding and DNA protection. In addition, thermodynamics of the interaction suggest that hydrophobicity must represent an important contribution to the stability of the Tau-DNA complex. SPR results together with those from Tau expression in HEK cells show that phosphorylation induces changes in Tau protein which prevent it from binding to DNA. The phosphorylation-dependent regulation of DNA binding is analogous to the Tau-microtubules binding inhibition induced by phosphorylation. Our results suggest that hydrophobicity may control Tau location and DNA interaction and that impairment of this Tau-DNA interaction, due to Tau hyperphosphorylation, could contribute to Alzheimer's pathogenesis.

  10. Effect of the microtubule-associated protein tau on dynamics of single-headed motor proteins KIF1A

    NASA Astrophysics Data System (ADS)

    Sparacino, J.; Farías, M. G.; Lamberti, P. W.

    2014-02-01

    Intracellular transport based on molecular motors and its regulation are crucial to the functioning of cells. Filamentary tracks of the cells are abundantly decorated with nonmotile microtubule-associated proteins, such as tau. Motivated by experiments on kinesin-tau interactions [Dixit et al., Science 319, 1086 (2008), 10.1126/science.1152993] we developed a stochastic model of interacting single-headed motor proteins KIF1A that also takes into account the interactions between motor proteins and tau molecules. Our model reproduces experimental observations and predicts significant effects of tau on bound time and run length which suggest an important role of tau in regulation of kinesin-based transport.

  11. Altered phosphorylation of. tau. protein in heat-shocked rats and patients with Alzheimer disease

    SciTech Connect

    Papasozomenos, S.C.; Yuan Su Baylor College of Medicine, Houston, TX )

    1991-05-15

    Six hours after heat shocking 2- to 3-month-old male and female Sprague-Dawley rats at 42C for 15 min, the authors analyzed {tau} protein immunoreactivity in SDS extracts of cerebrums and peripheral nerves by using immunoblot analysis and immunohistochemistry with the anti-{tau} monoclonal antibody Tau-1, which recognizes a phosphate-dependent nonphosphorylated epitope, and with {sup 125}I-labeled protein A. In the cerebal extracts, the authors found altered phosphorylation of {tau} in heat-shocked females, characterized by a marked reduction in the amount of nonphosphorylated {tau}, a doubling of the ratio of total (phosphorylated plus nonphosphorylated) {tau} to nonphosphorylated {tau}, and the appearance of the slowest moving phosphorylated {tau} polypeptide (68 kDa). Similar, but milder, changes were observed in male rats. Quantitative immunoblot analysis of cortex and the underlying white matter with Tau-1 and {sup 125}I-labeled protein A showed that the amount of phosphorylated {tau} progressively increased in the Alzheimer disease-affected cerebral cortex, while concurrently a proportionally lesser amount of {tau} entered the white matter axons. The similar findings for the rat heat-shock model and Alzheimer disease suggest that life stressors may play a role in the etiopathogenesis of Alzheimer's disease.

  12. Role of Tau, a microtubule associated protein, in Drosophila photoreceptor morphogenesis.

    PubMed

    Nam, Sang-Chul

    2016-11-01

    Cell polarity genes have important functions in photoreceptor morphogenesis. Based on recent discovery of stabilized microtubule cytoskeleton in developing photoreceptors and its role in photoreceptor cell polarity, microtubule associated proteins might have important roles in controlling cell polarity proteins' localizations in developing photoreceptors. Here, Tau, a microtubule associated protein, was analyzed to find its potential role in photoreceptor cell polarity. Tau colocalizes with acetylated/stabilized microtubules in developing pupal photoreceptors. Although it is known that tau mutant photoreceptor has no defects in early eye differentiation and development, it shows dramatic disruptions of cell polarity proteins, adherens junctions, and the stable microtubules in developing pupal photoreceptors. This role of Tau in cell polarity proteins' localization in photoreceptor cells during the photoreceptor morphogenesis was further supported by Tau's overexpression studies. Tau overexpression caused dramatic expansions of apical membrane domains where the polarity proteins localize in the developing pupal photoreceptors. It is also found that Tau's role in photoreceptor cell polarity depends on Par-1 kinase. Furthermore, a strong genetic interaction between tau and crumbs was found. It is found that Tau has a crucial role in cell polarity protein localization during pupal photoreceptor morphogenesis stage, but not in early eye development including eye cell differentiation.

  13. Oligomerization of the microtubule-associated protein tau is mediated by its N-terminal sequences: implications for normal and pathological tau action.

    PubMed

    Feinstein, H Eric; Benbow, Sarah J; LaPointe, Nichole E; Patel, Nirav; Ramachandran, Srinivasan; Do, Thanh D; Gaylord, Michelle R; Huskey, Noelle E; Dressler, Nicolette; Korff, Megan; Quon, Brady; Cantrell, Kristi Lazar; Bowers, Michael T; Lal, Ratnesh; Feinstein, Stuart C

    2016-06-01

    Despite extensive structure-function analyses, the molecular mechanisms of normal and pathological tau action remain poorly understood. How does the C-terminal microtubule-binding region regulate microtubule dynamics and bundling? In what biophysical form does tau transfer trans-synaptically from one neuron to another, promoting neurodegeneration and dementia? Previous biochemical/biophysical work led to the hypothesis that tau can dimerize via electrostatic interactions between two N-terminal 'projection domains' aligned in an anti-parallel fashion, generating a multivalent complex capable of interacting with multiple tubulin subunits. We sought to test this dimerization model directly. Native gel analyses of full-length tau and deletion constructs demonstrate that the N-terminal region leads to multiple bands, consistent with oligomerization. Ferguson analyses of native gels indicate that an N-terminal fragment (tau(45-230) ) assembles into heptamers/octamers. Ferguson analyses of denaturing gels demonstrates that tau(45-230) can dimerize even in sodium dodecyl sulfate. Atomic force microscopy reveals multiple levels of oligomerization by both full-length tau and tau(45-230) . Finally, ion mobility-mass spectrometric analyses of tau(106-144) , a small peptide containing the core of the hypothesized dimerization region, also demonstrate oligomerization. Thus, multiple independent strategies demonstrate that the N-terminal region of tau can mediate higher order oligomerization, which may have important implications for both normal and pathological tau action. The microtubule-associated protein tau is essential for neuronal development and maintenance, but is also central to Alzheimer's and related dementias. Unfortunately, the molecular mechanisms underlying normal and pathological tau action remain poorly understood. Here, we demonstrate that tau can homo-oligomerize, providing novel mechanistic models for normal tau action (promoting microtubule growth and

  14. Mechanical Dilution of Beta-amyloid Peptide and Phosphorylated Tau Protein in Alzheimer's Disease: Too Simple to be True?

    PubMed Central

    2017-01-01

    The neuropathology of Alzheimer's disease (AD) is characterized by the widespread accumulation of neuritic plaques and neurofibrillary tangles composed of deposits of beta-amyloid peptide (Aβ) and abnormally phosphorylated tau protein (phospho-tau) respectively. Considerable effort has been expended to identify methods to retard the deposition of these proteins or to enhance their clearance. It is strikingly surprising that until now, very few researchers have attempted to remove these proteins using mechanical procedures. In this article, we start by showing the rationale of mechanical dilution of cerebrospinal fluid (CSF) as a therapeutic approach in AD. Then, we present models of implantable systems allowing mechanical dilution of CSF by means of CSF replacement and CSF filtration (liquorpheresis). We conclude that even though this approach seems simplistic, it is feasible and deserves exploration.

  15. Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52

    NASA Astrophysics Data System (ADS)

    Jo, Chulman; Gundemir, Soner; Pritchard, Susanne; Jin, Youngnam N.; Rahman, Irfan; Johnson, Gail V. W.

    2014-03-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal transcription factor in the defence against oxidative stress. Here we provide evidence that activation of the Nrf2 pathway reduces the levels of phosphorylated tau by induction of an autophagy adaptor protein NDP52 (also known as CALCOCO2) in neurons. The expression of NDP52, which we show has three antioxidant response elements (AREs) in its promoter region, is strongly induced by Nrf2, and its overexpression facilitates clearance of phosphorylated tau in the presence of an autophagy stimulator. In Nrf2-knockout mice, phosphorylated and sarkosyl-insoluble tau accumulates in the brains concurrent with decreased levels of NDP52. Moreover, NDP52 associates with phosphorylated tau from brain cortical samples of Alzheimer disease cases, and the amount of phosphorylated tau in sarkosyl-insoluble fractions is inversely proportional to that of NDP52. These results suggest that NDP52 plays a key role in autophagy-mediated degradation of phosphorylated tau in vivo.

  16. The Metamorphic Nature of the Tau Protein: Dynamic Flexibility Comes at a Cost

    PubMed Central

    Sabbagh, Jonathan J.; Dickey, Chad A.

    2016-01-01

    Accumulation of the microtubule associated protein tau occurs in several neurodegenerative diseases including Alzheimer's disease (AD). The tau protein is intrinsically disordered, giving it unique structural properties that can be dynamically altered by post-translational modifications such as phosphorylation and cleavage. Over the last decade, technological advances in nuclear magnetic resonance (NMR) spectroscopy and structural modeling have permitted more in-depth insights into the nature of tau. These studies have helped elucidate how metamorphism of tau makes it ideally suited for dynamic microtubule regulation, but how it also facilitates tau self-assembly, oligomerization, and neurotoxicity. This review will focus on how the distinct structure of tau governs its function, accumulation, and toxicity as well as how other cellular factors such as molecular chaperones control these processes. PMID:26834532

  17. The Metamorphic Nature of the Tau Protein: Dynamic Flexibility Comes at a Cost.

    PubMed

    Sabbagh, Jonathan J; Dickey, Chad A

    2016-01-01

    Accumulation of the microtubule associated protein tau occurs in several neurodegenerative diseases including Alzheimer's disease (AD). The tau protein is intrinsically disordered, giving it unique structural properties that can be dynamically altered by post-translational modifications such as phosphorylation and cleavage. Over the last decade, technological advances in nuclear magnetic resonance (NMR) spectroscopy and structural modeling have permitted more in-depth insights into the nature of tau. These studies have helped elucidate how metamorphism of tau makes it ideally suited for dynamic microtubule regulation, but how it also facilitates tau self-assembly, oligomerization, and neurotoxicity. This review will focus on how the distinct structure of tau governs its function, accumulation, and toxicity as well as how other cellular factors such as molecular chaperones control these processes.

  18. A High-throughput Screening Assay for Determining Cellular Levels of Total Tau Protein

    PubMed Central

    Dehdashti, Seameen J.; Zheng, Wei; Gever, Joel R.; Wilhelm, Robert; Nguyen, Dac-Trung; Sittampalam, Gurusingham; McKew, John C.; Austin, Christopher P.; Prusiner, Stanley B.

    2014-01-01

    The microtubule-associated protein (MAP) tau has been implicated in the pathology of numerous neurodegenerative diseases. In the past decade, the hyperphosphorylated and aggregated states of tau protein have been important targets in the drug discovery field for the potential treatment of Alzheimer’s disease. Although several compounds have been reported to reduce the hyperphosphorylated state of tau or impact the stabilization of tau, their therapeutic activities are still to be validated. Recently, reduction of total cellular tau protein has emerged as an alternate intervention point for drug development and a potential treatment of tauopathies. We have developed and optimized a homogenous assay, using the AlphaLISA and HTRF assay technologies, for the quantification of total cellular tau protein levels in the SH-SY5Y neuroblastoma cell line. The signal-to-basal ratios were 375 and 5.3, and the Z’ factors were 0.67 and 0.60 for the AlphaLISA and HTRF tau assays, respectively. The clear advantages of this homogeneous tau assay over conventional total tau assays, such as ELISA and Western blot, are the elimination of plate wash steps and miniaturization of the assay into 1536-well plate format for the ultra–high-throughput screening of large compound libraries. PMID:23905996

  19. Tau protein is essential for stress-induced brain pathology

    PubMed Central

    Lopes, Sofia; Vaz-Silva, João; Pinto, Vitor; Dalla, Christina; Kokras, Nikolaos; Bedenk, Benedikt; Mack, Natalie; Czisch, Michael; Almeida, Osborne F. X.; Sousa, Nuno; Sotiropoulos, Ioannis

    2016-01-01

    Exposure to chronic stress is frequently accompanied by cognitive and affective disorders in association with neurostructural adaptations. Chronic stress was previously shown to trigger Alzheimer’s-like neuropathology, which is characterized by Tau hyperphosphorylation and missorting into dendritic spines followed by memory deficits. Here, we demonstrate that stress-driven hippocampal deficits in wild-type mice are accompanied by synaptic missorting of Tau and enhanced Fyn/GluN2B-driven synaptic signaling. In contrast, mice lacking Tau [Tau knockout (Tau-KO) mice] do not exhibit stress-induced pathological behaviors and atrophy of hippocampal dendrites or deficits of hippocampal connectivity. These findings implicate Tau as an essential mediator of the adverse effects of stress on brain structure and function. PMID:27274066

  20. Tau Structures

    PubMed Central

    Avila, Jesus; Jiménez, Juan S.; Sayas, Carmen L.; Bolós, Marta; Zabala, Juan C.; Rivas, Germán; Hernández, Felix

    2016-01-01

    Tau is a microtubule-associated protein that plays an important role in axonal stabilization, neuronal development, and neuronal polarity. In this review, we focus on the primary, secondary, tertiary, and quaternary tau structures. We describe the structure of tau from its specific residues until its conformation in dimers, oligomers, and larger polymers in physiological and pathological situations. PMID:27877124

  1. Tau proteins: the molecular structure and mode of binding on microtubules

    PubMed Central

    1988-01-01

    Tau is a family of closely related proteins (55,000-62,000 mol wt) which are contained in the nerve cells and copolymerize with tubulin to induce the formation of microtubules in vitro. All information so far has indicated that tau is closely apposed to the microtubule lattice, and there was no indication of domains projecting from the microtubule polymer lattice. We have studied the molecular structure of the tau factor and its mode of binding on microtubules using the quick-freeze, deep-etch method (QF.DE) and low angle rotary shadowing technique. Phosphocellulose column-purified tubulin from porcine brain was polymerized with tau and the centrifuged pellets were processed by QF.DE. We observed periodic armlike elements (18.7 +/- 4.8 nm long) projecting from the microtubule surface. Most of the projections appeared to cross-link adjacent microtubules. We measured the longitudinal periodicity of tau projections on the microtubules and found it to match the 6-dimer pattern better than the 12-dimer pattern. The stoichiometry of tau versus tubulin in preparations of tau saturated microtubules was 1:approximately 5.0 (molar ratio). Tau molecules adsorbed on mica took on rodlike forms (56.1 +/- 14.1 nm long). Although both tau and MAP1 are contained in axons, competitive binding studies demonstrated that the binding sites of tau and MAP1A on the microtubule surfaces are most distinct, although they may partially overlap. PMID:3139677

  2. Co-immunoprecipitation with Tau Isoform-specific Antibodies Reveals Distinct Protein Interactions and Highlights a Putative Role for 2N Tau in Disease*

    PubMed Central

    Liu, Chang; Song, Xiaomin; Nisbet, Rebecca

    2016-01-01

    Alternative splicing generates multiple isoforms of the microtubule-associated protein Tau, but little is known about their specific function. In the adult mouse brain, three Tau isoforms are expressed that contain either 0, 1, or 2 N-terminal inserts (0N, 1N, and 2N). We generated Tau isoform-specific antibodies and performed co-immunoprecipitations followed by tandem mass tag multiplexed quantitative mass spectrometry. We identified novel Tau-interacting proteins of which one-half comprised membrane-bound proteins, localized to the plasma membrane, mitochondria, and other organelles. Tau was also found to interact with proteins involved in presynaptic signal transduction. MetaCore analysis revealed one major Tau interaction cluster that contained 33 Tau pulldown proteins. To explore the pathways in which these proteins are involved, we conducted an ingenuity pathway analysis that revealed two significant overlapping pathways, “cell-to-cell signaling and interaction” and “neurological disease.” The functional enrichment tool DAVID showed that in particular the 2N Tau-interacting proteins were specifically associated with neurological disease. Finally, for a subset of Tau interactions (apolipoprotein A1 (apoA1), apoE, mitochondrial creatine kinase U-type, β-synuclein, synaptogyrin-3, synaptophysin, syntaxin 1B, synaptotagmin, and synapsin 1), we performed reverse co-immunoprecipitations, confirming the preferential interaction of specific isoforms. For example, apoA1 displayed a 5-fold preference for the interaction with 2N, whereas β-synuclein showed preference for 0N. Remarkably, a reverse immunoprecipitation with apoA1 detected only the 2N isoform. This highlights distinct protein interactions of the different Tau isoforms, suggesting that they execute different functions in brain tissue. PMID:26861879

  3. Intravenous immunoglobulin products contain specific antibodies to recombinant human tau protein.

    PubMed

    Smith, Lynnae M; Coffey, Mary P; Klaver, Andrea C; Loeffler, David A

    2013-08-01

    Intravenous immunoglobulin (IVIG) products are prepared from plasma immunoglobulins from healthy donors. Pilot studies suggest that IVIG may stabilize cognitive functioning in patients with mild-to-moderate Alzheimer's disease. This study measured antibodies to recombinant human tau protein in the IVIG products Gammagard (Baxter), Gamunex (Talecris), and Flebogamma (Grifols). Anti-tau antibodies were measured by ELISA, subtracting IVIG's polyvalent binding from its binding to tau-coated wells to calculate specific anti-tau antibody levels. Because polyvalent binding of IVIG products may interfere with ELISA measurement of their specific antibody levels, the percentage of binding of each IVIG product to tau-coated wells that was specific for tau was also determined. Specific anti-tau antibodies were detected in all three IVIG products, with significant differences between these products (p<0.001) even when Flebogamma's anti-tau antibodies were doubled to account for its preparation as a 5% solution vs. 10% solutions for Gammagard and Gamunex (means: Gammagard, 3.1 μg/ml; Gamunex, 2.5 μg/ml; Flebogamma, 1.2 μg/ml). The percentages of each IVIG product's specific binding to tau-coated wells also varied between the various products (p<0.001) and between all pairs of IVIG products (means: Gammagard, 73.1%; Flebogamma, 54.5%; Gamunex, 37.4%; p<0.01 for all pairwise comparisons). These findings indicate that IVIG products contain specific anti-tau antibodies. The concentrations of these antibodies and the percentages of specific binding of IVIG to tau-coated wells vary between IVIG products. Further studies are indicated to determine if IVIG also contains antibodies to pathologic forms of tau.

  4. A bio-mimetic zinc/tau protein as an artificial catalase.

    PubMed

    Asadollahi, Kazem; Jasemi, Neda Sadat Kazemein; Riazi, Gholam Hossein; Katuli, Fatemeh Hedayati; Yazdani, Fahimeh; Sartipnia, Nasrin; Moosavi, Mohammad Amin; Rahimi, Arash; Falahati, Mojtaba

    2016-11-01

    In this study, the catalase-like activity of monomeric tau protein was reported in the presence of of zinc (Zn(II)) ions at low pH value. Monomeric tau protein contains two SH groups that are a target of disulfide bond formation. However these SH groups are able to interact with Zn(II) ion at pH 7.2 which creates a thiol bond as a mimetic model of chloroperoxidase active site which performs catalase like activity at low pH. Zn(II)/tau protein complex decomposed H2O2 with a high rate (Vm) as well as an efficient turn oven number (kcat) at pH 3. This remarkable catalase like activity is may be attributed to the conformational reorientation of protein at low pH. Circular dichroism (CD) studies did not demonstrate any secondary structural changes of tau protein after addition of Zn(II) ions at pH 7.2. In addition, tau protein shows identical CD bands at pH 7.2 and 3. Moreover, fluorescence quenching of tau by Zn(II) at pH 7.2 was initiated by complex formation rather than by dynamic collision. A significant red shift (6nm) was observed in the emission maximum of the fluorescence spectra when the protein was dissolved at pH 3 compared to pH 7.2. This conformational change can provide information regarding the rearrangements of the protein structure and exposure of Cys-Zn(II) group to the solvent which induces easy access of active site to H2O2 molecules and corresponding enhanced catalytic activity of Zn(II)/tau protein complex. This study introduces tau protein as a bio-inspired high performing scaffold for transition metal encapsulation and introducing an engineered apoprotein-induced biomimetic enzyme.

  5. Hyperphosphorylation of tau protein in the ipsilateral thalamus after focal cortical infarction in rats.

    PubMed

    Dong, Da-Wei; Zhang, Yu-Sheng; Yang, Wan-Yong; Wang-Qin, Run-Qi; Xu, An-Ding; Ruan, Yi-Wen

    2014-01-16

    Hyperphosphorylation of tau has been considered as an important risk factor for neurodegenerative diseases. It has been found also in the cortex after focal cerebral ischemia. The present study is aimed at investigating changes of tau protein expression in the ipsilateral thalamus remote from the primary ischemic lesion site after distal middle cerebral artery occlusion (MCAO). The number of neurons in the ventroposterior thalamic nucleus (VPN) was evaluated using Nissl staining and neuronal nuclei (NeuN) immunostaining. Total tau and phosphorylated tau at threonine 231 (p-T231-tau) and serine 199 (p-S199-tau) levels, respectively, in the thalamus were measured using immunostaining and immunoblotting. Moreover, apoptosis was detected with terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP-biotin nick-end labeling (TUNEL) assay. It was found that the numbers of intact neurons and NeuN(+) cells within the ipsilateral VPN were reduced significantly compared with the sham-operated group, but the levels of p-T231-tau and p-S199-tau in the ipsilateral thalamus were increased significantly in rats subjected to ischemia for 3 days, 7 days and 28 days. Furthermore, the number of TUNEL-positive cells was increased in the ipsilateral VPN at 7 days and 28 days after MCAO. Thus, hyperphosphorylated tau protein is observed in ipsilateral thalamus after focal cerebral infarction in this study. Our findings suggest that the expression of hyperphosphorylated tau protein induced by ischemia may be associated with the secondary thalamic damage after focal cortical infarction via an apoptotic pathway.

  6. Conformational features of tau fibrils from Alzheimer’s disease brain are faithfully propagated by unmodified recombinant protein

    PubMed Central

    Morozova, Olga A.; March, Zachary M.; Robinson, Anne S.; Colby, David W.

    2014-01-01

    Fibrils composed of tau protein are a pathological hallmark of several neurodegenerative disorders including Alzheimer’s disease (AD). Here we show that when recombinant tau protein is seeded with paired helical filaments (PHFs) isolated from AD brain, the amyloid formed shares many of the structural features of AD PHFs. In contrast, tau amyloids formed with heparin as an inducing agent—a common biochemical model of tau misfolding—are structurally distinct from brain-derived PHFs. Using ultrastructural analysis by electron microscopy, circular dichroism, and chemical denaturation, we found that AD seeded recombinant tau fibrils were not significantly different than tau fibrils isolated from AD brain tissue. Tau fibrils produced by incubating recombinant tau with heparin had significantly narrower fibrils with a longer periodicity, higher chemical stability, and distinct secondary structure compared to AD PHFs. The addition of heparin to the reaction of recombinant tau and AD PHFs also corrupted the templating process, resulting in a mixture of fibril conformations. Our results suggest that AD-isolated PHFs act as a conformational template for the formation of recombinant tau fibrils. Therefore, the use of AD PHFs as seeds to stimulate recombinant tau amyloid formation produces synthetic tau fibers that that closely resemble those associated with AD pathology and provides a biochemical model of tau misfolding that may be of improved utility for structural studies and drug screening. These results also demonstrate that posttranslational modifications such as phosphorylation are not a prerequisite for the propagation of the tau fibril conformation found in AD. PMID:24033133

  7. Triple-transgenic Alzheimer's disease mice exhibit region-specific abnormalities in brain myelination patterns prior to appearance of amyloid and tau pathology

    PubMed Central

    Desai, Maya K.; Sudol, Kelly L.; Janelsins, Michelle C.; Mastrangelo, Michael A.; Frazer, Maria E.; Bowers, William J.

    2008-01-01

    Alzheimer's disease (AD) is a progressively debilitating brain disorder pathologically defined by extracellular amyloid plaques, intraneuronal neurofibrillary tangles, and synaptic disintegrity. AD has not been widely considered a disease of white matter, but more recent evidence suggests the existence of abnormalities in myelination patterns and myelin attrition in AD-afflicted human brains. Herein, we demonstrate that triple-transgenic AD (3xTg-AD) mice, which harbor the human amyloid precursor protein Swedish mutant transgene, presenilin knock-in mutation, and tau P301L mutant transgene, exhibit significant region-specific alterations in myelination patterns and in oligodendrocyte marker expression profiles at time points preceding the appearance of amyloid and tau pathology. These immunohistochemical signatures are coincident with age-related alterations in axonal and myelin sheath ultrastructure as visualized by comparative electron microscopic examination of 3xTg-AD and non-transgenic mouse brain tissue. Overall, these findings indicate 3xTg-AD mice represent a viable model in which to examine mechanisms underlying AD-related myelination and neural transmission defects that occur early during pre-symptomatic stages of the disease process. PMID:18661556

  8. Soluble Conformers of Aβ and Tau Alter Selective Proteins Governing Axonal Transport

    PubMed Central

    Sherman, Mathew A.; LaCroix, Michael; Amar, Fatou; Larson, Megan E.; Forster, Colleen; Aguzzi, Adriano; Bennett, David A.; Ramsden, Martin

    2016-01-01

    Despite the demonstration that amyloid-β (Aβ) can trigger increased tau phosphorylation and neurofibrillary tangle (NFT) formation in vivo, the molecular link associating Aβ and tau pathologies remains ill defined. Here, we observed that exposure of cultured primary neurons to Aβ trimers isolated from brain tissue of subjects with Alzheimer's disease led to a specific conformational change of tau detected by the antibody Alz50. A similar association was supported by postmortem human brain analyses. To study the role of Aβ trimers in vivo, we created a novel bigenic Tg-Aβ+Tau mouse line by crossing Tg2576 (Tg-Aβ) and rTg4510 (Tg-Tau) mice. Before neurodegeneration and amyloidosis, apparent Aβ trimers were increased by ∼2-fold in 3-month-old Tg-Aβ and Tg-Aβ+Tau mice compared with younger mice, whereas soluble monomeric Aβ levels were unchanged. Under these conditions, the expression of soluble Alz50-tau conformers rose by ∼2.2-fold in the forebrains of Tg-Aβ+Tau mice compared with nontransgenic littermates. In parallel, APP accumulated intracellularly, suggestive of a putative dysfunction of anterograde axonal transport. We found that the protein abundance of the kinesin-1 light chain (KLC1) was reduced selectively in vivo and in vitro when soluble Aβ trimers/Alz50-tau were present. Importantly, the reduction in KLC1 was prevented by the intraneuronal delivery of Alz50 antibodies. Collectively, our findings reveal that specific soluble conformers of Aβ and tau cooperatively disrupt axonal transport independently from plaques and tangles. Finally, these results suggest that not all endogenous Aβ oligomers trigger the same deleterious changes and that the role of each assembly should be considered separately. SIGNIFICANCE STATEMENT The mechanistic link between amyloid-β (Aβ) and tau, the two major proteins composing the neuropathological lesions detected in brain tissue of Alzheimer's disease subjects, remains unclear. Here, we report that the

  9. Structure of a Protein Phosphatase 2A Holoenzyme: Insights into B55-Mediated Tau Dephosphorylation

    SciTech Connect

    Xu, Y.; Chen, Y; Zhang, P; Jeffrey, P; Shi, Y

    2008-01-01

    Protein phosphatase 2A (PP2A) regulates many essential aspects of cellular physiology. Members of the regulatory B/B55/PR55 family are thought to play a key role in the dephosphorylation of Tau, whose hyperphosphorylation contributes to Alzheimer's disease. The underlying mechanisms of the PP2A-Tau connection remain largely enigmatic. Here, we report the complete reconstitution of a Tau dephosphorylation assay and the crystal structure of a heterotrimeric PP2A holoenzyme involving the regulatory subunit B?. We show that B? specifically and markedly facilitates dephosphorylation of the phosphorylated Tau in our reconstituted assay. The B? subunit comprises a seven-bladed ? propeller, with an acidic, substrate-binding groove located in the center of the propeller. The ? propeller latches onto the ridge of the PP2A scaffold subunit with the help of a protruding ? hairpin arm. Structure-guided mutagenesis studies revealed the underpinnings of PP2A-mediated dephosphorylation of Tau.

  10. Differential phosphorylation of tau proteins during kitten brain development and Alzheimer's disease.

    PubMed

    Riederer, B M; Mourton-Gilles, C; Frey, P; Delacourte, A; Probst, A

    2001-02-01

    Differential distribution and phosphorylation of tau proteins were studied in developing kitten brain by using several antibodies, and was compared to phosphorylation in Alzheimer's disease. Several antibodies demonstrated the presence of phosphorylated tau proteins during kitten brain development and identified pathological structures in human brain tissue. Antibody AD2, recognized tau in kittens and adult cats, but reacted in Alzheimer's tissue only with a pathological tau form. Antibody AT8 was prominent in developing kitten neurons and was found in axons and dendrites. After the first postnatal month this phosphorylation type disappeared from axons. Furthermore, dephosphorylation of kitten tau with alkaline phosphatase abolished immunoreactivity of AT8, but not that of AD2, pointing to a protection of the AD2 epitope in cats. Tau proteins during early cat brain development are phosphorylated at several sites that are also phosphorylated in paired helical filaments during Alzheimer's disease. In either event, phosphorylation of tau may play a crucial role to modulate microtubule dynamics, contributing to increased microtubule instability and promoting growth of processes during neuronal development or changing dynamic properties of the cytoskeleton and contributing to the formation of pathological structures in neurodegenerative diseases.

  11. Model Hirano bodies protect against tau-independent and tau-dependent cell death initiated by the amyloid precursor protein intracellular domain.

    PubMed

    Furgerson, Matthew; Fechheimer, Marcus; Furukawa, Ruth

    2012-01-01

    The main pathological hallmarks of Alzheimer's disease are amyloid-beta plaques and neurofibrillary tangles, which are primarily composed of amyloid precursor protein (APP) and tau, respectively. These proteins and their role in the mechanism of neurodegeneration have been extensively studied. Hirano bodies are a frequently occurring pathology in Alzheimer's disease as well as other neurodegenerative diseases. However, the physiological role of Hirano bodies in neurodegenerative diseases has yet to be determined. We have established cell culture models to study the role of Hirano bodies in amyloid precursor protein and tau-induced cell death mechanisms. Exogenous expression of APP and either of its c-terminal fragments c31 or Amyloid Precursor Protein Intracellular Domain c58 (AICDc58) enhance cell death. The presence of tau is not required for this enhanced cell death. However, the addition of a hyperphosphorylated tau mimic 352PHPtau significantly increases cell death in the presence of both APP and c31 or AICDc58 alone. The mechanism of cell death induced by APP and its c-terminal fragments and tau was investigated. Fe65, Tip60, p53, and caspases play a role in tau-independent and tau-dependent cell death. In addition, apoptosis was determined to contribute to cell death. The presence of model Hirano bodies protected against cell death, indicating Hirano bodies may play a protective role in neurodegeneration.

  12. Intrinsically disordered tau protein in Alzheimer's tangles: a coincidence or a rule?

    PubMed

    Skrabana, R; Skrabanova, M; Csokova, N; Sevcik, J; Novak, M

    2006-01-01

    Tau protein, the major constituent of neurofibrillary tangles in Alzheimer's disease (AD) and related tauopathies, is classified as intrinsically disordered protein (IDP). IDPs in contrast to globular proteins contain high proportion of polar and charged amino acids in their sequence, which results in the absence of a well-defined three-dimensional structure of the free protein. Structural flexibility of IDPs is required to perform their important role in many cellular processes. In the course of tauopathies, highly soluble disordered tau protein acquires rigid fold and forms highly insoluble filaments. Beneficial intrinsic disorder transforms into a fatal order: is it a coincidence, or is there an underlying reason for preferential IDPs assembly? In this review we present the structural characteristics of tau protein filamentous lesions in AD and discuss the tendency of IDPs to assembly and to form amyloid deposits (Ref: 65).

  13. Heat-induced immunoreactivity of tau protein in neocortical neurons of fire fatalities.

    PubMed

    Kibayashi, Kazuhiko; Shojo, Hideki

    2003-10-01

    Tau protein is the main component of neurofibrillary tangles of Alzheimer's disease (AD). Immunohistochemistry of tau protein is useful in the diagnosis of AD but produces diffuse staining of neocortical neurons in fire fatalities. To learn the cause of this phenomenon, we examined the temporal neocortex of 13 fire fatalities and 9 fatalities unrelated to fire. The diffuse tau immunoreactive neurons were observed in 10 fire fatalities with heat coagulation of the cerebrum. Diffuse staining was not found in the three fire fatalities without heat coagulation of the cerebrum or in fatalities unrelated to fire. The immunoreactivity progressively increased as a function of the degree of cerebral heat coagulation. These results demonstrate that diffuse tau immunoreactivity of neocortical neurons is a post-mortem phenomenon caused by prolonged exposure of the head to intense heat. Forensic pathologists should consider this phenomenon when they diagnose AD in fire fatalities.

  14. Computational Study of Pseudo-phosphorylation of the Microtubule associated Protein Tau

    NASA Astrophysics Data System (ADS)

    Prokopovich, Dmitriy; Larini, Luca

    This computational study focuses on the effect of pseudo-phosphorylation on the aggregation of the microtubule associated protein tau. In the axon of the neuron, tau regulates the assembly of microtubules in the cytoskeleton. This is important for both stabilization of and transport across the microtubules. One of the hallmarks of the Alzheimer's disease is that tau is hyper-phosphorylated and aggregates into neurofibrillary tangles that lay waste to the neurons. It is not known if hyper-phosphorylation directly causes the aggregation of tau into tangles. Experimentally, pseudo-phosphorylation mimics the effects of phosphorylation by mutating certain residues of the protein chain into charged residues. In this study, we will consider the fragment called PHF43 that belongs to the microtubule binding region and has been shown to readily aggregate.

  15. Simultaneous quantification of Myelin Basic Protein and Tau proteins in cerebrospinal fluid and serum of Multiple Sclerosis patients using nanoimmunosensor.

    PubMed

    Derkus, Burak; Acar Bozkurt, Pinar; Tulu, Metin; Emregul, Kaan C; Yucesan, Canan; Emregul, Emel

    2017-03-15

    This study was aimed at the development of an immunosensor for the simultaneous quantification of Myelin Basic Protein (MBP) and Tau proteins in cerebrospinal fluid (CSF) and serum, obtained from Multiple Sclerosis (MS) patients. The newly developed GO/pPG/anti-MBP/anti-Tau nanoimmunosensor has been established by immobilization of MBP and Tau antibodies. The newly developed nanoimmunosensor was tested, optimized and characterized using differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). The developed nanoimmunosensor was seen to have detection limits of 0.30nM for MBP and 0.15nM for Tau proteins which were sufficient for the levels to be analysed in neuro-clinic. The clinical study performed using CSF and serum of MS patients showed that the designed nanoimmunosensor was capable of detecting the proteins properly, that were essentially proven by ELISA.

  16. Tau as a biomarker of neurodegenerative diseases

    PubMed Central

    Schraen-Maschke, Susanna; Sergeant, Nicolas; Dhaenens, Claire-Marie; Bombois, Stephanie; Deramecourt, Vincent; Caillet-Boudin, Marie-Laure; Pasquier, Florence; Maurage, Claude-Alain; Sablonniere, Bernard; Vanmechelen, Eugeen; Buee, Luc

    2008-01-01

    Summary The microtubule associated protein Tau is mainly expressed in neurons of the central nervous system and is crucial in axonal maintenance and axonal transport. The rationale for Tau as a biomarker of neurodegenerative diseases is that it is a major component of abnormal intraneuronal aggregates observed in numerous of these diseases named Tauopathies, including Alzheimer’s disease. The molecular diversity of Tau is very useful when analysing it in the brain or in the peripheral fluids. Immunohistochemical and biochemical characterisation of Tau aggregates in the brain allows the post-mortem classification and differential diagnosis of Tauopathies. As peripheral biomarker of Alzheimer’s disease in the cerebrospinal fluid, Tau proteins are now validated for diagnosis and predictive purposes. For the future, the detailed characterization of Tau in brain and in peripheral fluids will lead to novel promising biomarkers for differential diagnosis of dementia and monitoring of therapeutics. PMID:20477391

  17. Simplified method to obtain enhanced expression of tau protein from E. coli and one-step purification by direct boiling.

    PubMed

    KrishnaKumar, V Guru; Gupta, Sharad

    2017-01-03

    Tau is an intrinsically disordered protein responsible for maintaining the structure and stability of axonal microtubules. However, in certain disease conditions including Alzheimer's disease, tau protein may undergo biochemical and structural changes to form intracellular aggregates. Since tau is a proline- and arginine-rich eukaryotic protein, heterologous expression in Escherichia coli often results in poor yield and has been a major technical challenge. In the current work, we have improved the expressed yield of tau by overcoming codon bias problem and established a simplified protocol for efficient extraction. The reported method has two distinct features: (i) enhanced tau expression (upto eightfold) by supplementing deficient tRNAs that aid in rapid translation and (ii) direct boiling of expressed E. coli cells to extract tau with no separate cell lysis step. We further demonstrate that tau extracted by the direct boiling method is similar to tau purified by size-exclusion chromatography exhibiting similar structural and biophysical characteristics including aggregation propensity. Since morphologies and in vitro toxicity of fibrillar tau aggregates were also similar, tau extracted by the one-step direct boiling method can be used for tau aggregation assays without any additional purification.

  18. Exaggerated phosphorylation of brain tau protein in CRH KO mice exposed to repeated immobilization stress.

    PubMed

    Kvetnansky, Richard; Novak, Petr; Vargovic, Peter; Lejavova, Katarina; Horvathova, Lubica; Ondicova, Katarina; Manz, George; Filipcik, Peter; Novak, Michal; Mravec, Boris

    2016-07-01

    Neuroendocrine and behavioral stress responses are orchestrated by corticotropin-releasing hormone (CRH) and norepinephrine (NE) synthesizing neurons. Recent findings indicate that stress may promote development of neurofibrillary pathology in Alzheimer's disease. Therefore, we investigated relationships among stress, tau protein phosphorylation, and brain NE using wild-type (WT) and CRH-knockout (CRH KO) mice. We assessed expression of phosphorylated tau (p-tau) at the PHF-1 epitope and NE concentrations in the locus coeruleus (LC), A1/C1 and A2/C2 catecholaminergic cell groups, hippocampus, amygdala, nucleus basalis magnocellularis, and frontal cortex of unstressed, singly stressed or repeatedly stressed mice. Moreover, gene expression and protein levels of tyrosine hydroxylase (TH) and CRH receptor mRNA were determined in the LC. Plasma corticosterone levels were also measured. Exposure to a single stress increases tau phosphorylation throughout the brain in WT mice when compared to singly stressed CRH KO animals. In contrast, repeatedly stressed CRH KO mice showed exaggerated tau phosphorylation relative to WT controls. We also observed differences in extent of tau phosphorylation between investigated structures, e.g. the LC and hippocampus. Moreover, CRH deficiency leads to different responses to stress in gene expression of TH, NE concentrations, CRH receptor mRNA, and plasma corticosterone levels. Our data indicate that CRH effects on tau phosphorylation are dependent on whether stress is single or repeated, and differs between brain regions. Our findings indicate that CRH attenuates mechanisms responsible for development of stress-induced tau neuropathology, particularly in conditions of chronic stress. However, the involvement of central catecholaminergic neurons in these mechanisms remains unclear and is in need of further investigation.

  19. Mechanical Effects of Dynamic Binding between Tau Proteins on Microtubules during Axonal Injury

    PubMed Central

    Ahmadzadeh, Hossein; Smith, Douglas H.; Shenoy, Vivek B.

    2015-01-01

    The viscoelastic nature of axons plays a key role in their selective vulnerability to damage in traumatic brain injury (TBI). Experimental studies have shown that although axons can tolerate 100% strain under slow loading rates, even strain as small as 5% can rupture microtubules (MTs) during the fast loading velocities relevant to TBI. Here, we developed a computational model to examine rate-dependent behavior related to dynamic interactions between MTs and the MT-associated protein tau under varying strains and strain rates. In the model, inverted pairs of tau proteins can dynamically cross-link parallel MTs via the respective MT-binding domain of each tau. The model also incorporates realistic thermodynamic breaking and reformation of the bonds between the connected tau proteins as they respond to mechanical stretch. With simulated stretch of the axon, the model shows that despite the highly dynamic nature of binding and unbinding events, under fast loading rates relevant to TBI, large tensile forces can be transmitted to the MTs that can lead to mechanical rupture of the MT cylinder, in agreement with experimental observations and as inferred in human TBI. In contrast, at slow loading rates, the progressive breaking and reformation of the bonds between the tau proteins facilitate the extension of axons up to ∼100% strain without any microstructural damage. The model also predicts that under fast loading rates, individual MTs detach from MT bundles via sequential breaking of the tau-tau bonds. Finally, the model demonstrates that longer MTs are more susceptible to mechanical rupture, whereas short MTs are more prone to detachment from the MT bundle, leading to disintegration of the axonal MT ultrastructure. Notably, the predictions from the model are in excellent agreement with the findings of the recent in vitro mechanical testing of micropatterned neuronal cultures. PMID:26636944

  20. Early glycogen synthase kinase-3β and protein phosphatase 2A independent tau dephosphorylation during global brain ischaemia and reperfusion following cardiac arrest and the role of the adenosine monophosphate kinase pathway.

    PubMed

    Majd, Shohreh; Power, John H T; Koblar, Simon A; Grantham, Hugh J M

    2016-08-01

    Abnormal tau phosphorylation (p-tau) has been shown after hypoxic damage to the brain associated with traumatic brain injury and stroke. As the level of p-tau is controlled by Glycogen Synthase Kinase (GSK)-3β, Protein Phosphatase 2A (PP2A) and Adenosine Monophosphate Kinase (AMPK), different activity levels of these enzymes could be involved in tau phosphorylation following ischaemia. This study assessed the effects of global brain ischaemia/reperfusion on the immediate status of p-tau in a rat model of cardiac arrest (CA) followed by cardiopulmonary resuscitation (CPR). We reported an early dephosphorylation of tau at its AMPK sensitive residues, Ser(396) and Ser(262) after 2 min of ischaemia, which did not recover during the first two hours of reperfusion, while the tau phosphorylation at GSK-3β sensitive but AMPK insensitive residues, Ser(202) /Thr(205) (AT8), as well as the total amount of tau remained unchanged. Our data showed no alteration in the activities of GSK-3β and PP2A during similar episodes of ischaemia of up to 8 min and reperfusion of up to 2 h, and 4 weeks recovery. Dephosphorylation of AMPK followed the same pattern as tau dephosphorylation during ischaemia/reperfusion. Catalase, another AMPK downstream substrate also showed a similar pattern of decline to p-AMPK, in ischaemic/reperfusion groups. This suggests the involvement of AMPK in changing the p-tau levels, indicating that tau dephosphorylation following ischaemia is not dependent on GSK-3β or PP2A activity, but is associated with AMPK dephosphorylation. We propose that a reduction in AMPK activity is a possible early mechanism responsible for tau dephosphorylation.

  1. The neuronal extracellular matrix restricts distribution and internalization of aggregated Tau-protein.

    PubMed

    Suttkus, A; Holzer, M; Morawski, M; Arendt, T

    2016-01-28

    Alzheimer's disease (AD) is a chronic degenerative disorder characterized by fibrillary aggregates of Aß and Tau-protein. Formation and progression of these pathological hallmarks throughout the brain follow a specific spatio-temporal pattern which provides the basis for neuropathological staging. Previously, we could demonstrate that cortical and subcortical neurons are less frequently affected by neurofibrillary degeneration if they are enwrapped by a specialized form of the hyaluronan-based extracellular matrix (ECM), the so called 'perineuronal net' (PN). PNs are composed of large aggregating chondroitin sulfate proteoglycans connected to a hyaluronan backbone, stabilized by link proteins and cross-linked via tenascin-R. Recently, PN-associated neurons were shown to be better protected against iron-induced neurodegeneration compared to neurons without PN, indicating a neuroprotective function. Here, we investigated the role of PNs in distribution and internalization of exogenous Tau-protein by using organotypic slice cultures of wildtype mice as well as mice lacking the ECM-components aggrecan, HAPLN1 or tenascin-R. We could demonstrate that PNs restrict both distribution and internalization of Tau. Accordingly, PN-ensheathed neurons were less frequently affected by Tau-internalization, than neurons without PN. Finally, the PNs as well as their three investigated components were shown to modulate the processes of distribution as well as internalization of Tau.

  2. Connecting the Dots Between Tau Dysfunction and Neurodegeneration

    PubMed Central

    Frost, Bess; Götz, Jürgen; Feany, Mel B.

    2014-01-01

    Tauopathies are devastating and ultimately fatal neurodegenerative diseases, which are histopathologically defined by insoluble filamentous deposits of abnormally phosphorylated tau protein within neurons and glia. Identifying the causes of abnormal tau phosphorylation and subsequent aggregation has been the focus of much research, and is currently a major target for the development of therapeutic interventions for tauopathies, including Alzheimer’s disease. Recently much has been learned about the sequence of events that lead from tau dysfunction to neuronal death. This review focuses on the cascade of events that are catalyzed by pathological tau, and highlights current and potential therapeutic strategies to target this pathway. PMID:25172552

  3. The Role of Tau in Neurodegenerative Diseases and Its Potential as a Therapeutic Target

    PubMed Central

    2012-01-01

    The abnormal deposition of proteins in and around neurons is a common pathological feature of many neurodegenerative diseases. Among these pathological proteins, the microtubule-associated protein tau forms intraneuronal filaments in a spectrum of neurological disorders. The discovery that dominant mutations in the MAPT gene encoding tau are associated with familial frontotemporal dementia strongly supports abnormal tau protein as directly involved in disease pathogenesis. This and other evidence suggest that tau is a worthwhile target for the prevention or treatment of tau-associated neurodegenerative diseases, collectively called tauopathies. However, it is critical to understand the normal biological roles of tau, the specific molecular events that induce tau to become neurotoxic, the biochemical nature of pathogenic tau, the means by which pathogenic tau exerts neurotoxicity, and how tau pathology propagates. Based on known differences between normal and abnormal tau, a number of approaches have been taken toward the discovery of potential therapeutics. Key questions still remain open, such as the nature of the connection between the amyloid-β protein of Alzheimer's disease and tau pathology. Answers to these questions should help better understand the nature of tauopathies and may also reveal new therapeutic targets and strategies. PMID:24278740

  4. Resveratrol Attenuates Formaldehyde Induced Hyperphosphorylation of Tau Protein and Cytotoxicity in N2a Cells

    PubMed Central

    He, Xiaping; Li, Zhenhui; Rizak, Joshua D.; Wu, Shihao; Wang, Zhengbo; He, Rongqiao; Su, Min; Qin, Dongdong; Wang, Jingkun; Hu, Xintian

    2017-01-01

    Recent studies have demonstrated that formaldehyde (FA)—induced neurotoxicity is important in the pathogenesis of Alzheimer's disease (AD). Elevated levels of FA have been associated with memory impairments and the main hallmarks of AD pathology, including β-amyloid plaques, tau protein hyperphosphorylation, and neuronal loss. Resveratrol (Res), as a polyphenol anti-oxidant, has been considered to have therapeutic potential for the treatment of AD. However, it has not been elucidated whether Res can exert its neuroprotective effects against FA-induced neuronal damages related to AD pathology. To answer this question, the effects of Res were investigated on Neuro-2a (N2a) cells prior to and after FA exposure. The experiments found that pre-treatment with Res significantly decreased FA-induced cytotoxicity, reduced cell apoptosis rates, and inhibited the hyperphosphorylation of tau protein at Thr181 in a dose-dependent manner. Further tests revealed that this effect was associated with the suppression of glycogen synthase kinase (GSK-3β) and calmodulin-dependent protein kinase II (CaMKII) activities, both of which are important kinases for tau protein hyperphosphorylation. In addition, Res was found to increase the activity of phosphoseryl/phosphothreonyl protein phosphatase-2A (PP2A). In summary, these findings provide evidence that Res protects N2a cells from FA-induced damages and suggests that inhibition of GSK-3β and CaMKII and the activation of PP2A by Res protect against the hyperphosphorylation and/or mediates the dephosphorylation of tau protein, respectively. These possible mechanisms underlying the neuroprotective effects of Res against FA-induced damages provide another perspective on AD treatment via inhibition of tau protein hyperhosphorylation. PMID:28197064

  5. Direct force measurements reveal that protein Tau confers short-range attractions and isoform-dependent steric stabilization to microtubules

    PubMed Central

    Chung, Peter J.; Choi, Myung Chul; Miller, Herbert P.; Feinstein, H. Eric; Raviv, Uri; Li, Youli; Wilson, Leslie; Feinstein, Stuart C.; Safinya, Cyrus R.

    2015-01-01

    Microtubules (MTs) are hollow cytoskeletal filaments assembled from αβ-tubulin heterodimers. Tau, an unstructured protein found in neuronal axons, binds to MTs and regulates their dynamics. Aberrant Tau behavior is associated with neurodegenerative dementias, including Alzheimer’s. Here, we report on a direct force measurement between paclitaxel-stabilized MTs coated with distinct Tau isoforms by synchrotron small-angle X-ray scattering (SAXS) of MT-Tau mixtures under osmotic pressure (P). In going from bare MTs to MTs with Tau coverage near the physiological submonolayer regime (Tau/tubulin-dimer molar ratio; ΦTau = 1/10), isoforms with longer N-terminal tails (NTTs) sterically stabilized MTs, preventing bundling up to PB ∼ 10,000–20,000 Pa, an order of magnitude larger than bare MTs. Tau with short NTTs showed little additional effect in suppressing the bundling pressure (PB ∼ 1,000–2,000 Pa) over the same range. Remarkably, the abrupt increase in PB observed for longer isoforms suggests a mushroom to brush transition occurring at 1/13 < ΦTau < 1/10, which corresponds to MT-bound Tau with NTTs that are considerably more extended than SAXS data for Tau in solution indicate. Modeling of Tau-mediated MT–MT interactions supports the hypothesis that longer NTTs transition to a polyelectrolyte brush at higher coverages. Higher pressures resulted in isoform-independent irreversible bundling because the polyampholytic nature of Tau leads to short-range attractions. These findings suggest an isoform-dependent biological role for regulation by Tau, with longer isoforms conferring MT steric stabilization against aggregation either with other biomacromolecules or into tight bundles, preventing loss of function in the crowded axon environment. PMID:26542680

  6. Complex proteinopathy with accumulations of prion protein, hyperphosphorylated tau, α-synuclein and ubiquitin in experimental bovine spongiform encephalopathy of monkeys.

    PubMed

    Piccardo, Pedro; Cervenak, Juraj; Bu, Ming; Miller, Lindsay; Asher, David M

    2014-07-01

    Proteins aggregate in several slowly progressive neurodegenerative diseases called 'proteinopathies'. Studies with cell cultures and transgenic mice overexpressing mutated proteins suggested that aggregates of one protein induced misfolding and aggregation of other proteins as well - a possible common mechanism for some neurodegenerative diseases. However, most proteinopathies are 'sporadic', without gene mutation or overexpression. Thus, proteinopathies in WT animals genetically close to humans might be informative. Squirrel monkeys infected with the classical bovine spongiform encephalopathy agent developed an encephalopathy resembling variant Creutzfeldt-Jakob disease with accumulations not only of abnormal prion protein (PrP(TSE)), but also three other proteins: hyperphosphorylated tau (p-tau), α-synuclein and ubiquitin; β-amyloid protein (Aβ) did not accumulate. Severity of brain lesions correlated with spongiform degeneration. No amyloid was detected. These results suggested that PrP(TSE) enhanced formation of p-tau and aggregation of α-synuclein and ubiquitin, but not Aβ, providing a new experimental model for neurodegenerative diseases associated with complex proteinopathies.

  7. DMAP-85: a tau-like protein from Drosophila melanogaster larvae.

    PubMed

    Cambiazo, V; González, M; Maccioni, R B

    1995-03-01

    Microtubule-associated proteins (MAPs) play major regulatory roles in the organization and integrity of the cytoskeletal network. Our main interest in this study was the identification and the analysis of structural and functional aspects of Drosophila melanogaster MAPs. A novel MAP with a relative molecular mass of 85 kDa from Drosophila larvae was found associated with taxol-polymerized microtubules. In addition, this protein bound to mammalian tubulin in an overlay assay and coassembled with purified bovine brain tubulin in microtubule sedimentation experiments. The estimated stoichiometry of 85-kDa protein versus tubulin in the polymers was 1:5.3 +/- 0.2 mol/mol. It was shown that the 85-kDa protein bound specifically to an affinity column of Sepharose-beta II-(422-434) tubulin peptide, which contains the sequence of the MAP binding domain on beta II-tubulin. Affinity-purified 85-kDa protein enhanced microtubule assembly in a concentration-dependent manner. This effect was significantly decreased by the presence of the beta II-(422-434) peptide in the assembly assays, thus confirming the specificity of the 85-kDa protein interaction with the C-terminal domain on tubulin. Furthermore, this protein also exhibited a strong affinity for calmodulin, based on affinity chromatographic assays. Monoclonal and polyclonal anti-tau antibodies, including sequence-specific probes that recognize repeated microtubule-binding motifs on tau, MAP-2, and MAP-4 and specific N-terminal sequences of tau, cross-reacted with the 85-kDa protein from Drosophila larvae. These results suggest that tau and Drosophila 85-kDa protein share common functional and structural epitopes. We have named this protein as DMAP-85 for Drosophila MAP.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Microtubule Associated Protein (MAP)-Tau: a novel mediator of paclitaxel sensitivity in vitro and in vivo.

    PubMed

    Wagner, P; Wang, B; Clark, E; Lee, H; Rouzier, R; Pusztai, L

    2005-09-01

    Microtubule binding protein Tau was recently identified through gene expression analysis of human breast cancer tissues as a novel marker of response to paclitaxel. This article reviews these recent findings and provides additional information to support the role of Tau as an emerging marker and mediator of paclitaxel sensitivity. Low expression of Tau is associated with increased sensitivity to paclitaxel in human breast cancer as well as in a broad range of cell lines. Down regulation of Tau in cell lines by siRNA increases their sensitivity to paclitaxel but not to anthracycline chemotherapy. We propose that this is due to increased paclitaxel binding to microtubules when microtubules are assembled in the presence of low concentrations (or absence) of Tau compared to microtubules that are formed in the presence of physiological (or higher) levels of Tau.

  9. Protein structural and surface water rearrangement constitute major events in the earliest aggregation stages of tau

    PubMed Central

    Pavlova, Anna; Cheng, Chi-Yuan; Kinnebrew, Maia; Lew, John; Dahlquist, Frederick W.; Han, Songi

    2016-01-01

    Protein aggregation plays a critical role in the pathogenesis of neurodegenerative diseases, and the mechanism of its progression is poorly understood. Here, we examine the structural and dynamic characteristics of transiently evolving protein aggregates under ambient conditions by directly probing protein surface water diffusivity, local protein segment dynamics, and interprotein packing as a function of aggregation time, along the third repeat domain and C terminus of Δtau187 spanning residues 255–441 of the longest isoform of human tau. These measurements were achieved with a set of highly sensitive magnetic resonance tools that rely on site-specific electron spin labeling of Δtau187. Within minutes of initiated aggregation, the majority of Δtau187 that is initially homogeneously hydrated undergoes structural transformations to form partially structured aggregation intermediates. This is reflected in the dispersion of surface water dynamics that is distinct around the third repeat domain, found to be embedded in an intertau interface, from that of the solvent-exposed C terminus. Over the course of hours and in a rate-limiting process, a majority of these aggregation intermediates proceed to convert into stable β-sheet structured species and maintain their stacking order without exchanging their subunits. The population of β-sheet structured species is >5% within 5 min of aggregation and gradually grows to 50–70% within the early stages of fibril formation, while they mostly anneal block-wisely to form elongated fibrils. Our findings suggest that the formation of dynamic aggregation intermediates constitutes a major event occurring in the earliest stages of tau aggregation that precedes, and likely facilitates, fibril formation and growth. PMID:26712030

  10. Naturally Occurring Autoantibodies against Tau Protein Are Reduced in Parkinson's Disease Dementia

    PubMed Central

    Kronimus, Yannick; Albus, Alexandra; Balzer-Geldsetzer, Monika; Straub, Sarah; Semler, Elisa; Otto, Markus; Klotsche, Jens; Dodel, Richard; Mengel, David

    2016-01-01

    Background and Objective Altered levels of naturally occurring autoantibodies (nAbs) against disease-associated neuronal proteins have been reported for neurodegenerative diseases, such as Alzheimer's (AD) and Parkinson's disease (PD). Recent histopathologic studies suggest a contribution of both Lewy body- and AD-related pathology to Parkinson's disease dementia (PDD). Therefore, we explored nAbs against alpha-synuclein (αS), tau and β-amyloid (Aβ) in PDD compared to cognitively normal PD patients. Materials and Methods We established three different ELISAs to quantify the nAbs-tau, nAbs-αS, and nAbs-Aβ levels and avidity towards their specific antigen in serum samples of 18 non-demented (PDND) and 18 demented PD patients (PDD), which were taken from an ongoing multi-center cohort study (DEMPARK/LANDSCAPE). Results PDD patients had significantly decreased nAbs-tau serum levels compared to PDND patients (p = 0.007), whereas the serum titers of nAbs-αS and nAbs-Aβ were unchanged. For all three nAbs, no significant differences in avidity were found between PDD and PDND cohorts. However, within both patient groups, nAbs-tau showed lowest avidity to their antigen, followed by nAbs-αS, and nAbs-Aβ. Though, due to a high interassay coefficient of variability and the exclusion of many samples below the limit of detection, conclusions for nAbs-Aβ are only conditionally possible. Conclusion We detected a significantly decreased nAbs-tau serum level in PDD patients, indicating a potential linkage between nAbs-tau serum titer and cognitive deficits in PD. Thus, further investigation in larger samples is justified to confirm our findings. PMID:27802290

  11. Human tau protein forms complex with PrP and some GSS- and fCJD-related PrP mutants possess stronger binding activities with tau in vitro.

    PubMed

    Wang, Xiao-Fan; Dong, Chen-Fang; Zhang, Jin; Wan, Yan-Zhen; Li, Feng; Huang, Yin-Xia; Han, Lu; Shan, Bing; Gao, Chen; Han, Jun; Dong, Xiao-Ping

    2008-03-01

    Microtubule associated protein tau is considered to play roles in some types of human transmissible spongiform encephalopathies (TSE). In this study, the full-length and several truncated human tau proteins were expressed from E. coli and purified. Using GST pull down, co-immunoprecipitation assay and tau-coated ELISA, the molecular interaction between tau protein and PrP was confirmed in the context of the full-length human tau. The N terminus (amino acids 1-91) and tandem repeats region (amino acids 186-283) of tau protein were responsible for the interaction with PrP. The octapeptide repeats within PrP directly affected the binding activity of PrP with tau. GSS-related mutant PrP102L and fCJD- related mutants with two and seven extra octarepeats showed more active binding capacity with tau than wild-type PrP. The molecular interactions between PrP and tau protein highlight a potential role of tau in the biological function of PrP and the pathogenesis of TSE.

  12. Site-specific phosphorylation of Tau protein is associated with deacetylation of microtubules in mouse spermatogenic cells during meiosis.

    PubMed

    Inoue, Hiroki; Hiradate, Yuuki; Shirakata, Yoshiki; Kanai, Kenta; Kosaka, Keita; Gotoh, Aina; Fukuda, Yasuhiro; Nakai, Yutaka; Uchida, Takafumi; Sato, Eimei; Tanemura, Kentaro

    2014-05-29

    Tau is one of the microtubule-associated proteins and a major component of paired helical filaments, a hallmark of Alzheimer's disease. Its expression has also been indicated in the testis. However, its function and modification in the testis have not been established. Here, we analyzed the dynamics of phosphorylation patterns during spermatogenesis. The expression of Tau protein and its phosphorylation were shown in the mouse testis. Immunohistochemistry revealed that the phosphorylation was strongly detected during meiosis. Correspondingly, the expression of acetylated tubulin was inversely weakened during meiosis. These results suggest that phosphorylation of Tau protein contributes to spermatogenesis, especially in meiosis.

  13. SBDPs and Tau proteins for diagnosis and hypothermia therapy in neonatal hypoxic ischemic encephalopathy

    PubMed Central

    Wu, Hongwei; Li, Zhenguang; Yang, Xia; Liu, Jinfeng; Wang, Wei; Liu, Gang

    2017-01-01

    The use of spectrin breakdown products (SBDPs) and Tau protein levels for diagnosis and a mild hypothermia therapy for treatment of neonatal hypoxic-ischemic encephalopathy (HIE) was evaluated. One hundred and fifty infants, with HIE within 12 h after birth, participated in the study. There were 30 newborns with mild symptoms, 60 with moderate symptoms, 60 with severe symptoms, and 30 in a control group. Regular therapy was used for the control and the mild HIE groups, and also for 30 cases in the group with moderate symptoms and for 30 in the group with severe symptoms. For the remaining infants, with moderate and severe symptoms, mild hypothermia therapy was used instead. A sandwich ELISA measured plasma concentrations of SBDPs and Tau proteins, at different time-points. For clinical follow-up, the neonatal behavioral neurological assessment (NBNA) assay and the Gesell development scale were performed at different time-points. The levels of SBDP and Tau proteins increased with the exacerbation of HIE, and decreased with the prolongation of therapy with statistically significant differences amongst groups. After treatment, the levels of SBDP and Tau proteins in groups with moderate and severe symptoms treated with mild hypothermia therapy were significantly lower than those of the groups treated with regular therapy. NBNA scores and the developmental quotient (DQ) were both worse with the increase in severity of HIE, however, the scores of groups with moderate and severe symptoms treated with mild hypothermia therapy were significantly better than those of groups treated with regular therapy (P<0.05). A gradual improvement of DQ was seen in the process of therapy in each group (P<0.05). According to a receiver operating characteristic (ROC) curve analysis, at a critical plasma concentration of SBDPs of 1.58 ng/ml, the sensitivity and specificity for HIE diagnosis was 84.6 and 87.5%, respectively. The ROC analysis for Tau protein yielded a sensitivity and

  14. Beta-amyloid 1-42 monomers, but not oligomers, produce PHF-like conformation of Tau protein.

    PubMed

    Manassero, Giusi; Guglielmotto, Michela; Zamfir, Raluca; Borghi, Roberta; Colombo, Laura; Salmona, Mario; Perry, George; Odetti, Patrizio; Arancio, Ottavio; Tamagno, Elena; Tabaton, Massimo

    2016-10-01

    The mechanistic relationship between amyloid β1-42 (Aβ1-42) and the alteration of Tau protein are debated. We investigated the effect of Aβ1-42 monomers and oligomers on Tau, using mice expressing wild-type human Tau that do not spontaneously develop Tau pathology. After intraventricular injection of Aβ1-42, mice were sacrificed after 3 h or 4 days. The short-lasting treatment with Aβ monomers, but not oligomers, showed a conformational PHF-like change of Tau, together with hyperphosphorylation. The same treatment induced increase in concentration of GSK3 and MAP kinases. The inhibition of the kinases rescued the Tau changes. Aβ monomers increased the levels of total Tau, through the inhibition of proteasomal degradation. Aβ oligomers reproduced all the aforementioned alterations only after 4 days of treatment. It is known that Aβ1-42 monomers foster synaptic activity. Our results suggest that Aβ monomers physiologically favor Tau activity and dendritic sprouting, whereas their excess causes Tau pathology. Moreover, our study indicates that anti-Aβ therapies should be targeted to Aβ1-42 monomers too.

  15. Molecular Dynamics Simulations of a Powder Model of the Intrinsically Disordered Protein Tau.

    PubMed

    Fichou, Yann; Heyden, Matthias; Zaccai, Giuseppe; Weik, Martin; Tobias, Douglas J

    2015-10-01

    The tau protein, whose aggregates are involved in Alzheimer's disease, is an intrinsically disordered protein (IDP) that regulates microtubule activity in neurons. An IDP lacks a single, well-defined structure and, rather, constantly exchanges among multiple conformations. In order to study IDP dynamics, the combination of experimental techniques, such as neutron scattering, and computational techniques, such as molecular dynamics (MD) simulations, is a powerful approach. Amorphous hydrated powder samples have been very useful for studying protein internal dynamics experimentally, e.g., using neutron scattering. Thus, there is demand for realistic in silico models of hydrated protein powders. Here we present an MD simulation analysis of a powder hydrated at 0.4 g water/g protein of the IDP tau in the temperature range 20-300 K. By comparing with neutron scattering data, we identify the protein-water interface as the predominant feature determining IDP dynamics. The so-called protein dynamical transition is shown to be attenuated, but not suppressed, in the parts of the protein that are not exposed to the solvent. In addition, we find similarities in the mean-squared displacements of the core of a globular protein and "dry" clusters formed by the IDP in hydrated powders. Thus, the ps to ns dynamics of proteins in hydrated powders originate mainly from those residues in contact with solvent. We propose that by measuring the dynamics of protein assemblies, such as aggregates, one might assess qualitatively their state of hydration.

  16. Detection of the tau protein in human serum by a sensitive four-electrode electrochemical biosensor.

    PubMed

    Wang, Scarlet Xiaoyan; Acha, Desiree; Shah, Ajit J; Hills, Frank; Roitt, Ivan; Demosthenous, Andreas; Bayford, Richard H

    2017-06-15

    This study presents a novel approach based on a four-electrode electrochemical biosensor for the detection of tau protein - one of the possible markers for the prediction of Alzheimer's disease (AD). The biosensor is based on the formation of stable antibody-antigen complexes on gold microband electrodes covered with a layer of a self-assembled monolayer and protein G. Antibodies were immobilized on the gold electrode surface in an optimal orientation by protein G interaction. Electrochemical impedance spectroscopy was used to analyze impedance change, which revealed a linear response with increasing tau concentrations. The assay is fast (<1h for incubation and measurement) and very sensitive. The limit of quantification for the full-length 2N4R tau protein is 0.03pM, a value unaltered when the assay was processed in bovine serum albumin or human serum. This technology could be adapted for the detection of other biomarkers to provide a multiple assay to identify AD progression in a point of care setting.

  17. Effects of microtubule-associated protein tau expression on neural stem cell migration after spinal cord injury.

    PubMed

    Qi, Zhi-Ping; Wang, Guo-Xiang; Xia, Peng; Hou, Ting-Ting; Zhou, Hong-Li; Wang, Tie-Jun; Yang, Xiao-Yu

    2016-02-01

    Our preliminary proteomics analysis suggested that expression of microtubule-associated protein tau is elevated in the spinal cord after injury. Therefore, the first aim of the present study was to examine tau expression in the injured spinal cord. The second aim was to determine whether tau can regulate neural stem cell migration, a critical factor in the successful treatment of spinal cord injury. We established rat models of spinal cord injury and injected them with mouse hippocampal neural stem cells through the tail vein. We used immunohistochemistry to show that the expression of tau protein and the number of migrated neural stem cells were markedly increased in the injured spinal cord. Furthermore, using a Transwell assay, we showed that neural stem cell migration was not affected by an elevated tau concentration in the outer chamber, but it was decreased by changes in intracellular tau phosphorylation state. These results demonstrate that neural stem cells have targeted migration capability at the site of injury, and that although tau is not a chemokine for targeted migration of neural stem cells, intracellular tau phosphorylation/dephosphorylation can inhibit cell migration.

  18. What Renders TAU Toxic

    PubMed Central

    Götz, Jürgen; Xia, Di; Leinenga, Gerhard; Chew, Yee Lian; Nicholas, Hannah R.

    2013-01-01

    TAU is a microtubule-associated protein that under pathological conditions such as Alzheimer’s disease (AD) forms insoluble, filamentous aggregates. When 20 years after TAU’s discovery the first TAU transgenic mouse models were established, one declared goal that was achieved was the modeling of authentic TAU aggregate formation in the form of neurofibrillary tangles. However, as we review here, it has become increasingly clear that TAU causes damage much before these filamentous aggregates develop. In fact, because TAU is a scaffolding protein, increased levels and an altered subcellular localization (due to an increased insolubility and impaired clearance) result in the interaction of TAU with cellular proteins with which it would otherwise either not interact or do so to a lesser degree, thereby impairing their physiological functions. We specifically discuss the non-axonal localization of TAU, the role phosphorylation has in TAU toxicity and how TAU impairs mitochondrial functions. A major emphasis is on what we have learned from the four available TAU knock-out models in mice, and the knock-out of the TAU/MAP2 homolog PTL-1 in worms. It has been proposed that in human pathological conditions such as AD, a rare toxic TAU species exists which needs to be specifically removed to abrogate TAU’s toxicity and restore neuronal functions. However, what is toxic in one context may not be in another, and simply reducing, but not fully abolishing TAU levels may be sufficient to abrogate TAU toxicity. PMID:23772223

  19. An unbiased approach to identifying tau kinases that phosphorylate tau at sites associated with Alzheimer disease.

    PubMed

    Cavallini, Annalisa; Brewerton, Suzanne; Bell, Amanda; Sargent, Samantha; Glover, Sarah; Hardy, Clare; Moore, Roger; Calley, John; Ramachandran, Devaki; Poidinger, Michael; Karran, Eric; Davies, Peter; Hutton, Michael; Szekeres, Philip; Bose, Suchira

    2013-08-09

    Neurofibrillary tangles, one of the hallmarks of Alzheimer disease (AD), are composed of paired helical filaments of abnormally hyperphosphorylated tau. The accumulation of these proteinaceous aggregates in AD correlates with synaptic loss and severity of dementia. Identifying the kinases involved in the pathological phosphorylation of tau may identify novel targets for AD. We used an unbiased approach to study the effect of 352 human kinases on their ability to phosphorylate tau at epitopes associated with AD. The kinases were overexpressed together with the longest form of human tau in human neuroblastoma cells. Levels of total and phosphorylated tau (epitopes Ser(P)-202, Thr(P)-231, Ser(P)-235, and Ser(P)-396/404) were measured in cell lysates using AlphaScreen assays. GSK3α, GSK3β, and MAPK13 were found to be the most active tau kinases, phosphorylating tau at all four epitopes. We further dissected the effects of GSK3α and GSK3β using pharmacological and genetic tools in hTau primary cortical neurons. Pathway analysis of the kinases identified in the screen suggested mechanisms for regulation of total tau levels and tau phosphorylation; for example, kinases that affect total tau levels do so by inhibition or activation of translation. A network fishing approach with the kinase hits identified other key molecules putatively involved in tau phosphorylation pathways, including the G-protein signaling through the Ras family of GTPases (MAPK family) pathway. The findings identify novel tau kinases and novel pathways that may be relevant for AD and other tauopathies.

  20. Alternative application of Tau protein in Creutzfeldt-Jakob disease diagnosis: Improvement for weakly positive 14-3-3 protein in the laboratory

    PubMed Central

    Hyeon, Jae Wook; Kim, Su Yeon; Lee, Jeongmin; Park, Jun Sun; Hwang, Kyu Jam; Lee, Sol Moe; An, SeongSoo A.; Lee, Myung Koo; Ju, Young Ran

    2015-01-01

    The 14-3-3 protein has been used as a biomarker for the diagnosis of sporadic Creutzfeldt-Jakob disease (sCJD). However, weakly positive 14-3-3 leads to false positive results and an incorrect diagnosis. We attempted to use quantitative data for tau protein to provide an accurate diagnosis based on weak 14-3-3 protein. Sixty-two patients with sCJD, including pathologically confirmed, clinically definite, and probable cases, and 89 non-CJD patients were investigated based on a Korean population. Among them, 20 sCJD and 14 non-CJD showed weakly positive 14-3-3. The total tau (t-tau) and phosphorylated tau (p-tau) protein levels were measured by ELISA, and the p-tau to t-tau ratio (p/t ratio) was calculated. The combined use of the 14-3-3 protein assay, t-tau levels, and p/t ratio improved the specificity of diagnosis compared with the use of the 14-3-3 protein assay alone (47% for 14-3-3 alone; 85.94% for 14-3-3 combined with t-tau; 90.62% for 14-3-3 combined with the p/t ratio). In addition, 18 of 20 sCJD and 12 of 14 non-CJD who were weakly positive for 14-3-3 were positive for the p/t ratio and negative for the p/t ratio, respectively. When used in combination with the 14-3-3 protein, the tau protein is useful as a biomarker for the precise diagnosis of sCJD. PMID:26507666

  1. Alternative application of Tau protein in Creutzfeldt-Jakob disease diagnosis: Improvement for weakly positive 14-3-3 protein in the laboratory.

    PubMed

    Hyeon, Jae Wook; Kim, Su Yeon; Lee, Jeongmin; Park, Jun Sun; Hwang, Kyu Jam; Lee, Sol Moe; An, SeongSoo A; Lee, Myung Koo; Ju, Young Ran

    2015-10-28

    The 14-3-3 protein has been used as a biomarker for the diagnosis of sporadic Creutzfeldt-Jakob disease (sCJD). However, weakly positive 14-3-3 leads to false positive results and an incorrect diagnosis. We attempted to use quantitative data for tau protein to provide an accurate diagnosis based on weak 14-3-3 protein. Sixty-two patients with sCJD, including pathologically confirmed, clinically definite, and probable cases, and 89 non-CJD patients were investigated based on a Korean population. Among them, 20 sCJD and 14 non-CJD showed weakly positive 14-3-3. The total tau (t-tau) and phosphorylated tau (p-tau) protein levels were measured by ELISA, and the p-tau to t-tau ratio (p/t ratio) was calculated. The combined use of the 14-3-3 protein assay, t-tau levels, and p/t ratio improved the specificity of diagnosis compared with the use of the 14-3-3 protein assay alone (47% for 14-3-3 alone; 85.94% for 14-3-3 combined with t-tau; 90.62% for 14-3-3 combined with the p/t ratio). In addition, 18 of 20 sCJD and 12 of 14 non-CJD who were weakly positive for 14-3-3 were positive for the p/t ratio and negative for the p/t ratio, respectively. When used in combination with the 14-3-3 protein, the tau protein is useful as a biomarker for the precise diagnosis of sCJD.

  2. Glutamate system, amyloid ß peptides and tau protein: functional interrelationships and relevance to Alzheimer disease pathology.

    PubMed

    Revett, Timothy J; Baker, Glen B; Jhamandas, Jack; Kar, Satyabrata

    2013-01-01

    Alzheimer disease is the most prevalent form of dementia globally and is characterized premortem by a gradual memory loss and deterioration of higher cognitive functions and postmortem by neuritic plaques containing amyloid ß peptide and neurofibrillary tangles containing phospho-tau protein. Glutamate is the most abundant neurotransmitter in the brain and is essential to memory formation through processes such as long-term potentiation and so might be pivotal to Alzheimer disease progression. This review discusses how the glutamatergic system is impaired in Alzheimer disease and how interactions of amyloid ß and glutamate influence synaptic function, tau phosphorylation and neurodegeneration. Interestingly, glutamate not only influences amyloid ß production, but also amyloid ß can alter the levels of glutamate at the synapse, indicating that small changes in the concentrations of both molecules could influence Alzheimer disease progression. Finally, we describe how the glutamate receptor antagonist, memantine, has been used in the treatment of individuals with Alzheimer disease and discuss its effectiveness.

  3. Apolipoprotein E genotyping and cerebrospinal fluid tau protein: implications for the clinical diagnosis of Alzheimer's disease.

    PubMed

    Arai, H; Higuchi, S; Sasaki, H

    1997-01-01

    Apolipoprotein E (ApoE) genotyping was conducted in sporadic Alzheimer's disease (AD, n = 91) as well as in other dementing disorders including Parkinson's disease (PD, n = 73), autopsy-confirmed diffuse Lewy body disease (DLBD, n = 16), progressive supranuclear palsy (n = 13), vascular dementia (n = 55), alcoholic dementia (n =25) and normal control subjects (n = 77). ApoE epsilon 4 allele frequency was significantly higher in AD (33.5%, p < 0.001), DLBD (40.6%, p < 0.001) and demented PD (29.4%, p < 0.05) compared to that in normal controls (11.7%). The association of the ApoE epsilon 4 allele with AD was more pronounced in early-onset AD (46.4%) than in late-onset AD (27.8%). 46% of the AD individuals developed AD without association to ApoE epsilon 4, and epsilon 4 homozygotes were found not only in AD, but also in many of other dementing disorders. These results suggest that ApoE genotyping cannot provide certainty about the presence of absence of AD, and that it should be used as an adjunct to other diagnostic tests for AD. On the other hand, cerebrospinal fluid (CSF) tau levels were significantly elevated (p < 0.0001) in AD (78.0 +/- 44.2 pg/ml) compared to those in normal controls (10.6 +/- 8.6 pg/ml). The specificity and the sensitivity of distinguishing AD from normal controls was 95.0 and 91.2%, respectively. Elevated CSF-tau levels were also detected in some patients with acute neurological diseases including meningoencephalitis, Creutzfeld-Jacob disease, normal pressure hydrocephalus and vitamin B12 deficiency encephalopathy. Increased CSF-tau levels in AD were found regardless of the age at onset, clinical stage, ApoE genotype, alpha 1-antichymotrypsin genotype, and presenilin-1 genotype. The CSF-tau levels continued to be abnormal during the progression of AD. These results suggest that CSF-tau serves as an unequivocal and reliable biological marker to aid in the clinical diagnosis of AD.

  4. The effect of human microtubule-associated-protein tau on the assembly structure of microtubules and its ionic strength dependence

    NASA Astrophysics Data System (ADS)

    Choi, M. C.; Raviv, U.; Miller, H. P.; Gaylord, M. R.; Kiris, E.; Ventimiglia, D.; Needleman, D. J.; Chung, P. J.; Deek, J.; Lapointe, N.; Kim, M. W.; Wilson, L.; Feinstein, S. C.; Safinya, C. R.

    2010-03-01

    Microtubules (MTs), 25 nm protein nanotubes, are among the major filamentous elements of the eukaryotic cytoskeleton involved in intracellular trafficking, cell division and the establishment and maintenance of cell shape. Microtubule-associated-protein tau regulates tubulin assembly, MT dynamics and stability. Aberrant tau action has long been correlated with numerous neurodegenerative diseases, including Alzheimer's, and fronto-temporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17) Using synchrotron small angle x-ray scattering (SAXS) and binding assay, we examine the effects of tau on the assembly structure of taxol-stabilized MTs. We find that tau regulates the distribution of protofilament numbers in MTs as reflected in the observed increase in the average radius of MTs with increasing the tau/tubulin molar ratio. Additionally, tau-MT interactions are mediated to a large extent via electrostatic interactions: the binding affinity of tau to MTs is ionic strength dependent. Supported by DOE-BES DE-FG02-06ER46314, NSF DMR-0803103, NIH NS35010, NIH NS13560. (Ref) M.C. Choi, S.C. Feinstein, and C.R. Safinya et al. Biophys. J. 97; 519 (2009).

  5. Invited review: Frontotemporal dementia caused by microtubule-associated protein tau gene (MAPT) mutations: a chameleon for neuropathology and neuroimaging

    PubMed Central

    Ghetti, B; Oblak, A L; Boeve, B F; Johnson, K A; Dickerson, B C; Goedert, M

    2015-01-01

    Hereditary frontotemporal dementia associated with mutations in the microtubule-associated protein tau gene (MAPT) is a protean disorder. Three neuropathologic subtypes can be recognized, based on the presence of inclusions made of tau isoforms with three and four repeats, predominantly three repeats and mostly four repeats. This is relevant for establishing a correlation between structural magnetic resonance imaging and positron emission tomography using tracers specific for aggregated tau. Longitudinal studies will be essential to determine the evolution of anatomical alterations from the asymptomatic stage to the various phases of disease following the onset of symptoms. PMID:25556536

  6. Boronate-tau mediated uptake in neurons.

    PubMed

    Pérez, Mar; Cuadros, Raquel; Pallas-Bazarra, Noemi; García, Carlos; Langa, Elena; Jurado-Arjona, Jerónimo; Hernández, Félix; Avila, Jesús

    2014-01-01

    We modified tau protein with boronic acid to facilitate its delivery into non neural or neural cultured cells lacking tau protein. Our results indicate that the incorporated tau promotes the formation of cytoplasmic extensions in non-neuronal cells, as well as the appearance of neurites in cultured tau knockout hippocampal neurons. In addition, boronated tau is incorporated into hippocampal neurons of tau knockout mice after intracranial injection in vivo. These findings describe a novel method to deliver exogenous tau protein into cells.

  7. Level of PICALM, a key component of clathrin-mediated endocytosis, is correlated with levels of phosphotau and autophagy-related proteins and is associated with tau inclusions in AD, PSP and Pick disease.

    PubMed

    Ando, Kunie; Tomimura, Karen; Sazdovitch, Véronique; Suain, Valérie; Yilmaz, Zehra; Authelet, Michèle; Ndjim, Marième; Vergara, Cristina; Belkouch, Mounir; Potier, Marie-Claude; Duyckaerts, Charles; Brion, Jean-Pierre

    2016-10-01

    Single nucleotide polymorphisms in PICALM, a key component of clathrin-mediated endocytosis machinery, have been identified as genetic susceptibility loci for late onset Alzheimer's disease (LOAD). We previously reported that PICALM protein levels were decreased in AD brains and that PICALM was co-localised with neurofibrillary tangles in LOAD, familial AD with PSEN1 mutations and Down syndrome. In the present study, we analysed PICALM expression, cell localisation and association with pathological cellular inclusions in other tauopathies and in non-tau related neurodegenerative diseases. We observed that PICALM was associated with neuronal tau pathology in Pick disease and in progressive supranuclear palsy (PSP) and co-localised with both 3R and 4R tau positive inclusions unlike in corticobasal degeneration (CBD) or in frontotemporal lobar degeneration (FTLD)-MAPT P301L. PICALM immunoreactivities were not detected in tau-positive tufted astrocytes in PSP, astrocytic plaques in CBD, Lewy bodies in Lewy body disease, diffuse type (LBD) and in TDP-43-positive inclusions in FTLD. In the frontal cortex in tauopathies, the ratio of insoluble to soluble PICALM was increased while the level of soluble PICALM was decreased and was inversely correlated with the level of phosphotau. PICALM decrease was also significantly correlated with increased LC3-II and decreased Beclin-1 levels in tauopathies and in non-tau related neurodegenerative diseases. These results suggest that there is a close relationship between abnormal PICALM processing, tau pathology and impairment of autophagy in human neurodegenerative diseases.

  8. The Cell Cycle Regulator Phosphorylated Retinoblastoma Protein Is Associated with Tau Pathology in Several Tauopathies

    PubMed Central

    Stone, Jeremy G.; Siedlak, Sandra L.; Tabaton, Massimo; Hirano, Asao; Castellani, Rudy J.; Santocanale, Corrado; Perry, George; Smith, Mark A.; Zhu, Xiongwei; Lee, Hyoung-gon

    2011-01-01

    Retinoblastoma protein (pRb) is a ubiquitous 928 amino acid cell cycle regulatory molecule with diverse biological activities. One critical function of pRb is control of the G1-to-S phase checkpoint of the cell cycle. In the hypophosphorylated state, pRb suppresses the activity of E2F transcription factors thereby inhibiting transcription of cell cycle promoting genes. Upon phosphorylation, primarily by cyclin dependent kinases, phosphorylated pRb dissociates from E2F and permits cell cycle progression. We previously found phosphorylated pRb to be intimately associated with hyperphosphorylated tau-containing neurofibrillary tangles of Alzheimer disease (AD), the pathogenesis of which is believed to involve dysregulation of the cell cycle and marked neuronal death. Here, we used immunohistochemistry to investigate the presence of phosphorylated pRb in other distinct neurodegenerative diseases that share the common characteristic of hyperphosphorylated tau pathology and neuronal loss with AD. We found colocalized labeling of tau pathology and phosphorylated pRb in Pick disease and progressive supranuclear palsy (3 cases each), neurodegeneration with brain iron accumulation type 1 (2 cases) and Parkinson-amyotrophic lateral sclerosis of Guam, subacute sclerosing panencephalitis, frontotemporal dementia and Parkinsonism linked to chromosome 17 and dementia pugilistica (1 case each). These observations further implicate aberrant neuronal cell cycle progression in neurodegenerative diseases, particularly tauopathies, and suggest a novel target for therapeutic intervention. PMID:21666500

  9. Tau protein degradation is catalyzed by the ATP/ubiquitin-independent 20S proteasome under normal cell conditions

    PubMed Central

    Grune, Tilman; Botzen, Diana; Engels, Martina; Voss, Peter; Kaiser, Barbara; Jung, Tobias; Grimm, Stefanie; Ermak, Gennady; Davies, Kelvin J. A.

    2010-01-01

    Tau is the major protein exhibiting intracellular accumulation in Alzheimer disease. The mechanisms leading to its accumulation are not fully understood. It has been proposed that the proteasome is responsible for degrading tau but, since proteasomal inhibitors block both the ubiquitin-dependent 26S proteasome and the ubiqutin-independent 20S proteasome pathways, it is not clear which of these pathways is involved in tau degradation. Some involvement of the ubiquitin ligase, CHIP in tau degradation has also been postulated during stress. In the current studies, we utilized HT22 cells and tau-transfected E36 cells in order to test the relative importance or possible requirement of the ubiquitin-dependent 26S proteasomal system versus the ubiquitin-independent 20S proteasome, in tau degradation. By means of ATP-depletion, ubiquitinylation-deficient E36ts20 cells, a 19S proteasomal regulator subunit MSS1-siRNA approaches, and in vitro ubiquitinylation studies, we were able to demonstrate that ubiquitinylation is not required for normal tau degradation. PMID:20478262

  10. Serum cleaved Tau protein and neurobehavioral battery of tests as markers of brain injury in experimental bacterial meningitis.

    PubMed

    Irazuzta, J E; de Courten-Myers, G; Zemlan, F P; Bekkedal, M Y; Rossi, J

    2001-09-14

    Brain injury due to bacterial meningitis affects multiple areas of the brain with a heterogeneous distribution generating a challenge to assess severity. Tau proteins are microtubular binding proteins localized in the axonal compartment of neurons. Brain injury releases cleaved Tau proteins (C-tau) into the extracellular space where they are transported to the cerebral spinal fluid. We hypothesized that C-tau crosses the blood-brain barrier during inflammation and that it can be detected in serum. The correlation between serum C-tau levels and the extent of the meningitic insult was examined. Furthermore, we studied whether the use of a subset of neurobehavioral tasks can assess the extent of brain injury after meningitis. The tests were chosen primarily for their ability to detect deficits in the acoustic system, low brain, reflexive responding, as well as for impaired motor coordination and the higher brain functions of learning and memory. A rat model of group B streptococcal meningitis with variable severity was utilized. At five days after bacterial inoculation followed by antibiotic therapy neurobehavioral tests were performed and serum C-tau and histologic samples of the brain were obtained. Our study shows that during meningitis C-tau appears in serum and reflects the extent of neurologic damage. Neurobehavioral performance was altered after bacterial meningitis and could be correlated with histologic and biochemical markers of neurologic sequelae. We conclude that serum C-tau and a composite of neurobehavioral tests could become useful markers for assessing the severity of neurological damage in experimental bacterial meningitis.

  11. ADNP/NAP dramatically increase microtubule end-binding protein-Tau interaction: a novel avenue for protection against tauopathy.

    PubMed

    Ivashko-Pachima, Y; Sayas, C Laura; Malishkevich, A; Gozes, I

    2017-01-24

    Activity-dependent neuroprotective protein (ADNP), vital for brain formation and cognitive function, is mutated in autism and linked to neurodegenerative/psychiatric diseases. An eight-amino-acid peptide snippet of ADNP, NAP (NAPVSIPQ), identified as a smallest active fragment, includes the SxIP microtubule (MT) end-binding protein (EB) association motif, and enhances ADNP-EB3 interaction. Depletion of EB1 or EB3 abolishes NAP protection against zinc intoxication. Furthermore, NAP enhances Tau-MT interaction, and Tau regulates the localization and function of EB1 and EB3 in developing neuronal cells. Here, we asked how NAP (ADNP) enhances Tau-MT interactions and whether this is mediated by EBs. We showed, for we believe the first time, that NAP augmented endogenous EB1 comet density in the N1E-115 neuroblastoma neuronal model. This finding was substantiated by cell transfection with fluorescent EB1 and live cell imaging. NAP increased comet amounts, length and speed. At the molecular level, NAP enhanced EB3 homodimer formation, while decreasing EB1-EB3 heterodimer content and driving EB1- and EB3-Tau interactions (dramatic 20-fold increases), leading to recruitment of EB1/EB3 and Tau to MTs under zinc intoxication. Our previous results showed that while NAP protected neuronal-like cells against oxidative stress, it did not protect NIH3T3 fibroblasts. Here, NAP did not protect NIH3T3 cells against zinc intoxication, unless these cells were transfected with Tau. Interestingly, other MT associated proteins (MAPs) may replace Tau, thus, EB-Tau (MAPs) interaction is identified as a novel target for endogenous ADNP neuroprotection, and a future target for drug development, with NAP as a prototype.Molecular Psychiatry advance online publication, 24 January 2017; doi:10.1038/mp.2016.255.

  12. The Role of Telomerase Protein TERT in Alzheimer's Disease and in Tau-Related Pathology In Vitro

    PubMed Central

    Spilsbury, Alison; Miwa, Satomi; Attems, Johannes

    2015-01-01

    The telomerase reverse transcriptase protein TERT has recently been demonstrated to have a variety of functions both in vitro and in vivo, which are distinct from its canonical role in telomere extension. In different cellular systems, TERT protein has been shown to be protective through its interaction with mitochondria. TERT has previously been found in rodent neurons, and we hypothesize that it might have a protective function in adult human brain. Here, we investigated the expression of TERT at different stages of Alzheimer's disease pathology (Braak Stages I-VI) in situ and the ability of TERT to protect against oxidative damage in an in vitro model of tau pathology. Our data reveal that TERT is expressed in vitro in mouse neurons and microglia, and in vivo in the cytoplasm of mature human hippocampal neurons and activated microglia, but is absent from astrocytes. Intriguingly, hippocampal neurons expressing TERT did not contain hyperphosphorylated tau. Vice versa, neurons that expressed high levels of pathological tau did not appear to express TERT protein. TERT protein colocalized with mitochondria in the hippocampus of Alzheimer's disease brains (Braak Stage VI), as well as in cultured neurons under conditions of oxidative stress. Our in vitro data suggest that the absence of TERT increases ROS generation and oxidative damage in neurons induced by pathological tau. Together, our findings suggest that TERT protein persists in neurons of the adult human brain, where it may have a protective role against tau pathology. PMID:25632141

  13. CSF tau levels influence cortical plasticity in Alzheimer's disease patients.

    PubMed

    Koch, Giacomo; Esposito, Zaira; Kusayanagi, Hajime; Monteleone, Fabrizia; Codecá, Claudia; Di Lorenzo, Francesco; Caltagirone, Carlo; Bernardi, Giorgio; Martorana, Alessandro

    2011-01-01

    Alzheimer's disease (AD) is a neurodegenerative process characterized by progressive neuronal degeneration, reduced levels of neurotransmitters, and altered forms of synaptic plasticity. In animal models of AD, amyloid-β (Aβ) and tau proteins are supposed to interfere with synaptic transmission. In the current study, we investigated the correlation between motor cortical plasticity, measured with 1 Hz repetitive transcranial magnetic stimulation (rTMS), and the levels of Aβ₁₋₄₂, total tau (t-Tau), and phosphorylated tau (p-Tau) detected in cerebrospinal fluid (CSF) of AD patients. We found that the overall rTMS after effects were milder in AD patients in comparison with controls. In AD patients the amount of rTMS-induced inhibition correlated with CSF t-Tau, but not with Aβ₁₋₄₂ CSF levels. Surprisingly, higher CSF t-Tau levels were associated to a stronger inhibition of the motor evoked potentials, implying that the expected effects of the 1 Hz rTMS protocol were more evident in patients with more pathological t-Tau CSF levels. These data could be interpreted as the consequence of CSF t-Tau mediated abnormal excitatory activity and could suggest that CSF t-Tau may impact mechanisms of cortical plasticity.

  14. Tau physics and tau factories

    SciTech Connect

    Perl, M.L.

    1989-01-01

    Substantial progress in tau lepton physics requires larger and cleaner samples of /tau/'s produced in e/sup +/e/sup minus/ ..-->.. /tau//sup +//tau//sup minus/. Single-tagging of the /tau/ pair is crucial. Possibilities for such progress at particle factories are discussed with emphasis on the Tau-Charm Factory concept. 30 refs., 1 fig., 1 tab.

  15. Extracellular Vesicles Isolated from the Brains of rTg4510 Mice Seed Tau Protein Aggregation in a Threshold-dependent Manner.

    PubMed

    Polanco, Juan Carlos; Scicluna, Benjamin James; Hill, Andrew Francis; Götz, Jürgen

    2016-06-10

    The microtubule-associated protein tau has a critical role in Alzheimer disease and related tauopathies. There is accumulating evidence that tau aggregates spread and replicate in a prion-like manner, with the uptake of pathological tau seeds causing misfolding and aggregation of monomeric tau in recipient cells. Here we focused on small extracellular vesicles enriched for exosomes that were isolated from the brains of tau transgenic rTg4510 and control mice. We found that these extracellular vesicles contained tau, although the levels were significantly higher in transgenic mice that have a pronounced tau pathology. Tau in the vesicles was differentially phosphorylated, although to a lower degree than in the brain cells from which they were derived. Several phospho-epitopes (AT8, AT100, and AT180) thought to be critical for tau pathology were undetected in extracellular vesicles. Despite this, when assayed with FRET tau biosensor cells, extracellular vesicles derived from transgenic mice were capable of seeding tau aggregation in a threshold-dependent manner. We also observed that the dye used to label extracellular vesicle membranes was still present during nucleation and formation of tau inclusions, suggesting either a role for membranes in the seeding or in the process of degradation. Together, we clearly demonstrate that extracellular vesicles can transmit tau pathology. This indicates a role for extracellular vesicles in the transmission and spreading of tau pathology. The characteristics of tau in extracellular vesicles and the seeding threshold we identified may explain why tau pathology develops very slowly in neurodegenerative diseases such as Alzheimer disease.

  16. Extracellular Vesicles Isolated from the Brains of rTg4510 Mice Seed Tau Protein Aggregation in a Threshold-dependent Manner*

    PubMed Central

    Polanco, Juan Carlos; Scicluna, Benjamin James; Hill, Andrew Francis

    2016-01-01

    The microtubule-associated protein tau has a critical role in Alzheimer disease and related tauopathies. There is accumulating evidence that tau aggregates spread and replicate in a prion-like manner, with the uptake of pathological tau seeds causing misfolding and aggregation of monomeric tau in recipient cells. Here we focused on small extracellular vesicles enriched for exosomes that were isolated from the brains of tau transgenic rTg4510 and control mice. We found that these extracellular vesicles contained tau, although the levels were significantly higher in transgenic mice that have a pronounced tau pathology. Tau in the vesicles was differentially phosphorylated, although to a lower degree than in the brain cells from which they were derived. Several phospho-epitopes (AT8, AT100, and AT180) thought to be critical for tau pathology were undetected in extracellular vesicles. Despite this, when assayed with FRET tau biosensor cells, extracellular vesicles derived from transgenic mice were capable of seeding tau aggregation in a threshold-dependent manner. We also observed that the dye used to label extracellular vesicle membranes was still present during nucleation and formation of tau inclusions, suggesting either a role for membranes in the seeding or in the process of degradation. Together, we clearly demonstrate that extracellular vesicles can transmit tau pathology. This indicates a role for extracellular vesicles in the transmission and spreading of tau pathology. The characteristics of tau in extracellular vesicles and the seeding threshold we identified may explain why tau pathology develops very slowly in neurodegenerative diseases such as Alzheimer disease. PMID:27030011

  17. Progressive Motor Deficit is Mediated by the Denervation of Neuromuscular Junctions and Axonal Degeneration in Transgenic Mice Expressing Mutant (P301S) Tau Protein.

    PubMed

    Yin, Zhuoran; Valkenburg, Femke; Hornix, Betty E; Mantingh-Otter, Ietje; Zhou, Xingdong; Mari, Muriel; Reggiori, Fulvio; Van Dam, Debby; Eggen, Bart J L; De Deyn, Peter P; Boddeke, Erik

    2017-02-10

    Tauopathies include a variety of neurodegenerative diseases associated with the pathological aggregation of hyperphosphorylated tau, resulting in progressive cognitive decline and motor impairment. The underlying mechanism for motor deficits related to tauopathy is not yet fully understood. Here, we use a novel transgenic tau mouse line, Tau 58/4, with enhanced neuron-specific expression of P301S mutant tau to investigate the motor abnormalities in association with the peripheral nervous system. Using stationary beam, gait, and rotarod tests, motor deficits were found in Tau 58/4 mice already 3 months after birth, which deteriorated during aging. Hyperphosphorylated tau was detected in the cell bodies and axons of motor neurons. At the age of 9 and 12 months, significant denervation of the neuromuscular junction in the extensor digitorum longus muscle was observed in Tau 58/4 mice, compared to wild-type mice. Muscle hypotrophy was observed in Tau 58/4 mice at 9 and 12 months. Using electron microscopy, we observed ultrastructural changes in the sciatic nerve of 12-month-old Tau 58/4 mice indicative of the loss of large axonal fibers and hypomyelination (assessed by g-ratio). We conclude that the accumulated hyperphosphorylated tau in the axon terminals may induce dying-back axonal degeneration, myelin abnormalities, neuromuscular junction denervation, and muscular atrophy, which may be the mechanisms responsible for the deterioration of the motor function in Tau 58/4 mice. Tau 58/4 mice represent an interesting neuromuscular degeneration model, and the pathological mechanisms might be responsible for motor signs observed in some human tauopathies.

  18. CD64-directed microtubule associated protein tau kills leukemic blasts ex vivo

    PubMed Central

    Mladenov, Radoslav; Hristodorov, Dmitrij; Cremer, Christian; Gresch, Gerrit; Grieger, Elena; Schenke, Lea; Klose, Diana; Amoury, Manal; Woitok, Mira; Jost, Edgar; Brümmendorf, Tim H.; Fendel, Rolf; Fischer, Rainer; Stein, Christoph; Thepen, Theo; Barth, Stefan

    2016-01-01

    Fc gamma receptor I (FcγRI, CD64) is a well-known target antigen for passive immunotherapy against acute myeloid leukemia and chronic myelomonocytic leukemia. We recently reported the preclinical immunotherapeutic potential of microtubule associated protein tau (MAP) against a variety of cancer types including breast carcinoma and Hodgkin's lymphoma. Here we demonstrate that the CD64-directed human cytolytic fusion protein H22(scFv)-MAP kills ex vivo 15–50% of CD64+ leukemic blasts derived from seven myeloid leukemia patients. Furthermore, in contrast to the nonspecific cytostatic agent paclitaxel, H22(scFv)-MAP showed no cytotoxicity towards healthy CD64+ PBMC-derived cells and macrophages. The targeted delivery of this microtubule stabilizing agent therefore offers a promising new strategy for specific treatment of CD64+ leukemia. PMID:27564103

  19. CD64-directed microtubule associated protein tau kills leukemic blasts ex vivo.

    PubMed

    Mladenov, Radoslav; Hristodorov, Dmitrij; Cremer, Christian; Gresch, Gerrit; Grieger, Elena; Schenke, Lea; Klose, Diana; Amoury, Manal; Woitok, Mira; Jost, Edgar; Brümmendorf, Tim H; Fendel, Rolf; Fischer, Rainer; Stein, Christoph; Thepen, Theo; Barth, Stefan

    2016-10-11

    Fc gamma receptor I (FcγRI, CD64) is a well-known target antigen for passive immunotherapy against acute myeloid leukemia and chronic myelomonocytic leukemia. We recently reported the preclinical immunotherapeutic potential of microtubule associated protein tau (MAP) against a variety of cancer types including breast carcinoma and Hodgkin's lymphoma. Here we demonstrate that the CD64-directed human cytolytic fusion protein H22(scFv)-MAP kills ex vivo 15-50% of CD64+ leukemic blasts derived from seven myeloid leukemia patients. Furthermore, in contrast to the nonspecific cytostatic agent paclitaxel, H22(scFv)-MAP showed no cytotoxicity towards healthy CD64+ PBMC-derived cells and macrophages. The targeted delivery of this microtubule stabilizing agent therefore offers a promising new strategy for specific treatment of CD64+ leukemia.

  20. Potential of Horse Apple Isoflavones in Targeting Inflammation and Tau Protein Fibrillization.

    PubMed

    Abourashed, Ehab A; Abraha, Aida; Khan, Shabana I; McCants, Tanika; Awan, Saad

    2015-09-01

    In our ongoing search for anti-inflammatory and neuroprotective agents of natural origin, the total methanolic extract (MPE) of horse apple (Maclura pomifera) and its two major prenylated isoflavones, osajin (OSA) and pomiferin (POM), were evaluated in vitro for their ability to affect four mediators of inflammation and to inhibit tau protein fibrillization. The two isoflavones were effective in enhancing the activity of NSAID activated gene (NAG-1) at 2.5 pg/mL (1.5-1.8 fold increase) and inhibiting iNOS and NF-κB activity with IC50 values in the range of 6-13 µg/mL. Pomiferin also inhibited intracellular oxidative stress with IC50 of 3.3 µg/mL, while osajin did not show any effect. The extract activated NAG-1 and inhibited iNOS and oxidative stress without affecting NF-κB. As observed by transmission electron microscopy (TEM), MPE, OSA and POM also inhibited arachidonic acid-induced tau fibrillization in a concentration-dependent manner.

  1. Microtubule-associated protein tau promotes neuronal class II β-tubulin microtubule formation and axon elongation in embryonic Xenopus laevis.

    PubMed

    Liu, Yuanyuan; Wang, Chen; Destin, Giovanny; Szaro, Ben G

    2015-05-01

    Compared with its roles in neurodegeneration, much less is known about microtubule-associated protein tau's normal functions in vivo, especially during development. The external development and ease of manipulating gene expression of Xenopus laevis embryos make them especially useful for studying gene function during early development. To study tau's functions in axon outgrowth, we characterized the most prominent tau isoforms of Xenopus embryos and manipulated their expression. None of these four isoforms were strictly analogous to those commonly studied in mammals, as all constitutively contained exon 10, which is preferentially removed from mammalian fetal tau isoforms, as well as exon 8, which in mammals is rare. Nonetheless, like mammalian tau, Xenopus tau exhibited alternative splicing of exon 4a, which in mammals distinguishes 'big' tau of peripheral neurons, and exon 6. Strongly suppressing tau expression with antisense morpholino oligonucleotides only modestly compromised peripheral nerve outgrowth of intact tadpoles, but severely disrupted neuronal microtubules containing class II β-tubulins while leaving other microtubules largely unperturbed. Thus, the relatively mild dependence of axon development on tau likely resulted from having only a single class of microtubules disrupted by its loss. Also, consistent with its greater expression in long peripheral axons, boosting expression of 'big' tau increased neurite outgrowth significantly and enhanced tubulin acetylation more so than did the smaller isoform. These data demonstrate the utility of Xenopus as a tool to gain new insights into tau's functions in vivo.

  2. Simple and accurate determination of global tau(R) in proteins using (13)C or (15)N relaxation data.

    PubMed

    Mispelter, J; Izadi-Pruneyre, N; Quiniou, E; Adjadj, E

    2000-03-01

    In the study of protein dynamics by (13)C or (15)N relaxation measurements different models from the Lipari-Szabo formalism are used in order to determine the motion parameters. The global rotational correlation time tau(R) of the molecule must be estimated prior to the analysis. In this Communication, the authors propose a new approach in determining an accurate value for tau(R) in order to realize the best fit of R(2) for the whole sequence of the protein, regardless of the different type of motions atoms may experience. The method first determines the highly structured regions of the sequence. For each corresponding site, the Lipari-Szabo parameters are calculated for R(1) and NOE, using an arbitrary value for tau(R). The chi(2) for R(2), summed over the selected sites, shows a clear minimum, as a function of tau(R). This minimum is used to better estimate a proper value for tau(R).

  3. Taxol and tau overexpression induced calpain-dependent degradation of the microtubule-destabilizing protein SCG10.

    PubMed

    Vega, Irving E; Hamano, Tadanori; Propost, Josh A; Grenningloh, Gabriele; Yen, Shu-Hui

    2006-11-01

    Microtubule-stabilizing and -destabilizing proteins play a crucial role in regulating the dynamic instability of microtubules during neuronal development and synaptic transmission. The microtubule-destabilizing protein SCG10 is a neuron-specific protein implicated in neurite outgrowth. The SCG10 protein is significantly reduced in mature neurons, suggesting that its expression is developmentally regulated. In contrast, the microtubule-stabilizing protein tau is expressed in mature neurons and its function is essential for the maintenance of neuronal polarity and neuronal survival. Thus, the establishment and maintenance of neuronal polarity may down-regulate the protein level/function of SCG10. In this report, we show that treatment of PC12 cells and neuroblastoma cells with the microtubule-stabilizing drug Taxol induced a rapid degradation of the SCG10 protein. Consistently, overexpression of tau protein in neuroblastoma cells also induced a reduction in SCG10 protein levels. Calpain inhibitor MDL-28170, but not caspase inhibitors, blocked a significant decrease in SCG10 protein levels. Collectively, these results indicate that tau overexpression and Taxol treatment induced a calpain-dependent degradation of the microtubule-destabilizing protein SCG10. The results provide evidence for the existence of an intracellular mechanism involved in the regulation of SCG10 upon microtubule stabilization.

  4. Tau and neurodegenerative disease: the story so far.

    PubMed

    Iqbal, Khalid; Liu, Fei; Gong, Cheng-Xin

    2016-01-01

    In 1975, tau protein was isolated as a microtubule-associated factor from the porcine brain. In the previous year, a paired helical filament (PHF) protein had been identified in neurofibrillary tangles in the brains of individuals with Alzheimer disease (AD), but it was not until 1986 that the PHF protein and tau were discovered to be one and the same. In the AD brain, tau was found to be abnormally hyperphosphorylated, and it inhibited rather than promoted in vitro microtubule assembly. Almost 80 disease-causing exonic missense and intronic silent mutations in the tau gene have been found in familial cases of frontotemporal dementia but, to date, no such mutation has been found in AD. The first phase I clinical trial of an active tau immunization vaccine in patients with AD was recently completed. Assays for tau levels in cerebrospinal fluid and plasma are now available, and tau radiotracers for PET are under development. In this article, we provide an overview of the pivotal discoveries in the tau research field over the past 40 years. We also review the current status of the field, including disease mechanisms and therapeutic approaches.

  5. Lysine methylation is an endogenous post-translational modification of tau protein in human brain and a modulator of aggregation propensity

    PubMed Central

    Funk, Kristen E.; Thomas, Stefani N.; Schafer, Kelsey N.; Cooper, Grace L.; Liao, Zhongping; Clark, David J.; Yang, Austin J.; Kuret, Jeff

    2015-01-01

    In Alzheimer disease, the microtubule-associated protein tau dissociates from the neuronal cytoskeleton and aggregates to form cytoplasmic inclusions. Although hyper-phosphorylation of tau Ser and Thr residues is an established trigger of tau misfunction and aggregation, tau modifications extend to Lys residues as well, raising the possibility that different modification signatures depress or promote aggregation propensity depending on site occupancy. To identify Lys-residue modifications associated with normal tau function, soluble tau proteins isolated from four cognitively normal human brains were characterized by mass spectrometry methods. The major detectable Lys modification was found to be methylation, which appeared in the form of mono- and di-methyl Lys residues distributed among at least eleven sites. Unlike tau phosphorylation sites, the frequency of Lys methylation was highest in the microtubule binding repeat region that mediates both microtubule binding and homotypic interactions. When purified recombinant human tau was modified in vitro through reductive methylation, its ability to promote tubulin polymerization was retained, whereas its aggregation propensity was greatly attenuated at both nucleation and extension steps. These data establish Lys methylation as part of the normal tau post-translational modification signature in human brain, and suggest that it can function in part to protect against pathological tau aggregation. PMID:24869773

  6. Passive immunization targeting the N-terminal projection domain of tau decreases tau pathology and improves cognition in a transgenic mouse model of Alzheimer disease and tauopathies.

    PubMed

    Dai, Chun-ling; Chen, Xia; Kazim, Syed Faraz; Liu, Fei; Gong, Cheng-Xin; Grundke-Iqbal, Inge; Iqbal, Khalid

    2015-04-01

    Intraneuronal accumulation of abnormally hyperphosphorylated tau in the brain is a histopathological hallmark of Alzheimer's disease and a family of related neurodegenerative disorders collectively called tauopathies. At present there is no effective treatment available for these progressive neurodegenerative diseases which are clinically characterized by dementia in mid to old-age. Here we report the treatment of 14-17-months-old 3xTg-AD mice with tau antibodies 43D (tau 6-18) and 77E9 (tau 184-195) to the N-terminal projection domain of tau or mouse IgG as a control by intraperitoneal injection once a week for 4 weeks, and the effects of the passive immunization on reduction of hyperphosphorylated tau, Aβ accumulation and cognitive performance in these animals. We found that treatment with tau antibodies 43D and 77E9 reduced total tau level, decreased tau hyperphosphorylated at Ser199, Ser202/Thr205 (AT8), Thr205, Ser262/356 (12E8), and Ser396/404 (PHF-1) sites, and a trend to reduce Aβ pathology. Most importantly, targeting N-terminal tau especially by 43D (tau 6-18) improved reference memory in the Morris water maze task in 3xTg-AD mice. We did not observe any abnormality in general physical characteristics of the treated animals with either of the two antibodies during the course of this study. Taken together, our studies demonstrate for the first time (1) that passive immunization targeting normal tau can effectively clear the hyperphosphorylated protein and possibly reduce Aβ pathology from the brain and (2) that targeting N-terminal projection domain of tau containing amino acid 6-18 is especially beneficial. Thus, targeting selective epitopes of N-terminal domain of tau may present a novel effective therapeutic opportunity for Alzheimer disease and other tauopathies.

  7. Sporadic inclusion-body myositis: A degenerative muscle disease associated with aging, impaired muscle protein homeostasis and abnormal mitophagy.

    PubMed

    Askanas, Valerie; Engel, W King; Nogalska, Anna

    2015-04-01

    Sporadic inclusion-body myositis (s-IBM) is the most common degenerative muscle disease in which aging appears to be a key risk factor. In this review we focus on several cellular molecular mechanisms responsible for multiprotein aggregation and accumulations within s-IBM muscle fibers, and their possible consequences. Those include mechanisms leading to: a) accumulation in the form of aggregates within the muscle fibers, of several proteins, including amyloid-β42 and its oligomers, and phosphorylated tau in the form of paired helical filaments, and we consider their putative detrimental influence; and b) protein misfolding and aggregation, including evidence of abnormal myoproteostasis, such as increased protein transcription, inadequate protein disposal, and abnormal posttranslational modifications of proteins. Pathogenic importance of our recently demonstrated abnormal mitophagy is also discussed. The intriguing phenotypic similarities between s-IBM muscle fibers and the brains of Alzheimer and Parkinson's disease patients, the two most common neurodegenerative diseases associated with aging, are also discussed. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis.

  8. Interactions between glycogen synthase kinase 3beta, protein kinase B, and protein phosphatase 2A in tau phosphorylation in mouse N2a neuroblastoma cells.

    PubMed

    Zhou, Xin-Wen; Winblad, Bengt; Guan, Zhizhong; Pei, Jin-Jing

    2009-01-01

    In this study, we investigated how tau phosphorylation is regulated by protein kinase glycogen synthase kinase 3beta (GSK3 beta), protein kinase B (PKB), and protein phosphatase 2A (PP2A) in mouse N2a neuroblastoma cells. Results showed that GSK3 beta overexpression significantly increased PKB phosphorylation at the S473 site but not the T308 site. Neither GSK3 beta nor PKB overexpression could reduce the PP2AC phosphorylation at the Y307 site. In contrast, either PKB or GSK3 beta knockdown could increase PP2A phosphorylation at the Y307 site. PP2AC knockdown increased GSK3 beta phosphorylation at the S9 site but not at the Y216 site, and PKB phosphorylation at the T308 site but not at the S473 site. Tau phosphorylation at the S396 site was increased by GSK3 beta or PKB overexpression. Tau phosphorylation at the S214 site was only induced by PKB overexpression in the study. While GSK3 beta knockdown decreased tau phosphorylation at the S396 site, PKB knockdown increased tau phosphorylation at both the S396 and S214 sites. PP2AC knockdown decreased tau phosphorylation at the S396 and S214 sites. These findings suggest that tau phosphorylation at the S396 and S214 sites is differentially regulated by GSK3 beta, PKB, and PP2A in N2a cells. The final phosphorylation state of tau is possibly caused by the synergic action of the three enzymes.

  9. Conformational Dynamics of Intracellular Tau Protein Revealed by CD and SAXS.

    PubMed

    Gorantla, Nalini Vijay; Shkumatov, Alexander V; Chinnathambi, Subashchandrabose

    2017-01-01

    A native conformation of a protein is essential for its biological role. In certain conditions, some proteins show non-native conformations, leading to aggregation, which in turn may produce severe pathologies. Such physiological conditions are classified as protein misfolding diseases. Alzheimer's disease (AD) is the most common form of dementia. Extracellular senile plaques formed by Amyloid β and intracellular aggregates formed by microtubule-associated protein Tau (MAPT) are the hallmarks of AD. Physiological role of MAPT is to maintain the integrity and stability of microtubules, however it tends to self-aggregate forming intracellular paired helical filaments (PHFs) during AD. MAPT is also subjected to various post-translational modifications such as phosphorylation, glycosylation, truncation, and acetylation. Being natively unfolded, MAPT is prone to full characterization at atomic level. Small-angle X-ray scattering (SAXS) is often applied in combination with other biophysical methods, like nuclear magnetic resonance (NMR), circular dichroism (CD), fluorescence spectroscopy, analytical ultracentrifugation (AUC), or dynamic light scattering (DLS) to characterize natively unfolded systems. Here we describe the practical aspects of MAPT characterization by SAXS and CD in detail as well as outline the inferred structural and functional implications.

  10. Characterization of the AT180 epitope of phosphorylated Tau protein by a combined nuclear magnetic resonance and fluorescence spectroscopy approach

    SciTech Connect

    Amniai, Laziza; Lippens, Guy; Landrieu, Isabelle

    2011-09-09

    Highlights: {yields} pThr231 of the Tau protein is necessary for the binding of the AT180 antibody. {yields} pSer235 of the Tau protein does not interfere with the AT180 recognition of pThr231. {yields} Epitope mapping is efficiently achieved by combining NMR and FRET spectroscopy. -- Abstract: We present here the characterization of the epitope recognized by the AT180 monoclonal antibody currently used to define an Alzheimer's disease (AD)-related pathological form of the phosphorylated Tau protein. Some ambiguity remains as to the exact phospho-residue(s) recognized by this monoclonal: pThr231 or both pThr231 and pSer235. To answer this question, we have used a combination of nuclear magnetic resonance (NMR) and fluorescence spectroscopy to characterize in a qualitative and quantitative manner the phospho-residue(s) essential for the epitope recognition. Data from the first step of NMR experiments are used to map the residues bound by the antibodies, which were found to be limited to a few residues. A fluorophore is then chemically attached to a cystein residue introduced close-by the mapped epitope, at arginine 221, by mutagenesis of the recombinant protein. The second step of Foerster resonance energy transfer (FRET) between the AT180 antibody tryptophanes and the phospho-Tau protein fluorophore allows to calculate a dissociation constant Kd of 30 nM. We show that the sole pThr231 is necessary for the AT180 recognition of phospho-Tau and that phosphorylation of Ser235 does not interfere with the binding.

  11. The physiological link between metabolic rate depression and tau phosphorylation in mammalian hibernation.

    PubMed

    Stieler, Jens T; Bullmann, Torsten; Kohl, Franziska; Tøien, Øivind; Brückner, Martina K; Härtig, Wolfgang; Barnes, Brian M; Arendt, Thomas

    2011-01-18

    Abnormal phosphorylation and aggregation of tau protein are hallmarks of a variety of neurological disorders, including Alzheimer's disease (AD). Increased tau phosphorylation is assumed to represent an early event in pathogenesis and a pivotal aspect for aggregation and formation of neurofibrillary tangles. However, the regulation of tau phosphorylation in vivo and the causes for its increased stage of phosphorylation in AD are still not well understood, a fact that is primarily based on the lack of adequate animal models. Recently we described the reversible formation of highly phosphorylated tau protein in hibernating European ground squirrels. Hence, mammalian hibernation represents a model system very well suited to study molecular mechanisms of both tau phosphorylation and dephosphorylation under in vivo physiological conditions. Here, we analysed the extent and kinetics of hibernation-state dependent tau phosphorylation in various brain regions of three species of hibernating mammals: arctic ground squirrels, Syrian hamsters and black bears. Overall, tau protein was highly phosphorylated in torpor states and phosphorylation levels decreased after arousal in all species. Differences between brain regions, hibernation-states and phosphosites were observed with respect to degree and kinetics of tau phosphorylation. Furthermore, we tested the phosphate net turnover of tau protein to analyse potential alterations in kinase and/or phosphatase activities during hibernation. Our results demonstrate that the hibernation-state dependent phosphorylation of tau protein is specifically regulated but involves, in addition, passive, temperature driven regulatory mechanisms. By determining the activity-state profile for key enzymes of tau phosphorylation we could identify kinases potentially involved in the differentially regulated, reversible tau phosphorylation that occurs during hibernation. We show that in black bears hibernation is associated with conformational

  12. Thermal compaction of the intrinsically disordered protein tau: entropic, structural, and hydrophobic factors.

    PubMed

    Battisti, Anna; Ciasca, Gabriele; Grottesi, Alessandro; Tenenbaum, Alexander

    2017-03-28

    Globular denatured proteins have structural properties similar to those of random coils. Experiments on denatured proteins have shown that when the temperature is increased thermal compaction may take place, resulting in a reduction of their radius of gyration Rg to range between 5% and 35% of its initial value. This phenomenon has been attributed to various causes, namely entropic, hydrophobic, and structural factors. The intrinsically disordered protein tau, which helps in nucleating and stabilizing microtubules in the axons of the neurons, also undergoes a relevant compaction process: when its temperature is increased from 293 K to 333 K its gyration radius decreases by 18%. We have performed an atomistic simulation of this molecule, at the lowest and highest temperatures of the mentioned interval, using both standard molecular dynamics and metadynamics, in parallel with small-angle X-ray scattering experiments. Using the fit of the experimental data and a genetic algorithm to select the most probable configurations among those produced in both atomistic simulations (standard MD and metadynamics), we were able to compute relevant changes, related to the temperature increase, in the average angles between residues, in the transient secondary structures, in the solvent accessible surface area, and in the number of intramolecular H-bonds. The analysis of the data showed how to decompose the compaction phenomenon into three contributions. An estimate of the entropic contribution to the compaction was obtained using the changes in the mean values of the angles between contiguous residues. The computation of the solvent accessible surface at the two temperatures allowed an estimation of the second factor contributing to the compaction, namely the increase in the hydrophobic interaction. We also measured the change in the average number of residues temporarily being in α-helices, 3-helices, PP II helices, β-sheets and β-turns. Those changes in the secondary

  13. CSF tau markers are correlated with hippocampal volume in Alzheimer's disease.

    PubMed

    de Souza, Leonardo C; Chupin, Marie; Lamari, Foudil; Jardel, Claude; Leclercq, Delphine; Colliot, Olivier; Lehéricy, Stéphane; Dubois, Bruno; Sarazin, Marie

    2012-07-01

    Hippocampal atrophy as assessed by magnetic resonance imaging (MRI) and abnormal cerebrospinal fluid (CSF) biomarkers are supportive features for the diagnosis of Alzheimer's disease (AD) and are assumed to be indirect pathological markers of the disease. In AD patients, antemortem MRI hippocampal volumes (HVs) correlate with the density of neurofibrillary tangles (but not with senile plaques) at autopsy suggesting that HVs may better correlate with CSF tau and hyperphosphorylated tau (P-tau) levels than CSF amyloid beta protein (Aβ)(42) level. Here, we tested this hypothesis in a well-defined AD group. Patients were selected according to the New Research Criteria for AD, including specific episodic memory deficit and CSF AD profile (defined as abnormal ratio of Aβ(42):tau). MRI was performed within 6 months of lumbar puncture. HVs were obtained using automated segmentation software. Thirty-six patients were included. Left HV correlated with CSF tau (R = -0.53) and P-tau (R = -0.56) levels. Mean HVs correlated with the CSF P-tau level (R = -0.52). No correlation was found between any brain measurement and CSF Aβ(42) level. The CSF tau and P-tau levels, but not the CSF Aβ(42) level, correlated with HV, suggesting that CSF tau markers reflect the neuronal loss associated with the physiopathological process of AD.

  14. Escitalopram Ameliorates Tau Hyperphosphorylation and Spatial Memory Deficits Induced by Protein Kinase A Activation in Sprague Dawley Rats.

    PubMed

    Ren, Qing-Guo; Wang, Yan-Juan; Gong, Wei-Gang; Xu, Lin; Zhang, Zhi-Jun

    2015-01-01

    Here, we investigated the effect of escitalopram pretreatment on protein kinase A (PKA)-induced tau hyperphosphorylation and spatial memory deficits in rats using western blot and behavioral tests, respectively. We demonstrated that escitalopram effectively ameliorated tau hyperphosphorylation and the spatial memory deficits induced by PKA activation. We measured the total and activity-dependent Ser9-phosphorylated levels of glycogen synthase kinase (GSK)-3β in hippocampal extracts. No significant change in the total level of GSK-3β was observed between the different groups. However, compared with forskolin injection alone, pretreatment with escitalopram increased the level of Ser9-phosphorylated GSK-3β. We also demonstrated that escitalopram increased Akt phosphorylation at Ser473 (the active form of Akt). Furthermore, we identified other important kinases and phosphatases, such as protein phosphatase 2A, extracellular signal-regulated kinases 1 and 2, and MAP kinase kinase-1/2, that have previously been reported to play a crucial role in tau phosphorylation; however, we did not detect any significant change in the activation of these kinases or phosphatases in our study. We unexpectedly demonstrated that forskolin caused anxiety-like behavior in rats, and pretreatment with escitalopram did not significantly ameliorate the anxiety-like behavior induced by forskolin. These data provide the first evidence that escitalopram ameliorates forskolin-induced tau hyperphosphorylation and spatial memory impairment in rats; these effects do not occur via the anti-anxiety activity of escitalopram but may involve the Akt/GSK-3β signaling pathway.

  15. Age-dependent changes in neuronal distribution of CacyBP/SIP: comparison to tubulin and the tau protein.

    PubMed

    Filipek, Anna; Schneider, Gabriela; Mietelska, Anna; Figiel, Izabela; Niewiadomska, Grazyna

    2008-09-01

    CacyBP/SIP was originally identified as an S100A6 (calcyclin) target and later on as a Siah-1 interacting protein. Recently, we have shown that CacyBP/SIP interacts with tubulin, which suggests its involvement in the reorganization of microtubules. In this work we examined the localization of CacyBP/SIP in cultured neurons and in brain neurons of young and aged rats, and compared this localization with that of tubulin and the tau protein. We have found that in neurons of young rats CacyBP/SIP, tubulin and tau are present in the cytoplasm and in the neuronal processes, whereas in aged animals CacyBP/SIP and tau are mainly seen in the cytoplasm of the neuronal somata. In aged rats, these changes are also accompanied by a different localization pattern of tubulin. Thus, our results show that localization of CacyBP/SIP in brain neurons is similar to that observed for tau and tubulin, which points to the involvement of CacyBP/SIP in cytoskeletal physiology.

  16. Regulated phosphorylation and dephosphorylation of tau protein: effects on microtubule interaction, intracellular trafficking and neurodegeneration.

    PubMed Central

    Billingsley, M L; Kincaid, R L

    1997-01-01

    This review attempts to summarize what is known about tau phosphorylation in the context of both normal cellular function and dysfunction. However, conceptions of tau function continue to evolve, and it is likely that the regulation of tau distribution and metabolism is complex. The roles of microtubule-associated kinases and phosphatases have yet to be fully described, but may afford insight into how tau phosphorylation at the distal end of the axon regulates cytoskeletal-membrane interactions. Finally, lipid and glycosaminoglycan modification of tau structure affords yet more complexity for regulation and aggregation. Continued work will help to determine what is causal and what is coincidental in Alzheimer's disease, and may lead to identification of therapeutic targets for halting the progression of paired helical filament formation. PMID:9169588

  17. Pioglitazone prevents tau oligomerization.

    PubMed

    Hamano, Tadanori; Shirafuji, Norimichi; Makino, Chiemi; Yen, Shu-Hui; Kanaan, Nicholas M; Ueno, Asako; Suzuki, Jinya; Ikawa, Masamichi; Matsunaga, Akiko; Yamamura, Osamu; Kuriyama, Masaru; Nakamoto, Yasunari

    2016-09-23

    Tau aggregation and amyloid β protein (Aβ) deposition are the main causes of Alzheimer's disease (AD). Peroxisome proliferator-activated receptor γ (PPARγ) activation modulates Aβ production. To test whether the PPARγ agonist pioglitazone (PIO) is also effective in preventing tau aggregation in AD, we used a cellular model in which wild-type tau protein (4R0N) is overexpressed (M1C cells) (Hamano et al., 2012) as well as primary neuronal cultures. PIO reduced both phosphorylated and total tau levels, and inactivated glycogen synthase kinase 3β, a major tau kinase, associated with activation of Akt. In addition, PIO decreased cleaved caspase3 and C-terminal truncated tau species by caspase, which is expected to decrease tau aggregation. A fractionation study showed that PIO reduced high molecular-weight (120 kDa), oligomeric tau species in Tris Insoluble, sarkosyl-soluble fractions. Tau decrease was reversed by adding GW9662, a PPARγ antagonist. Together, our current results support the idea that PPARγ agonists may be useful therapeutic agents for AD.

  18. Interaction of single and multi wall carbon nanotubes with the biological systems: tau protein and PC12 cells as targets

    PubMed Central

    Zeinabad, Hojjat Alizadeh; Zarrabian, Alireza; Saboury, Ali Akbar; Alizadeh, Ali Mohammad; Falahati, Mojtaba

    2016-01-01

    Subtle changes in the structure of nanoparticles influence their surface tension and corresponding interaction with cells and proteins. Here, the interaction of the single wall carbon nanotube (SWCNT) and multiwall carbon nanotube (MWCNT) with different surface tension with tau protein was evaluated using a variety of techniques including far and near circular dichroism, fluorescence spectroscopy, dynamic light scattering, Zeta potential, and TEM evaluation. Also the cytotoxicity of SWCNT and MWCNT on the PC12 cell line as a model of nervous system cell line was investigated by the MTT, LDH, acridine orange/ethidium bromide staining, flow cytometry, caspase 3 activity, cell and membrane potential assays. It was observed that SWCNT induced more structural changes of tau protein relative to MWCNT/tau protein interaction. It was also revealed that SWCNT and MWCNT impaired the viability and complexity of PC12 cells in different modes of cytotoxicity. Analysis of cellular outcomes indicated that MWCNT in comparison with SWCNT resulted in induction of necrotic modes of cell death, whereas apoptotic modes of cell death were activated in SWCNT-incubated cells. Together these findings suggest that surface tension may be used to determine how nanoparticle structure affects neurotoxicity and protein conformational changes. PMID:27216374

  19. Dynamic model for kinesin-mediated long-range transport and its local traffic jam caused by tau proteins

    NASA Astrophysics Data System (ADS)

    Nam, Woochul; Epureanu, Bogdan I.

    2017-01-01

    In neurons, several intracellular cargoes are transported by motor proteins (kinesins) which walk on microtubules (MTs). However, kinesins can possibly unbind from the MTs before they reach their destinations. The unbound kinesins randomly diffuse in neurons until they bind to MTs. Then, they walk again along the MTs to continue their tasks. Kinesins repeat this cycle of motion until they transport their cargoes to the destinations. However, most previous models mainly focused on the motion of kinesins when they walk on MTs. Thus, a new model is required to encompass the various types of kinesin motion. We developed a comprehensive model and studied the long-range axonal transport of neurons using the model. To enhance reliability of the model, it was constructed based on multiphysics on kinesin motion (i.e., chemical kinetics, diffusion, fluid dynamics, nonlinear dynamics, and stochastic characteristics). Also, parameter values for kinesin motions are carefully obtained by comparing the model predictions and several experimental observations. The axonal transport can be degraded when a large number of binding sites on MTs are blocked by excessive tau proteins. By considering the interference between walking kinesins and tau molecules on MTs, effects of tau proteins on the axonal transport are studied. One of the meaningful predictions obtained from the model is that the velocity is not an effective metric to estimate the degradation of the transport because the decrease in velocity is not noticeable when the concentration of tau protein is not high. However, our model shows that the transport locally changes near tau molecules on MTs even when the change in the velocity is not significant. Thus, a statistical method is proposed to detect this local change effectively. The advantage of this method is that a value obtained from this method is highly sensitive to the concentration of tau protein. Another benefit of this method is that this highly sensitive value can

  20. Dynamic model for kinesin-mediated long-range transport and its local traffic jam caused by tau proteins.

    PubMed

    Nam, Woochul; Epureanu, Bogdan I

    2017-01-01

    In neurons, several intracellular cargoes are transported by motor proteins (kinesins) which walk on microtubules (MTs). However, kinesins can possibly unbind from the MTs before they reach their destinations. The unbound kinesins randomly diffuse in neurons until they bind to MTs. Then, they walk again along the MTs to continue their tasks. Kinesins repeat this cycle of motion until they transport their cargoes to the destinations. However, most previous models mainly focused on the motion of kinesins when they walk on MTs. Thus, a new model is required to encompass the various types of kinesin motion. We developed a comprehensive model and studied the long-range axonal transport of neurons using the model. To enhance reliability of the model, it was constructed based on multiphysics on kinesin motion (i.e., chemical kinetics, diffusion, fluid dynamics, nonlinear dynamics, and stochastic characteristics). Also, parameter values for kinesin motions are carefully obtained by comparing the model predictions and several experimental observations. The axonal transport can be degraded when a large number of binding sites on MTs are blocked by excessive tau proteins. By considering the interference between walking kinesins and tau molecules on MTs, effects of tau proteins on the axonal transport are studied. One of the meaningful predictions obtained from the model is that the velocity is not an effective metric to estimate the degradation of the transport because the decrease in velocity is not noticeable when the concentration of tau protein is not high. However, our model shows that the transport locally changes near tau molecules on MTs even when the change in the velocity is not significant. Thus, a statistical method is proposed to detect this local change effectively. The advantage of this method is that a value obtained from this method is highly sensitive to the concentration of tau protein. Another benefit of this method is that this highly sensitive value can

  1. Divergent CSF tau alterations in two common tauopathies: Alzheimer’s disease and Progressive Supranuclear Palsy

    PubMed Central

    Wagshal, Dana; Sankaranarayanan, Sethu; Guss, Valerie; Hall, Tracey; Berisha, Flora; Lobach, Iryna; Karydas, Anna; Voltarelli, Lisa; Scherling, Carole; Heuer, Hilary; Tartaglia, Maria Carmela; Miller, Zachary; Coppola, Giovanni; Ahlijanian, Michael; Soares, Holly; Kramer, Joel H; Rabinovici, Gil D; Rosen, Howard J; Miller, Bruce L; Meredith, Jere; Boxer, Adam L

    2014-01-01

    Background Elevated CSF tau is considered a biomarker of neuronal injury in newly developed Alzheimer’s disease (AD) and mild cognitive impairment (MCI) criteria. However, previous studies have failed to detect alterations of tau species in other primary tauopathies. We assessed CSF tau protein abnormalities in AD, a tauopathy with prominent Aβ pathology, and progressive supranuclear palsy (PSP), a primary tauopathy characterized by deposition of four microtubule binding repeat (4R) tau with minimal Aβ pathology. Methods 26 normal control (NC), 37 AD, and 24 PSP patients participated in the study. AD and PSP were matched for severity using the clinical dementia rating sum of boxes (CDR-sb) scores. The INNO BIA AlzBio3 multiplex immunoassay was used to measure CSF Aβ, total tau, and ptau181. Additional, novel ELISAs targeting different N-terminal and central tau epitopes were developed to examine CSF tau components and to investigate interactions between diagnostic group, demographics, and genetic variables. Results PSP had lower CSF N-terminal and C-terminal tau concentrations than NC and AD measured with both the novel tau ELISAs and the standard AlzBio3 tau and ptau assays. AD had higher total tau and ptau levels than NC and PSP. There was a gender by diagnosis interaction in both AD and PSP for most tau species, with lower concentrations for male compared to female patients. Conclusions CSF tau fragment concentrations are different in PSP compared with AD despite the presence of severe tau pathology and neuronal injury in both disorders. CSF tau concentration likely reflects multiple factors in addition to the degree of neuronal injury. PMID:24899730

  2. Protein interaction module-assisted function X (PIMAX) approach to producing challenging proteins including hyperphosphorylated tau and active CDK5/p25 kinase complex.

    PubMed

    Sui, Dexin; Xu, Xinjing; Ye, Xuemei; Liu, Mengyu; Mianecki, Maxwell; Rattanasinchai, Chotirat; Buehl, Christopher; Deng, Xiexiong; Kuo, Min-Hao

    2015-01-01

    Many biomedically critical proteins are underrepresented in proteomics and biochemical studies because of the difficulty of their production in Escherichia coli. These proteins might possess posttranslational modifications vital to their functions, tend to misfold and be partitioned into bacterial inclusion bodies, or act only in a stoichiometric dimeric complex. Successful production of these proteins requires efficient interaction between these proteins and a specific "facilitator," such as a protein-modifying enzyme, a molecular chaperone, or a natural physical partner within the dimeric complex. Here we report the design and application of a protein interaction module-assisted function X (PIMAX) system that effectively overcomes these hurdles. By fusing two proteins of interest to a pair of well-studied protein-protein interaction modules, we were able to potentiate the association of these two proteins, resulting in successful production of an enzymatically active cyclin-dependent kinase complex and hyperphosphorylated tau protein, which is intimately linked to Alzheimer disease. Furthermore, using tau isoforms quantitatively phosphorylated by GSK-3β and CDK5 kinases via PIMAX, we demonstrated the hyperphosphorylation-stimulated tau oligomerization in vitro, paving the way for new Alzheimer disease drug discoveries. Vectors for PIMAX can be easily modified to meet the needs of different applications. This approach thus provides a convenient and modular suite with broad implications for proteomics and biomedical research.

  3. Expression of Tau Produces Aberrant Plasma Membrane Blebbing in Glial Cells Through RhoA-ROCK-Dependent F-Actin Remodeling.

    PubMed

    Torres-Cruz, Francisco M; Rodríguez-Cruz, Fanny; Escobar-Herrera, Jaime; Barragán-Andrade, Norma; Basurto-Islas, Gustavo; Ripova, Daniela; Ávila, Jesús; Garcia-Sierra, Francisco

    2016-03-21

    Abnormal aggregation of Tau in glial cells has been reported in Alzheimer's disease (AD) and other tauopathies; however, the pathological significance of these aggregates remains unsolved to date. In this study, we evaluated whether full-length Tau (Tau441) and its aspartic acid421-truncated Tau variant (Tau421) produce alterations in the normal organization of the cytoskeleton and plasma membrane (PM) when transiently expressed in cultured C6-glial cells. Forty-eight hours post-transfection, abnormal microtubule bundling was observed in the majority of the cells, which expressed either Tau441 or Tau421. Moreover, both variants of Tau produced extensive PM blebbing associated with cortical redistribution of filamentous actin (F-Actin). These effects were reverted when Tau-expressing cells were incubated with drugs that depolymerize F-Actin. In addition, when glial cells showing Tau-induced PM blebbing were incubated with inhibitors of the Rho-associated protein kinase (ROCK) signaling pathway, both formation of abnormal PM blebs and F-Actin remodeling were avoided. All of these effects were initiated upstream by abnormal Tau-induced microtubule bundling, which may release the microtubule-bound guanine nucleotide exchange factor-H1 (GEF-H1) into the cytoplasm in order to activate its major effector RhoA-GTPase. These results may represent a new mechanism of Tau toxicity in which Tau-induced microtubule bundling produces activation of the Rho-GTPase-ROCK pathway that in turn mediates the remodeling of cortical Actin and PM blebbing. In AD and other tauopathies, these Tau-induced abnormalities may occur and contribute to the impairment of glial activity.

  4. The relationship between truncation and phosphorylation at the C-terminus of tau protein in the paired helical filaments of Alzheimer's disease

    PubMed Central

    Flores-Rodríguez, Paola; Ontiveros-Torres, Miguel A.; Cárdenas-Aguayo, María C.; Luna-Arias, Juan P.; Meraz-Ríos, Marco A.; Viramontes-Pintos, Amparo; Harrington, Charles R.; Wischik, Claude M.; Mena, Raúl; Florán-Garduño, Benjamin; Luna-Muñoz, José

    2015-01-01

    We previously demonstrated that, in the early stages of tau processing in Alzheimer's disease, the N-terminal part of the molecule undergoes a characteristic cascade of phosphorylation and progressive misfolding of the proteins resulting in a structural conformation detected by Alz-50. In this immunohistochemical study of AD brain tissue, we have found that C-terminal truncation of tau at Asp-421 was an early event in tau aggregation and analyzed the relationship between phospho-dependent tau epitopes located at the C-terminus with truncation at Glu-391. The aim of this study was to determine whether C-terminal truncation may trigger events leading to the assembly of insoluble PHFs from soluble tau aggregates present in pre-tangle cells. Our findings suggest that there is a complex interaction between phosphorylated and truncated tau species. A model is presented here in which truncated tau protein represents an early neurotoxic species while phosphorylated tau species may provide a neuroprotective role in Alzheimer's disease. PMID:25717290

  5. Rosiglitazone ameliorates diffuse axonal injury by reducing loss of tau and up-regulating caveolin-1 expression

    PubMed Central

    Zhao, Yong-lin; Song, Jin-ning; Ma, Xu-dong; Zhang, Bin-fei; Li, Dan-dong; Pang, Hong-gang

    2016-01-01

    Rosiglitazone up-regulates caveolin-1 levels and has neuroprotective effects in both chronic and acute brain injury. Therefore, we postulated that rosiglitazone may ameliorate diffuse axonal injury via its ability to up-regulate caveolin-1, inhibit expression of amyloid-beta precursor protein, and reduce the loss and abnormal phosphorylation of tau. In the present study, intraperitoneal injection of rosiglitazone significantly reduced the levels of amyloid-beta precursor protein and hyperphosphorylated tau (phosphorylated at Ser404(p-tau (S404)), and it increased the expression of total tau and caveolin-1 in the rat cortex. Our results show that rosiglitazone inhibits the expression of amyloid-beta precursor protein and lowers p-tau (S404) levels, and it reduces the loss of total tau, possibly by up-regulating caveolin-1. These actions of rosiglitazone may underlie its neuroprotective effects in the treatment of diffuse axonal injury. PMID:27482223

  6. Internalized Tau sensitizes cells to stress by promoting formation and stability of stress granules

    PubMed Central

    Brunello, Cecilia A.; Yan, Xu; Huttunen, Henri J.

    2016-01-01

    Stress granules are membrane-less RNA- and RNA-binding protein-containing complexes that are transiently assembled in stressful conditions to promote cell survival. Several stress granule-associated RNA-binding proteins have been associated with neurodegenerative diseases. In addition, a close link was recently identified between the stress granule core-nucleating protein TIA-1 and Tau. Tau is a central pathological protein in Alzheimer’s disease and other tauopathies, and misfolded, aggregated Tau is capable of propagating pathology via cell-to-cell transmission. Here we show that following internalization hyperphosphorylated extracellular Tau associates with stress granules in a TIA-1 dependent manner. Cytosolic Tau normally only weakly interacts with TIA-1 but mutations mimicking abnormal phosphorylation promote this interaction. We show that internalized Tau significantly delays normal clearance of stress granules in the recipient cells sensitizing them to secondary stress. These results suggest that secreted Tau species may have properties, likely related to its hyperphosphorylation and oligomerization, which promote pathological association of internalized Tau with stress granules altering their dynamics and reducing cell viability. We suggest that stress granules and TIA-1 play a central role in the cell-to-cell transmission of Tau pathology. PMID:27460788

  7. Lack of exon 10 in the murine tau gene results in mild sensorimotor defects with aging

    PubMed Central

    2013-01-01

    Background Complex species-specific, developmental- and tissue-dependent mechanisms regulate alternative splicing of tau, thereby diversifying tau protein synthesis. The functional role of alternative splicing of tau e.g. exon 10 has never been examined in vivo, although genetic studies suggest that it is important to neurodegenerative disease. Results Gene-targeting was used to delete exon 10 in murine tau on both alleles (E10−/−) to study its functional role. Moreover, mice devoid of exon 10 (E10+/−) on one allele were generated to investigate the effects of 1:1 balanced expression of 4R-/3R-tau protein, since equal amounts of 4R-/3R-tau protein are synthesized in human brain. Middle-aged E10−/− mice displayed sensorimotor disturbances in the rotarod when compared to age-matched E10+/− and wild-type mice, and their muscular grip strength was less than that of E10+/− mice. The performance of E10+/− mice and wild-type mice (E10+/+) was similar in sensorimotor tests. Cognitive abilities or anxiety-like behaviours did not depend on exon 10 in tau, and neither pathological inclusions nor gene-dependent morphological abnormalities were found. Conclusion Ablation of exon 10 in the murine tau gene alters alternative splicing and tau protein synthesis which results in mild sensorimotor phenotypes with aging. Presumably related microtubule-stabilizing genes rescue other functions. PMID:24261309

  8. Grape derived polyphenols attenuate tau neuropathology in a mouse model of Alzheimer's disease.

    PubMed

    Wang, Jun; Santa-Maria, Ismael; Ho, Lap; Ksiezak-Reding, Hanna; Ono, Kenjiro; Teplow, David B; Pasinetti, Giulio Maria

    2010-01-01

    Aggregation of microtubule-associated protein tau into insoluble intracellular neurofibrillary tangles is a characteristic hallmark of Alzheimer's disease (AD) and other neurodegenerative diseases, including progressive supranuclear palsy, argyrophilic grain disease, corticobasal degeneration, frontotemporal dementias with Parkinsonism linked to chromosome 17, and Pick's disease. Tau is abnormally hyperphosphorylated in AD and aberrant tau phosphorylation contributes to the neuropathology of AD and other tauopathies. Anti-aggregation and anti-phosphorylation are main approaches for tau-based therapy. In this study, we report that a select grape-seed polyphenol extract (GSPE) could potently interfere with the assembly of tau peptides into neurotoxic aggregates. Moreover, oral administration of GSPE significantly attenuated the development of AD type tau neuropathology in the brain of TMHT mouse model of AD through mechanisms associated with attenuation of extracellular signal-receptor kinase 1/2 signaling in the brain.

  9. Aluminum interaction with human brain tau protein phosphorylation by various kinases

    SciTech Connect

    El-Sebae; Abou Zeid, M.M.; Saleh, M.A. . Environmental Chemistry and Toxicology Lab.); Abdel-Ghany, M.E.; Shalloway, D. . Section of Biochemistry, Mol, and Cell Biology); Blancato, J. . Environmental Monit. Systems Lab.)

    1993-01-01

    Phosphorylation is an indispensable process for energy and signal transduction in biological systems. AlCl[sub 3] at 10 nM to 10 [mu]M range activated in-vitro [[gamma][sup [minus]32]P]ATP phosphorylation of the brain ([tau]) [Gamma] protein in both normal human or E.coli expressed [Gamma] forms; in the presence of the kinases P34,PKP, and PKC. However, higher concentrations of AlCl[sub 3] inhibited the [Gamma] phosphorylation with P34, PKP, and PKC to a maximum at 1 mM level. AlCl[sub 3] at 100 [mu]M to 500 [mu]M range induced non-enzymatic phosphorylation of [Gamma] with [gamma]-ATP, [gamma]-GTP, and [alpha]-GRP. AlCl[sub 3] activated histone phosphorylation by P34 in a similar pattern. The hyperphosphorylation of [Gamma] by Al[sup 3+] was accompanied in molecular shift and mobility retardation in SDS-PAGE. This may demonstrate the mechanism of the long term neurological effect of Al[sub 3+] in human brain leading to the formation of the neutrofibrillary tangles related to Alzeheimer's disease.

  10. The aqueous extract of Glycyrrhiza inflata can upregulate unfolded protein response-mediated chaperones to reduce tau misfolding in cell models of Alzheimer’s disease

    PubMed Central

    Chang, Kuo-Hsuan; Chen, I-Cheng; Lin, Hsuan-Yuan; Chen, Hsuan-Chiang; Lin, Chih-Hsin; Lin, Te-Hsien; Weng, Yu-Ting; Chao, Chih-Ying; Wu, Yih-Ru; Lin, Jung-Yaw; Lee-Chen, Guey-Jen; Chen, Chiung-Mei

    2016-01-01

    Background Alzheimer’s disease (AD) and several neurodegenerative disorders known as tauopathies are characterized by misfolding and aggregation of tau protein. Although several studies have suggested the potential of traditional Chinese medicine (TCM) as treatment for neurodegenerative diseases, the role of TCM in treating AD and tauopathies have not been well explored. Materials and methods Tau protein was coupled to the DsRed fluorophore by fusing a pro-aggregation mutant of repeat domain of tau (ΔK280 tauRD) with DsRed. The ΔK280 tauRD-DsRed fusion gene was then used to generate Tet-On 293 and SH-SY5Y cell clones as platforms to test the efficacy of 39 aqueous extracts of TCM in reducing tau misfolding and in neuroprotection. Results Seven TCM extracts demonstrated a significant reduction in tau misfolding and reactive oxidative species with low cytotoxicity in the ΔK280 tauRD-DsRed 293 cell model. Glycyrrhiza inflata and Panax ginseng also demonstrated the potential to improve neurite outgrowth in the ΔK280 tauRD-DsRed SH-SY5Y neuronal cell model. G. inflata further rescued the upregulation of ERN2 (pro-apoptotic) and downregulation of unfolded-protein-response-mediated chaperones ERP44, DNAJC3, and SERP1 in ΔK280 tauRD-DsRed 293 cells. Conclusion This in vitro study provides evidence that G. inflata may be a novel therapeutic for AD and tauopathies. Future applications of G. inflata on animal models of AD and tauopathies are warranted to corroborate its effect of reducing misfolding and potential disease modification. PMID:27013866

  11. Characterization of the AT180 epitope of phosphorylated Tau protein by a combined nuclear magnetic resonance and fluorescence spectroscopy approach.

    PubMed

    Amniai, Laziza; Lippens, Guy; Landrieu, Isabelle

    2011-09-09

    We present here the characterization of the epitope recognized by the AT180 monoclonal antibody currently used to define an Alzheimer's disease (AD)-related pathological form of the phosphorylated Tau protein. Some ambiguity remains as to the exact phospho-residue(s) recognized by this monoclonal: pThr231 or both pThr231 and pSer235. To answer this question, we have used a combination of nuclear magnetic resonance (NMR) and fluorescence spectroscopy to characterize in a qualitative and quantitative manner the phospho-residue(s) essential for the epitope recognition. Data from the first step of NMR experiments are used to map the residues bound by the antibodies, which were found to be limited to a few residues. A fluorophore is then chemically attached to a cystein residue introduced close-by the mapped epitope, at arginine 221, by mutagenesis of the recombinant protein. The second step of Förster resonance energy transfer (FRET) between the AT180 antibody tryptophanes and the phospho-Tau protein fluorophore allows to calculate a dissociation constant Kd of 30 nM. We show that the sole pThr231 is necessary for the AT180 recognition of phospho-Tau and that phosphorylation of Ser235 does not interfere with the binding.

  12. Biochemical studies in Normal Pressure Hydrocephalus (NPH) patients: change in CSF levels of amyloid precursor protein (APP), amyloid-beta (Aβ) peptide and phospho-tau.

    PubMed

    Ray, Balmiki; Reyes, Patricio F; Lahiri, Debomoy K

    2011-04-01

    Normal Pressure Hydrocephalus (NPH) is one of the causes of dementia of the elderly characterized by impaired mental function, gait difficulties and urinary incontinence. Previously, it was proposed that some of the NPH patients may develop Alzheimer's disease (AD) like pathology. Aim of this study was to compare levels of different CSF biomarkers, including total secreted β-amyloid precursor protein (sAPP), sAPP-alpha form (sAPPα), amyloid-beta (Aβ) peptide, total-tau protein and hyperphosphorylated-tau protein in subjects from NPH and Non-NPH Control (NNC). CSF was collected from 23 NPH patients and 13 Non-NPH controls by lumber puncture. Western blot analysis was performed to measure levels of sAPP-total. ELISA was used separately to determine levels of sAPPα, Aβ peptide, total-tau and phospho-tau proteins. We found a significant decrease in levels of total secreted APP, sAPPα and Aβ (1-42) in the CSF sample of NPH patients vs. NNC. We did not observe any change in levels of total-tau or phospho-tau in NPH vs. NNC subjects. Notably, phospho-tau level was significantly increased in the NPH patients, who were suffering from the disease for more than one year, vs. NNC. Among five biomarkers studied, decreased sAPP, sAPPα and Aβ (1-42) levels in CSF can be molecular markers to distinguish NPH cases from NNC. Disease severity can also be assessed by increased levels of CSF phospho-tau protein and the ratio of phospho-tau to Aβ (1-42), which might be a useful tool for predicting conversion of NPH individuals to other neurodegenerative disorders including Alzheimer's disease (AD).

  13. Potential Natural Products for Alzheimer’s Disease: Targeted Search Using the Internal Ribosome Entry Site of Tau and Amyloid-β Precursor Protein

    PubMed Central

    Tasi, Yun-Chieh; Chin, Ting-Yu; Chen, Ying-Ju; Huang, Chun-Chih; Lee, Shou-Lun; Wu, Tzong-Yuan

    2015-01-01

    Overexpression of the amyloid precursor protein (APP) and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer’s disease (AD). As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES) elements flanked by β-galactosidase gene (cap-dependent) and secreted alkaline phosphatase (SEAP) (cap-independent) to discern the mechanism of action of memantine, an N-methyl-d-aspartate (NMDA) receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity) without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A) and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine) fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE−/−) mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD. PMID:25903151

  14. Secondary Metabolites in Ramalina terebrata Detected by UHPLC/ESI/MS/MS and Identification of Parietin as Tau Protein Inhibitor.

    PubMed

    Cornejo, Alberto; Salgado, Francisco; Caballero, Julio; Vargas, Reinaldo; Simirgiotis, Mario; Areche, Carlos

    2016-08-18

    Liquid chromatography coupled with mass spectrometry is an outstanding methodology for fast analysis of phenolic compounds in biological samples. Twenty two compounds were quickly and accurately identified in the methanolic extract of the Antarctic lichen Ramalina terebrata for the first time using ultra high pressure liquid chromatography coupled with photodiode array detector and high resolution mass spectrometry (UHPLC-PDA-Q/Orbitrap/MS/MS). In addition, the extract and the four compounds isolated from this species were tested for the inhibitory activity of tau protein aggregation, which is a protein involved in Alzheimer's disease (AD). All compounds showed null activity with the exception of parietin, which it was able to inhibit aggregation process of tau in a concentration range between 3 µg/mL (10 µM) to 28 µg/mL (100 µM). In addition, we show how parietin interact with tau (306)VQIVYK(311) hexapeptide inside of the microtubule binding domain (4R) with the help of molecular docking experiments. Finally, the constituents present in the methanolic extract could possibly contribute to the established anti-aggregation activity for this extract and this in-depth analysis of the chemical composition of R. terebrata could guide further research into its medicinal properties and potential uses.

  15. Secondary Metabolites in Ramalina terebrata Detected by UHPLC/ESI/MS/MS and Identification of Parietin as Tau Protein Inhibitor

    PubMed Central

    Cornejo, Alberto; Salgado, Francisco; Caballero, Julio; Vargas, Reinaldo; Simirgiotis, Mario; Areche, Carlos

    2016-01-01

    Liquid chromatography coupled with mass spectrometry is an outstanding methodology for fast analysis of phenolic compounds in biological samples. Twenty two compounds were quickly and accurately identified in the methanolic extract of the Antarctic lichen Ramalina terebrata for the first time using ultra high pressure liquid chromatography coupled with photodiode array detector and high resolution mass spectrometry (UHPLC-PDA-Q/Orbitrap/MS/MS). In addition, the extract and the four compounds isolated from this species were tested for the inhibitory activity of tau protein aggregation, which is a protein involved in Alzheimer’s disease (AD). All compounds showed null activity with the exception of parietin, which it was able to inhibit aggregation process of tau in a concentration range between 3 µg/mL (10 µM) to 28 µg/mL (100 µM). In addition, we show how parietin interact with tau 306VQIVYK311 hexapeptide inside of the microtubule binding domain (4R) with the help of molecular docking experiments. Finally, the constituents present in the methanolic extract could possibly contribute to the established anti-aggregation activity for this extract and this in-depth analysis of the chemical composition of R. terebrata could guide further research into its medicinal properties and potential uses. PMID:27548142

  16. Efficient neuronal gene transfer with AAV8 leads to neurotoxic levels of tau or green fluorescent proteins.

    PubMed

    Klein, Ronald L; Dayton, Robert D; Leidenheimer, Nancy J; Jansen, Karen; Golde, Todd E; Zweig, Richard M

    2006-03-01

    Adeno-associated virus (AAV) serotype 8 appears to be the strongest of the natural serotypes reported to date for gene transfer in liver and muscle. In this study, we evaluated AAV8 in the brain by several methods, including biophotonic imaging of green fluorescent protein (GFP). In the adult rat hippocampus, levels of GFP expressed were clearly greater with AAV8 than with AAV2 or AAV5 by Western blot and biophotonic imaging and slightly but significantly greater than AAV1 by Western blot. In the substantia nigra, the GFP expression conferred by AAV8 was toxic to dopamine neurons, although toxicity could be avoided with dose titration. At the low dose at which there was no GFP toxicity from the GFP vector, another AAV8 vector for a disease-related (P301L) form of the microtubule-associated protein tau caused a 78% loss of dopamine neurons and significant amphetamine-stimulated rotational behavior. The AAV8 tau vector-induced cell loss was greater than that from AAV2 or AAV5 tau vectors, demonstrating that the increased gene transfer was functional. While the toxicity observed with GFP expression warrants great caution, the efficient AAV8 is promising for animal models of neurodegenerative diseases and potentially as well for gene therapy of brain diseases.

  17. Tau as a Therapeutic Target for Alzheimer’s Disease

    PubMed Central

    Boutajangout, Allal; Sigurdsson, Einar M.; Krishnamurthy, Pavan K.

    2012-01-01

    Neurofibrillary tangles (NFTs) are one of the pathological hallmarks of Alzheimer’s disease (AD) and are primarily composed of aggregates of hyperphosphorylated forms of the microtubule associated protein tau. It is likely that an imbalance of kinase and phosphatase activities leads to the abnormal phosphorylation of tau and subsequent aggregation. The wide ranging therapeutic approaches that are being developed include to inhibit tau kinases, to enhance phosphatase activity, to promote microtubule stability, and to reduce tau aggregate formation and/or enhance their clearance with small molecule drugs or by immunotherapeutic means. Most of these promising approaches are still in preclinical development whilst some have progressed to Phase II clinical trials. By pursuing these lines of study, a viable therapy for AD and related tauopathies may be obtained. PMID:21679154

  18. The Link between Type 2 Diabetes and Neurodegeneration: Roles for Amyloid-β, Amylin, and Tau Proteins.

    PubMed

    Bharadwaj, Prashant; Wijesekara, Nadeeja; Liyanapathirana, Milindu; Newsholme, Philip; Ittner, Lars; Fraser, Paul; Verdile, Giuseppe

    2017-03-01

    A wealth of evidence indicates a strong link between type 2 diabetes (T2D) and neurodegenerative diseases such as Alzheimer's disease (AD). Although the precise mechanism remains unclear, T2D can exacerbate neurodegenerative processes. Brain atrophy, reduced cerebral glucose metabolism, and central nervous system insulin resistance are features of both AD and T2D. The T2D phenotype (glucose dyshomeostasis, insulin resistance, impaired insulin signaling) also promotes AD pathology, namely accumulation of amyloid-β (Aβ) and hyperphosphorylated tau and can induce other aspects of neuronal degeneration including inflammatory and oxidative processes. Aβ and hyperphosphorylated tau may also have roles in pancreatic β-cell dysfunction and in reducing insulin sensitivity and glucose uptake by peripheral tissues such as liver, skeletal muscle, and adipose tissue. This suggests a role for these AD-related proteins in promoting T2D. The accumulation of the islet amyloid polypeptide (IAPP, or amylin) within islet β-cells is a major pathological feature of the pancreas in patients with chronic T2D. Co-secreted with insulin, amylin accumulates over time and contributes to β-cell toxicity, ultimately leading to reduced insulin secretion and onset of overt (insulin dependent) diabetes. Recent evidence also suggests that this protein accumulates in the brain of AD patients and may interact with Aβ to exacerbate the neurodegenerative process. In this review, we highlight evidence indicating T2D in promoting Aβ and tau mediated neurodegeneration and the potential contributions of Aβ and tau in promoting a diabetic phenotype that could further exacerbate neurodegeneration. We also discuss underlying mechanisms by which amylin can contribute to the neurodegenerative processes.

  19. Mechanisms of Alzheimer’s Disease Pathogenesis and Prevention: The Brain, Neural Pathology, N-methyl-D-aspartate Receptors, Tau Protein and Other Risk Factors

    PubMed Central

    Kocahan, Sayad; Doğan, Zumrut

    2017-01-01

    The characteristic features of Alzheimer’s disease (AD) are the appearance of extracellular amyloid-beta (Aβ) plaques and neurofibrillary tangles in the intracellular environment, neuronal death and the loss of synapses, all of which contribute to cognitive decline in a progressive manner. A number of hypotheses have been advanced to explain AD. Abnormal tau phosphorylation may contribute to the formation of abnormal neurofibrillary structures. Many different structures are susceptible to AD, including the reticular formation, the nuclei in the brain stem (e.g., raphe nucleus), thalamus, hypothalamus, locus ceruleus, amygdala, substantia nigra, striatum, and claustrum. Excitotoxicity results from continuous, low-level activation of N-methyl-D-aspartate (NMDA) receptors. Premature synaptotoxicity, changes in neurotransmitter expression, neurophils loss, accumulation of amyloid β-protein deposits (amyloid/senile plaques), and neuronal loss and brain atrophy are all associated with stages of AD progression. Several recent studies have examined the relationship between Aβ and NMDA receptors. Aβ-induced spine loss is associated with a decrease in glutamate receptors and is dependent upon the calcium-dependent phosphatase calcineurin, which has also been linked to long-term depression. PMID:28138104

  20. Accelerated Human Mutant Tau Aggregation by Knocking Out Murine Tau in a Transgenic Mouse Model

    PubMed Central

    Ando, Kunie; Leroy, Karelle; Héraud, Céline; Yilmaz, Zehra; Authelet, Michèle; Suain, Valèrie; De Decker, Robert; Brion, Jean-Pierre

    2011-01-01

    Many models of human tauopathies have been generated in mice by expression of a human mutant tau with maintained expression of mouse endogenous tau. Because murine tau might interfere with the toxic effects of human mutant tau, we generated a model in which a pathogenic human tau protein is expressed in the absence of wild-type tau protein, with the aim of facilitating the study of the pathogenic role of the mutant tau and to reproduce more faithfully a human tauopathy. The Tg30 line is a tau transgenic mouse model overexpressing human 1N4R double-mutant tau (P301S and G272V) that develops Alzheimer's disease-like neurofibrillary tangles in an age-dependent manner. By crossing Tg30 mice with mice invalidated for their endogenous tau gene, we obtained Tg30xtau−/− mice that express only exogenous human double-mutant 1N4R tau. Although Tg30xtau−/− mice express less tau protein compared with Tg30, they exhibit signs of decreased survival, increased proportion of sarkosyl-insoluble tau in the brain and in the spinal cord, increased number of Gallyas-positive neurofibrillary tangles in the hippocampus, increased number of inclusions in the spinal cord, and a more severe motor phenotype. Deletion of murine tau accelerated tau aggregation during aging of this mutant tau transgenic model, suggesting that murine tau could interfere with the development of tau pathology in transgenic models of human tauopathies. PMID:21281813

  1. Exosome-associated Tau Is Secreted in Tauopathy Models and Is Selectively Phosphorylated in Cerebrospinal Fluid in Early Alzheimer Disease*

    PubMed Central

    Saman, Sudad; Kim, WonHee; Raya, Mario; Visnick, Yvonne; Miro, Suhad; Saman, Sarmad; Jackson, Bruce; McKee, Ann C.; Alvarez, Victor E.; Lee, Norman C. Y.; Hall, Garth F.

    2012-01-01

    Recent demonstrations that the secretion, uptake, and interneuronal transfer of tau can be modulated by disease-associated tau modifications suggest that secretion may be an important element in tau-induced neurodegeneration. Here, we show that much of the tau secreted by M1C cells occurs via exosomal release, a widely characterized mechanism that mediates unconventional secretion of other aggregation-prone proteins (α-synuclein, prion protein, and β-amyloid) in neurodegenerative disease. Exosome-associated tau is also present in human CSF samples and is phosphorylated at Thr-181 (AT270), an established phosphotau biomarker for Alzheimer disease (AD), in both M1C cells and in CSF samples from patients with mild (Braak stage 3) AD. A preliminary analysis of proteins co-purified with tau in secreted exosomes identified several that are known to be involved in disease-associated tau misprocessing. Our results suggest that exosome-mediated secretion of phosphorylated tau may play a significant role in the abnormal processing of tau and in the genesis of elevated CSF tau in early AD. PMID:22057275

  2. Changes in tau phosphorylation in hibernating rodents.

    PubMed

    León-Espinosa, Gonzalo; García, Esther; García-Escudero, Vega; Hernández, Félix; Defelipe, Javier; Avila, Jesús

    2013-07-01

    Tau is a cytoskeletal protein present mainly in the neurons of vertebrates. By comparing the sequence of tau molecule among different vertebrates, it was found that the variability of the N-terminal sequence in tau protein is higher than that of the C-terminal region. The N-terminal region is involved mainly in the binding of tau to cellular membranes, whereas the C-terminal region of the tau molecule contains the microtubule-binding sites. We have compared the sequence of Syrian hamster tau with the sequences of other hibernating and nonhibernating rodents and investigated how differences in the N-terminal region of tau could affect the phosphorylation level and tau binding to cell membranes. We also describe a change, in tau phosphorylation, on a casein kinase 1 (ck1)-dependent site that is found only in hibernating rodents. This ck1 site seems to play an important role in the regulation of tau binding to membranes.

  3. Reversible phosphorylation of tau to form A68 in heat-shocked neuronal PC12 cells.

    PubMed

    Wallace, W; Johnson, G; Sugar, J; Merril, C R; Refolo, L M

    1993-07-01

    A68, the primary protein constituent of Alzheimer's disease-associated neurofibrillary tangles, is an abnormally phosphorylated form of the microtubule-associated protein tau. We find that A68 is formed in neuronal PC12 cells when the cells are subjected to a heat shock (45 degrees C for 30 min). A68 was identified by immunoprecipitation with two different anti-tau antibodies (tau-2 and Alz50). Upon separation by SDS-polyacrylamide gel electrophoresis, the tau immunoprecipitates from heat-shocked cells exhibited an additional polypeptide of reduced electrophoretic mobility (approximately 68 kDa) when compared to control cells. A68 was formed with heat shock in the presence of cycloheximide, suggesting that its production occurred by post-translational modification of existing polypeptides. The tau/A68 polypeptides were identified as phosphoproteins by incorporation of 32P into the immunoprecipitates. The phosphorylation of tau to form A68 was reversed with recovery of the intact cells from the heat shock. Finally, immunoprecipitation of lysates from heat-shocked cells with antibodies to heat shock protein (hsp) 72/73 resulted in co-precipitation of tau with hsp 72, which indicates a stable complex formation between these two proteins. On the other hand, A68 remained unassociated with hsp during the heat shock. These results suggest that tau is reversibly phosphorylated to form A68 in neuronal PC12 cells under conditions of stress.

  4. Neuronal activity enhances tau propagation and tau pathology in vivo.

    PubMed

    Wu, Jessica W; Hussaini, S Abid; Bastille, Isle M; Rodriguez, Gustavo A; Mrejeru, Ana; Rilett, Kelly; Sanders, David W; Cook, Casey; Fu, Hongjun; Boonen, Rick A C M; Herman, Mathieu; Nahmani, Eden; Emrani, Sheina; Figueroa, Y Helen; Diamond, Marc I; Clelland, Catherine L; Wray, Selina; Duff, Karen E

    2016-08-01

    Tau protein can transfer between neurons transneuronally and trans-synaptically, which is thought to explain the progressive spread of tauopathy observed in the brain of patients with Alzheimer's disease. Here we show that physiological tau released from donor cells can transfer to recipient cells via the medium, suggesting that at least one mechanism by which tau can transfer is via the extracellular space. Neuronal activity has been shown to regulate tau secretion, but its effect on tau pathology is unknown. Using optogenetic and chemogenetic approaches, we found that increased neuronal activity stimulates the release of tau in vitro and enhances tau pathology in vivo. These data have implications for disease pathogenesis and therapeutic strategies for Alzheimer's disease and other tauopathies.

  5. Collapsin Response Mediator Protein-2 (CRMP2) is a Plausible Etiological Factor and Potential Therapeutic Target in Alzheimer’s Disease: Comparison and Contrast with Microtubule-Associated Protein Tau

    PubMed Central

    Hensley, Kenneth; Kursula, Petri

    2016-01-01

    Alzheimer’s disease (AD) has long been viewed as a pathology that must be caused either by aberrant amyloid-β protein precursor (AβPP) processing, dysfunctional tau protein processing, or a combination of these two factors. This is a reasonable assumption because amyloid-β peptide (Aβ) accumulation and tau hyperphosphorylation are the defining histological features in AD, and because AβPP and tau mutations can cause AD in humans or AD-like features in animal models. Nonetheless, other protein players are emerging that one can argue are significant etiological players in subsets of AD and potentially novel, druggable targets. In particular, the microtubule-associated protein CRMP2 (collapsin response mediator protein-2) bears striking analogies to tau and is similarly relevant to AD. Like tau, CRMP2 dynamically regulates microtubule stability; it is acted upon by the same kinases; collects similarly in neurofibrillary tangles (NFTs); and when sequestered in NFTs, complexes with critical synapse-stabilizing factors. Additionally, CRMP2 is becoming recognized as an important adaptor protein involved in vesicle trafficking, amyloidogenesis and autophagy, in ways that tau is not. This review systematically compares the biology of CRMP2 to that of tau in the context of AD and explores the hypothesis that CRMP2 is an etiologically significant protein in AD and participates in pathways that can be rationally engaged for therapeutic benefit. PMID:27079722

  6. A Quantitative Analysis of Brain Soluble Tau and the Tau Secretion Factor.

    PubMed

    Han, Pengcheng; Serrano, Geidy; Beach, Thomas G; Caselli, Richard J; Yin, Junxiang; Zhuang, Ningning; Shi, Jiong

    2017-01-09

    Neurofibrillary tangles (NFTs) represent products of insoluble tau protein in the brains of patients with Alzheimer disease (AD). The cerebrospinal fluid (CSF) tau level is a biomarker in AD diagnosis. The soluble portion of tau protein in brain parenchyma is presumably the source for CSF tau but this has not previously been quantified. We measured CSF tau and soluble brain tau at autopsy in temporal and frontal brain tissue samples from 7 cognitive normal, 12 mild cognitively impaired, and 19 AD subjects. Based on the measured brain soluble tau, we calculated the whole brain tau load and estimated tau secretion factor. Our results suggest that the increase in NFT in AD is likely attributable to post-translational processes; the increase in CSF tau in AD patients is due to an accelerated carrier-based secretion. Moreover, cognitive dysfunction assessed by final Mini-Mental State Examination scores correlated with the secretion factor but not with the soluble tau.

  7. Ilex latifolia Prevents Amyloid β Protein (25-35)-Induced Memory Impairment by Inhibiting Apoptosis and Tau Phosphorylation in Mice.

    PubMed

    Kim, Joo Youn; Lee, Hong Kyu; Jang, Ji Yeon; Yoo, Jae Kuk; Seong, Yeon Hee

    2015-12-01

    Ilex latifolia Thunb. (Aquifoliaceae), a Chinese bitter tea called "kudingcha," has been widely consumed as a health beverage and found to possess antioxidant, antidiabetic, antihypertensive, anti-inflammatory, and anti-ischemic activities. The aim of the present study was to investigate the neuroprotective effects of an ethanol extract of I. latifolia against amyloid β protein (Aβ)-induced memory impairment in mice and neurotoxicity in cultured rat cortical neurons. Memory impairment in mice was induced by intracerebroventricular injection of 15 nmol Aβ (25-35) and measured by the passive avoidance test and Morris water maze test. Chronic administration of I. latifolia (25-100 mg/kg, p.o.) significantly prevented Aβ (25-35)-induced memory loss. I. latifolia also prevented the decrease of glutathione concentrations, increased lipid peroxidation, expression of phosphorylated tau (p-tau), and changes in apoptosis-associated proteins in the memory-impaired mouse brain. Exposure of cultured cortical neurons to 10 μM Aβ (25-35) for 36 h induced neuronal apoptotic death. The neuronal cell death, elevation of intracellular Ca(2+) concentration, generation of reactive oxygen species, and expression of proapoptotic proteins caused by Aβ (25-35) in the cultured neurons were inhibited by treatment with I. latifolia (1-50 μg/mL). These results suggest that I. latifolia may have a possible therapeutic role in managing cognitive impairment associated with Alzheimer's disease. The underlying mechanism might involve the antiapoptotic effects mediated by antioxidant activity and inhibition of p-tau formation.

  8. O-GlcNAcylation modulates the self-aggregation ability of the fourth microtubule-binding repeat of tau

    SciTech Connect

    Yu, C.-H.; Si Tong; Wu Weihui; Hu Jia; Du Jintang; Zhao Yufen; Li Yanmei

    2008-10-10

    In Alzheimer's disease (AD), tau protein is abnormally hyperphosphorylated and aggregated into paired helical filaments (PHFs). It was discovered recently that tau is also O-GlcNAcylated in human brains. And O-GlcNAcylation may regulate phosphorylation of tau in a site-specific manner. In this work, we focused on the fourth microtubule-binding repeat (R4) of tau, which has an O-GlcNAcylation site-Ser356. The aggregation behavior of this repeat and its O-GlcNAcylated form was investigated by turbidity, precipitation assay and electron microscopy. In addition, conformations of these two peptides were analyzed with circular dichroism (CD). Our results revealed that O-GlcNAcylation at Ser356 could greatly slow down the aggregation speed of R4 peptide. This modulation of O-GlcNAcylation on tau aggregation implies a new perspective of tau pathology.

  9. Olfactory Dysfunctions and Decreased Nitric Oxide Production in the Brain of Human P301L Tau Transgenic Mice.

    PubMed

    Hu, Yang; Ding, Wenting; Zhu, Xiaonan; Chen, Ruzhu; Wang, Xuelan

    2016-04-01

    Different patterns of olfactory dysfunction have been found in both patients and mouse models of Alzheimer's Disease. However, the underlying mechanism of the dysfunction remained unknown. Deficits of nitric oxide production in brain can cause olfactory dysfunction by preventing the formation of olfactory memory. The aim of this study was to investigate the behavioral changes in olfaction and alterations in metabolites of nitric oxide, nitrate/nitrite concentration, in the brain of human P301L tau transgenic mice. The tau mice showed impairments in olfaction and increased abnormal phosphorylation of Tau protein at AT8 in different brain areas, especially in olfactory bulb. We now report that these olfactory deficits and Tau pathological changes were accompanied by decreased nitrate/nitrite concentration in the brain, especially in the olfactory bulb, and reduced expression of nNOS in the brain of tau mice. These findings provided evidence of olfactory dysfunctions correlated with decreased nitric oxide production in the brain of tau mice.

  10. Aging-related tau astrogliopathy (ARTAG): harmonized evaluation strategy.

    PubMed

    Kovacs, Gabor G; Ferrer, Isidro; Grinberg, Lea T; Alafuzoff, Irina; Attems, Johannes; Budka, Herbert; Cairns, Nigel J; Crary, John F; Duyckaerts, Charles; Ghetti, Bernardino; Halliday, Glenda M; Ironside, James W; Love, Seth; Mackenzie, Ian R; Munoz, David G; Murray, Melissa E; Nelson, Peter T; Takahashi, Hitoshi; Trojanowski, John Q; Ansorge, Olaf; Arzberger, Thomas; Baborie, Atik; Beach, Thomas G; Bieniek, Kevin F; Bigio, Eileen H; Bodi, Istvan; Dugger, Brittany N; Feany, Mel; Gelpi, Ellen; Gentleman, Stephen M; Giaccone, Giorgio; Hatanpaa, Kimmo J; Heale, Richard; Hof, Patrick R; Hofer, Monika; Hortobágyi, Tibor; Jellinger, Kurt; Jicha, Gregory A; Ince, Paul; Kofler, Julia; Kövari, Enikö; Kril, Jillian J; Mann, David M; Matej, Radoslav; McKee, Ann C; McLean, Catriona; Milenkovic, Ivan; Montine, Thomas J; Murayama, Shigeo; Lee, Edward B; Rahimi, Jasmin; Rodriguez, Roberta D; Rozemüller, Annemieke; Schneider, Julie A; Schultz, Christian; Seeley, William; Seilhean, Danielle; Smith, Colin; Tagliavini, Fabrizio; Takao, Masaki; Thal, Dietmar Rudolf; Toledo, Jon B; Tolnay, Markus; Troncoso, Juan C; Vinters, Harry V; Weis, Serge; Wharton, Stephen B; White, Charles L; Wisniewski, Thomas; Woulfe, John M; Yamada, Masahito; Dickson, Dennis W

    2016-01-01

    Pathological accumulation of abnormally phosphorylated tau protein in astrocytes is a frequent, but poorly characterized feature of the aging brain. Its etiology is uncertain, but its presence is sufficiently ubiquitous to merit further characterization and classification, which may stimulate clinicopathological studies and research into its pathobiology. This paper aims to harmonize evaluation and nomenclature of aging-related tau astrogliopathy (ARTAG), a term that refers to a morphological spectrum of astroglial pathology detected by tau immunohistochemistry, especially with phosphorylation-dependent and 4R isoform-specific antibodies. ARTAG occurs mainly, but not exclusively, in individuals over 60 years of age. Tau-immunoreactive astrocytes in ARTAG include thorn-shaped astrocytes at the glia limitans and in white matter, as well as solitary or clustered astrocytes with perinuclear cytoplasmic tau immunoreactivity that extends into the astroglial processes as fine fibrillar or granular immunopositivity, typically in gray matter. Various forms of ARTAG may coexist in the same brain and might reflect different pathogenic processes. Based on morphology and anatomical distribution, ARTAG can be distinguished from primary tauopathies, but may be concurrent with primary tauopathies or other disorders. We recommend four steps for evaluation of ARTAG: (1) identification of five types based on the location of either morphologies of tau astrogliopathy: subpial, subependymal, perivascular, white matter, gray matter; (2) documentation of the regional involvement: medial temporal lobe, lobar (frontal, parietal, occipital, lateral temporal), subcortical, brainstem; (3) documentation of the severity of tau astrogliopathy; and (4) description of subregional involvement. Some types of ARTAG may underlie neurological symptoms; however, the clinical significance of ARTAG is currently uncertain and awaits further studies. The goal of this proposal is to raise awareness of

  11. Aging-related tau astrogliopathy (ARTAG): harmonized evaluation strategy

    PubMed Central

    Ferrer, Isidro; Grinberg, Lea T.; Alafuzoff, Irina; Attems, Johannes; Budka, Herbert; Cairns, Nigel J.; Crary, John F.; Duyckaerts, Charles; Ghetti, Bernardino; Halliday, Glenda M.; Ironside, James W.; Love, Seth; Mackenzie, Ian R.; Munoz, David G.; Murray, Melissa E.; Nelson, Peter T.; Takahashi, Hitoshi; Trojanowski, John Q.; Ansorge, Olaf; Arzberger, Thomas; Baborie, Atik; Beach, Thomas G.; Bieniek, Kevin F.; Bigio, Eileen H.; Bodi, Istvan; Dugger, Brittany N.; Feany, Mel; Gelpi, Ellen; Gentleman, Stephen M.; Giaccone, Giorgio; Hatanpaa, Kimmo J.; Heale, Richard; Hof, Patrick R.; Hofer, Monika; Hortobágyi, Tibor; Jellinger, Kurt; Jicha, Gregory A.; Ince, Paul; Kofler, Julia; Kövari, Enikö; Kril, Jillian J.; Mann, David M.; Matej, Radoslav; McKee, Ann C.; McLean, Catriona; Milenkovic, Ivan; Montine, Thomas J.; Murayama, Shigeo; Lee, Edward B.; Rahimi, Jasmin; Rodriguez, Roberta D.; Rozemüller, Annemieke; Schneider, Julie A.; Schultz, Christian; Seeley, William; Seilhean, Danielle; Smith, Colin; Tagliavini, Fabrizio; Takao, Masaki; Thal, Dietmar Rudolf; Toledo, Jon B.; Tolnay, Markus; Troncoso, Juan C.; Vinters, Harry V.; Weis, Serge; Wharton, Stephen B.; White, Charles L.; Wisniewski, Thomas; Woulfe, John M.; Yamada, Masahito

    2016-01-01

    Pathological accumulation of abnormally phosphorylated tau protein in astrocytes is a frequent, but poorly characterized feature of the aging brain. Its etiology is uncertain, but its presence is sufficiently ubiquitous to merit further characterization and classification, which may stimulate clinicopathological studies and research into its pathobiology. This paper aims to harmonize evaluation and nomenclature of aging-related tau astrogliopathy (ARTAG), a term that refers to a morphological spectrum of astroglial pathology detected by tau immunohistochemistry, especially with phosphorylation-dependent and 4R isoform-specific antibodies. ARTAG occurs mainly, but not exclusively, in individuals over 60 years of age. Tau-immunoreactive astrocytes in ARTAG include thorn-shaped astrocytes at the glia limitans and in white matter, as well as solitary or clustered astrocytes with perinuclear cytoplasmic tau immunoreactivity that extends into the astroglial processes as fine fibrillar or granular immunopositivity, typically in gray matter. Various forms of ARTAG may coexist in the same brain and might reflect different pathogenic processes. Based on morphology and anatomical distribution, ARTAG can be distinguished from primary tauopathies, but may be concurrent with primary tauopathies or other disorders. We recommend four steps for evaluation of ARTAG: (1) identification of five types based on the location of either morphologies of tau astrogliopathy: subpial, subependymal, perivascular, white matter, gray matter; (2) documentation of the regional involvement: medial temporal lobe, lobar (frontal, parietal, occipital, lateral temporal), subcortical, brainstem; (3) documentation of the severity of tau astrogliopathy; and (4) description of subregional involvement. Some types of ARTAG may underlie neurological symptoms; however, the clinical significance of ARTAG is currently uncertain and awaits further studies. The goal of this proposal is to raise awareness of

  12. Amyloid-β Peptides and Tau Protein as Biomarkers in Cerebrospinal and Interstitial Fluid Following Traumatic Brain Injury: A Review of Experimental and Clinical Studies

    PubMed Central

    Tsitsopoulos, Parmenion P.; Marklund, Niklas

    2013-01-01

    Traumatic brain injury (TBI) survivors frequently suffer from life-long deficits in cognitive functions and a reduced quality of life. Axonal injury, observed in many severe TBI patients, results in accumulation of amyloid precursor protein (APP). Post-injury enzymatic cleavage of APP can generate amyloid-β (Aβ) peptides, a hallmark finding in Alzheimer’s disease (AD). At autopsy, brains of AD and a subset of TBI victims display some similarities including accumulation of Aβ peptides and neurofibrillary tangles of hyperphosphorylated tau proteins. Most epidemiological evidence suggests a link between TBI and AD, implying that TBI has neurodegenerative sequelae. Aβ peptides and tau may be used as biomarkers in interstitial fluid (ISF) using cerebral microdialysis and/or cerebrospinal fluid (CSF) following clinical TBI. In the present review, the available clinical and experimental literature on Aβ peptides and tau as potential biomarkers following TBI is comprehensively analyzed. Elevated CSF and ISF tau protein levels have been observed following severe TBI and suggested to correlate with clinical outcome. Although Aβ peptides are produced by normal neuronal metabolism, high levels of long and/or fibrillary Aβ peptides may be neurotoxic. Increased CSF and/or ISF Aβ levels post-injury may be related to neuronal activity and/or the presence of axonal injury. The heterogeneity of animal models, clinical cohorts, analytical techniques, and the complexity of TBI in the available studies make the clinical value of tau and Aβ as biomarkers uncertain at present. Additionally, the link between early post-injury changes in tau and Aβ peptides and the future risk of developing AD remains unclear. Future studies using methods such as rapid biomarker sampling combined with enhanced analytical techniques and/or novel pharmacological tools could provide additional information on the importance of Aβ peptides and tau protein in both the acute pathophysiology and long

  13. Astrocyte pathology in a human neural stem cell model of frontotemporal dementia caused by mutant TAU protein

    PubMed Central

    Hallmann, Anna-Lena; Araúzo-Bravo, Marcos J.; Mavrommatis, Lampros; Ehrlich, Marc; Röpke, Albrecht; Brockhaus, Johannes; Missler, Markus; Sterneckert, Jared; Schöler, Hans R.; Kuhlmann, Tanja; Zaehres, Holm; Hargus, Gunnar

    2017-01-01

    Astroglial pathology is seen in various neurodegenerative diseases including frontotemporal dementia (FTD), which can be caused by mutations in the gene encoding the microtubule-associated protein TAU (MAPT). Here, we applied a stem cell model of FTD to examine if FTD astrocytes carry an intrinsic propensity to degeneration and to determine if they can induce non-cell-autonomous effects in neighboring neurons. We utilized CRISPR/Cas9 genome editing in human induced pluripotent stem (iPS) cell-derived neural progenitor cells (NPCs) to repair the FTD-associated N279K MAPT mutation. While astrocytic differentiation was not impaired in FTD NPCs derived from one patient carrying the N279K MAPT mutation, FTD astrocytes appeared larger, expressed increased levels of 4R-TAU isoforms, demonstrated increased vulnerability to oxidative stress and elevated protein ubiquitination and exhibited disease-associated changes in transcriptome profiles when compared to astrocytes derived from one control individual and to the isogenic control. Interestingly, co-culture experiments with FTD astrocytes revealed increased oxidative stress and robust changes in whole genome expression in previously healthy neurons. Our study highlights the utility of iPS cell-derived NPCs to elucidate the role of astrocytes in the pathogenesis of FTD. PMID:28256506

  14. Elevated cerebrospinal fluid tau in Wernicke encephalopathy.

    PubMed

    Frijlink, Daphne W; Tilanus, Joachim J; Roks, Gerwin

    2012-08-08

    Wernicke encephalopathy (WE) commonly presents with oculomotor abnormalities, gait ataxia and confusion. WE can mimic rapidly progressive dementia syndromes, such as Creutzfeldt-Jakob disease (CJD). Cerebrospinal fluid (CSF) tau is frequently used for diagnosis of several dementia subtypes, predominantly CJD and Alzheimer's disease. The combination of very high CSF tau (tau) and normal phosphorylated tau (p-tau) levels is almost exclusively seen in aggressive diseases, such as CJD. The authors present a case of a woman with WE, caused by chronic insufficient dietary intake, with highly elevated CSF tau and normal p-tau. The clinical symptoms and CSF findings raised the suspicion of CJD. However, shortly after immediate treatment with thiamine the patient clinically improved. At follow-up, 2.5 months later, she had made a good recovery. This case of rapidly progressive dementia illustrates that, even in the case of a highly elevated CSF tau, clinicians should be alert for treatable causes such as WE.

  15. HIV-1-Tat Protein Inhibits SC35-mediated Tau Exon 10 Inclusion through Up-regulation of DYRK1A Kinase.

    PubMed

    Kadri, Ferdous; Pacifici, Marco; Wilk, Anna; Parker-Struckhoff, Amanda; Del Valle, Luis; Hauser, Kurt F; Knapp, Pamela E; Parsons, Christopher; Jeansonne, Duane; Lassak, Adam; Peruzzi, Francesca

    2015-12-25

    The HIV-1 transactivator protein Tat is implicated in the neuronal damage that contributes to neurocognitive impairment affecting people living with HIV/AIDS. Aberrant splicing of TAU exon 10 results in tauopathies characterized by alterations in the proportion of TAU isoforms containing three (3R) or four (4R) microtubule-binding repeats. The splicing factor SC35/SRSF2 binds to nuclear RNA and facilitates the incorporation of exon 10 in the TAU molecule. Here, we utilized clinical samples, an animal model, and neuronal cell cultures and found that Tat promotes TAU 3R up-regulation through increased levels of phosphorylated SC35, which is retained in nuclear speckles. This mechanism involved Tat-mediated increased expression of DYRK1A and was prevented by DYRK1A silencing. In addition, we found that Tat associates with TAU RNA, further demonstrating that Tat interferes with host RNA metabolism in the absence of viral infection. Altogether, our data unravel a novel mechanism of Tat-mediated neuronal toxicity through dysregulation of the SC35-dependent alternative splicing of TAU exon 10. Furthermore, the increased immunostaining of DYRK1A in HIV+ brains without pathology points at dysregulation of DYRK1A as an early event in the neuronal complications of HIV infection.

  16. HIV-1-Tat Protein Inhibits SC35-mediated Tau Exon 10 Inclusion through Up-regulation of DYRK1A Kinase*

    PubMed Central

    Kadri, Ferdous; Pacifici, Marco; Wilk, Anna; Parker-Struckhoff, Amanda; Del Valle, Luis; Hauser, Kurt F.; Knapp, Pamela E.; Parsons, Christopher; Jeansonne, Duane; Lassak, Adam; Peruzzi, Francesca

    2015-01-01

    The HIV-1 transactivator protein Tat is implicated in the neuronal damage that contributes to neurocognitive impairment affecting people living with HIV/AIDS. Aberrant splicing of TAU exon 10 results in tauopathies characterized by alterations in the proportion of TAU isoforms containing three (3R) or four (4R) microtubule-binding repeats. The splicing factor SC35/SRSF2 binds to nuclear RNA and facilitates the incorporation of exon 10 in the TAU molecule. Here, we utilized clinical samples, an animal model, and neuronal cell cultures and found that Tat promotes TAU 3R up-regulation through increased levels of phosphorylated SC35, which is retained in nuclear speckles. This mechanism involved Tat-mediated increased expression of DYRK1A and was prevented by DYRK1A silencing. In addition, we found that Tat associates with TAU RNA, further demonstrating that Tat interferes with host RNA metabolism in the absence of viral infection. Altogether, our data unravel a novel mechanism of Tat-mediated neuronal toxicity through dysregulation of the SC35-dependent alternative splicing of TAU exon 10. Furthermore, the increased immunostaining of DYRK1A in HIV+ brains without pathology points at dysregulation of DYRK1A as an early event in the neuronal complications of HIV infection. PMID:26534959

  17. Neonatal exposure to a moderate dose of ionizing radiation causes behavioural defects and altered levels of tau protein in mice.

    PubMed

    Buratovic, Sonja; Stenerlöw, Bo; Fredriksson, Anders; Sundell-Bergman, Synnöve; Viberg, Henrik; Eriksson, Per

    2014-12-01

    Medical use of ionizing radiation (IR) has great benefits for treatment and diagnostic imaging, but procedures as computerized tomography (CT) may deliver a significant radiation dose to the patient. Recently, awareness has been raised about possible non-cancer consequences from low dose exposure to IR during critical phases of perinatal and/or neonatal brain development. In the present study neonatal NMRI mice were whole body irradiated with a single dose of gamma radiation (0; 350 and 500 mGy) on postnatal day 10 (PND 10). At 2 and 4 months of age, mice of both sexes were observed for spontaneous behaviour in a novel home environment. The neuroproteins CaMKII, GAP-43, synaptophysin and total tau in male mouse cerebral cortex and hippocampus were analysed 24h post-irradiation and in adults at 6 months of age exposed to 0 or 500 mGy on PND 10. A significantly dose-response related deranged spontaneous behaviour in 2- and 4-month-old mice was observed, where both males and females displayed a modified habituation, indicating reduced cognitive function. The dose of 350 mGy seems to be a tentative threshold. Six-month-old male mice showed a significantly increased level of total tau in cerebral cortex after irradiation to 500 mGy compared to controls. This demonstrates that a single moderate dose of IR, given during a defined critical period of brain development, is sufficient to cause persistently reduced cognitive function. Moreover, an elevation of tau protein was observed in male mice displaying reduced cognitive function.

  18. Hyperosmotic Stress Induces Tau Proteolysis by Caspase-3 Activation in SH-SY5Y Cells.

    PubMed

    Olivera-Santa Catalina, Marta; Caballero-Bermejo, Montaña; Argent, Ricardo; Alonso, Juan C; Cuenda, Ana; Lorenzo, María J; Centeno, Francisco

    2016-12-01

    Tau is a microtubule-associated protein implicated in the pathogenesis of Alzheimer's disease and other related tauopathies. In this subset of neurodegenerative disorders, Tau auto-assembles into insoluble fibrils that accumulate in neurons as paired helical filaments (PHFs), promoting cellular dysfunction and cytotoxic effects. Growing evidence suggests that abnormal post-translational regulation, mainly hyperphosphorylation and aberrant cleavage, drives Tau to this pathological state. In this work we show that sorbitol-induced hyperosmotic stress promotes Tau proteolysis in SH-SY5Y neuroblastoma cells. The appearance of cleaved Tau was preceded by the activation of μ-calpain, the proteasome system and caspase-3. Tau proteolysis was completely prevented by caspase-3 inhibition but unaffected by neither the proteasome system nor μ-calpain activity blockade. Concomitantly, hyperosmotic stress induced apoptosis in SH-SY5Y cells, which was efficiently avoided by the inhibition of caspase-3 activity. Altogether, our results provide the first evidence that Tau protein is susceptible to caspase-3 proteolysis under hyperosmotic stress and suggest a positive relationship between Tau proteolysis and apoptosis in SH-SY5Y cells. J. Cell. Biochem. 117: 2781-2790, 2016. © 2016 Wiley Periodicals, Inc.

  19. Tau immunotherapy for Alzheimer's disease.

    PubMed

    Pedersen, Jan Torleif; Sigurdsson, Einar M

    2015-06-01

    Targeting pathological tau protein in Alzheimer's disease (AD) and related tauopathies has shown great potential in animal models. Given that tau lesions correlate better with the degree of dementia than do amyloid-β (Aβ) plaques, their clearance may be clinically more efficacious than removing Aβ when cognitive deficits become evident in AD. Several complementary mechanisms of antibody-mediated removal of tau aggregates are likely to act in concert and the importance of each one may depend on antibody properties, the disease, and its stage. Clinical trials of tau immunotherapy are already underway and several more are likely to be initiated in the near future.

  20. Tau Reduction Prevents Disease in a Mouse Model of Dravet Syndrome

    PubMed Central

    Gheyara, Ania L; Ponnusamy, Ravikumar; Djukic, Biljana; Craft, Ryan J; Ho, Kaitlyn; Guo, Weikun; Finucane, Mariel M; Sanchez, Pascal E; Mucke, Lennart

    2014-01-01

    Objective Reducing levels of the microtubule-associated protein tau has shown promise as a potential treatment strategy for diseases with secondary epileptic features such as Alzheimer disease. We wanted to determine whether tau reduction may also be of benefit in intractable genetic epilepsies. Methods We studied a mouse model of Dravet syndrome, a severe childhood epilepsy caused by mutations in the human SCN1A gene encoding the voltage-gated sodium channel subunit Nav1.1. We genetically deleted 1 or 2 Tau alleles in mice carrying an Nav1.1 truncation mutation (R1407X) that causes Dravet syndrome in humans, and examined their survival, epileptic activity, related hippocampal alterations, and behavioral abnormalities using observation, electroencephalographic recordings, acute slice electrophysiology, immunohistochemistry, and behavioral assays. Results Tau ablation prevented the high mortality of Dravet mice and reduced the frequency of spontaneous and febrile seizures. It reduced interictal epileptic spikes in vivo and drug-induced epileptic activity in brain slices ex vivo. Tau ablation also prevented biochemical changes in the hippocampus indicative of epileptic activity and ameliorated abnormalities in learning and memory, nest building, and open field behaviors in Dravet mice. Deletion of only 1 Tau allele was sufficient to suppress epileptic activity and improve survival and nesting performance. Interpretation Tau reduction may be of therapeutic benefit in Dravet syndrome and other intractable genetic epilepsies. Ann Neurol 2014;76:443–456 PMID:25042160

  1. Neuronal plasticity in hibernation and the proposed role of the microtubule-associated protein tau as a "master switch" regulating synaptic gain in neuronal networks.

    PubMed

    Arendt, Thomas; Bullmann, Torsten

    2013-09-01

    The present paper provides an overview of adaptive changes in brain structure and learning abilities during hibernation as a behavioral strategy used by several mammalian species to minimize energy expenditure under current or anticipated inhospitable environmental conditions. One cellular mechanism that contributes to the regulated suppression of metabolism and thermogenesis during hibernation is reversible phosphorylation of enzymes and proteins, which limits rates of flux through metabolic pathways. Reversible phosphorylation during hibernation also affects synaptic membrane proteins, a process known to be involved in synaptic plasticity. This mechanism of reversible protein phosphorylation also affects the microtubule-associated protein tau, thereby generating a condition that in the adult human brain is associated with aggregation of tau protein to paired helical filaments (PHFs), as observed in Alzheimer's disease. Here, we put forward the concept that phosphorylation of tau is a neuroprotective mechanism to escape NMDA-mediated hyperexcitability of neurons that would otherwise occur during slow gradual cooling of the brain. Phosphorylation of tau and its subsequent targeting to subsynaptic sites might, thus, work as a kind of "master switch," regulating NMDA receptor-mediated synaptic gain in a wide array of neuronal networks, thereby enabling entry into torpor. If this condition lasts too long, however, it may eventually turn into a pathological trigger, driving a cascade of events leading to neurodegeneration, as in Alzheimer's disease or other "tauopathies".

  2. New perspectives on the role of tau in Alzheimer's disease. Implications for therapy.

    PubMed

    Medina, Miguel; Avila, Jesús

    2014-04-15

    Alzheimer's disease (AD) and related dementias constitute a major public health issue due to an increasingly aged population as a consequence of generally improved medical care and demographic changes. Current drug treatment of AD, the most prevalent dementia, with cholinesterase inhibitors or NMDA antagonists have demonstrated very modest, symptomatic efficacy, leaving an unmet medical need for new, more effective therapies. While drug development efforts in the last two decades have primarily focused on the amyloid cascade hypothesis, so far with disappointing results, tau-based strategies have received little attention until recently despite that the presence of extensive tau pathology is central to the disease. The discovery of mutations within the tau gene that cause fronto-temporal dementia demonstrated that tau dysfunction, in the absence of amyloid pathology, was sufficient to cause neuronal loss and clinical dementia. Abnormal levels and hyperphosphorylation of tau protein have been reported to be the underlying cause of a group of neurodegenerative disorders collectively known as 'tauopathies'. The detrimental consequence is the loss of affinity between this protein and the microtubules, increased production of fibrillary aggregates and the accumulation of insoluble intracellular neurofibrillary tangles. However, it has become clear in recent years that tau is not only a microtubule interacting protein, but rather has additional roles in cellular processes. This review focuses on emerging therapeutic strategies aimed at treating the underlying causes of the tau pathology in tauopathies and AD, including some novel approaches on the verge of providing new treatment paradigms within the coming years.

  3. Increased Amyloid Precursor Protein and Tau Expression Manifests as Key Secondary Cell Death in Chronic Traumatic Brain Injury.

    PubMed

    Acosta, Sandra A; Tajiri, Naoki; Sanberg, Paul R; Kaneko, Yuji; Borlongan, Cesar V

    2017-03-01

    In testing the hypothesis of Alzheimer's disease (AD)-like pathology in late stage traumatic brain injury (TBI), we evaluated AD pathological markers in late stage TBI model. Sprague-Dawley male rats were subjected to moderate controlled cortical impact (CCI) injury, and 6 months later euthanized and brain tissues harvested. Results from H&E staining revealed significant 33% and 10% reduction in the ipsilateral and contralateral hippocampal CA3 interneurons, increased MHCII-activated inflammatory cells in many gray matter (8-20-fold increase) and white matter (6-30-fold increased) regions of both the ipsilateral and contralateral hemispheres, decreased cell cycle regulating protein marker by 1.6- and 1-fold in the SVZ and a 2.3- and 1.5-fold reductions in the ipsilateral and contralateral dentate gyrus, diminution of immature neuronal marker by two- and onefold in both the ipsilateral and contralateral SVZ and dentate gyrus, and amplified amyloid precursor protein (APP) distribution volumes in white matter including corpus callosum, fornix, and internal capsule (4-38-fold increase), as well as in the cortical gray matter, such as the striatum hilus, SVZ, and dentate gyrus (6-40-fold increase) in TBI animals compared to controls (P's < 0.001). Surrogate AD-like phenotypic markers revealed a significant accumulation of phosphorylated tau (AT8) and oligomeric tau (T22) within the neuronal cell bodies in ipsilateral and contralateral cortex, and dentate gyrus relative to sham control, further supporting the rampant neurodegenerative pathology in TBI secondary cell death. These findings indicate that AD-like pathological features may prove to be valuable markers and therapeutic targets for late stage TBI. J. Cell. Physiol. 232: 665-677, 2017. © 2016 Wiley Periodicals, Inc.

  4. Secretion of full-length tau or tau fragments in a cell culture model.

    PubMed

    Pérez, Mar; Cuadros, Raquel; Hernández, Félix; Avila, Jesús

    2016-11-10

    Tau is a microtubule-associated protein that plays an important role in the pathogenesis of neurodegenerative diseases such as Alzheimer's disease. Several studies have suggested that tau may be secreted to extracellular medium and may be responsible of spreading of neurodegeneration. The overexpression of tau in cultured non-neuronal cells leads to the secretion of this protein. The proline-rich region of tau may serve as a membrane-binding site during the secretion of the full-length tau molecule. Tau fragments lacking this proline-region are either not secreted or are secreted in a distinct manner to the full-length molecule.

  5. Stabilizing the Hsp70-Tau Complex Promotes Turnover in Models of Tauopathy.

    PubMed

    Young, Zapporah T; Rauch, Jennifer N; Assimon, Victoria A; Jinwal, Umesh K; Ahn, Misol; Li, Xiaokai; Dunyak, Bryan M; Ahmad, Atta; Carlson, George A; Srinivasan, Sharan R; Zuiderweg, Erik R P; Dickey, Chad A; Gestwicki, Jason E

    2016-08-18

    Heat shock protein 70 (Hsp70) is a chaperone that normally scans the proteome and initiates the turnover of some proteins (termed clients) by linking them to the degradation pathways. This activity is critical to normal protein homeostasis, yet it appears to fail in diseases associated with abnormal protein accumulation. It is not clear why Hsp70 promotes client degradation under some conditions, while sparing that protein under others. Here, we used a combination of chemical biology and genetic strategies to systematically perturb the affinity of Hsp70 for the model client, tau. This approach revealed that tight complexes between Hsp70 and tau were associated with enhanced turnover while transient interactions favored tau retention. These results suggest that client affinity is one important parameter governing Hsp70-mediated quality control.

  6. An Ultra-specific Avian Antibody to Phosphorylated Tau Protein Reveals a Unique Mechanism for Phosphoepitope Recognition

    PubMed Central

    Shih, Heather H.; Tu, Chao; Cao, Wei; Klein, Anne; Ramsey, Renee; Fennell, Brian J.; Lambert, Matthew; Ní Shúilleabháin, Deirdre; Autin, Bénédicte; Kouranova, Eugenia; Laxmanan, Sri; Braithwaite, Steven; Wu, Leeying; Ait-Zahra, Mostafa; Milici, Anthony J.; Dumin, Jo Ann; LaVallie, Edward R.; Arai, Maya; Corcoran, Christopher; Paulsen, Janet E.; Gill, Davinder; Cunningham, Orla; Bard, Joel; Mosyak, Lydia; Finlay, William J. J.

    2012-01-01

    Highly specific antibodies to phosphoepitopes are valuable tools to study phosphorylation in disease states, but their discovery is largely empirical, and the molecular mechanisms mediating phosphospecific binding are poorly understood. Here, we report the generation and characterization of extremely specific recombinant chicken antibodies to three phosphoepitopes on the Alzheimer disease-associated protein tau. Each antibody shows full specificity for a single phosphopeptide. The chimeric IgG pT231/pS235_1 exhibits a KD of 0.35 nm in 1:1 binding to its cognate phosphopeptide. This IgG is murine ortholog-cross-reactive, specifically recognizing the pathological form of tau in brain samples from Alzheimer patients and a mouse model of tauopathy. To better understand the underlying binding mechanisms allowing such remarkable specificity, we determined the structure of pT231/pS235_1 Fab in complex with its cognate phosphopeptide at 1.9 Å resolution. The Fab fragment exhibits novel complementarity determining region (CDR) structures with a “bowl-like” conformation in CDR-H2 that tightly and specifically interacts with the phospho-Thr-231 phosphate group, as well as a long, disulfide-constrained CDR-H3 that mediates peptide recognition. This binding mechanism differs distinctly from either peptide- or hapten-specific antibodies described to date. Surface plasmon resonance analyses showed that pT231/pS235_1 binds a truly compound epitope, as neither phosphorylated Ser-235 nor free peptide shows any measurable binding affinity. PMID:23148212

  7. Focal adhesion protein abnormalities in myelodysplastic mesenchymal stromal cells

    SciTech Connect

    Aanei, Carmen Mariana; Eloae, Florin Zugun; Flandrin-Gresta, Pascale; Tavernier, Emmanuelle; Carasevici, Eugen; Guyotat, Denis; Campos, Lydia

    2011-11-01

    Direct cell-cell contact between haematopoietic progenitor cells (HPCs) and their cellular microenvironment is essential to maintain 'stemness'. In cancer biology, focal adhesion (FA) proteins are involved in survival signal transduction in a wide variety of human tumours. To define the role of FA proteins in the haematopoietic microenvironment of myelodysplastic syndromes (MDS), CD73-positive mesenchymal stromal cells (MSCs) were immunostained for paxillin, pFAK [Y{sup 397}], and HSP90{alpha}/{beta} and p130CAS, and analysed for reactivity, intensity and cellular localisation. Immunofluorescence microscopy allowed us to identify qualitative and quantitative differences, and subcellular localisation analysis revealed that in pathological MSCs, paxillin, pFAK [Y{sup 397}], and HSP90{alpha}/{beta} formed nuclear molecular complexes. Increased expression of paxillin, pFAK [Y{sup 397}], and HSP90{alpha}/{beta} and enhanced nuclear co-localisation of these proteins correlated with a consistent proliferative advantage in MSCs from patients with refractory anaemia with excess blasts (RAEB) and negatively impacted clonogenicity of HPCs. These results suggest that signalling via FA proteins could be implicated in HPC-MSC interactions. Further, because FAK is an HSP90{alpha}/{beta} client protein, these results suggest the utility of HSP90{alpha}/{beta} inhibition as a target for adjuvant therapy for myelodysplasia.

  8. Causes of proteolytic degradation of secreted recombinant proteins produced in methylotrophic yeast Pichia pastoris: case study with recombinant ovine interferon-tau.

    PubMed

    Sinha, Jayanta; Plantz, Bradley A; Inan, Mehmet; Meagher, Michael M

    2005-01-05

    It was observed that during fermentative production of recombinant ovine interferon-tau (r-oIFN-tau) in Pichia pastoris, a secreted recombinant protein, the protein was degraded increasingly after 48 h of induction and the rate of degradation increased towards the end of fermentation at 72 h, when the fermentation was stopped. Proteases, whose primary source was the vacuoles, was found in increasing levels in the cytoplasm and in the fermentation broth after 48 h of induction and reached maximal values when the batch was completed at 72 h. Protease levels at various cell fractions as well as in the culture supernatant were lower when glycerol was used as the carbon source instead of methanol. It can be concluded that methanol metabolism along with cell lysis towards the end of fermentation contributes to increased proteolytic activity and eventual degradation of recombinant protein.

  9. Microtubule-associated protein/microtubule affinity-regulating kinase (p110mark). A novel protein kinase that regulates tau-microtubule interactions and dynamic instability by phosphorylation at the Alzheimer-specific site serine 262.

    PubMed

    Drewes, G; Trinczek, B; Illenberger, S; Biernat, J; Schmitt-Ulms, G; Meyer, H E; Mandelkow, E M; Mandelkow, E

    1995-03-31

    Aberrant phosphorylation of the microtubule-associated protein tau is one of the pathological features of neuronal degeneration in Alzheimer's disease. The phosphorylation of Ser-262 within the microtubule binding region of tau is of particular interest because so far it is observed only in Alzheimer's disease (Hasegawa, M., Morishima-Kawashima, M., Takio, K., Suzuki, M., Titani, K., and Ihara, Y. (1992) J. Biol. Chem. 26, 17047-17054) and because phosphorylation of this site alone dramatically reduces the affinity for microtubules in vitro (Biernat, J., Gustke, N., Drewes, G., Mandelkow, E.-M., and Mandelkow, E. (1993) Neuron 11, 153-163). Here we describe the purification and characterization of a protein-serine kinase from brain tissue with an apparent molecular mass of 110 kDa on SDS gels. This kinase specifically phosphorylates tau on its KIGS or KCGS motifs in the repeat domain, whereas no significant phosphorylation outside this region was detected. Phosphorylation occurs mainly on Ser-262 located in the first repeat. This largely abolishes tau's binding to microtubules and makes them dynamically unstable, in contrast to other protein kinases that phosphorylate tau at or near the repeat domain. The data suggest a role for this novel kinase in cellular events involving rearrangement of the microtuble-associated proteins/microtubule arrays and their pathological degeneration in Alzheimer's disease.

  10. Tau phosphorylation affects its axonal transport and degradation

    PubMed Central

    Rodríguez-Martín, Teresa; Cuchillo-Ibáñez, Inmaculada; Noble, Wendy; Nyenya, Fanon; Anderton, Brian H.; Hanger, Diane P.

    2013-01-01

    Phosphorylated forms of microtubule-associated protein tau accumulate in neurofibrillary tangles in Alzheimer's disease. To investigate the effects of specific phosphorylated tau residues on its function, wild type or phosphomutant tau was expressed in cells. Elevated tau phosphorylation decreased its microtubule binding and bundling, and increased the number of motile tau particles, without affecting axonal transport kinetics. In contrast, reducing tau phosphorylation enhanced the amount of tau bound to microtubules and inhibited axonal transport of tau. To determine whether differential tau clearance is responsible for the increase in phosphomimic tau, we inhibited autophagy in neurons which resulted in a 3-fold accumulation of phosphomimic tau compared with wild type tau, and endogenous tau was unaffected. In autophagy-deficient mouse embryonic fibroblasts, but not in neurons, proteasomal degradation of phosphomutant tau was also reduced compared with wild type tau. Therefore, autophagic and proteasomal pathways are involved in tau degradation, with autophagy appearing to be the primary route for clearing phosphorylated tau in neurons. Defective autophagy might contribute to the accumulaton of tau in neurodegenerative diseases. PMID:23601672

  11. The Link Between DYRK1A Overexpression and Several-fold Enhancement of Neurofibrillary Degeneration with 3-Repeat Tau Protein in Down Syndrome

    PubMed Central

    Wegiel, Jerzy; Kaczmarski, Wojciech; Barua, Madhabi; Kuchna, Izabela; Nowicki, Krzysztof; Wang, Kuo-Chiang; Wegiel, Jarek; Ma, Shuang Yang; Frackowiak, Janusz; Mazur-Kolecka, Bozena; Silverman, Wayne P.; Reisberg, Barry; Monteiro, Isabel; Leon, Mony de; Wisniewski, Thomas; Dalton, Arthur; Lai, Florence; Hwang, Yu-Wen; Adayev, Tatyana; Liu, Fei; Iqbal, Khalid; Iqbal, Inge-Grundke; Gong, Cheng-Xin

    2011-01-01

    Triplication of chromosome 21 in Down syndrome (DS) results in overexpression of the minibrain kinase/dual-specificity tyrosine phosphorylated and regulated kinase 1A gene (DYRK1A). DYRK1A phosphorylates cytoplasmic tau protein and appears in intraneuronal neurofibrillary tangles (NFTs). We have previously shown significantly more DYRK1A-positive NFTs in DS brains than in sporadic Alzheimer disease (AD) brains. This study demonstrates a gene dosage–proportional increase in the level of DYRK1A in DS in the cytoplasm and the cell nucleus and enhanced cytoplasmic and nuclear immunoreactivity of DYRK1A in DS. The results suggest that overexpressed DYRK1A may alter both phosphorylation of tau and alternative splicing factor (ASF). Two-dimensional electrophoresis revealed modification of ASF phosphorylation in DS/AD and AD in comparison to controls. Altered phosphorylation of ASF by overexpressed nuclear DYRK1A may contribute to the alternative splicing of the tau gene and an increase by 2.68× of the 3R/4R ratio in DS/AD, and a several-fold increase in the number of 3R-tau–positive NFTs in DS/AD subjects compared to in sporadic AD subjects. These data support the hypothesis that phosphorylation of ASF by overexpressed DYRK1A may contribute to alternative splicing of exon 10, increased expression of 3R tau, and early onset of neurofibrillary degeneration in DS. PMID:21157379

  12. Intracerebroventricular administration of okadaic acid induces hippocampal glucose uptake dysfunction and tau phosphorylation.

    PubMed

    Broetto, Núbia; Hansen, Fernanda; Brolese, Giovana; Batassini, Cristiane; Lirio, Franciane; Galland, Fabiana; Dos Santos, João Paulo Almeida; Dutra, Márcio Ferreira; Gonçalves, Carlos-Alberto

    2016-06-01

    Intraneuronal aggregates of neurofibrillary tangles (NFTs), together with beta-amyloid plaques and astrogliosis, are histological markers of Alzheimer's disease (AD). The underlying mechanism of sporadic AD remains poorly understood, but abnormal hyperphosphorylation of tau protein is suggested to have a role in NFTs genesis, which leads to neuronal dysfunction and death. Okadaic acid (OKA), a strong inhibitor of protein phosphatase 2A, has been used to induce dementia similar to AD in rats. We herein investigated the effect of intracerebroventricular (ICV) infusion of OKA (100 and 200ng) on hippocampal tau phosphorylation at Ser396, which is considered an important fibrillogenic tau protein site, and on glucose uptake, which is reduced early in AD. ICV infusion of OKA (at 200ng) induced a spatial cognitive deficit, hippocampal astrogliosis (based on GFAP increment) and increase in tau phosphorylation at site 396 in this model. Moreover, we observed a decreased glucose uptake in the hippocampal slices of OKA-treated rats. In vitro exposure of hippocampal slices to OKA altered tau phosphorylation at site 396, without any associated change in glucose uptake activity. Taken together, these findings further our understanding of OKA neurotoxicity, in vivo and vitro, particularly with regard to the role of tau phosphorylation, and reinforce the importance of the OKA dementia model for studying the neurochemical alterations that may occur in AD, such as NFTs and glucose hypometabolism.

  13. Spatially pathogenic forms of tau detected in Alzheimer's disease brain tissue by fluorescence lifetime-based Förster resonance energy transfer.

    PubMed

    Larionov, Sergey; Wielgat, Przemyslaw; Wang, Yiner; Thal, Dietmar Rudolf; Neumann, Harald

    2010-09-30

    In tauopathies including Alzheimer's disease (AD) tau molecules have lost their normal spatial distance to each other and appear in oligomeric or aggregated forms. Conventional immunostaining methods allow detection of abnormally phosphorylated or conformationally altered aggregated tau proteins, but fail to visualize oligomeric forms of tau. Here we show that tau molecules that lost their normal spatial localization can be detected on a subcellular level in postmortem central nervous system (CNS) tissue sections of AD patients by fluorescence lifetime-based Förster resonance energy transfer (FRET). Paraffin sections were co-immunostained with two tau-specific monoclonal antibodies recognizing the same epitope, but labeled with distinct fluorescence dyes suitable for spatial resolution at a nanometer scale by lifetime-based FRET. A FRET signal was detected in neuritic plaques and neurofibrillary tangles of CNS tissue sections of AD patients, showing associated tau proteins typically reflecting either fibrillary, oligomeric or aggregated tau. The 'pretangle-like' structures within the neuronal perikarya did not contain spatially pathogenic forms of tau accordingly to this method. Data demonstrate that fluorescence lifetime-based FRET can be applied to human brain tissue sections to detect pathogenic forms of tau molecules that lost their normal spatial distance.

  14. Truncation and activation of GSK-3β by calpain I: a molecular mechanism links to tau hyperphosphorylation in Alzheimer's disease

    PubMed Central

    Jin, Nana; Yin, Xiaomin; Yu, Dian; Cao, Maohong; Gong, Cheng-Xin; Iqbal, Khalid; Ding, Fei; Gu, Xiaosong; Liu, Fei

    2015-01-01

    Abnormal hyperphosphorylation of tau is pivotally involved in the pathogenesis of Alzheimer's disease (AD) and related tauopathies. Glycogen synthase kinase 3β (GSK-3β) is a primary tau kinase that is most implicated in tau pathology in AD. However, the exact molecular nature of GSK-3β involved in AD is unclear. In the present study, we found that GSK-3β was truncated at C-terminus and correlated with over-activation of calpain I in AD brain. Truncation of GSK-3β was positively correlated with tau hyperphosphorylation, tangles score and Braak stage in human brain. Calpain I proteolyzed GSK-3β in vitro at C-terminus, leading to an increase of its kinase activity, but keeping its characteristic to preferentially phosphorylate the protein kinase A-primed tau. Excitotoxicity induced by kainic acid (KA) caused GSK-3β truncation at C-terminus and hyperphosphorylation of tau in mouse brain. Inhibition of calpain prevented the KA-induced changes. These findings suggest that truncation of GSK-3β by Ca2+/calpain I markedly increases its activity and involvement of this mechanism probably is responsible for up-regulation of GSK-3β and consequent abnormal hyperphosphorylation of tau and neurofibrillary degeneration in AD. PMID:25641096

  15. Amyloid-β and tau: the trigger and bullet in Alzheimer disease pathogenesis.

    PubMed

    Bloom, George S

    2014-04-01

    The defining features of Alzheimer disease (AD) include conspicuous changes in both brain histology and behavior. The AD brain is characterized microscopically by the combined presence of 2 classes of abnormal structures, extracellular amyloid plaques and intraneuronal neurofibrillary tangles, both of which comprise highly insoluble, densely packed filaments. The soluble building blocks of these structures are amyloid-β (Aβ) peptides for plaques and tau for tangles. Amyloid-β peptides are proteolytic fragments of the transmembrane amyloid precursor protein, whereas tau is a brain-specific, axon-enriched microtubule-associated protein. The behavioral symptoms of AD correlate with the accumulation of plaques and tangles, and they are a direct consequence of the damage and destruction of synapses that mediate memory and cognition. Synapse loss can be caused by the failure of live neurons to maintain functional axons and dendrites or by neuron death. During the past dozen years, a steadily accumulating body of evidence has indicated that soluble forms of Aβ and tau work together, independently of their accumulation into plaques and tangles, to drive healthy neurons into the diseased state and that hallmark toxic properties of Aβ require tau. For instance, acute neuron death, delayed neuron death following ectopic cell cycle reentry, and synaptic dysfunction are triggered by soluble, extracellular Aβ species and depend on soluble, cytoplasmic tau. Therefore, Aβ is upstream of tau in AD pathogenesis and triggers the conversion of tau from a normal to a toxic state, but there is also evidence that toxic tau enhances Aβ toxicity via a feedback loop. Because soluble toxic aggregates of both Aβ and tau can self-propagate and spread throughout the brain by prionlike mechanisms, successful therapeutic intervention for AD would benefit from detecting these species before plaques, tangles, and cognitive impairment become evident and from interfering with the destructive

  16. Proteomic identification of abnormally expressed proteins in early-stage placenta derived from cloned cat embryos.

    PubMed

    Bang, Jae-Il; Lee, Hyo-Sang; Deb, Gautam Kumar; Ha, A-Na; Kwon, Young-Sang; Cho, Seong-Keun; Kim, Byeong-Woo; Cho, Kyu-Woan; Kong, Il-Keun

    2013-01-15

    It is unknown whether gene expression in cloned placenta during pre- and postimplantation is associated with early pregnancy failure in the cat. In this study, protein expression patterns were examined in early-stage (21-day-old) domestic cat placentas of fetuses derived from AI (CP; N = 4) and cloned embryo transfer (CEP; N = 2). Differentially expressed proteins were analyzed by two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight (TOF) mass spectrometry (MS). A total of 21 proteins were aberrantly expressed (P < 0.05) by >1.5-fold in CEP compared with CP. Compared with CP, 12 proteins were upregulated in CEP (peptidyl-prolyl cis-trans isomerase A, annexin A2, protein DJ-1, adenylate kinase isoenzyme 1, protein disulfide-isomerase A3, actin cytoplasmic 1, serum albumin, protein disulfide-isomerase A6, and triosephosphate isomerase), and nine proteins were downregulated (triosephosphate isomerase; heterogeneous nuclear ribonucleoprotein H; tropomyosin alpha-4; triosephosphate isomerase 1; 60 kDa heat shock protein, mitochondrial; serum albumin; calumenin; keratin type 1; and prohibitin). The identities of the differentially expressed proteins were validated by peptide mass fingerprinting using matrix-assisted laser desorption/ionization-TOF/TOF MS/MS. The abnormally expressed proteins identified in this study might be associated with impaired development and dysfunction of CEP during early pregnancy. Abnormal protein expression might also induce fetal loss and contribute to failure to maintain pregnancy to term.

  17. [Abnormal Serum Total Protein Measurement by Lipoprotein-X in an Infant with Biliary Atresia].

    PubMed

    Futatsugi, Akiko; Hidaka, Eiko; Kubota, Noriko; Nishijima, Fumie; Yoshizawa, Katsumi; Ishimine, Nau; Sugano, Mitsutoshi; Hori, Atsushi; Hidaka, Hiroya

    2015-11-01

    Lipoprotein-X (LP-X) in cholestatic jaundice causes abnormal reaction in assays for low-density lipoprotein-cholesterol, but the effects on other test items are unknown. Here, we report an infant with biliary atresia showing abnormal reaction in total serum protein assay using the biuret method, and lipoprotein-X (LP-X) was then detected. In this 11-month-old female infant, jaundice was observed at 2 months old, and a diagnosis of biliary atresia was made. On biochemical tests at 12 months old, the total serum protein concentrations detected by the biuret method were very high, and the response curve and linearity of dilution were abnormal. LP-X was detected by agar electrophoresis. In addition and recovery experiments with normal serum fractionation of the patient's LP-X-rich lipoprotein fraction prepared by ultracentrifugation, normal γ-globulin fractionation showed an abnormal reaction by the biuret method. In infants with biliary atresia, we showed that the total serum protein assay by the biuret method was influenced by LP-X-rich lipoprotein, which may be caused by abnormal reaction of LP-X and γ-globulin. [Case Report].

  18. A Single-Use, In Vitro Biosensor for the Detection of T-Tau Protein, A Biomarker of Neuro-Degenerative Disorders, in PBS and Human Serum Using Differential Pulse Voltammetry (DPV).

    PubMed

    Dai, Yifan; Molazemhosseini, Alireza; Liu, Chung Chiun

    2017-02-19

    A single-use, in vitro biosensor for the detection of T-Tau protein in phosphate-buffer saline (PBS) and undiluted human serum was designed, manufactured, and tested. Differential pulse voltammetry (DPV) served as the transduction mechanism. This biosensor consisted of three electrodes: working, counter, and reference electrodes fabricated on a PET sheet. Both working and counter electrodes were thin gold film, 10 nm in thickness. Laser ablation technique was used to define the size and structure of the biosensor. The biosensor was produced using cost-effective roll-to-roll process. Self-assembled monolayers (SAM) of 3-mercaptopropionic acid (MPA) were employed to covalently immobilize the anti-T-Tau (T-Tau antibody) on the gold working electrode. A carbodiimide conjugation approach using N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) cross-linked anti-T-Tau to the carboxylic groups on one end of the MPA. A T-Tau protein ladder with six isoforms was used in this study. The anti-T-Tau concentration used was 500,000 pg/mL. The T-Tau protein concentration ranged from 1000 pg/mL to 100,000 pg/mL. DPV measurements showed excellent responses, with a good calibration curve. Thus, a practical tool for simple detection of T-Tau protein, a biomarker of neuro-degenerative disorders, has been successfully developed. This tool could also be extended to detect other biomarkers for neuro-degenerative disorders, such as P-Tau protein and β-amyloid 42.

  19. A Single-Use, In Vitro Biosensor for the Detection of T-Tau Protein, A Biomarker of Neuro-Degenerative Disorders, in PBS and Human Serum Using Differential Pulse Voltammetry (DPV)

    PubMed Central

    Dai, Yifan; Molazemhosseini, Alireza; Liu, Chung Chiun

    2017-01-01

    A single-use, in vitro biosensor for the detection of T-Tau protein in phosphate-buffer saline (PBS) and undiluted human serum was designed, manufactured, and tested. Differential pulse voltammetry (DPV) served as the transduction mechanism. This biosensor consisted of three electrodes: working, counter, and reference electrodes fabricated on a PET sheet. Both working and counter electrodes were thin gold film, 10 nm in thickness. Laser ablation technique was used to define the size and structure of the biosensor. The biosensor was produced using cost-effective roll-to-roll process. Self-assembled monolayers (SAM) of 3-mercaptopropionic acid (MPA) were employed to covalently immobilize the anti-T-Tau (T-Tau antibody) on the gold working electrode. A carbodiimide conjugation approach using N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) and N–hydroxysuccinimide (NHS) cross-linked anti-T-Tau to the carboxylic groups on one end of the MPA. A T-Tau protein ladder with six isoforms was used in this study. The anti-T-Tau concentration used was 500,000 pg/mL. The T-Tau protein concentration ranged from 1000 pg/mL to 100,000 pg/mL. DPV measurements showed excellent responses, with a good calibration curve. Thus, a practical tool for simple detection of T-Tau protein, a biomarker of neuro-degenerative disorders, has been successfully developed. This tool could also be extended to detect other biomarkers for neuro-degenerative disorders, such as P-Tau protein and β-amyloid 42. PMID:28218731

  20. Theory of {tau} mesonic decays

    SciTech Connect

    Li, B.A.

    1997-02-01

    Studies of {tau} mesonic decays are presented. A mechanism for the axial-vector current at low energies is proposed. The VMD is used to treat the vector current. All the meson vertices of both normal parity and abnormal parity (Wess-Zumino-Witten anomaly) are obtained from an effective chiral theory of mesons. a{sub 1} dominance is found in the decay modes of the {tau} lepton: 3{pi}, f(1285){pi}. Both the {rho} and the a{sub 1} meson contribute to the decay {tau}{r_arrow}K{sup {asterisk}}K{nu}; it is found that the vector current is dominant. CVC is tested by studying e{sup +}e{sup {minus}}{r_arrow}{pi}{sup +}{pi}{sup {minus}}. The branching ratios of {tau}{r_arrow}{omega}{pi}{nu} and K{bar K}{nu} are calculated. In terms of a similar mechanism the {Delta}s=1 decay modes of the {tau} lepton are studied and K{sub a} dominance is found in {tau}{r_arrow}K{sup {asterisk}}{pi}{nu} and K{sup {asterisk}}{eta}{nu}. The suppression of {tau}{r_arrow}K{rho}{nu} is revealed. The branching ratio of {tau}{r_arrow}{eta}K{nu} is computed. As a test of this theory, the form factors of {pi}{r_arrow}e{gamma}{nu} and K{r_arrow}e{gamma}{nu} are determined. The theoretical results agree with data reasonably well. {copyright} {ital 1997} {ital The American Physical Society}

  1. Clioquinol rescues Parkinsonism and dementia phenotypes of the tau knockout mouse.

    PubMed

    Lei, Peng; Ayton, Scott; Appukuttan, Ambili Thoppuvalappil; Volitakis, Irene; Adlard, Paul A; Finkelstein, David I; Bush, Ashley I

    2015-09-01

    Iron accumulation and tau protein deposition are pathological features of Alzheimer's (AD) and Parkinson's diseases (PD). Soluble tau protein is lower in affected regions of these diseases, and we previously reported that tau knockout mice display motor and cognitive behavioral abnormities, brain atrophy, neuronal death in substantia nigra, and iron accumulation in the brain that all emerged between 6 and 12 months of age. This argues for a loss of tau function in AD and PD. We also showed that treatment with the moderate iron chelator, clioquinol (CQ) restored iron levels and prevented neuronal atrophy and attendant behavioral decline in 12-month old tau KO mice when commenced prior to the onset of deterioration (6 months). However, therapies for AD and PD will need to treat the disease once it is already manifest. So, in the current study, we tested whether CQ could also rescue the phenotype of mice with a developed phenotype. We found that 5-month treatment of symptomatic (13 months old) tau KO mice with CQ increased nigral tyrosine hydroxylase phosphorylation (which induces activity) and reversed the motor deficits. Treatment also reversed cognitive deficits and raised BDNF levels in the hippocampus, which was accompanied by attenuated brain atrophy, and reduced iron content in the brain. These data raise the possibility that lowering brain iron levels in symptomatic patients could reverse neuronal atrophy and improve brain function, possibly by elevating neurotrophins.

  2. Tau regulates the subcellular localization of calmodulin

    SciTech Connect

    Barreda, Elena Gomez de

    2011-05-13

    Highlights: {yields} In this work we have tried to explain how a cytoplasmic protein could regulate a cell nuclear function. We have tested the role of a cytoplasmic protein (tau) in regulating the expression of calbindin gene. We found that calmodulin, a tau-binding protein with nuclear and cytoplasmic localization, increases its nuclear localization in the absence of tau. Since nuclear calmodulin regulates calbindin expression, a decrease in nuclear calmodulin, due to the presence of tau that retains it at the cytoplasm, results in a change in calbindin expression. -- Abstract: Lack of tau expression in neuronal cells results in a change in the expression of few genes. However, little is known about how tau regulates gene expression. Here we show that the presence of tau could alter the subcellular localization of calmodulin, a protein that could be located at the cytoplasm or in the nucleus. Nuclear calmodulin binds to co-transcription factors, regulating the expression of genes like calbindin. In this work, we have found that in neurons containing tau, a higher proportion of calmodulin is present in the cytoplasm compared with neurons lacking tau and that an increase in cytoplasmic calmodulin correlates with a higher expression of calbindin.

  3. Interaction of Tau with Fe65 links tau to APP.

    PubMed

    Barbato, Christian; Canu, Nadia; Zambrano, Nicola; Serafino, Annalucia; Minopoli, Giuseppina; Ciotti, Maria Teresa; Amadoro, Giuseppina; Russo, Tommaso; Calissano, Pietro

    2005-03-01

    The beta-amyloid precursor protein APP and the microtubule-associated protein Tau play a crucial role in the pathogenesis of Alzheimer's disease (AD). However, the possible molecular events linking these two proteins are still unknown. Here, we show that Fe65, one of the ligands of the APP cytodomain, is associated with Tau in vivo and in vitro, as demonstrated by co-immunoprecipitation, co-localization, and FRET experiments. Deletion studies indicated that the N-terminal domain of Tau and the PTB1 domain of Fe65 are required for this association. This interaction is regulated by the phosphorylation of Tau at selected sites, by glycogen synthase kinase-3beta (GSK3beta) and cyclin-dependent kinase 5 (Cdk5), and requires an intact microtubule network. Furthermore, laser scanner microscopy and co-immunoprecipitation experiments provide preliminary evidence of possible complex(es) involving Tau, Fe65, APP. These findings open new perspectives for the study of the possible crosstalk between these proteins in the pathogenesis of AD.

  4. Mutations in the SPTLC1 protein cause mitochondrial structural abnormalities and endoplasmic reticulum stress in lymphoblasts.

    PubMed

    Myers, Simon J; Malladi, Chandra S; Hyland, Ryan A; Bautista, Tara; Boadle, Ross; Robinson, Phillip J; Nicholson, Garth A

    2014-07-01

    Mutations in serine palmitoyltransferase long chain subunit 1 (SPTLC1) cause the typical length-dependent axonal degeneration hereditary sensory neuropathy type 1 (HSN1). Transmission electron microscopy studies on SPTLC1 mutant lymphoblasts derived from patients revealed specific structural abnormalities of mitochondria. Swollen mitochondria with abnormal cristae were clustered around the nucleus, with some mitochondria being wrapped in rough endoplasmic reticulum (ER) membranes. Total mitochondrial counts revealed a significant change in mitochondrial numbers between healthy and diseased lymphocytes but did not reveal any change in length to width ratios nor were there any changes to cellular function. However, there was a notable change in ER homeostasis, as assessed using key ER stress markers, BiP and ERO1-Lα, displaying reduced protein expression. The observations suggest that SPTLC1 mutations cause mitochondrial abnormalities and ER stress in HSN1 cells.

  5. Abnormal membrane protein methylation and merocyanine 540 fluorescence in sickle erythrocyte membranes.

    PubMed

    Manna, C; Hermanowicz, N; Ro, J Y; Neilan, B; Glushko, V; Kim, S

    1984-06-01

    Sickle cell erythrocytes exhibit reduced carboxyl methylation of membrane proteins compared to normal erythrocytes. This altered methylation in sickle membrane proteins is also observable when extracted membranes, both intact and alkali treated, were used as substrates for the homologous protein methylase II (S-adenosylmethionine:protein-carboxyl O-methyltransferase, EC. 2.1.1.24). However, when glycophorin A, one of the major methyl acceptors in both membranes, was extracted by lithium diiodosalicylate and used as the methyl acceptor, the proteins from both membranes were methylated equally, suggesting an involvement of membrane structure in membrane-bound protein methylation. Merocyanine 540 (MC-540), a fluorescent probe, was used to determine if the membranes differed in organization. Incubation of both normal and sickle erythrocytes membranes with MC-540 produced a marked increase in extrinsic fluorescence, reflecting a relatively nonpolar environment for the dye bound to the membranes. The fluorescence from sickle cell ghosts was only 87% as intense as that from normal ghosts, while the actual amount of MC-540 associated with sickle cell membranes was only 62% of normal. These data suggest that differences exist in the distribution of surface charges on these plasma membranes. These results are consistent with the hypothesis that abnormal levels of membrane protein methylation observed in sickle erythrocytes may be a result of abnormal membrane organization characteristic to sickle cell anemia.

  6. Knockout of G protein β5 impairs brain development and causes multiple neurologic abnormalities in mice

    PubMed Central

    Zhang, Jian-Hua; Pandey, Mritunjay; Seigneur, Erica M.; Panicker, Leelamma M.; Koo, Lily; Schwartz, Owen M.; Chen, Weiping; Chen, Ching-Kang; Simonds, William F.

    2011-01-01

    Gβ5 is a divergent member of the signal-transducing G protein β subunit family encoded by GNB5 and expressed principally in brain and neuronal tissue. Among heterotrimeric Gβ isoforms, Gβ5 is unique in its ability to heterodimerize with members of the R7 subfamily of the regulator of G protein signaling (RGS) proteins that contain G protein-γ like domains. Previous studies employing Gnb5 knockout (KO) mice have shown that Gβ5 is an essential stabilizer of such RGS proteins and regulates the deactivation of retinal phototransduction and the proper functioning of retinal bipolar cells. However, little is known of the function of Gβ5 in the brain outside the visual system. We show here that mice lacking Gβ5 have a markedly abnormal neurologic phenotype that includes impaired development, tiptoe-walking, motor learning and coordination deficiencies, and hyperactivity. We further show that Gβ5-deficient mice have abnormalities of neuronal development in cerebellum and hippocampus. We find that the expression of both mRNA and protein from multiple neuronal genes is dysregulated in Gnb5 KO mice. Taken together with previous observations from Gnb5 KO mice, our findings suggest a model in which Gβ5 regulates dendritic arborization and/or synapse formation during development, in part by effects on gene expression. PMID:21883221

  7. The role of tau in the pathological process and clinical expression of Huntington’s disease

    PubMed Central

    Vuono, Romina; Winder-Rhodes, Sophie; de Silva, Rohan; Cisbani, Giulia; Drouin-Ouellet, Janelle; Spillantini, Maria G.; Cicchetti, Francesca

    2015-01-01

    Huntington’s disease is a neurodegenerative disorder caused by an abnormal CAG repeat expansion within exon 1 of the huntingtin gene HTT. While several genetic modifiers, distinct from the Huntington’s disease locus itself, have been identified as being linked to the clinical expression and progression of Huntington’s disease, the exact molecular mechanisms driving its pathogenic cascade and clinical features, especially the dementia, are not fully understood. Recently the microtubule associated protein tau, MAPT, which is associated with several neurodegenerative disorders, has been implicated in Huntington’s disease. We explored this association in more detail at the neuropathological, genetic and clinical level. We first investigated tau pathology by looking for the presence of hyperphosphorylated tau aggregates, co-localization of tau with mutant HTT and its oligomeric intermediates in post-mortem brain samples from patients with Huntington’s disease (n = 16) compared to cases with a known tauopathy and healthy controls. Next, we undertook a genotype–phenotype analysis of a large cohort of patients with Huntington’s disease (n = 960) with a particular focus on cognitive decline. We report not only on the tau pathology in the Huntington’s disease brain but also the association between genetic variation in tau gene and the clinical expression and progression of the disease. We found extensive pathological inclusions containing abnormally phosphorylated tau protein that co-localized in some instances with mutant HTT. We confirmed this related to the disease process rather than age, by showing it is also present in two patients with young-onset Huntington’s disease (26 and 40 years old at death). In addition we demonstrate that tau oligomers (suggested to be the most likely neurotoxic tau entity) are present in the Huntington’s disease brains. Finally we highlight the clinical significance of this pathology by demonstrating that the MAPT

  8. The role of tau in the pathological process and clinical expression of Huntington's disease.

    PubMed

    Vuono, Romina; Winder-Rhodes, Sophie; de Silva, Rohan; Cisbani, Giulia; Drouin-Ouellet, Janelle; Spillantini, Maria G; Cicchetti, Francesca; Barker, Roger A

    2015-07-01

    Huntington's disease is a neurodegenerative disorder caused by an abnormal CAG repeat expansion within exon 1 of the huntingtin gene HTT. While several genetic modifiers, distinct from the Huntington's disease locus itself, have been identified as being linked to the clinical expression and progression of Huntington's disease, the exact molecular mechanisms driving its pathogenic cascade and clinical features, especially the dementia, are not fully understood. Recently the microtubule associated protein tau, MAPT, which is associated with several neurodegenerative disorders, has been implicated in Huntington's disease. We explored this association in more detail at the neuropathological, genetic and clinical level. We first investigated tau pathology by looking for the presence of hyperphosphorylated tau aggregates, co-localization of tau with mutant HTT and its oligomeric intermediates in post-mortem brain samples from patients with Huntington's disease (n = 16) compared to cases with a known tauopathy and healthy controls. Next, we undertook a genotype-phenotype analysis of a large cohort of patients with Huntington's disease (n = 960) with a particular focus on cognitive decline. We report not only on the tau pathology in the Huntington's disease brain but also the association between genetic variation in tau gene and the clinical expression and progression of the disease. We found extensive pathological inclusions containing abnormally phosphorylated tau protein that co-localized in some instances with mutant HTT. We confirmed this related to the disease process rather than age, by showing it is also present in two patients with young-onset Huntington's disease (26 and 40 years old at death). In addition we demonstrate that tau oligomers (suggested to be the most likely neurotoxic tau entity) are present in the Huntington's disease brains. Finally we highlight the clinical significance of this pathology by demonstrating that the MAPT haplotypes affect the rate

  9. Squirrel monkeys (Saimiri sciureus) infected with the agent of bovine spongiform encephalopathy develop tau pathology.

    PubMed

    Piccardo, P; Cervenak, J; Yakovleva, O; Gregori, L; Pomeroy, K; Cook, A; Muhammad, F S; Seuberlich, T; Cervenakova, L; Asher, D M

    2012-07-01

    Squirrel monkeys (Saimiri sciureus) were infected experimentally with the agent of classical bovine spongiform encephalopathy (BSE). Two to four years later, six of the monkeys developed alterations in interactive behaviour and cognition and other neurological signs typical of transmissible spongiform encephalopathy (TSE). At necropsy examination, the brains from all of the monkeys showed pathological changes similar to those described in variant Creutzfeldt-Jakob disease (vCJD) of man, except that the squirrel monkey brains contained no PrP-amyloid plaques typical of that disease. Constant neuropathological features included spongiform degeneration, gliosis, deposition of abnormal prion protein (PrP(TSE)) and many deposits of abnormally phosphorylated tau protein (p-Tau) in several areas of the cerebrum and cerebellum. Western blots showed large amounts of proteinase K-resistant prion protein in the central nervous system. The striking absence of PrP plaques (prominent in brains of cynomolgus macaques [Macaca fascicularis] with experimentally-induced BSE and vCJD and in human patients with vCJD) reinforces the conclusion that the host plays a major role in determining the neuropathology of TSEs. Results of this study suggest that p-Tau, found in the brains of all BSE-infected monkeys, might play a role in the pathogenesis of TSEs. Whether p-Tau contributes to development of disease or appears as a secondary change late in the course of illness remains to be determined.

  10. NMR observation of Tau in Xenopus oocytes

    NASA Astrophysics Data System (ADS)

    Bodart, Jean-François; Wieruszeski, Jean-Michel; Amniai, Laziza; Leroy, Arnaud; Landrieu, Isabelle; Rousseau-Lescuyer, Arlette; Vilain, Jean-Pierre; Lippens, Guy

    2008-06-01

    The observation by NMR spectroscopy of microinjected 15N-labelled proteins into Xenopus laevis oocytes might open the way to link structural and cellular biology. We show here that embedding the oocytes into a 20% Ficoll solution maintains their structural integrity over extended periods of time, allowing for the detection of nearly physiological protein concentrations. We use these novel conditions to study the neuronal Tau protein inside the oocytes. Spectral reproducibility and careful comparison of the spectra of Tau before and after cell homogenization is presented. When injecting Tau protein into immature oocytes, we show that both its microtubule association and different phosphorylation events can be detected.

  11. Formation and Propagation of Tau Oligomeric Seeds

    PubMed Central

    Gerson, Julia E.; Kayed, Rakez

    2013-01-01

    Tau misfolding and aggregation leads to the formation of neurofibrillary tangles (NFTs), which have long been considered one of the main pathological hallmarks for numerous neurodegenerative diseases known as tauopathies, including Alzheimer’s Disease (AD) and Parkinson’s Disease (PD). However, recent studies completed both in vitro and in vivo suggest that intermediate forms of tau, known as tau oligomers, between the monomeric form and NFTs are the true toxic species in disease and the best targets for anti-tau therapies. However, the exact mechanism by which the spread of pathology occurs is unknown. Evidence suggests that tau oligomers may act as templates for the misfolding of native tau, thereby seeding the spread of the toxic forms of the protein. Recently, researchers have reported the ability of tau oligomers to enter and exit cells, propagating from disease-affected regions to unaffected areas. While the mechanism by which the spreading of misfolded tau occurs has yet to be elucidated, there are a few different models which have been proposed, including cell membrane stress and pore-formation, endocytosis and exocytosis, and non-traditional secretion of protein not enclosed by a membrane. Coming to an understanding of how toxic tau species seed and spread through the brain will be crucial to finding effective treatments for neurodegenerative tauopathies. PMID:23882255

  12. Prolyl oligopeptidase colocalizes with α-synuclein, β-amyloid, tau protein and astroglia in the post-mortem brain samples with Parkinson's and Alzheimer's diseases.

    PubMed

    Hannula, M J; Myöhänen, T T; Tenorio-Laranga, J; Männistö, P T; Garcia-Horsman, J A

    2013-07-09

    Prolyl oligopeptidase (EC 3.4.21.26, PREP) is a serine protease that hydrolyzes proline-containing peptides shorter than 30-mer but it has also nonhydrolytic functions. PREP has been shown to accelerate aggregation of wild-type α-synuclein (α-syn) under cell-free conditions, and PREP inhibitors can block this aggregation both in vitro and in vivo. α-syn is the main component of Lewy bodies in Parkinson's disease (PD) and Lewy body dementia. To clarify the possible interaction of PREP with other markers of neurodegenerative diseases, we studied colocalizations of PREP and (1) α-syn, (2) β-amyloid, (3) tau protein and (4) astroglial and microglial cells in human post-mortem brain samples from PD, Alzheimer's disease (AD) patients and in healthy control brain samples. In the substantia nigra of PD brains, an intense colocalization with PREP and α-syn was evident. PREP colocalized also with β-amyloid plaques in AD brains and with tau protein in AD and in healthy brains. PREP was also found in astroglial cells in PD, AD and control brains, but not in the microglia. Our findings are the first ones to demonstrate colocalization of PREP and pathological proteins in the human brain and support the view that, at least in spatial terms, PREP could be associated with pathogenesis of neurodegenerative diseases.

  13. Phosphorylation of tau is regulated by PKN.

    PubMed

    Taniguchi, T; Kawamata, T; Mukai, H; Hasegawa, H; Isagawa, T; Yasuda, M; Hashimoto, T; Terashima, A; Nakai, M; Mori, H; Ono, Y; Tanaka, C

    2001-03-30

    For the phosphorylation state of microtubule-associated protein, tau plays a pivotal role in regulating microtubule networks in neurons. Tau promotes the assembly and stabilization of microtubules. The potential for tau to bind to microtubules is down-regulated after local phosphorylation. When we investigated the effects of PKN activation on tau phosphorylation, we found that PKN triggers disruption of the microtubule array both in vitro and in vivo and predominantly phosphorylates tau in microtubule binding domains (MBDs). PKN has a catalytic domain highly homologous to protein kinase C (PKC), a kinase that phosphorylates Ser-313 (= Ser-324, the number used in this study) in MBDs. Thus, we identified the phosphorylation sites of PKN and PKC subtypes (PKC-alpha, -betaI, -betaII, -gamma, -delta, -epsilon, -zeta, and -lambda) in MBDs. PKN phosphorylates Ser-258, Ser-320, and Ser-352, although all PKC subtypes phosphorylate Ser-258, Ser-293, Ser-324, and Ser-352. There is a PKN-specific phosphorylation site, Ser-320, in MBDs. HIA3, a novel phosphorylation-dependent antibody recognizing phosphorylated tau at Ser-320, showed immunoreactivity in Chinese hamster ovary cells expressing tau and the active form of PKN, but not in Chinese hamster ovary cells expressing tau and the inactive form of PKN. The immunoreactivity for phosphorylated tau at Ser-320 increased in the presence of a phosphatase inhibitor, FK506 treatment, which means that calcineurin (protein phosphatase 2B) may be involved in dephosphorylating tau at Ser-320 site. We also noted that PKN reduces the phosphorylation recognized by the phosphorylation-dependent antibodies AT8, AT180, and AT270 in vivo. Thus PKN serves as a regulator of microtubules by specific phosphorylation of tau, which leads to disruption of tubulin assembly.

  14. Protein restriction cycles reduce IGF-1 and phosphorylated Tau, and improve behavioral performance in an Alzheimer’s disease mouse model

    PubMed Central

    Parrella, Edoardo; Maxim, Tom; Maialetti, Francesca; Zhang, Lu; Wan, Junxiang; Wei, Min; Cohen, Pinchas; Fontana, Luigi; Longo, Valter D.

    2014-01-01

    Summary In laboratory animals, calorie restriction (CR) protects against aging, oxidative stress, and neurodegenerative pathologies. Reduced levels of growth hormone and IGF-1, which mediate some of the protective effects of CR, can also extend longevity and/or protect against age-related diseases in rodents and humans. However, severely restricted diets are difficult to maintain and are associated with chronically low weight and other major side effects. Here we show that 4 months of periodic protein restriction cycles (PRCs) with supplementation of nonessential amino acids in mice already displaying significant cognitive impairment and Alzheimer’s disease (AD)-like pathology reduced circulating IGF-1 levels by 30–70% and caused an 8-fold increase in IGFBP-1. Whereas PRCs did not affect the levels of β amyloid (Aβ), they decreased tau phosphorylation in the hippocampus and alleviated the age-dependent impairment in cognitive performance. These results indicate that periodic protein restriction cycles without CR can promote changes in circulating growth factors and tau phosphorylation associated with protection against age-related neuropathologies. PMID:23362919

  15. Tau Phosphorylation by GSK3 in Different Conditions

    PubMed Central

    Avila, Jesús; León-Espinosa, Gonzalo; García, Esther; García-Escudero, Vega; Hernández, Félix; DeFelipe, Javier

    2012-01-01

    Almost a 20% of the residues of tau protein are phosphorylatable amino acids: serine, threonine, and tyrosine. In this paper we comment on the consequences for tau of being a phosphoprotein. We will focus on serine/threonine phosphorylation. It will be discussed that, depending on the modified residue in tau molecule, phosphorylation could be protective, in processes like hibernation, or toxic like in development of those diseases known as tauopathies, which are characterized by an hyperphosphorylation and aggregation of tau. PMID:22675648

  16. Role of NMDA receptors in noise-induced tau hyperphosphorylation in rat hippocampus and prefrontal cortex.

    PubMed

    Li, Kang; Jia, Hengchuan; She, Xiaojun; Cui, Bo; Zhang, Na; Chen, Xuewei; Xu, Chuanxiang; An, Gaihong; Ma, Qiang

    2014-05-15

    Chronic noise exposure has been associated with abnormalities in glutamate (Glu)-NMDAR signaling and tau hyperphosphorylation. However, further studies are necessary to clarify potential causal relationships. The aim of the present study was to evaluate the role of NMDA receptors in noise-induced tau hyperphosphorylation in the rat hippocampus and prefrontal cortex. Male Wistar rats were randomly divided into three groups in the present study: control with isotonic saline instillation (n=10); noise exposure (100 dB SPL white noise, 4h/d × 14d) and treated with saline (n=10); and noise exposure and treated with MK-801 (0.5mg/kg, intraperitoneally; n=10). The levels of tau phosphorylated at Ser202 and Ser396, and proteins involved in hyperphosphorylation, namely glycogen synthase kinase 3β (GSK3β) and protein phosphatase 2A (PP2A), were measured in the hippocampus and prefrontal cortex (PFC) after the last noise exposure. We showed that phosphorylated tau levels were enhanced in noise-exposed-rat hippocampus and PFC. MK-801 decreased the hyperphosphorylation of tau at Ser202 and Ser396 sites in the hippocampus and PFC. Furthermore, MK-801 reversed noise-induced GSK3β overexpression but had no significant effect on PP2A levels. This suggests that MK-801 protects against chronic-noise-induced tau hyperphosphorylation in the hippocampus and PFC. These findings demonstrate that Glu-NMDAR signaling may be involved in triggering aberrant tau hyperphosphorylation in the hippocampus and PFC after chronic noise exposure.

  17. Early maturation and distinct tau pathology in induced pluripotent stem cell-derived neurons from patients with MAPT mutations.

    PubMed

    Iovino, Mariangela; Agathou, Sylvia; González-Rueda, Ana; Del Castillo Velasco-Herrera, Martin; Borroni, Barbara; Alberici, Antonella; Lynch, Timothy; O'Dowd, Sean; Geti, Imbisaat; Gaffney, Daniel; Vallier, Ludovic; Paulsen, Ole; Káradóttir, Ragnhildur Thóra; Spillantini, Maria Grazia

    2015-11-01

    Tauopathies, such as Alzheimer's disease, some cases of frontotemporal dementia, corticobasal degeneration and progressive supranuclear palsy, are characterized by aggregates of the microtubule-associated protein tau, which are linked to neuronal death and disease development and can be caused by mutations in the MAPT gene. Six tau isoforms are present in the adult human brain and they differ by the presence of 3(3R) or 4(4R) C-terminal repeats. Only the shortest 3R isoform is present in foetal brain. MAPT mutations found in human disease affect tau binding to microtubules or the 3R:4R isoform ratio by altering exon 10 splicing. We have differentiated neurons from induced pluripotent stem cells derived from fibroblasts of controls and patients with N279K and P301L MAPT mutations. Induced pluripotent stem cell-derived neurons recapitulate developmental tau expression, showing the adult brain tau isoforms after several months in culture. Both N279K and P301L neurons exhibit earlier electrophysiological maturation and altered mitochondrial transport compared to controls. Specifically, the N279K neurons show abnormally premature developmental 4R tau expression, including changes in the 3R:4R isoform ratio and AT100-hyperphosphorylated tau aggregates, while P301L neurons are characterized by contorted processes with varicosity-like structures, some containing both alpha-synuclein and 4R tau. The previously unreported faster maturation of MAPT mutant human neurons, the developmental expression of 4R tau and the morphological alterations may contribute to disease development.

  18. New Features about Tau Function and Dysfunction

    PubMed Central

    Medina, Miguel; Hernández, Félix; Avila, Jesús

    2016-01-01

    Tau is a brain microtubule-associated protein that directly binds to a microtubule and dynamically regulates its structure and function. Under pathological conditions, tau self-assembles into filamentous structures that end up forming neurofibrillary tangles. Prominent tau neurofibrillary pathology is a common feature in a number of neurodegenerative disorders, collectively referred to as tauopathies, the most common of which is Alzheimer’s disease (AD). Beyond its classical role as a microtubule-associated protein, recent advances in our understanding of tau cellular functions have revealed novel insights into their important role during pathogenesis and provided potential novel therapeutic targets. Regulation of tau behavior and function under physiological and pathological conditions is mainly achieved through post-translational modifications, including phosphorylation, glycosylation, acetylation, and truncation, among others, indicating the complexity and variability of factors influencing regulation of tau toxicity, all of which have significant implications for the development of novel therapeutic approaches in various neurodegenerative disorders. A more comprehensive understanding of the molecular mechanisms regulating tau function and dysfunction will provide us with a better outline of tau cellular networking and, hopefully, offer new clues for designing more efficient approaches to tackle tauopathies in the near future. PMID:27104579

  19. Tau mis-splicing in the pathogenesis of neurodegenerative disorders

    PubMed Central

    Park, Sun Ah; Ahn, Sang Il; Gallo, Jean-Marc

    2016-01-01

    Tau proteins, which stabilize the structure and regulate the dynamics of microtubules, also play important roles in axonal transport and signal transduction. Tau proteins are missorted, aggregated, and found as tau inclusions under many pathological conditions associated with neurodegenerative disorders, which are collectively known as tauopathies. In the adult human brain, tau protein can be expressed in six isoforms due to alternative splicing. The aberrant splicing of tau pre-mRNA has been consistently identified in a variety of tauopathies but is not restricted to these types of disorders as it is also present in patients with non-tau proteinopathies and RNAopathies. Tau mis-splicing results in isoform-specific impairments in normal physiological function and enhanced recruitment of excessive tau isoforms into the pathological process. A variety of factors are involved in the complex set of mechanisms underlying tau mis-splicing, but variation in the cis-element, methylation of the MAPT gene, genetic polymorphisms, the quantity and activity of spliceosomal proteins, and the patency of other RNA-binding proteins, are related to aberrant splicing. Currently, there is a lack of appropriate therapeutic strategies aimed at correcting the tau mis-splicing process in patients with neurodegenerative disorders. Thus, a more comprehensive understanding of the relationship between tau mis-splicing and neurodegenerative disorders will aid in the development of efficient therapeutic strategies for patients with a tauopathy or other, related neurodegenerative disorders. [BMB Reports 2016; 49(8): 405-413] PMID:27222125

  20. Diaphragm Abnormalities in Patients with End-Stage Heart Failure: NADPH Oxidase Upregulation and Protein Oxidation

    PubMed Central

    Ahn, Bumsoo; Coblentz, Philip D.; Beharry, Adam W.; Patel, Nikhil; Judge, Andrew R.; Moylan, Jennifer. S.; Hoopes, Charles W.; Bonnell, Mark R.; Ferreira, Leonardo F.

    2017-01-01

    Patients with heart failure (HF) have diaphragm abnormalities that contribute to disease morbidity and mortality. Studies in animals suggest that reactive oxygen species (ROS) cause diaphragm abnormalities in HF. However, the effects of HF on ROS sources, antioxidant enzymes, and protein oxidation in the diaphragm of humans is unknown. NAD(P)H oxidase, especially the Nox2 isoform, is an important source of ROS in the diaphragm. Our main hypothesis was that diaphragm from patients with HF have heightened Nox2 expression and p47phox phosphorylation (marker of enzyme activation) that is associated with elevated protein oxidation. We collected diaphragm biopsies from patients with HF and brain-dead organ donors (controls). Diaphragm mRNA levels of Nox2 subunits were increased 2.5–4.6-fold over controls (p < 0.05). Patients also had increased protein levels of Nox2 subunits (p47phox, p22phox, and p67phox) and total p47phox phosphorylation, while phospho-to-total p47phox levels were unchanged. The antioxidant enzyme catalase was increased in patients, whereas glutathione peroxidase and superoxide dismutases were unchanged. Among markers of protein oxidation, carbonyls were increased by ~40% (p < 0.05) and 4-hydroxynonenal and 3-nitrotyrosines were unchanged in patients with HF. Overall, our findings suggest that Nox2 is an important source of ROS in the diaphragm of patients with HF and increases in levels of antioxidant enzymes are not sufficient to maintain normal redox homeostasis. The net outcome is elevated diaphragm protein oxidation that has been shown to cause weakness in animals. PMID:28119629

  1. CCDC115 Deficiency Causes a Disorder of Golgi Homeostasis with Abnormal Protein Glycosylation

    PubMed Central

    Jansen, Jos C.; Cirak, Sebahattin; van Scherpenzeel, Monique; Timal, Sharita; Reunert, Janine; Rust, Stephan; Pérez, Belén; Vicogne, Dorothée; Krawitz, Peter; Wada, Yoshinao; Ashikov, Angel; Pérez-Cerdá, Celia; Medrano, Celia; Arnoldy, Andrea; Hoischen, Alexander; Huijben, Karin; Steenbergen, Gerry; Quelhas, Dulce; Diogo, Luisa; Rymen, Daisy; Jaeken, Jaak; Guffon, Nathalie; Cheillan, David; van den Heuvel, Lambertus P.; Maeda, Yusuke; Kaiser, Olaf; Schara, Ulrike; Gerner, Patrick; van den Boogert, Marjolein A.W.; Holleboom, Adriaan G.; Nassogne, Marie-Cécile; Sokal, Etienne; Salomon, Jody; van den Bogaart, Geert; Drenth, Joost P.H.; Huynen, Martijn A.; Veltman, Joris A.; Wevers, Ron A.; Morava, Eva; Matthijs, Gert; Foulquier, François; Marquardt, Thorsten; Lefeber, Dirk J.

    2016-01-01

    Disorders of Golgi homeostasis form an emerging group of genetic defects. The highly heterogeneous clinical spectrum is not explained by our current understanding of the underlying cell-biological processes in the Golgi. Therefore, uncovering genetic defects and annotating gene function are challenging. Exome sequencing in a family with three siblings affected by abnormal Golgi glycosylation revealed a homozygous missense mutation, c.92T>C (p.Leu31Ser), in coiled-coil domain containing 115 (CCDC115), the function of which is unknown. The same mutation was identified in three unrelated families, and in one family it was compound heterozygous in combination with a heterozygous deletion of CCDC115. An additional homozygous missense mutation, c.31G>T (p.Asp11Tyr), was found in a family with two affected siblings. All individuals displayed a storage-disease-like phenotype involving hepatosplenomegaly, which regressed with age, highly elevated bone-derived alkaline phosphatase, elevated aminotransferases, and elevated cholesterol, in combination with abnormal copper metabolism and neurological symptoms. Two individuals died of liver failure, and one individual was successfully treated by liver transplantation. Abnormal N- and mucin type O-glycosylation was found on serum proteins, and reduced metabolic labeling of sialic acids was found in fibroblasts, which was restored after complementation with wild-type CCDC115. PSI-BLAST homology detection revealed reciprocal homology with Vma22p, the yeast V-ATPase assembly factor located in the endoplasmic reticulum (ER). Human CCDC115 mainly localized to the ERGIC and to COPI vesicles, but not to the ER. These data, in combination with the phenotypic spectrum, which is distinct from that associated with defects in V-ATPase core subunits, suggest a more general role for CCDC115 in Golgi trafficking. Our study reveals CCDC115 deficiency as a disorder of Golgi homeostasis that can be readily identified via screening for abnormal

  2. Estimation of Tau and Phosphorylated Tau181 in Serum of Alzheimer’s Disease and Mild Cognitive Impairment Patients

    PubMed Central

    Shekhar, Shashank; Kumar, Rahul; Rai, Nitish; Kumar, Vijay; Singh, Kusum; Upadhyay, Ashish Datt; Tripathi, Manjari; Dwivedi, Sadanand; Dey, Aparajit B.; Dey, Sharmistha

    2016-01-01

    The elevated level of cerebrospinal fluid (CSF) Tau and phosphorylated Tau181 (p-Tau181) proteins are well established hallmarks of Alzheimer’s disease (AD). Elevated level of p-Tau181 can differentiate AD from other neurodegenerative disease. However, the expression level of these proteins in serum of AD patient is not well set up. This study sought to evaluate the level of Tau and p-Tau181 in serum of AD, and mild cognitive impairment (MCI) patients for an alternative approach to establish protein-based markers by convenient way. Blood samples were collected from 39 AD patients, 37 MCI patients and 37 elderly individuals as controls. The levels of Tau and p-Tau181 in the serum of the different groups were measured by label free real time Surface Plasmon Resonance technology by using specific antibodies, and were further confirmed by the conventional western blot method. An appropriate statistical analysis, including Receiver Operating Characteristic (ROC), was performed. The concentrations of serum Tau and p-Tau181 were significantly higher (p<0.00001) in AD (Tau; 47.49±9.00ng/μL, p-Tau181; 0.161±0.04 ng/μL) compared to MCI (Tau; 39.26±7.78 ng/μL, p-Tau181; 0.135±0.02 ng/μL) and were further higher compared to elderly controls (Tau; 34.92±6.58 ng/μL, p-Tau181; 0.122±0.01 ng/ μL). A significant (p<0.0001) downhill correlation was found between Tau as well as p-Tau181 levels with HMSE and MoCA score. This study for the first time reports the concentration of Tau and p-Tau181 in serum of AD and MCI patients. The cutoff values of Tau and p-Tau181 of AD and MCI patients with sensitivity and specificity reveal that serum level of these proteins can be used as a predictive marker for AD and MCI. PMID:27459603

  3. Tau--an inhibitor of deacetylase HDAC6 function.

    PubMed

    Perez, Mar; Santa-Maria, Ismael; Gomez de Barreda, Elena; Zhu, Xiongwei; Cuadros, Raquel; Cabrero, Jose Roman; Sanchez-Madrid, Francisco; Dawson, Hana N; Vitek, Michael P; Perry, George; Smith, Mark A; Avila, Jesus

    2009-06-01

    Analysis of brain microtubule protein from patients with Alzheimer's disease showed decreased alpha tubulin levels along with increased acetylation of the alpha tubulin subunit, mainly in those microtubules from neurons containing neurofibrillary tau pathology. To determine the relationship of tau protein and increased tubulin acetylation, we studied the effect of tau on the acetylation-deacetylation of tubulin. Our results indicate that tau binds to the tubulin-deacetylase, histone deacetylase 6 (HDAC6), decreasing its activity with a consequent increase in tubulin acetylation. As expected, increased acetylation was also found in tubulin from wild-type mice compared with tubulin from mice lacking tau because of the tau-mediated inhibition of the deacetylase. In addition, we found that an excess of tau protein, as a HDAC6 inhibitor, prevents induction of autophagy by inhibiting proteasome function.

  4. 5-HT(2C) serotonin receptor blockade prevents tau protein hyperphosphorylation and corrects the defect in hippocampal synaptic plasticity caused by a combination of environmental stressors in mice.

    PubMed

    Busceti, Carla Letizia; Di Pietro, Paola; Riozzi, Barbara; Traficante, Anna; Biagioni, Francesca; Nisticò, Robert; Fornai, Francesco; Battaglia, Giuseppe; Nicoletti, Ferdinando; Bruno, Valeria

    2015-09-01

    Exposure to multimodal sensory stressors is an everyday occurrence and sometimes becomes very intense, such as during rave parties or other recreational events. A growing body of evidence suggests that strong environmental stressors might cause neuronal dysfunction on their own in addition to their synergistic action with illicit drugs. Mice were exposed to a combination of physical and sensory stressors that are reminiscent of those encountered in a rave party. However, this is not a model of rave because it lacks the rewarding properties of rave. A 14-h exposure to environmental stressors caused an impairment of hippocampal long-term potentiation (LTP) and spatial memory, and an enhanced phosphorylation of tau protein in the CA1 and CA3 regions. These effects were transient and critically depended on the activation of 5-HT2C serotonin receptors, which are highly expressed in the CA1 region. Acute systemic injection of the selective 5-HT2C antagonist, RS-102,221 (2 mg/kg, i.p., 2 min prior the onset of stress), prevented tau hyperphosphorylation and also corrected the defects in hippocampal LTP and spatial memory. These findings suggest that passive exposure to a combination of physical and sensory stressors causes a reversible hippocampal dysfunction, which might compromise mechanisms of synaptic plasticity and spatial memory for a few days. Drugs that block 5-HT2C receptors might protect the hippocampus against the detrimental effect of environmental stressors.

  5. Highly potent and specific GSK-3beta inhibitors that block tau phosphorylation and decrease alpha-synuclein protein expression in a cellular model of Parkinson's disease.

    PubMed

    Kozikowski, Alan P; Gaisina, Irina N; Petukhov, Pavel A; Sridhar, Jayalakshmi; King, LaShaunda T; Blond, Sylvie Y; Duka, Tetyana; Rusnak, Milan; Sidhu, Anita

    2006-02-01

    Research by Klein and co-workers suggests that the inhibition of GSK-3beta by small molecules may offer an important strategy in the treatment of a number of central nervous system (CNS) disorders including Alzheimer's disease, Parkinson's disease, and bipolar disorders. Based on results from kinase-screening assays that identified a staurosporine analogue as a modest inhibitor of GSK-3beta, a series of 3-indolyl-4-indazolylmaleimides was prepared for study in both enzymatic and cell-based assays. Most strikingly, whereas we identified ligands having poor to high potency for GSK-3beta inhibition, only ligands with a Ki value of less than 8 nM, namely maleimides 18 and 22, were found to inhibit Tau phosphorylation at a GSK-3beta-specific site (Ser 396/404). Accordingly, maleimides 18 and 22 may protect neuronal cells against cell death by decreasing the level of alpha-Syn protein expression. We conclude that the GSK-3beta inhibitors described herein offer promise in defending cells against MPP+-induced neurotoxicity and that such compounds will be valuable to explore in animal models of Parkinson's disease as well as in other Tau-related neurodegenerative disease states.

  6. Synaptic Contacts Enhance Cell-to-Cell Tau Pathology Propagation.

    PubMed

    Calafate, Sara; Buist, Arjan; Miskiewicz, Katarzyna; Vijayan, Vinoy; Daneels, Guy; de Strooper, Bart; de Wit, Joris; Verstreken, Patrik; Moechars, Diederik

    2015-05-26

    Accumulation of insoluble Tau protein aggregates and stereotypical propagation of Tau pathology through the brain are common hallmarks of tauopathies, including Alzheimer's disease (AD). Propagation of Tau pathology appears to occur along connected neurons, but whether synaptic contacts between neurons are facilitating propagation has not been demonstrated. Using quantitative in vitro models, we demonstrate that, in parallel to non-synaptic mechanisms, synapses, but not merely the close distance between the cells, enhance the propagation of Tau pathology between acceptor hippocampal neurons and Tau donor cells. Similarly, in an artificial neuronal network using microfluidic devices, synapses and synaptic activity are promoting neuronal Tau pathology propagation in parallel to the non-synaptic mechanisms. Our work indicates that the physical presence of synaptic contacts between neurons facilitate Tau pathology propagation. These findings can have implications for synaptic repair therapies, which may turn out to have adverse effects by promoting propagation of Tau pathology.

  7. Caspase-Cleaved Tau Impairs Mitochondrial Dynamics in Alzheimer's Disease.

    PubMed

    Pérez, María José; Vergara-Pulgar, Katiana; Jara, Claudia; Cabezas-Opazo, Fabian; Quintanilla, Rodrigo A

    2017-01-13

    Alzheimer's disease (AD) is characterized by the presence of aggregates of tau protein. Tau truncated by caspase-3 (D421) or tau hyperphosphorylated at Ser396/S404 might play a role in the pathogenesis of AD. Mitochondria are dynamic organelles that modify their size and function through mitochondrial dynamics. Recent studies have shown that alterations of mitochondrial dynamics affect synaptic communication. Therefore, we studied the effects of pathological forms of tau on the regulation of mitochondrial dynamics. We used primary cortical neurons from tau(-/-) knockout mice and immortalized cortical neurons (CN1.4) that were transfected with plasmids containing green fluorescent protein (GFP) or GFP with different tau forms: full-length (GFP-T4), truncated (GFP-T4C3), pseudophosphorylated (GFP-T42EC), or both truncated and pseudophosphorylated modifications of tau (GFP-T4C3-2EC). Cells expressing truncated tau showed fragmented mitochondria compared to cells that expressed full-length tau. These findings were corroborated using primary neurons from tau(-/-) knockout mice that expressed the truncated and both truncated and pseudophosphorylated forms of tau. Interestingly, mitochondrial fragmentation was accompanied by a significant reduction in levels of optic atrophy protein 1 (Opa1) in cells expressing the truncated form of tau. In addition, treatment with low concentrations of amyloid-beta (Aβ) significantly reduced mitochondrial membrane potential, cell viability, and mitochondrial length in cortical cells and primary neurons from tau(-/-) mice that express truncated tau. These results indicate that the presence of tau pathology impairs mitochondrial dynamics by reducing Opa1 levels, an event that could lead to mitochondrial impairment observed in AD.

  8. Opposite effects of two estrogen receptors on tau phosphorylation through disparate effects on the miR-218/PTPA pathway

    PubMed Central

    Xiong, Yan-Si; Liu, Fang-Fang; Liu, Dan; Huang, He-Zhou; Wei, Na; Tan, Lu; Chen, Jian-Guo; Man, Heng-Ye; Gong, Cheng-Xin; Lu, Youming; Wang, Jian-Zhi; Zhu, Ling-Qiang

    2015-01-01

    The two estrogen receptors (ERs), ERα and ERβ, mediate the diverse biological functions of estradiol. Opposite effects of ERα and ERβ have been found in estrogen-induced cancer cell proliferation and differentiation as well as in memory-related tasks. However, whether these opposite effects are implicated in the pathogenesis of Alzheimer’s disease (AD) remains unclear. Here, we find that ERα and ERβ play contrasting roles in regulating tau phosphorylation, which is a pathological hallmark of AD. ERα increases the expression of miR-218 to suppress the protein levels of its specific target, protein tyrosine phosphatase α (PTPα). The downregulation of PTPα results in the abnormal tyrosine hyperphosphorylation of glycogen synthase kinase-3β (resulting in activation) and protein phosphatase 2A (resulting in inactivation), the major tau kinase and phosphatase. Suppressing the increased expression of miR-218 inhibits the ERα-induced tau hyperphosphorylation as well as the PTPα decline. In contrast, ERβ inhibits tau phosphorylation by limiting miR-218 levels and restoring the miR-218 levels antagonized the attenuation of tau phosphorylation by ERβ. These data reveal for the first time opposing roles for ERα and ERβ in AD pathogenesis and suggest potential therapeutic targets for AD. PMID:26111662

  9. Endometrial inflammation and abnormal expression of extracellular matrix proteins induced by Mycoplasma bovis in dairy cows.

    PubMed

    Guo, Mengyao; Wang, Guoqing; Lv, Tingting; Song, Xiaojing; Wang, Tiancheng; Xie, Guanghong; Cao, Yongguo; Zhang, Naisheng; Cao, Rongfeng

    2014-03-15

    Mycoplasma bovis infection can cause endometrial inflammation leading to infertility and involuntary culling in dairy cows. Because extracellular matrix (ECM) proteins affect the adherence of mycoplasma to eukaryotic cell surface, they may play a role in the pathogenesis of the bacteria. The objective of the present study was to evaluate the endometrial inflammatory response and ECM protein expression induced by M bovis. Endometrial concentrations of inflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and mRNA and protein expression of collagen IV (CL-IV), fibronectin (FN), and laminin (LN) were evaluated 10, 20, and 30 days after M bovis intrauterine infusion in breed cows 18 days postpartum. The presence of the bacteria in the uterus was detected by nested polymerase chain reaction and denaturing gradient gel electrophoresis. Endometrial TNF-α, IL-1β, and IL-6 concentrations in the treatment group were greater (P < 0.05) than in the positive and negative control groups 20 and 30 days after infusion. Endometrial CL-IV, FN, and LN mRNA and protein expression increased (P < 0.01) 20 days after infusion in all groups. However, the increase was more pronounced in the treatment group and reactive expressions were greater (P < 0.05) than in the positive and negative control groups 10, 20, and 30 days after infusion. In conclusion, M bovis triggered endometrial inflammatory response and increased CL-IV, FN, and LN mRNA and protein expression. The abnormal expression of ECM these proteins may promote the pathogenic effects of M bovis that lead to endometrial tissue damage and infertility.

  10. Neuroinflammation, hyperphosphorylated tau, diffuse amyloid plaques, and down-regulation of the cellular prion protein in air pollution exposed children and young adults.

    PubMed

    Calderón-Garcidueñas, Lilian; Kavanaugh, Michael; Block, Michelle; D'Angiulli, Amedeo; Delgado-Chávez, Ricardo; Torres-Jardón, Ricardo; González-Maciel, Angelica; Reynoso-Robles, Rafael; Osnaya, Norma; Villarreal-Calderon, Rodolfo; Guo, Ruixin; Hua, Zhaowei; Zhu, Hongtu; Perry, George; Diaz, Philippe

    2012-01-01

    Air pollution exposures have been linked to neuroinflammation and neuropathology. Autopsy samples of the frontal cortex from control (n = 8) and pollution-exposed (n = 35) children and young adults were analyzed by RT-PCR (n = 43) and microarray analysis (n = 12) for gene expression changes in oxidative stress, DNA damage signaling, NFκB signaling, inflammation, and neurodegeneration pathways. The effect of apolipoprotein E (APOE) genotype on the presence of protein aggregates associated with Alzheimer's disease (AD) pathology was also explored. Exposed urbanites displayed differential (>2-fold) regulation of 134 genes. Forty percent exhibited tau hyperphosphorylation with pre-tangle material and 51% had amyloid-β (Aβ) diffuse plaques compared with 0% in controls. APOE4 carriers had greater hyperphosphorylated tau and diffuse Aβ plaques versus E3 carriers (Q = 7.82, p = 0.005). Upregulated gene network clusters included IL1, NFκB, TNF, IFN, and TLRs. A 15-fold frontal down-regulation of the prion-related protein (PrP(C)) was seen in highly exposed subjects. The down-regulation of the PrP(C) is critical given its important roles for neuroprotection, neurodegeneration, and mood disorder states. Elevation of indices of neuroinflammation and oxidative stress, down-regulation of the PrP(C) and AD-associated pathology are present in young megacity residents. The inducible regulation of gene expression suggests they are evolving different mechanisms in an attempt to cope with the constant state of inflammation and oxidative stress related to their environmental exposures. Together, these data support a role for air pollution in CNS damage and its impact upon the developing brain and the potential etiology of AD and mood disorders.

  11. Growth of plasmodium falciparum in human erythrocytes containing abnormal membrane proteins

    SciTech Connect

    Schulman, S. City Univ. of New York, NY ); Roth, E.F. Jr.; Cheng, B.; Rybicki, A.C.; Sussman, I.I.; Wong, M.; Nagel, R.L.; Schwartz, R.S. ); Wang, W. ); Ranney, H.M. )

    1990-09-01

    To evaluate the role of erythrocyte (RBC) membrane proteins in the invasion and maturation of Plasmodium falciparum, the authors have studied, in culture, abnormal RBCs containing quantitative or qualitative membrane protein defects. These defects included hereditary spherocytosis (HS) due to decreases in the content of spectrin (HS(Sp{sup +})), hereditary elliptocytosis (HE) due to protein 4.1 deficiency (HE(4.1{sup 0})), HE due to a spectrin {alpha}I domain structural variant that results in increased content of spectrin dimers (HE(Sp{alpha}{sup I/65})), and band 3 structural variants. Parasite invasion, measured by the initial uptake of ({sup 3}H)hypoxanthine 18 hr after inoculation with merozoites, was normal in all of the pathologic RBCs. In contrast, RBCs from six HS(Sp{sup +}) subjects showed marked growth inhibition that became apparent after the first or second growth cycle. The extent of decreased parasite growth in HS(Sp{sup +}) RBCs closely correlated with the extent of RBC spectrin deficiency. Homogeneous subpopulations of dense HS RBCs exhibited decreased parasite growth to the same extent as did HS whole blood. RBCs from four HE subjects showed marked parasite growth and development.

  12. 14-3-3ζ Mediates Tau Aggregation in Human Neuroblastoma M17 Cells.

    PubMed

    Li, Tong; Paudel, Hemant K

    2016-01-01

    Microtubule-associated protein tau is the major component of paired helical filaments (PHFs) associated with the neuropathology of Alzheimer's disease (AD). Tau in the normal brain binds and stabilizes microtubules. Tau isolated from PHFs is hyperphosphorylated, which prevents it from binding to microtubules. Tau phosphorylation has been suggested to be involved in the development of NFT pathology in the AD brain. Recently, we showed that 14-3-3ζ is bound to tau in the PHFs and when incubated in vitro with 14-3-3ζ, tau formed amorphous aggregates, single-stranded straight filaments, double stranded ribbon-like filaments and PHF-like filaments that displayed close resemblance with corresponding ultrastructures of AD brain. Surprisingly however, phosphorylated and non-phosphorylated tau aggregated in a similar manner, indicating that tau phosphorylation does not affect in vitro tau aggregation (Qureshi et al (2013) Biochemistry 52, 6445-6455). In this study, we have examined the role of tau phosphorylation in tau aggregation in cellular level. We have found that in human M17 neuroblastoma cells, tau phosphorylation by GSK3β or PKA does not cause tau aggregation, but promotes 14-3-3ζ-induced tau aggregation by destabilizing microtubules. Microtubule disrupting drugs also promoted 14-3-3ζ-induced tau aggregation without changing tau phosphorylation in M17 cell. In vitro, when incubated with 14-3-3ζ and microtubules, nonphosphorylated tau bound to microtubules and did not aggregate. Phosphorylated tau on the other hand did not bind to microtubules and aggregated. Our data indicate that microtubule-bound tau is resistant to 14-3-3ζ-induced tau aggregation and suggest that tau phosphorylation promotes tau aggregation in the brain by detaching tau from microtubules and thus making it accessible to 14-3-3ζ.

  13. 14-3-3ζ Mediates Tau Aggregation in Human Neuroblastoma M17 Cells

    PubMed Central

    Li, Tong; Paudel, Hemant K.

    2016-01-01

    Microtubule-associated protein tau is the major component of paired helical filaments (PHFs) associated with the neuropathology of Alzheimer’s disease (AD). Tau in the normal brain binds and stabilizes microtubules. Tau isolated from PHFs is hyperphosphorylated, which prevents it from binding to microtubules. Tau phosphorylation has been suggested to be involved in the development of NFT pathology in the AD brain. Recently, we showed that 14-3-3ζ is bound to tau in the PHFs and when incubated in vitro with 14-3-3ζ, tau formed amorphous aggregates, single-stranded straight filaments, double stranded ribbon-like filaments and PHF-like filaments that displayed close resemblance with corresponding ultrastructures of AD brain. Surprisingly however, phosphorylated and non-phosphorylated tau aggregated in a similar manner, indicating that tau phosphorylation does not affect in vitro tau aggregation (Qureshi et al (2013) Biochemistry 52, 6445–6455). In this study, we have examined the role of tau phosphorylation in tau aggregation in cellular level. We have found that in human M17 neuroblastoma cells, tau phosphorylation by GSK3β or PKA does not cause tau aggregation, but promotes 14-3-3ζ-induced tau aggregation by destabilizing microtubules. Microtubule disrupting drugs also promoted 14-3-3ζ-induced tau aggregation without changing tau phosphorylation in M17 cell. In vitro, when incubated with 14-3-3ζ and microtubules, nonphosphorylated tau bound to microtubules and did not aggregate. Phosphorylated tau on the other hand did not bind to microtubules and aggregated. Our data indicate that microtubule-bound tau is resistant to 14-3-3ζ-induced tau aggregation and suggest that tau phosphorylation promotes tau aggregation in the brain by detaching tau from microtubules and thus making it accessible to 14-3-3ζ. PMID:27548710

  14. Total-tau and phospho-tau(181Thr) in cerebrospinal fluid of neurologically intact population increase with age.

    PubMed

    Jaworski, J; Psujek, M; Bartosik-Psujek, H

    2009-01-01

    Tau protein is a microtubule-associated molecule playing a crucial role in maintenance of neuronal integrity and in many neurodegenerative processes; its pathology has become a hallmark feature at the tissue level. The aim of the study was to estimate total tau and phospho-tau (Thr181) concentrations in cerebrospinal fluid of healthy population. Cerebrospinal fluid samples were taken from 129 subjects (age 18-77 years) without known neurologic or psychiatric condition. Both total-tau and phospho-tau levels showed significant correlation with age, which was more pronounced in older population.

  15. Alzheimer-related decrease in CYFIP2 links amyloid production to tau hyperphosphorylation and memory loss

    PubMed Central

    Tiwari, Sachin Suresh; Mizuno, Keiko; Ghosh, Anshua; Aziz, Wajeeha; Troakes, Claire; Daoud, Jason; Golash, Vidushi; Noble, Wendy; Hortobágyi, Tibor

    2016-01-01

    Characteristic features of Alzheimer’s disease are memory loss, plaques resulting from abnormal processing of amyloid precursor protein (APP), and presence of neurofibrillary tangles and dystrophic neurites containing hyperphosphorylated tau. Currently, it is not known what links these abnormalities together. Cytoplasmic FMR1 interacting protein 2 (CYFIP2) has been suggested to regulate mRNA translation at synapses and this may include local synthesis of APP and alpha-calcium/calmodulin-dependent kinase II, a kinase that can phosphorylate tau. Further, CYFIP2 is part of the Wiskott-Aldrich syndrome protein-family verprolin-homologous protein complex, which has been implicated in actin polymerization at synapses, a process thought to be required for memory formation. Our previous studies on p25 dysregulation put forward the hypothesis that CYFIP2 expression is reduced in Alzheimer’s disease and that this contributes to memory impairment, abnormal APP processing and tau hyperphosphorylation. Here, we tested this hypothesis. First, in post-mortem tissue CYFIP2 expression was reduced by ∼50% in severe Alzheimer’s hippocampus and superior temporal gyrus when normalized to expression of a neuronal or synaptic marker protein. Interestingly, there was also a trend for decreased expression in mild Alzheimer’s disease hippocampus. Second, CYFIP2 expression was reduced in old but not in young Tg2576 mice, a model of familial Alzheimer’s disease. Finally, we tested the direct impact of reduced CYFIP2 expression in heterozygous null mutant mice. We found that in hippocampus this reduced expression causes an increase in APP and β-site amyloid precursor protein cleaving enzyme 1 (BACE1) protein, but not mRNA expression, and elevates production of amyloid-β42. Reduced CYFIP2 expression also increases alpha-calcium/calmodulin-dependent kinase II protein expression, and this is associated with hyperphosphorylation of tau at serine-214. The reduced expression also

  16. Curcumin Suppresses Soluble Tau Dimers and Corrects Molecular Chaperone, Synaptic, and Behavioral Deficits in Aged Human Tau Transgenic Mice*

    PubMed Central

    Ma, Qiu-Lan; Zuo, Xiaohong; Yang, Fusheng; Ubeda, Oliver J.; Gant, Dana J.; Alaverdyan, Mher; Teng, Edmond; Hu, Shuxin; Chen, Ping-Ping; Maiti, Panchanan; Teter, Bruce; Cole, Greg M.; Frautschy, Sally A.

    2013-01-01

    The mechanisms underlying Tau-related synaptic and cognitive deficits and the interrelationships between Tau species, their clearance pathways, and synaptic impairments remain poorly understood. To gain insight into these mechanisms, we examined these interrelationships in aged non-mutant genomic human Tau mice, with established Tau pathology and neuron loss. We also examined how these interrelationships changed with an intervention by feeding mice either a control diet or one containing the brain permeable beta-amyloid and Tau aggregate binding molecule curcumin. Transgene-dependent elevations in soluble and insoluble phospho-Tau monomer and soluble Tau dimers accompanied deficits in behavior, hippocampal excitatory synaptic markers, and molecular chaperones (heat shock proteins (HSPs)) involved in Tau degradation and microtubule stability. In human Tau mice but not control mice, HSP70, HSP70/HSP72, and HSP90 were reduced in membrane-enriched fractions but not in cytosolic fractions. The synaptic proteins PSD95 and NR2B were reduced in dendritic fields and redistributed into perikarya, corresponding to changes observed by immunoblot. Curcumin selectively suppressed levels of soluble Tau dimers, but not of insoluble and monomeric phospho-Tau, while correcting behavioral, synaptic, and HSP deficits. Treatment increased PSD95 co-immunoprecipitating with NR2B and, independent of transgene, increased HSPs implicated in Tau clearance. It elevated HSP90 and HSC70 without increasing HSP mRNAs; that is, without induction of the heat shock response. Instead curcumin differentially impacted HSP90 client kinases, reducing Fyn without reducing Akt. In summary, curcumin reduced soluble Tau and elevated HSPs involved in Tau clearance, showing that even after tangles have formed, Tau-dependent behavioral and synaptic deficits can be corrected. PMID:23264626

  17. Chicken antibody against a restrictive epitope of prion protein distinguishes normal and abnormal prion proteins.

    PubMed

    Miyamoto, Kazuyoshi; Kimura, Sota; Nakamura, Naoto; Yokoyama, Takashi; Horiuchi, Hiroyuki; Furusawa, Shuichi; Matsuda, Haruo

    2007-10-01

    Recently, we reported the application of a recombinant chicken IgY monoclonal antibody, Ab3-15, against mammalian prion protein (PrP), for the diagnosis of bovine spongiform encephalopathy in cattle. In this study, we have characterized a soluble, single-chain variable fragment (scFv) form of this antibody, sphAb3-15 using brain homogenates from mice. This sphAb3-15 antibody recognized denatured forms of both PrP(C) and PrP(Sc), and PrP(Sc) after PK-treatment, on Western blotting. In sandwich ELISAs, on dot blots and by immunoprecipitation, sphAb3-15 efficiently bound to PrP from normal brain homogenates, but weakly bound PrP from scrapie-infected brain homogenates. These results suggest that sphAb3-15 selectively recognizes PrP(C) under native conditions and that the epitope recognized by sphAb3-15 may undergo conformational changes during the conversion of PrP(C) into PrP(Sc).

  18. Overexpression of Wild-Type Murine Tau Results in Progressive Tauopathy and Neurodegeneration

    PubMed Central

    Adams, Stephanie J.; Crook, Richard J.P.; DeTure, Michael; Randle, Suzanne J.; Innes, Amy E.; Yu, Xin Z.; Lin, Wen-Lang; Dugger, Brittany N.; McBride, Melinda; Hutton, Mike; Dickson, Dennis W.; McGowan, Eileen

    2009-01-01

    Here, we describe the generation and characterization of a novel tau transgenic mouse model (mTau) that overexpresses wild-type murine tau protein by twofold compared with endogenous levels. Transgenic tau expression was driven by a BAC transgene containing the entire wild-type mouse tau locus, including the endogenous promoter and the regulatory elements associated with the tau gene. The mTau model therefore differs from other tau models in that regulation of the genomic mouse transgene mimics that of the endogenous gene, including normal exon splicing regulation. Biochemical data from the mTau mice demonstrated that modest elevation of mouse tau leads to tau hyperphosphorylation at multiple pathologically relevant epitopes and accumulation of sarkosyl-insoluble tau. The mTau mice show a progressive increase in hyperphosphorylated tau pathology with age up to 15 to 18 months, which is accompanied by gliosis and vacuolization. In contrast, older mice show a decrease in tau pathology levels, which may represent hippocampal neuronal loss occurring in this wild-type model. Collectively, these results describe a novel model of tauopathy that develops pathological changes reminiscent of early stage Alzheimer’s disease and other related neurodegenerative diseases, achieved without overexpression of a mutant human tau transgene. This model will provide an important tool for understanding the early events leading to the development of tau pathology and a model for analysis of potential therapeutic targets for sporadic tauopathies. PMID:19717642

  19. Development of two novel benzoylphenylurea sulfur analogues and evidence that the microtubule-associated protein tau is predictive of their activity in pancreatic cancer.

    PubMed

    Jimeno, Antonio; Hallur, Gurulingappa; Chan, Audrey; Zhang, Xiangfeng; Cusatis, George; Chan, Fonda; Shah, Preeti; Chen, Rongbing; Hamel, Ernest; Garrett-Mayer, Elizabeth; Khan, Saeed; Hidalgo, Manuel

    2007-05-01

    In this work, we evaluated two lead compounds, referred to as SG410 and SG430, obtained from a screen of sulfur benzoylphenylurea analogues, against in vitro and in vivo models of pancreas cancer. Both drugs showed a similar mechanism of action profile, with SG410 being more potent as an inhibitor of tubulin assembly. We determined the best in vivo administration schedule and tested SG410 and SG430 in nine cases of a novel platform of direct pancreas cancer xenografts. Both compounds had antiproliferative activity in vitro in the low nanomolar range, but only SG410 showed significant activity in vivo. Administration of SG410 resulted in significant tumor growth delay in five of nine groups tested. In a direct comparison in three of the cases, SG410 was at least as efficacious as docetaxel. We also sought markers that would be predictive of the efficacy of these agents, and we found such a marker in microtubule-associated protein tau (MAPT). This protein enhances the assembly and stability of microtubules. In both the cell lines and the direct human xenografts, MAPT mRNA and protein levels correlated well. There was also a statistically significant inverse correlation between MAPT expression and sensitivity to the tested agents. In summary, the novel sulfur benzoylphenylurea SG410 showed activity inversely related to MAPT expression in a preclinical model of pancreatic cancer comparable with that observed with docetaxel, another microtubule-targeting agent.

  20. Ironing out Tau's Role in Parkinsonism

    PubMed Central

    Stankowski, Jeannette N.; Dawson, Valina L.; Dawson, Ted M.

    2015-01-01

    Parkinson's disease affects more than five million people worldwide, yet no therapeutic has been identified that can slow or halt the progression of this debilitating disease. A new study in tau knockout mice suggests that tau deficiency causes impaired ferroportin-coupled iron export, by retention of the amyloid precursor protein, a neuronal ferroxidase partner, in the endoplasmic reticulum. This leads to parkinsonism through intracellular iron accumulation and degeneration of dopamine neurons (pages X-Y). PMID:22310680

  1. Tau polarisation at LEP

    NASA Astrophysics Data System (ADS)

    Alemany, Ricard

    1999-04-01

    The measurements of the tau polarisation at LEP I are reviewed. Special emphasis is given to the new preliminary results presented at this conference. The ALEPH collaboration has studied the polarisation as a function of the polar angle using a new method based on the tau direction reconstruction and fully exploiting the angular correlations. A second traditional approach, based on the single tau decays has been also developed. The DELPHI collaboration has also studied the full data sample using an individual tau decay method and an inclusive hadronic selection. The results from the four experiments are presented with discussion of the compatibility among the methods and experiments.

  2. Abnormal expression of FLI1 protein is an adverse prognostic factor in acute myeloid leukemia

    PubMed Central

    Qiu, Yi Hua; Zhang, Nianxiang; Singh, Neera; Faderl, Stefan; Ferrajoli, Alessandra; York, Heather; Qutub, Amina A.; Coombes, Kevin R.; Watson, Dennis K.

    2011-01-01

    Friend leukemia virus integration 1 (FLI1), an Ets transcription factor family member, is linked to acute myelogenous leukemia (AML) by chromosomal events at the FLI1 locus, but the biologic impact of FLI1 expression on AML is unknown. FLI1 protein expression was measured in 511 newly diagnosed AML patients. Expression was similar in peripheral blood (PB) and BM and higher at diagnosis than at relapse (P = .02). Compared with normal CD34+ cells, expression in AML was above or below normal in 32% and 5% of patients, respectively. Levels were negatively correlated with an antecedent hematologic disorder (P = .002) but not with age or cytogenetics. Mutated NPM1 (P = .0007) or FLT3-ITD (P < .02) had higher expression. FLI1 levels were negatively correlated with 10 of 195 proteins associated with proliferation and stromal interaction, and positively correlated (R > 0.3) with 19 others. The FLI1 level was not predictive of remission attainment, but patients with low or high FLI1 expression had shorter remission duration (22.6 and 40.3 vs 51.1 weeks, respectively; P = .01) and overall survival (45.2 and 35.4 vs 59.4 weeks, respectively; P = .03). High FLI1 levels were adverse in univariate and multivariate analysis. FLI1 expression is frequently abnormal and prognostically adverse in AML. FLI1 and/or its response genes may be therapeutically targetable to interfere with AML cell biology. PMID:21917756

  3. Proteolysis of abnormal prion protein with a thermostable protease from Thermococcus kodakarensis KOD1.

    PubMed

    Koga, Yuichi; Tanaka, Shun-ichi; Sakudo, Akikazu; Tobiume, Minoru; Aranishi, Mutsuo; Hirata, Azumi; Takano, Kazufumi; Ikuta, Kazuyoshi; Kanaya, Shigenori

    2014-03-01

    The abnormal prion protein (scrapie-associated prion protein, PrP(Sc)) is considered to be included in the group of infectious agents of transmissible spongiform encephalopathies. Since PrP(Sc) is highly resistant to normal sterilization procedures, the decontamination of PrP(Sc) is a significant public health issue. In the present study, a hyperthermostable protease, Tk-subtilisin, was used to degrade PrP(Sc). Although PrP(Sc) is known to be resistant toward proteolytic enzymes, Tk-subtilisin was able to degrade PrP(Sc) under extreme conditions. The level of PrP(Sc) in brain homogenates was found to decrease significantly in vitro following Tk-subtilisin treatment at 100 °C, whereas some protease-resistant fractions remain after proteinase K treatment. Rather small amounts of Tk-subtilisin (0.3 U) were required to degrade PrP(Sc) at 100 °C and pH 8.0. In addition, Tk-subtilisin was observed to degrade PrP(Sc) in the presence of sodium dodecyl sulfate or other industrial surfactants. Although several proteases degrading PrP(Sc) have been reported, practical decontamination procedures using enzymes are not available. This report aims to provide basic information for the practical use of a proteolytic enzyme for PrP(Sc) degradation.

  4. ATP6AP1 deficiency causes an immunodeficiency with hepatopathy, cognitive impairment and abnormal protein glycosylation

    PubMed Central

    Jansen, Eric J. R.; Timal, Sharita; Ryan, Margret; Ashikov, Angel; van Scherpenzeel, Monique; Graham, Laurie A.; Mandel, Hanna; Hoischen, Alexander; Iancu, Theodore C.; Raymond, Kimiyo; Steenbergen, Gerry; Gilissen, Christian; Huijben, Karin; van Bakel, Nick H. M.; Maeda, Yusuke; Rodenburg, Richard J.; Adamowicz, Maciej; Crushell, Ellen; Koenen, Hans; Adams, Darius; Vodopiutz, Julia; Greber-Platzer, Susanne; Müller, Thomas; Dueckers, Gregor; Morava, Eva; Sykut-Cegielska, Jolanta; Martens, Gerard J. M.; Wevers, Ron A.; Niehues, Tim; Huynen, Martijn A.; Veltman, Joris A.; Stevens, Tom H.; Lefeber, Dirk J.

    2016-01-01

    The V-ATPase is the main regulator of intra-organellar acidification. Assembly of this complex has extensively been studied in yeast, while limited knowledge exists for man. We identified 11 male patients with hemizygous missense mutations in ATP6AP1, encoding accessory protein Ac45 of the V-ATPase. Homology detection at the level of sequence profiles indicated Ac45 as the long-sought human homologue of yeast V-ATPase assembly factor Voa1. Processed wild-type Ac45, but not its disease mutants, restored V-ATPase-dependent growth in Voa1 mutant yeast. Patients display an immunodeficiency phenotype associated with hypogammaglobulinemia, hepatopathy and a spectrum of neurocognitive abnormalities. Ac45 in human brain is present as the common, processed ∼40-kDa form, while liver shows a 62-kDa intact protein, and B-cells a 50-kDa isoform. Our work unmasks Ac45 as the functional ortholog of yeast V-ATPase assembly factor Voa1 and reveals a novel link of tissue-specific V-ATPase assembly with immunoglobulin production and cognitive function. PMID:27231034

  5. Prognostic value of serum tumor abnormal protein in gastric cancer patients

    PubMed Central

    LAN, FENG; ZHU, MING; QI, QIUFENG; ZHANG, YAPING; LIU, YONGPING

    2016-01-01

    Aberrant glycosylation of protein occurs in nearly all types of cancers and has been confirmed to be associated with tumor progression, metastasis and the survival rate of patients. The present study aimed to explore the prognostic value of tumor abnormal protein (TAP) in gastric cancer patients. TAP was detected in the blood of 42 gastric cancer patients and 56 healthy volunteers by using the TAP testing kit. Univariate and multivariate Cox regression analysis were performed to evaluate the prognostic value of TAP. In total, 64.3% of gastric cancer patients were positive for TAP, and TAP was significantly correlated with poor prognosis [progression-free survival (PFS), 4.2 vs. 12.6 months; P=0.043]. TAP [hazard ratio (HR), 64.487; P<0.01), differentiation (HR, 17.279; P<0.01) and TNM stage (HR, 45.480; P<0.01) were found to be independent predictive factors for PFS. Furthermore, Kaplan-Meier curves indicated that TAP is associated with a reduced PFS in gastric cancer patients. The results of the present study therefore indicated that the TAP test has significant prognostic value for gastric cancer patients. PMID:27330802

  6. ATP6AP1 deficiency causes an immunodeficiency with hepatopathy, cognitive impairment and abnormal protein glycosylation.

    PubMed

    Jansen, Eric J R; Timal, Sharita; Ryan, Margret; Ashikov, Angel; van Scherpenzeel, Monique; Graham, Laurie A; Mandel, Hanna; Hoischen, Alexander; Iancu, Theodore C; Raymond, Kimiyo; Steenbergen, Gerry; Gilissen, Christian; Huijben, Karin; van Bakel, Nick H M; Maeda, Yusuke; Rodenburg, Richard J; Adamowicz, Maciej; Crushell, Ellen; Koenen, Hans; Adams, Darius; Vodopiutz, Julia; Greber-Platzer, Susanne; Müller, Thomas; Dueckers, Gregor; Morava, Eva; Sykut-Cegielska, Jolanta; Martens, Gerard J M; Wevers, Ron A; Niehues, Tim; Huynen, Martijn A; Veltman, Joris A; Stevens, Tom H; Lefeber, Dirk J

    2016-05-27

    The V-ATPase is the main regulator of intra-organellar acidification. Assembly of this complex has extensively been studied in yeast, while limited knowledge exists for man. We identified 11 male patients with hemizygous missense mutations in ATP6AP1, encoding accessory protein Ac45 of the V-ATPase. Homology detection at the level of sequence profiles indicated Ac45 as the long-sought human homologue of yeast V-ATPase assembly factor Voa1. Processed wild-type Ac45, but not its disease mutants, restored V-ATPase-dependent growth in Voa1 mutant yeast. Patients display an immunodeficiency phenotype associated with hypogammaglobulinemia, hepatopathy and a spectrum of neurocognitive abnormalities. Ac45 in human brain is present as the common, processed ∼40-kDa form, while liver shows a 62-kDa intact protein, and B-cells a 50-kDa isoform. Our work unmasks Ac45 as the functional ortholog of yeast V-ATPase assembly factor Voa1 and reveals a novel link of tissue-specific V-ATPase assembly with immunoglobulin production and cognitive function.

  7. Abnormal expression of FLI1 protein is an adverse prognostic factor in acute myeloid leukemia.

    PubMed

    Kornblau, Steven M; Qiu, Yi Hua; Zhang, Nianxiang; Singh, Neera; Faderl, Stefan; Ferrajoli, Alessandra; York, Heather; Qutub, Amina A; Coombes, Kevin R; Watson, Dennis K

    2011-11-17

    Friend leukemia virus integration 1 (FLI1), an Ets transcription factor family member, is linked to acute myelogenous leukemia (AML) by chromosomal events at the FLI1 locus, but the biologic impact of FLI1 expression on AML is unknown. FLI1 protein expression was measured in 511 newly diagnosed AML patients. Expression was similar in peripheral blood (PB) and BM and higher at diagnosis than at relapse (P = .02). Compared with normal CD34(+) cells, expression in AML was above or below normal in 32% and 5% of patients, respectively. Levels were negatively correlated with an antecedent hematologic disorder (P = .002) but not with age or cytogenetics. Mutated NPM1 (P = .0007) or FLT3-ITD (P < .02) had higher expression. FLI1 levels were negatively correlated with 10 of 195 proteins associated with proliferation and stromal interaction, and positively correlated (R > 0.3) with 19 others. The FLI1 level was not predictive of remission attainment, but patients with low or high FLI1 expression had shorter remission duration (22.6 and 40.3 vs 51.1 weeks, respectively; P = .01) and overall survival (45.2 and 35.4 vs 59.4 weeks, respectively; P = .03). High FLI1 levels were adverse in univariate and multivariate analysis. FLI1 expression is frequently abnormal and prognostically adverse in AML. FLI1 and/or its response genes may be therapeutically targetable to interfere with AML cell biology.

  8. Regulatable transgenic mouse models of Alzheimer disease: onset, reversibility and spreading of Tau pathology.

    PubMed

    Hochgräfe, Katja; Sydow, Astrid; Mandelkow, Eva-Maria

    2013-09-01

    Accumulation of amyloidogenic proteins such as Tau is a hallmark of neurodegenerative diseases including Alzheimer disease and fronto-temporal dementias. To link Tau pathology to cognitive impairments and defects in synaptic plasticity, we created four inducible Tau transgenic mouse models with expression of pro- and anti-aggregant variants of either full-length human Tau (hTau40/ΔK280 and hTau40/ΔK280/PP) or the truncated Tau repeat domain (Tau(RD)/ΔK280 and Tau(RD)/ΔK280/PP). Here we review the histopathological features caused by pro-aggregant Tau, and correlate them with behavioral deficits and impairments in synaptic transmission. Both pro-aggregant Tau variants cause Alzheimer-like features, including synapse loss, mis-localization of Tau into the somatodendritic compartment, conformational changes and hyperphosphorylation. However, there is a clear difference in the extent of Tau aggregation and neurotoxicity. While pro-aggregant full-length hTau40/ΔK280 leads to a 'pre-tangle' pathology, the repeat domain Tau(RD)/ΔK280 causes massive formation of neurofibrillary tangles and neuronal loss in the hippocampus. However, both Tau variants cause co-aggregation of human and mouse Tau and similar functional impairments. Thus, earlier Tau pathological stages and not necessarily neurofibrillary tangles are critical for the development of cognitive malfunctions. Most importantly, memory and synapses recover after switching off expression of pro-aggregant Tau. The rescue of functional impairments correlates with the rescue of most Tau pathological changes and most strikingly the recovery of synapses. This implies that tauopathies as such are reversible, provided that amyloidogenic Tau is removed. Therefore, our Tau transgenic mice may serve as model systems for in vivo validation of therapeutic strategies and drug candidates with regard to cognition and synaptic function.

  9. Activation of asparaginyl endopeptidase leads to Tau hyperphosphorylation in Alzheimer disease.

    PubMed

    Basurto-Islas, Gustavo; Grundke-Iqbal, Inge; Tung, Yunn Chyn; Liu, Fei; Iqbal, Khalid

    2013-06-14

    Neurofibrillary pathology of abnormally hyperphosphorylated Tau is a key lesion of Alzheimer disease and other tauopathies, and its density in the brain directly correlates with dementia. The phosphorylation of Tau is regulated by protein phosphatase 2A, which in turn is regulated by inhibitor 2, I2(PP2A). In acidic conditions such as generated by brain ischemia and hypoxia, especially in association with hyperglycemia as in diabetes, I2(PP2A) is cleaved by asparaginyl endopeptidase at Asn-175 into the N-terminal fragment (I2NTF) and the C-terminal fragment (I2CTF). Both I2NTF and I2CTF are known to bind to the catalytic subunit of protein phosphatase 2A and inhibit its activity. Here we show that the level of activated asparaginyl endopeptidase is significantly increased, and this enzyme and I2(PP2A) translocate, respectively, from neuronal lysosomes and nucleus to the cytoplasm where they interact and are associated with hyperphosphorylated Tau in Alzheimer disease brain. Asparaginyl endopeptidase from Alzheimer disease brain could cleave GST-I2(PP2A), except when I2(PP2A) was mutated at the cleavage site Asn-175 to Gln. Finally, an induction of acidosis by treatment with kainic acid or pH 6.0 medium activated asparaginyl endopeptidase and consequently produced the cleavage of I2(PP2A), inhibition of protein phosphatase 2A, and hyperphosphorylation of Tau, and the knockdown of asparaginyl endopeptidase with siRNA abolished this pathway in SH-SY5Y cells. These findings suggest the involvement of brain acidosis in the etiopathogenesis of Alzheimer disease, and asparaginyl endopeptidase-I2(PP2A)-protein phosphatase 2A-Tau hyperphosphorylation pathway as a therapeutic target.

  10. Measurement of the tau lifetime

    SciTech Connect

    Jaros, J.A.

    1982-10-01

    If the tau lepton couples to the charged weak current with universal strength, its lifetime can be expressed in terms of the muon's lifetime, the ratio of the masses of the muon and the tau, and the tau's branching ratio into e anti nu/sub e/ nu/sub tau/ as tau/sub tau/ = tau/sub ..mu../ (m/sub ..mu..//m/sub tau/)/sup 5/ B(tau ..-->.. e anti nu/sub e/nu/sub tau/) = 2.8 +- 0.2 x 10/sup -13/ s. This paper describes the measurement of the tau lifetime made by the Mark II collaboration, using a new high precision drift chamber in contunction with the Mark II detector at PEP. The results of other tau lifetime measurements are summarized.

  11. Antibody uptake into neurons occurs primarily via clathrin-dependent Fcγ receptor endocytosis and is a prerequisite for acute tau protein clearance.

    PubMed

    Congdon, Erin E; Gu, Jiaping; Sait, Hameetha B R; Sigurdsson, Einar M

    2013-12-06

    Tau immunotherapy is effective in transgenic mice, but the mechanisms of Tau clearance are not well known. To this end, Tau antibody uptake was analyzed in brain slice cultures and primary neurons. Internalization was rapid (<1 h), saturable, and substantial compared with control mouse IgG. Furthermore, temperature reduction to 4 °C, an excess of unlabeled mouse IgG, or an excess of Tau antibodies reduced uptake in slices by 63, 41, and 62%, respectively (p = 0.002, 0.04, and 0.005). Uptake strongly correlated with total and insoluble Tau levels (r(2) = 0.77 and 0.87 and p = 0.002 and 0.0002), suggesting that Tau aggregates influence antibody internalization and/or retention within neurons. Inhibiting phagocytosis did not reduce uptake in slices or neuronal cultures, indicating limited microglial involvement. In contrast, clathrin-specific inhibitors reduced uptake in neurons (≤ 78%, p < 0.0001) and slices (≤ 35%, p = 0.03), demonstrating receptor-mediated endocytosis as the primary uptake pathway. Fluid phase endocytosis accounted for the remainder of antibody uptake in primary neurons, based on co-staining with internalized dextran. The receptor-mediated uptake is to a large extent via low affinity FcγII/III receptors and can be blocked in slices (43%, p = 0.04) and neurons (53%, p = 0.008) with an antibody against these receptors. Importantly, antibody internalization appears to be necessary for Tau reduction in primary neurons. Overall, these findings clarify that Tau antibody uptake is primarily receptor-mediated, that these antibodies are mainly found in neurons with Tau aggregates, and that their intracellular interaction leads to clearance of Tau pathology, all of which have major implications for therapeutic development of this approach.

  12. NMDA receptor dysfunction contributes to impaired brain-derived neurotrophic factor-induced facilitation of hippocampal synaptic transmission in a Tau transgenic model.

    PubMed

    Burnouf, Sylvie; Martire, Alberto; Derisbourg, Maxime; Laurent, Cyril; Belarbi, Karim; Leboucher, Antoine; Fernandez-Gomez, Francisco J; Troquier, Laetitia; Eddarkaoui, Sabiha; Grosjean, Marie-Eve; Demeyer, Dominique; Muhr-Tailleux, Anne; Buisson, Alain; Sergeant, Nicolas; Hamdane, Malika; Humez, Sandrine; Popoli, Patrizia; Buée, Luc; Blum, David

    2013-02-01

    While the spatiotemporal development of Tau pathology has been correlated with occurrence of cognitive deficits in Alzheimer's patients, mechanisms underlying these deficits remain unclear. Both brain-derived neurotrophic factor (BDNF) and its tyrosine kinase receptor TrkB play a critical role in hippocampus-dependent synaptic plasticity and memory. When applied on hippocampal slices, BDNF is able to enhance AMPA receptor-dependent hippocampal basal synaptic transmission through a mechanism involving TrkB and N-methyl-d-Aspartate receptors (NMDAR). Using THY-Tau22 transgenic mice, we demonstrated that hippocampal Tau pathology is associated with loss of synaptic enhancement normally induced by exogenous BDNF. This defective response was concomitant to significant memory impairments. We show here that loss of BDNF response was due to impaired NMDAR function. Indeed, we observed a significant reduction of NMDA-induced field excitatory postsynaptic potential depression in the hippocampus of Tau mice together with a reduced phosphorylation of NR2B at the Y1472, known to be critical for NMDAR function. Interestingly, we found that both NR2B and Src, one of the NR2B main kinases, interact with Tau and are mislocalized to the insoluble protein fraction rich in pathological Tau species. Defective response to BDNF was thus likely related to abnormal interaction of Src and NR2B with Tau in THY-Tau22 animals. These are the first data demonstrating a relationship between Tau pathology and synaptic effects of BDNF and supporting a contribution of defective BDNF response and impaired NMDAR function to the cognitive deficits associated with Tauopathies.

  13. Tau-Driven Neuronal and Neurotrophic Dysfunction in a Mouse Model of Early Tauopathy

    PubMed Central

    Mazzaro, Nadia; Barini, Erica; Spillantini, Maria Grazia; Goedert, Michel; Medini, Paolo

    2016-01-01

    Tauopathies are neurodegenerative diseases characterized by intraneuronal inclusions of hyperphosphorylated tau protein and abnormal expression of brain-derived neurotrophic factor (BDNF), a key modulator of neuronal survival and function. The severity of both these pathological hallmarks correlate with the degree of cognitive impairment in patients. However, how tau pathology specifically modifies BDNF signaling and affects neuronal function during early prodromal stages of tauopathy remains unclear. Here, we report that the mild tauopathy developing in retinal ganglion cells (RGCs) of the P301S tau transgenic (P301S) mouse induces functional retinal changes by disrupting BDNF signaling via the TrkB receptor. In adult P301S mice, the physiological visual response of RGCs to pattern light stimuli and retinal acuity decline significantly. As a consequence, the activity-dependent secretion of BDNF in the vitreous is impaired in P301S mice. Further, in P301S retinas, TrkB receptors are selectively upregulated, but uncoupled from downstream extracellular signal-regulated kinase (ERK) 1/2 signaling. We also show that the impairment of TrkB signaling is triggered by tau pathology and mediates the tau-induced dysfunction of visual response. Overall our results identify a neurotrophin-mediated mechanism by which tau induces neuronal dysfunction during prodromal stages of tauopathy and define tau-driven pathophysiological changes of potential value to support early diagnosis and informed therapeutic decisions. SIGNIFICANCE STATEMENT This work highlights the potential molecular mechanisms by which initial tauopathy induces neuronal dysfunction. Combining clinically used electrophysiological techniques (i.e., electroretinography) and molecular analyses, this work shows that in a relevant model of early tauopathy, the retina of the P301S mutant human tau transgenic mouse, mild tau pathology results in functional changes of neuronal activity, likely due to selective impairment

  14. Presynaptic C-terminal truncated tau is released from cortical synapses in Alzheimer's disease

    PubMed Central

    Sokolow, Sophie; Henkins, Kristen M.; Bilousova, Tina; Gonzalez, Bianca; Vinters, Harry V.; Miller, Carol A.; Cornwell, Lindsey; Poon, Wayne W.; Gylys, Karen H.

    2015-01-01

    The microtubule-associated protein tau has primarily been associated with axonal location and function; however, recent work shows tau release from neurons and suggests an important role for tau in synaptic plasticity. In our study, we measured synaptic levels of total tau using synaptosomes prepared from cryopreserved human postmortem Alzheimer's disease (AD) and control samples. Flow cytometry data show that a majority of synaptic terminals are highly immunolabeled with the total tau antibody (HT7) in both AD and control samples. Immunoblots of synaptosomal fractions reveal increases in a 20 kDa tau fragment and in tau dimers in AD synapses, and terminal-specific antibodies show that in many synaptosome samples tau lacks a C-terminus. Flow cytometry experiments to quantify the extent of C-terminal truncation reveal that only 15-25% of synaptosomes are positive for intact C-terminal tau. Potassium-induced depolarization demonstrates release of tau and tau fragments from presynaptic terminals, with increased release from AD compared to control samples. This study indicates that tau is normally highly localized to synaptic terminals in cortex where it is well-positioned to affect synaptic plasticity. Tau cleavage may facilitate tau aggregation as well as tau secretion and propagation of tau pathology from the presynaptic compartment in AD. PMID:25393609

  15. Taxol-stabilized microtubules promote the formation of filaments from unmodified full-length Tau in vitro.

    PubMed

    Duan, Aranda R; Goodson, Holly V

    2012-12-01

    Tau is a neuronal protein that stabilizes the microtubule (MT) network, but it also forms filaments associated with Alzheimer's disease. Understanding Tau-MT and Tau-Tau interactions would help to establish Tau function in health and disease. For many years, literature reports on Tau-MT binding behavior and affinity have remained surprisingly contradictory (e.g., 10-fold variation in Tau-MT affinity). Tau-Tau interactions have also been investigated, but whether MTs might affect Tau filament formation is unknown. We have addressed these issues through binding assays and microscopy. We assessed Tau-MT interactions via cosedimentation and found that the measured affinity of Tau varies greatly, depending on the experimental design and the protein concentrations used. To investigate this dependence, we used fluorescence microscopy to examine Tau-MT binding. Strikingly, we found that Taxol-stabilized MTs promote Tau filament formation without characterized Tau-filament inducers. We propose that these novel Tau filaments account for the incongruence in Tau-MT affinity measurements. Moreover, electron microscopy reveals that these filaments appear similar to the heparin-induced Alzheimer's model. These observations suggest that the MT-induced Tau filaments provide a new model for Alzheimer's studies and that MTs might play a role in the formation of Alzheimer's-associated neurofibrillary tangles.

  16. Distribution of abnormal prion protein in a sheep affected with L-type bovine spongiform encephalopathy.

    PubMed

    Matsuura, Y; Iwamaru, Y; Masujin, K; Imamura, M; Mohri, S; Yokoyama, T; Okada, H

    2013-07-01

    To investigate the topographical distribution and patterns of deposition of immunolabelled abnormal prion protein (PrP(Sc)), interspecies transmission of atypical L-type bovine spongiform encephalopathy (BSE) to Cheviot ewes (ARQ/ARQ genotype) was performed. L-type BSE was successfully transmitted via the intracerebral route to a ewe, with an incubation period of 1,562 days. Minimal vacuolar change was detected in the basal ganglia, thalamus and brainstem, and PrP(Sc) accumulated throughout the brain. The L-type BSE-affected sheep was characterized by conspicuous fine particulate deposits in the neuropil, particulate and/or granular intraneuronal and intraglial deposits, and the absence of PrP(Sc) plaques or stellate deposits. In addition, immunohistochemical and western blot analyses revealed that PrP(Sc) accumulation was present in peripheral nervous tissues (including the trigeminal ganglia and dorsal root ganglion) and adrenal glands, but was absent in lymphoid tissues. These results suggest that L-type BSE has distinct and distinguishable characteristics as well as PrP(Sc) tissue tropism in sheep.

  17. Evidence for degradation of abnormal prion protein in tissues from sheep with scrapie during composting

    PubMed Central

    Huang, Hongsheng; Spencer, J. Lloyd; Soutyrine, Andrei; Guan, Jeiwen; Rendulich, Jasmine; Balachandran, Aru

    2007-01-01

    This study investigated whether the abnormal prion protein (PrPSc) in tissues from sheep with scrapie would be destroyed by composting. Tissues from sheep naturally infected with scrapie were placed within fiberglass mesh bags and buried in compost piles for 108 d in experiment 1 or 148 d in experiment 2. The temperature in the compost piles rose quickly; it was above 60°C for about 2 wk and then slowly declined to the ambient temperature. Before composting, PrPSc was detected in all the tissues by Western blotting. In experiment 1, PrPSc was not detected after composting in the tissue remnants or the surrounding sawdust. In experiment 2, 1 of 5 specimens tested negative after composting, whereas PrPSc was detected in the other 4 bags, though in reduced amounts compared with those before composting. Tissue weights were reduced during composting. Analysis of the tissue remnants for microbial 16S ribosomal DNA demonstrated that there were more diverse microbes involved in experiment 1 than in experiment 2 and that the guanine and cytosine content of the microbial 16S DNA was higher in the specimens of experiment 1 than in those of experiment 2, which suggests greater dominance of thermophilic microbes in experiment 1. These results indicate that composting may have value as a means for degrading PrPSc in carcasses and other wastes. PMID:17193880

  18. Methylene blue upregulates Nrf2/ARE genes and prevents tau-related neurotoxicity

    PubMed Central

    Stack, Cliona; Jainuddin, Shari; Elipenahli, Ceyhan; Gerges, Meri; Starkova, Natalia; Starkov, Anatoly A.; Jové, Mariona; Portero-Otin, Manuel; Launay, Nathalie; Pujol, Aurora; Kaidery, Navneet Ammal; Thomas, Bobby; Tampellini, Davide; Beal, M. Flint; Dumont, Magali

    2014-01-01

    Methylene blue (MB, methylthioninium chloride) is a phenothiazine that crosses the blood brain barrier and acts as a redox cycler. Among its beneficial properties are its abilities to act as an antioxidant, to reduce tau protein aggregation and to improve energy metabolism. These actions are of particular interest for the treatment of neurodegenerative diseases with tau protein aggregates known as tauopathies. The present study examined the effects of MB in the P301S mouse model of tauopathy. Both 4 mg/kg MB (low dose) and 40 mg/kg MB (high dose) were administered in the diet ad libitum from 1 to 10 months of age. We assessed behavior, tau pathology, oxidative damage, inflammation and numbers of mitochondria. MB improved the behavioral abnormalities and reduced tau pathology, inflammation and oxidative damage in the P301S mice. These beneficial effects were associated with increased expression of genes regulated by NF-E2-related factor 2 (Nrf2)/antioxidant response element (ARE), which play an important role in antioxidant defenses, preventing protein aggregation, and reducing inflammation. The activation of Nrf2/ARE genes is neuroprotective in other transgenic mouse models of neurodegenerative diseases and it appears to be an important mediator of the neuroprotective effects of MB in P301S mice. Moreover, we used Nrf2 knock out fibroblasts to show that the upregulation of Nrf2/ARE genes by MB is Nrf2 dependent and not due to secondary effects of the compound. These findings provide further evidence that MB has important neuroprotective effects that may be beneficial in the treatment of human neurodegenerative diseases with tau pathology. PMID:24556215

  19. Abnormal recruitment of extracellular matrix proteins by excess Notch3 ECD: a new pathomechanism in CADASIL.

    PubMed

    Monet-Leprêtre, Marie; Haddad, Iman; Baron-Menguy, Céline; Fouillot-Panchal, Maï; Riani, Meriem; Domenga-Denier, Valérie; Dussaule, Claire; Cognat, Emmanuel; Vinh, Joelle; Joutel, Anne

    2013-06-01

    -linked and soluble TIMP3 species. Moreover, reverse zymography assays show a significant elevation of TIMP3 activity in the brain vessels from mice and patients with CADASIL. Collectively, our findings lend support to a Notch3(ECD) cascade hypothesis in CADASIL disease pathology, which posits that aggregation/accumulation of Notch3(ECD) in the brain vessels is a central event, promoting the abnormal recruitment of functionally important extracellular matrix proteins that may ultimately cause multifactorial toxicity. Specifically, our results suggest a dysregulation of TIMP3 activity, which could contribute to mutant Notch3(ECD) toxicity by impairing extracellular matrix homeostasis in small vessels.

  20. MTHFSD and DDX58 are novel RNA-binding proteins abnormally regulated in amyotrophic lateral sclerosis.

    PubMed

    MacNair, Laura; Xiao, Shangxi; Miletic, Denise; Ghani, Mahdi; Julien, Jean-Pierre; Keith, Julia; Zinman, Lorne; Rogaeva, Ekaterina; Robertson, Janice

    2016-01-01

    Tar DNA-binding protein 43 (TDP-43) is an RNA-binding protein normally localized to the nucleus of cells, where it elicits functions related to RNA metabolism such as transcriptional regulation and alternative splicing. In amyotrophic lateral sclerosis, TDP-43 is mislocalized from the nucleus to the cytoplasm of diseased motor neurons, forming ubiquitinated inclusions. Although mutations in the gene encoding TDP-43, TARDBP, are found in amyotrophic lateral sclerosis, these are rare. However, TDP-43 pathology is common to over 95% of amyotrophic lateral sclerosis cases, suggesting that abnormalities of TDP-43 play an active role in disease pathogenesis. It is our hypothesis that a loss of TDP-43 from the nucleus of affected motor neurons in amyotrophic lateral sclerosis will lead to changes in RNA processing and expression. Identifying these changes could uncover molecular pathways that underpin motor neuron degeneration. Here we have used translating ribosome affinity purification coupled with microarray analysis to identify the mRNAs being actively translated in motor neurons of mutant TDP-43(A315T) mice compared to age-matched non-transgenic littermates. No significant changes were found at 5 months (presymptomatic) of age, but at 10 months (symptomatic) the translational profile revealed significant changes in genes involved in RNA metabolic process, immune response and cell cycle regulation. Of 28 differentially expressed genes, seven had a ≥ 2-fold change; four were validated by immunofluorescence labelling of motor neurons in TDP-43(A315T) mice, and two of these were confirmed by immunohistochemistry in amyotrophic lateral sclerosis cases. Both of these identified genes, DDX58 and MTHFSD, are RNA-binding proteins, and we show that TDP-43 binds to their respective mRNAs and we identify MTHFSD as a novel component of stress granules. This discovery-based approach has for the first time revealed translational changes in motor neurons of a TDP-43 mouse model

  1. Subcutaneous administration of liraglutide ameliorates learning and memory impairment by modulating tau hyperphosphorylation via the glycogen synthase kinase-3β pathway in an amyloid β protein induced alzheimer disease mouse model.

    PubMed

    Qi, Liqin; Ke, Linfang; Liu, Xiaohong; Liao, Lianming; Ke, Sujie; Liu, Xiaoying; Wang, Yanping; Lin, Xiaowei; Zhou, Yu; Wu, Lijuan; Chen, Zhou; Liu, Libin

    2016-07-15

    Type 2 diabetes mellitus is a risk factor for Alzheimer's disease (AD). The glucagon-like peptide-1 analog liraglutide, a novel long-lasting incretin hormone, has been used to treat type 2 diabetes mellitus. In addition, liraglutide has been shown to be neurotrophic and neuroprotective. Here, we investigated the effects of liraglutide on amyloid β protein (Aβ)-induced AD in mice and explored its mechanism of action. The results showed that subcutaneous administration of liraglutide (25nmol/day), once daily for 8 weeks, prevented memory impairments in the Y Maze and Morris Water Maze following Aβ1-42 intracerebroventricular injection, and alleviated the ultra-structural changes of pyramidal neurons and chemical synapses in the hippocampal CA1 region. Furthermore, liraglutide reduced Aβ1-42-induced tau phosphorylation via the protein kinase B and glycogen synthase kinase-3β pathways. Thus liraglutide may alleviate cognitive impairment in AD by at least decreasing the phosphorylation of tau.

  2. Human microtubule-associated protein tau mediates targeted killing of CD30(+) lymphoma cells in vitro and inhibits tumour growth in vivo.

    PubMed

    Hristodorov, Dmitrij; Nordlohne, Johannes; Mladenov, Radoslav; Huhn, Michael; Fischer, Rainer; Thepen, Theo; Barth, Stefan

    2014-01-01

    Hodgkin lymphoma (HL) and systemic anaplastic large cell lymphoma (sALCL) are rare lymphoproliferative cancer types. Although most HL patients can be cured by chemo- and radio-therapy, 4-50% of patients relapse and have a poor prognosis. The need for improved therapeutic options for patients with relapsed or refractory disease has been addressed by CD30-specific antibody-based immunotherapeutics. However, available CD30-specific monoclonal antibodies (mAbs), antibody drug conjugates (ADCs) or chimeric immunotoxins suffer from the requirement of a functional host immunity, undesirable immune reactions or heterogeneity and instability, respectively. Here, we present a new fusion protein comprised of the CD30-specific antibody single-chain fragment Ki4(scFv) and the human pro-apoptotic effector protein, microtubule-associated protein tau (MAPT). Ki4(scFv)-MAP selectively induced apoptosis in rapidly proliferating L540cy, L428, and Karpas 299 cells in a dose-dependent manner. Tubulin polymerization assays confirmed that Ki4(scFv)-MAP stabilizes microtubules, suggesting a mechanism for its pro-apoptotic action. Dose-finding experiments proved that Ki4(scFv)-MAP is well tolerated in mice compared to the previously reported Ki4(scFv)-ETA'. Ki4(scFv)-MAP significantly inhibited growth of subcutaneous L540cy xenograft tumours in mice. Our data present a novel approach for the treatment of CD30(+) lymphomas, combining the binding specificity of a target-specific antibody fragment with the selective cytotoxicity of MAPT towards proliferating lymphoma cells.

  3. PICALM modulates autophagy activity and tau accumulation

    PubMed Central

    Moreau, Kevin; Fleming, Angeleen; Imarisio, Sara; Lopez Ramirez, Ana; Mercer, Jacob L.; Jimenez-Sanchez, Maria; Bento, Carla F.; Puri, Claudia; Zavodszky, Eszter; Siddiqi, Farah; Lavau, Catherine P.; Betton, Maureen; O’Kane, Cahir J.; Wechsler, Daniel S.; Rubinsztein, David C.

    2014-01-01

    Genome-wide association studies have identified several loci associated with Alzheimer’s disease (AD), including proteins involved in endocytic trafficking such as PICALM/CALM (phosphatidylinositol binding clathrin assembly protein). It is unclear how these loci may contribute to AD pathology. Here we show that CALM modulates autophagy and alters clearance of tau, a protein which is a known autophagy substrate and which is causatively linked to AD, both in vitro and in vivo. Furthermore, altered CALM expression exacerbates tau-mediated toxicity in zebrafish transgenic models. CALM influences autophagy by regulating the endocytosis of SNAREs, such as VAMP2, VAMP3 and VAMP8, which have diverse effects on different stages of the autophagy pathway, from autophagosome formation to autophagosome degradation. This study suggests that the AD genetic risk factor CALM modulates autophagy, and this may affect disease in a number of ways including modulation of tau turnover. PMID:25241929

  4. Monitoring of Intracellular Tau Aggregation Regulated by OGA/OGT Inhibitors.

    PubMed

    Lim, Sungsu; Haque, Md Mamunul; Nam, Ghilsoo; Ryoo, Nayeon; Rhim, Hyewhon; Kim, Yun Kyung

    2015-08-26

    Abnormal phosphorylation of tau has been considered as a key pathogenic mechanism inducing tau aggregation in multiple neurodegenerative disorders, collectively called tauopathies. Recent evidence showed that tau phosphorylation sites are protected with O-linked β-N-acetylglucosamine (O-GlcNAc) in normal brain. In pathological condition, tau is de-glycosylated and becomes a substrate for kinases. Despite the importance of O-GlcNAcylation in tau pathology, O-GlcNAc transferase (OGT), and an enzyme catalyzing O-GlcNAc to tau, has not been carefully investigated in the context of tau aggregation. Here, we investigated intracellular tau aggregation regulated by BZX2, an inhibitor of OGT. Upon the inhibition of OGT, tau phosphorylation increased 2.0-fold at Ser199 and 1.5-fold at Ser396, resulting in increased tau aggregation. Moreover, the BZX2 induced tau aggregation was efficiently reduced by the treatment of Thiamet G, an inhibitor of O-GlcNAcase (OGA). Our results demonstrated the protective role of OGT in tau aggregation and also suggest the counter-regulatory mechanism of OGA and OGT in tau pathology.

  5. Absence of a Role for Phosphorylation in the Tau Pathology of Alzheimer’s Disease

    PubMed Central

    Lai, Robert Y. K.; Harrington, Charles R.; Wischik, Claude M.

    2016-01-01

    Alzheimer’s disease is characterized by redistribution of the tau protein pool from soluble to aggregated states. Aggregation forms proteolytically stable core polymers restricted to the repeat domain, and this binding interaction has prion-like properties. We have compared the binding properties of tau and tubulin in vitro using a system in which we can measure binding affinities for proteins alternated between solid and aqueous phases. The study reveals that a phase-shifted repeat domain fragment from the Paired Helical Filament core contains all that is required for high affinity tau-tau binding. Unlike tau-tubulin binding, tau-tau binding shows concentration-dependent enhancement in both phase directions due to an avidity effect which permits one molecule to bind to many as the concentration in the opposite phase increases. Phosphorylation of tau inhibits tau-tau binding and tau-tubulin binding to equivalent extents. Tau-tau binding is favoured over tau-tubulin binding by factors in the range 19–41-fold, irrespective of phosphorylation status. A critical requirement for tau to become aggregation-competent is prior binding to a solid-phase substrate, which induces a conformational change in the repeat domain permitting high-affinity binding to occur even if tau is phosphorylated. The endogenous species enabling this nucleation event to occur in vivo remains to be identified. The findings of the study suggest that development of disease-modifying drugs for tauopathies should not target phosphorylation, but rather should target inhibitors of tau-tau binding or inhibitors of the binding interaction with as yet unidentified endogenous polyanionic substrates required to nucleate tau assembly. PMID:27070645

  6. Hyperphosphorylation results in tau dysfunction in DNA folding and protection.

    PubMed

    Lu, Yang; He, Hai-Jin; Zhou, Jun; Miao, Jun-Ye; Lu, Jing; He, Ying-Ge; Pan, Rong; Wei, Yan; Liu, Ying; He, Rong-Qiao

    2013-01-01

    Hyperphosphorylation of tau occurs in preclinical and clinical stages of Alzheimer's disease (AD), and hyperphosphorylated tau is the main constituent of the paired helical filaments in the brains of mild cognitive impairment and AD patients. While most of the work described so far focused on the relationship between hyperphosphorylation of tau and microtubule disassembly as well as axonal transport impairments, both phenomena ultimately leading to cell death, little work has been done to study the correlation between tau hyperphosphorylation and DNA damage. As we showed in this study, tau hyperphosphorylation and DNA damage co-occurred under formaldehyde treatment in N2a cells, indicating that phosphorylated tau (p-Tau) induced by formaldehyde may be involved in DNA impairment. After phosphorylation, the effect of tau in preventing DNA from thermal denaturation was diminished, its ability to accelerate DNA renaturation was lost, and its function in protecting DNA from reactive oxygen species (ROS) attack was impaired. Thus, p-Tau is not only associated with the disassembly of the microtubule system, but also plays a crucial role in DNA impairment. Hyperphosphorylation-mediated dysfunction of tau protein in prevention of DNA structure from damage under the attack of ROS may provide novel insights into the mechanisms underlying tauopathies.

  7. Membrane toxicity of abnormal prion protein in adrenal chromaffin cells of scrapie infected sheep.

    PubMed

    McGovern, Gillian; Jeffrey, Martin

    2013-01-01

    Transmissible spongiform encephalopathies (TSEs) or prion diseases are associated with accumulations of disease specific PrP (PrP(d)) in the central nervous system (CNS) and often the lymphoreticular system (LRS). Accumulations have additionally been recorded in other tissues including the peripheral nervous system and adrenal gland. Here we investigate the effect of sheep scrapie on the morphology and the accumulation of PrP(d) in the adrenal medulla of scrapie affected sheep using light and electron microscopy. Using immunogold electron microscopy, non-fibrillar forms of PrP(d) were shown to accumulate mainly in association with chromaffin cells, occasional nerve endings and macrophages. PrP(d) accumulation was associated with distinctive membrane changes of chromaffin cells including increased electron density, abnormal linearity and invaginations. Internalisation of PrP(d) from the chromaffin cell plasma membrane occurred in association with granule recycling following hormone exocytosis. PrP(d) accumulation and internalisation from membranes is similarly associated with perturbations of membrane structure and trafficking in CNS neurons and tingible body macrophages of the LRS. These data suggest that a major toxic effect of PrP(d) is at the level of plasma membranes. However, the precise nature of PrP(d)-membrane toxicity is tissue and cell specific suggesting that the normal protein may act as a multi-functional scaffolding molecule. We further suggest that the co-localisation of PrP(d) with exocytic granules of the hormone trafficking system may provide an additional source of infectivity in blood.

  8. Clinical significance of the appearance of abnormal protein band in patients with multiple myeloma.

    PubMed

    Jo, Jae-Cheol; Yoon, Dok Hyun; Kim, Shin; Lee, Kyoungmin; Kang, Eun Hee; Jang, Seongsoo; Park, Chan-Jeoung; Chi, Hyun-Sook; Huh, Jooryung; Park, Chan-Sik; Suh, Cheolwon

    2014-03-01

    Multiple myeloma (MM) is characterized by clonal expansion of malignant bone marrow cells producing a unique monoclonal immunoglobulin. The appearance of abnormal protein band (APB) in MM has been reported during follow-up. We aimed to evaluate the clinical characteristics and outcomes of patients with APB in a single center cohort. A total of 377 consecutive MM patients were treated at the Asan Medical Center between January 2002 and December 2012. We compared clinical characteristics and survival outcome between those with and without APB. Of the 377 patients, 34 (9 %) experienced APB. They comprised 18.2 % (27/148) of patients treated with autologous stem cell transplantation (ASCT) and 3.1 % (7/229) of those not receiving ASCT. APB occurred after a median of 7.9 months (range, 2.2-95.7 months) from diagnosis. Immunoglobulin isotypes at diagnosis were as follows: IgG (n = 10), IgA (n = 8), IgD (n = 5), free κ (n = 4), and free λ (n = 7). Nine patients experienced a second APB. With a median follow-up of 54.1 months, the median overall survival (OS) has not been reached in patients with APB and was 38.3 months in patients without (P < 0.001). Multivariate analysis indicated that the development of APB was a significant favorable prognostic factor for OS (hazard ratio 0.21; 95 % confidence interval 0.08-0.52). Serum β₂-microglobulin, albumin, creatinine, and ASCT were also independent prognostic factors for OS. Further investigation is required to establish the mechanisms underlying APB in MM.

  9. Reversibility of Tau-related cognitive defects in a regulatable FTD mouse model.

    PubMed

    Sydow, Astrid; Van der Jeugd, Ann; Zheng, Fang; Ahmed, Tariq; Balschun, Detlef; Petrova, Olga; Drexler, Dagmar; Zhou, Lepu; Rune, Gabriele; Mandelkow, Eckhard; D'Hooge, Rudi; Alzheimer, Christian; Mandelkow, Eva-Maria

    2011-11-01

    The accumulation of proteins such as Tau is a hallmark of several neurodegenerative diseases, e.g., frontotemporal dementia (FTD). So far, many mouse models of tauopathies have been generated by the use of mutated or truncated human Tau isoforms in order to enhance the amyloidogenic character of Tau and to mimic pathological processes similar to those in FTD patients. Our inducible mice express the repeat domain of human Tau (Tau(RD)) carrying the FTDP-17 mutation ΔK280 in a "pro-aggregant" and an "anti-aggregant" version. Based on the enhanced tendency of Tau to aggregate, only the "pro-aggregant" Tau(RD) mice develop Tau pathology (hyperphosphorylation, coassembly of human and mouse Tau, synaptic loss, and neuronal degeneration). We have now carried out behavioral and electrophysiological analyses showing that only the pro-aggregant Tau(RD) mice have impaired learning/memory and a distinct loss of LTP. Remarkably, after suppressing the pro-aggregant human Tau(RD), memory and LTP recover, while neuronal loss persists. Aggregates persist as well but change their composition from mixed human/mouse to mouse Tau only. The rescue of cognition and synaptic plasticity is explained by a partial recovery of spine synapses in the hippocampus. These results indicate a tight relationship between the amyloidogenic character of Tau and brain malfunction, and suggest that the cognitive impairment is caused by toxic human Tau(RD) species rather than by mouse Tau aggregates.

  10. Acetylation mimic of lysine 280 exacerbates human Tau neurotoxicity in vivo

    PubMed Central

    Gorsky, Marianna Karina; Burnouf, Sylvie; Dols, Jacqueline; Mandelkow, Eckhard; Partridge, Linda

    2016-01-01

    Dysfunction and accumulation of the microtubule-associated human Tau (hTau) protein into intraneuronal aggregates is observed in many neurodegenerative disorders including Alzheimer’s disease (AD). Reversible lysine acetylation has recently emerged as a post-translational modification that may play an important role in the modulation of hTau pathology. Acetylated hTau species have been observed within hTau aggregates in human AD brains and multi-acetylation of hTau in vitro regulates its propensity to aggregate. However, whether lysine acetylation at position 280 (K280) modulates hTau-induced toxicity in vivo is unknown. We generated new Drosophila transgenic models of hTau pathology to evaluate the contribution of K280 acetylation to hTau toxicity, by analysing the respective toxicity of pseudo-acetylated (K280Q) and pseudo-de-acetylated (K280R) mutant forms of hTau. We observed that mis-expression of pseudo-acetylated K280Q-hTau in the adult fly nervous system potently exacerbated fly locomotion defects and photoreceptor neurodegeneration. In addition, modulation of K280 influenced total hTau levels and phosphorylation without changing hTau solubility. Altogether, our results indicate that pseudo-acetylation of the single K280 residue is sufficient to exacerbate hTau neurotoxicity in vivo, suggesting that acetylated K280-hTau species contribute to the pathological events leading to neurodegeneration in AD. PMID:26940749

  11. Function of taurine transporter (Slc6a6/TauT) as a GABA transporting protein and its relevance to GABA transport in rat retinal capillary endothelial cells.

    PubMed

    Tomi, Masatoshi; Tajima, Ayumi; Tachikawa, Masanori; Hosoya, Ken-ichi

    2008-10-01

    The purpose of this study was to identify the uptake mechanism of gamma-aminobutyric acid (GABA) via taurine transporter (Slc6a6/TauT) and its relationship with GABA transport at the inner BRB. Rat Slc6a6/TauT-transfected HeLa cells exhibited Na(+)-, Cl(-)-, and concentration-dependent [3H]GABA uptake with a Km of 1.5 mM. Taurine, beta-alanine, and GABA markedly inhibited Slc6a6/TauT-mediated uptake of [3H]GABA. The uptake of [3H]GABA by a conditionally immortalized rat retinal capillary endothelial cell line (TR-iBRB2) was Na(+)-, Cl(-)-, and concentration-dependent with a Km of 2.0 mM. This process was more potently inhibited by substrates of Slc6a6/TauT, taurine and beta-alanine, than those of GABA transporters, GABA and betaine. In the presence of taurine, there was competitive inhibition with a Ki of 74 microM. [3H]Taurine also exhibited competitive inhibition with a Ki of 1.8 mM in the presence of GABA. In conclusion, rat Slc6a6/TauT has the ability to use GABA as a substrate and Slc6a6/TauT-mediated GABA transport appears to be present at the inner BRB.

  12. NMR Meets Tau: Insights into Its Function and Pathology

    PubMed Central

    Lippens, Guy; Landrieu, Isabelle; Smet, Caroline; Huvent, Isabelle; Gandhi, Neha S.; Gigant, Benoît; Despres, Clément; Qi, Haoling; Lopez, Juan

    2016-01-01

    In this review, we focus on what we have learned from Nuclear Magnetic Resonance (NMR) studies on the neuronal microtubule-associated protein Tau. We consider both the mechanistic details of Tau: the tubulin relationship and its aggregation process. Phosphorylation of Tau is intimately linked to both aspects. NMR spectroscopy has depicted accurate phosphorylation patterns by different kinases, and its non-destructive character has allowed functional assays with the same samples. Finally, we will discuss other post-translational modifications of Tau and its interaction with other cellular factors in relationship to its (dys)function. PMID:27338491

  13. A novel approach for targeted elimination of CSPG4-positive triple-negative breast cancer cells using a MAP tau-based fusion protein.

    PubMed

    Amoury, Manal; Mladenov, Radoslav; Nachreiner, Thomas; Pham, Anh-Tuan; Hristodorov, Dmitrij; Di Fiore, Stefano; Helfrich, Wijnand; Pardo, Alessa; Fey, Georg; Schwenkert, Michael; Thepen, Theophilus; Kiessling, Fabian; Hussain, Ahmad F; Fischer, Rainer; Kolberg, Katharina; Barth, Stefan

    2016-08-15

    Chondroitin sulfate proteoglycan 4 (CSPG4) has been identified as a highly promising target antigen for immunotherapy of triple-negative breast cancer (TNBC). TNBC represents a highly aggressive heterogeneous group of tumors lacking expression of estrogen, progesterone and human epidermal growth factor receptor 2. TNBC is particularly prevalent among young premenopausal women. No suitable targeted therapies are currently available and therefore, novel agents for the targeted elimination of TNBC are urgently needed. Here, we present a novel cytolytic fusion protein (CFP), designated αCSPG4(scFv)-MAP, that consists of a high affinity CSPG4-specific single-chain antibody fragment (scFv) genetically fused to a functionally enhanced form of the human microtubule-associated protein (MAP) tau. Our data indicate that αCSPG4(scFv)-MAP efficiently targets CSPG4(+) TNBC-derived cell lines MDA-MB-231 and Hs 578T and potently inhibits their growth with IC50 values of ∼200 nM. Treatment with αCSPG(scFv)-MAP resulted in induction of the mitochondrial stress pathway by activation of caspase-9 as well as endonuclease G translocation to the nucleus, while induction of the caspase-3 apoptosis pathway was not detectable. Importantly, in vivo studies in mice bearing human breast cancer xenografts revealed efficient targeting to and accumulation of αCSPG4(scFv)-MAP at tumor sites resulting in prominent tumor regression. Taken together, this preclinical proof of concept study confirms the potential clinical value of αCSPG4(scFv)-MAP as a novel targeted approach for the elimination of CSPG4-positive TNBC.

  14. Anti-tau antibodies that block tau aggregate seeding in vitro markedly decrease pathology and improve cognition in vivo

    PubMed Central

    Yanamandra, Kiran; Kfoury, Najla; Jiang, Hong; Mahan, Thomas E.; Ma, Shengmei; Maloney, Susan E.; Wozniak, David F.

    2014-01-01

    Summary Tau aggregation occurs in neurodegenerative diseases including Alzheimer's disease and many other disorders collectively termed tauopathies. Trans-cellular propagation of tau pathology, mediated by extracellular tau aggregates, may underlie pathogenesis of these conditions. P301S tau transgenic mice express mutant human tau protein, and develop progressive tau pathology. Using a cell-based biosensor assay, we screened anti-tau monoclonal antibodies for their ability to block seeding activity present in P301S brain lysates. We infused 3 effective antibodies or controls into the lateral ventricle of P301S mice for 3 months. The antibodies markedly reduced hyperphosphorylated, aggregated, and insoluble tau. They also blocked development of tau seeding activity detected in brain lysates using the biosensor assay, reduced microglial activation, and improved cognitive deficits. These data imply a central role for extracellular tau aggregates in the development of pathology. They also suggest immunotherapy specifically designed to block trans-cellular aggregate propagation will be a productive treatment strategy. PMID:24075978

  15. Anti-tau antibodies that block tau aggregate seeding in vitro markedly decrease pathology and improve cognition in vivo.

    PubMed

    Yanamandra, Kiran; Kfoury, Najla; Jiang, Hong; Mahan, Thomas E; Ma, Shengmei; Maloney, Susan E; Wozniak, David F; Diamond, Marc I; Holtzman, David M

    2013-10-16

    Tau aggregation occurs in neurodegenerative diseases including Alzheimer's disease and many other disorders collectively termed tauopathies. trans-cellular propagation of tau pathology, mediated by extracellular tau aggregates, may underlie pathogenesis of these conditions. P301S tau transgenic mice express mutant human tau protein and develop progressive tau pathology. Using a cell-based biosensor assay, we screened anti-tau monoclonal antibodies for their ability to block seeding activity present in P301S brain lysates. We infused three effective antibodies or controls into the lateral ventricle of P301S mice for 3 months. The antibodies markedly reduced hyperphosphorylated, aggregated, and insoluble tau. They also blocked development of tau seeding activity detected in brain lysates using the biosensor assay, reduced microglial activation, and improved cognitive deficits. These data imply a central role for extracellular tau aggregates in the development of pathology. They also suggest that immunotherapy specifically designed to block trans-cellular aggregate propagation will be a productive treatment strategy.

  16. Dysregulation of Protein Phosphorylation/Dephosphorylation in Alzheimer's Disease: A Therapeutic Target

    PubMed Central

    Gong, Cheng-Xin; Liu, Fei; Grundke-Iqbal, Inge; Iqbal, Khalid

    2006-01-01

    Studies during the last two decades have provided new insights into the molecular mechanism of Alzheimer's disease (AD). One of the milestone findings in AD research was the demonstration that neurofibrillary degeneration characterized by tau pathology is central to the pathogenesis of AD and other tauopathies and that abnormal hyperphosphorylation of tau is pivotal to neurofibrillary degeneration. This article reviews the recent research advances in tau pathology and the underlying dysregulation of the protein phosphorylation/dephosphorylation system. An updated model of the mechanism of neurofibrillary degeneration is also presented, and a promising therapeutic target to treat AD by correcting dysregulation of protein phosphorylation/dephosphorylation is discussed. PMID:17047304

  17. Is tau ready for admission to the prion club?

    PubMed Central

    Hall, Garth F.; Patuto, Brian A.

    2012-01-01

    Aggregation-prone proteins associated with neurodegenerative disease, such as α synuclein and β amyloid, now appear to share key prion-like features with mammalian prion protein, such as the ability to recruit normal proteins to aggregates and to translocate between neurons. These features may shed light on the genesis of stereotyped lesion development patterns in conditions such as Alzheimer disease and Lewy Body dementia. We discuss the qualifications of tau protein as a possible “prionoid” mediator of lesion spread based on recent characterizations of the secretion, uptake and transneuronal transfer of human tau isoforms in a variety of tauopathy models, and in human patients. In particular, we consider (1) the possibility that prionoid behavior of misprocessed tau in neurodegenerative disease may involve other aggregation-prone proteins, including PrP itself, and (2) whether “prionlike” tau lesion propagation might include mechanisms other than protein-protein templating. PMID:22561167

  18. Measurements of the tau Mass and Mass Difference of the tau^+ and tau^- at BABAR

    SciTech Connect

    Aubert, B.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Battaglia, M.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison

    2009-10-30

    The authors present the result of a precision measurement of the mass of the {tau} lepton, M{sub {tau}}, based on 423 fb{sup -1} of data recorded at the {Upsilon}(4S) resonance with the BABAR detector. Using a pseudomass endpoint method, they determine the mass to be 1776.68 {+-} 0.12(stat) {+-} 0.41(syst) MeV. They also measure the mass difference between the {tau}{sup +} and {tau}{sup -}, and obtain (M{sub {tau}{sup +}} - M{sub {tau}{sup -}})/M{sub AVG}{sup {tau}} = (-3.4 {+-} 1.3(stat) {+-} 0.3(syst)) x 10{sup -4}, where M{sub AVG}{sup {tau}} is the average value of M{sub {tau}{sup +}} and M{sub {tau}{sup -}}.

  19. Interactions between Aβ and Mutated Tau Lead to Polymorphism and Induce Aggregation of Aβ-Mutated Tau Oligomeric Complexes

    PubMed Central

    Raz, Yoav; Miller, Yifat

    2013-01-01

    One of the main hallmarks of the fronto-temporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17) is the accumulation of neurofibrillary tangles in the brain as an outcome of the aggregation of mutated tau protein. This process occurs due to a number of genetic mutations in the MAPT gene. One of these mutations is the ∆K280 mutation in the tau R2 repeat domain, which promotes the aggregation vis-à-vis that for the wild-type tau. Experimental studies have shown that in Alzheimer’s disease Aβ peptide forms aggregates both with itself and with wild-type tau. By analogy, in FTDP-17, it is likely that there are interactions between Aβ and mutated tau, but the molecular mechanisms underlying such interactions remain to be elucidated. Thus, to investigate the interactions between Aβ and mutated tau, we constructed fourteen ∆K280 mutated tau-Aβ17-42 oligomeric complexes. In seven of the mutated tau-Aβ17-42 oligoemric complexes the mutated tau oligomers exhibited hydrophobic interactions in their core domain, and in the other seven mutated tau-Aβ17-42 oligoemric complexes the mutated tau oligomers exhibited salt-bridge interactions in their core domain. We considered two types of interactions between mutated tau oligomers and Aβ oligomers: interactions of one monomer of the Aβ oligomer with one monomer of the mutated tau oligomer to form a single-layer conformation, and interactions of the entire Aβ oligomer with the entire mutated tau oligomer to form a double-layer conformation. We also considered parallel arrangements of Aβ trimers alternating with mutated tau trimers in a single-layer conformation. Our results demonstrate that in the interactions of Aβ and mutated tau oligomers, polymorphic mutated tau-Aβ17-42 oligomeric complexes were observed, with a slight preference for the double-layer conformation. Aβ trimers alternating with mutated tau trimers constituted a structurally stable confined β-structure, albeit one that was

  20. Tau, phospho-tau, and S-100B in the cerebrospinal fluid of children with multiple sclerosis.

    PubMed

    Rostasy, Kevin; Withut, Esther; Pohl, Daniela; Lange, Peter; Ciesielcyk, Barbara; Diem, Ricarda; Gärtner, Jutta; Otto, Markus

    2005-10-01

    Axonal injury and glial activation are an early neuropathologic event in adults with multiple sclerosis. To investigate whether markers of axonal injury and glial activation are already elevated in the cerebrospinal fluid of children with multiple sclerosis, we studied the cerebrospinal fluid of 25 children with multiple sclerosis and 67 controls for the presence of tau, phospho-tau, and S-100B proteins using specific enzyme-linked immunoabsorbent assays. In general, tau, phospho-tau, and S-100B protein levels did not differ significantly between groups. However, in a subgroup of nine children with multiple sclerosis, all of whom had prominent clinical symptoms at the time of lumbar puncture and radiologic disease activity, tau protein levels were significantly elevated when compared with other controls. These data indicate that axonal injury is not restricted to adult multiple sclerosis but can already occur in children with multiple sclerosis.

  1. Revisiting the Role of Acetylcholinesterase in Alzheimer’s Disease: Cross-Talk with P-tau and β-Amyloid

    PubMed Central

    García-Ayllón, María-Salud; Small, David H.; Avila, Jesús; Sáez-Valero, Javier

    2011-01-01

    A common feature in the Alzheimer’s disease (AD) brain is the presence of acetylcholinesterase (AChE) which is commonly associated with β-amyloid plaques and neurofibrillary tangles (NFT). Although our understanding of the relationship between AChE and the pathological features of AD is incomplete, increasing evidence suggests that both β-amyloid protein (Aβ) and abnormally hyperphosphorylated tau (P-tau) can influence AChE expression. We also review recent findings which suggest the possible role of AChE in the development of a vicious cycle of Aβ and P-tau dysregulation and discuss the limited and temporary effect of therapeutic intervention with AChE inhibitors. PMID:21949503

  2. Altered protein phosphatase 2A methylation and Tau phosphorylation in the young and aged brain of methylenetetrahydrofolate reductase (MTHFR) deficient mice

    PubMed Central

    Sontag, Jean-Marie; Wasek, Brandi; Taleski, Goce; Smith, Josephine; Arning, Erland; Sontag, Estelle; Bottiglieri, Teodoro

    2014-01-01

    Common functional polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, a key enzyme in folate and homocysteine metabolism, influence risk for a variety of complex disorders, including developmental, vascular, and neurological diseases. MTHFR deficiency is associated with elevation of homocysteine levels and alterations in the methylation cycle. Here, using young and aged Mthfr knockout mouse models, we show that mild MTHFR deficiency can lead to brain-region specific impairment of the methylation of Ser/Thr protein phosphatase 2A (PP2A). Relative to wild-type controls, decreased expression levels of PP2A and leucine carboxyl methyltransferase (LCMT1) were primarily observed in the hippocampus and cerebellum, and to a lesser extent in the cortex of young null Mthfr−/− and aged heterozygous Mthfr+/− mice. A marked down regulation of LCMT1 correlated with the loss of PP2A/Bα holoenzymes. Dietary folate deficiency significantly decreased LCMT1, methylated PP2A and PP2A/Bα levels in all brain regions examined from aged Mthfr+/+ mice, and further exacerbated the regional effects of MTHFR deficiency in aged Mthfr+/− mice. In turn, the down regulation of PP2A/Bα was associated with enhanced phosphorylation of Tau, a neuropathological hallmark of Alzheimer’s disease (AD). Our findings identify hypomethylation of PP2A enzymes, which are major CNS phosphatases, as a novel mechanism by which MTHFR deficiency and Mthfr gene-diet interactions could lead to disruption of neuronal homeostasis, and increase the risk for a variety of neuropsychiatric disorders, including age-related diseases like sporadic AD. PMID:25202269

  3. Identification of nuclear. tau. isoforms in human neuroblastoma cells

    SciTech Connect

    Loomis, P.A.; Howard, T.H.; Castleberry, R.P.; Binder, L.I. )

    1990-11-01

    The {tau} proteins have been reported only in association with microtubules and with ribosomes in situ, in the normal central nervous system. In addition, {tau} has been shown to be an integral component of paired helical filaments, the principal constituent of the neurofibrillary tangles found in brains of patients with Alzheimer's disease and of most aged individuals with Down syndrome (trisomy 21). The authors report here the localization of the well-characterized Tau-1 monoclonal antibody to the nucleolar organizer regions of the acrocentric chromosomes and to their interphase counterpart, the fibrillar component of the nucleolus, in human neuroblastoma cells. Similar localization to the nucleolar organizer regions was also observed in other human cell lines and in one monkey kidney cell line but was not seen in non-primate species. Immunochemically, they further demonstrated the existence of the entire {tau} molecule in the isolated nuclei of neuroblastoma cells. Nuclear {tau} proteins, like the {tau} proteins of the paired helical filaments, cannot be extracted in standard SDS-containing electrophoresis sample buffer but require pretreatment with formic acid prior to immunoblot analysis. This work indicates that {tau} may function in processes not directly associated with microtubules and that highly insoluble complexes of {tau} may also play a role in normal cellular physiology.

  4. Learning and Memory Deficits upon TAU Accumulation in "Drosophila" Mushroom Body Neurons

    ERIC Educational Resources Information Center

    Mershin, Andreas; Pavlopoulos, Elias; Fitch, Olivia; Braden, Brittany C.; Nanopoulos, Dimitri V.; Skoulakis, Efthimios M. C.

    2004-01-01

    Mutations in the neuronal-specific microtubule-binding protein TAU are associated with several dementias and neurodegenerative diseases. However, the effects of elevated TAU accumulation on behavioral plasticity are unknown. We report that directed expression of wild-type vertebrate and "Drosophila" TAU in adult mushroom body neurons, centers for…

  5. Tau physics results from SLD

    SciTech Connect

    Daoudi, M.; SLD Collaboration

    1996-08-10

    Results on {tau} physics at SLD are presented. They are based on 4,316 {tau}-pair events selected from a 150 k Z{sup 0} data sample collected at the SLC. These results include measurements of the {tau} lifetime ({tau}{sub r} = 288.1 {+-} 6.1 {+-} 3.3 fs), the {tau} Michel parameters ({rho} = 0.71 {+-} 0.09 {+-} 0.04, {zeta} = 1.03 {+-} 0.36 {+-} 0.05, and {zeta}{delta} = 0.84 {+-} 0.27 {+-} 0.05), and the {tau} neutrino helicity (h{sub {nu}} = {minus}0.81 {+-} 0.18 {+-} 0.03).

  6. ELISA measurement of specific antibodies to phosphorylated tau in intravenous immunoglobulin products.

    PubMed

    Loeffler, David A; Klaver, Andrea C; Coffey, Mary P

    2015-10-01

    The therapeutic effects of intravenous immunoglobulin (IVIG) products were recently studied in Alzheimer's disease (AD) patients. Pilot studies produced encouraging results but phase II and III trials gave disappointing results; a further study is in progress. IVIG products contain antibodies to tau protein, the main component of neurofibrillary tangles (NFTs). The tau used to detect IVIG's anti-tau antibodies in previous studies was non-phosphorylated recombinant human tau-441, but NFT-associated tau is extensively phosphorylated. The objective of this study was to determine if various IVIG products contain specific antibodies to phosphorylated tau (anti-pTau antibodies). ELISAs were used to evaluate binding of six IVIG products to a 12 amino acid peptide, tau 196-207, which was phosphorylated ("pTau peptide") or non-phosphorylated ("non-pTau peptide") at Serine-199 and Serine-202. Both amino acid residues are phosphorylated in AD NFTs. Each IVIG's "anti-pTau antibody ratio" was calculated by dividing its binding to the pTau peptide by its binding to the non-pTau peptide. Seven experiments were performed and data were pooled, with each experiment contributing one data point from each IVIG product. Mean anti-pTau antibody ratios greater than 1.0, suggesting specific antibodies to phosphorylated tau, were found for three IVIG products. Because administration of antibodies to phosphorylated tau has been found to reduce tau-associated pathology in transgenic mouse models of tauopathy, increasing the levels of anti-pTau antibodies, together with other selected antibodies such as anti-Aβ, in IVIG might increase its ability to slow AD's progression.

  7. PROTEIN L-ISOASPARTYL METHYLTRANSFERASE2 is differentially expressed in chickpea and enhances seed vigor and longevity by reducing abnormal isoaspartyl accumulation predominantly in seed nuclear proteins.

    PubMed

    Verma, Pooja; Kaur, Harmeet; Petla, Bhanu Prakash; Rao, Venkateswara; Saxena, Saurabh C; Majee, Manoj

    2013-03-01

    PROTEIN l-ISOASPARTYL METHYLTRANSFERASE (PIMT) is a widely distributed protein-repairing enzyme that catalyzes the conversion of abnormal l-isoaspartyl residues in spontaneously damaged proteins to normal aspartyl residues. This enzyme is encoded by two divergent genes (PIMT1 and PIMT2) in plants, unlike many other organisms. While the biological role of PIMT1 has been elucidated, the role and significance of the PIMT2 gene in plants is not well defined. Here, we isolated the PIMT2 gene (CaPIMT2) from chickpea (Cicer arietinum), which exhibits a significant increase in isoaspartyl residues in seed proteins coupled with reduced germination vigor under artificial aging conditions. The CaPIMT2 gene is found to be highly divergent and encodes two possible isoforms (CaPIMT2 and CaPIMT2') differing by two amino acids in the region I catalytic domain through alternative splicing. Unlike CaPIMT1, both isoforms possess a unique 56-amino acid amino terminus and exhibit similar yet distinct enzymatic properties. Expression analysis revealed that CaPIMT2 is differentially regulated by stresses and abscisic acid. Confocal visualization of stably expressed green fluorescent protein-fused PIMT proteins and cell fractionation-immunoblot analysis revealed that apart from the plasma membrane, both CaPIMT2 isoforms localize predominantly in the nucleus, while CaPIMT1 localizes in the cytosol. Remarkably, CaPIMT2 enhances seed vigor and longevity by repairing abnormal isoaspartyl residues predominantly in nuclear proteins upon seed-specific expression in Arabidopsis (Arabidopsis thaliana), while CaPIMT1 enhances seed vigor and longevity by repairing such abnormal proteins mainly in the cytosolic fraction. Together, our data suggest that CaPIMT2 has most likely evolved through gene duplication, followed by subfunctionalization to specialize in repairing the nuclear proteome.

  8. 18F-AV-1451 tau PET imaging correlates strongly with tau neuropathology in MAPT mutation carriers.

    PubMed

    Smith, Ruben; Puschmann, Andreas; Schöll, Michael; Ohlsson, Tomas; van Swieten, John; Honer, Michael; Englund, Elisabet; Hansson, Oskar

    2016-09-01

    Tau positron emission tomography ligands provide the novel possibility to image tau pathology in vivo However, little is known about how in vivo brain uptake of tau positron emission tomography ligands relates to tau aggregates observed post-mortem. We performed tau positron emission tomography imaging with (18)F-AV-1451 in three patients harbouring a p.R406W mutation in the MAPT gene, encoding tau. This mutation results in 3- and 4-repeat tau aggregates similar to those in Alzheimer's disease, and many of the mutation carriers initially suffer from memory impairment and temporal lobe atrophy. Two patients with short disease duration and isolated memory impairment exhibited (18)F-AV-1451 uptake mainly in the hippocampus and adjacent temporal lobe regions, correlating with glucose hypometabolism in corresponding regions. One patient died after 26 years of disease duration with dementia and behavioural deficits. Pre-mortem, there was (18)F-AV-1451 uptake in the temporal and frontal lobes, as well as in the basal ganglia, which strongly correlated with the regional extent and amount of tau pathology in post-mortem brain sections. Amyloid-β ((18)F-flutemetamol) positron emission tomography scans were negative in all cases, as were stainings of brain sections for amyloid. This provides strong evidence that (18)F-AV-1451 positron emission tomography can be used to accurately quantify in vivo the regional distribution of hyperphosphorylated tau protein.

  9. Expression of EGFP and NPTII protein is not associated with organ abnormalities in deceased transgenic cloned cattle.

    PubMed

    Liu, Yan; Wu, Qian; Cui, Huiting; Li, Qinghe; Zhao, Yiqiang; Luo, Juan; Liu, Qiuyue; Sun, Xiuzhu; Tang, Bo; Zhang, Lei; Dai, Yunping; Li, Ning

    2008-12-01

    Both enhanced green fluorescence protein (EGFP) and neomycin phosphotransferase type II enzyme (NPTII) are widely used in transgenic studies, but their side effects have not been extensively investigated. In this study, we evaluated the expression profiles of the two marker genes and the relationship between their expression and organ abnormalities. Eight transgenic cloned cattle were studied, four harboring both EGFP and NPTII, and four harboring only the NPTII gene. Four age-matched cloned cattle were used as controls. EGFP and NPTII expression were measured and detected by Q-PCR, Western blot, ELISA, and RIA in heart, liver, and lungs, and the values ranged from 0.3 to 5 microg/g. The expression profiles exhibited differential or mosaic pattern between the organs, the pathologic symptoms of which were identified, but were similar to those of age-matched cloned cattle. All data indicated that the expression of EGFP and NPTII is not associated with organ abnormalities in transgenic cloned cattle.

  10. Interaction of cinnamaldehyde and epicatechin with tau: implications of beneficial effects in modulating Alzheimer's disease pathogenesis.

    PubMed

    George, Roshni C; Lew, John; Graves, Donald J

    2013-01-01

    Abnormal modifications in tau such as hyperphosphorylation, oxidation, and glycation interfere with its interaction with microtubules leading to its dissociation and self-aggregation into neurofibrillary tangles, a hallmark of Alzheimer's disease (AD). Previously we reported that an aqueous extract of cinnamon has the ability to inhibit tau aggregation in vitro and can even induce dissociation of tangles isolated from AD brain. In the present study, we carried out investigations with cinnamaldehyde (CA) and epicatechin (EC), two components of active cinnamon extract. We found that CA and the oxidized form of EC (ECox) inhibited tau aggregation in vitro and the activity was due to their interaction with the two cysteine residues in tau. Mass spectrometry of a synthetic peptide, SKCGS, representing the actual tau sequence, identified the thiol as reacting with CA and ECox. Use of a cysteine double mutant of tau showed the necessity of cysteine for aggregation inhibition by CA. The interaction of CA with tau cysteines was reversible and the presence of CA did not impair the biological function of tau in tubulin assembly in vitro. Further, these compounds protected tau from oxidation caused by the reactive oxygen species, H2O2, and prevented subsequent formation of high molecular weight species that are considered to stimulate tangle formation. Finally, we observed that EC can sequester highly reactive and toxic byproducts of oxidation such as acrolein. Our results suggest that small molecules that form a reversible interaction with cysteines have the potential to protect tau from abnormal modifications.

  11. Disruption of Axonal Transport Perturbs Bone Morphogenetic Protein (BMP) - Signaling and Contributes to Synaptic Abnormalities in Two Neurodegenerative Diseases

    PubMed Central

    Kang, Min Jung; Hansen, Timothy J.; Mickiewicz, Monique; Kaczynski, Tadeusz J.; Fye, Samantha; Gunawardena, Shermali

    2014-01-01

    Formation of new synapses or maintenance of existing synapses requires the delivery of synaptic components from the soma to the nerve termini via axonal transport. One pathway that is important in synapse formation, maintenance and function of the Drosophila neuromuscular junction (NMJ) is the bone morphogenetic protein (BMP)-signaling pathway. Here we show that perturbations in axonal transport directly disrupt BMP signaling, as measured by its downstream signal, phospho Mad (p-Mad). We found that components of the BMP pathway genetically interact with both kinesin-1 and dynein motor proteins. Thick vein (TKV) vesicle motility was also perturbed by reductions in kinesin-1 or dynein motors. Interestingly, dynein mutations severely disrupted p-Mad signaling while kinesin-1 mutants showed a mild reduction in p-Mad signal intensity. Similar to mutants in components of the BMP pathway, both kinesin-1 and dynein motor protein mutants also showed synaptic morphological defects. Strikingly TKV motility and p-Mad signaling were disrupted in larvae expressing two human disease proteins; expansions of glutamine repeats (polyQ77) and human amyloid precursor protein (APP) with a familial Alzheimer's disease (AD) mutation (APPswe). Consistent with axonal transport defects, larvae expressing these disease proteins showed accumulations of synaptic proteins along axons and synaptic abnormalities. Taken together our results suggest that similar to the NGF-TrkA signaling endosome, a BMP signaling endosome that directly interacts with molecular motors likely exist. Thus problems in axonal transport occurs early, perturbs BMP signaling, and likely contributes to the synaptic abnormalities observed in these two diseases. PMID:25127478

  12. Escitalopram Ameliorates Forskolin-Induced Tau Hyperphosphorylation in HEK239/tau441 Cells.

    PubMed

    Ren, Qing-Guo; Wang, Yan-Juan; Gong, Wei-Gang; Zhou, Qi-Da; Xu, Lin; Zhang, Zhi-Jun

    2015-06-01

    To investigate the effect of escitalopram (a widely used and highly efficacious antidepressant from the SSRI class) on tau hyperphosphorylation, HEK293/tau441 cells were pretreated with 4 μM of forskolin for 2 h. Then we treated the cells with different doses of escitalopram (0, 5, 10, 20, 40, 80 μM) for 22 h. We measured the phosphorylation level of tau by Western blotting. It was shown that escitalopram could protect tau from hyperphosphorylation induced by pharmacological activation of protein kinase A (PKA) at a dose of 20, 40, and 80 μM in vitro. Interestingly, the same dose of escitalopram could also increase the level of serine-9-phosphorylated GSK-3β (inactive form) and the phosphorylation level of Akt at Ser473 (active form) with no significant change in the level of total GSK-3β and Akt. Unexpectedly, 5-hydroxytryptamine 1A receptor (5-HT1A) agonist 8-OH-DPAT did not decrease forskolin-induced tau hyperphosphorylation. Our results suggest that escitalopram can ameliorate forskolin-induced tau hyperphosphorylation, which is not through the typical 5-HT1A pathway, and Akt/GSK-3β signaling pathway is involved. These findings may support an effective role of antidepressants in the prevention of dementia associated with depression in patients.

  13. Congenital Abnormalities

    MedlinePlus

    ... Listen Español Text Size Email Print Share Congenital Abnormalities Page Content Article Body About 3% to 4% ... of congenital abnormalities earlier. 5 Categories of Congenital Abnormalities Chromosome Abnormalities Chromosomes are structures that carry genetic ...

  14. Human P301L-Mutant Tau Expression in Mouse Entorhinal-Hippocampal Network Causes Tau Aggregation and Presynaptic Pathology but No Cognitive Deficits

    PubMed Central

    Harris, Julie A.; Koyama, Akihiko; Maeda, Sumihiro; Ho, Kaitlyn; Devidze, Nino; Dubal, Dena B.; Yu, Gui-Qiu; Masliah, Eliezer; Mucke, Lennart

    2012-01-01

    Accumulation of hyperphosphorylated tau in the entorhinal cortex (EC) is one of the earliest pathological hallmarks in patients with Alzheimer’s disease (AD). It can occur before significant Aβ deposition and appears to “spread” into anatomically connected brain regions. To determine whether this early-stage pathology is sufficient to cause disease progression and cognitive decline in experimental models, we overexpressed mutant human tau (hTauP301L) predominantly in layer II/III neurons of the mouse EC. Cognitive functions remained normal in mice at 4, 8, 12 and 16 months of age, despite early and extensive tau accumulation in the EC. Perforant path (PP) axon terminals within the dentate gyrus (DG) contained abnormal conformations of tau even in young EC-hTau mice, and phosphorylated tau increased with age in both the EC and PP. In old mice, ultrastructural alterations in presynaptic terminals were observed at PP-to-granule cell synapses. Phosphorylated tau was more abundant in presynaptic than postsynaptic elements. Human and pathological tau was also detected within hippocampal neurons of this mouse model. Thus, hTauP301L accumulation predominantly in the EC and related presynaptic pathology in hippocampal circuits was not sufficient to cause robust cognitive deficits within the age range analyzed here. PMID:23029293

  15. Review of tau lepton decays

    SciTech Connect

    Stoker, D.P.

    1991-07-01

    Measurements of the {tau} decay modes are reviewed and compared with the predictions of the Standard Model. While the agreement is generally good, the status of the 1-prong puzzle'' remains controversial and a discrepancy between the measured leptonic branching fractions and the {tau} lifetime persists. Prospects for precision measurements at a Tau-Charm Factory are also reviewed. 20 refs., 2 tabs.

  16. BAG3 facilitates the clearance of endogenous tau in primary neurons.

    PubMed

    Lei, Zhinian; Brizzee, Corey; Johnson, Gail V W

    2015-01-01

    Tau is a microtubule associated protein that is found primarily in neurons, and in pathologic conditions, such as Alzheimer's disease (AD) it accumulates and contributes to the disease process. Because tau plays a fundamental role in the pathogenesis of AD and other tauopathies, and in AD mouse models reducing tau levels improves outcomes, approaches that facilitate tau clearance are being considered as therapeutic strategies. However, fundamental to the development of such interventions is a clearer understanding of the mechanisms that regulate tau clearance. Here, we report a novel mechanism of tau degradation mediated by the co-chaperone BAG3. BAG3 has been shown to be an essential component of a complex that targets substrates to the autophagy pathway for degradation. In rat primary neurons, activation of autophagy by inhibition of proteasome activity or treatment with trehalose resulted in significant decreases in tau and phospho-tau levels. These treatments also induced an upregulation of BAG3. Proteasome inhibition activated JNK, which was responsible for the upregulation of BAG3 and increased tau clearance. Inhibiting JNK or knocking down BAG3 blocked the proteasome inhibition-induced decreases in tau. Further, BAG3 overexpression alone resulted in significant decreases in tau and phospho-tau levels in neurons. These results indicate that BAG3 plays a critical role in regulating the levels of tau in neurons, and interventions that increase BAG3 levels could provide a therapeutic approach in the treatment of AD.

  17. Cadmium-induced cell death of basal forebrain cholinergic neurons mediated by muscarinic M1 receptor blockade, increase in GSK-3β enzyme, β-amyloid and tau protein levels.

    PubMed

    Del Pino, Javier; Zeballos, Gabriela; Anadón, María José; Moyano, Paula; Díaz, María Jesús; García, José Manuel; Frejo, María Teresa

    2016-05-01

    Cadmium is a neurotoxic compound which induces cognitive alterations similar to those produced by Alzheimer's disease (AD). However, the mechanism through which cadmium induces this effect remains unknown. In this regard, we described in a previous work that cadmium blocks cholinergic transmission and induces a more pronounced cell death on cholinergic neurons from basal forebrain which is partially mediated by AChE overexpression. Degeneration of basal forebrain cholinergic neurons, as happens in AD, results in memory deficits attributable to the loss of cholinergic modulation of hippocampal synaptic circuits. Moreover, cadmium has been described to activate GSK-3β, induce Aβ protein production and tau filament formation, which have been related to a selective loss of basal forebrain cholinergic neurons and development of AD. The present study is aimed at researching the mechanisms of cell death induced by cadmium on basal forebrain cholinergic neurons. For this purpose, we evaluated, in SN56 cholinergic mourine septal cell line from basal forebrain region, the cadmium toxic effects on neuronal viability through muscarinic M1 receptor, AChE splice variants, GSK-3β enzyme, Aβ and tau proteins. This study proves that cadmium induces cell death on cholinergic neurons through blockade of M1 receptor, overexpression of AChE-S and GSK-3β, down-regulation of AChE-R and increase in Aβ and total and phosphorylated tau protein levels. Our present results provide new understanding of the mechanisms contributing to the harmful effects of cadmium on cholinergic neurons and suggest that cadmium could mediate these mechanisms by M1R blockade through AChE splices altered expression.

  18. Role of the Long Non-Coding RNA MAPT-AS1 in Regulation of Microtubule Associated Protein Tau (MAPT) Expression in Parkinson's Disease

    PubMed Central

    Coupland, Kirsten G.; Kim, Woojin S.; Halliday, Glenda M.; Hallupp, Marianne; Dobson-Stone, Carol; Kwok, John B. J.

    2016-01-01

    Studies investigating the pathogenic role of the microtubule associated protein tau (MAPT) gene in Parkinson’s disease (PD) have indicated that DNA methylation of the promoter region is aberrant in disease, leading to dysregulated MAPT expression. We examined two potential regulators of MAPT gene expression in respect to PD, a promoter-associated long non-coding RNA MAPT-AS1, and DNA methyltransferases (DNMTs), enzymes responsible for new and maintenance of DNA methylation. We assessed the relationship between expression levels of MAPT and the candidate MAPT-AS1, DNMT1, DNMT3A and DNMT3B transcripts in four brain regions with varying degrees of cell loss and pathology (putamen, anterior cingulate cortex, visual cortex and cerebellum) in N = 10 PD and N = 10 controls. We found a significant decrease in MAPT-AS1 expression in PD (p = 7.154 x 10−6). The transcript levels of both MAPT-AS1 (p = 2.569 x 10−4) and DNMT1 (p = 0.001) correlated with those of MAPT across the four brain regions, but not with each other. Overexpression of MAPT-AS1 decreased MAPT promoter activity by ∼2.2 to 4.3 fold in an in vitro luciferase assay performed in two cell lines (p ≤ 2.678 x 10−4). Knock-down expression of MAPT-AS1 led to a 1.3 to 6.3 fold increase in methylation of the endogenous MAPT promoter (p ≤ 0.011) and a 1.2 to 1.5 fold increased expression of the 4-repeat MAPT isoform transcript (p ≤ 0.013). In conclusion, MAPT-AS1 and DNMT1 have been identified as potential epigenetic regulators of MAPT expression in PD across four different brain regions. Our data also suggest that increased MAPT expression could be associated with disease state, but not with PD neuropathology severity. PMID:27336847

  19. Measurements of the decays tau/sup -/. -->. rho/sup -/. nu. /sub tau/, tau/sup -/. -->. pi. /sup -/. nu. /sub tau/ and tau/sup -/. -->. K*-(892). nu. /sub tau/ using the MARK II detector at SPEAR

    SciTech Connect

    Dorfan, J.

    1981-04-01

    Measurements of the branching fractions for the Cabibbo favored decays tau/sup -/ ..-->.. rho/sup -/ ..-->.. ..pi../sup -/..nu../sub tau/ and the Cabibbo suppressed decay mode tau/sup -/ ..-->.. K*/sup -/ (892)..nu../sub tau/ are presented. The energy dependence of the tau/sup +/tau/sup -/ production cross section is obtained for the decays tau/sup -/ ..-->.. rho/sup -/..nu../sub tau/ and these spectra agree well with the classification of the tau/sup -/ as a spin-1/2 point particle. Fits to the production cross section yield a measurement of M/sub tau/ = (1787 +- 10) MeV/c/sup 2/ for the tau mass. Ninety-five percent confidence upper limits for the forbidden decay tau/sup -/ ..-->.. K*/sup -/(1430)..nu../sub tau/ and the tau neutrino mass are presented.

  20. Uptake and Degradation of Protease-Sensitive and -Resistant Forms of Abnormal Human Prion Protein Aggregates by Human Astrocytes

    PubMed Central

    Choi, Young Pyo; Head, Mark W.; Ironside, James W.; Priola, Suzette A.

    2015-01-01

    Sporadic Creutzfeldt-Jakob disease is the most common of the human prion diseases, a group of rare, transmissible, and fatal neurologic diseases associated with the accumulation of an abnormal form (PrPSc) of the host prion protein. In sporadic Creutzfeldt-Jakob disease, disease-associated PrPSc is present not only as an aggregated, protease-resistant form but also as an aggregated protease-sensitive form (sPrPSc). Although evidence suggests that sPrPSc may play a role in prion pathogenesis, little is known about how it interacts with cells during prion infection. Here, we show that protease-sensitive abnormal PrP aggregates derived from patients with sporadic Creutzfeldt-Jakob disease are taken up and degraded by immortalized human astrocytes similarly to abnormal PrP aggregates that are resistant to proteases. Our data suggest that relative proteinase K resistance does not significantly influence the astrocyte's ability to degrade PrPSc. Furthermore, the cell does not appear to distinguish between sPrPSc and protease-resistant PrPSc, suggesting that sPrPSc could contribute to prion infection. PMID:25280631

  1. Early Golgi abnormalities and neurodegeneration upon loss of presynaptic proteins Munc18-1, syntaxin-1 or SNAP-25.

    PubMed

    Santos, Tatiana C; Wierda, Keimpe; Broeke, Jurjen H; Toonen, Ruud F; Verhage, Matthijs

    2017-03-27

    The loss of presynaptic proteins Munc18-1, syntaxin-1 or SNAP-25 is known to produce cell death, but the underlying features have not been compared experimentally. Here, we investigated these features in cultured mouse CNS and dorsal root ganglion neurons. Side-by-side comparisons confirmed massive cell death, before synaptogenesis, within 1-4 days in vitro (DIV) upon loss of t-SNAREs (syntaxin-1, SNAP-25) or Munc18-1, but not v-SNAREs (synaptobrevins/VAMP1/2/3 using Tetanus Neurotoxin (TeNT), also in TI-VAMP/VAMP7 knock-out (KO) neurons). A condensed cis-Golgi was the first abnormality observed upon Munc18-1 or SNAP-25 loss within 3 DIV. This phenotype was distinct from the Golgi fragmentation observed in apoptosis. Cell death was too rapid after syntaxin-1 loss to study Golgi abnormalities. Syntaxin-1 and Munc18-1 depend on each other for normal cellular levels. We observed that endogenous syntaxin-1 accumulates at the Golgi of Munc18-1 KO neurons. However, expression of a non-neuronal Munc18 isoform that does not bind syntaxin-1, Munc18-3, in Munc18-1 KO neurons prevented cell death and restored normal cis-Golgi morphology, but not synaptic transmission or syntaxin-1 targeting. Finally, we observed that dorsal root ganglion neurons are the only Munc18-1 KO neurons that do not degenerate in vivo or in vitro In these neurons, cis-Golgi abnormalities were less severe, with no changes in Golgi shape. Together these data demonstrate that cell death upon Munc18-1, syntaxin-1 or SNAP-25 loss occurs via a degenerative pathway unrelated to the known synapse function of these proteins and involving early cis-Golgi abnormalities, distinct from apoptosis.SIGNIFICANCE STATEMENTThis study provides new insights in a neurodegeneration pathway triggered by the absence of specific proteins involved in synaptic transmission (syntaxin-1, Munc18-1, SNAP-25), while other proteins involved in the same molecular process (synaptobrevins, Munc13-1/2) do not cause degeneration. Massive

  2. Human 14-3-3 gamma protein results in abnormal cell proliferation in the developing eye of Drosophila melanogaster

    PubMed Central

    Hong, Sophia W; Qi, Wenqing; Brabant, Marc; Bosco, Giovanni; Martinez, Jesse D

    2008-01-01

    Background 14-3-3 proteins are a family of adaptor proteins that participate in a wide variety of cellular processes. Recent evidence indicates that the expression levels of these proteins are elevated in some human tumors providing circumstantial evidence for their involvement in human cancers. However, the mechanism through which these proteins act in tumorigenesis is uncertain. Results To determine whether elevated levels of 14-3-3 proteins may perturb cell growth we overexpressed human 14-3-3 gamma (h14-3-3 gamma) in Drosophila larvae using the heat shock promoter or the GMR-Gal4 driver and then examined the effect that this had on cell proliferation in the eye imaginal discs of third instar larvae. We found that induction of h14-3-3 gamma resulted in the abnormal appearance of replicating cells in the differentiating proneural photoreceptor cells of eye imaginal discs where h14-3-3 gamma was driven by the heat shock promoter. Similarly, we found that driving h14-3-3 gamma expression specifically in developing eye discs with the GMR-Gal4 driver resulted in increased numbers of replicative cells following the morphogenetic furrow. Interestingly, we found that the effects of overexpressing h1433 gamma on eye development were increased in a genetic background where String (cdc25) function was compromised. Conclusion Taken together our results indicate that h14-3-3 gamma can promote abnormal cell proliferation and may act through Cdc25. This has important implications for 14-3-3 gamma as an oncogene as it suggests that elevated levels of 14-3-3 may confer a growth advantage to cells that overexpress it. PMID:18194556

  3. High-fat, high-sugar, and high-cholesterol consumption does not impact tau pathogenesis in a mouse model of Alzheimer's disease-like tau pathology.

    PubMed

    Gratuze, Maud; Julien, Jacinthe; Morin, Françoise; Calon, Frédéric; Hébert, Sébastien S; Marette, André; Planel, Emmanuel

    2016-11-01

    Aggregates of hyperphosphorylated tau protein are a pathological hallmark of Alzheimer's disease (AD). The origin of AD is multifactorial, and many metabolic disorders originating from overconsumption of fat, cholesterol, and sugar are associated with higher risk of AD later in life. However, the effects of fat, cholesterol, and sugar overconsumption on tau pathology in AD remain controversial. Using the hTau mice, a model of AD-like tau pathology, we assessed the effects of high-fat, high-cholesterol, and/or high-sugar diets on tau pathogenesis. Surprisingly, we found no effects of these compounds, even combined, on tau phosphorylation, O-GlcNAcylation, splicing, cleavage, and aggregation, suggesting that their overconsumption does not seem to worsen tau pathology in these mice.

  4. Methylglyoxal induces tau hyperphosphorylation via promoting AGEs formation.

    PubMed

    Li, Xiao-Hong; Xie, Jia-Zhao; Jiang, Xia; Lv, Bing-Ling; Cheng, Xiang-Shu; Du, Lai-Ling; Zhang, Jia-Yu; Wang, Jian-Zhi; Zhou, Xin-Wen

    2012-12-01

    The hyperphosphorylated tau is a major protein component of neurofibrillary tangle, which is one of hallmarks of Alzheimer's disease (AD). While the level of methylglyoxal (MG) is significantly increased in the AD brains, the role of MG in tau phosphorylation is still not reported. Here, we found that MG could induce tau hyperphosphorylation at multiple AD-related sites in neuroblastoma 2a cells under maintaining normal cell viability. MG treatment increased the level of advanced glycation end products (AGEs) and the receptor of AGEs (RAGE). Glycogen synthesis kinase-3β (GSK-3β) and p38 MAPK were activated, whereas the level and activity of JNK, Erk1/2, cdk5, and PP2A were not altered after MG treatment. Simultaneous inhibition of GSK-3β or p38 attenuated the MG-induced tau hyperphosphorylation. Aminoguanidine, a blocker of AGEs formation, could effectively reverse the MG-induced tau hyperphosphorylation. These data suggest that MG induces AD-like tau hyperphosphorylation through AGEs formation involving RAGE up-regulation and GSK-3β activation and p38 activation is also partially involved in MG-induced tau hyperphosphorylation. Thus, targeting MG may be a promising therapeutic strategy to prevent AD-like tau hyperphosphorylation.

  5. Widespread tau seeding activity at early Braak stages.

    PubMed

    Furman, Jennifer L; Vaquer-Alicea, Jaime; White, Charles L; Cairns, Nigel J; Nelson, Peter T; Diamond, Marc I

    2017-01-01

    Transcellular propagation of tau aggregates may underlie the progression of pathology in Alzheimer's disease (AD) and other tauopathies. Braak staging (B1, B2, B3) is based on phospho-tau accumulation within connected brain regions: entorhinal cortex (B1); hippocampus/limbic system (B2); and frontal and parietal lobes (B3). We previously developed a specific and sensitive assay that uses flow cytometry to quantify tissue seeding activity based on fluorescence resonance energy transfer (FRET) in cells that stably express tau reporter proteins. In a tauopathy mouse model, we have detected seeding activity far in advance of histopathological changes. It remains unknown whether individuals with AD also develop seeding activity prior to accumulation of phospho-tau. We measured tau seeding activity across four brain regions (hippocampus, frontal lobe, parietal lobe, and cerebellum) in 104 fresh-frozen human AD brain samples from all Braak stages. We observed widespread seeding activity, notably in regions predicted to be free of phospho-tau deposition, and in detergent-insoluble fractions that lacked tau detectable by ELISA. Seeding activity correlated positively with Braak stage and negatively with MMSE. Our results are consistent with early transcellular propagation of tau seeds that triggers subsequent development of neuropathology. The FRET-based seeding assay may also complement standard neuropathological classification of tauopathies.

  6. Dimethyl sulfoxide induces both direct and indirect tau hyperphosphorylation.

    PubMed

    Julien, Carl; Marcouiller, François; Bretteville, Alexis; El Khoury, Noura B; Baillargeon, Joanie; Hébert, Sébastien S; Planel, Emmanuel

    2012-01-01

    Dimethyl sulfoxide (DMSO) is widely used as a solvent or vehicle for biological studies, and for treatment of specific disorders, including traumatic brain injury and several forms of amyloidosis. As Alzheimer's disease (AD) brains are characterized by deposits of β-amyloid peptides, it has been suggested that DMSO could be used as a treatment for this devastating disease. AD brains are also characterized by aggregates of hyperphosphorylated tau protein, but the effect of DMSO on tau phosphorylation is unknown. We thus investigated the impact of DMSO on tau phosphorylation in vitro and in vivo. One hour following intraperitoneal administration of 1 or 2 ml/kg DMSO in mice, no change was observed in tau phosphorylation. However, at 4 ml/kg, tau was hyperphosphorylated at AT8 (Ser(202)/Thr(205)), PHF-1 (Ser(396)/Ser(404)) and AT180 (Thr(231)) epitopes. At this dose, we also noticed that the animals were hypothermic. When the mice were maintained normothermic, the effect of 4 ml/kg DMSO on tau hyperphosphorylation was prevented. On the other hand, in SH-SY5Y cells, 0.1% DMSO induced tau hyperphosphorylation at AT8 and AT180 phosphoepitopes in normothermic conditions. Globally, these findings demonstrate that DMSO can induce tau hyperphosphorylation indirectly via hypothermia in vivo, and directly in vitro. These data should caution researchers working with DMSO as it can induce artifactual results both in vivo and in vitro.

  7. Brain-derived neurotrophic factor protects against tau-related neurodegeneration of Alzheimer's disease

    PubMed Central

    Jiao, S-S; Shen, L-L; Zhu, C; Bu, X-L; Liu, Y-H; Liu, C-H; Yao, X-Q; Zhang, L-L; Zhou, H-D; Walker, D G; Tan, J; Götz, J; Zhou, X-F; Wang, Y-J

    2016-01-01

    Reduced expression of brain-derived neurotrophic factor (BDNF) has a crucial role in the pathogenesis of Alzheimer's disease (AD), which is characterized with the formation of neuritic plaques consisting of amyloid-beta (Aβ) and neurofibrillary tangles composed of hyperphosphorylated tau protein. A growing body of evidence indicates a potential protective effect of BDNF against Aβ-induced neurotoxicity in AD mouse models. However, the direct therapeutic effect of BDNF supplement on tauopathy in AD remains to be established. Here, we found that the BDNF level was reduced in the serum and brain of AD patients and P301L transgenic mice (a mouse model of tauopathy). Intralateral ventricle injection of adeno-associated virus carrying the gene encoding human BDNF (AAV-BDNF) achieved stable expression of BDNF gene and restored the BDNF level in the brains of P301L mice. Restoration of the BDNF level attenuated behavioral deficits, prevented neuron loss, alleviated synaptic degeneration and reduced neuronal abnormality, but did not affect tau hyperphosphorylation level in the brains of P301L mice. Long-term expression of AAV-BDNF in the brain was well tolerated by the mice. These findings suggest that the gene delivery of BDNF is a promising treatment for tau-related neurodegeneration for AD and other neurodegenerative disorders with tauopathy. PMID:27701410

  8. Brain-derived neurotrophic factor protects against tau-related neurodegeneration of Alzheimer's disease.

    PubMed

    Jiao, S-S; Shen, L-L; Zhu, C; Bu, X-L; Liu, Y-H; Liu, C-H; Yao, X-Q; Zhang, L-L; Zhou, H-D; Walker, D G; Tan, J; Götz, J; Zhou, X-F; Wang, Y-J

    2016-10-04

    Reduced expression of brain-derived neurotrophic factor (BDNF) has a crucial role in the pathogenesis of Alzheimer's disease (AD), which is characterized with the formation of neuritic plaques consisting of amyloid-beta (Aβ) and neurofibrillary tangles composed of hyperphosphorylated tau protein. A growing body of evidence indicates a potential protective effect of BDNF against Aβ-induced neurotoxicity in AD mouse models. However, the direct therapeutic effect of BDNF supplement on tauopathy in AD remains to be established. Here, we found that the BDNF level was reduced in the serum and brain of AD patients and P301L transgenic mice (a mouse model of tauopathy). Intralateral ventricle injection of adeno-associated virus carrying the gene encoding human BDNF (AAV-BDNF) achieved stable expression of BDNF gene and restored the BDNF level in the brains of P301L mice. Restoration of the BDNF level attenuated behavioral deficits, prevented neuron loss, alleviated synaptic degeneration and reduced neuronal abnormality, but did not affect tau hyperphosphorylation level in the brains of P301L mice. Long-term expression of AAV-BDNF in the brain was well tolerated by the mice. These findings suggest that the gene delivery of BDNF is a promising treatment for tau-related neurodegeneration for AD and other neurodegenerative disorders with tauopathy.

  9. Diagnostic Accuracy of a Combined Analysis of Cerebrospinal Fluid t-PrP, t-tau, p-tau, and Aβ42 in the Differential Diagnosis of Creutzfeldt-Jakob Disease from Alzheimer’s Disease with Emphasis on Atypical Disease Variants

    PubMed Central

    Abu Rumeileh, Samir; Lattanzio, Francesca; Stanzani Maserati, Michelangelo; Rizzi, Romana; Capellari, Sabina; Parchi, Piero

    2016-01-01

    According to recent studies, the determination of cerebrospinal fluid (CSF) total tau (t-tau)/phosphorylated tau (p-tau) ratio and total prion protein (t-PrP) levels significantly improves the accuracy of the diagnosis of Alzheimer’s disease (AD) in atypical cases with clinical or laboratory features mimicking Creutzfeldt-Jakob disease (CJD). However, this has neither been validated nor tested in series including atypical CJD variants. Furthermore, the added diagnostic value of amyloid-β (Aβ)42 remains unclear. To address these issues, we measured t-PrP, 14-3-3, t-tau, p-tau, and Aβ42 CSF levels in 45 typical and 44 atypical/rapidly progressive AD patients, 54 typical and 54 atypical CJD patients, and 33 controls. CJD patients showed significantly lower CSF t-PrP levels than controls and AD patients. Furthermore, atypical CJD was associated with lower t-PrP levels in comparison to typical CJD. T-tau, 14-3-3, or t-PrP alone yielded, respectively, 80.6, 63.0, and 73.0% sensitivity and 75.3, 92.1, and 75% specificity in distinguishing AD from CJD. On receiver operating characteristic (ROC) curve analyses of biomarker combinations, the (t-tau×Aβ42)/(p-tau×t-PrP) ratio achieved the best accuracy, with 98.1% sensitivity and 97.7% specificity overall, and 96.2% sensitivity and 95.5% specificity for the “atypical” disease groups. Our results show that the combined analysis of CSF t-PrP, t-tau, p-tau, and Aβ42 is clinically useful in the differential diagnosis between CJD and AD. Furthermore, the finding of reduced CSF t-PrP levels in CJD patients suggest that, likewise Aβ42 in AD, CSF t-PrP levels reflect the extent of PrPc conversion into abnormal PrP (PrPSc) and the burden of PrPSc deposition in CJD. PMID:27886009

  10. Proline Conformation in a Functional Tau Fragment.

    PubMed

    Ahuja, Puneet; Cantrelle, François-Xavier; Huvent, Isabelle; Hanoulle, Xavier; Lopez, Juan; Smet, Caroline; Wieruszeski, Jean-Michel; Landrieu, Isabelle; Lippens, G

    2016-01-16

    The conformational state of distinct prolines can determine the folding of a protein but equally other biological processes when coupled to a conformation-sensitive secondary reaction. For the neuronal tau protein, the importance of proline conformation is underscored by its interaction with different prolyl cis/trans isomerases. The proline conformation would gain even further importance after phosphorylation of the preceding residue by various proline-directed kinases. A number of molecular diseases including Alzheimer's disease and traumatic brain injury were thereby recently qualified as "cistauosis", as they would imply a cis conformation for the pThr231-Pro232 prolyl bond. We here investigate by NMR spectroscopy the conformation of all prolines in a functional Tau fragment, Tau[208-324]. Although we can detect and identify some minor conformers in the cis form, we show that all prolines are for over 90% in the trans conformation. Phosphorylation by CDK2/CycA3, which notably leads to complete modification of the Thr231 residue, does not change this conclusion. Our data hence disagree with the notion that specific prolyl bonds in tau would adopt preferentially the cis conformation.

  11. Function and regulation of tau conformations in the development and treatment of traumatic brain injury and neurodegeneration.

    PubMed

    Albayram, Onder; Herbert, Megan K; Kondo, Asami; Tsai, Cheng-Yu; Baxley, Sean; Lian, Xiaolan; Hansen, Madison; Zhou, Xiao Zhen; Lu, Kun Ping

    2016-01-01

    One of the two common hallmark lesions of Alzheimer's disease (AD) brains is neurofibrillary tangles (NFTs), which are composed of hyperphosphorylated tau protein (p-tau). NFTs are also a defining feature of other neurodegenerative disorders and have recently been identified in the brains of patients suffering from chronic traumatic encephalopathy (CTE). However, NFTs are not normally observed in traumatic brain injury (TBI) until months or years after injury. This raises the question of whether NFTs are a cause or a consequence of long-term neurodegeneration following TBI. Two conformations of phosphorylated tau, cis p-tau and trans p-tau, which are regulated by the peptidyl-prolyl isomerase Pin1, have been previously identified. By generating a polyclonal and monoclonal antibody (Ab) pair capable of distinguishing between cis and trans isoforms of p-tau (cis p-tau and trans p-tau, respectively), cis p-tau was identified as a precursor of tau pathology and an early driver of neurodegeneration in AD, TBI and CTE. Histological studies shows the appearance of robust cis p-tau in the early stages of human mild cognitive impairment (MCI), AD and CTE brains, as well as after sport- and military-related TBI. Notably, cis p-tau appears within hours after closed head injury and long before other known pathogenic p-tau conformations including oligomers, pre-fibrillary tangles and NFTs. Importantly, cis p-tau monoclonal antibody treatment not only eliminates cis p-tau induction and tau pathology, but also restores many neuropathological and functional outcome in TBI mouse models. Thus, cis p-tau is an early driver of tau pathology in TBI and CTE and detection of cis p-tau in human bodily fluids could potentially provide new diagnostic and prognostic tools. Furthermore, humanization of the cis p-tau antibody could ultimately be developed as a new treatment for AD, TBI and CTE.

  12. Tau binds to lipid membrane surfaces via short amphipathic helices located in its microtubule-binding repeats.

    PubMed

    Georgieva, Elka R; Xiao, Shifeng; Borbat, Peter P; Freed, Jack H; Eliezer, David

    2014-09-16

    Tau is a microtubule-associated protein that is genetically linked to dementia and linked to Alzheimer's disease via its presence in intraneuronal neurofibrillary tangle deposits, where it takes the form of aggregated paired helical and straight filaments. Although the precise mechanisms by which tau contributes to neurodegeneration remain unclear, tau aggregation is commonly considered to be a critical component of tau-mediated pathogenicity. Nevertheless, the context in which tau aggregation begins in vivo is unknown. Tau is enriched in membrane-rich neuronal structures such as axons and growth cones, and can interact with membranes both via intermediary proteins and directly via its microtubule-binding domain (MBD). Membranes efficiently facilitate tau aggregation in vitro, and may therefore provide a physiologically relevant context for nucleating tau aggregation in vivo. Furthermore, tau-membrane interactions may potentially play a role in tau's poorly understood normal physiological functions. Despite the potential importance of direct tau-membrane interactions for tau pathology and physiology, the structural mechanisms that underlie such interactions remain to be elucidated. Here, we employ electron spin resonance spectroscopy to investigate the secondary and long-range structural properties of the MBD of three-repeat tau isoforms when bound to lipid vesicles and membrane mimetics. We show that the membrane interactions of the tau MBD are mediated by short amphipathic helices formed within each of the MBD repeats in the membrane-bound state. To our knowledge, this is the first detailed elucidation of helical tau structure in the context of intact lipid bilayers. We further show, for the first time (to our knowledge), that these individual helical regions behave as independent membrane-binding sites linked by flexible connecting regions. These results represent the first (to our knowledge) detailed structural view of membrane-bound tau and provide insights

  13. Chromothripsis in healthy individuals affects multiple protein-coding genes and can result in severe congenital abnormalities in offspring.

    PubMed

    de Pagter, Mirjam S; van Roosmalen, Markus J; Baas, Annette F; Renkens, Ivo; Duran, Karen J; van Binsbergen, Ellen; Tavakoli-Yaraki, Masoumeh; Hochstenbach, Ron; van der Veken, Lars T; Cuppen, Edwin; Kloosterman, Wigard P

    2015-04-02

    Chromothripsis represents an extreme class of complex chromosome rearrangements (CCRs) with major effects on chromosomal architecture. Although recent studies have associated chromothripsis with congenital abnormalities, the incidence and pathogenic effects of this phenomenon require further investigation. Here, we analyzed the genomes of three families in which chromothripsis rearrangements were transmitted from a mother to her child. The chromothripsis in the mothers resulted in completely balanced rearrangements involving 8-23 breakpoint junctions across three to five chromosomes. Two mothers did not show any phenotypic abnormalities, although 3-13 protein-coding genes were affected by breakpoints. Unbalanced but stable transmission of a subset of the derivative chromosomes caused apparently de novo complex copy-number changes in two children. This resulted in gene-dosage changes, which are probably responsible for the severe congenital phenotypes of these two children. In contrast, the third child, who has a severe congenital disease, harbored all three chromothripsis chromosomes from his healthy mother, but one of the chromosomes acquired de novo rearrangements leading to copy-number changes. These results show that the human genome can tolerate extreme reshuffling of chromosomal architecture, including breakage of multiple protein-coding genes, without noticeable phenotypic effects. The presence of chromothripsis in healthy individuals affects reproduction and is expected to substantially increase the risk of miscarriages, abortions, and severe congenital disease.

  14. A novel tau-tubulin kinase from bovine brain.

    PubMed

    Takahashi, M; Tomizawa, K; Sato, K; Ohtake, A; Omori, A

    1995-09-18

    During purification of tau protein kinase I and II from the bovine brain extract, a new tau protein kinase was detected and purified with phosphocellulose, gel filtration, S-Sepharose and AF-Heparin column chromatography. The molecular mass of the enzyme was determined to be 32 kDa by gel filtration and activity staining on SDS-PAGE. The enzyme is a Ser/Thr protein kinase phosphorylating tau, beta-tubulin, MAP2 and alpha-casein. Employing many synthetic peptides, the recognition site of this enzyme appears to be -SR-. The enzyme requires no second messenger and is inhibited with high concentration of heparin, but not by inhibitors of CKI. These results indicate that this enzyme, tau-tubulin kinase is novel and distinct from TPKI, II and CKI, II.

  15. Tau-based therapeutics for Alzheimer's disease: active and passive immunotherapy.

    PubMed

    Panza, Francesco; Solfrizzi, Vincenzo; Seripa, Davide; Imbimbo, Bruno P; Lozupone, Madia; Santamato, Andrea; Tortelli, Rosanna; Galizia, Ilaria; Prete, Camilla; Daniele, Antonio; Pilotto, Alberto; Greco, Antonio; Logroscino, Giancarlo

    2016-09-01

    Pharmacological manipulation of tau protein in Alzheimer's disease included microtubule-stabilizing agents, tau protein kinase inhibitors, tau aggregation inhibitors, active and passive immunotherapies and, more recently, inhibitors of tau acetylation. Animal studies have shown that both active and passive approaches can remove tau pathology and, in some cases, improve cognitive function. Two active vaccines targeting either nonphosphorylated (AAD-vac1) and phosphorylated tau (ACI-35) have entered Phase I testing. Notwithstanding, the recent discontinuation of the monoclonal antibody RG7345 for Alzheimer's disease, two other antitau antibodies, BMS-986168 and C2N-8E12, are also currently in Phase I testing for progressive supranuclear palsy. After the recent impressive results in animal studies obtained by salsalate, the dimer of salicylic acid, inhibitors of tau acetylation are being actively pursued.

  16. Histone deacetylase 6 inhibition improves memory and reduces total tau levels in a mouse model of tau deposition

    PubMed Central

    2014-01-01

    Introduction Tau pathology is associated with a number of age-related neurodegenerative disorders. Few treatments have been demonstrated to diminish the impact of tau pathology in mouse models and none are yet effective in humans. Histone deacetylase 6 (HDAC6) is an enzyme that removes acetyl groups from cytoplasmic proteins, rather than nuclear histones. Its substrates include tubulin, heat shock protein 90 and cortactin. Tubastatin A is a selective inhibitor of HDAC6. Modification of tau pathology by specific inhibition of HDAC6 presents a potential therapeutic approach in tauopathy. Methods We treated rTg4510 mouse models of tau deposition and non-transgenic mice with tubastatin (25 mg/kg) or saline (0.9%) from 5 to 7 months of age. Cognitive behavior analysis, histology and biochemical analysis were applied to access the effect of tubastatin on memory, tau pathology and neurodegeneration (hippocampal volume). Results We present data showing that tubastatin restored memory function in rTg4510 mice and reversed a hyperactivity phenotype. We further found that tubastatin reduced the levels of total tau, both histologically and by western analysis. Reduction in total tau levels was positively correlated with memory improvement in these mice. However, there was no impact on phosphorylated forms of tau, either by histology or western analysis, nor was there an impact on silver positive inclusions histologically. Conclusion Potential mechanisms by which HDAC6 inhibitors might benefit the rTg4510 mouse include stabilization of microtubules secondary to increased tubulin acetylation, increased degradation of tau secondary to increased acetylation of HSP90 or both. These data support the use of HDAC6 inhibitors as potential therapeutic agents against tau pathology. PMID:24576665

  17. The mitotic tensegrity guardian tau protects mammary epithelia from katanin-like1-induced aneuploidy

    PubMed Central

    Sudo, Haruka; Nakajima, Kazunori

    2016-01-01

    The microtubule associated-protein tau has been identified as an effective positive prognostic indicator in breast cancer. To explore the physiological function of tau in early carcinogenesis, endogenous tau was knocked down in primary cultured human mammary epithelial cells. This resulted in chromosome-bridging during anaphase followed by micronucleation, both of which were suppressed by a further katanin-like1 knockdown. We also detected that the exogenously expressed katanin-like1 induction of cellular transformation is prevented by exogenous tau in rat fibroblasts. The mutant katanin-like1 (L123V) identified in breast cancer showed an increase in this transformation capacity as well as microtubule severing activity resistant to tau. The tau knockdown resulted in a loss of the kinetochore fibers on which tau is normally localized. This physical fragility was also observed in isolated tau-knockdown mitotic spindles, supporting the relevance of microtubule damage to the onset of transformation. The karyotyping of tau-knockdown cells showed increased frequency of loss of one X chromosome, further suggesting the involvement of tau in breast tumorigenesis. We propose that tau may contribute to tumor progression by protecting spindle microtubules from excess severing by katanin-like1. We also present data indicating that the microtubule-binding octapeptide NAP is a candidate modifier against the tau deficiency in tumor cells. PMID:27447563

  18. Tau phosphorylation and cleavage in ethanol-induced neurodegeneration in the developing mouse brain.

    PubMed

    Saito, Mariko; Chakraborty, Goutam; Mao, Rui-Fen; Paik, Sun-Mee; Vadasz, Csaba; Saito, Mitsuo

    2010-04-01

    Previous studies indicated that ethanol-induced neurodegeneration in postnatal day 7 (P7) mice, widely used as a model for the fetal alcohol spectrum disorders, was accompanied by glycogen synthase kinase-3beta (GSK-3beta) and caspase-3 activation. Presently, we examined whether tau, a microtubule associated protein, is modified by GSK-3beta and caspase-3 in ethanol-treated P7 mouse forebrains. We found that ethanol increased phosphorylated tau recognized by the paired helical filament (PHF)-1 antibody and by the antibody against tau phosphorylated at Ser199. Ethanol also generated tau fragments recognized by an antibody against caspase-cleaved tau (C-tau). C-tau was localized in neurons bearing activated caspase-3 and fragmented nuclei. Over time, cell debris and degenerated projections containing C-tau appeared to be engulfed by activated microglia. A caspase-3 inhibitor partially blocked C-tau formation. Lithium, a GSK-3beta inhibitor, blocked ethanol-induced caspase-3 activation, phosphorylated tau elevation, C-tau formation, and microglial activation. These results indicate that tau is phosphorylated by GSK-3beta and cleaved by caspase-3 during ethanol-induced neurodegeneration in the developing brain.

  19. Plasma tau in Alzheimer disease

    PubMed Central

    Zetterberg, Henrik; Janelidze, Shorena; Insel, Philip S.; Andreasson, Ulf; Stomrud, Erik; Palmqvist, Sebastian; Baker, David; Tan Hehir, Cristina A.; Jeromin, Andreas; Hanlon, David; Song, Linan; Shaw, Leslie M.; Trojanowski, John Q.; Weiner, Michael W.; Hansson, Oskar; Blennow, Kaj

    2016-01-01

    Objective: To test whether plasma tau is altered in Alzheimer disease (AD) and whether it is related to changes in cognition, CSF biomarkers of AD pathology (including β-amyloid [Aβ] and tau), brain atrophy, and brain metabolism. Methods: This was a study of plasma tau in prospectively followed patients with AD (n = 179), patients with mild cognitive impairment (n = 195), and cognitive healthy controls (n = 189) from the Alzheimer's Disease Neuroimaging Initiative (ADNI) and cross-sectionally studied patients with AD (n = 61), mild cognitive impairment (n = 212), and subjective cognitive decline (n = 174) and controls (n = 274) from the Biomarkers for Identifying Neurodegenerative Disorders Early and Reliably (BioFINDER) study at Lund University, Sweden. A total of 1284 participants were studied. Associations were tested between plasma tau and diagnosis, CSF biomarkers, MRI measures, 18fluorodeoxyglucose-PET, and cognition. Results: Higher plasma tau was associated with AD dementia, higher CSF tau, and lower CSF Aβ42, but the correlations were weak and differed between ADNI and BioFINDER. Longitudinal analysis in ADNI showed significant associations between plasma tau and worse cognition, more atrophy, and more hypometabolism during follow-up. Conclusions: Plasma tau partly reflects AD pathology, but the overlap between normal aging and AD is large, especially in patients without dementia. Despite group-level differences, these results do not support plasma tau as an AD biomarker in individual people. Future studies may test longitudinal plasma tau measurements in AD. PMID:27694257

  20. Melanin or a Melanin-Like Substance Interacts with the N-Terminal Portion of Prion Protein and Inhibits Abnormal Prion Protein Formation in Prion-Infected Cells.

    PubMed

    Hamanaka, Taichi; Nishizawa, Keiko; Sakasegawa, Yuji; Oguma, Ayumi; Teruya, Kenta; Kurahashi, Hiroshi; Hara, Hideyuki; Sakaguchi, Suehiro; Doh-Ura, Katsumi

    2017-03-15

    Prion diseases are progressive fatal neurodegenerative illnesses caused by the accumulation of transmissible abnormal prion protein (PrP). To find treatments for prion diseases, we searched for substances from natural resources that inhibit abnormal PrP formation in prion-infected cells. We found that high-molecular-weight components from insect cuticle extracts reduced abnormal PrP levels. The chemical nature of these components was consistent with that of melanin. In fact, synthetic melanin produced from tyrosine or 3-hydroxy-l-tyrosine inhibited abnormal PrP formation. Melanin did not modify cellular or cell surface PrP levels, nor did it modify lipid raft or cellular cholesterol levels. Neither did it enhance autophagy or lysosomal function. Melanin was capable of interacting with PrP at two N-terminal domains. Specifically, it strongly interacted with the PrP region of amino acids 23 to 50 including a positively charged amino acid cluster and weakly interacted with the PrP octarepeat peptide region of residues 51 to 90. However, the in vitro and in vivo data were inconsistent with those of prion-infected cells. Abnormal PrP formation in protein misfolding cyclic amplification was not inhibited by melanin. Survival after prion infection was not significantly altered in albino mice or exogenously melanin-injected mice compared with that of control mice. These data suggest that melanin, a main determinant of skin color, is not likely to modify prion disease pathogenesis, even though racial differences in the incidence of human prion diseases have been reported. Thus, the findings identify an interaction between melanin and the N terminus of PrP, but the pathophysiological roles of the PrP-melanin interaction remain unclear.IMPORTANCE The N-terminal region of PrP is reportedly important for neuroprotection, neurotoxicity, and abnormal PrP formation, as this region is bound by many factors, such as metal ions, lipids, nucleic acids, antiprion compounds, and several

  1. Mechanisms of tau and Aβ-induced excitotoxicity.

    PubMed

    Pallo, Susanne P; DiMaio, John; Cook, Alexis; Nilsson, Bradley; Johnson, Gail V W

    2016-03-01

    Excitotoxicity was originally postulated to be a late stage side effect of Alzheimer׳s disease (AD)-related neurodegeneration, however more recent studies indicate that it may occur early in AD and contribute to the neurodegenerative process. Tau and amyloid beta (Aβ), the main components of neurofibrillary tangles (NFTs) and amyloid plaques, have been implicated in cooperatively and independently facilitating excitotoxicity. Our study investigated the roles of tau and Aβ in AD-related excitotoxicity. In vivo studies showed that tau knockout (tau(-/-)) mice were significantly protected from seizures and hippocampal superoxide production induced with the glutamate analog, kainic acid (KA). We hypothesized that tau accomplished this by facilitating KA-induced Ca(2+) influx into neurons, however lentiviral tau knockdown failed to ameliorate KA-induced Ca(2+) influx into primary rat cortical neurons. We further investigated if tau cooperated with Aβ to facilitate KA-induced Ca(2+) influx. While Aβ biphasically modulated the KA-induced Cacyt(2+) responses, tau knockdown continued to have no effect. Therefore, tau facilitates KA-induced seizures and superoxide production in a manner that does not involve facilitation of Ca(2+) influx through KA receptors (KAR). On the other hand, acute pretreatment with Aβ (10 min) enhanced KA-induced Ca(2+) influx, while chronic Aβ (24 h) significantly reduced it, regardless of tau knockdown. Given previously published connections between Aβ, group 1 metabotropic glutamate receptors (mGluRs), and KAR regulation, we hypothesized that Aβ modulates KAR via a G-protein coupled receptor pathway mediated by group 1 mGluRs. We found that Aβ did not activate group 1 mGluRs and inhibition of these receptors did not reverse Aβ modulation of KA-induced Ca(2+) influx. Therefore, Aβ biphasically regulates KAR via a mechanism that does not involve group 1mGluR activation.

  2. No Obvious Abnormality in Mice Deficient in Receptor Protein Tyrosine Phosphatase β

    PubMed Central

    Harroch, S.; Palmeri, M.; Rosenbluth, J.; Custer, A.; Okigaki, M.; Shrager, P.; Blum, M.; Buxbaum, J. D.; Schlessinger, J.

    2000-01-01

    The development of neurons and glia is governed by a multitude of extracellular signals that control protein tyrosine phosphorylation, a process regulated by the action of protein tyrosine kinases and protein tyrosine phosphatases (PTPs). Receptor PTPβ (RPTPβ; also known as PTPζ) is expressed predominantly in the nervous system and exhibits structural features common to cell adhesion proteins, suggesting that this phosphatase participates in cell-cell communication. It has been proposed that the three isoforms of RPTPβ play a role in regulation of neuronal migration, neurite outgrowth, and gliogenesis. To investigate the biological functions of this PTP, we have generated mice deficient in RPTPβ. RPTPβ-deficient mice are viable, are fertile, and showed no gross anatomical alterations in the nervous system or other organs. In contrast to results of in vitro experiments, our study demonstrates that RPTPβ is not essential for neurite outgrowth and node formation in mice. The ultrastructure of nerves of the central nervous system in RPTPβ-deficient mice suggests a fragility of myelin. However, conduction velocity was not altered in RPTPβ-deficient mice. The normal development of neurons and glia in RPTPβ-deficient mice demonstrates that RPTPβ function is not necessary for these processes in vivo or that loss of RPTPβ can be compensated for by other PTPs expressed in the nervous system. PMID:11003666

  3. A RAS oncogene imparts growth factor independence to myeloid cells that abnormally regulate protein kinase C: a nonautocrine transformation pathway.

    PubMed

    Boswell, H S; Nahreini, T S; Burgess, G S; Srivastava, A; Gabig, T G; Inhorn, L; Srour, E F; Harrington, M A

    1990-06-01

    The factor-dependent cell line FDC-P1 has been utilized as a model of interleukin 3 (IL-3)-dependent myeloid cell proliferation. However, it has been recently observed that active phorbol esters (e.g., phorbol 12-myristate 13-acetate) may entirely replace IL-3 to promote its proliferation. These observations reveal abnormal regulation of protein kinase C (pkC) (absence of downregulation or overexpression). This property allowed a test of the hypothesis that the T24 RAS (codon 12) oncogene acts by constitutive and persistent pkC activation, driving proliferation. FDC-P1 cells were transfected by electroporation with the T24 RAS-containing vector pAL 8, or with a control vector pSVX Zip Neo, and neomycin-resistant clones were selected. Multiple RAS-transfectant clones were categorized for their growth factor requirement and incorporation of the 6.6-kb human mutant H-RAS genome. IL-3-independent clones had incorporated multiple (more than two) copies of the entire 6.6-kb RAS genome. The incorporation of multiple 6.6-kb RAS genomes was correlated with high-level p21 RAS expression. No evidence for autostimulatory growth factor production by clones containing the RAS oncogene was observed. Thus, acquisition of growth factor independence in myeloid cells by abundant expression of a RAS oncogene is linked, in part, to abnormal regulation of pkC, which acts as a collaborating oncogene.

  4. Decays of the heavy lepton, tau (1785)

    SciTech Connect

    Blocker, C.A.

    1980-04-01

    The structure of the weak hadronic current coupled to the tau is investigated via some of the hadronic decays of the tau. The vector current coupling is determined by measuring the tau ..-->.. rho ..nu../sub tau/ branching ratio. The axial-vector coupling is determined by measuring the tau ..-->.. ..pi.. ..nu../sub tau/ branching ratio. The Cabibbo structure of the hadronic current is established by observing the decay tau ..-->.. K*(890)..nu../sub tau/ and measuring its branching ratio. The branching ratios for the decays tau ..-->.. e anti ..nu../sub e/..nu../sub tau/ and tau ..-->.. ..mu.. anti ..nu../sub ..mu../..nu../sub tau/ are measured as a normalization for the hadronic decays and as a check on the validity of the measurements. The leptonic branching ratios agree well with previous experiments. From a kinematic fit to the pion energy spectrum in the decay tau ..-->.. ..pi.. ..nu../sub tau/, an upper limit (95% confidence level) of 245 MeV is placed on the tau neutrino mass. From a simultaneous fit of the center of mass energy dependence of the tau production cross section and the pion energy spectrum in the decay tau ..-->.. ..pi.. ..nu../sub tau/, the tau mass is determined to be 1.787 +- .010 GeV/c. All properties of the tau measured here are consistent with it being a sequential lepton coupled to the ordinary weak hadronic current.

  5. Protein and glycoprotein abnormalities in platelets from human Chediak-Higashi syndrome: polyacrylamide gel electrophoretic study of platelets from five patients.

    PubMed

    Ledezma, E; Apitz-Castro, R

    1985-10-01

    Polyacrylamide electrophoretic analysis of proteins and Tritium-labelled glycoproteins of the platelets from five patients with Chediak-Higashi Syndrome shows the existence of marked quantitative differences when compared to normal platelets. While the glycoprotein abnormalities are solely related to the plasma membrane, some of the abnormalities detected in the Coomasie blue pattern are probably representative of defects related to the dense bodies and the alpha-granules. Some of the abnormalities found may, in part, explain the variability of aggregatory responses described in these patients, as well as the marked tendency towards desaggregation exhibited by platelets from humans with the Chediak-Higashi Syndrome.

  6. The abnormal isoform of the prion protein accumulates in late-endosome-like organelles in scrapie-infected mouse brain.

    PubMed

    Arnold, J E; Tipler, C; Laszlo, L; Hope, J; Landon, M; Mayer, R J

    1995-08-01

    The prion encephalopathies are characterized by accumulation in the brain of the abnormal form PrPsc of a normal host gene product PrPc. The mechanism and site of formation of PrPsc from PrPc are currently unknown. In this study, ME7 scrapie-infected mouse brain was used to show, both biochemically and by double-labelled immunogold electron microscopy, that proteinase K-resistant PrPsc is enriched in subcellular structures which contain the cation-independent mannose 6-phosphate receptor, ubiquitin-protein conjugates, beta-glucuronidase, and cathepsin B, termed late endosome-like organelles. The glycosylinositol phospholipid membrane-anchored PrPc will enter such compartment for normal degradation and the organelles may therefore act as chambers for the conversion of PrPc into infectious PrPsc in this murine model of scrapie.

  7. Nanoscale Drug Delivery Platforms Overcome Platinum-Based Resistance in Cancer Cells Due to Abnormal Membrane Protein Trafficking

    PubMed Central

    Xue, Xue; Hall, Matthew D.; Zhang, Qiang; Wang, Paul C.; Gottesman, Michael M.; Liang, Xing-Jie

    2014-01-01

    The development of cellular resistance to platinum-based chemotherapies is often associated with reduced intracellular platinum concentrations. In some models, this reduction is due to abnormal membrane protein trafficking, resulting in reduced uptake by transporters at the cell surface. Given the central role of platinum drugs in the clinic, it is critical to overcome cisplatin resistance by bypassing the plasma membrane barrier to significantly increase the intracellular cisplatin concentration enough to inhibit the proliferation of cisplatin-resistant cells. Therefore, rational design of appropriate nanoscale drug delivery platforms (nDDPs) loaded with cisplatin or other platinum analogs as payloads is a possible strategy to solve this problem. This review will focus on the known mechanism of membrane trafficking in cisplatin-resistant cells, and the development and employment of nDDPs to improve cell uptake of cisplatin. PMID:24219825

  8. Nanoscale drug delivery platforms overcome platinum-based resistance in cancer cells due to abnormal membrane protein trafficking.

    PubMed

    Xue, Xue; Hall, Matthew D; Zhang, Qiang; Wang, Paul C; Gottesman, Michael M; Liang, Xing-Jie

    2013-12-23

    The development of cellular resistance to platinum-based chemotherapies is often associated with reduced intracellular platinum concentrations. In some models, this reduction is due to abnormal membrane protein trafficking, resulting in reduced uptake by transporters at the cell surface. Given the central role of platinum drugs in the clinic, it is critical to overcome cisplatin resistance by bypassing the plasma membrane barrier to significantly increase the intracellular cisplatin concentration enough to inhibit the proliferation of cisplatin-resistant cells. Therefore, rational design of appropriate nanoscale drug delivery platforms (nDDPs) loaded with cisplatin or other platinum analogues as payloads is a possible strategy to solve this problem. This review will focus on the known mechanism of membrane trafficking in cisplatin-resistant cells and the development and employment of nDDPs to improve cell uptake of cisplatin.

  9. Familial abnormalities of thyroxine binding proteins: some problems of recognition and interpretation.

    PubMed Central

    Neild, J E; Byfield, P G; Lalloz, M R; Tait, D; Marigold, J H; Croft, D N; Slavin, B M

    1985-01-01

    A three generation family study was carried out after inappropriate treatment with radioactive iodine of a 50 year old woman with a raised serum total thyroxine concentration and free thyroxine index. Subsequent investigations showed that she and five members of her family had raised thyroxine binding globulin concentrations. Free thyroxine and free triiodothyronine concentrations were normal. Problems encountered in the recognition of this thyroxine binding protein disorder are discussed. Clinicians and clinical biochemists should be aware of these pitfalls and thus avoid further incorrect treatment on the basis of biochemical findings, even though free hormone estimations are now becoming readily available. PMID:3919066

  10. Heterogeneity of the Abnormal Prion Protein (PrPSc) of the Chandler Scrapie Strain

    PubMed Central

    Kasai, Kazuo; Iwamaru, Yoshifumi; Masujin, Kentaro; Imamura, Morikazu; Mohri, Shirou; Yokoyama, Takashi

    2013-01-01

    The pathological prion protein, PrPSc, displays various sizes of aggregates. In this study, we investigated the conformation, aggregation stability and proteinase K (PK)-sensitivity of small and large PrPSc aggregates of mouse-adapted prion strains. We showed that small PrPSc aggregates, previously thought to be PK-sensitive, are resistant to PK digestion. Furthermore, we showed that small PrPSc aggregates of the Chandler scrapie strain have greater resistance to PK digestion and aggregation-denaturation than large PrPSc aggregates of this strain. We conclude that this strain consists of heterogeneous PrPSc. PMID:25436883

  11. Chronic noise exposure causes persistence of tau hyperphosphorylation and formation of NFT tau in the rat hippocampus and prefrontal cortex.

    PubMed

    Cui, Bo; Zhu, Lixing; She, Xiaojun; Wu, Mingquan; Ma, Qiang; Wang, Tianhui; Zhang, Na; Xu, Chuanxiang; Chen, Xuewei; An, Gaihong; Liu, Hongtao

    2012-12-01

    The non-auditory effects of noise exposure on the central nervous system have been established both epidemiologically and experimentally. Chronic noise exposure (CNE) has been associated with tau hyperphosphorylation and Alzheimer's disease (AD)-like pathological changes. However, experimental evidence for these associations remains limited. The aim of the current study was to explore the effects of CNE [100 dB sound pressure level (SPL) white noise, 4 h/d×14 d] on tau phosphorylation in the rat hippocampus and the prefrontal cortex. Forty-eight male Wistar rats were randomly assigned to two groups: a noise-exposed group and a control group. The levels of radioimmunoprecipitation assay (RIPA)-soluble and RIPA-insoluble phosphorylated tau at Ser202, Ser396, Ser404, and Ser422 in the hippocampus and the prefrontal cortex were measured at different time points (days 0, 3, 7, and 14) after the end of the last noise exposure. Exposure to white noise for 14 consecutive days significantly increased the levels of tau phosphorylation at Ser202, Ser396, Ser404, and Ser422, the sites typically phosphorylated in AD brains, in the hippocampus and the prefrontal cortex. Tau hyperphosphorylation persisted for 7 to 14 d after the cessation of noise exposure. These alterations were also concomitant with the generation of pathological neurofibrillary tangle (NFT) tau 3, 7 and 14 d after the end of the stimulus. Furthermore, lasting increases in proteins involved in hyperphosphorylation, namely glycogen synthase kinase 3β (GSK3β) and protein phosphatase 2A (PP2A), were found to occur in close correspondence with increase in tau hyperphosphorylation. The results of this study show that CNE leads to long-lasting increases in non-NFT hyperphosphorylated tau and delayed formation of misfolded NFT tau in the hippocampus and the prefrontal cortex. Our results also provide evidence for the involvement of GSK3β and PP2A in these processes.

  12. Synthesis and initial evaluation of YM-08, a blood-brain barrier permeable derivative of the heat shock protein 70 (Hsp70) inhibitor MKT-077, which reduces tau levels.

    PubMed

    Miyata, Yoshinari; Li, Xiaokai; Lee, Hsiu-Fang; Jinwal, Umesh K; Srinivasan, Sharan R; Seguin, Sandlin P; Young, Zapporah T; Brodsky, Jeffrey L; Dickey, Chad A; Sun, Duxin; Gestwicki, Jason E

    2013-06-19

    The molecular chaperone, heat shock protein 70 (Hsp70), is an emerging drug target for treating neurodegenerative tauopathies. We recently found that one promising Hsp70 inhibitor, MKT-077, reduces tau levels in cellular models. However, MKT-077 does not penetrate the blood-brain barrier (BBB), limiting its use as either a clinical candidate or probe for exploring Hsp70 as a drug target in the central nervous system (CNS). We hypothesized that replacing the cationic pyridinium moiety in MKT-077 with a neutral pyridine might improve its clogP and enhance its BBB penetrance. To test this idea, we designed and synthesized YM-08, a neutral analogue of MKT-077. Like the parent compound, YM-08 bound to Hsp70 in vitro and reduced phosphorylated tau levels in cultured brain slices. Pharmacokinetic evaluation in CD1 mice showed that YM-08 crossed the BBB and maintained a brain/plasma (B/P) value of ∼0.25 for at least 18 h. Together, these studies suggest that YM-08 is a promising scaffold for the development of Hsp70 inhibitors suitable for use in the CNS.

  13. The sequential development of abnormal prion protein accumulation in mice with Creutzfeldt-Jakob disease.

    PubMed Central

    Muramoto, T.; Kitamoto, T.; Tateishi, J.; Goto, I.

    1992-01-01

    The distribution and sequential development of prion protein (PrP) accumulation in the central nervous system (CNS) and non-neuronal organs of mice infected with Creutzfeldt-Jakob disease (CJD) were investigated immunohistochemically using a new pretreatment method that greatly enhanced the immunoreactivity of PrP. Prion protein accumulation in the CNS was first detected at 30 days after inoculation and then developed near the inoculation site or periventricular area, and later spread to the whole cerebrum and then to the pons. Its staining took some characteristic forms. Among non-neuronal organs, PrP accumulated in the follicular dendritic cells (FDCs) in spleen, lymph node, Peyer's patch, and thymus. FDCs staining appeared in spleen, lymph node, and Peyer's patch at 21 or 30 days after inoculation, and in thymus at 90 days. Germinal centers developed in the thymus of some CJD-infected mice. No PrP staining was detected in any examined organs of age-matched control mice. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:1376559

  14. Abnormal lipopolysaccharide binding protein as marker of gastrointestinal inflammation in Parkinson disease

    PubMed Central

    Pal, Gian D.; Shaikh, Maliha; Forsyth, Christopher B.; Ouyang, Bichun; Keshavarzian, Ali; Shannon, Kathleen M.

    2015-01-01

    Objective: An inflammation-driven model of PD has been proposed based on the endotoxin lipopolysaccaride (LPS), a potential source of inflammation in the gastrointestinal system linked to neurotoxicity. Systemic exposure to bacterial endotoxin (LPS) can be determined by measuring plasma LPS binding protein (LBP). We aimed to evaluate whether lipopolysaccharide binding protein (LBP) can be used to distinguish PD subjects from control subjects and to assess whether LBP levels correlate with PD disease severity. Methods: We measured plasma LBP (ng/ml) using an ELISA kit in 94 PD subjects of various stages and 97 control subjects. Disease severity was assessed using the UPDRS and Hoehn and Yahr staging. The LBP level between the PD and control groups was compared using analysis of covariance. Spearman correlation was used to explore the relationship between LBP level and disease severity. Results: The mean LBP level in PD subjects (n = 94) was significantly different from control subjects (n = 95, p = 0.018). In PD subjects, we did not find a correlation between mean LBP level and disease severity. Conclusions: Our data suggests that LBP is one GI biomarker related to LPS induced neurotoxicity. However, there was significant variability in LBP levels within the PD and control groups, limiting its utility as a stand-alone biomarker. This study supports the role of LPS induced neurotoxicity in PD and further exploration of this pathway may be useful in developing sensitive and specific biomarkers for PD. PMID:26388718

  15. PMPCA mutations cause abnormal mitochondrial protein processing in patients with non-progressive cerebellar ataxia

    PubMed Central

    Jobling, Rebekah K.; Assoum, Mirna; Gakh, Oleksandr; Blaser, Susan; Raiman, Julian A.; Mignot, Cyril; Roze, Emmanuel; Dürr, Alexandra; Brice, Alexis; Lévy, Nicolas; Prasad, Chitra; Paton, Tara; Paterson, Andrew D.; Roslin, Nicole M.; Marshall, Christian R.; Desvignes, Jean-Pierre; Roëckel-Trevisiol, Nathalie; Scherer, Stephen W.; Rouleau, Guy A.; Mégarbané, André; Isaya, Grazia

    2015-01-01

    Non-progressive cerebellar ataxias are a rare group of disorders that comprise approximately 10% of static infantile encephalopathies. We report the identification of mutations in PMPCA in 17 patients from four families affected with cerebellar ataxia, including the large Lebanese family previously described with autosomal recessive cerebellar ataxia and short stature of Norman type and localized to chromosome 9q34 (OMIM #213200). All patients present with non-progressive cerebellar ataxia, and the majority have intellectual disability of variable severity. PMPCA encodes α-MPP, the alpha subunit of mitochondrial processing peptidase, the primary enzyme responsible for the maturation of the vast majority of nuclear-encoded mitochondrial proteins, which is necessary for life at the cellular level. Analysis of lymphoblastoid cells and fibroblasts from patients homozygous for the PMPCA p.Ala377Thr mutation and carriers demonstrate that the mutation impacts both the level of the alpha subunit encoded by PMPCA and the function of mitochondrial processing peptidase. In particular, this mutation impacts the maturation process of frataxin, the protein which is depleted in Friedreich ataxia. This study represents the first time that defects in PMPCA and mitochondrial processing peptidase have been described in association with a disease phenotype in humans. PMID:25808372

  16. Epilepsy, Behavioral Abnormalities, and Physiological Comorbidities in Syntaxin-Binding Protein 1 (STXBP1) Mutant Zebrafish

    PubMed Central

    Grone, Brian P.; Marchese, Maria; Hamling, Kyla R.; Kumar, Maneesh G.; Krasniak, Christopher S.; Sicca, Federico; Santorelli, Filippo M.; Patel, Manisha; Baraban, Scott C.

    2016-01-01

    Mutations in the synaptic machinery gene syntaxin-binding protein 1, STXBP1 (also known as MUNC18-1), are linked to childhood epilepsies and other neurodevelopmental disorders. Zebrafish STXBP1 homologs (stxbp1a and stxbp1b) have highly conserved sequence and are prominently expressed in the larval zebrafish brain. To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing “dark-flash” visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity. Our findings in these newly generated mutant lines of zebrafish suggest that zebrafish recapitulate clinical phenotypes associated with human syntaxin-binding protein 1 mutations. PMID:26963117

  17. Early Axonopathy Preceding Neurofibrillary Tangles in Mutant Tau Transgenic Mice

    PubMed Central

    Leroy, Karelle; Bretteville, Alexis; Schindowski, Katharina; Gilissen, Emmanuel; Authelet, Michèle; De Decker, Robert; Yilmaz, Zehra; Buée, Luc; Brion, Jean-Pierre

    2007-01-01

    Neurodegenerative diseases characterized by brain and spinal cord involvement often show widespread accumulations of tau aggregates. We have generated a transgenic mouse line (Tg30tau) expressing in the forebrain and the spinal cord a human tau protein bearing two pathogenic mutations (P301S and G272V). These mice developed age-dependent brain and hippocampal atrophy, central and peripheral axonopathy, progressive motor impairment with neurogenic muscle atrophy, and neurofibrillary tangles and had decreased survival. Axonal spheroids and axonal atrophy developed early before neurofibrillary tangles. Neurofibrillary inclusions developed in neurons at 3 months and were of two types, suggestive of a selective vulnerability of neurons to form different types of fibrillary aggregates. A first type of tau-positive neurofibrillary tangles, more abundant in the forebrain, were composed of ribbon-like 19-nm-wide filaments and twisted paired helical filaments. A second type of tau and neurofilament-positive neurofibrillary tangles, more abundant in the spinal cord and the brainstem, were composed of 10-nm-wide neurofilaments and straight 19-nm filaments. Unbiased stereological analysis indicated that total number of pyramidal neurons and density of neurons in the lumbar spinal cord were not reduced up to 12 months in Tg30tau mice. This Tg30tau model thus provides evidence that axonopathy precedes tangle formation and that both lesions can be dissociated from overt neuronal loss in selected brain areas but not from neuronal dysfunction. PMID:17690183

  18. Effects of macromolecular crowding and osmolyte on human Tau fibrillation.

    PubMed

    Wu, Yingying; Teng, Ningning; Li, Sen

    2016-09-01

    Tau fibrillation is reported to be involved in neurodegenerative disorders, such as Alzheimer's disease, in which the natural environment is very crowded in the cells. Understanding the role of crowding environments in regulating Tau fibrillation is of great importance for elucidating the etiology of these diseases. In this experiment, the effects of macromolecular crowding and osmolyte reagents in the crowding environment on Tau fibrillation were studied by thioflavin T binding, SDS-PAGE and TEM assays. Ficoll 70 and Dextran 70 of different concentrations were used as macromolecular crowding reagents inside the cells and showed a strong enhancing effect on the fibrillation of normal and hyperphosphorylated Tau. The enhancing effect of Dextran is stronger than that of Ficoll 70 at the same concentration. In addition, the cellular osmolyte sucrose was found to protect Tau against fibrillation, and inhibit the enhancing effect of macromolecular crowding on Tau fibrillation. A possible model for the fibrillation process of Tau and the effect of macromolecular crowding and osmolyte on this process was proposed based on these experimental results. The information obtained from our study can enhance the understanding of how proteins aggregate and avoid aggregation in crowded physiological environments and might lead to a better understanding of the molecular mechanisms of Alzheimer's disease in vivo.

  19. Effects of tau domain-specific antibodies and intravenous immunoglobulin on tau aggregation and aggregate degradation.

    PubMed

    Esteves-Villanueva, Jose O; Trzeciakiewicz, Hanna; Loeffler, David A; Martić, Sanela

    2015-01-20

    Tau pathology, including neurofibrillary tangles, develops in Alzheimer's disease (AD). The aggregation and hyperphosphorylation of tau are potential therapeutic targets for AD. Administration of anti-tau antibodies reduces tau pathology in transgenic "tauopathy" mice; however, the optimal tau epitopes and conformations to target are unclear. Also unknown is whether intravenous immunoglobulin (IVIG) products, currently being evaluated in AD trials, exert effects on pathological tau. This study examined the effects of anti-tau antibodies targeting different tau epitopes and the IVIG Gammagard on tau aggregation and preformed tau aggregates. Tau aggregation was assessed by transmission electron microscopy and fluorescence spectroscopy, and the binding affinity of the anti-tau antibodies for tau was evaluated by enzyme-linked immunosorbent assays. Antibodies used were anti-tau 1-150 ("D-8"), anti-tau 259-266 ("Paired-262"), anti-tau 341-360 ("A-10"), and anti-tau 404-441 ("Tau-46"), which bind to tau's N-terminus, microtubule binding domain (MBD) repeat sequences R1 and R4, and the C-terminus, respectively. The antibodies Paired-262 and A-10, but not D-8 and Tau-46, reduced tau fibrillization and degraded preformed tau aggregates, whereas the IVIG reduced tau aggregation but did not alter preformed aggregates. The binding affinities of the antibodies for the epitope for which they were specific did not appear to be related to their effects on tau aggregation. These results confirm that antibody binding to tau's MBD repeat sequences may inhibit tau aggregation and indicate that such antibodies may also degrade preformed tau aggregates. In the presence of anti-tau antibodies, the resulting tau morphologies were antigen-dependent. The results also suggested the possibility of different pathways regulating antibody-mediated inhibition of tau aggregation and antibody-mediated degradation of preformed tau aggregates.

  20. Abnormal phosphoinositide metabolism and protein phosphorylation in platelets from a patient with the grey platelet syndrome.

    PubMed

    Rendu, F; Marche, P; Hovig, T; Maclouf, J; Lebret, M; Tenza, D; Levy-Toledano, S; Caen, J P

    1987-10-01

    Washed platelets isolated from one patient suffering from the inherited grey platelet syndrome were studied during thrombin-induced activation. The agonist-induced changes in (i) morphology, (ii) typical functional cell responses, (iii) membrane phospholipid metabolism and protein phosphorylation were studied and compared with the changes obtained with normal platelets. The morphology of the platelets as visualized by electron microscopy confirmed the almost total absence of intracellular alpha-granules and marked vacuolization. During thrombin stimulation the morphological changes were clearly delayed as compared to normal platelets, the granule centralization and aggregation occurred only 15 s after thrombin addition instead of 5 s in normal platelets. After 15 s, however, even though no alpha-granules were observed, a ring-like structure occurred centrally, indicating that they are not a prerequisite for this reaction. The whole release reaction, i.e. liberation of [14C]serotonin from dense granules and beta-N-acetylglucosaminidase activity from lysosomes, and the thromboxane synthesis were delayed and remained lower than in normal platelets. No thrombin-induced phosphatidyl 4,5-bisphosphate breakdown was measurable on 32P-prelabelled platelets although [32P]phosphatidate formation occurred normally. Phosphorylation time courses of myosin light chain (P20) and of protein P43 (mol wt 43,000) markedly differed from those of controls, being less than half of the normal during the first 15 s and remaining subnormal even after complete aggregation. These results suggest that in platelets devoid of alpha-granules a deficient transmembrane signalling system is likely responsible for the impaired physiological responses.

  1. FTDP-17 mutations in Tau alter the regulation of microtubule dynamics: an "alternative core" model for normal and pathological Tau action.

    PubMed

    LeBoeuf, Adria C; Levy, Sasha F; Gaylord, Michelle; Bhattacharya, Arnab; Singh, Ambuj K; Jordan, Mary Ann; Wilson, Leslie; Feinstein, Stuart C

    2008-12-26

    Mutations affecting either the structure or regulation of the microtubule-associated protein Tau cause neuronal cell death and dementia. However, the molecular mechanisms mediating these deleterious effects remain unclear. Among the most characterized activities of Tau is the ability to regulate microtubule dynamics, known to be essential for proper cell function and viability. Here we have tested the hypothesis that Tau mutations causing neurodegeneration also alter the ability of Tau to regulate the dynamic instability behaviors of microtubules. Using in vitro microtubule dynamics assays to assess average microtubule growth rates, microtubule growth rate distributions, and catastrophe frequencies, we found that all tested mutants possessing amino acid substitutions or deletions mapping to either the repeat or interrepeat regions of Tau do indeed compromise its ability to regulate microtubule dynamics. Further mutational analyses suggest a novel mechanism of Tau regulatory action based on an "alternative core" of microtubule binding and regulatory activities composed of two repeats and the interrepeat between them. In this model, the interrepeat serves as the primary regulator of microtubule dynamics, whereas the flanking repeats serve as tethers to properly position the interrepeat on the microtubule. Importantly, since there are multiple interrepeats on each Tau molecule, there are also multiple cores on each Tau molecule, each with distinct mechanistic capabilities, thereby providing significant regulatory potential. Taken together, the data are consistent with a microtubule misregulation mechanism for Tau-mediated neuronal cell death and provide a novel mechanistic model for normal and pathological Tau action.

  2. Extracellular Vesicles Containing P301L Mutant Tau Accelerate Pathological Tau Phosphorylation and Oligomer Formation but Do Not Seed Mature Neurofibrillary Tangles in ALZ17 Mice.

    PubMed

    Baker, Siân; Polanco, Juan Carlos; Götz, Jϋrgen

    2016-10-04

    In Alzheimer's disease, the distribution of neurofibrillary tangles, a histological hallmark comprised of phosphorylated forms of the protein tau, follows a distinct pattern through anatomically connected brain regions. The well-documented correlation between the severity of tau pathology and disease progression implies a prion-like seeding and spreading mechanism for tau. Experimentally, this has been addressed in transgenic mice by the injection of protein lysates isolated from brains of transgenic mice or patients with tauopathies, including AD, that were shown to behave like seeds, accelerating tau pathology and tangle formation in predisposed mice. More specifically, in vivo data suggest that brain lysates from mice harboring the P301S mutation of tau can seed protein aggregation when injected into the hippocampi of human wild-type tau transgenic ALZ17 mice. Here, we compared the seeding potential of lysates and extracellular vesicles enriched for exosomes (EVs) from wild-type and human P301L tau transgenic rTg4510 mouse brains. We show that transgenic EVs cause increased tau phosphorylation and soluble oligomer formation in a manner comparable to that of freely available proteins in brain lysates, a prerequisite for the formation of mature protein aggregates.

  3. Loss of medial septum cholinergic neurons in THY-Tau22 mouse model: what links with tau pathology?

    PubMed

    Belarbi, K; Burnouf, S; Fernandez-Gomez, F-J; Desmercières, J; Troquier, L; Brouillette, J; Tsambou, L; Grosjean, M-E; Caillierez, R; Demeyer, D; Hamdane, M; Schindowski, K; Blum, D; Buée, L

    2011-09-01

    Alzheimer's disease (AD) is a neurodegenerative disorder histologically defined by the cerebral accumulation of amyloid deposits and neurofibrillary tangles composed of hyperphosphorylated tau proteins. Loss of basal forebrain cholinergic neurons is another hallmark of the disease thought to contribute to the cognitive dysfunctions. To this date, the mechanisms underlying cholinergic neurons degeneration remain uncertain. The present study aimed to investigate the relationship between neurofibrillary degeneration and cholinergic defects in AD using THY-Tau22 transgenic mouse model exhibiting a major hippocampal AD-like tau pathology and hyperphosphorylated tau species in the septohippocampal pathway. Here, we report that at a time THY-Tau22 mice display strong reference memory alterations, the retrograde transport of fluorogold through the septohippocampal pathway is altered. This impairment is associated with a significant reduction in the number of choline acetyltransferase (ChAT)-immunopositive cholinergic neurons in the medial septum. Analysis of nerve growth factor (NGF) levels supports an accumulation of the mature neurotrophin in the hippocampus of THY-Tau22 mice, consistent with a decrease of its uptake or retrograde transport by cholinergic terminals. Finally, our data strongly support that tau pathology could be instrumental in the cholinergic neuronal loss observed in AD.

  4. Appoptosin-Mediated Caspase Cleavage of Tau Contributes to Progressive Supranuclear Palsy Pathogenesis.

    PubMed

    Zhao, Yingjun; Tseng, I-Chu; Heyser, Charles J; Rockenstein, Edward; Mante, Michael; Adame, Anthony; Zheng, Qiuyang; Huang, Timothy; Wang, Xin; Arslan, Pharhad E; Chakrabarty, Paramita; Wu, Chengbiao; Bu, Guojun; Mobley, William C; Zhang, Yun-Wu; St George-Hyslop, Peter; Masliah, Eliezer; Fraser, Paul; Xu, Huaxi

    2015-09-02

    Progressive supranuclear palsy (PSP) is a movement disorder characterized by tau neuropathology where the underlying mechanism is unknown. An SNP (rs1768208 C/T) has been identified as a strong risk factor for PSP. Here, we identified a much higher T-allele occurrence and increased levels of the pro-apoptotic protein appoptosin in PSP patients. Elevations in appoptosin correlate with activated caspase-3 and caspase-cleaved tau levels. Appoptosin overexpression increased caspase-mediated tau cleavage, tau aggregation, and synaptic dysfunction, whereas appoptosin deficiency reduced tau cleavage and aggregation. Appoptosin transduction impaired multiple motor functions and exacerbated neuropathology in tau-transgenic mice in a manner dependent on caspase-3 and tau. Increased appoptosin and caspase-3-cleaved tau were also observed in brain samples of patients with Alzheimer's disease and frontotemporal dementia with tau inclusions. Our findings reveal a novel role for appoptosin in neurological disorders with tau neuropathology, linking caspase-3-mediated tau cleavage to synaptic dysfunction and behavioral/motor defects.

  5. Pesticides induce spatial memory deficits with synaptic impairments and an imbalanced tau phosphorylation in rats.

    PubMed

    Chen, Ning-Ning; Luo, Dan-Ju; Yao, Xiu-Qing; Yu, Cong; Wang, Yi; Wang, Qun; Wang, Jian-Zhi; Liu, Gong-Ping

    2012-01-01

    Pesticides are widely used in agriculture, and epidemiological studies suggest that pesticide exposure is a risk factor for Alzheimer's disease (AD), but the mechanisms are elusive. Here, we studied the effects of pesticide exposure on the cognitive ability and the underlying mechanisms in rats. Deltamethrin and carbofuran were administered respectively into the rats once a day for 28 days by gavage. We found that pesticide exposure induced spatial learning and memory deficits with a simultaneous decrease of N-methyl-D-aspartate receptor 1, synaptophysin, and synapsin I, all of which are memory-related synaptic proteins. Pesticide exposure also induced tau hyperphosphorylation at multiple AD-related phosphorylation sites with activation of glycogen synthase kinase-3β and inhibition of protein phosphatase-2A. Additionally, neuron loss in the hippocampus and cortex was observed upon administration of the pesticides. These results indicate that the pesticides exposure could induce AD-like pathology and cognitive abnormality in rats.

  6. Abnormal spermatogenesis and male infertility in testicular zinc finger protein Zfp318-knockout mice.

    PubMed

    Ishizuka, Masamichi; Ohtsuka, Eri; Inoue, Atsuto; Odaka, Mirei; Ohshima, Hirotaka; Tamura, Norihisa; Yoshida, Kaoru; Sako, Norihisa; Baba, Tadashi; Kashiwabara, Shin-Ichi; Okabe, Masaru; Noguchi, Junko; Hagiwara, Hiromi

    2016-09-01

    Zfp318, a mouse gene with a Cys2/His2 zinc finger motif, is mainly expressed in germ cells in the testis. It encodes two alternative transcripts, which regulate androgen receptor-mediated transcriptional activation or repression by overexpression of them. However, the role of Zfp318 is still obscure in vivo, especially in spermatogenesis. To elucidate the role of Zfp318 during gamete production, we established a knockout mouse line. Zfp318-null male mice exhibited infertility, whereas Zfp318-null female mice displayed normal fertility. ZFP318 was expressed during multiple stages of spermatogenesis, from spermatocytes to round spermatids. The nuclei of secondary spermatocytes showed high levels of expression. Histological analysis and quantitative analysis of DNA content showed decreased numbers of both spermatids in the seminiferous tubules and mature spermatozoa in the epididymides of Zfp318-null mice. These results suggest that Zfp318 is expressed as a functional protein in testicular germ cells and plays an important role in meiosis during spermatogenesis.

  7. Mechanisms of Tau and Aβ-induced Excitotoxicity

    PubMed Central

    Pallo, Susanne P.; DiMaio, John; Cook, Alexis; Nilsson, Bradley; Johnson, Gail V.W.

    2016-01-01

    Excitotoxicity was originally postulated to be a late stage side effect of Alzheimer’s disease (AD)-related neurodegeneration, however more recent studies indicate that it may occur early in AD and contribute to the neurodegenerative process. Tau and amyloid beta (Aβ), the main components of neurofibrillary tangles (NFTs) and amyloid plaques, have been implicated in cooperatively and independently facilitating excitotoxicity. Our study investigated the roles of tau and Aβ in AD-related excitotoxicity. In vivo studies showed that tau knockout (tau−/−) mice were significantly protected from seizures and hippocampal superoxide production induced with the glutamate analog, kainic acid (KA). We hypothesized that tau accomplished this by facilitating KA-induced Ca2+ influx into neurons, however lentiviral tau knockdown failed to ameliorate KA-induced Ca2+ influx into primary rat cortical neurons. We further investigated if tau cooperated with Aβ to facilitate KA-induced Ca2+ influx. While Aβ biphasically modulated the KA-induced Ca2+cyt responses, tau knockdown continued to have no effect. Therefore, tau facilitates KA-induced seizures and superoxide production in a manner that does not involve facilitation of Ca2+ influx through KA receptors (KAR). On the other hand, acute pretreatment with Aβ (10 minutes) enhanced KA-induced Ca2+ influx, while chronic Aβ (24 hours) significantly reduced it, regardless of tau knockdown. Given previously published connections between Aβ, group 1 metabotropic glutamate receptors (mGluRs), and KAR regulation, we hypothesized that Aβ modulates KAR via a G-protein coupled receptor pathway mediated by group 1 mGluRs. We found that Aβ did not activate group 1 mGluRs and inhibition of these receptors did not reverse Aβ modulation of KA-induced Ca2+ influx. Therefore, Aβ biphasically regulates KAR via a mechanism that does not involve group 1 mGluR activation. PMID:26731336

  8. Abnormal Sensory Protein Expression and Urothelial Dysfunction in Ketamine-Related Cystitis in Humans

    PubMed Central

    2016-01-01

    Purpose The aim of this study was to analyze patterns of sensory protein expression and urothelial dysfunction in ketamine-related cystitis (KC) in humans. Methods Biopsies of bladder mucosa were performed in 29 KC patients during cystoscopy. Then specimens were analyzed for tryptase, zonula occludens-1 (ZO-1), E-cadherin, and terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) with immunofluorescence staining and quantification. In addition, 10 healthy control bladder specimens were analyzed and compared with the KC specimens. Another 16 whole bladder specimens obtained from partial cystectomy were also analyzed for the muscarinic receptors M2 and M3, endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS), β-3 adrenergic receptors (β3-ARs), and the P2X3 receptor by western blotting. In addition, 3 normal control bladder specimens were analyzed and compared with the KC specimens. Results The KC bladder mucosa revealed significantly less expression of ZO-1 and E-cadherin, and greater expression of TUNEL and tryptase activity than the control samples. The expression of M3 and β3-AR in the KC specimens was significantly greater than in the controls. The expression of iNOS, eNOS, M2, and P2X3 was not significantly different between the KC and control specimens. Conclusions The bladder tissue of KC patients revealed significant urothelial dysfunction, which was associated with mast-cell mediated inflammation, increased urothelial cell apoptosis, and increased expression of the M3 and β3-AR. PMID:27706016

  9. Tau identification at the Tevatron

    SciTech Connect

    Levy, Stephen; /Chicago U., EFI

    2005-07-01

    Methods for reconstructing and identifying the hadronic decays of tau leptons with the CDF and D0 detectors at the Fermilab Tevatron collider in Run II are described. Precision electroweak measurements of W and Z gauge boson cross sections are presented as well as results of searches for physics beyond the Standard Model with hadronically decaying tau leptons in the final state.

  10. Production of O-GlcNAc Modified Recombinant Tau in E. coli and Detection of Ser400 O-GlcNAc Tau In Vivo.

    PubMed

    Yuzwa, Scott A; Vocadlo, David J

    2017-01-01

    Assembly of the microtubule-associated protein tau (tau) into paired helical filaments that ultimately give rise to neurofibrillary tangles (NFTs) makes up one half of the two hallmark pathologies of Alzheimer's disease (AD). Tau has been shown to be modified with O-linked N-acetylglucosamine residues (O-GlcNAc), which is the modification of serine and threonine residues of nucleocytoplasmic proteins with N-acetyl-D-glucosamine (GlcNAc) moieties. Increasing O-GlcNAc in mouse models of tauopathy has been shown to hinder the progression of symptoms in these mice and impair the aggregation of tau into NFTs. In order to study how O-GlcNAc on tau may contribute to the protective effects observed in tauopathy mouse models, it is beneficial to study O-GlcNAc modified tau in vitro. Here we describe a method for producing, purifying and enriching recombinant tau that is O-GlcNAc modified. These methods have enabled the identification of O-GlcNAc modification sites on tau including Ser400. We further describe the detection of Ser400 O-GlcNAc on tau from brain lysates.

  11. Structure and mechanism of action of tau aggregation inhibitors

    PubMed Central

    Cisek, Katryna; Cooper, Grace L.; Huseby, Carol J.; Kuret, Jeff

    2015-01-01

    Since the discovery of phenothiazines as tau protein aggregation inhibitors, many additional small molecule inhibitors of diverse chemotype have been discovered and characterized in biological model systems. Although direct inhibition of tau aggregation has shown promise as a potential treatment strategy for depressing neurofibrillary lesion formation in Alzheimer’s disease, the mechanism of action of these compounds has been unclear. However, recent studies have found that tau aggregation antagonists exert their effects through both covalent and non-covalent means, and have identified associated potency and selectivity driving features. Here we review small-molecule tau aggregation inhibitors with a focus on compound structure and inhibitory mechanism. The elucidation of inhibitory mechanism has implications for maximizing on-target efficacy while minimizing off-target side effects. PMID:25387336

  12. Effects of interferon-tau on cattle persistently infected with bovine viral diarrhea virus.

    PubMed

    Kohara, Junko; Nishikura, Yumiko; Konnai, Satoru; Tajima, Motoshi; Onuma, Misao

    2012-08-01

    In this study, the antiviral effects of bovine interferon-tau (boIFN-tau) on bovine viral diarrhea virus (BVDV) were examined in vitro and in vivo. In the in vitro experiments, the replication of cytopathic and non-cytopathic BVDV was inhibited in the bovine cells treated with boIFN-tau. The replication of BVDV was completely suppressed by boIFN-tau at a concentration higher than 10(2) U/ml. In order to examine the effect of boIFN-tau on virus propagation in cattle persistently infected (PI) with non-cytopathic BVDV, boIFN-tau was subcutaneously administered to PI cattle at 10(5) U/kg or 10(6) U/kg body weight 5 times per week for 2 weeks. No physical abnormality such as depression was observed in the cattle during the experiment. The mean BVDV titers in the serum of the PI cattle decreased slightly during the boIFN-tau administration period with the dose of 10(6) U/kg. However, the BVDV titers in the serum returned to the pre-administration level after the final boIFN-tau administration. These results suggest that boIFN-tau demonstrates an anti-BVDV effect, reducing the BVDV level in serum transiently when injected into PI cattle.

  13. Using Human iPSC-Derived Neurons to Model TAU Aggregation.

    PubMed

    Verheyen, An; Diels, Annick; Dijkmans, Joyce; Oyelami, Tutu; Meneghello, Giulia; Mertens, Liesbeth; Versweyveld, Sofie; Borgers, Marianne; Buist, Arjan; Peeters, Pieter; Cik, Miroslav

    2015-01-01

    Alzheimer's disease and frontotemporal dementia are amongst the most common forms of dementia characterized by the formation and deposition of abnormal TAU in the brain. In order to develop a translational human TAU aggregation model suitable for screening, we transduced TAU harboring the pro-aggregating P301L mutation into control hiPSC-derived neural progenitor cells followed by differentiation into cortical neurons. TAU aggregation and phosphorylation was quantified using AlphaLISA technology. Although no spontaneous aggregation was observed upon expressing TAU-P301L in neurons, seeding with preformed aggregates consisting of the TAU-microtubule binding repeat domain triggered robust TAU aggregation and hyperphosphorylation already after 2 weeks, without affecting general cell health. To validate our model, activity of two autophagy inducers was tested. Both rapamycin and trehalose significantly reduced TAU aggregation levels suggesting that iPSC-derived neurons allow for the generation of a biologically relevant human Tauopathy model, highly suitable to screen for compounds that modulate TAU aggregation.

  14. Using Human iPSC-Derived Neurons to Model TAU Aggregation

    PubMed Central

    Verheyen, An; Diels, Annick; Dijkmans, Joyce; Oyelami, Tutu; Meneghello, Giulia; Mertens, Liesbeth; Versweyveld, Sofie; Borgers, Marianne; Buist, Arjan; Peeters, Pieter; Cik, Miroslav

    2015-01-01

    Alzheimer’s disease and frontotemporal dementia are amongst the most common forms of dementia characterized by the formation and deposition of abnormal TAU in the brain. In order to develop a translational human TAU aggregation model suitable for screening, we transduced TAU harboring the pro-aggregating P301L mutation into control hiPSC-derived neural progenitor cells followed by differentiation into cortical neurons. TAU aggregation and phosphorylation was quantified using AlphaLISA technology. Although no spontaneous aggregation was observed upon expressing TAU-P301L in neurons, seeding with preformed aggregates consisting of the TAU-microtubule binding repeat domain triggered robust TAU aggregation and hyperphosphorylation already after 2 weeks, without affecting general cell health. To validate our model, activity of two autophagy inducers was tested. Both rapamycin and trehalose significantly reduced TAU aggregation levels suggesting that iPSC-derived neurons allow for the generation of a biologically relevant human Tauopathy model, highly suitable to screen for compounds that modulate TAU aggregation. PMID:26720731

  15. Blocking protein farnesylation improves nuclear shape abnormalities in keratinocytes of mice expressing the prelamin A variant in Hutchinson-Gilford progeria syndrome.

    PubMed

    Wang, Yuexia; Ostlund, Cecilia; Worman, Howard J

    2010-01-01

    Hutchinson-Gilford progeria syndrome (HGPS) is an accelerated aging disorder caused by mutations in LMNA leading to expression of a truncated prelamin A variant termed progerin. Whereas a farnesylated polypeptide is normally removed from the carboxyl-terminus of prelamin A during endoproteolytic processing to lamin A, progerin lacks the cleavage site and remains farnesylated. Cultured cells from human subjects with HGPS and genetically modified mice expressing progerin have nuclear morphological abnormalities, which are reversed by inhibitors of protein farnesylation. In addition, treatment with protein farnesyltransferase inhibitors improves whole animal phenotypes in mouse models of HGPS. However, improvement in nuclear morphology in tissues after treatment of animals has not been demonstrated. We therefore treated transgenic mice that express progerin in epidermis with the protein farnesyltransferase inhibitor FTI-276 or a combination of pravastatin and zoledronate to determine if they reversed nuclear morphological abnormalities in tissue. Immunofluorescence microscopy and "blinded" electron microscopic analysis demonstrated that systemic administration of FTI-276 or pravastatin plus zoledronate significantly improved nuclear morphological abnormalities in keratinocytes of transgenic mice. These results show that pharmacological blockade of protein prenylation reverses nuclear morphological abnormalities that occur in HGPS in vivo. They further suggest that skin biopsy may be useful to determine if protein farnesylation inhibitors are exerting effects in subjects with HGPS in clinical trials.

  16. 7,8-Dihydroxyflavone Ameliorates Cognitive Impairment by Inhibiting Expression of Tau Pathology in ApoE-Knockout Mice

    PubMed Central

    Tan, Yang; Nie, Shuke; Zhu, Wende; Liu, Fang; Guo, Hailong; Chu, Jiewen; Cao, Xue B.; Jiang, Xingjun; Zhang, Yunjian; Li, Yuzhen

    2016-01-01

    7,8-Dihydroxyflavone (7,8-DHF), a tyrosine kinase B agonist that mimics the neuroprotective properties of brain-derived neurotrophic factor, which can not efficiently deliver into the brain, has been reported to be useful in ameliorating cognitive impairment in many diseases. Researches have indicated that apolipoprotein E-knockout (ApoE-KO) mouse was associated with cognitive alteration via various mechanisms. Our present study investigated the possible mechanisms of cognitive impairment of ApoE-KO mouse fed with western type diet and the protective effects of 7,8-DHF in improving spatial learning and memory in ApoE-KO mouse. Five-weeks-old ApoE-KO mice and C57BL/6 mice were chronically treated with 7,8-DHF (with a dosage of 5 mg/kg) or vehicles orally for 25 weeks, and then subjected to Morris water maze at the age of 30 weeks to evaluate the cognitive performances. Afterward, histology analysis and western blotting were performed. Spatial learning and memory deficits were observed in ApoE-KO mice, which were consistent with higher expression of active-asparaginyl endopeptidase (active-AEP) as well as AEP-derived truncated tau N368 compared with normal group. In addition to that, long-term treatment of 7,8-DHF dramatically ameliorated cognitive decline in ApoE-KO mice, accompanied by the activation in phosphorylated protein kinase B (Akt)/glycogen synthase kinase-3β (GSK-3β) pathway and down-regulated expression of tau S396 and PHF-tau (phosphorylated tau at ser396 and ser404 epitope). These findings suggested that cognitive impairment of ApoE-KO mouse might associate with tau pathology and 7,8-DHF could activate AKT and then phosphorylate its downstream molecule to inhibit expression of abnormal tau, meanwhile, 7,8-DHF could reduce the expression of active-AEP and then inhibit production of truncated tau N368. PMID:27965573

  17. Fragile X-like behaviors and abnormal cortical dendritic spines in cytoplasmic FMR1-interacting protein 2-mutant mice.

    PubMed

    Han, Kihoon; Chen, Hogmei; Gennarino, Vincenzo A; Richman, Ronald; Lu, Hui-Chen; Zoghbi, Huda Y

    2015-04-01

    Silencing of fragile X mental retardation 1 (FMR1) gene and loss of fragile X mental retardation protein (FMRP) cause fragile X syndrome (FXS), a genetic disorder characterized by intellectual disability and autistic behaviors. FMRP is an mRNA-binding protein regulating neuronal translation of target mRNAs. Abnormalities in actin-rich dendritic spines are major neuronal features in FXS, but the molecular mechanism and identity of FMRP targets mediating this phenotype remain largely unknown. Cytoplasmic FMR1-interacting protein 2 (Cyfip2) was identified as an interactor of FMRP, and its mRNA is a highly ranked FMRP target in mouse brain. Importantly, Cyfip2 is a component of WAVE regulatory complex, a key regulator of actin cytoskeleton, suggesting that Cyfip2 could be implicated in the dendritic spine phenotype of FXS. Here, we generated and characterized Cyfip2-mutant (Cyfip2(+/-)) mice. We found that Cyfip2(+/-) mice exhibited behavioral phenotypes similar to Fmr1-null (Fmr1(-/y)) mice, an animal model of FXS. Synaptic plasticity and dendritic spines were normal in Cyfip2(+/-) hippocampus. However, dendritic spines were altered in Cyfip2(+/-) cortex, and the dendritic spine phenotype of Fmr1(-/y) cortex was aggravated in Fmr1(-/y); Cyfip2(+/-) double-mutant mice. In addition to the spine changes at basal state, metabotropic glutamate receptor (mGluR)-induced dendritic spine regulation was impaired in both Fmr1(-/y) and Cyfip2(+/-) cortical neurons. Mechanistically, mGluR activation induced mRNA translation-dependent increase of Cyfip2 in wild-type cortical neurons, but not in Fmr1(-/y) or Cyfip2(+/-) neurons. These results suggest that misregulation of Cyfip2 function and its mGluR-induced expression contribute to the neurobehavioral phenotypes of FXS.

  18. Alveolar abnormalities

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/001093.htm Alveolar abnormalities To use the sharing features on this page, please enable JavaScript. Alveolar abnormalities are changes in the tiny air sacs in ...

  19. Nail abnormalities

    MedlinePlus

    Beau's lines; Fingernail abnormalities; Spoon nails; Onycholysis; Leukonychia; Koilonychia; Brittle nails ... 2012:chap 71. Zaiac MN, Walker A. Nail abnormalities associated with systemic pathologies. Clin Dermatol . 2013;31: ...

  20. CP violation in hadronic {tau} decays

    SciTech Connect

    Datta, Alakabha; Kiers, Ken; London, David; Szynkman, Alejandro; O'Donnell, Patrick J.

    2007-04-01

    We reexamine CP violation in the {delta}S=0 decays {tau}{yields}N{pi}{nu}{sub {tau}} (N=2,3,4). We assume that the new physics (NP) is a charged Higgs boson. We show that there is no NP contribution to {tau}{yields}{pi}{pi}{nu}{sub {tau}}, which means that no CP violation is expected in this decay. On the other hand, NP can contribute to {tau}{yields}N{pi}{nu}{sub {tau}} (N=3,4). These are dominated by the intermediate resonant decays {tau}{yields}{omega}{pi}{nu}{sub {tau}}, {tau}{yields}{rho}{pi}{nu}{sub {tau}}, and {tau}{yields}a{sub 1}{pi}{nu}{sub {tau}}. We show that the only sizeable CP-violating effects which are possible are in {tau}{yields}a{sub 1}{pi}{nu}{sub {tau}}{yields}4{pi}{nu}{sub {tau}} (polarization-dependent rate asymmetry) and {tau}{yields}{omega}{pi}{nu}{sub {tau}} (triple-product asymmetry)

  1. A Novel, Ultrasensitive Assay for Tau: Potential for Assessing Traumatic Brain Injury in Tissues and Biofluids

    PubMed Central

    Chang, Binggong; Davies, Peter; Wagner, Amy K.; Robertson, Claudia S.; Wang, Kevin K.W.

    2015-01-01

    Abstract Traumatic brain injury (TBI) is a cause of death and disability and can lead to tauopathy-related dementia at an early age. Pathologically, TBI results in axonal injury that is coupled to tau hyperphosphorylation, leading to microtubule instability and tau-mediated neurodegeneration. This suggests that the forms of this protein might serve as neuroinjury-related biomarkers for diagnosis of injury severity and prognosis of the neurological damage prior to clinical expression. We initially determined whether we could detect tau in body fluids using a highly sensitive assay. We used a novel immunoassay, enhanced immunoassay using multi-arrayed fiberoptics (EIMAF) either alone or in combination with rolling circle amplification (a-EIMAF) for the detection of total (T) and phosphorylated (P) tau proteins from brains and biofluids (blood, CSF) of rodents following controlled cortical impact (CCI) and human patients post severe TBI (sTBI). This assay technology for tau is the most sensitive to date with a detection limit of approximately 100 ag/mL for either T-tau and P-tau. In the rodent models, T-tau and P-tau levels in brain and blood increased following CCI during the acute phase and remained high during the chronic phase (30 d). In human CSF samples, T-tau and P-tau increased during the sampling period (5–6 d). T-tau and P-tau in human serum rose during the acute phase and decreased during the chronic stage but was still detectable beyond six months post sTBI. Thus, EIMAF has the potential for assessing both the severity of the proximal injury and the prognosis using easily accessible samples. PMID:25177776

  2. Tau Deletion Prevents Stress-Induced Dendritic Atrophy in Prefrontal Cortex: Role of Synaptic Mitochondria.

    PubMed

    Lopes, Sofia; Teplytska, Larysa; Vaz-Silva, Joao; Dioli, Chrysoula; Trindade, Rita; Morais, Monica; Webhofer, Christian; Maccarrone, Giuseppina; Almeida, Osborne F X; Turck, Christoph W; Sousa, Nuno; Sotiropoulos, Ioannis; Filiou, Michaela D

    2016-04-12

    Tau protein in dendrites and synapses has been recently implicated in synaptic degeneration and neuronal malfunction. Chronic stress, a well-known inducer of neuronal/synaptic atrophy, triggers hyperphosphorylation of Tau protein and cognitive deficits. However, the cause-effect relationship between these events remains to be established. To test the involvement of Tau in stress-induced impairments of cognition, we investigated the impact of stress on cognitive behavior, neuronal structure, and the synaptic proteome in the prefrontal cortex (PFC) of Tau knock-out (Tau-KO) and wild-type (WT) mice. Whereas exposure to chronic stress resulted in atrophy of apical dendrites and spine loss in PFC neurons as well as significant impairments in working memory in WT mice, such changes were absent in Tau-KO animals. Quantitative proteomic analysis of PFC synaptosomal fractions, combined with transmission electron microscopy analysis, suggested a prominent role for mitochondria in the regulation of the effects of stress. Specifically, chronically stressed animals exhibit Tau-dependent alterations in the levels of proteins involved in mitochondrial transport and oxidative phosphorylation as well as in the synaptic localization of mitochondria in PFC. These findings provide evidence for a causal role of Tau in mediating stress-elicited neuronal atrophy and cognitive impairment and indicate that Tau may exert its effects through synaptic mitochondria.

  3. Caspase-mediated cleavage of C53/LZAP protein causes abnormal microtubule bundling and rupture of the nuclear envelope.

    PubMed

    Wu, Jianchun; Jiang, Hai; Luo, Shouqing; Zhang, Mingsheng; Zhang, Yinghua; Sun, Fei; Huang, Shuang; Li, Honglin

    2013-05-01

    Apoptotic nucleus undergoes distinct morphological and biochemical changes including nuclear shrinkage, chromatin condensation and DNA fragmentation, which are attributed to caspase-mediated cleavage of several nuclear substrates such as lamins. As most of active caspases reside in the cytoplasm, disruption of the nuclear-cytoplasmic barrier is essential for caspases to reach their nuclear targets. The prevailing proposed mechanism is that the increase in the permeability of nuclear pores induced by caspases allows the caspases and other apoptotic factors to diffuse into the nucleus, thereby resulting in the nuclear destruction. Here, we report a novel observation that physical rupture of the nuclear envelope (NE) occurs in the early stage of apoptosis. We found that the NE rupture was caused by caspase-mediated cleavage of C53/LZAP, a protein that has been implicated in various signaling pathways, including NF-κB signaling and DNA damage response, as well as tumorigenesis and metastasis. We also demonstrated that C53/LZAP bound indirectly to the microtubule (MT), and expression of the C53/LZAP cleavage product caused abnormal MT bundling and NE rupture. Taken together, our findings suggest a novel role of C53/LZAP in the regulation of MT dynamics and NE structure during apoptotic cell death. Our study may provide an additional mechanism for disruption of the nuclear-cytoplasmic barrier during apoptosis.

  4. Caspase-mediated cleavage of C53/LZAP protein causes abnormal microtubule bundling and rupture of the nuclear envelope

    PubMed Central

    Wu, Jianchun; Jiang, Hai; Luo, Shouqing; Zhang, Mingsheng; Zhang, Yinghua; Sun, Fei; Huang, Shuang; Li, Honglin

    2013-01-01

    Apoptotic nucleus undergoes distinct morphological and biochemical changes including nuclear shrinkage, chromatin condensation and DNA fragmentation, which are attributed to caspase-mediated cleavage of several nuclear substrates such as lamins. As most of active caspases reside in the cytoplasm, disruption of the nuclear-cytoplasmic barrier is essential for caspases to reach their nuclear targets. The prevailing proposed mechanism is that the increase in the permeability of nuclear pores induced by caspases allows the caspases and other apoptotic factors to diffuse into the nucleus, thereby resulting in the nuclear destruction. Here, we report a novel observation that physical rupture of the nuclear envelope (NE) occurs in the early stage of apoptosis. We found that the NE rupture was caused by caspase-mediated cleavage of C53/LZAP, a protein that has been implicated in various signaling pathways, including NF-κB signaling and DNA damage response, as well as tumorigenesis and metastasis. We also demonstrated that C53/LZAP bound indirectly to the microtubule (MT), and expression of the C53/LZAP cleavage product caused abnormal MT bundling and NE rupture. Taken together, our findings suggest a novel role of C53/LZAP in the regulation of MT dynamics and NE structure during apoptotic cell death. Our study may provide an additional mechanism for disruption of the nuclear-cytoplasmic barrier during apoptosis. PMID:23478299

  5. Development of tau aggregation inhibitors for Alzheimer's disease.

    PubMed

    Bulic, Bruno; Pickhardt, Marcus; Schmidt, Boris; Mandelkow, Eva-Maria; Waldmann, Herbert; Mandelkow, Eckhard

    2009-01-01

    A variety of human diseases are suspected to be directly linked to protein misfolding. Highly organized protein aggregates, called amyloid fibrils, and aggregation intermediates are observed; these are considered to be mediators of cellular toxicity and thus attract a great deal of attention from investigators. Neurodegenerative pathologies such as Alzheimer's disease account for a major part of these protein misfolding diseases. The last decade has witnessed a renaissance of interest in inhibitors of tau aggregation as potential disease-modifying drugs for Alzheimer's disease and other "tauopathies". The recent report of a phase II clinical trial with the tau aggregation inhibitor MTC could hold promise for the validation of the concept. This Review summarizes the available data concerning small-molecule inhibitors of tau aggregation from a medicinal chemistry point of view.

  6. Induction of intracellular tau aggregation is promoted by α-synuclein seeds, and provides novel insights into the hyperphosphorylation of tau

    PubMed Central

    Waxman, Elisa A.; Giasson, Benoit I.

    2011-01-01

    Intracytoplasmic proteinaceous inclusions, primarily composed of tau or α-synuclein (α-syn), are predominant pathological features of Alzheimer’s disease (AD) and Parkinson’s disease (PD), respectively. However, the co-existence of these pathological aggregates is identified in many neurodegenerative disorders, including spectrum disorders of AD and PD. While α-syn can spontaneously polymerize into amyloidogenic fibrils, in vitro, tau polymerization requires an inducing agent. The current study presents a human-derived cellular model, in which recombinant, pre-formed α-syn fibrils cross-seed intracellular tau to promote the formation of neurofibrillary tangle-like aggregates. These aggregates were hyperphosphorylated, Triton-insoluble, and thioflavin S-positive, either co-mingling with endogenously expressed α-syn aggregates, or induced by only exogenously applied recombinant α-syn fibrils. Further, filamentous, amyloidogenic tau took over the cellular soma, displacing the nucleus and isolating or displacing organelles, likely preventing cellular function. While a significant proportion of wild-type tau formed these cellular inclusions, the P301L mutation in tau increased aggregation propensity resulting from α-syn seeds to over 50% of total tau protein. The role of phosphorylation on the development of these tau aggregates was investigated by co-expressing glycogen synthase kinase 3 beta or MAP/microtubule affinity-regulating kinase 2. Expression of either kinase inhibited the formation of α-syn-induced tau aggregates. Analyses of phosphorylation sites suggest that multiple complex factors may be associated with this effect, and that Triton-soluble versus Triton-insoluble tau may be independently targeted by kinases. The current work not only provides an exceptional cellular model of tau pathology, but also examines α-syn-induced tau inclusion formation and provides novel insights into hyperphosphorylation observed in disease. PMID:21613474

  7. Photometric and spectroscopic monitoring of AA Tau, DN Tau, UX Tau A, T Tau, RY Tau, Lk Ca 4, and Lk Ca 7

    NASA Technical Reports Server (NTRS)

    Vrba, F. J.; Chugainov, P. F.; Weaver, W. B.; Stauffer, J. S.

    1993-01-01

    We report the results of a UBVRI photometric monitoring campaign for three classical T Tauri stars (AA Tau, DN Tau, and UX Tau A) and two weak emission line T Tauri stars (Lk Ca 4 and Lk Ca 7). Observations were obtained at three sites during a core observing period spanning UT 1985 October 14 through UT 1985 December 25, with additional observations continuing until UT 1986 April 6. Concurrent spectrophotometric observations were obtained for all main program stars except Lk Ca 7 and additionally for T Tau, RW Aur, and RY Tau. Periodic photometric variability, assumed to be the stars' rotation periods, were found for AA Tau, DN Tau, Lk Ca 4, and Lk Ca 7, respectively, as 8.2, 6.3, 3.4, and 5.7 days. Several U-filter flares were observed for Lk Ca 4 and Lk Ca 7, which are strongly concentrated toward phases of minimum light. Correlations are found between H-alpha line strengths and V magnitudes for AA Tau and RY Tau. An analysis of absolute color variations of classical T Tauri stars confirms that hot spots are the predominant cause of these stars' variability. Our overall results are consistent with earlier findings that long-lived cool spots are responsible for most of the variability found for weak-emission T Tauri stars, while temporal hot spots are primarily responsible for the observed variability found in classical T Tauri stars.

  8. Halting of Caspase Activity Protects Tau from MC1-Conformational Change and Aggregation.

    PubMed

    Mead, Emma; Kestoras, Dimitra; Gibson, Yolanda; Hamilton, Lucy; Goodson, Ross; Jones, Sophie; Eversden, Sarah; Davies, Peter; O'Neill, Michael; Hutton, Michael; Szekeres, Philip; Wolak, Joanna

    2016-10-18

    Intracellular neurofibrillary tangles (NFTs) are the hallmark of Alzheimer's disease and other tauopathies in which tau, a microtubule-associated protein, loses its ability to stabilize microtubules. Several post-translational modifications including phosphorylation and truncation increase tau's propensity to aggregate thus forming NFTs; however, the mechanisms underlying tau conformational change and aggregation still remain to be defined. Caspase activation and subsequent proteolytic cleavage of tau is thought to be a potential trigger of this disease-related pathological conformation. The aim of this work was to investigate the link between caspase activation and a disease-related conformational change of tau in a neuroblastoma cell-based model of spontaneous tau aggregation. We demonstrated that caspase induction initiates proteolytic cleavage of tau and generation of conformationally altered and aggregated tau recognized by the MC1 conformational antibody. Most importantly, these events were shown to be attenuated with caspase inhibitors. This implies that therapeutics aimed at inhibiting caspase-mediated tau cleavage may prove beneficial in slowing cleavage and aggregation, thus potentially halting tau pathology and disease progression.

  9. Tau Acts as a Mediator for Alzheimer's Disease-Related Synaptic Deficits

    PubMed Central

    Liao, Dezhi; Miller, Eric C.; Teravskis, Peter J.

    2014-01-01

    The two histopathological hallmarks of Alzheimer's disease (AD) are amyloid plaques containing multiple forms of Aβ and neurofibrillary tangles containing phosphorylated tau proteins. As mild cognitive impairment frequently occurs long before the clinical diagnosis of Alzheimer's disease, the scientific community has been increasingly interested in the roles of Aβ and tau in earlier cellular changes that lead to functional deficits. Therefore, great progress has recently been made in understanding how Aβ or tau causes synaptic dysfunction. However, the interaction between the Aβ and tau-initiated intracellular cascades that lead to synaptic dysfunction remains elusive. The cornerstone of the two decade-old hypothetical amyloid cascade model is that amyloid pathologies precede tau pathologies. Although the premise of Aβ-tau pathway remains valid, the model keeps evolving as new signaling events are discovered that lead to functional deficits and neurodegeneration. Recent progress has been made in understanding Aβ-PrPC-Fyn-mediated neurotoxicity and synaptic deficits. Although still elusive, many novel upstream and downstream signaling molecules have been found to modulate tau mislocalization and tau hyperphosphorylation. Here we will discuss the mechanistic interactions between Aβ-PrPC-mediated neurotoxicity and tau-mediated synaptic deficits in an updated amyloid cascade model with calcium and tau as the central mediators. PMID:24712999

  10. Autophagic degradation of tau in primary neurons and its enhancement by trehalose.

    PubMed

    Krüger, Ulrike; Wang, Yipeng; Kumar, Satish; Mandelkow, Eva-Maria

    2012-10-01

    Modulating the tau level may represent a therapeutic target for Alzheimer's disease (AD), as accumulating evidence shows that Abeta-induced neurodegeneration is mediated by tau. It is therefore important to understand the expression and degradation of tau in neurons. Recently we showed that overexpressed mutant tau and tau aggregates are degraded via the autophagic pathway in an N2a cell model. Here we investigated whether autophagy is involved in the degradation of endogenous tau in cultured primary neurons. We activated this pathway in primary neurons with trehalose, an enhancer of autophagy. This resulted in the reduction of endogenous tau protein. Tau phosphorylation at several sites elevated in AD pathology had little influence on its degradation by autophagy. Furthermore, by using a neuronal cell model of tauopathy, we showed that activation of autophagy suppresses tau aggregation and eliminates cytotoxicity. Notably, apart from activating autophagy, trehalose also inhibits tau aggregation directly. Thus, trehalose may be a good candidate for developing therapeutic strategies for AD and other tauopathies.

  11. Stages and Conformations of the Tau Repeat Domain during Aggregation and Its Effect on Neuronal Toxicity*

    PubMed Central

    Kumar, Satish; Tepper, Katharina; Kaniyappan, Senthilvelrajan; Biernat, Jacek; Wegmann, Susanne; Mandelkow, Eva-Maria; Müller, Daniel J.; Mandelkow, Eckhard

    2014-01-01

    Several neurodegenerative diseases are characterized by the aggregation and posttranslational modifications of Tau protein. Its “repeat domain” (TauRD) is mainly responsible for the aggregation properties, and oligomeric forms are thought to dominate the toxic effects of Tau. Here we investigated the conformational transitions of this domain during oligomerization and aggregation in different states of β-propensity and pseudo-phosphorylation, using several complementary imaging and spectroscopic methods. Although the repeat domain generally aggregates more readily than full-length Tau, its aggregation was greatly slowed down by phosphorylation or pseudo-phosphorylation at the KXGS motifs, concomitant with an extended phase of oligomerization. Analogous effects were observed with pro-aggregant variants of TauRD. Oligomers became most evident in the case of the pro-aggregant mutant TauRDΔK280, as monitored by atomic force microscopy, and the fluorescence lifetime of Alexa-labeled Tau (time-correlated single photon counting (TCSPC)), consistent with its pronounced toxicity in mouse models. In cell models or primary neurons, neither oligomers nor fibrils of TauRD or TauRDΔK280 had a toxic effect, as seen by assays with lactate dehydrogenase and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, respectively. However, oligomers of pro-aggregant TauRDΔK280 specifically caused a loss of spine density in differentiated neurons, indicating a locally restricted impairment of function. PMID:24825901

  12. Potent inhibition of tau fibrillization with a multivalent ligand

    SciTech Connect

    Honson, Nicolette S.; Jensen, Jordan R.; Darby, Michael V.; Kuret, Jeff

    2007-11-09

    Small-molecule inhibitors of tau fibrillization are under investigation as tools for interrogating the tau aggregation pathway and as potential therapeutic agents for Alzheimer's disease. Established inhibitors include thiacarbocyanine dyes, which can inhibit recombinant tau fibrillization in the presence of anionic surfactant aggregation inducers. In an effort to increase inhibitory potency, a cyclic bis-thiacarbocyanine molecule containing two thiacarbocyanine moieties was synthesized and characterized with respect to tau fibrillization inhibitory activity by electron microscopy and ligand aggregation state by absorbance spectroscopy. Results showed that the inhibitory activity of the bis-thiacarbocyanine was qualitatively similar to a monomeric cyanine dye, but was more potent with 50% inhibition achieved at {approx}80 nM concentration. At all concentrations tested in aqueous solution, the bis-thiacarbocyanine collapsed to form a closed clamshell structure. However, the presence of tau protein selectively stabilized the open conformation. These results suggest that the inhibitory activity of bis-thiacarbocyanine results from multivalency, and reveal a route to more potent tau aggregation inhibitors.

  13. Tau Isoform Composition Influences Rate and Extent of Filament Formation*

    PubMed Central

    Zhong, Qi; Congdon, Erin E.; Nagaraja, Haikady N.; Kuret, Jeff

    2012-01-01

    The risk of developing tauopathic neurodegenerative disease depends in part on the levels and composition of six naturally occurring Tau isoforms in human brain. These proteins, which form filamentous aggregates in disease, vary only by the presence or absence of three inserts encoded by alternatively spliced exons 2, 3, and 10 of the Tau gene (MAPT). To determine the contribution of alternatively spliced segments to Tau aggregation propensity, the aggregation kinetics of six unmodified, recombinant human Tau isoforms were examined in vitro using electron microscopy assay methods. Aggregation propensity was then compared at the level of elementary rate constants for nucleation and extension phases. We found that all three alternatively spliced segments modulated Tau aggregation but through differing kinetic mechanisms that could synergize or compete depending on sequence context. Overall, segments encoded by exons 2 and 10 promoted aggregation, whereas the segment encoded by exon 3 depressed it with its efficacy dependent on the presence or absence of a fourth microtubule binding repeat. In general, aggregation propensity correlated with genetic risk reported for multiple tauopathies, implicating aggregation as one candidate mechanism rationalizing the correlation between Tau expression patterns and disease. PMID:22539343

  14. Tau mRNA is present in axonal RNA granules and is associated with elongation factor 1A.

    PubMed

    Malmqvist, Tony; Anthony, Karen; Gallo, Jean-Marc

    2014-10-10

    The microtubule-associated protein tau is predominantly localized in the axonal compartment over the entire length of the axon in neurons. The mechanisms responsible for the localization of tau in axons at long distance from the cell body are not properly understood. Using fluorescence in situ hybridization, we show that tau mRNA is present in the central and distal parts of the axons of cultured rat cortical neurons. Axonal tau mRNA is associated with granules which are distributed throughout the entire length of the axon, including the growth cone. We also show that tau mRNA-containing axonal particles are associated with elongation factor 1A, a component of the protein translation machinery. The presence of tau mRNA in axons might be at least part of the process by which tau is localized to distal axons.

  15. Caffeine modulates tau phosphorylation and affects Akt signaling in postmitotic neurons.

    PubMed

    Currais, Antonio; Kato, Kiyoko; Canuet, Leonides; Ishii, Ryouhei; Tanaka, Toshihisa; Takeda, Masatoshi; Soriano, Salvador

    2011-03-01

    Neuronal cell cycle reentry, which is associated with aberrant tau phosphorylation, is thought to be a mechanism of neurodegeneration in AD. Caffeine is a neuroprotective drug known to inhibit the cell cycle, suggesting that its neuroprotective nature may rely, at least in part, on preventing tau abnormalities secondary to its inhibitory effect on neuronal cell cycle-related pathways. Accordingly, we have explored in the present study the impact of caffeine on cell cycle-linked parameters and tau phosphorylation patterns in an attempt to identify molecular clues to its neuroprotective effect. We show that caffeine blocks the cell cycle at G1 phase in neuroblastoma cells and leads to a decrease in tau phosphorylation; similarly, exposure of postmitotic neurons to caffeine led to changes in tau phosphorylation concomitantly with downregulation of Akt signaling. Taken together, our results show a unique impact of caffeine on tau phosphorylation and warrant further investigation to address whether caffeine may help prevent neuronal death by preventing tau abnormalities secondary to aberrant entry into the cell cycle.

  16. Hadronic Tau Decays at BaBar

    SciTech Connect

    Nugent, I.M.; /Victoria U.

    2007-10-25

    Precision measurements of the exclusive branching fraction {tau}{sup -} {yields} K{sup -}{pi}{sup 0}{nu}{sub {tau}} and {tau}{sup -} {yields} h{sup -}h{sup -}h{sup +}{nu}{sub {tau}}, where the h represent either a pion or a kaon, from the BABAR Experiment are presented. The branching fraction for {tau}{sup -} {yields} K{sup -}K{sup -}K{sup +}{nu}{sub {tau}} is the first resonant plus non-resonant measurement of this mode and the branching fraction {tau}{sup -} {yields} {phi}{pi}{sup -}{nu}{sub {tau}} is also a first measurement. In addition we present the new measurement of the branching fraction of {tau}{sup -} {yields} {phi}K{sup -}{nu}{sub {tau}}.

  17. The Ambiguous Relationship of Oxidative Stress, Tau Hyperphosphorylation, and Autophagy Dysfunction in Alzheimer's Disease

    PubMed Central

    Liu, Zhenzhen; Li, Tao; Li, Ping; Wei, Nannan; Zhao, Zhiquan; Liang, Huimin; Ji, Xinying; Chen, Wenwu; Xue, Mengzhou; Wei, Jianshe

    2015-01-01

    Alzheimer's disease (AD) is the most common form of dementia. The pathological hallmarks of AD are amyloid plaques [aggregates of amyloid-beta (Aβ)] and neurofibrillary tangles (aggregates of tau). Growing evidence suggests that tau accumulation is pathologically more relevant to the development of neurodegeneration and cognitive decline in AD patients than Aβ plaques. Oxidative stress is a prominent early event in the pathogenesis of AD and is therefore believed to contribute to tau hyperphosphorylation. Several studies have shown that the autophagic pathway in neurons is important under physiological and pathological conditions. Therefore, this pathway plays a crucial role for the degradation of endogenous soluble tau. However, the relationship between oxidative stress, tau protein hyperphosphorylation, autophagy dysregulation, and neuronal cell death in AD remains unclear. Here, we review the latest progress in AD, with a special emphasis on oxidative stress, tau hyperphosphorylation, and autophagy. We also discuss the relationship of these three factors in AD. PMID:26171115

  18. MDMA impairs mitochondrial neuronal trafficking in a Tau- and Mitofusin2/Drp1-dependent manner.

    PubMed

    Barbosa, Daniel José; Serrat, Román; Mirra, Serena; Quevedo, Martí; Gómez de Barreda, Elena; Avila, Jesús; Fernandes, Eduarda; Bastos, Maria de Lourdes; Capela, João Paulo; Carvalho, Félix; Soriano, Eduardo

    2014-08-01

    Identification of the mechanisms by which drugs of abuse cause neuronal dysfunction is essential for understanding the biological bases of their acute and long-lasting effects in the brain. Here, we performed real-time functional experiments of axonal transport of mitochondria to explore the role of in situ mitochondrial dysfunction in 3,4-methylenedioxymethamphetamine (MDMA; "ecstasy")-related brain actions. We showed that MDMA dramatically reduced mitochondrial trafficking in hippocampal neurons in a Tau-dependent manner, in which glycogen synthase kinase 3β activity was implicated. Furthermore, we found that these trafficking abnormalities were rescued by over-expression of Mitofusin2 and dynamin-related protein 1, but not of Miro1. Given the relevance of mitochondrial targeting for neuronal function and neurotransmission, our data underscore a novel mechanism of action of MDMA that may contribute to our understanding of how this drug of abuse alters neuronal functioning.

  19. Closing the tau loop: the missing tau mutation

    PubMed Central

    McCarthy, Allan; Lonergan, Roisin; Olszewska, Diana A.; O’Dowd, Sean; Cummins, Gemma; Magennis, Brian; Fallon, Emer M.; Pender, Niall; Huey, Edward D.; Cosentino, Stephanie; O’Rourke, Killian; Kelly, Brendan D.; O’Connell, Martin; Delon, Isabelle; Farrell, Michael; Spillantini, Maria Grazia; Rowland, Lewis P.; Fahn, Stanley; Craig, Peter; Hutton, Michael

    2015-01-01

    Frontotemporal lobar degeneration comprises a group of disorders characterized by behavioural, executive, language impairment and sometimes features of parkinsonism and motor neuron disease. In 1994 we described an Irish-American family with frontotemporal dementia linked to chromosome 17 associated with extensive tau pathology. We named this disinhibition-dementia-parkinsonism-amyotrophy complex. We subsequently identified mutations in the MAPT gene. Eleven MAPT gene splice site stem loop mutations were identified over time except for 5’ splice site of exon 10. We recently identified another Irish family with autosomal dominant early amnesia and behavioural change or parkinsonism associated with the ‘missing’ +15 mutation at the intronic boundary of exon 10. We performed a clinical, neuropsychological and neuroimaging study on the proband and four siblings, including two affected siblings. We sequenced MAPT and performed segregation analysis. We looked for a biological effect of the tau variant by performing real-time polymerase chain reaction analysis of RNA extracted from human embryonic kidney cells transfected with exon trapping constructs. We found a c.915+15A>C exon 10/intron 10 stem loop mutation in all affected subjects but not in the unaffected. The c.915+15A>C variant caused a shift in tau splicing pattern to a predominantly exon 10+ pattern presumably resulting in predominant 4 repeat tau and little 3 repeat tau. This strongly suggests that the c.915+15A>C variant is a mutation and that it causes frontotemporal dementia linked to chromosome 17 in this pedigree by shifting tau transcription and translation to +4 repeat tau. Tau (MAPT) screening should be considered in families where amnesia or atypical parkinsonism coexists with behavioural disturbance early in the disease process. We describe the final missing stem loop tau mutation predicted 15 years ago. Mutations have now been identified at all predicted sites within the ‘stem’ when the

  20. Closing the tau loop: the missing tau mutation.

    PubMed

    McCarthy, Allan; Lonergan, Roisin; Olszewska, Diana A; O'Dowd, Sean; Cummins, Gemma; Magennis, Brian; Fallon, Emer M; Pender, Niall; Huey, Edward D; Cosentino, Stephanie; O'Rourke, Killian; Kelly, Brendan D; O'Connell, Martin; Delon, Isabelle; Farrell, Michael; Spillantini, Maria Grazia; Rowland, Lewis P; Fahn, Stanley; Craig, Peter; Hutton, Michael; Lynch, Tim

    2015-10-01

    Frontotemporal lobar degeneration comprises a group of disorders characterized by behavioural, executive, language impairment and sometimes features of parkinsonism and motor neuron disease. In 1994 we described an Irish-American family with frontotemporal dementia linked to chromosome 17 associated with extensive tau pathology. We named this disinhibition-dementia-parkinsonism-amyotrophy complex. We subsequently identified mutations in the MAPT gene. Eleven MAPT gene splice site stem loop mutations were identified over time except for 5' splice site of exon 10. We recently identified another Irish family with autosomal dominant early amnesia and behavioural change or parkinsonism associated with the 'missing' +15 mutation at the intronic boundary of exon 10. We performed a clinical, neuropsychological and neuroimaging study on the proband and four siblings, including two affected siblings. We sequenced MAPT and performed segregation analysis. We looked for a biological effect of the tau variant by performing real-time polymerase chain reaction analysis of RNA extracted from human embryonic kidney cells transfected with exon trapping constructs. We found a c.915+15A>C exon 10/intron 10 stem loop mutation in all affected subjects but not in the unaffected. The c.915+15A>C variant caused a shift in tau splicing pattern to a predominantly exon 10+ pattern presumably resulting in predominant 4 repeat tau and little 3 repeat tau. This strongly suggests that the c.915+15A>C variant is a mutation and that it causes frontotemporal dementia linked to chromosome 17 in this pedigree by shifting tau transcription and translation to +4 repeat tau. Tau (MAPT) screening should be considered in families where amnesia or atypical parkinsonism coexists with behavioural disturbance early in the disease process. We describe the final missing stem loop tau mutation predicted 15 years ago. Mutations have now been identified at all predicted sites within the 'stem' when the stem

  1. Extrasynaptic NMDA receptor-induced tau overexpression mediates neuronal death through suppressing survival signaling ERK phosphorylation

    PubMed Central

    Sun, Xu-Ying; Tuo, Qing-Zhang; Liuyang, Zhen-Yu; Xie, Ao-Ji; Feng, Xiao-Long; Yan, Xiong; Qiu, Mei; Li, Shen; Wang, Xiu-Lian; Cao, Fu-Yuan; Wang, Xiao-Chuan; Wang, Jian-Zhi; Liu, Rong

    2016-01-01

    Intracellular accumulation of the hyperphosphorylated tau is a pathological hallmark in the brain of Alzheimer disease. Activation of extrasynaptic NMDA receptors (E-NMDARs) induces excitatory toxicity that is involved in Alzheimer's neurodegeneration. However, the intrinsic link between E-NMDARs and the tau-induced neuronal damage remains elusive. In the present study, we showed in cultured primary cortical neurons that activation of E-NMDA receptors but not synaptic NMDA receptors dramatically increased tau mRNA and protein levels, with a simultaneous neuronal degeneration and decreased neuronal survival. Memantine, a selective antagonist of E-NMDARs, reversed E-NMDARs-induced tau overexpression. Activation of E-NMDARs in wild-type mouse brains resulted in neuron loss in hippocampus, whereas tau deletion in neuronal cultures and in the mouse brains rescued the E-NMDARs-induced neuronal death and degeneration. The E-NMDARs-induced tau overexpression was correlated with a reduced ERK phosphorylation, whereas the increased MEK activity, decreased binding and activity of ERK phosphatase to ERK, and increased ERK phosphorylation were observed in tau knockout mice. On the contrary, addition of tau proteins promoted ERK dephosphorylation in vitro. Taking together, these results indicate that tau overexpression mediates the excitatory toxicity induced by E-NMDAR activation through inhibiting ERK phosphorylation. PMID:27809304

  2. Abnormal Expression of Urea Transporter Protein in a Rat Model of Hepatorenal Syndrome Induced by Succinylated Gelatin

    PubMed Central

    Song, Weiping; Qi, Xiaolong; Zhang, Wenhui; Zhao, C Yingying; Cao, Yan; Wang, Fei; Yang, Changqing

    2015-01-01

    Background Hepatorenal syndrome (HRS) is a serious complication of advanced chronic liver disease. Abdominal compartment syndrome (ACS) occurs with dysfunction of multiple organs when abdominal pressure increases. Here, we report on a novel model of ACS with ascites and a model of HRS in rats to observe the urea transporter protein (UT) expression in the 2 models. Material/Methods A liver cirrhosis model was induced by CCl4. After changes of liver histopathology were observed, rats were injected intraperitoneally with succinylated gelatin to establish a model of ACS and HRS. Then, changes in BUN, Cr, and renal histopathology were detected. Moreover, the UT in ACS and HRS were also quantified. Results The surfaces of liver in the cirrhotic group became coarse, with visible small nodules and became yellow and greasy. The normal structure of the hepatic lobules were destroyed, and hyperplasia of fibrotic tissue and pseudo-lobe was observed. The levels of BUN and Cr were significantly increased in rats suffering from ACS and HRS, respectively, compared to their control groups. In addition, the mRNA levels of UT-A2 and UT-A3 decreased in rats with HRS compared to cirrhotic rats. However, there was no significant difference between the mRNA levels of UT-A2, UT-A3, and UT-B in rats with ACS vs. normal rats. Conclusions It is feasible to model ACS in rats by injecting succinylated gelatin into the abdominal cavity. Increasing the intra-abdominal pressure by succinylated gelatin is also a novel approach for modeling HRS in cirrhotic rats. Compared with control rats, there is an abnormal mRNA expression of UT in ACS rats and HRS rats. PMID:26414230

  3. Effect of treadmill exercise on PI3K/AKT/mTOR, autophagy, and Tau hyperphosphorylation in the cerebral cortex of NSE/htau23 transgenic mice

    PubMed Central

    Kang, Eun-Bum; Cho, Joon-Yong

    2015-01-01

    Purpose Neurofibrillary tangles, one of pathological features of Alzheimer’s disease, are produced by the hyperphosphorylation and aggregation of tau protein. This study aimed to investigate the effects of treadmill exercise on PI3K/AKT/mTOR signal transmission, autophagy, and cognitive ability that are involved in the hyperphosphorylation and aggregation of tau protein. Methods Experimental animals (NSE/htau23 mice) were divided into non-transgenic control group (Non-Tg-Control; CON; n = 7), transgenic control group (Tg-CON; n = 7), and transgenic exercise group (Tg-Treadmill Exercise; TE; n = 7). The Tg-TE group was subjected to treadmill exercise for 12 weeks. After the treadmill exercise was completed, the cognitive ability was determined by conducting underwater maze tests. Western blot was conducted to determine the phosphorylation status of PI3K/AKT/mTOR proteins and autophagy-related proteins (Beclin-1, p62, LC3-B); hyperphosphorylation and aggregation of tau protein (Ser199/202, Ser404, Thr231, PHF-1); and phosphorylation of GSK-3β, which is involved in the phosphorylation of tau protein in the cerebral cortex of experimental animals. Results In the Tg-TE group that was subjected to treadmill exercise for 12 weeks, abnormal mTOR phosphorylation of PI3K/AKT proteins was improved via increased phosphorylation and its activity was inhibited by increased GSK-3β phosphorylation compared with those in the Tg-CON group, which was used as the control group. In addition, the expression of Beclin-1 protein involved in autophagosome formation was increased in the Tg-TE group compared with that in the Tg-CON group, whereas that of p62 protein was reduced in the Tg-TE group compared with that in the Tg-CON group. Autophagy was activated owing to the increased expression of LC3-B that controls the completion of autophagosome formation. The hyperphosphorylation and aggregation (Ser199/202, Ser404, Thr231, PHF-1) of tau protein was found to be reduced in the Tg

  4. The biology of the circadian Ck1epsilon tau mutation in mice and Syrian hamsters: a tale of two species.

    PubMed

    Loudon, A S I; Meng, Q J; Maywood, E S; Bechtold, D A; Boot-Handford, R P; Hastings, M H

    2007-01-01

    The tau mutation in the Syrian hamster resides in the enzyme casein kinase 1 epsilon (CK1epsilon), resulting in a dramatic acceleration of wheel-running activity cycles to about 20 hours. tau also impacts growth, energy, metabolism, feeding behavior, and circadian mechanisms underpinning seasonal timing, causing accelerated reproductive and neuroendocrine responses to photoperiodic changes. Modeling and experimental studies suggest that tau acts as a gain of function on specific residues of PER, consistent with hamster studies showing accelerated degradation of PER in the suprachiasmatic nucleus in the early circadian night. We have created null and tau mutants of Ck1epsilon in mice. Circadian period lengthens in CK1epsilon(/), whereas CK1epsilon(tau/tau) shortens circadian period of behavior in vivo in a manner nearly identical to that of the Syrian hamster. CK1epsilon(tau/tau) also accelerates molecular oscillations in peripheral tissues, demonstrating its global circadian role. CK1epsilon(tau) acts by promoting degradation of both nuclear and cytoplasmic PERIOD, but not CRYPTOCHROME, proteins. Our studies reveal that tau acts as a gain-of-function mutation, to accelerate degradation of PERIOD proteins. tau has consistent effects in both hamsters and mice on the circadian organization of behavior and metabolism, highlighting the global impact of this mutation on mammalian clockwork in brain and periphery.

  5. Abnormal amounts of intracellular calcium regulatory proteins in SHRSP.Z-Lepr(fa)/IzmDmcr rats with metabolic syndrome and cardiac dysfunction.

    PubMed

    Kagota, Satomi; Maruyama, Kana; Tada, Yukari; Wakuda, Hirokazu; Nakamura, Kazuki; Kunitomo, Masaru; Shinozuka, Kazumasa

    2013-02-01

    Metabolic syndrome is known to increase the risk of abnormal cardiac structure and function, which are considered to contribute to increased incidence of cardiovascular disease and mortality. We previously demonstrated that ventricular hypertrophy and diastolic dysfunction occur in SHRSP.Z-Lepr(fa)/IzmDmcr (SHRSP fatty) rats with metabolic syndrome. The aim of this study was to investigate the possible mechanisms underlying abnormal heart function in SHRSP fatty rats. The amount of sarcoplasmic reticulum Ca(2+)-ATPase (SERCA) 2a, phospholamban (PLB) protein, and Ser(16)-phosphorylated PLB was decreased in cardiomyocytes from SHRSP fatty rats compared with those from control Wistar-Kyoto rats at 18 weeks of age, and the PLB-to-SERCA2a ratio was increased. Left ventricular developed pressure was unchanged, and coronary flow rate and maximum rate of left ventricular pressure decline (-dP/dt) was decreased in SHRSP fatty rats. Treatment with telmisartan reversed the abnormalities of PLB amount, coronary flow rate, and -dP/dt in SHRSP fatty rats. These results indicate that abnormal amounts of intracellular Ca(2+) regulatory proteins in cardiomyocytes, leading to reduced intracellular Ca(2+) reuptake into the sarcoplasmic reticulum, may play a role in the diastolic dysfunction in SHRSP fatty rats and that these effects are partially related to decreased coronary circulation. Telmisartan may be beneficial in protecting against disturbances in cardiac function associated with metabolic syndrome.

  6. Protein Kinase MARK/PAR-1 Is Required for Neurite Outgrowth and Establishment of Neuronal Polarity

    PubMed Central

    Biernat, Jacek; Wu, Yong-Zhong; Timm, Thomas; Zheng-Fischhöfer, Qingyi; Mandelkow, Eckhard; Meijer, Laurent; Mandelkow, Eva-Maria

    2002-01-01

    Protein kinases of the microtubule affinity-regulating kinase (MARK) family were originally discovered because of their ability to phosphorylate certain sites in tau protein (KXGS motifs in the repeat domain). This type of phosphorylation is enhanced in abnormal tau from Alzheimer brain tissue and causes the detachment of tau from microtubules. MARK-related kinases (PAR-1 and KIN1) occur in various organisms and are involved in establishing and maintaining cell polarity. Herein, we report the ability of MARK2 to affect the differentiation and outgrowth of cell processes from neuroblastoma and other cell models. MARK2 phosphorylates tau protein at the KXGS motifs; this results in the detachment of tau from microtubules and their destabilization. The formation of neurites in N2a cells is blocked if MARK2 is inactivated, either by transfecting a dominant negative mutant, or by MARK2 inhibitors such as hymenialdisine. Alternatively, neurites are blocked if the target KXGS motifs on tau are rendered nonphosphorylatable by point mutations. The results suggest that MARK2 contributes to the plasticity of microtubules needed for neuronal polarity and the growth of neurites. PMID:12429843

  7. Tau excess impairs mitosis and kinesin-5 function, leading to aneuploidy and cell death.

    PubMed

    Bougé, Anne-Laure; Parmentier, Marie-Laure

    2016-03-01

    In neurodegenerative diseases such as Alzheimer's disease (AD), cell cycle defects and associated aneuploidy have been described. However, the importance of these defects in the physiopathology of AD and the underlying mechanistic processes are largely unknown, in particular with respect to the microtubule (MT)-binding protein Tau, which is found in excess in the brain and cerebrospinal fluid of affected individuals. Although it has long been known that Tau is phosphorylated during mitosis to generate a lower affinity for MTs, there is, to our knowledge, no indication that an excess of this protein could affect mitosis. Here, we studied the effect of an excess of human Tau (hTau) protein on cell mitosis in vivo. Using the Drosophila developing wing disc epithelium as a model, we show that an excess of hTau induces a mitotic arrest, with the presence of monopolar spindles. This mitotic defect leads to aneuploidy and apoptotic cell death. We studied the mechanism of action of hTau and found that the MT-binding domain of hTau is responsible for these defects. We also demonstrate that the effects of hTau occur via the inhibition of the function of the kinesin Klp61F, the Drosophila homologue of kinesin-5 (also called Eg5 or KIF11). We finally show that this deleterious effect of hTau is also found in other Drosophila cell types (neuroblasts) and tissues (the developing eye disc), as well as in human HeLa cells. By demonstrating that MT-bound Tau inhibits the Eg5 kinesin and cell mitosis, our work provides a new framework to consider the role of Tau in neurodegenerative diseases.

  8. Meiotic abnormalities

    SciTech Connect

    1993-12-31

    Chapter 19, describes meiotic abnormalities. These include nondisjunction of autosomes and sex chromosomes, genetic and environmental causes of nondisjunction, misdivision of the centromere, chromosomally abnormal human sperm, male infertility, parental age, and origin of diploid gametes. 57 refs., 2 figs., 1 tab.

  9. Is phosphorylated tau unique to chronic traumatic encephalopathy? Phosphorylated tau in epileptic brain and chronic traumatic encephalopathy

    PubMed Central

    Puvenna, Vikram; Engeler, Madeline; Banjara, Manoj; Brennan, Chanda; Schreiber, Peter; Dadas, Aaron; Bahrami, Ashkon; Solanki, Jesal; Bandyopadhyay, Anasua; Morris, Jacqueline K.; Bernick, Charles; Ghosh, Chaitali; Bazarian, Jeffrey J.; Janigro, Damir

    2016-01-01

    Repetitive traumatic brain injury (rTBI) is one of the major risk factors for the abnormal deposition of phosphorylated tau (PT) in the brain and chronic traumatic encephalopathy (CTE). CTE and temporal lobe epilepsy (TLE) affect the limbic system, but no comparative studies on PT distribution in TLE and CTE are available. It is also unclear whether PT pathology results from repeated head hits (rTBI). These gaps prevent a thorough understanding of the pathogenesis and clinical significance of PT, limiting our ability to develop preventative and therapeutic interventions. We quantified PT in TLE and CTE to unveil whether a history of rTBI is a prerequisite for PT accumulation in the brain. Six post mortem CTE (mean 73.3 years) and age matched control samples were compared to 19 surgically resected TLE brain specimens (4 months-58 years; mean 27.6 years). No history of TBI was present in TLE or control; all CTE patients had a history of rTBI. TLE and CTE brain displayed increased levels of PT as revealed by immunohistochemistry. No age-dependent changes were noted, as PT was present as early as 4 months after birth. In TLE and CTE, cortical neurons, perivascular regions around penetrating pial vessels and meninges were immunopositive for PT; white matter tracts also displayed robust expression of extracellular PT organized in bundles parallel to venules. Microscopically, there were extensive tau-immunoreactive neuronal, astrocytic and degenerating neurites throughout the brain. In CTE perivascular tangles were most prominent. Overall, significant differences in staining intensities were found between CTE and control (P<0.01) but not between CTE and TLE (P=0.08). pS199 tau analysis showed that CTE had the most high molecular weight tangle-associated tau, whereas epileptic brain contained low molecular weight tau. Tau deposition may not be specific to rTBI since TLE recapitulated most of the pathological features of CTE. PMID:26556772

  10. Is phosphorylated tau unique to chronic traumatic encephalopathy? Phosphorylated tau in epileptic brain and chronic traumatic encephalopathy.

    PubMed

    Puvenna, Vikram; Engeler, Madeline; Banjara, Manoj; Brennan, Chanda; Schreiber, Peter; Dadas, Aaron; Bahrami, Ashkon; Solanki, Jesal; Bandyopadhyay, Anasua; Morris, Jacqueline K; Bernick, Charles; Ghosh, Chaitali; Rapp, Edward; Bazarian, Jeffrey J; Janigro, Damir

    2016-01-01

    Repetitive traumatic brain injury (rTBI) is one of the major risk factors for the abnormal deposition of phosphorylated tau (PT) in the brain and chronic traumatic encephalopathy (CTE). CTE and temporal lobe epilepsy (TLE) affect the limbic system, but no comparative studies on PT distribution in TLE and CTE are available. It is also unclear whether PT pathology results from repeated head hits (rTBI). These gaps prevent a thorough understanding of the pathogenesis and clinical significance of PT, limiting our ability to develop preventative and therapeutic interventions. We quantified PT in TLE and CTE to unveil whether a history of rTBI is a prerequisite for PT accumulation in the brain. Six postmortem CTE (mean 73.3 years) and age matched control samples were compared to 19 surgically resected TLE brain specimens (4 months-58 years; mean 27.6 years). No history of TBI was present in TLE or control; all CTE patients had a history of rTBI. TLE and CTE brain displayed increased levels of PT as revealed by immunohistochemistry. No age-dependent changes were noted, as PT was present as early as 4 months after birth. In TLE and CTE, cortical neurons, perivascular regions around penetrating pial vessels and meninges were immunopositive for PT; white matter tracts also displayed robust expression of extracellular PT organized in bundles parallel to venules. Microscopically, there were extensive tau-immunoreactive neuronal, astrocytic and degenerating neurites throughout the brain. In CTE perivascular tangles were most prominent. Overall, significant differences in staining intensities were found between CTE and control (P<0.01) but not between CTE and TLE (P=0.08). pS199 tau analysis showed that CTE had the most high molecular weight tangle-associated tau, whereas epileptic brain contained low molecular weight tau. Tau deposition may not be specific to rTBI since TLE recapitulated most of the pathological features of CTE.

  11. Rapid and Highly Sensitive Detection of Variant Creutzfeldt - Jakob Disease Abnormal Prion Protein on Steel Surfaces by Protein Misfolding Cyclic Amplification: Application to Prion Decontamination Studies

    PubMed Central

    Belondrade, Maxime; Nicot, Simon; Béringue, Vincent; Coste, Joliette; Lehmann, Sylvain; Bougard, Daisy

    2016-01-01

    The prevalence of variant Creutzfeldt-Jakob disease (vCJD) in the population remains uncertain, although it has been estimated that 1 in 2000 people in the United Kingdom are positive for abnormal prion protein (PrPTSE) by a recent survey of archived appendix tissues. The prominent lymphotropism of vCJD prions raises the possibility that some surgical procedures may be at risk of iatrogenic vCJD transmission in healthcare facilities. It is therefore vital that decontamination procedures applied to medical devices before their reprocessing are thoroughly validated. A current limitation is the lack of a rapid model permissive to human prions. Here, we developed a prion detection assay based on protein misfolding cyclic amplification (PMCA) technology combined with stainless-steel wire surfaces as carriers of prions (Surf-PMCA). This assay allowed the specific detection of minute quantities (10−8 brain dilution) of either human vCJD or ovine scrapie PrPTSE adsorbed onto a single steel wire, within a two week timeframe. Using Surf-PMCA we evaluated the performance of several reference and commercially available prion-specific decontamination procedures. Surprisingly, we found the efficiency of several marketed reagents to remove human vCJD PrPTSE was lower than expected. Overall, our results demonstrate that Surf-PMCA can be used as a rapid and ultrasensitive assay for the detection of human vCJD PrPTSE adsorbed onto a metallic surface, therefore facilitating the development and validation of decontamination procedures against human prions. PMID:26800081

  12. Obesity, diabetes, and leptin resistance promote tau pathology in a mouse model of disease.

    PubMed

    Platt, T L; Beckett, T L; Kohler, K; Niedowicz, D M; Murphy, M P

    2016-02-19

    Obesity and type 2 diabetes mellitus (T2DM) convey an increased risk for developing dementia. The microtubule-associated protein tau is implicated in neurodegenerative disease by undergoing hyperphosphorylation and aggregation, leading to cytotoxicity and neurodegeneration. Enzymes involved in the regulation of tau phosphorylation, such as GSK3β, are tightly associated with pathways found to be dysregulated in T2DM. We have shown previously that leptin-resistant mice, which develop obesity and a diabetic phenotype, display elevated levels of tau phosphorylation. Here we show cells cultured with leptin, an adipokine shown to have neuroprotective effects, reduces tau phosphorylation. To explore how this mechanism works in vivo we transduced an existing diabetic mouse line (Lepr(db/db)) with a tau mutant (tau(P301L)) via adeno-associated virus (AAV). The resulting phenotype included a striking increase in tau phosphorylation and the number of neurofibrillary tangles (NFTs) found within the hippocampus. We conclude that leptin resistance-induced obesity and diabetes accelerates the development of tau pathology. This model of metabolic dysfunction and tauopathy provides a new system in which to explore the mechanisms underlying the ways in which leptin resistance and diabetes influence development of tau pathology, and may ultimately be related to the development of NFTs.

  13. Extracellular Tau Oligomers Produce An Immediate Impairment of LTP and Memory.

    PubMed

    Fá, M; Puzzo, D; Piacentini, R; Staniszewski, A; Zhang, H; Baltrons, M A; Li Puma, D D; Chatterjee, I; Li, J; Saeed, F; Berman, H L; Ripoli, C; Gulisano, W; Gonzalez, J; Tian, H; Costa, J A; Lopez, P; Davidowitz, E; Yu, W H; Haroutunian, V; Brown, L M; Palmeri, A; Sigurdsson, E M; Duff, K E; Teich, A F; Honig, L S; Sierks, M; Moe, J G; D'Adamio, L; Grassi, C; Kanaan, N M; Fraser, P E; Arancio, O

    2016-01-20

    Non-fibrillar soluble oligomeric forms of amyloid-β peptide (oAβ) and tau proteins are likely to play a major role in Alzheimer's disease (AD). The prevailing hypothesis on the disease etiopathogenesis is that oAβ initiates tau pathology that slowly spreads throughout the medial temporal cortex and neocortices independently of Aβ, eventually leading to memory loss. Here we show that a brief exposure to extracellular recombinant human tau oligomers (oTau), but not monomers, produces an impairment of long-term potentiation (LTP) and memory, independent of the presence of high oAβ levels. The impairment is immediate as it raises as soon as 20 min after exposure to the oligomers. These effects are reproduced either by oTau extracted from AD human specimens, or naturally produced in mice overexpressing human tau. Finally, we found that oTau could also act in combination with oAβ to produce these effects, as sub-toxic doses of the two peptides combined lead to LTP and memory impairment. These findings provide a novel view of the effects of tau and Aβ on memory loss, offering new therapeutic opportunities in the therapy of AD and other neurodegenerative diseases associated with Aβ and tau pathology.

  14. Halting of Caspase Activity Protects Tau from MC1-Conformational Change and Aggregation

    PubMed Central

    Mead, Emma; Kestoras, Dimitra; Gibson, Yolanda; Hamilton, Lucy; Goodson, Ross; Jones, Sophie; Eversden, Sarah; Davies, Peter; O’Neill, Michael; Hutton, Michael; Szekeres, Philip; Wolak, Joanna

    2016-01-01

    Intracellular neurofibrillary tangles (NFTs) are the hallmark of Alzheimer’s disease and other tauopathies in which tau, a microtubule-associated protein, loses its ability to stabilize microtubules. Several post-translational modifications including phosphorylation and truncation increase tau’s propensity to aggregate thus forming NFTs; however, the mechanisms underlying tau conformational change and aggregation still remain to be defined. Caspase activation and subsequent proteolytic cleavage of tau is thought to be a potential trigger of this disease-related pathological conformation. The aim of this work was to investigate the link between caspase activation and a disease-related conformational change of tau in a neuroblastoma cell-based model of spontaneous tau aggregation. We demonstrated that caspase induction initiates proteolytic cleavage of tau and generation of conformationally altered and aggregated tau recognized by the MC1 conformational antibody. Most importantly, these events were shown to be attenuated with caspase inhibitors. This implies that therapeutics aimed at inhibiting caspase-mediated tau cleavage may prove beneficial in slowing cleavage and aggregation, thus potentially halting tau pathology and disease progression. PMID:27589517

  15. Selection and Characterization of Tau Binding ᴅ-Enantiomeric Peptides with Potential for Therapy of Alzheimer Disease

    PubMed Central

    Kukuk, Laura; Willbold, Dieter; Pickhardt, Marcus; Mandelkow, Eckhard; Horn, Anselm H. C.; Sticht, Heinrich; Malhis, Marwa Nidal; Will, Nadja; Schuster, Judith; Funke, Susanne Aileen

    2016-01-01

    A variety of neurodegenerative disorders, including Alzheimer disease (AD), are associated with neurofibrillary tangles composed of the tau protein, as well as toxic tau oligomers. Inhibitors of pathological tau aggregation, interrupting tau self-assembly, might be useful for the development of therapeutics. Employing mirror image phage display with a large peptide library (over 109 different peptides), we have identified tau fibril binding peptides consisting of d-enantiomeric amino acids. d-enantiomeric peptides are extremely protease stable and not or less immunogenic than l-peptides, and the suitability of d-peptides for in vivo applications have already been demonstrated. Phage display selections were performed using fibrils of the d-enantiomeric hexapeptide VQIVYK, representing residues 306 to 311 of the tau protein, as a target. VQIVYK has been demonstrated to be important for fibril formation of the full lengths protein and forms fibrils by itself. Here, we report on d-enantiomeric peptides, which bind to VQIVYK, tau isoforms like tau3RD (K19) as well as to full lengths tau fibrils, and modulate the aggregation of the respective tau form. The peptides are able to penetrate cells and might be interesting for therapeutic and diagnostic applications in AD research. PMID:28006031

  16. Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice.

    PubMed

    Ribé, Elena M; Pérez, Mar; Puig, Berta; Gich, Ignasi; Lim, Filip; Cuadrado, Mar; Sesma, Teresa; Catena, Silvia; Sánchez, Belén; Nieto, María; Gómez-Ramos, Pilar; Morán, M Asunción; Cabodevilla, Felipe; Samaranch, Lluis; Ortiz, Lourdes; Pérez, Alberto; Ferrer, Isidro; Avila, Jesús; Gómez-Isla, Teresa

    2005-12-01

    Even though the idea that amyloid beta peptide accumulation is the primary event in the pathogenesis of Alzheimer's disease has become the leading hypothesis, the causal link between aberrant amyloid precursor protein processing and tau alterations in this type of dementia remains controversial. We further investigated the role of beta-amyloid production/deposition in tau pathology and neuronal cell death in the mouse brain by crossing Tg2576 and VLW lines expressing human mutant amyloid precursor protein and human mutant tau, respectively. The resulting double transgenic mice showed enhanced amyloid deposition accompanied by neurofibrillary degeneration and overt neuronal loss in selectively vulnerable brain limbic areas. These findings challenge the idea that tau pathology in Alzheimer's disease is merely a downstream effect of amyloid production/deposition and suggest that reciprocal interactions between beta-amyloid and tau alterations may take place in vivo.

  17. Mandibular coronoid process in parathyroid hormone-related protein-deficient mice shows ectopic cartilage formation accompanied by abnormal bone modeling.

    PubMed

    Shibata, Shunichi; Suda, Naoto; Fukada, Kenji; Ohyama, Kimie; Yamashita, Yasuo; Hammond, Vicki E

    2003-07-01

    Parathyroid hormone-related protein (PTHrP) null mutant mice were analyzed to investigate an additional role for PTHrP in cell differentiation. We found ectopic cartilage formation in the mandibular coronoid process in newborn mice. While many previous studies involving PTHrP gene knockout mouse have shown that the cartilage in various regions becomes smaller, this is the first report showing an "increase" of cartilage volume. Investigations of mandibular growth using normal mice indicated that coronoid secondary cartilage never formed from E 15 to d 4, but small amount of cartilage temporally formed at d 7, and this also applies to PTHrP-wild type mice. Therefore, PTHrP deficiency consequently advanced the secondary cartilage formation, which is a novel role of PTHrP in chondrocyte differentiation. In situ hybridization of matrix proteins showed that this coronoid cartilage had characteristics of the lower hypertrophic cell zone usually present at the site of endochondral bone formation and/or "chondroid bone" occasionally found in distraction osteogenesis. In addition, the coronoid process in the PTHrP-deficient mouse also showed abnormal expansion of bone marrow and an increase in the number of multinucleated osteoclasts, an indication of abnormal bone modeling. These results indicate that PTHrP is involved in bone modeling as well as in chondrocyte differentiation. In situ hybridization of matrix protein mRNAs in the abnormal mandibular condylar cartilage revealed that this cartilage was proportionally smaller, supporting previous immunohistochemical results.

  18. [Anti-HIV effects of IFN-tau in human macrophages: role of cellular antiviral factors and interleukin-6].

    PubMed

    Maneglier, B; Rogez-Kreuz, C; Dereuddre-Bosquet, N; Martal, J; Devillier, P; Dormont, D; Clayette, P

    2008-01-01

    Tau interferon (IFN-tau) was shown to inhibit human immunodeficiency virus (HIV) replication in vitro more strongly than human IFN-alpha, particularly in human macrophages. IFN-tau efficiently inhibited the early steps of HIV biological cycle, decreasing intracellular HIV RNA and inhibiting the initiation of the reverse transcription of viral RNA into proviral DNA. In this study, the in vitro immunomodulatory effects of IFN-tau were explored in human macrophages. We found that IFN-tau increased the synthesis of the cellular antiviral factors, such as 2',5'-oligoadenylate synthetase/RNase L and MxA protein. These results suggested that IFN-tau induces the same antiviral pathways in macrophages as other type I IFNs. We found that IFN-tau increased the production of interleukins (IL)-10 and IL-6, but not of IL-1ss or TNF-alpha, in not infected and in in vitro HIV-1/Ba-L-infected macrophages. We also found that the neutralization of IL-6 biological activity in the cell culture supernatants of IFN-tau-treated macrophages led to a decrease in the antiretroviral effects of IFN-tau towards HIV RNA. In conclusion, anti-HIV effects of IFN-tau are mediated by several modes of action, mediated either directly by IFN-tau or via other cytokines, such as IL-6, also known to be induced by IFN-alpha.

  19. Chronic cerebral hypoperfusion causes decrease of O-GlcNAcylation, hyperphosphorylation of tau and behavioral deficits in mice

    PubMed Central

    Zhao, Yang; Gu, Jin-hua; Dai, Chun-ling; Liu, Qun; Iqbal, Khalid; Liu, Fei; Gong, Cheng-Xin

    2014-01-01

    Chronic cerebral hypoperfusion (CCH) is one of the causes of vascular dementia (VaD) and is also an etiological factor for Alzheimer’s disease (AD). However, how CCH causes cognitive impairment and contributes to Alzheimer’s pathology is poorly understood. Here we produced a mouse model of CCH by unilateral common carotid artery occlusion (UCCAO) and studied the behavioral changes and brain abnormalities in mice 2.5 months after UCCAO. We found that CCH caused significant short-term memory deficits and mild long-term spatial memory impairment, as well as decreased level of protein O-GlcNAcylation, increased level of tau phosphorylation, dysregulated synaptic proteins and insulin signaling, and selective neurodegeneration in the brain. These findings provide mechanistic insight into the effects of CCH on memory and cognition and the likely link between AD and VaD. PMID:24575038

  20. Cholinesterase inhibitors may increase phosphorylated tau in Alzheimer's disease.

    PubMed

    Chalmers, Katy A; Wilcock, Gordon K; Vinters, Harry V; Perry, Elaine K; Perry, Robert; Ballard, Clive G; Love, Seth

    2009-05-01

    Cholinesterase inhibitors (ChEIs) are widely used for the symptomatic treatment of Alzheimer's disease (AD). In vitro and in animal studies, ChEIs have been shown to influence the processing of Abeta and the phosphorylation of tau, proteins that are the principal constituents of the plaques and neurofibrillary tangles, respectively, in AD brain. However, little is known about the effects of these drugs on Abeta and tau pathology in AD. Using avidin-biotin immunohistochemistry and computer-assisted image analysis, we compared Abeta and tau loads in the frontal and temporal cortices of 72 brains from matched cohorts of AD patients who had or had not received ChEIs. Patients treated with ChEIs had accumulated significantly more phospho-tau in their cerebral cortex than had untreated patients (P = 0.004). Abeta accumulation was reduced but not significantly. These data raise the possibility that increased tau phosphorylation may influence long-term clinical responsiveness to ChEIs.

  1. Multiple-motor based transport and its regulation by Tau

    PubMed Central

    Vershinin, Michael; Carter, Brian C.; Razafsky, David S.; King, Stephen J.; Gross, Steven P.

    2007-01-01

    Motor-based intracellular transport and its regulation are crucial to the functioning of a cell. Disruption of transport is linked to Alzheimer's and other neurodegenerative diseases. However, many fundamental aspects of transport are poorly understood. An important issue is how cells achieve and regulate efficient long-distance transport. Mounting evidence suggests that many in vivo cargoes are transported along microtubules by more than one motor, but we do not know how multiple motors work together or can be regulated. Here we first show that multiple kinesin motors, working in conjunction, can achieve very long distance transport and apply significantly larger forces without the need of additional factors. We then demonstrate in vitro that the important microtubule-associated protein, tau, regulates the number of engaged kinesin motors per cargo via its local concentration on microtubules. This function of tau provides a previously unappreciated mechanism to regulate transport. By reducing motor reattachment rates, tau affects cargo travel distance, motive force, and cargo dispersal. We also show that different isoforms of tau, at concentrations similar to those in cells, have dramatically different potency. These results provide a well defined mechanism for how altered tau isoform levels could impair transport and thereby lead to neurodegeneration without the need of any other pathway. PMID:17190808

  2. X-Ray Structural Study of Amyloid-Like Fibrils of Tau Peptides Bound to Small-Molecule Ligands.

    PubMed

    Tayeb-Fligelman, Einav; Landau, Meytal

    2017-01-01

    Atomic structures of Tau involved in Alzheimer's disease complexed with small molecule binders are the first step to define the Tau pharmacophore, leading the way to a structure-based design of improved diagnostics and therapeutics. Yet the partially disordered and polymorphic nature of Tau hinders structural analyses. Fortunately, short segments from amyloid proteins, which exhibit similar biophysical properties to the full-length proteins, also form fibrils and oligomers, and their atomic structures can be determined using X-ray microcrystallography. Such structures were successfully used to design amyloid inhibitors. This chapter describes experimental procedures used to determine crystal structures of Tau peptide segments in complex with small-molecule binders.

  3. Genetic Ablation of Tau Mitigates Cognitive Impairment Induced by Type 1 Diabetes

    PubMed Central

    Abbondante, Serena; Baglietto-Vargas, David; Rodriguez-Ortiz, Carlos J.; Estrada-Hernandez, Tatiana; Medeiros, Rodrigo; LaFerla, Frank M.

    2015-01-01

    Patients affected by diabetes show an increased risk of developing Alzheimer disease (AD). Similarly, patients with AD show impaired insulin function and glucose metabolism. However, the underlying molecular mechanisms connecting these two disorders are still not well understood. Herein, we investigated the microtubule-associated protein tau as a new link between AD and diabetes. To determine whether diabetes causes cognitive decline by a tau-dependent mechanism, we treated non-transgenic (Ntg) and tau-knockout mice with streptozotocin, causing type 1 diabetes-like disease (T1D). Interestingly, although induction of T1D in Ntg mice led to cellular and behavioral deficits, it did not do so in tau-knockout mice. Thus, data suggest that tau is a fundamental mediator of the induction of cognitive impairments in T1D. Tau dysregulation, which causes a reduction in synaptic protein levels, may be responsible for the cognitive decline observed in Ntg streptozotocin-treated mice. Concomitantly, we demonstrate the novel finding that depletion of endogenous tau mitigates behavioral impairment and synaptic deficits induced in T1D-like mice. Overall, our data reveal that tau is a key molecular factor responsible for the induction of cognitive deficits observed in T1D and represents a potential therapeutic target for diabetes and patients with AD. PMID:24412516

  4. The. tau. -lepton and its associated neutrino

    SciTech Connect

    Pich, A. )

    1990-10-10

    This paper discusses the {tau}-lepton and the prospects for future improvements. It is shown how a better understanding of the {tau} properties could be used for testing fundamental aspects of the electroweak and strong interactions.

  5. Does neuroinflammation drive the relationship between tau hyperphosphorylation and dementia development following traumatic brain injury?

    PubMed

    Collins-Praino, Lyndsey E; Corrigan, Frances

    2017-02-01

    A history of traumatic brain injury (TBI) is linked to an increased risk for the later development of dementia. This encompasses a variety of neurodegenerative diseases including Alzheimer's Disease (AD) and chronic traumatic encephalopathy (CTE), with AD linked to history of moderate-severe TBI and CTE to a history of repeated concussion. Of note, both AD and CTE are characterized by the abnormal accumulation of hyperphosphorylated tau aggregates, which are thought to play an important role in the development of neurodegeneration. Hyperphosphorylation of tau leads to destabilization of microtubules, interrupting axonal transport, whilst tau aggregates are associated with synaptic dysfunction. The exact mechanisms via which TBI may promote the later tauopathy and its role in the later development of dementia are yet to be fully determined. Following TBI, it is proposed that axonal injury may provide the initial perturbation of tau, by promoting its dissociation from microtubules, facilitating its phosphorylation and aggregation. Altered tau dynamics may then be exacerbated by the chronic persistent inflammatory response that has been shown to persist for decades following the initial impact. Importantly, immune activation has been shown to play a role in accelerating disease progression in other tauopathies, with pro-inflammatory cytokines, like IL-1β, shown to activate kinases that promote tau hyperphosphorylation. Thus, targeting the inflammatory response in the sub-acute phase following TBI may represent a promising target to halt the alterations in tau dynamics that may precede overt neurodegeneration and later development of dementia.

  6. Tau pathology in aged cynomolgus monkeys is progressive supranuclear palsy/corticobasal degeneration- but not Alzheimer disease-like -Ultrastructural mapping of tau by EDX.

    PubMed

    Uchihara, Toshiki; Endo, Kentaro; Kondo, Hiromi; Okabayashi, Sachi; Shimozawa, Nobuhiro; Yasutomi, Yasuhiro; Adachi, Eijiro; Kimura, Nobuyuki

    2016-11-14

    Concomitant deposition of amyloid -beta protein (Aβ) and neuronal tau as neurofibrillary tangles in the human brain is a hallmark of Alzheimer disease (AD). Because these deposits increase during normal aging, it has been proposed that aging brains may also undergo AD-like changes. To investigate the neuropathological changes that occur in the aging primate brain, we examined 21 brains of cynomolgus monkeys (7-36 years old) for Aβ- and tau-positive lesions. We found, 1) extensive deposition of Aβ in brains of cynomolgus monkeys over 25 years of age, 2) selective deposition of 4-repeat tau as pretangles in neurons, and as coiled body-like structures in oligodendroglia-like cells and astrocytes, 3) preferential distribution of tau in the basal ganglia and neocortex rather than the hippocampus, and 4) age-associated increases in 30-34 kDa AT8- and RD4-positive tau fragments in sarkosyl-insoluble fractions. We further labeled tau-positive structures using diaminobezidine enhanced with nickel, and visualized nickel-labeled structures by energy-dispersive X-ray (EDX) analysis of ultrathin sections. This allowed us to distinguish between nickel-labeled tau and background electron-dense structures, and we found that tau localized to 20-25 nm straight filaments in oligodendroglia-like cells and neurons. Our results indicate that the cytopathology and distribution of tau deposits in aged cynomolgus brains resemble those of progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD) rather than AD. Thus, even in the presence of Aβ, age-associated deposition of tau in non-human primates likely does not occur through AD-associated mechanisms.

  7. GNG11 (G-protein γ subunit 11) suppresses cell growth with induction of reactive oxygen species and abnormal nuclear morphology in human SUSM-1 cells.

    PubMed

    Takauji, Yuki; Kudo, Ikuru; En, Atsuki; Matsuo, Ryo; Hossain, Mohammad; Nakabayashi, Kazuhiko; Miki, Kensuke; Fujii, Michihiko; Ayusawa, Dai

    2017-04-05

    Enforced expression of GNG11, G-protein γ subunit 11, induces cellular senescence in normal human diploid fibroblasts. We here examined the effect of the expression of GNG11 on the growth of immortalized human cell lines, and found that it suppressed the growth of SUSM-1 cells, but not of HeLa cells. We then compared these two cell lines to understand the molecular basis for the action of GNG11. We found that expression of GNG11 induced the generation of reactive oxygen species (ROS) and abnormal nuclear morphology in SUSM-1 cells but not in HeLa cells. Increased ROS generation by GNG11 would likely be caused by the down-regulation of the antioxidant enzymes in SUSM-1 cells. We also found that SUSM-1 cells, even under normal culture conditions, showed higher levels of ROS and higher incidence of abnormal nuclear morphology than HeLa cells, and that abnormal nuclear morphology was relevant to the increased ROS generation in SUSM-1 cells. Thus, SUSM-1 and HeLa cells showed differences in the regulation of ROS and nuclear morphology, which might account for their different responses to the expression of GNG11. Then, SUSM-1 cells may provide a unique system to study the regulatory relationship between ROS generation, nuclear morphology, and G-protein signaling.

  8. Microtubules (tau) as an emerging therapeutic target: NAP (davunetide).

    PubMed

    Gozes, Illana

    2011-01-01

    This review focuses on the discovery of activity-dependent neuroprotective protein (ADNP) and the ensuing discovery of NAP (davunetide) toward clinical development with emphasis on microtubule protection. ADNP immunoreactivity was shown to occasionally decorate microtubules and ADNP silencing inhibited neurite outgrowth as measured by microtubule associated protein 2 (MAP2) labeling. ADNP knockout is lethal, while 50% reduction in ADNP (ADNP haploinsufficiency) resulted in the microtubule associated protein tau pathology coupled to cognitive dysfunction and neurodegeneration. NAP (davunetide), an eight amino acid peptide derived from ADNP partly ameliorated deficits associated with ADNP deficiency. NAP (davunetide) interacted with microtubules, protected against microtubule toxicity associated with zinc, nocodazole and oxidative stress in vitro and against tau pathology and MAP6 (stable tubuleonly polypeptide - STOP) pathology in vivo. NAP (davunetide) provided neurotrophic functions promoting neurite outgrowth as measured by increases in MAP2 immunoreactivity and synapse formation by increasing synaptophysin expression. NAP (davunetide) protection against neurodegeneration has recently been shown to extend to katanin-related microtubule disruption under conditions of tau deficiencies. In conclusion, NAP (davunetide) provided potent neuroprotection in a broad range of neurodegenerative models, protecting the neuroglial cytoskeleton in vitro and inhibiting tau pathology (tauopathy) in vivo. Based on these extensive preclinical results, davunetide (NAP) is now being evaluated in a Phase II/III study of the tauopathy, progressive supranuclear palsy (PSP); (Allon Therapeutics Inc.).

  9. Silencing [Formula: see text] Rescues Tau Pathologies and Memory Deficits through Rescuing PP2A and Inhibiting GSK-3β Signaling in Human Tau Transgenic Mice.

    PubMed

    Zhang, Yao; Ma, Rong-Hong; Li, Xia-Chun; Zhang, Jia-Yu; Shi, Hai-Rong; Wei, Wei; Luo, Dan-Ju; Wang, Qun; Wang, Jian-Zhi; Liu, Gong-Ping

    2014-01-01

    Increase of inhibitor-2 of protein phosphatase-2A [Formula: see text] is associated with protein phosphatase-2A (PP2A) inhibition and tau hyperphosphorylation in Alzheimer's disease (AD). Down-regulating [Formula: see text] attenuated amyloidogenesis and improved the cognitive functions in transgenic mice expressing amyloid precursor protein (tg2576). Here, we found that silencing [Formula: see text] by hippocampal infusion of [Formula: see text] down-regulated [Formula: see text] (~45%) with reduction of tau phosphorylation/accumulation, improvement of memory deficits, and dendritic plasticity in 12-month-old human tau transgenic mice. Silencing [Formula: see text] not only restored PP2A activity but also inhibited glycogen synthase kinase-3β (GSK-3β) with a significant activation of protein kinase A (PKA) and Akt. In HEK293/tau and N2a/tau cells, silencing [Formula: see text] by [Formula: see text] also significantly reduced tau hyperphosphorylation with restoration of PP2A activity and inhibition of GSK-3β, demonstrated by the decreased GSK-3β total protein and mRNA levels, and the increased inhibitory phosphorylation of GSK-3β at serine-9. Furthermore, activation of PKA but not Akt mediated the inhibition of GSK-3β by [Formula: see text] silencing. We conclude that targeting [Formula: see text] can improve tau pathologies and memory deficits in human tau transgenic mice, and activation of PKA contributes to GSK-3β inhibition induced by silencing [Formula: see text]in vitro, suggesting that [Formula: see text] is a promising multiple target of AD.

  10. Silencing I2PP2A Rescues Tau Pathologies and Memory Deficits through Rescuing PP2A and Inhibiting GSK-3β Signaling in Human Tau Transgenic Mice

    PubMed Central

    Zhang, Yao; Ma, Rong-Hong; Li, Xia-Chun; Zhang, Jia-Yu; Shi, Hai-Rong; Wei, Wei; Luo, Dan-Ju; Wang, Qun; Wang, Jian-Zhi; Liu, Gong-Ping

    2014-01-01

    Increase of inhibitor-2 of protein phosphatase-2A I2PP2A is associated with protein phosphatase-2A (PP2A) inhibition and tau hyperphosphorylation in Alzheimer’s disease (AD). Down-regulating I2PP2A attenuated amyloidogenesis and improved the cognitive functions in transgenic mice expressing amyloid precursor protein (tg2576). Here, we found that silencing I2PP2A by hippocampal infusion of Lenti - siI2PP2A down-regulated I2PP2A (~45%) with reduction of tau phosphorylation/accumulation, improvement of memory deficits, and dendritic plasticity in 12-month-old human tau transgenic mice. Silencing I2PP2A not only restored PP2A activity but also inhibited glycogen synthase kinase-3β (GSK-3β) with a significant activation of protein kinase A (PKA) and Akt. In HEK293/tau and N2a/tau cells, silencing I2PP2A by pSUPER - siI2PP2A also significantly reduced tau hyperphosphorylation with restoration of PP2A activity and inhibition of GSK-3β, demonstrated by the decreased GSK-3β total protein and mRNA levels, and the increased inhibitory phosphorylation of GSK-3β at serine-9. Furthermore, activation of PKA but not Akt mediated the inhibition of GSK-3β by I2PP2A silencing. We conclude that targeting I2PP2A can improve tau pathologies and memory deficits in human tau transgenic mice, and activation of PKA contributes to GSK-3β inhibition induced by silencing I2PP2A in vitro, suggesting that I2PP2A is a promising multiple target of AD. PMID:24987368

  11. Tau Decays at BaBar

    SciTech Connect

    Hast, Carsten; /SLAC

    2009-01-22

    Recent results of tau lepton decay studies based on luminosities between 350 fb{sup -1} and 469 fb{sup -1} collected with the BABAR detector at the PEP-II e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory are presented. The analyses reported here are Charged Current Lepton Universality and measurements of |V{sub us}| using {tau}{sup -} {yields} e{sup -}{bar {nu}}{sub e}{nu}{sub {tau}}, {mu}{sup -}{bar {nu}}{sub {mu}}{nu}{sub {tau}}, {pi}{sup -} {nu}{sub {tau}}, and K{sup -}{nu}{sub {tau}} decays, as well as searches for Second Class Currents in {tau}{sup -} {yields} {omega}{pi}{sup -}{nu}{sub {tau}} decays, studies of Lepton Flavor Violations, and a tau mass measurement and CPT-Test. If not explicitly mentioned, charge conjugate decay modes are also implied. decays, as well as searches for Second Class Currents in {tau}{sup -} {yields} {omega}{pi}{sup -}{nu}{sub {tau}} decays, studies of Lepton Flavor Violations, and a tau mass measurement and CPT-Test. If not explicitly mentioned, charge conjugate decay modes are also implied.

  12. A Tau-Charm Factory at CEBAF

    SciTech Connect

    Seth, K.K.

    1994-04-01

    It is proposed that a Tau Charm Factory represents a natural extension of CEBAF into higher energy domains. The exciting nature of the physics of charm quarks and tau leptons is briefly reviewed and it is suggested that the concept of a linac-ring collider as a Tau Charm Factory at CEBAF should be seriously studied.

  13. Tau Trigger at the ATLAS Experiment

    SciTech Connect

    Benslama, K.; Kalinowski, A.; Belanger-Champange, C.; Brenner, R.; Bosman, M.; Casado, P.; Osuna, C.; Perez, E.; Vorwerk, V.; Czyczula, Z.; Dam, M.; Xella, S.; Demers, S.; Farrington, S.; Igonkina, O.; Kanaya, N.; Tsuno, S.; Ptacek, E.; Reinsch, A.; Strom, David M.; Torrence, E.; /Oregon U. /Sydney U. /Lancaster U. /Birmingham U.

    2011-11-09

    Many theoretical models, like the Standard Model or SUSY at large tan({beta}), predict Higgs bosons or new particles which decay more abundantly to final states including tau leptons than to other leptons. At the energy scale of the LHC, the identification of tau leptons, in particular in the hadronic decay mode, will be a challenging task due to an overwhelming QCD background which gives rise to jets of particles that can be hard to distinguish from hadronic tau decays. Equipped with excellent tracking and calorimetry, the ATLAS experiment has developed tau identification tools capable of working at the trigger level. This contribution presents tau trigger algorithms which exploit the main features of hadronic tau decays and describes the current tau trigger commissioning activities. Many of the SM processes being investigated at ATLAS, as well as numerous BSM searches, contain tau leptons in their final states. Being able to trigger effectively on the tau leptons in these events will contribute to the success of the ATLAS experiment. The tau trigger algorithms and monitoring infrastructure are ready for the first data, and are being tested with the data collected with cosmic muons. The development of efficiency measurements methods using QCD and Z {yields} {tau}{tau} events is well advanced.

  14. Sodium selenate reduces hyperphosphorylated tau and improves outcomes after traumatic brain injury.

    PubMed

    Shultz, Sandy R; Wright, David K; Zheng, Ping; Stuchbery, Ryan; Liu, Shi-Jie; Sashindranath, Maithili; Medcalf, Robert L; Johnston, Leigh A; Hovens, Christopher M; Jones, Nigel C; O'Brien, Terence J

    2015-05-01

    Traumatic brain injury is a common and serious neurodegenerative condition that lacks a pharmaceutical intervention to improve long-term outcome. Hyperphosphorylated tau is implicated in some of the consequences of traumatic brain injury and is a potential pharmacological target. Protein phosphatase 2A is a heterotrimeric protein that regulates key signalling pathways, and protein phosphatase 2A heterotrimers consisting of the PR55 B-subunit represent the major tau phosphatase in the brain. Here we investigated whether traumatic brain injury in rats and humans would induce changes in protein phosphatase 2A and phosphorylated tau, and whether treatment with sodium selenate-a potent PR55 activator-would reduce phosphorylated tau and improve traumatic brain injury outcomes in rats. Ninety young adult male Long-Evans rats were administered either a fluid percussion injury or sham-injury. A proportion of rats were killed at 2, 24, and 72 h post-injury to assess acute changes in protein phosphatase 2A and tau. Other rats were given either sodium selenate or saline-vehicle treatment that was continuously administered via subcutaneous osmotic pump for 12 weeks. Serial magnetic resonance imaging was acquired prior to, and at 1, 4, and 12 weeks post-injury to assess evolving structural brain damage and axonal injury. Behavioural impairments were assessed at 12 weeks post-injury. The results showed that traumatic brain injury in rats acutely reduced PR55 expression and protein phosphatase 2A activity, and increased the expression of phosphorylated tau and the ratio of phosphorylated tau to total tau. Similar findings were seen in post-mortem brain samples from acute human traumatic brain injury patients, although many did not reach statistical significance. Continuous sodium selenate treatment for 12 weeks after sham or fluid percussion injury in rats increased protein phosphatase 2A activity and PR55 expression, and reduced the ratio of phosphorylated tau to total tau

  15. iTRAQ-based proteomic analysis of plasma reveals abnormalities in lipid metabolism proteins in chronic kidney disease-related atherosclerosis

    PubMed Central

    Luczak, Magdalena; Formanowicz, Dorota; Marczak, Łukasz; Suszyńska-Zajczyk, Joanna; Pawliczak, Elżbieta; Wanic-Kossowska, Maria; Stobiecki, Maciej

    2016-01-01

    Patients with chronic kidney disease (CKD) have a considerably higher risk of death due to cardiovascular causes. Using an iTRAQ MS/MS approach, we investigated the alterations in plasma protein accumulation in patients with CKD and classical cardiovascular disease (CVD) without CKD. The proteomic analysis led to the identification of 130 differentially expressed proteins among CVD and CKD patients and healthy volunteers. Bioinformatics analysis revealed that 29 differentially expressed proteins were involved in lipid metabolism and atherosclerosis, 20 of which were apolipoproteins and constituents of high-density lipoprotein (HDL) and low-density lipoprotein (LDL). Although dyslipidemia is common in CKD patients, we found that significant changes in apolipoproteins were not strictly associated with changes in plasma lipid levels. A lack of correlation between apoB and LDL concentration and an inverse relationship of some proteins with the HDL level were revealed. An increased level of apolipoprotein AIV, adiponectin, or apolipoprotein C, despite their anti-atherogenic properties, was not associated with a decrease in cardiovascular event risk in CKD patients. The presence of the distinctive pattern of apolipoproteins demonstrated in this study may suggest that lipid abnormalities in CKD are characterized by more qualitative abnormalities and may be related to HDL function rather than HDL deficiency. PMID:27600335

  16. Temporarily decreasing progesterone after timed artificial insemination decreased expression of interferon-tau stimulated gene 15 (ISG15) in blood leukocytes, serum pregnancy-specific protein B concentrations, and embryo size in lactating Holstein cows.

    PubMed

    Carvalho, P D; Consentini, C C; Weaver, S R; Barleta, R V; Hernandez, L L; Fricke, P M

    2017-04-01

    Our objective was to evaluate the effects of temporarily decreasing progesterone (P4) after timed artificial insemination (TAI) on embryonic growth in dairy cows. Lactating Holstein cows (n = 80) were submitted to a Double-Ovsynch protocol for first TAI and were assigned randomly to receive 12.5 mg of PGF2α 5 d after the last GnRH treatment (LowP4) or remain untreated (control). Blood samples were collected thrice weekly from 5 to 29 d after TAI for all cows and from 32 to 67 d for pregnant cows, and were analyzed for P4 and pregnancy-specific protein B concentrations. Expression of interferon-tau stimulated gene 15 (ISG15) was assessed in blood leukocyte mRNA 18 and 20 d after TAI. Pregnancy diagnosis was performed weekly using ultrasound from 32 to 67 d after TAI, and embryonic crown-rump length was measured 32, 39, and 46 d after TAI. Data were analyzed by ANOVA and logistic regression using the MIXED and GLIMMIX procedures of SAS. The LowP4 cows had less P4 than control cows from 6 to 11 d after TAI; however, pregnancy outcomes 32 d after TAI and pregnancy loss from 32 to 67 d after TAI did not differ between treatments. Control cows diagnosed pregnant 32 d after TAI had greater expression of ISG15 20 d after TAI than LowP4 cows diagnosed pregnant 32 d after TAI, and pregnant control cows had greater pregnancy-specific protein B concentrations from 25 to 67 d after TAI than pregnant LowP4 cows. Embryo size did not differ between treatments 32 and 39 d after TAI, but control cows had larger embryos 46 d after TAI. In conclusion, temporarily decreasing P4 after TAI decreased embryonic growth during early pregnancy in lactating Holstein cows but did not affect pregnancies per artificial insemination or pregnancy loss.

  17. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    PubMed

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  18. Functional genomic screen and network analysis reveal novel modifiers of tauopathy dissociated from tau phosphorylation

    PubMed Central

    Ambegaokar, Surendra S.; Jackson, George R.

    2011-01-01

    A functional genetic screen using loss-of-function and gain-of-function alleles was performed to identify modifiers of tau-induced neurotoxicity using the 2N/4R (full-length) isoform of wild-type human tau expressed in the fly retina. We previously reported eye pigment mutations, which create dysfunctional lysosomes, as potent modifiers; here, we report 37 additional genes identified from ∼1900 genes screened, including the kinases shaggy/GSK-3beta, par-1/MARK, CamKI and Mekk1. Tau acts synergistically with Mekk1 and p38 to down-regulate extracellular regulated kinase activity, with a corresponding decrease in AT8 immunoreactivity (pS202/T205), suggesting that tau can participate in signaling pathways to regulate its own kinases. Modifiers showed poor correlation with tau phosphorylation (using the AT8, 12E8 and AT270 epitopes); moreover, tested suppressors of wild-type tau were equally effective in suppressing toxicity of a phosphorylation-resistant S11A tau construct, demonstrating that changes in tau phosphorylation state are not required to suppress or enhance its toxicity. Genes related to autophagy, the cell cycle, RNA-associated proteins and chromatin-binding proteins constitute a large percentage of identified modifiers. Other functional categories identified include mitochondrial proteins, lipid trafficking, Golgi proteins, kinesins and dynein and the Hsp70/Hsp90-organizing protein (Hop). Network analysis uncovered several other genes highly associated with the functional modifiers, including genes related to the PI3K, Notch, BMP/TGF-β and Hedgehog pathways, and nuclear trafficking. Activity of GSK-3β is strongly upregulated due to TDP-43 expression, and reduced GSK-3β dosage is also a common suppressor of Aβ42 and TDP-43 toxicity. These findings suggest therapeutic targets other than mitigation of tau phosphorylation. PMID:21949350

  19. Prospect for measuring the CP phase in the $h\\tau\\tau$ coupling at the LHC

    SciTech Connect

    Askew, Andrew; Jaiswal, Prerit; Okui, Takemichi; Prosper, Harrison B.; Sato, Nobuo

    2015-04-01

    The search for a new source of CP violation is one of the most important endeavors in particle physics. A particularly interesting way to perform this search is to probe the CP phase in the $h\\tau\\tau$ coupling, as the phase is currently completely unconstrained by all existing data. Recently, a novel variable $\\Theta$ was proposed for measuring the CP phase in the $h\\tau\\tau$ coupling through the $\\tau^\\pm \\to \\pi^\\pm \\pi^0 \

  20. Regulation of Microtubule Assembly by Tau and not by Pin1.

    PubMed

    Kutter, Steffen; Eichner, Timo; Deaconescu, Alexandra M; Kern, Dorothee

    2016-05-08

    The molecular mechanism by which the microtubule-associated protein (MAP) tau regulates the formation of microtubules (MTs) is poorly understood. The activity of tau is controlled via phosphorylation at specific Ser/Thr sites. Of those phosphorylation sites, 17 precede a proline, making them potential recognition sites for the peptidyl-prolyl isomerase Pin1. Pin1 binding and catalysis of phosphorylated tau at the AT180 epitope, which was implicated in Alzheimer's disease, has been reported to be crucial for restoring tau's ability to promote MT polymerization in vitro and in vivo [1]. Surprisingly, we discover that Pin1 does not promote phosphorylated tau-induced MT formation in vitro, refuting the commonly accepted model in which Pin1 binding and catalysis on the A180 epitope restores the function of the Alzheimer's associated phosphorylated tau in tubulin assembly [1, 2]. Using turbidity assays, time-resolved small angle X-ray scattering (SAXS), and time-resolved negative stain electron microscopy (EM), we investigate the mechanism of tau-mediated MT assembly and the role of the Thr231 and Ser235 phosphorylation on this process. We discover novel GTP-tubulin ring-shaped species, which are detectable in the earliest stage of tau-induced polymerization and may play a crucial role in the early nucleation phase of MT assembly. Finally, by NMR and SAXS experiments, we show that the tau molecules must be located on the surface of MTs and tubulin rings during the polymerization reaction. The interaction between tau and tubulin is multipartite, with a high affinity interaction of the four tubulin-binding repeats, and a weaker interaction with the proline-rich sequence and the termini of tau.

  1. N-Terminal Tau Fragments as Biomarkers for Alzheimer’s Disease and Neurotrauma

    DTIC Science & Technology

    2014-10-01

    1), such as might be expected with senile plaques (1). This pattern suggests that E2- tau may accumulate as the result of Abeta – tau interactions... plaques (Figure 2C). This is particularly interesting in light of the bioinformatic analysis of the exosomal fraction proteins associated with E2...colocalize with senile plaque profiles revealed by GFAP (glial fibrillary acidic protein) immunolabel (see insets and panel at right). The patchy

  2. Interplay between Velocity and Travel Distance of Kinesin-based Transport in the Presence of Tau

    PubMed Central

    Xu, Jing; King, Stephen J.; Lapierre-Landry, Maryse; Nemec, Brian

    2013-01-01

    Although the disease-relevant microtubule-associated protein tau is known to severely inhibit kinesin-based transport in vitro, the potential mechanisms for reversing this detrimental effect to maintain healthy transport in cells remain unknown. Here we report the unambiguous upregulation of multiple-kinesin travel distance despite the presence of tau, via decreased single-kinesin velocity. Interestingly, the presence of tau also modestly reduced cargo velocity in multiple-kinesin transport, and our stochastic simulations indicate that the tau-mediated reduction in single-kinesin travel underlies this observation. Taken together, our observations highlight a nontrivial interplay between velocity and travel distance for kinesin transport, and suggest that single-kinesin velocity is a promising experimental handle for tuning the effect of tau on multiple-kinesin travel distance. PMID:24268156

  3. Evidence for B+ --> tau+ nu_tau Decays using Hadronic B Tags

    SciTech Connect

    del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Milanes, D.A.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC