Sample records for acad sci issn

  1. SciLinks

    Science.gov Websites

    SciLinks Forgot your login? Sign up for FREE access Log In I'm a ... Teacher Student User Name questions and satisfy their curiosity Learn More Sign up for Free Access Sites in the SciLinks program . SciLinks-Targeted, Grade-Specific Web Content for your Books Free web content to extend and expand student

  2. Reveal genes functionally associated with ACADS by a network study.

    PubMed

    Chen, Yulong; Su, Zhiguang

    2015-09-15

    Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Preface: SciDAC 2009

    NASA Astrophysics Data System (ADS)

    Simon, Horst

    2009-07-01

    By almost any measure, the SciDAC community has come a long way since DOE launched the SciDAC program back in 2001. At the time, we were grappling with how to efficiently run applications on terascale systems (the November 2001 TOP500 list was led by DOE's ASCI White IBM system at Lawrence Livermore achieving 7.2 teraflop/s). And the results stemming from the first round of SciDAC projects were summed up in two-page reports. The scientific results were presented at annual meetings, which were by invitation only and typically were attended by about 75 researchers. Fast forward to 2009 and we now have SciDAC Review, a quarterly magazine showcasing the scientific computing contributions of SciDAC projects and related programs, all focused on presenting a comprehensive look at Scientific Discovery through Advanced Computing. That is also the motivation behind the annual SciDAC conference that in 2009 was held from June 14-18 in San Diego. The annual conference, which can also be described as a celebration of all things SciDAC, grew out those meetings organized in the early days of the program. In 2005, the meeting was held in San Francisco and attendance was opened up to all members of the SciDAC community. The schedule was also expanded to include a keynote address, plenary speakers and other features found in a conference format. This year marks the fifth such SciDAC conference, which now comprises four days of computational science presentations, multiple poster sessions and, since last year, an evening event showcasing simulations and modeling runs resulting from SciDAC projects. The fifth annual SciDAC conference was remarkable on several levels. The primary purpose, of course, is to showcase the research accomplishments resulting from SciDAC programs in particular and computational science in general. It is these accomplishments, represented in 38 papers and 52 posters, that comprise this set of conference proceedings. These proceedings can stand alone as

  4. 75 FR 24747 - SCI, LLC/Zener-Rectifier Operations Division A Wholly Owned Subsidiary of SCI, LLC/ON...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,235] SCI, LLC/Zener-Rectifier... Adjustment Assistance on October 19, 2009, applicable to workers of SCI LLC/Zener-Rectifier, Operations... Technical Resources were employed on-site at the Phoenix Arizona location of SCI LLC/Zener-Rectifier...

  5. Evaluation and Management of SCI-Associated Pain.

    PubMed

    Saulino, Michael; Averna, Justin F

    2016-09-01

    Traumatic spinal cord injury (SCI) is a devastating neurological condition. Treatment of SCI-related pain is challenging for the treating physician, as normal neural pathways are disrupted. Patients with SCI consistently rate pain as one of the most difficult problems associated with their injury. SCI-related pain can be refractory and complete relief is often not possible. The multidimensional nature of SCI-related pain affects the neural system including autonomic nervous system deregulation and can alter metabolic and biochemical processes throughout the body. Co-morbid psychological illnesses such as depression and adjustment disorder are seen in a significant percentage of patients. Despite a better understanding of the underlying pain mechanisms and advances in procedural, pharmacologic, and non-pharmacologic therapies, treatment of pain after SCI remains elusive. This manuscript reviews the current evidence-based evaluation and management of the SCI patient with the overarching goal of providing appropriate and effective management of their pain. In particular, additional well-designed studies are needed to help elucidate effective treatments for SCI-related neuropathic pain in an effort to help provide these patients with better management of their pain and improve their quality of life.

  6. SCI Hazard Report Methodology

    NASA Technical Reports Server (NTRS)

    Mitchell, Michael S.

    2010-01-01

    This slide presentation reviews the methodology in creating a Source Control Item (SCI) Hazard Report (HR). The SCI HR provides a system safety risk assessment for the following Ares I Upper Stage Production Contract (USPC) components (1) Pyro Separation Systems (2) Main Propulsion System (3) Reaction and Roll Control Systems (4) Thrust Vector Control System and (5) Ullage Settling Motor System components.

  7. Preface: SciDAC 2007

    NASA Astrophysics Data System (ADS)

    Keyes, David E.

    2007-09-01

    It takes a village to perform a petascale computation—domain scientists, applied mathematicians, computer scientists, computer system vendors, program managers, and support staff—and the village was assembled during 24-28 June 2007 in Boston's Westin Copley Place for the third annual Scientific Discovery through Advanced Computing (SciDAC) 2007 Conference. Over 300 registered participants networked around 76 posters, focused on achievements and challenges in 36 plenary talks, and brainstormed in two panels. In addition, with an eye to spreading the vision for simulation at the petascale and to growing the workforce, 115 participants—mostly doctoral students and post-docs complementary to the conferees—were gathered on 29 June 2007 in classrooms of the Massachusetts Institute of Technology for a full day of tutorials on the use of SciDAC software. Eleven SciDAC-sponsored research groups presented their software at an introductory level, in both lecture and hands-on formats that included live runs on a local BlueGene/L. Computation has always been about garnering insight into the behavior of systems too complex to explore satisfactorily by theoretical means alone. Today, however, computation is about much more: scientists and decision makers expect quantitatively reliable predictions from simulations ranging in scale from that of the Earth's climate, down to quarks, and out to colliding black holes. Predictive simulation lies at the heart of policy choices in energy and environment affecting billions of lives and expenditures of trillions of dollars. It is also at the heart of scientific debates on the nature of matter and the origin of the universe. The petascale is barely adequate for such demands and we are barely established at the levels of resolution and throughput that this new scale of computation affords. However, no scientific agenda worldwide is pushing the petascale frontier on all its fronts as vigorously as SciDAC. The breadth of this conference

  8. Preface: SciDAC 2006

    NASA Astrophysics Data System (ADS)

    Tang, William M., Dr.

    2006-01-01

    The second annual Scientific Discovery through Advanced Computing (SciDAC) Conference was held from June 25-29, 2006 at the new Hyatt Regency Hotel in Denver, Colorado. This conference showcased outstanding SciDAC-sponsored computational science results achieved during the past year across many scientific domains, with an emphasis on science at scale. Exciting computational science that has been accomplished outside of the SciDAC program both nationally and internationally was also featured to help foster communication between SciDAC computational scientists and those funded by other agencies. This was illustrated by many compelling examples of how domain scientists collaborated productively with applied mathematicians and computer scientists to effectively take advantage of terascale computers (capable of performing trillions of calculations per second) not only to accelerate progress in scientific discovery in a variety of fields but also to show great promise for being able to utilize the exciting petascale capabilities in the near future. The SciDAC program was originally conceived as an interdisciplinary computational science program based on the guiding principle that strong collaborative alliances between domain scientists, applied mathematicians, and computer scientists are vital to accelerated progress and associated discovery on the world's most challenging scientific problems. Associated verification and validation are essential in this successful program, which was funded by the US Department of Energy Office of Science (DOE OS) five years ago. As is made clear in many of the papers in these proceedings, SciDAC has fundamentally changed the way that computational science is now carried out in response to the exciting challenge of making the best use of the rapid progress in the emergence of more and more powerful computational platforms. In this regard, Dr. Raymond Orbach, Energy Undersecretary for Science at the DOE and Director of the OS has stated

  9. Combined SCI and TBI: Recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement

    PubMed Central

    Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L.; Creasey, Graham H.; Manley, Geoffrey T.; Ferguson, Adam R.; Bresnahan, Jacqueline C.; Beattie, Michael S.

    2015-01-01

    A significant proportion (estimates range from 16–74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI + TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6 weeks, in the paw placement test, SCI + contralateral TBI produced a profound deficit that failed to recover, but SCI + ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI + contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI + contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the

  10. Combined SCI and TBI: recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement.

    PubMed

    Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L; Creasey, Graham H; Manley, Geoffrey T; Ferguson, Adam R; Bresnahan, Jacqueline C; Beattie, Michael S

    2013-10-01

    A significant proportion (estimates range from 16 to 74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI+TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6weeks, in the paw placement test, SCI+contralateral TBI produced a profound deficit that failed to recover, but SCI+ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI+contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI+contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the contralateral

  11. Learning by Creating and Exchanging Objects: The SCY Experience

    ERIC Educational Resources Information Center

    De Jong, Ton; Van Joolingen, Wouter R.; Giemza, Adam; Girault, Isabelle; Hoppe, Ulrich; Kindermann, Jorg; Kluge, Anders; Lazonder, Ard W.; Vold, Vibeke; Weinberger, Armin; Weinbrenner, Stefan; Wichmann, Astrid; Anjewierden, Anjo; Bodin, Marjolaine; Bollen, Lars; D'Ham, Cedric; Dolonen, Jan; Engler, Jan; Geraedts, Caspar; Grosskreutz, Henrik; Hovardas, Tasos; Julien, Rachel; Lechner, Judith; Ludvigsen, Sten; Matteman, Yuri; Meistadt, Oyvind; Naess, Bjorge; Ney, Muriel; Pedaste, Margus; Perritano, Anthony; Rinket, Marieke; Von Schlanbusch, Henrik; Sarapuu, Tago; Schulz, Florian; Sikken, Jakob; Slotta, Jim; Toussaint, Jeremy; Verkade, Alex; Wajeman, Claire; Wasson, Barbara; Zacharia, Zacharias C.; Van Der Zanden, Martine

    2010-01-01

    Science Created by You (SCY) is a project on learning in science and technology domains. SCY uses a pedagogical approach that centres around products, called "emerging learning objects" (ELOs) that are created by students. Students work individually and collaboratively in SCY-Lab (the general SCY learning environment) on "missions" that are guided…

  12. Psychometric evaluation of the Spanish version of the MPI-SCI.

    PubMed

    Soler, M D; Cruz-Almeida, Y; Saurí, J; Widerström-Noga, E G

    2013-07-01

    Postal surveys. To confirm the factor structure of the Spanish version of the MPI-SCI (MPI-SCI-S, Multidimensional Pain Inventory in the SCI population) and to test its internal consistency and construct validity in a Spanish population. Guttmann Institute, Barcelona, Spain. The MPI-SCI-S along with Spanish measures of pain intensity (Numerical Rating Scale), pain interference (Brief Pain Inventory), functional independence (Functional Independence Measure), depression (Beck Depression Inventory), locus of control (Multidimensional health Locus of Control), support (Functional Social Support Questionnaire (Duke-UNC)), psychological well-being (Psychological Global Well-Being Index) and demographic/injury characteristics were assessed in persons with spinal cord injury (SCI) and chronic pain (n=126). Confirmatory factor analysis suggested an adequate factor structure for the MPI-SCI-S. The internal consistency of the MPI-SCI-S subscales ranged from acceptable (r=0.66, Life Control) to excellent (r=0.94, Life Interference). All MPI-SCI-S subscales showed adequate construct validity, with the exception of the Negative and Solicitous Responses subscales. The Spanish version of the MPI-SCI is adequate for evaluating chronic pain impact following SCI in a Spanish-speaking population. Future studies should include additional measures of pain-related support in the Spanish-speaking SCI population.

  13. [SciELO: method for electronic publishing].

    PubMed

    Laerte Packer, A; Rocha Biojone, M; Antonio, I; Mayumi Takemaka, R; Pedroso García, A; Costa da Silva, A; Toshiyuki Murasaki, R; Mylek, C; Carvalho Reisl, O; Rocha F Delbucio, H C

    2001-01-01

    It describes the SciELO Methodology Scientific Electronic Library Online for electronic publishing of scientific periodicals, examining issues such as the transition from traditional printed publication to electronic publishing, the scientific communication process, the principles which founded the methodology development, its application in the building of the SciELO site, its modules and components, the tools use for its construction etc. The article also discusses the potentialities and trends for the area in Brazil and Latin America, pointing out questions and proposals which should be investigated and solved by the methodology. It concludes that the SciELO Methodology is an efficient, flexible and wide solution for the scientific electronic publishing.

  14. PTEN Loss Antagonizes Calcitriol-Mediated Growth Inhibition in Prostate Epithelial Cells

    DTIC Science & Technology

    2009-05-01

    deleting lentiviral vector: efficient gene targeting in vivo. Proc Natl Acad Sci U S A, 98: 11450-11455, 2001. 27. Vlahos , C. J., Matter, W. F., Hui, K...and in aging skin in vivo. Proc Natl Acad Sci U S A, 92: 9363-9367, 1995. 35. Vlahos , C. J., Matter, W. F., Hui, K. Y., and Brown, R. F. A specific

  15. MadSciNet: The 24-hour exploding laboratory.

    Science.gov Websites

    Page New! Help Improve The Madsci Network Help Support MadSci MAD Head MAD egg Welcome to the laboratory that never sleeps! MadSci Network represents a collective cranium of scientists providing answers Sunday May 27, 2018. Lynn MadSci Network is a non-profit organization operating in partnership with Third

  16. Performance of the SciBar cosmic ray telescope (SciCRT) toward the detection of high-energy solar neutrons in solar cycle 24

    NASA Astrophysics Data System (ADS)

    Sasai, Yoshinori; Nagai, Yuya; Itow, Yoshitaka; Matsubara, Yutaka; Sako, Takashi; Lopez, Diego; Itow, Tsukasa; Munakata, Kazuoki; Kato, Chihiro; Kozai, Masayoshi; Miyazaki, Takahiro; Shibata, Shoichi; Oshima, Akitoshi; Kojima, Hiroshi; Tsuchiya, Harufumi; Watanabe, Kyoko; Koi, Tatsumi; Valdés-Galicia, Jose Francisco; González, Luis Xavier; Ortiz, Ernesto; Musalem, Octavio; Hurtado, Alejandro; Garcia, Rocio; Anzorena, Marcos

    2014-12-01

    We plan to observe solar neutrons at Mt. Sierra Negra (4,600 m above sea level) in Mexico using the SciBar detector. This project is named the SciBar Cosmic Ray Telescope (SciCRT). The main aims of the SciCRT project are to observe solar neutrons to study the mechanism of ion acceleration on the surface of the sun and to monitor the anisotropy of galactic cosmic-ray muons. The SciBar detector, a fully active tracker, is composed of 14,848 scintillator bars, whose dimension is 300 cm × 2.5 cm × 1.3 cm. The structure of the detector enables us to obtain the particle trajectory and its total deposited energy. This information is useful for the energy reconstruction of primary neutrons and particle identification. The total volume of the detector is 3.0 m × 3.0 m × 1.7 m. Since this volume is much larger than the solar neutron telescope (SNT) in Mexico, the detection efficiency of the SciCRT for neutrons is highly enhanced. We performed the calibration of the SciCRT at Instituto Nacional de Astrofisica, Optica y Electronica (INAOE) located at 2,150 m above sea level in Mexico in 2012. We installed the SciCRT at Mt. Sierra Negra in April 2013 and calibrated this detector in May and August 2013. We started continuous observation in March 2014. In this paper, we report the detector performance as a solar neutron telescope and the current status of the SciCRT.

  17. Development and initial evaluation of the SCI-FI/AT.

    PubMed

    Jette, Alan M; Slavin, Mary D; Ni, Pengsheng; Kisala, Pamela A; Tulsky, David S; Heinemann, Allen W; Charlifue, Susie; Tate, Denise G; Fyffe, Denise; Morse, Leslie; Marino, Ralph; Smith, Ian; Williams, Steve

    2015-05-01

    To describe the domain structure and calibration of the Spinal Cord Injury Functional Index for samples using Assistive Technology (SCI-FI/AT) and report the initial psychometric properties of each domain. Cross sectional survey followed by computerized adaptive test (CAT) simulations. Inpatient and community settings. A sample of 460 adults with traumatic spinal cord injury (SCI) stratified by level of injury, completeness of injury, and time since injury. None SCI-FI/AT RESULTS: Confirmatory factor analysis (CFA) and Item response theory (IRT) analyses identified 4 unidimensional SCI-FI/AT domains: Basic Mobility (41 items) Self-care (71 items), Fine Motor Function (35 items), and Ambulation (29 items). High correlations of full item banks with 10-item simulated CATs indicated high accuracy of each CAT in estimating a person's function, and there was high measurement reliability for the simulated CAT scales compared with the full item bank. SCI-FI/AT item difficulties in the domains of Self-care, Fine Motor Function, and Ambulation were less difficult than the same items in the original SCI-FI item banks. With the development of the SCI-FI/AT, clinicians and investigators have available multidimensional assessment scales that evaluate function for users of AT to complement the scales available in the original SCI-FI.

  18. Opening Comments: SciDAC 2008

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2008-07-01

    Welcome to Seattle and the 2008 SciDAC Conference. This conference, the fourth in the series, is a continuation of the PI meetings we first began under SciDAC-1. I would like to start by thanking the organizing committee, and Rick Stevens in particular, for organizing this year's meeting. This morning I would like to look briefly at SciDAC, to give you a brief history of SciDAC and also look ahead to see where we plan to go over the next few years. I think the best description of SciDAC, at least the simulation part, comes from a quote from Dr Ray Orbach, DOE's Under Secretary for Science and Director of the Office of Science. In an interview that appeared in the SciDAC Review magazine, Dr Orbach said, `SciDAC is unique in the world. There isn't any other program like it anywhere else, and it has the remarkable ability to do science by bringing together physical scientists, mathematicians, applied mathematicians, and computer scientists who recognize that computation is not something you do at the end, but rather it needs to be built into the solution of the very problem that one is addressing'. Of course, that is extended not just to physical scientists, but also to biological scientists. This is a theme of computational science, this partnership among disciplines, which goes all the way back to the early 1980s and Ken Wilson. It's a unique thread within the Department of Energy. SciDAC-1, launched around the turn of the millennium, created a new generation of scientific simulation codes. It advocated building out mathematical and computing system software in support of science and a new collaboratory software environment for data. The original concept for SciDAC-1 had topical centers for the execution of the various science codes, but several corrections and adjustments were needed. The ASCR scientific computing infrastructure was also upgraded, providing the hardware facilities for the program. The computing facility that we had at that time was the big 3

  19. The Implementation Challenge and the Learning Health System for SCI Initiative.

    PubMed

    Stucki, Gerold; Bickenbach, Jerome

    2017-02-01

    The paper introduces the special issue by linking the International Spinal Cord Injury (InSCI) Community Survey study to the Learning Health System for SCI Initiative (LHS-SCI). The LHS-SCI was designed to respond to the implementation challenge of bringing about policy reform in light of the targeted policy recommendations of World Health Organization's International Perspectives on SCI report as well as the call for action of WHO's Global Disability Action Plan. The paper reviews the components of LHS-SCI relevant to internationally comparable information, a theory of change to guide for action, and the tools for evidence-informed policy. The interplay between persons, their health needs, and the societal response to those needs provides the foundation for the organization of the LHS-SCI Initiative. Moreover, as the other articles in this special issue describe in detail, the rationale, conceptualization, and study design of the InSCI study are also informed by the rationale, and mission, of the LHS for SCI Initiative. The LHS-SCI, and the implementation challenge that motivates it, is responsible for the design of the InSCI study and the overall mission of LHS-SCI to continuously improve the lived experience of people living with SCI around the world through an international evidence- and rights-informed research and policy reform effort.

  20. Development and initial evaluation of the SCI-FI/AT

    PubMed Central

    Jette, Alan M.; Slavin, Mary D.; Ni, Pengsheng; Kisala, Pamela A.; Tulsky, David S.; Heinemann, Allen W.; Charlifue, Susie; Tate, Denise G.; Fyffe, Denise; Morse, Leslie; Marino, Ralph; Smith, Ian; Williams, Steve

    2015-01-01

    Objectives To describe the domain structure and calibration of the Spinal Cord Injury Functional Index for samples using Assistive Technology (SCI-FI/AT) and report the initial psychometric properties of each domain. Design Cross sectional survey followed by computerized adaptive test (CAT) simulations. Setting Inpatient and community settings. Participants A sample of 460 adults with traumatic spinal cord injury (SCI) stratified by level of injury, completeness of injury, and time since injury. Interventions None Main outcome measure SCI-FI/AT Results Confirmatory factor analysis (CFA) and Item response theory (IRT) analyses identified 4 unidimensional SCI-FI/AT domains: Basic Mobility (41 items) Self-care (71 items), Fine Motor Function (35 items), and Ambulation (29 items). High correlations of full item banks with 10-item simulated CATs indicated high accuracy of each CAT in estimating a person's function, and there was high measurement reliability for the simulated CAT scales compared with the full item bank. SCI-FI/AT item difficulties in the domains of Self-care, Fine Motor Function, and Ambulation were less difficult than the same items in the original SCI-FI item banks. Conclusion With the development of the SCI-FI/AT, clinicians and investigators have available multidimensional assessment scales that evaluate function for users of AT to complement the scales available in the original SCI-FI. PMID:26010975

  1. Orgasm and SCI: what do we know?

    PubMed

    Alexander, Marcalee; Marson, Lesley

    2018-06-01

    narrative review OBJECTIVES: To determine the percentage of persons with SCI able to achieve orgasm and ejaculation, the associations between ejaculation and orgasm and the subjective and autonomic findings during these events, and the potential benefits with regards to spasticity. Two American medical centers METHODS: Data bases were searched for the terms orgasm and SCI and ejaculation and SCI. Search criteria were human studies published in English from 1990 to 12/2/2016. Approximately 50% of sexually active men and women report orgasmic ability after SCI. There is a relative inability of persons with complete lower motor neuron injuries affecting the sacral segments to achieve orgasm. Time to orgasm is longer in persons with SCIs than able-bodied (AB) persons. With orgasm, elevated blood pressure (BP) occurs after SCI in a similar fashion to AB persons. With penile vibratory stimulation and electroejaculation, BP elevation is common and prophylaxis is recommended in persons with injuries at T6 and above. Dry orgasm occurs approximately 13% of times in males. Midodrine, vibratory stimulation, clitoral vacuum suction, and 4-aminopyridine may improve orgasmic potential. Depending on level and severity of injury, persons with SCIs can achieve orgasm. Sympathetically mediated changes occur during sexual response with culmination at orgasm. Future research should address benefits of orgasm. Additionally, inherent biases associated with studying orgasm must be considered.

  2. Preface: SciDAC 2005

    NASA Astrophysics Data System (ADS)

    Mezzacappa, Anthony

    2005-01-01

    On 26-30 June 2005 at the Grand Hyatt on Union Square in San Francisco several hundred computational scientists from around the world came together for what can certainly be described as a celebration of computational science. Scientists from the SciDAC Program and scientists from other agencies and nations were joined by applied mathematicians and computer scientists to highlight the many successes in the past year where computation has led to scientific discovery in a variety of fields: lattice quantum chromodynamics, accelerator modeling, chemistry, biology, materials science, Earth and climate science, astrophysics, and combustion and fusion energy science. Also highlighted were the advances in numerical methods and computer science, and the multidisciplinary collaboration cutting across science, mathematics, and computer science that enabled these discoveries. The SciDAC Program was conceived and funded by the US Department of Energy Office of Science. It is the Office of Science's premier computational science program founded on what is arguably the perfect formula: the priority and focus is science and scientific discovery, with the understanding that the full arsenal of `enabling technologies' in applied mathematics and computer science must be brought to bear if we are to have any hope of attacking and ultimately solving today's computational Grand Challenge problems. The SciDAC Program has been in existence for four years, and many of the computational scientists funded by this program will tell you that the program has given them the hope of addressing their scientific problems in full realism for the very first time. Many of these scientists will also tell you that SciDAC has also fundamentally changed the way they do computational science. We begin this volume with one of DOE's great traditions, and core missions: energy research. As we will see, computation has been seminal to the critical advances that have been made in this arena. Of course, to

  3. Spontaneous Transition of Turbulent Flames to Detonations in Unconfined Media

    DTIC Science & Technology

    2011-06-07

    1] M. Berthelot and P. Vieille, Compt. Rend. Acad. Sci. 93, 18 (1881). [2] E. Mallard and H.L. le Chatelier , Compt. Rend. Acad. Sci. 93, 145 (1881...or with pre-existing shocks. It remains unclear, however, whether DDT can occur in unconfined media. Here we show, through first- principles direct...converting fuel into product. A simplified reaction-diffusion model rep- resents stoichiometric H2-air and CH4-air mixtures under Le = 1 conditions

  4. The Aplacophora: History, Taxonomy, Phylogeny, Biogeography, and Ecology

    DTIC Science & Technology

    1992-02-01

    Great Bay.] Pp. 28-41. In: A. I. Kafanov (ed.), [ Hydrobiological research of bays and inlets of Primorye.] Far East Science Center, USSR Acad. Sci...gonadal products into the sea (Franzdn 1955; Buckland-Nicks and Chia 1989). The Neomeniomorpha have a slightly modified sperm (Scheltema et al in press...Kafanov (ed.), Hydrobiological research of bays and inlets of Primorye. Far East Science Center, USSR Acad. Sci. Vladivostok Morse, M.P. (1979). Meiomenia

  5. Length of stay and medical stability for spinal cord-injured patients on admission to an inpatient rehabilitation hospital: a comparison between a model SCI trauma center and non-SCI trauma center.

    PubMed

    Ploumis, A; Kolli, S; Patrick, M; Owens, M; Beris, A; Marino, R J

    2011-03-01

    Retrospective database review. To compare lengths of stay (LOS), pressure ulcers and readmissions to the acute care hospital of patients admitted to the inpatient rehabilitation facility (IRF) from a model spinal cord injury (SCI) trauma center or from a non-SCI acute hospital. Only sparse data exist comparing the status of patients admitted to IRF from a model SCI trauma center or from a non-SCI acute hospital. Acute care, IRF and total LOS were compared between patients transferred to IRF from the SCI center (n=78) and from non-SCI centers (n=131). The percentages of pressure ulcers on admission to IRF and transfer back to acute care were also compared. Patients admitted to IRF from the SCI trauma center (SCI TC) had significantly shorter (P=0.01) acute care LOS and total LOS compared with patients admitted from non-SCI TCs. By neurological category, acute-care LOS was less for all groups admitted from the SCI center, but statistically significant only for tetraplegia. There was no significant difference in the incidence of readmissions to acute care from IRF. More patients from non-SCI centers (34%) than SCI centers (12%) had pressure ulcers (P<0.001). Acute care in organized SCI TCs before transfer to IRF can significantly lower acute-care LOS or total LOS and incidence of pressure ulcers compared with non-SCI TCs. Patients admitted to IRF from SCI TCs are no more likely to be sent back to an acute hospital than those from non-SCI TCs.

  6. Opening Remarks: SciDAC 2007

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2007-09-01

    Good morning. Welcome to Boston, the home of the Red Sox, Celtics and Bruins, baked beans, tea parties, Robert Parker, and SciDAC 2007. A year ago I stood before you to share the legacy of the first SciDAC program and identify the challenges that we must address on the road to petascale computing—a road E E Cummins described as `. . . never traveled, gladly beyond any experience.' Today, I want to explore the preparations for the rapidly approaching extreme scale (X-scale) generation. These preparations are the first step propelling us along the road of burgeoning scientific discovery enabled by the application of X- scale computing. We look to petascale computing and beyond to open up a world of discovery that cuts across scientific fields and leads us to a greater understanding of not only our world, but our universe. As part of the President's America Competitiveness Initiative, the ASCR Office has been preparing a ten year vision for computing. As part of this planning the LBNL together with ORNL and ANL hosted three town hall meetings on Simulation and Modeling at the Exascale for Energy, Ecological Sustainability and Global Security (E3). The proposed E3 initiative is organized around four programmatic themes: Engaging our top scientists, engineers, computer scientists and applied mathematicians; investing in pioneering large-scale science; developing scalable analysis algorithms, and storage architectures to accelerate discovery; and accelerating the build-out and future development of the DOE open computing facilities. It is clear that we have only just started down the path to extreme scale computing. Plan to attend Thursday's session on the out-briefing and discussion of these meetings. The road to the petascale has been at best rocky. In FY07, the continuing resolution provided 12% less money for Advanced Scientific Computing than either the President, the Senate, or the House. As a consequence, many of you had to absorb a no cost extension for your

  7. Selection of Human Antibody Fragments Which Bind Novel Breast Tumor Antigens

    DTIC Science & Technology

    1998-09-01

    chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci U S A. 85: 5879-83. 11. Adams, G.P., McCartney, J.E., Tai, M.-S., Oppermann, H...antidigoxin single-chain Fv analogue produced in E coil. Proc NailAcadSci Bernard Foundation, the Frank Strick Foundation and the USA 85:5879-5883 CaPCURE...recovery of infectious phage was increased by preincubation of cells with chloroquine . Measurement of phage recovery from within the cytosol as a

  8. The Cross-Cultural Societal Response to SCI: Health and Related Systems.

    PubMed

    Pacheco, Diana; Gross-Hemmi, Mirja H

    2017-02-01

    The Learning Health System for Spinal Cord Injury (LHS-SCI) is an initiative aligned with the World Health Organization's (WHO) Global Disability Action Plan. Based on the outcomes of this initiative, countries will be able to shape their health systems to better respond to the needs of persons with SCI. This paper describes and compares the macroeconomic situation and societal response to SCI across 27 countries from all 6 WHO regions that will participate in the LHS-SCI initiative. A concurrent mixed-methods study was conducted to identify key indicators that describe the situation of persons with SCI, the general societal response, the health and rehabilitation system, and the experience for a SCI person after discharge from inpatient rehabilitation. A strong correlation was found between the efficiency of a healthcare system and the amount a country invests in health. Higher availability of resources does not necessarily imply that unrestricted access to the healthcare system is warranted. Variations in the health systems were found for various domains of the health and rehabilitation systems. The evaluation and comparative analysis of the societal response to SCI raise the awareness of the need of more standardized data to identify current needs and gaps in the quality and access to SCI-specific health system.

  9. GeoSciML and EarthResourceML Update, 2012

    NASA Astrophysics Data System (ADS)

    Richard, S. M.; Commissionthe Management; Application Inte, I.

    2012-12-01

    CGI Interoperability Working Group activities during 2012 include deployment of services using the GeoSciML-Portrayal schema, addition of new vocabularies to support properties added in version 3.0, improvements to server software for deploying services, introduction of EarthResourceML v.2 for mineral resources, and collaboration with the IUSS on a markup language for soils information. GeoSciML and EarthResourceML have been used as the basis for the INSPIRE Geology and Mineral Resources specifications respectively. GeoSciML-Portrayal is an OGC GML simple-feature application schema for presentation of geologic map unit, contact, and shear displacement structure (fault and ductile shear zone) descriptions in web map services. Use of standard vocabularies for geologic age and lithology enables map services using shared legends to achieve visual harmonization of maps provided by different services. New vocabularies have been added to the collection of CGI vocabularies provided to support interoperable GeoSciML services, and can be accessed through http://resource.geosciml.org. Concept URIs can be dereferenced to obtain SKOS rdf or html representations using the SISSVoc vocabulary service. New releases of the FOSS GeoServer application greatly improve support for complex XML feature schemas like GeoSciML, and the ArcGIS for INSPIRE extension implements similar complex feature support for ArcGIS Server. These improved server implementations greatly facilitate deploying GeoSciML services. EarthResourceML v2 adds features for information related to mining activities. SoilML provides an interchange format for soil material, soil profile, and terrain information. Work is underway to add GeoSciML to the portfolio of Open Geospatial Consortium (OGC) specifications.

  10. ComSciCon: The Communicating Science Workshop for Graduate Students

    NASA Astrophysics Data System (ADS)

    Sanders, Nathan; Drout, Maria; Kohler, Susanna; Cook, Ben; ComSciCon Leadership Team

    2018-01-01

    ComSciCon (comscicon.com) is a national workshop series organized by graduate students, for graduate students, focused on leadership and training in science communication. Our goal is to empower young scientists to become leaders in their field, propagating appreciation and understanding of research results to broad and diverse audiences. ComSciCon attendees meet and interact with professional communicators, build lasting networks with graduate students in all fields of science and engineering from around the country, and write and publish original works. ComSciCon consists of both a flagship national conference series run annually for future leaders in science communication, and a series of regional and specialized workshops organized by ComSciCon alumni nationwide. We routinely receive over 1000 applications for 50 spots in our national workshop. Since its founding in 2012, over 300 STEM graduate students have participated in the national workshop, and 23 local spin-off workshops have been organized in 10 different locations throughout the country. This year, ComSciCon is working to grow as a self-sustaining organization by launching as an independent 501(c)(3) non-profit. In this poster we will discuss the ComSciCon program and methods, our results to date, potential future collaborations between ComSciCon and AAS, and how you can become involved.

  11. Clinical interpretation of the Spinal Cord Injury Functional Index (SCI-FI).

    PubMed

    Fyffe, Denise; Kalpakjian, Claire Z; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Kirshblum, Steven C; Tulsky, David S; Jette, Alan M

    2016-09-01

    To provide validation of functional ability levels for the Spinal Cord Injury - Functional Index (SCI-FI). Cross-sectional. Inpatient rehabilitation hospital and community settings. A sample of 855 individuals with traumatic spinal cord injury enrolled in 6 rehabilitation centers participating in the National Spinal Cord Injury Model Systems Network. Not Applicable. Spinal Cord Injury-Functional Index (SCI-FI). Cluster analyses identified three distinct groups that represent low, mid-range and high SCI-FI functional ability levels. Comparison of clusters on personal and other injury characteristics suggested some significant differences between groups. These results strongly support the use of SCI-FI functional ability levels to document the perceived functional abilities of persons with SCI. Results of the cluster analysis suggest that the SCI-FI functional ability levels capture function by injury characteristics. Clinical implications regarding tracking functional activity trajectories during follow-up visits are discussed.

  12. Overview of the Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Victorson, David; Tate, Denise G; Heinemann, Allen W; Charlifue, Susan; Kirshblum, Steve C; Fyffe, Denise; Gershon, Richard; Spungen, Ann M; Bombardier, Charles H; Dyson-Hudson, Trevor A; Amtmann, Dagmar; Kalpakjian, Claire Z; Choi, Seung W; Jette, Alan M; Forchheimer, Martin; Cella, David

    2015-05-01

    The Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n=877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n=245). Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Adults with traumatic SCI. n/a n/a The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population.

  13. Publisher’s Note: “Multi-energy x-ray detector calibration for Te and impurity density (nZ) measurements of MCF plasmas” [Rev. Sci. Instrum. 87, 11E320 (2016)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maddox, J.; Pablant, N.; Efthimion, P.

    2016-10-17

    Correction Original Article: ISSN: 0034-6748, Rev. Sci. Instrum. 87, (2016) This article was originally published online on 12 August 2016 with the fourth author’s name listed as “L. Delgado”. It should have been “L. Delgado-Aparicio”. The author’s name appears correctly above. All online versions of the article were corrected on 7 September 2016; the article is correct as it appears in the printed version of the journal.

  14. Sci-Hub provides access to nearly all scholarly literature

    PubMed Central

    Romero, Ariel Rodriguez; Levernier, Jacob G; Munro, Thomas Anthony; McLaughlin, Stephen Reid; Greshake Tzovaras, Bastian

    2018-01-01

    The website Sci-Hub enables users to download PDF versions of scholarly articles, including many articles that are paywalled at their journal’s site. Sci-Hub has grown rapidly since its creation in 2011, but the extent of its coverage has been unclear. Here we report that, as of March 2017, Sci-Hub’s database contains 68.9% of the 81.6 million scholarly articles registered with Crossref and 85.1% of articles published in toll access journals. We find that coverage varies by discipline and publisher, and that Sci-Hub preferentially covers popular, paywalled content. For toll access articles, we find that Sci-Hub provides greater coverage than the University of Pennsylvania, a major research university in the United States. Green open access to toll access articles via licit services, on the other hand, remains quite limited. Our interactive browser at https://greenelab.github.io/scihub allows users to explore these findings in more detail. For the first time, nearly all scholarly literature is available gratis to anyone with an Internet connection, suggesting the toll access business model may become unsustainable. PMID:29424689

  15. Sensitivity of the SCI-FI/AT in Individuals With Traumatic Spinal Cord Injury.

    PubMed

    Keeney, Tamra; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Heinemann, Allen W; Charlifue, Susan; Fyffe, Denise C; Marino, Ralph J; Morse, Leslie R; Worobey, Lynn A; Tate, Denise; Rosenblum, David; Zafonte, Ross; Tulsky, David; Jette, Alan M

    2018-03-31

    To examine the ability of the Spinal Cord Injury-Functional Index/Assistive Technology (SCI-FI/AT) measure to detect change in persons with spinal cord injury (SCI). Multisite longitudinal (12-mo follow-up) study. Nine SCI Model Systems programs. Adults (N=165) with SCI enrolled in the SCI Model Systems database. Not applicable. SCI-FI/AT computerized adaptive test (CAT) (Basic Mobility, Self-Care, Fine Motor Function, Wheelchair Mobility, and/or Ambulation domains) completed at discharge from rehabilitation and 12 months after SCI. For each domain, effect size estimates and 95% confidence intervals were calculated for subgroups with paraplegia and tetraplegia. The demographic characteristics of the sample were as follows: 46% (n=76) individuals with paraplegia, 76% (n=125) male participants, 57% (n=94) used a manual wheelchair, 38% (n=63) used a power wheelchair, 30% (n=50) were ambulatory. For individuals with paraplegia, the Basic Mobility, Self-Care, and Ambulation domains of the SCI-FI/AT detected a significantly large amount of change; in contrast, the Fine Motor Function and Wheelchair Mobility domains detected only a small amount of change. For those with tetraplegia, the Basic Mobility, Fine Motor Function, and Self-Care domains detected a small amount of change whereas the Ambulation item domain detected a medium amount of change. The Wheelchair Mobility domain for people with tetraplegia was the only SCI-FI/AT domain that did not detect significant change. SCI-FI/AT CAT item banks detected an increase in function from discharge to 12 months after SCI. The effect size estimates for the SCI-FI/AT CAT vary by domain and level of lesion. Findings support the use of the SCI-FI/AT CAT in the population with SCI and highlight the importance of multidimensional functional measures. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  16. Methodology for the development and calibration of the SCI-QOL item banks.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Victorson, David; Choi, Seung W; Gershon, Richard; Heinemann, Allen W; Cella, David

    2015-05-01

    To develop a comprehensive, psychometrically sound, and conceptually grounded patient reported outcomes (PRO) measurement system for individuals with spinal cord injury (SCI). Individual interviews (n=44) and focus groups (n=65 individuals with SCI and n=42 SCI clinicians) were used to select key domains for inclusion and to develop PRO items. Verbatim items from other cutting-edge measurement systems (i.e. PROMIS, Neuro-QOL) were included to facilitate linkage and cross-population comparison. Items were field tested in a large sample of individuals with traumatic SCI (n=877). Dimensionality was assessed with confirmatory factor analysis. Local item dependence and differential item functioning were assessed, and items were calibrated using the item response theory (IRT) graded response model. Finally, computer adaptive tests (CATs) and short forms were administered in a new sample (n=245) to assess test-retest reliability and stability. A calibration sample of 877 individuals with traumatic SCI across five SCI Model Systems sites and one Department of Veterans Affairs medical center completed SCI-QOL items in interview format. We developed 14 unidimensional calibrated item banks and 3 calibrated scales across physical, emotional, and social health domains. When combined with the five Spinal Cord Injury--Functional Index physical function banks, the final SCI-QOL system consists of 22 IRT-calibrated item banks/scales. Item banks may be administered as CATs or short forms. Scales may be administered in a fixed-length format only. The SCI-QOL measurement system provides SCI researchers and clinicians with a comprehensive, relevant and psychometrically robust system for measurement of physical-medical, physical-functional, emotional, and social outcomes. All SCI-QOL instruments are freely available on Assessment CenterSM.

  17. Clinical interpretation of the Spinal Cord Injury Functional Index (SCI-FI)

    PubMed Central

    Fyffe, Denise; Kalpakjian, Claire Z.; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Kirshblum, Steven C.; Tulsky, David S.; Jette, Alan M.

    2016-01-01

    Objective: To provide validation of functional ability levels for the Spinal Cord Injury – Functional Index (SCI-FI). Design: Cross-sectional. Setting: Inpatient rehabilitation hospital and community settings. Participants: A sample of 855 individuals with traumatic spinal cord injury enrolled in 6 rehabilitation centers participating in the National Spinal Cord Injury Model Systems Network. Interventions: Not Applicable. Main Outcome Measures: Spinal Cord Injury-Functional Index (SCI-FI). Results: Cluster analyses identified three distinct groups that represent low, mid-range and high SCI-FI functional ability levels. Comparison of clusters on personal and other injury characteristics suggested some significant differences between groups. Conclusions: These results strongly support the use of SCI-FI functional ability levels to document the perceived functional abilities of persons with SCI. Results of the cluster analysis suggest that the SCI-FI functional ability levels capture function by injury characteristics. Clinical implications regarding tracking functional activity trajectories during follow-up visits are discussed. PMID:26781769

  18. Genetics Home Reference: aceruloplasminemia

    MedlinePlus

    ... PubMed Harris ZL. Aceruloplasminemia. J Neurol Sci. 2003 Mar 15;207(1-2):108-9. Review. Citation ... nervous system. Ann N Y Acad Sci. 2004 Mar;1012:267-81. Review. Citation on PubMed Vassiliev ...

  19. SCI Longitudinal Aging Study: 40 Years of Research.

    PubMed

    Krause, James S; Clark, Jillian M R; Saunders, Lee L

    2015-01-01

    The Spinal Cord Injury (SCI) Longitudinal Aging Study was initiated in 1973 and has conducted 8 assessments over the past 40 years. It was designed to help rehabilitation professionals understand the life situation of people with SCI, but it has developed into the most long-standing study of aging and SCI and has resulted in over 50 publications. Our purpose was to provide a detailed history of the study, response patterns, utilization of measures, and a summary of key findings reported in the literature. Five participant samples have been incorporated over the 40 years, with enrollment in 1973, 1984, 1993 (2 samples), and 2003. A total of 2,208 participants have completed 6,001 assessments, with a particularly large number of assessments among those who are more than 40 years post injury (n = 349). The overall results have indicated changing patterns of outcomes over time as persons with SCI age, with some notable declines in participation and health. There has been a survivor effect whereby persons who are more active, well-adjusted, and healthier live longer. This study has several important features that are required for longitudinal research including (a) consistency of follow-up, (b) consistency of measures over time, (c) addition of new participant samples to counteract attrition, and (d) inclusion of a large number of individuals who have reached aging milestones unparalleled in the literature. Data from this study can inform the literature on the natural course of aging with SCI.

  20. SciServer Compute brings Analysis to Big Data in the Cloud

    NASA Astrophysics Data System (ADS)

    Raddick, Jordan; Medvedev, Dmitry; Lemson, Gerard; Souter, Barbara

    2016-06-01

    SciServer Compute uses Jupyter Notebooks running within server-side Docker containers attached to big data collections to bring advanced analysis to big data "in the cloud." SciServer Compute is a component in the SciServer Big-Data ecosystem under development at JHU, which will provide a stable, reproducible, sharable virtual research environment.SciServer builds on the popular CasJobs and SkyServer systems that made the Sloan Digital Sky Survey (SDSS) archive one of the most-used astronomical instruments. SciServer extends those systems with server-side computational capabilities and very large scratch storage space, and further extends their functions to a range of other scientific disciplines.Although big datasets like SDSS have revolutionized astronomy research, for further analysis, users are still restricted to downloading the selected data sets locally - but increasing data sizes make this local approach impractical. Instead, researchers need online tools that are co-located with data in a virtual research environment, enabling them to bring their analysis to the data.SciServer supports this using the popular Jupyter notebooks, which allow users to write their own Python and R scripts and execute them on the server with the data (extensions to Matlab and other languages are planned). We have written special-purpose libraries that enable querying the databases and other persistent datasets. Intermediate results can be stored in large scratch space (hundreds of TBs) and analyzed directly from within Python or R with state-of-the-art visualization and machine learning libraries. Users can store science-ready results in their permanent allocation on SciDrive, a Dropbox-like system for sharing and publishing files. Communication between the various components of the SciServer system is managed through SciServer‘s new Single Sign-on Portal.We have created a number of demos to illustrate the capabilities of SciServer Compute, including Python and R scripts

  1. Methodology for the development and calibration of the SCI-QOL item banks

    PubMed Central

    Tulsky, David S.; Kisala, Pamela A.; Victorson, David; Choi, Seung W.; Gershon, Richard; Heinemann, Allen W.; Cella, David

    2015-01-01

    Objective To develop a comprehensive, psychometrically sound, and conceptually grounded patient reported outcomes (PRO) measurement system for individuals with spinal cord injury (SCI). Methods Individual interviews (n = 44) and focus groups (n = 65 individuals with SCI and n = 42 SCI clinicians) were used to select key domains for inclusion and to develop PRO items. Verbatim items from other cutting-edge measurement systems (i.e. PROMIS, Neuro-QOL) were included to facilitate linkage and cross-population comparison. Items were field tested in a large sample of individuals with traumatic SCI (n = 877). Dimensionality was assessed with confirmatory factor analysis. Local item dependence and differential item functioning were assessed, and items were calibrated using the item response theory (IRT) graded response model. Finally, computer adaptive tests (CATs) and short forms were administered in a new sample (n = 245) to assess test-retest reliability and stability. Participants and Procedures A calibration sample of 877 individuals with traumatic SCI across five SCI Model Systems sites and one Department of Veterans Affairs medical center completed SCI-QOL items in interview format. Results We developed 14 unidimensional calibrated item banks and 3 calibrated scales across physical, emotional, and social health domains. When combined with the five Spinal Cord Injury – Functional Index physical function banks, the final SCI-QOL system consists of 22 IRT-calibrated item banks/scales. Item banks may be administered as CATs or short forms. Scales may be administered in a fixed-length format only. Conclusions The SCI-QOL measurement system provides SCI researchers and clinicians with a comprehensive, relevant and psychometrically robust system for measurement of physical-medical, physical-functional, emotional, and social outcomes. All SCI-QOL instruments are freely available on Assessment CenterSM. PMID:26010963

  2. Treatment of Nueropathic Pain after SCI with a Catalytic Oxidoreductant

    DTIC Science & Technology

    2016-10-01

    reducing inflammation and ROS activation acutely post-SCI in rats and mice. On-going experiments will evaluate additional outcome measures and...NF-kB signaling, and inflammation in the spinal cord acutely post-SCI We have completed approximately 100% of the animal experiments in support of this...in the spinal cord acutely post-SCI. These data are in the final analysis stages. Please see the data to date as described in the task section

  3. Circulating sclerostin is elevated in short-term and reduced in long-term SCI

    PubMed Central

    Battaglino, Ricardo A.; Sudhakar, Supreetha; Lazzari, Antonio; Garshick, Eric; Zafonte, Ross; Morse, Leslie R.

    2012-01-01

    Spinal cord injury (SCI) causes profound bone loss due to muscle paralysis resulting in the inability to walk. Sclerostin, a Wnt signaling pathway antagonist produced by osteocytes, is a potent inhibitor of bone formation. Short-term studies in rodent models have demonstrated increased sclerostin in response to mechanical unloading that is reversed with reloading. Although sclerostin inhibition has been proposed as a potential therapy for bone loss, it is not known if sclerostin levels vary with duration of SCI in humans. We analyzed circulating sclerostin in 155 men with varying degrees of SCI who were 1 year or more post-injury. We report that sclerostin levels are greatest in subjects with short-term SCI (≤ 5 years post-injury) and decrease significantly over the first 5 years post-injury. There was no association between sclerostin and injury duration in subjects with long-term SCI (> 5 years post-injury). In subjects with long-term SCI, sclerostin levels were positively associated with lower extremity bone density and bone mineral content. These data suggest that sclerostin levels in SCI are initially increased after SCI in response to mechanical unloading. This response is time-limited and as bone loss progresses, circulating sclerostin is lowest in subjects with severe osteoporosis. These findings support a dual role for sclerostin after SCI: a therapeutic target in acute SCI, and a biomarker of osteoporosis severity in chronic SCI. PMID:22575440

  4. Astronomy Popularization via Sci-fi Movies

    NASA Astrophysics Data System (ADS)

    Li, Qingkang

    2015-08-01

    It is astronomers’ duty to let more and more young people know a bit astronomy and be interested in astronomy and appreciate the beauty and great achievements in astronomy. One of the most effective methods to popularize astronomy to young people nowadays might be via enjoying some brilliant sci-fi movies related to astronomy with some guidance from astronomers. Firstly, we will introduce the basic information of our selective course “Appreciation of Sci-fi Movies in Astronomy” for the non-major astronomy students in our University, which is surely unique in China, then we will show its effect on astronomy popularization based on several rounds of teaching.

  5. Sci-Hub provides access to nearly all scholarly literature.

    PubMed

    Himmelstein, Daniel S; Romero, Ariel Rodriguez; Levernier, Jacob G; Munro, Thomas Anthony; McLaughlin, Stephen Reid; Greshake Tzovaras, Bastian; Greene, Casey S

    2018-03-01

    The website Sci-Hub enables users to download PDF versions of scholarly articles, including many articles that are paywalled at their journal's site. Sci-Hub has grown rapidly since its creation in 2011, but the extent of its coverage has been unclear. Here we report that, as of March 2017, Sci-Hub's database contains 68.9% of the 81.6 million scholarly articles registered with Crossref and 85.1% of articles published in toll access journals. We find that coverage varies by discipline and publisher, and that Sci-Hub preferentially covers popular, paywalled content. For toll access articles, we find that Sci-Hub provides greater coverage than the University of Pennsylvania, a major research university in the United States. Green open access to toll access articles via licit services, on the other hand, remains quite limited. Our interactive browser at https://greenelab.github.io/scihub allows users to explore these findings in more detail. For the first time, nearly all scholarly literature is available gratis to anyone with an Internet connection, suggesting the toll access business model may become unsustainable. © 2018, Himmelstein et al.

  6. Women's Sexual Health and Reproductive Function After SCI.

    PubMed

    Courtois, Frédérique; Alexander, Marcalee; McLain, Amie B Jackson

    2017-01-01

    Sexual function and to a lesser extent reproduction are often disrupted in women with spinal cord injuries (SCI), who must be educated to better understand their sexual and reproductive health. Women with SCI are sexually active; they can use psychogenic or reflexogenic stimulation to obtain sexual pleasure and orgasm. Treatment should consider a holistic approach using autonomic standards to describe remaining sexual function and to assess both genital function and psychosocial factors. Assessment of genital function should include thoracolumbar dermatomes, vulvar sensitivity (touch, pressure, vibration), and sacral reflexes. Self-exploration should include not only clitoral stimulation, but also stimulation of the vagina (G spot), cervix, and nipples conveyed by different innervation sources. Treatments may consider PDE5 inhibitors and flibanserin on an individual basis, and secondary consequences of SCI should address concerns with spasticity, pain, incontinence, and side effects of medications. Psychosocial issues must be addressed as possible contributors to sexual dysfunctions (eg, lower self-esteem, past sexual history, depression, dating habits). Pregnancy is possible for women with SCI; younger age at the time of injury and at the time of pregnancy being significant predictors of successful pregnancy, along with marital status, motor score, mobility, and occupational scores. Pregnancy may decrease the level of functioning (eg, self-care, ambulation, upper-extremity tasks), may involve complications (eg, decubitus ulcers, weight gain, urological complications), and must be monitored for postural hypotension and autonomic dysreflexia. Taking into consideration the physical and psychosocial determinants of sexuality and childbearing allows women with SCI to achieve positive sexual and reproductive health.

  7. Women's Sexual Health and Reproductive Function After SCI

    PubMed Central

    Alexander, Marcalee; McLain, Amie B. (Jackson)

    2017-01-01

    Sexual function and to a lesser extent reproduction are often disrupted in women with spinal cord injuries (SCI), who must be educated to better understand their sexual and reproductive health. Women with SCI are sexually active; they can use psychogenic or reflexogenic stimulation to obtain sexual pleasure and orgasm. Treatment should consider a holistic approach using autonomic standards to describe remaining sexual function and to assess both genital function and psychosocial factors. Assessment of genital function should include thoracolumbar dermatomes, vulvar sensitivity (touch, pressure, vibration), and sacral reflexes. Self-exploration should include not only clitoral stimulation, but also stimulation of the vagina (G spot), cervix, and nipples conveyed by different innervation sources. Treatments may consider PDE5 inhibitors and flibanserin on an individual basis, and secondary consequences of SCI should address concerns with spasticity, pain, incontinence, and side effects of medications. Psychosocial issues must be addressed as possible contributors to sexual dysfunctions (eg, lower self-esteem, past sexual history, depression, dating habits). Pregnancy is possible for women with SCI; younger age at the time of injury and at the time of pregnancy being significant predictors of successful pregnancy, along with marital status, motor score, mobility, and occupational scores. Pregnancy may decrease the level of functioning (eg, self-care, ambulation, upper-extremity tasks), may involve complications (eg, decubitus ulcers, weight gain, urological complications), and must be monitored for postural hypotension and autonomic dysreflexia. Taking into consideration the physical and psychosocial determinants of sexuality and childbearing allows women with SCI to achieve positive sexual and reproductive health. PMID:29339874

  8. ScienceDirect through SciVerse: a new way to approach Elsevier.

    PubMed

    Bengtson, Jason

    2011-01-01

    SciVerse is the new combined portal from Elsevier that services their ScienceDirect collection, SciTopics, and their Scopus database. Using SciVerse to access ScienceDirect is the specific focus of this review. Along with advanced keyword searching and citation searching options, SciVerse also incorporates a very useful image search feature. The aim seems to be not only to create an interface that provides broad functionality on par with other database search tools that many searchers use regularly but also to create an open platform that could be changed to respond effectively to the needs of customers.

  9. Preface: SciDAC 2008

    NASA Astrophysics Data System (ADS)

    Stevens, Rick

    2008-07-01

    The fourth annual Scientific Discovery through Advanced Computing (SciDAC) Conference was held June 13-18, 2008, in Seattle, Washington. The SciDAC conference series is the premier communitywide venue for presentation of results from the DOE Office of Science's interdisciplinary computational science program. Started in 2001 and renewed in 2006, the DOE SciDAC program is the country's - and arguably the world's - most significant interdisciplinary research program supporting the development of advanced scientific computing methods and their application to fundamental and applied areas of science. SciDAC supports computational science across many disciplines, including astrophysics, biology, chemistry, fusion sciences, and nuclear physics. Moreover, the program actively encourages the creation of long-term partnerships among scientists focused on challenging problems and computer scientists and applied mathematicians developing the technology and tools needed to address those problems. The SciDAC program has played an increasingly important role in scientific research by allowing scientists to create more accurate models of complex processes, simulate problems once thought to be impossible, and analyze the growing amount of data generated by experiments. To help further the research community's ability to tap into the capabilities of current and future supercomputers, Under Secretary for Science, Raymond Orbach, launched the Innovative and Novel Computational Impact on Theory and Experiment (INCITE) program in 2003. The INCITE program was conceived specifically to seek out computationally intensive, large-scale research projects with the potential to significantly advance key areas in science and engineering. The program encourages proposals from universities, other research institutions, and industry. During the first two years of the INCITE program, 10 percent of the resources at NERSC were allocated to INCITE awardees. However, demand for supercomputing resources

  10. Measurement of Bone: Diagnosis of SCI-Induced Osteoporosis and Fracture Risk Prediction.

    PubMed

    Troy, Karen L; Morse, Leslie R

    2015-01-01

    Spinal cord injury (SCI) is associated with a rapid loss of bone mass, resulting in severe osteoporosis and a 5- to 23-fold increase in fracture risk. Despite the seriousness of fractures in SCI, there are multiple barriers to osteoporosis diagnosis and wide variations in treatment practices for SCI-induced osteoporosis. We review the biological and structural changes that are known to occur in bone after SCI in the context of promoting future research to prevent or reduce risk of fracture in this population. We also review the most commonly used methods for assessing bone after SCI and discuss the strengths, limitations, and clinical applications of each method. Although dual-energy x-ray absorptiometry assessments of bone mineral density may be used clinically to detect changes in bone after SCI, 3-dimensional methods such as quantitative CT analysis are recommended for research applications and are explained in detail.

  11. Circulating sclerostin is elevated in short-term and reduced in long-term SCI.

    PubMed

    Battaglino, Ricardo A; Sudhakar, Supreetha; Lazzari, Antonio A; Garshick, Eric; Zafonte, Ross; Morse, Leslie R

    2012-09-01

    Spinal cord injury (SCI) causes profound bone loss due to muscle paralysis resulting in the inability to walk. Sclerostin, a Wnt signaling pathway antagonist produced by osteocytes, is a potent inhibitor of bone formation. Short-term studies in rodent models have demonstrated increased sclerostin in response to mechanical unloading that is reversed with reloading. Although sclerostin inhibition has been proposed as a potential therapy for bone loss, it is not known if sclerostin levels vary with duration of SCI in humans. We analyzed circulating sclerostin in 155 men with varying degrees of SCI who were 1 year or more post-injury. We report that sclerostin levels are greatest in subjects with short-term SCI (≤5 years post-injury) and decrease significantly over the first 5 years post-injury. There was no association between sclerostin and injury duration in subjects with long-term SCI (>5 years post-injury). In subjects with long-term SCI, sclerostin levels were positively associated with lower extremity bone density and bone mineral content. These data suggest that sclerostin levels are initially increased after SCI in response to mechanical unloading. This response is time-limited and as bone loss progresses, circulating sclerostin is lowest in subjects with severe osteoporosis. These findings support a dual role for sclerostin after SCI: a therapeutic target in acute SCI, and a biomarker of osteoporosis severity in chronic SCI. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Regulation & Development of Membrane Transport Processes.

    DTIC Science & Technology

    1985-05-15

    221, 733-741. 30. Liu, A. Y. C. and Greengard, P. (1974) Proc. Nall. Acad. Sci. USA, 71, 3869-3873. 31. MacKnight, A. D. C., DiBona , D. R., and Leaf...However, DiBona and Sachs and their collaborators 2. IXO(YI’(YI’IC INSEITION OF OTHER TANSPORT SYSTEMS 155 have challenged this view, suggesting that...the U.S. Public Health Service. REFERENCES I. DiBona , D. R., Ito, S., Berglindh, T.. and Sachs, G. (1979) Proc. Nall. Acad. Sci. USA, 76, 6689-6693. 2

  13. Mexican Space Weather Service (SCiESMEX)

    NASA Astrophysics Data System (ADS)

    Gonzalez-Esparza, J. A.; De la Luz, V.; Corona-Romero, P.; Mejia-Ambriz, J. C.; Gonzalez, L. X.; Sergeeva, M. A.; Romero-Hernandez, E.; Aguilar-Rodriguez, E.

    2017-01-01

    Legislative modifications of the General Civil Protection Law in Mexico in 2014 included specific references to space hazards and space weather phenomena. The legislation is consistent with United Nations promotion of international engagement and cooperation on space weather awareness, studies, and monitoring. These internal and external conditions motivated the creation of a space weather service in Mexico. The Mexican Space Weather Service (SCiESMEX in Spanish) (www.sciesmex.unam.mx) was initiated in October 2014 and is operated by the Institute of Geophysics at the Universidad Nacional Autonoma de Mexico (UNAM). SCiESMEX became a Regional Warning Center of the International Space Environment Services (ISES) in June 2015. We present the characteristics of the service, some products, and the initial actions for developing a space weather strategy in Mexico. The service operates a computing infrastructure including a web application, data repository, and a high-performance computing server to run numerical models. SCiESMEX uses data of the ground-based instrumental network of the National Space Weather Laboratory (LANCE), covering solar radio burst emissions, solar wind and interplanetary disturbances (by interplanetary scintillation observations), geomagnetic measurements, and analysis of the total electron content (TEC) of the ionosphere (by employing data from local networks of GPS receiver stations).

  14. Overview of the Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system

    PubMed Central

    Tulsky, David S.; Kisala, Pamela A.; Victorson, David; Tate, Denise G.; Heinemann, Allen W.; Charlifue, Susan; Kirshblum, Steve C.; Fyffe, Denise; Gershon, Richard; Spungen, Ann M.; Bombardier, Charles H.; Dyson-Hudson, Trevor A.; Amtmann, Dagmar; Z. Kalpakjian, Claire; W. Choi, Seung; Jette, Alan M.; Forchheimer, Martin; Cella, David

    2015-01-01

    Context/Objective The Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Design Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n = 877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n = 245). Setting Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Participants Adults with traumatic SCI. Interventions n/a Outcome Measures n/a Results The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). Conclusion The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population. PMID:26010962

  15. Measurement of Bone: Diagnosis of SCI-Induced Osteoporosis and Fracture Risk Prediction

    PubMed Central

    Morse, Leslie R.

    2015-01-01

    Background: Spinal cord injury (SCI) is associated with a rapid loss of bone mass, resulting in severe osteoporosis and a 5- to 23-fold increase in fracture risk. Despite the seriousness of fractures in SCI, there are multiple barriers to osteoporosis diagnosis and wide variations in treatment practices for SCI-induced osteoporosis. Methods: We review the biological and structural changes that are known to occur in bone after SCI in the context of promoting future research to prevent or reduce risk of fracture in this population. We also review the most commonly used methods for assessing bone after SCI and discuss the strengths, limitations, and clinical applications of each method. Conclusions: Although dual-energy x-ray absorptiometry assessments of bone mineral density may be used clinically to detect changes in bone after SCI, 3-dimensional methods such as quantitative CT analysis are recommended for research applications and are explained in detail. PMID:26689691

  16. Discontinuous ventilator weaning of patients with acute SCI.

    PubMed

    Füssenich, Wout; Hirschfeld Araujo, Sven; Kowald, Birgitt; Hosman, Allard; Auerswald, Marc; Thietje, Roland

    2018-05-01

    Retrospective, single centre cohort study. To determine factors associated with ventilator weaning success and failure in patients with acute spinal cord injury (SCI); determine length of time and attempts required to wean from the ventilator successfully and determine the incidence of pneumonia. BG Klinikum Hamburg, Level 1 trauma centre, SCI Department, Germany. From 2010 until 2017, 165 consecutive patients with cervical SCI, initially dependent on a ventilator, were included and weaned discontinuously via tracheal cannula. Data related to anthropometric details, neurological injury, respiratory outcomes, and weaning parameters were prospectively recorded in a database and retrospectively analysed. Seventy-nine percent of all patients were successfully weaned from ventilation. Average duration of the complete weaning process was 37 days. Ninety-one percent of the successfully weaned patients completed this on first attempt. Age (>56 years), level of injury (C4 and/or above), vital capacity (<1500 ml), obesity (>25 kg/m 2 ), and chronic obstructive pulmonary disease (COPD) significantly decreased the chance of successful weaning. These factors also correlated with a higher number of weaning attempts. High level of injury, older age, and reduced vital capacity also increased the duration of the weaning process. Patients with low vital capacity and concurrent therapy with Baclofen and Dantrolene showed higher rates of pneumonia. We conclude that mentioned factors are associated with weaning outcome and useful for clinical recommendations and patient counselling. These data further support the complexity of ventilator weaning in the SCI population due to associated complications, therefore we recommend conducting weaning of patients with SCI on intensive or intermediate care units (ICU/IMCU) in specialised centres.

  17. SciTech Clubs for Girls. [Annual] technical report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nogal, A.M.

    1993-02-01

    Since January 1992, 9 exhibits have been constructed by the SciTech Clubs for Girls, which involved 63 girls, ages 10 to 14. These exhibits are: Bubble Shapes by the St. Charles Cadette Girl Scout Troop No. 109. Density Games by the South Elgin Cadette Girl Scout Troop No. 132. Electric Fleas by the Warrenville Junior Girl Scout Troop No. 305. Energy vs. Power by the Aurora Junior Girl Scout Troop No. 242. The Organ Pipe by the Bartlett Junior Girl Scout Troop No. 107. Ohm`s Law by the Geneva Junior Girl Scout Troop No. 401. What is Gravity by themore » Pilsen YMCA girls. Insulation at Work by the Algonquin Junior Girl Scout Troop No. 303. Series vs. Parallel by the Leland Junior Girl Scout Troop No. 50. The report is a description of each exhibit and the group that built the exhibit. Each group had a minimum of 10 hours of contact time at SciTech with the SciTech Clubs for Girls Program Coordinator. All mentors are female. Each exhibit building experience includes a trip to the hardware store to purchase supplies. After the exhibit is complete, the girls receive certificates of achievement and a SciTech Club Patch.« less

  18. SciReader enables reading of medical content with instantaneous definitions.

    PubMed

    Gradie, Patrick R; Litster, Megan; Thomas, Rinu; Vyas, Jay; Schiller, Martin R

    2011-01-25

    A major problem patients encounter when reading about health related issues is document interpretation, which limits reading comprehension and therefore negatively impacts health care. Currently, searching for medical definitions from an external source is time consuming, distracting, and negatively impacts reading comprehension and memory of the material. SciReader was built as a Java application with a Flex-based front-end client. The dictionary used by SciReader was built by consolidating data from several sources and generating new definitions with a standardized syntax. The application was evaluated by measuring the percentage of words defined in different documents. A survey was used to test the perceived effect of SciReader on reading time and comprehension. We present SciReader, a web-application that simplifies document interpretation by allowing users to instantaneously view medical, English, and scientific definitions as they read any document. This tool reveals the definitions of any selected word in a small frame at the top of the application. SciReader relies on a dictionary of ~750,000 unique Biomedical and English word definitions. Evaluation of the application shows that it maps ~98% of words in several different types of documents and that most users tested in a survey indicate that the application decreases reading time and increases comprehension. SciReader is a web application useful for reading medical and scientific documents. The program makes jargon-laden content more accessible to patients, educators, health care professionals, and the general public.

  19. Can FES-rowing mediate bone mineral density in SCI: a pilot study.

    PubMed

    Gibbons, R S; McCarthy, I D; Gall, A; Stock, C G; Shippen, J; Andrews, B J

    2014-11-01

    A single case study. To compare proximal tibia trabecular bone mineral density (BMD) of a participant with complete spinal cord injury (SCI), long-termed functional electrical stimulation-rowing (FES-R) trained, with previously reported SCI and non-SCI group norms. To estimate lower limb joint contact forces (JCFs) in the FES-R trained participant. UK University and orthopaedic hospital research centre. Bilateral proximal tibial trabecular BMD of the FES-R trained participant was measured using peripheral quantitative computerised tomography, and the data were compared with SCI and non-SCI groups. An instrumented four-channel FES-R system was used to measure the lower limb JCFs in the FES-R trained participant. Structurally, proximal tibial trabecular BMD was higher in the FES-R trained participant compared with the SCI group, but was less than the non-SCI group. Furthermore, left (184.7 mg cm(-3)) and right (160.7 mg cm(-3)) BMD were well above the threshold associated with non-traumatic fracture. The knee JCFs were above the threshold known to mediate BMD in SCI, but below threshold at the hip and ankle. As pathological fractures predominate in the distal femur and proximal tibia in chronic SCI patients, the fact that the FES-R trained participant's knee JCFs were above those known to partially prevent bone loss, suggests that FES-R training may provide therapeutic benefit. Although the elevated bilateral proximal tibial BMD of the FES-R participant provides circumstantial evidence of osteogenesis, this single case precludes any statement on the clinical significance. Further investigations are required involving larger numbers and additional channels of FES to increase loading at the hip and ankle.

  20. Detection of abnormal muscle activations during walking following spinal cord injury (SCI).

    PubMed

    Wang, Ping; Low, K H; McGregor, Alison H; Tow, Adela

    2013-04-01

    In order to identify optimal rehabilitation strategies for spinal cord injury (SCI) participants, assessment of impaired walking is required to detect, monitor and quantify movement disorders. In the proposed assessment, ten healthy and seven SCI participants were recruited to perform an over-ground walking test at slow walking speeds. SCI participants were given assistance from physiotherapists, if required, while they were walking. In agreement with other research, larger cadence and smaller step length and swing phase of SCI gait were observed as a result of muscle weakness and resultant gait instability. Muscle activation patterns of seven major leg muscles were collected. The EMG signal was processed by the RMS in frequency domain to represent the muscle activation power, and the distribution of muscle activation was compared between healthy and SCI participants. The alternations of muscle activation within the phases of the gait cycle are highlighted to facilitate our understanding of the underlying muscular activation following SCI. Key differences were observed (p-value=0.0006) in the reduced activation of tibialis anterior (TA) in single stance phase and rectus femoris (RF) in swing phase (p-value=0.0011). We can then conclude that the proposed assessment approach of gait provides valuable information that can be used to target and define therapeutic interventions and their evaluation; hence impacting the functional outcome of SCI individuals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Development and psychometric characteristics of the SCI-QOL Pressure Ulcers scale and short form.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Choi, Seung W; Kirshblum, Steven C

    2015-05-01

    To develop a self-reported measure of the subjective impact of pressure ulcers on health-related quality of life (HRQOL) in individuals with spinal cord injury (SCI) as part of the SCI quality of life (SCI-QOL) measurement system. Grounded-theory based qualitative item development methods, large-scale item calibration testing, confirmatory factor analysis (CFA), and item response theory-based psychometric analysis. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. SCI-QOL Pressure Ulcers scale. 189 individuals with traumatic SCI who experienced a pressure ulcer within the past 7 days completed 30 items related to pressure ulcers. CFA confirmed a unidimensional pool of items. IRT analyses were conducted. A constrained Graded Response Model with a constant slope parameter was used to estimate item thresholds for the 12 retained items. The 12-item SCI-QOL Pressure Ulcers scale is unique in that it is specifically targeted to individuals with spinal cord injury and at every stage of development has included input from individuals with SCI. Furthermore, use of CFA and IRT methods provide flexibility and precision of measurement. The scale may be administered in its entirety or as a 7-item "short form" and is available for both research and clinical practice.

  2. Sci-Hub: What Librarians Should Know and Do about Article Piracy.

    PubMed

    Hoy, Matthew B

    2017-01-01

    The high cost of journal articles has driven many researchers to turn to a new way of getting access: "pirate" article sites. Sci-Hub, the largest and best known of these sites, currently offers instant access to more than 58 million journal articles. Users attracted by the ease of use and breadth of the collection may not realize that these articles are often obtained using stolen credentials and downloading them may be illegal. This article will briefly describe Sci-Hub and how it works, the legal and ethical issues it raises, and the problems it may cause for librarians. Librarians should be aware of Sci-Hub and the ways it may change their patrons' expectations. They should also understand the risks Sci-Hub can pose to their patrons and their institutions.

  3. SciFlo: Semantically-Enabled Grid Workflow for Collaborative Science

    NASA Astrophysics Data System (ADS)

    Yunck, T.; Wilson, B. D.; Raskin, R.; Manipon, G.

    2005-12-01

    SciFlo is a system for Scientific Knowledge Creation on the Grid using a Semantically-Enabled Dataflow Execution Environment. SciFlo leverages Simple Object Access Protocol (SOAP) Web Services and the Grid Computing standards (WS-* standards and the Globus Alliance toolkits), and enables scientists to do multi-instrument Earth Science by assembling reusable SOAP Services, native executables, local command-line scripts, and python codes into a distributed computing flow (a graph of operators). SciFlo's XML dataflow documents can be a mixture of concrete operators (fully bound operations) and abstract template operators (late binding via semantic lookup). All data objects and operators can be both simply typed (simple and complex types in XML schema) and semantically typed using controlled vocabularies (linked to OWL ontologies such as SWEET). By exploiting ontology-enhanced search and inference, one can discover (and automatically invoke) Web Services and operators that have been semantically labeled as performing the desired transformation, and adapt a particular invocation to the proper interface (number, types, and meaning of inputs and outputs). The SciFlo client & server engines optimize the execution of such distributed data flows and allow the user to transparently find and use datasets and operators without worrying about the actual location of the Grid resources. The scientist injects a distributed computation into the Grid by simply filling out an HTML form or directly authoring the underlying XML dataflow document, and results are returned directly to the scientist's desktop. A Visual Programming tool is also being developed, but it is not required. Once an analysis has been specified for a granule or day of data, it can be easily repeated with different control parameters and over months or years of data. SciFlo uses and preserves semantics, and also generates and infers new semantic annotations. Specifically, the SciFlo engine uses semantic metadata to

  4. Development and psychometric characteristics of the SCI-QOL Pressure Ulcers scale and short form

    PubMed Central

    Kisala, Pamela A.; Tulsky, David S.; Choi, Seung W.; Kirshblum, Steven C.

    2015-01-01

    Objective To develop a self-reported measure of the subjective impact of pressure ulcers on health-related quality of life (HRQOL) in individuals with spinal cord injury (SCI) as part of the SCI quality of life (SCI-QOL) measurement system. Design Grounded-theory based qualitative item development methods, large-scale item calibration testing, confirmatory factor analysis (CFA), and item response theory-based psychometric analysis. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Main Outcome Measures SCI-QOL Pressure Ulcers scale. Results 189 individuals with traumatic SCI who experienced a pressure ulcer within the past 7 days completed 30 items related to pressure ulcers. CFA confirmed a unidimensional pool of items. IRT analyses were conducted. A constrained Graded Response Model with a constant slope parameter was used to estimate item thresholds for the 12 retained items. Conclusions The 12-item SCI-QOL Pressure Ulcers scale is unique in that it is specifically targeted to individuals with spinal cord injury and at every stage of development has included input from individuals with SCI. Furthermore, use of CFA and IRT methods provide flexibility and precision of measurement. The scale may be administered in its entirety or as a 7-item “short form” and is available for both research and clinical practice. PMID:26010965

  5. www.elearnSCI.org: a global educational initiative of ISCoS.

    PubMed

    Chhabra, H S; Harvey, L A; Muldoon, S; Chaudhary, S; Arora, M; Brown, D J; Biering-Sorensen, F; Wyndaele, J J; Charlifue, S; Horsewell, J; Ducharme, S; Green, D; Simpson, D; Glinsky, J; Weerts, E; Upadhyay, N; Aito, S; Wing, P; Katoh, S; Kovindha, A; Krassioukov, A; Weeks, C; Srikumar, V; Reeves, R; Siriwardane, C; Hasnan, N; Kalke, Y B; Lanig, I

    2013-03-01

    To develop a web-based educational resource for health professionals responsible for the management of spinal cord injury (SCI). The resource:www.elearnSCI.org is comprised of seven learning modules, each subdivided into various submodules. Six of the seven modules address the educational needs of all disciplines involved in comprehensive SCI management. The seventh module addresses prevention of SCI. Each submodule includes an overview, activities, self-assessment questions and references. Three hundred and thirty-two experts from The International Spinal Cord Society (ISCoS) and various affiliated societies from 36 countries were involved in developing the resource through 28 subcommittees. The content of each submodule was reviewed and approved by the Education and Scientific Committees of ISCoS and finally by an Editorial Committee of 23 experts. The content of the learning modules is relevant to students and to new as well as experienced SCI healthcare professionals. The content is applicable globally, has received consumer input and is available at no cost. The material is presented on a website underpinned by a sophisticated content-management system, which allows easy maintenance and ready update of all the content. The resource conforms to key principles of e-learning, including appropriateness of curriculum, engagement of learners, innovative approaches, effective learning, ease of use, inclusion, assessment, coherence, consistency, transparency, cost effectiveness and feedback. www.elearnSCI.org provides a cost effective way of training healthcare professionals that goes beyond the textbook and traditional face-to-face teaching.

  6. A High Resolution Clinical PET with Breast and Whole Body Transfigurations

    DTIC Science & Technology

    2006-08-01

    1999. [6] Inst. Inorganic Chemistry, Siberian Branch, Russian Acad. Sci. 3, Acad. Lavrentyev Prospect, Novosibirsk, Russia. [7] White Reflecting Paint...46, no.6, pp. 491-497, 1999. [6] Institute of Inorganic Chemistry, Siberian Branch, Russian Academy of Science 3, Acad.Lavrentyev Prospect, 630090...demanding, higher spatial resolution 8 x 8 array (2.3 x 2.3 x 10 mm BGO) for mouse PET with shallower crystals, the pulse-height ratio was 0.73 with an

  7. Close Encounters of the Best Kind: The Latest Sci-Fi

    ERIC Educational Resources Information Center

    Kunzel, Bonnie

    2008-01-01

    Not only is science fiction alive and well--it's flourishing. From the big screen (howdy, Wall-E) to the big books (like Suzanne Collins's The Hunger Games, which has attracted loads of prepublication praise), 2008 has been a great year for sci-fi. Publishers have released truckloads of new sci-fi titles this year, but what's particularly…

  8. 76 FR 10395 - BreconRidge Manufacturing Solutions, Now Known as Sanmina-SCI Corporation, Division...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-24

    ... Solutions, Now Known as Sanmina-SCI Corporation, Division Optoelectronic and Microelectronic Design and Manufacturing, a Subsidiary of Sanmina-SCI Corporation, Including On- Site Leased Workers From Kelly Services... Manufacturing Solutions, now known as Sanmina-SCI Corporation, Division Optoelectronic and Microelectronic...

  9. SCI peer health coach influence on self-management with peers: a qualitative analysis.

    PubMed

    Skeels, S E; Pernigotti, D; Houlihan, B V; Belliveau, T; Brody, M; Zazula, J; Hasiotis, S; Seetharama, S; Rosenblum, D; Jette, A

    2017-11-01

    A process evaluation of a clinical trial. To describe the roles fulfilled by peer health coaches (PHCs) with spinal cord injury (SCI) during a randomized controlled trial research study called 'My Care My Call', a novel telephone-based, peer-led self-management intervention for adults with chronic SCI 1+ years after injury. Connecticut and Greater Boston Area, MA, USA. Directed content analysis was used to qualitatively examine information from 504 tele-coaching calls, conducted with 42 participants with SCI, by two trained SCI PHCs. Self-management was the focus of each 6-month PHC-peer relationship. PHCs documented how and when they used the communication tools (CTs) and information delivery strategies (IDSs) they developed for the intervention. Interaction data were coded and analyzed to determine PHC roles in relation to CT and IDS utilization and application. PHCs performed three principal roles: Role Model, Supporter, and Advisor. Role Model interactions included CTs and IDSs that allowed PHCs to share personal experiences of managing and living with an SCI, including sharing their opinions and advice when appropriate. As Supporters, PHCs used CTs and IDSs to build credible relationships based on dependability and reassuring encouragement. PHCs fulfilled the unique role of Advisor using CTs and IDSs to teach and strategize with peers about SCI self-management. The SCI PHC performs a powerful, flexible role in promoting SCI self-management among peers. Analysis of PHC roles can inform the design of peer-led interventions and highlights the importance for the provision of peer mentor training.

  10. Opening Comments: SciDAC 2009

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2009-07-01

    Welcome to San Diego and the 2009 SciDAC conference. Over the next four days, I would like to present an assessment of the SciDAC program. We will look at where we've been, how we got to where we are and where we are going in the future. Our vision is to be first in computational science, to be best in class in modeling and simulation. When Ray Orbach asked me what I would do, in my job interview for the SciDAC Director position, I said we would achieve that vision. And with our collective dedicated efforts, we have managed to achieve this vision. In the last year, we have now the most powerful supercomputer for open science, Jaguar, the Cray XT system at the Oak Ridge Leadership Computing Facility (OLCF). We also have NERSC, probably the best-in-the-world program for productivity in science that the Office of Science so depends on. And the Argonne Leadership Computing Facility offers architectural diversity with its IBM Blue Gene/P system as a counterbalance to Oak Ridge. There is also ESnet, which is often understated—the 40 gigabit per second dual backbone ring that connects all the labs and many DOE sites. In the President's Recovery Act funding, there is exciting news that ESnet is going to build out to a 100 gigabit per second network using new optical technologies. This is very exciting news for simulations and large-scale scientific facilities. But as one noted SciDAC luminary said, it's not all about the computers—it's also about the science—and we are also achieving our vision in this area. Together with having the fastest supercomputer for science, at the SC08 conference, SciDAC researchers won two ACM Gordon Bell Prizes for the outstanding performance of their applications. The DCA++ code, which solves some very interesting problems in materials, achieved a sustained performance of 1.3 petaflops, an astounding result and a mark I suspect will last for some time. The LS3DF application for studying nanomaterials also required the development of a

  11. Development and psychometric characteristics of the SCI-QOL Bladder Management Difficulties and Bowel Management Difficulties item banks and short forms and the SCI-QOL Bladder Complications scale.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Tate, Denise G; Spungen, Ann M; Kirshblum, Steven C

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury--Quality of Life (SCI-QOL) Bladder Management Difficulties and Bowel Management Difficulties item banks and Bladder Complications scale. Using a mixed-methods design, a pool of items assessing bladder and bowel-related concerns were developed using focus groups with individuals with spinal cord injury (SCI) and SCI clinicians, cognitive interviews, and item response theory (IRT) analytic approaches, including tests of model fit and differential item functioning. Thirty-eight bladder items and 52 bowel items were tested at the University of Michigan, Kessler Foundation Research Center, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters VA Medical Center, Bronx, NY. Seven hundred fifty-seven adults with traumatic SCI. The final item banks demonstrated unidimensionality (Bladder Management Difficulties CFI=0.965; RMSEA=0.093; Bowel Management Difficulties CFI=0.955; RMSEA=0.078) and acceptable fit to a graded response IRT model. The final calibrated Bladder Management Difficulties bank includes 15 items, and the final Bowel Management Difficulties item bank consists of 26 items. Additionally, 5 items related to urinary tract infections (UTI) did not fit with the larger Bladder Management Difficulties item bank but performed relatively well independently (CFI=0.992, RMSEA=0.050) and were thus retained as a separate scale. The SCI-QOL Bladder Management Difficulties and Bowel Management Difficulties item banks are psychometrically robust and are available as computer adaptive tests or short forms. The SCI-QOL Bladder Complications scale is a brief, fixed-length outcomes instrument for individuals with a UTI.

  12. SciSpark's SRDD : A Scientific Resilient Distributed Dataset for Multidimensional Data

    NASA Astrophysics Data System (ADS)

    Palamuttam, R. S.; Wilson, B. D.; Mogrovejo, R. M.; Whitehall, K. D.; Mattmann, C. A.; McGibbney, L. J.; Ramirez, P.

    2015-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We have developed SciSpark, a robust Big Data framework, that extends ApacheTM Spark for scaling scientific computations. Apache Spark improves the map-reduce implementation in ApacheTM Hadoop for parallel computing on a cluster, by emphasizing in-memory computation, "spilling" to disk only as needed, and relying on lazy evaluation. Central to Spark is the Resilient Distributed Dataset (RDD), an in-memory distributed data structure that extends the functional paradigm provided by the Scala programming language. However, RDDs are ideal for tabular or unstructured data, and not for highly dimensional data. The SciSpark project introduces the Scientific Resilient Distributed Dataset (sRDD), a distributed-computing array structure which supports iterative scientific algorithms for multidimensional data. SciSpark processes data stored in NetCDF and HDF files by partitioning them across time or space and distributing the partitions among a cluster of compute nodes. We show usability and extensibility of SciSpark by implementing distributed algorithms for geospatial operations on large collections of multi-dimensional grids. In particular we address the problem of scaling an automated method for finding Mesoscale Convective Complexes. SciSpark provides a tensor interface to support the pluggability of different matrix libraries. We evaluate performance of the various matrix libraries in distributed pipelines, such as Nd4jTM and BreezeTM. We detail the architecture and design of SciSpark, our efforts to integrate climate science algorithms, parallel ingest and partitioning (sharding) of A-Train satellite observations from model grids. These

  13. Implication of altered autonomic control for orthostatic tolerance in SCI.

    PubMed

    Wecht, Jill Maria; Bauman, William A

    2018-01-01

    Neural output from the sympathetic and parasympathetic branches of the autonomic nervous system (ANS) are integrated to appropriately control cardiovascular responses during routine activities of daily living including orthostatic positioning. Sympathetic control of the upper extremity vasculature and the heart arises from the thoracic cord between T1 and T5, whereas splanchnic bed and lower extremity vasculature receive sympathetic neural input from the lower cord between segments T5 and L2. Although the vasculature is not directly innervated by the parasympathetic nervous system, the SA node is innervated by post-ganglionic vagal nerve fibers via cranial nerve X. Segmental differences in sympathetic cardiovascular innervation highlight the effect of lesion level on orthostatic cardiovascular control following spinal cord injury (SCI). Due to impaired sympathetic cardiovascular control, many individuals with SCI, particularly those with lesions above T6, are prone to orthostatic hypotension (OH) and orthostatic intolerance (OI). Symptomatic OH, which may result in OI, is a consequence of episodic reductions in cerebral perfusion pressure and the symptoms may include: dizziness, lightheadedness, nausea, blurred vision, ringing in the ears, headache and syncope. However, many, if not most, individuals with SCI who experience persistent and episodic hypotension and OH do not report symptoms of cerebral hypoperfusion and therefore do not raise clinical concern. This review will discuss the mechanism underlying OH and OI following SCI, and will review our knowledge to date regarding the prevalence, consequences and possible treatment options for these conditions in the SCI population. Published by Elsevier B.V.

  14. OPENING REMARKS: SciDAC: Scientific Discovery through Advanced Computing

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2005-01-01

    Good morning. Welcome to SciDAC 2005 and San Francisco. SciDAC is all about computational science and scientific discovery. In a large sense, computational science characterizes SciDAC and its intent is change. It transforms both our approach and our understanding of science. It opens new doors and crosses traditional boundaries while seeking discovery. In terms of twentieth century methodologies, computational science may be said to be transformational. There are a number of examples to this point. First are the sciences that encompass climate modeling. The application of computational science has in essence created the field of climate modeling. This community is now international in scope and has provided precision results that are challenging our understanding of our environment. A second example is that of lattice quantum chromodynamics. Lattice QCD, while adding precision and insight to our fundamental understanding of strong interaction dynamics, has transformed our approach to particle and nuclear science. The individual investigator approach has evolved to teams of scientists from different disciplines working side-by-side towards a common goal. SciDAC is also undergoing a transformation. This meeting is a prime example. Last year it was a small programmatic meeting tracking progress in SciDAC. This year, we have a major computational science meeting with a variety of disciplines and enabling technologies represented. SciDAC 2005 should position itself as a new corner stone for Computational Science and its impact on science. As we look to the immediate future, FY2006 will bring a new cycle to SciDAC. Most of the program elements of SciDAC will be re-competed in FY2006. The re-competition will involve new instruments for computational science, new approaches for collaboration, as well as new disciplines. There will be new opportunities for virtual experiments in carbon sequestration, fusion, and nuclear power and nuclear waste, as well as collaborations

  15. Neuropathic pain and SCI: Identification and treatment strategies in the 21st century.

    PubMed

    Hatch, Maya N; Cushing, Timothy R; Carlson, Gregory D; Chang, Eric Y

    2018-01-15

    Pain is a common complication in patients following spinal cord injury (SCI), with studies citing up to 80% of patients reporting some form of pain. Neuropathic pain (NP) makes up a substantial percentage of all pain symptoms in patients with SCI and is often complex. Given the high prevalence of NP in patients with SCI, proper identification and treatment is imperative. Indeed, identification of pain subtypes is a vital step toward determining appropriate treatment. A variety of pharmacological and non-pharmacological treatments can be undertaken including antiepileptics, tricyclic antidepressants, opioids, transcranial direct current stimulation, and invasive surgical procedures. Despite all the available treatment options and advances in the field of SCI medicine, providing adequate treatment of NP after SCI continues to be challenging. It is therefore extremely important for clinicians to have a strong foundation in the identification of SCI NP, as well as an understanding of appropriate treatment options. Here, we highlight the definitions and classification tools available for NP identification, and discuss current treatment options. We hope that this will not only provide a better understanding of NP for physicians in various subspecialties, but that it will also help guide future research on this subject. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Institutional profile: the national Swedish academic drug discovery & development platform at SciLifeLab

    PubMed Central

    Arvidsson, Per I; Sandberg, Kristian; Sakariassen, Kjell S

    2017-01-01

    The Science for Life Laboratory Drug Discovery and Development Platform (SciLifeLab DDD) was established in Stockholm and Uppsala, Sweden, in 2014. It is one of ten platforms of the Swedish national SciLifeLab which support projects run by Swedish academic researchers with large-scale technologies for molecular biosciences with a focus on health and environment. SciLifeLab was created by the coordinated effort of four universities in Stockholm and Uppsala: Stockholm University, Karolinska Institutet, KTH Royal Institute of Technology and Uppsala University, and has recently expanded to other Swedish university locations. The primary goal of the SciLifeLab DDD is to support selected academic discovery and development research projects with tools and resources to discover novel lead therapeutics, either molecules or human antibodies. Intellectual property developed with the help of SciLifeLab DDD is wholly owned by the academic research group. The bulk of SciLifeLab DDD's research and service activities are funded from the Swedish state, with only consumables paid by the academic research group through individual grants. PMID:28670468

  17. Institutional profile: the national Swedish academic drug discovery & development platform at SciLifeLab.

    PubMed

    Arvidsson, Per I; Sandberg, Kristian; Sakariassen, Kjell S

    2017-06-01

    The Science for Life Laboratory Drug Discovery and Development Platform (SciLifeLab DDD) was established in Stockholm and Uppsala, Sweden, in 2014. It is one of ten platforms of the Swedish national SciLifeLab which support projects run by Swedish academic researchers with large-scale technologies for molecular biosciences with a focus on health and environment. SciLifeLab was created by the coordinated effort of four universities in Stockholm and Uppsala: Stockholm University, Karolinska Institutet, KTH Royal Institute of Technology and Uppsala University, and has recently expanded to other Swedish university locations. The primary goal of the SciLifeLab DDD is to support selected academic discovery and development research projects with tools and resources to discover novel lead therapeutics, either molecules or human antibodies. Intellectual property developed with the help of SciLifeLab DDD is wholly owned by the academic research group. The bulk of SciLifeLab DDD's research and service activities are funded from the Swedish state, with only consumables paid by the academic research group through individual grants.

  18. GeoSciML v3.0 - a significant upgrade of the CGI-IUGS geoscience data model

    NASA Astrophysics Data System (ADS)

    Raymond, O.; Duclaux, G.; Boisvert, E.; Cipolloni, C.; Cox, S.; Laxton, J.; Letourneau, F.; Richard, S.; Ritchie, A.; Sen, M.; Serrano, J.-J.; Simons, B.; Vuollo, J.

    2012-04-01

    GeoSciML version 3.0 (http://www.geosciml.org), released in late 2011, is the latest version of the CGI-IUGS* Interoperability Working Group geoscience data interchange standard. The new version is a significant upgrade and refactoring of GeoSciML v2 which was released in 2008. GeoSciML v3 has already been adopted by several major international interoperability initiatives, including OneGeology, the EU INSPIRE program, and the US Geoscience Information Network, as their standard data exchange format for geoscience data. GeoSciML v3 makes use of recently upgraded versions of several Open Geospatial Consortium (OGC) and ISO data transfer standards, including GML v3.2, SWE Common v2.0, and Observations and Measurements v2 (ISO 19156). The GeoSciML v3 data model has been refactored from a single large application schema with many packages, into a number of smaller, but related, application schema modules with individual namespaces. This refactoring allows the use and future development of modules of GeoSciML (eg; GeologicUnit, GeologicStructure, GeologicAge, Borehole) in smaller, more manageable units. As a result of this refactoring and the integration with new OGC and ISO standards, GeoSciML v3 is not backwardly compatible with previous GeoSciML versions. The scope of GeoSciML has been extended in version 3.0 to include new models for geomorphological data (a Geomorphology application schema), and for geological specimens, geochronological interpretations, and metadata for geochemical and geochronological analyses (a LaboratoryAnalysis-Specimen application schema). In addition, there is better support for borehole data, and the PhysicalProperties model now supports a wider range of petrophysical measurements. The previously used CGI_Value data type has been superseded in favour of externally governed data types provided by OGC's SWE Common v2 and GML v3.2 data standards. The GeoSciML v3 release includes worked examples of best practice in delivering geochemical

  19. NetSciEd: Network Science and Education for the Interconnected World

    ERIC Educational Resources Information Center

    Sayama, Hiroki; Cramer, Catherine; Sheetz, Lori; Uzzo, Stephen

    2017-01-01

    This short article presents a summary of the NetSciEd (Network Science and Education) initiative that aims to address the need for curricula, resources, accessible materials, and tools for introducing K-12 students and the general public to the concept of networks, a crucial framework in understanding complexity. NetSciEd activities include (1)…

  20. HamSCI: The Ham Radio Science Citizen Investigation

    NASA Astrophysics Data System (ADS)

    Frissell, N. A.; Moses, M. L.; Earle, G. D.; McGwier, R. W.; Miller, E. S.; Kaeppler, S. R.; Silver, H. W.; Ceglia, F.; Pascoe, D.; Sinanis, N.; Smith, P.; Williams, R.; Shovkoplyas, A.; Gerrard, A. J.

    2016-12-01

    Amateur (or "ham") radio operators are individuals with a non-pecuniary interest in radio technology, engineering, communications, science, and public service. They are licensed by their national governments to transmit on amateur radio frequencies. In many jurisdictions, there is no age requirement for a ham radio license, and operators from diverse backgrounds participate. There are more than 740,000 hams in the US, and over 3 million (estimated) worldwide. Many amateur communications are conducted using transionospheric links and thus affected by space weather and ionospheric processes. Recent technological advances have enabled the development of automated ham radio observation networks (e.g. the Reverse Beacon Network, www.reversebeacon.net) and specialized operating modes for the study of weak-signal propagation. The data from these networks have been shown to be useful for the study of ionospheric processes. In order to connect professional researchers with the volunteer-based ham radio community, HamSCI (Ham Radio Science Citizen Investigation, www.hamsci.org) has been established. HamSCI is a platform for publicizing and promoting projects that are consistent with the following objectives: (1) Advance scientific research and understanding through amateur radio activities. (2) Encourage the development of new technologies to support this research. (3) Provide educational opportunities for the amateur community and the general public. HamSCI researchers are working with the American Radio Relay League (ARRL, www.arrl.org) to publicize these objectives and recruit interested hams. The ARRL is the US national organization for amateur radio with a membership of over 170,000 and a monthly magazine, QST. HamSCI is currently preparing to support ionospheric research connected to the 21 Aug 2017 Total Solar Eclipse by expanding coverage of the Reverse Beacon Network and organizing a large-scale ham radio operating event ("QSO Party") to generate data during the

  1. Spinal Cord Injury Community Survey: Understanding the Needs of Canadians with SCI.

    PubMed

    Noreau, Luc; Noonan, Vanessa K; Cobb, John; Leblond, Jean; Dumont, Frédéric S

    2014-01-01

    There is a lack of literature regarding service needs of people with SCI living in the community. Better assessment of expressed and met and unmet needs would help in the development of effective service delivery. From a national SCI Community Survey in Canada, the aim was to identify the most critical service needs of people living in the community at least 1 year post discharge from rehabilitation and the support they received to meet their needs. Data were collected mainly through a secure Web site and encompassed demographics, personal and household income, an SCI severity measure, and an SCI community needs measure containing information on 13 SCI-related needs. A total of 1,549 persons with SCI (traumatic lesion, n = 1,137; nontraumatic lesion, n = 412) across Canada completed the survey. Most critical needs for community integration were expressed by a substantial proportion of survey participants, but significantly more expressed and met needs were reported by persons with a traumatic than a nontraumatic lesion. Personal and environmental characteristics influenced the probability of expressing and meeting needs (eg, severity of injury and household income). Help and support to meet expressed needs were received from government agencies, community organizations, and friends or family. Better assessment of expressed and met or unmet needs for services remains a challenge but will serve as a tool to optimize service delivery in the community. Environmental barriers to services, particularly the process of getting needs met and associated costs, remain an issue that requires a reconsideration of some aspects of access to services.

  2. GeoSciML version 3: A GML application for geologic information

    NASA Astrophysics Data System (ADS)

    International Union of Geological Sciences., I. C.; Richard, S. M.

    2011-12-01

    After 2 years of testing and development, XML schema for GeoSciML version 3 are now ready for application deployment. GeoSciML draws from many geoscience data modelling efforts to establish a common suite of feature types to represent information associated with geologic maps (materials, structures, and geologic units) and observations including structure data, samples, and chemical analyses. After extensive testing and use case analysis, in December 2008 the CGI Interoperability Working Group (IWG) released GeoSciML 2.0 as an application schema for basic geological information. GeoSciML 2.0 is in use to deliver geologic data by the OneGeology Europe portal, the Geological Survey of Canada Groundwater Information Network (wet GIN), and the Auscope Mineral Resources portal. GeoSciML to version 3.0 is updated to OGC Geography Markup Language v3.2, re-engineered patterns for association of element values with controlled vocabulary concepts, incorporation of ISO19156 Observation and Measurement constructs for representing numeric and categorical values and for representing analytical data, incorporation of EarthResourceML to represent mineral occurrences and mines, incorporation of the GeoTime model to represent GSSP and stratigraphic time scale, and refactoring of the GeoSciML namespace to follow emerging ISO practices for decoupling of dependencies between standardized namespaces. These changes will make it easier for data providers to link to standard vocabulary and registry services. The depth and breadth of GeoSciML remains largely unchanged, covering the representation of geologic units, earth materials and geologic structures. ISO19156 elements and patterns are used to represent sampling features such as boreholes and rock samples, as well as geochemical and geochronologic measurements. Geologic structures include shear displacement structures (brittle faults and ductile shears), contacts, folds, foliations, lineations and structures with no preferred

  3. Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury.

    PubMed

    Moore, Sarah A; Granger, Nicolas; Olby, Natasha J; Spitzbarth, Ingo; Jeffery, Nick D; Tipold, Andrea; Nout-Lomas, Yvette S; da Costa, Ronaldo C; Stein, Veronika M; Noble-Haeusslein, Linda J; Blight, Andrew R; Grossman, Robert G; Basso, D Michele; Levine, Jonathan M

    2017-06-15

    Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process.

  4. SciSpark: In-Memory Map-Reduce for Earth Science Algorithms

    NASA Astrophysics Data System (ADS)

    Ramirez, P.; Wilson, B. D.; Whitehall, K. D.; Palamuttam, R. S.; Mattmann, C. A.; Shah, S.; Goodman, A.; Burke, W.

    2016-12-01

    We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark under a NASA AIST grant (PI Mattmann). Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based Apache Hadoop by 100x in memory and by 10x on disk. SciSpark extends Spark to support Earth Science use in three ways: Efficient ingest of N-dimensional geo-located arrays (physical variables) from netCDF3/4, HDF4/5, and/or OPeNDAP URLS; Array operations for dense arrays in scala and Java using the ND4S/ND4J or Breeze libraries; Operations to "split" datasets across a Spark cluster by time or space or both. For example, a decade-long time-series of geo-variables can be split across time to enable parallel "speedups" of analysis by day, month, or season. Similarly, very high-resolution climate grids can be partitioned into spatial tiles for parallel operations across rows, columns, or blocks. In addition, using Spark's gateway into python, PySpark, one can utilize the entire ecosystem of numpy, scipy, etc. Finally, SciSpark Notebooks provide a modern eNotebook technology in which scala, python, or spark-sql codes are entered into cells in the Notebook and executed on the cluster, with results, plots, or graph visualizations displayed in "live widgets". We have exercised SciSpark by implementing three complex Use Cases: discovery and evolution of Mesoscale Convective Complexes (MCCs) in storms, yielding a graph of connected components; PDF Clustering of atmospheric state using parallel K-Means; and statistical "rollups" of geo-variables or model-to-obs. differences (i.e. mean, stddev, skewness, & kurtosis) by day, month, season, year, and multi-year. Geo-variables are ingested and split across the cluster using methods on the sciSparkContext object including netCDFVariables() for spatial decomposition and wholeNetCDFVariables() for time-series. The

  5. SciServer: An Online Collaborative Environment for Big Data in Research and Education

    NASA Astrophysics Data System (ADS)

    Raddick, Jordan; Souter, Barbara; Lemson, Gerard; Taghizadeh-Popp, Manuchehr

    2017-01-01

    For the past year, SciServer Compute (http://compute.sciserver.org) has offered access to big data resources running within server-side Docker containers. Compute has allowed thousands of researchers to bring advanced analysis to big datasets like the Sloan Digital Sky Survey and others, while keeping the analysis close to the data for better performance and easier read/write access. SciServer Compute is just one part of the SciServer system being developed at Johns Hopkins University, which provides an easy-to-use collaborative research environment for astronomy and many other sciences.SciServer enables these collaborative research strategies using Jupyter notebooks, in which users can write their own Python and R scripts and execute them on the same server as the data. We have written special-purpose libraries for querying, reading, and writing data. Intermediate results can be stored in large scratch space (hundreds of TBs) and analyzed directly from within Python or R with state-of-the-art visualization and machine learning libraries. Users can store science-ready results in their permanent allocation on SciDrive, a Dropbox-like system for sharing and publishing files.SciServer Compute’s virtual research environment has grown with the addition of task management and access control functions, allowing collaborators to share both data and analysis scripts securely across the world. These features also open up new possibilities for education, allowing instructors to share datasets with students and students to write analysis scripts to share with their instructors. We are leveraging these features into a new system called “SciServer Courseware,” which will allow instructors to share assignments with their students, allowing students to engage with big data in new ways.SciServer has also expanded to include more datasets beyond the Sloan Digital Sky Survey. A part of that growth has been the addition of the SkyQuery component, which allows for simple, fast

  6. Study protocol: Münster tinnitus randomized controlled clinical trial-2013 based on tailor-made notched music training (TMNMT).

    PubMed

    Pantev, Christo; Rudack, Claudia; Stein, Alwina; Wunderlich, Robert; Engell, Alva; Lau, Pia; Wollbrink, Andreas; Shaykevich, Alex

    2014-03-02

    Tinnitus is a result of hyper-activity/hyper-synchrony of auditory neurons coding the tinnitus frequency, which has developed to synchronous mass activity owing the lack of inhibition. We assume that removal of exactly these frequency components from an auditory stimulus will cause the brain to reorganize around tonotopic regions coding the tinnitus frequency. Based on this assumption a novel treatment for tonal tinnitus - tailor-made notched music training (TMNMT) (Proc Natl Acad Sci USA 107:1207-1210, 2010; Ann N Y Acad Sci 1252:253-258, 2012; Frontiers Syst Neurosci 6:50, 2012) has been introduced and will be tested in this clinical trial on a large number of tinnitus patients. A randomized controlled trial (RCT) in parallel group design will be performed in a double-blinded manner. The choice of the intervention we are going to apply is based on two "proof of concept" studies in humans (Proc Natl Acad Sci USA 107:1207-1210, 2010; Ann N Y Acad Sci 1252:253-258, 2012; Frontiers Syst Neurosci 6:50, 2012; PloS One 6(9):e24685, 2011) and on a recent animal study (Front Syst Neurosci 7:21, 2013).The RCT includes 100 participants with chronic, tonal tinnitus who listened to tailor-made notched music (TMNM) for two hours a day for three months. The effect of TMNMT is assessed by the tinnitus handicap questionnaire and visual analogue scales (VAS) measuring perceived tinnitus loudness, distress and handicap. This is the first randomized controlled trial applying TMNMT on a larger number of patients with tonal tinnitus. Our data will verify more securely and reliably the effectiveness of this kind of completely non-invasive and low-cost treatment approach on tonal tinnitus. Current Controlled Trials ISRCTN04840953.

  7. Not just quantity: gluteus maximus muscle characteristics in able-bodied and SCI individuals--implications for tissue viability.

    PubMed

    Wu, Gary A; Bogie, Kath M

    2013-08-01

    Some individuals with spinal cord injury (SCI) remain pressure ulcer (PU) free whilst others experience a recurring cycle of tissue breakdown. Detailed analysis of gluteal muscle characteristics may provide insights to local tissue viability variability. The study hypothesis was that SCI individuals have altered muscle composition compared to able-bodied (AB). Ten AB and ten SCI received a supine pelvic CT scan, with contrast. Cross-sectional area (CSA) and overall muscle volume were derived using image analysis. Gluteal muscle tissue type was classified at the S2/S3 sacral vertebrae midpoint, the superior greater trochanters margin (GT) and the inferior ischial tuberosities margin (IT) using the linear transformation Hounsfield Unit scale. SCI gluteal CSA was less than for AB throughout the muscle, with the greatest relative atrophy at the IT (48%). Average AB gluteal volume was nearly double SCI. Eight SCI had over 20% infiltrative adipose tissue, three with over 50%. SCI gluteal CSA and intramuscular fat infiltration were significantly negatively correlated (p < 0.05). SCI IT axial slices showed less lean muscle and higher intramuscular fat infiltration than more proximally (p < 0.05). SCI gluteal muscle characteristics were indicative of impaired tissue viability. SCI disuse muscle atrophy was anticipated; the analytic approach further indicated that intramuscular atrophy was not uniform. SCI muscle composition showed increased proportions of both low density muscle and adipose tissue. CT scan with contrast is effective for gluteal muscle characterization. This assessment technique may contribute to determination of personalized risk for PU development and other secondary complications. Published by Elsevier Ltd.

  8. Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury

    PubMed Central

    Granger, Nicolas; Olby, Natasha J.; Spitzbarth, Ingo; Jeffery, Nick D.; Tipold, Andrea; Nout-Lomas, Yvette S.; da Costa, Ronaldo C.; Stein, Veronika M.; Noble-Haeusslein, Linda J.; Blight, Andrew R.; Grossman, Robert G.; Basso, D. Michele; Levine, Jonathan M.

    2017-01-01

    Abstract Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process. PMID:28230415

  9. Whole body vibration (WBV) following spinal cord injury (SCI) in rats: Timing of intervention.

    PubMed

    Manthou, Marilena; Abdulla, Diana Saad Yousif; Pavlov, Stoyan Pavlov; Jansen, Ramona; Bendella, Habib; Nohroudi, Klaus; Stein, Gregor; Meyer, Carolin; Ozsoy, Ozlem; Ozsoy, Umut; Behram Kandemir, Yasemin; Sarikcioglu, Levent; Semler, Oliver; Schoenau, Eckhard; Dunlop, Sarah; Angelov, Doychin Nikolov

    2017-01-01

    Following spinal cord injury (SCI), exercise training provides a wide range of benefits and promotes activity-dependent synaptic plasticity. Whole body vibration (WBV) in SCI patients improves walking and spasticity as well as bone and muscle mass. However, little is known about the effects of timing or frequency of intervention. To determine which WBV-onset improves locomotor and bladder functions and influences synaptic plasticity beneficially. SCI was followed by WBV starting 1, 7, 14, 28 days after injury (WBV1, WBV7, etc.) and continued for 12 weeks. Intact animals and those receiving SCI but no WBV (No WBV), SCI plus WBV twice daily (2×WBV) and SCI followed by passive hindlimb flexion-extension (PFE) served as controls. Locomotor [BBB rating, foot stepping angle (FSA) and rump-height index (RHI)] as well as bladder function were determined at 1, 3, 6, 9, and 12 weeks. Following perfusion fixation at 12 weeks, lesion volume and immunofluorescence for astrogliosis (GFAP), microglia (IBA1) and synaptic vesicles (synaptophysin, SYN) were determined. Compared to the No WBV group, the WB7 and WBV14 groups showed significantly faster speeds of BBB score recovery though this effect was temporary. Considering RHI we detected a sustained improvement in the WBV14 and PFE groups. Bladder function was better in the WBV14, WBV28, 2×WBV and PFE groups. Synaptophysin levels improved in response to WBV7 and WBV14, but worsened after WBV28 in parallel to an increased IBA1 expression. Correlation- and principal components analysis revealed complex relationships between behavioural (BBB, FSA, RHI) and morphological (GFAP, IBA1, SYN) measurements. WBV started 14 days after SCI provides the most benefit (RHI, bladder); starting at 1day after SCI provides no benefit and starting at 28 days may be detrimental. Increasing the intensity of WBV to twice daily did not provide additional benefit.

  10. Detection of Abnormal Muscle Activations during Walking Following Spinal Cord Injury (SCI)

    ERIC Educational Resources Information Center

    Wang, Ping; Low, K. H.; McGregor, Alison H.; Tow, Adela

    2013-01-01

    In order to identify optimal rehabilitation strategies for spinal cord injury (SCI) participants, assessment of impaired walking is required to detect, monitor and quantify movement disorders. In the proposed assessment, ten healthy and seven SCI participants were recruited to perform an over-ground walking test at slow walking speeds. SCI…

  11. GeoSciGraph: An Ontological Framework for EarthCube Semantic Infrastructure

    NASA Astrophysics Data System (ADS)

    Gupta, A.; Schachne, A.; Condit, C.; Valentine, D.; Richard, S.; Zaslavsky, I.

    2015-12-01

    The CINERGI (Community Inventory of EarthCube Resources for Geosciences Interoperability) project compiles an inventory of a wide variety of earth science resources including documents, catalogs, vocabularies, data models, data services, process models, information repositories, domain-specific ontologies etc. developed by research groups and data practitioners. We have developed a multidisciplinary semantic framework called GeoSciGraph semantic ingration of earth science resources. An integrated ontology is constructed with Basic Formal Ontology (BFO) as its upper ontology and currently ingests multiple component ontologies including the SWEET ontology, GeoSciML's lithology ontology, Tematres controlled vocabulary server, GeoNames, GCMD vocabularies on equipment, platforms and institutions, software ontology, CUAHSI hydrology vocabulary, the environmental ontology (ENVO) and several more. These ontologies are connected through bridging axioms; GeoSciGraph identifies lexically close terms and creates equivalence class or subclass relationships between them after human verification. GeoSciGraph allows a community to create community-specific customizations of the integrated ontology. GeoSciGraph uses the Neo4J,a graph database that can hold several billion concepts and relationships. GeoSciGraph provides a number of REST services that can be called by other software modules like the CINERGI information augmentation pipeline. 1) Vocabulary services are used to find exact and approximate terms, term categories (community-provided clusters of terms e.g., measurement-related terms or environmental material related terms), synonyms, term definitions and annotations. 2) Lexical services are used for text parsing to find entities, which can then be included into the ontology by a domain expert. 3) Graph services provide the ability to perform traversal centric operations e.g., finding paths and neighborhoods which can be used to perform ontological operations like

  12. Understanding Quality of Life in Adults with Spinal Cord Injury Via SCI-Related Needs and Secondary Complications.

    PubMed

    Sweet, Shane N; Noreau, Luc; Leblond, Jean; Dumont, Frédéric S

    2014-01-01

    Understanding the factors that can predict greater quality of life (QoL) is important for adults with spinal cord injury (SCI), given that they report lower levels of QoL than the general population. To build a conceptual model linking SCI-related needs, secondary complications, and QoL in adults with SCI. Prior to testing the conceptual model, we aimed to develop and evaluate the factor structure for both SCI-related needs and secondary complications. Individuals with a traumatic SCI (N = 1,137) responded to an online survey measuring 13 SCI-related needs, 13 secondary complications, and the Life Satisfaction Questionnaire to assess QoL. The SCI-related needs and secondary complications were conceptualized into factors, tested with a confirmatory factor analysis, and subsequently evaluated in a structural equation model to predict QoL. The confirmatory factor analysis supported a 2-factor model for SCI related needs, χ(2)(61, N = 1,137) = 250.40, P <.001, comparative fit index (CFI) = .93, root mean square error of approximation (RMSEA) = .05, standardized root mean square residual (SRMR) = .04, and for 11 of the 13 secondary complications, χ(2)(44, N = 1,137) = 305.67, P < .001, CFI = .91, RMSEA = .060, SRMR = .033. The final 2 secondary complications were kept as observed constructs. In the structural model, both vital and personal development unmet SCI-related needs (β = -.22 and -.20, P < .05, respectively) and the neuro-physiological systems factor (β = -.45, P < .05) were negatively related with QoL. Identifying unmet SCI-related needs of individuals with SCI and preventing or managing secondary complications are essential to their QoL.

  13. Emotional Intelligence in Patients with Spinal Cord Injury (SCI).

    PubMed

    Saberi, Hooshang; Ghajarzadeh, Mahsa

    2017-05-01

    Spinal Cord Injury (SCI) is a devastating situation. Spinal Cord Injury affects functional, psychological and socioeconomic aspects of patients' lives. The ability to accomplish and explicate the one's own and other's feelings and emotions to spread over appropriate information for confirming thoughts and actions is defined as emotional intelligence (EI). The goal of this study was to evaluate depression and EI in SCI patients in comparison with healthy subjects. One-hundred-ten patients with SCI and 80 healthy subjects between Aug 2014 and Aug 2015 were enrolled. The study was conducted in Imam Hospital, Tehran, Iran. All participants were asked to fill valid and reliable Persian version Emotional Quotient inventory (EQ-i) and Beck Depression Inventory (BDI). All data were analyzed using SPSS. Data were presented as Mean±SD for continuous or frequencies for categorical variables. Continuous variables compared by means of independent sample t -test. P -values less than 0.05 were considered as significant. Mean age of patients was 28.7 and mean age of controls was 30.2 yr. Spinal cord injury in 20 (18.3%) were at cervical level, in 83 (75.4%) were thoracic and in 7 (6.3%) were lumbar. Mean values of independence, stress tolerance, self-actualization, emotional Self-Awareness, reality testing, Impulse Control, flexibility, responsibility, and assertiveness were significantly different between cases and controls. Mean values of stress tolerance, optimism, self-regard, and responsibility were significantly different between three groups with different injury level. Most scales were not significantly different between male and female cases. Emotional intelligence should be considered in SCI cases as their physical and psychological health is affected by their illness.

  14. Spinal Cord Injury Clinical Registries: Improving Care across the SCI Care Continuum by Identifying Knowledge Gaps.

    PubMed

    Dvorak, Marcel F; Cheng, Christiana L; Fallah, Nader; Santos, Argelio; Atkins, Derek; Humphreys, Suzanne; Rivers, Carly S; White, Barry A B; Ho, Chester; Ahn, Henry; Kwon, Brian K; Christie, Sean; Noonan, Vanessa K

    2017-10-15

    Timely access and ongoing delivery of care and therapeutic interventions is needed to maximize recovery and function after traumatic spinal cord injury (tSCI). To ensure these decisions are evidence-based, access to consistent, reliable, and valid sources of clinical data is required. The Access to Care and Timing Model used data from the Rick Hansen SCI Registry (RHSCIR) to generate a simulation of healthcare delivery for persons after tSCI and to test scenarios aimed at improving outcomes and reducing the economic burden of SCI. Through model development, we identified knowledge gaps and challenges in the literature and current health outcomes data collection throughout the continuum of SCI care. The objectives of this article were to describe these gaps and to provide recommendations for bridging them. Accurate information on injury severity after tSCI was hindered by difficulties in conducting neurological assessments and classifications of SCI (e.g., timing), variations in reporting, and the lack of a validated SCI-specific measure of associated injuries. There was also limited availability of reliable data on patient factors such as multi-morbidity and patient-reported measures. Knowledge gaps related to structures (e.g., protocols) and processes (e.g., costs) at each phase of care have prevented comprehensive evaluation of system performance. Addressing these knowledge gaps will enhance comparative and cost-effectiveness evaluations to inform decision-making and standards of care. Recommendations to do so were: standardize data element collection and facilitate database linkages, validate and adopt more outcome measures for SCI, and increase opportunities for collaborations with stakeholders from diverse backgrounds.

  15. Spinal Cord Injury Clinical Registries: Improving Care across the SCI Care Continuum by Identifying Knowledge Gaps

    PubMed Central

    Cheng, Christiana L.; Fallah, Nader; Santos, Argelio; Atkins, Derek; Humphreys, Suzanne; Rivers, Carly S.; White, Barry A.B.; Ho, Chester; Ahn, Henry; Kwon, Brian K.; Christie, Sean; Noonan, Vanessa K.

    2017-01-01

    Abstract Timely access and ongoing delivery of care and therapeutic interventions is needed to maximize recovery and function after traumatic spinal cord injury (tSCI). To ensure these decisions are evidence-based, access to consistent, reliable, and valid sources of clinical data is required. The Access to Care and Timing Model used data from the Rick Hansen SCI Registry (RHSCIR) to generate a simulation of healthcare delivery for persons after tSCI and to test scenarios aimed at improving outcomes and reducing the economic burden of SCI. Through model development, we identified knowledge gaps and challenges in the literature and current health outcomes data collection throughout the continuum of SCI care. The objectives of this article were to describe these gaps and to provide recommendations for bridging them. Accurate information on injury severity after tSCI was hindered by difficulties in conducting neurological assessments and classifications of SCI (e.g., timing), variations in reporting, and the lack of a validated SCI-specific measure of associated injuries. There was also limited availability of reliable data on patient factors such as multi-morbidity and patient-reported measures. Knowledge gaps related to structures (e.g., protocols) and processes (e.g., costs) at each phase of care have prevented comprehensive evaluation of system performance. Addressing these knowledge gaps will enhance comparative and cost-effectiveness evaluations to inform decision-making and standards of care. Recommendations to do so were: standardize data element collection and facilitate database linkages, validate and adopt more outcome measures for SCI, and increase opportunities for collaborations with stakeholders from diverse backgrounds. PMID:28745934

  16. FES-Rowing versus Zoledronic Acid to Improve BoneHealth in SCI

    DTIC Science & Technology

    2016-12-01

    SUPPLEMENTARY NOTES 14. ABSTRACT There is no established treatment to prevent bone loss or to induce new bone formation following SCI, although the... no established treatment to prevent bone loss or to induce new bone formation following SCI. The goal of this clinical trial -- FES-Rowing versus...Army position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No . 0704-0188 Public

  17. Implementing Connected Component Labeling as a User Defined Operator for SciDB

    NASA Technical Reports Server (NTRS)

    Oloso, Amidu; Kuo, Kwo-Sen; Clune, Thomas; Brown, Paul; Poliakov, Alex; Yu, Hongfeng

    2016-01-01

    We have implemented a flexible User Defined Operator (UDO) for labeling connected components of a binary mask expressed as an array in SciDB, a parallel distributed database management system based on the array data model. This UDO is able to process very large multidimensional arrays by exploiting SciDB's memory management mechanism that efficiently manipulates arrays whose memory requirements far exceed available physical memory. The UDO takes as primary inputs a binary mask array and a binary stencil array that specifies the connectivity of a given cell to its neighbors. The UDO returns an array of the same shape as the input mask array with each foreground cell containing the label of the component it belongs to. By default, dimensions are treated as non-periodic, but the UDO also accepts optional input parameters to specify periodicity in any of the array dimensions. The UDO requires four stages to completely label connected components. In the first stage, labels are computed for each subarray or chunk of the mask array in parallel across SciDB instances using the weighted quick union (WQU) with half-path compression algorithm. In the second stage, labels around chunk boundaries from the first stage are stored in a temporary SciDB array that is then replicated across all SciDB instances. Equivalences are resolved by again applying the WQU algorithm to these boundary labels. In the third stage, relabeling is done for each chunk using the resolved equivalences. In the fourth stage, the resolved labels, which so far are "flattened" coordinates of the original binary mask array, are renamed with sequential integers for legibility. The UDO is demonstrated on a 3-D mask of O(1011) elements, with O(108) foreground cells and O(106) connected components. The operator completes in 19 minutes using 84 SciDB instances.

  18. Bacterial susceptibility patterns in patients with spinal cord injury and disorder (SCI/D): an opportunity for customized stewardship tools.

    PubMed

    Suda, K J; Patel, U C; Sabzwari, R; Cao, L; Ramanathan, S; Hill, J N; Evans, C T

    2016-11-01

    Retrospective observational study of bacterial susceptibilities in Veterans with SCI/D as compared to a general patient population. The purpose of this project was to evaluate the prevalence and susceptibility of bacteria isolated from spinal cord injury and disorder (SCI/D) patients as compared with a general patient population and determine whether a SCI/D-specific antibiogram, a report of bacterial susceptibilities used to guide empiric antibiotic selection, would be a useful stewardship tool. Veterans Affairs Medical Center located in Cook county, IL, USA. Microbiology reports from 1 October 2012 to 30 September 2013 were compiled into a SCI/D-specific antibiogram and compared to a non-SCI/D antibiogram. Persons with positive cultures and SCI/D were younger and had a higher Charlson Index as compared to non-SCI/D patients (P<0.0001 for both). Five thousand one hundred and thirty-one unique isolate cultures were evaluated (SCI/D=23.0%). Frequencies of pathogens isolated in SCI/D and non-SCI/D differed. Methicillin-resistant Staphylococcus aureus occurred more frequently in SCI/D (27.8% vs 55.4%; P<0.0001). Gram-negatives had generally lower susceptibilities in SCI/D and a higher frequency of organisms producing extended-spectrum Beta-lactamases (17.6% vs 5.0%; P<0.0001), carbapenem-resistant Enterobacteriaceae (2.4% vs 0.5%; P<0.0001), carbapenem resistance (7.6% vs 2.4%; P<0.0001) and isolates resistant to ⩾3 antibiotic classes (60.7% vs 28.0%; P=0.0001). Different pathogens with poorer susceptibilities are isolated in SCI/D. Thus an SCI/D-specific antibiogram reflective of resistance patterns in these patients may increase the appropriateness of empiric antibiotic selection. The frequency of multi-drug resistant organisms in cultures obtained from patients with SCI/D is worrisome.

  19. Lifetime exercise intolerance with lactic acidosis as key manifestation of novel compound heterozygous ACAD9 mutations causing complex I deficiency.

    PubMed

    Schrank, Bertold; Schoser, Benedikt; Klopstock, Thomas; Schneiderat, Peter; Horvath, Rita; Abicht, Angela; Holinski-Feder, Elke; Augustis, Sarunas

    2017-05-01

    We report a 36-year-old female having lifetime exercise intolerance and lactic acidosis with nausea associated with novel compound heterozygous Acyl-CoA dehydrogenase 9 gene (ACAD9) mutations (p.Ala390Thr and p.Arg518Cys). ACAD9 is an assembly factor for the mitochondrial respiratory chain complex I. ACAD9 mutations are recognized as frequent causes of complex I deficiency. Our patient presented with exercise intolerance, rapid fatigue, and nausea since early childhood. Mild physical workload provoked the occurrence of nausea and vomiting repeatedly. Her neurological examination, laboratory findings and muscle biopsy demonstrated no abnormalities. A bicycle spiroergometry provoked significant lactic acidosis during and following exercise pointing towards a mitochondrial disorder. Subsequently, the analysis of respiratory chain enzyme activities in muscle revealed severe isolated complex I deficiency. Candidate gene sequencing revealed two novel heterozygous ACAD9 mutations. This patient report expands the mutational and phenotypic spectrum of diseases associated with mutations in ACAD9. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. People Interview: Using sci-fi to promote physics

    NASA Astrophysics Data System (ADS)

    2009-07-01

    INTERVIEW Using sci-fi to promote physics Robert Flack, a research fellow at University College London, talks to David Smith about science writing and the consequences for physicists of books like Angels and Demons.

  1. Le Carbonifère du Maroc central : les formations de Migoumess, de Tirhela et d'Idmarrach. Lithologie, biostratigraphie et conséquences géodynamiquesThe Carboniferous formations of Migoumess, Tirhela and Idmarrach (central Morocco): lithology, biostratigraphy and geodynamic consequences

    NASA Astrophysics Data System (ADS)

    Berkhli, Mostafa; Vachard, Daniel

    2002-01-01

    New biostratigraphical data based on foraminifers, algae and pseudo-algae indicate that the limestone pebbles of the channelized polygenic conglomerates of the Migoumess formation contain Late Visean (V3b γ-V3c) assemblages. That confirms the Westphalian age attributed to this formation by Hollard [Zdt. Geol. Ges. 129 (1978) 495-512]. The Tournaisian age assigned to it by palynology [C. R. Acad. Sci. Paris, série II 310 (1990) 1573-1576] cannot be retained. The Tirhela formation, Late Visean and Serpukhovian (E1) in age, is coeval with the Akerchi formation [Berkhli, thèse d'État, 1999; Berkhli et al., J. Afr. Earth Sci. (accepté)]. The Idmarrach formation, mapped as a thrust sheet [C. R. Acad. Sci. Paris, série II 310 (1990) 1573-1576], is dated as Serpukhovian (E1) and its thrusting is consequently post-Serpukhovian. Palaeogeographic and geodynamic consequences are listed. To cite this article: M. Berkhli, D. Vachard, C. R. Geoscience 334 (2002) 67-72

  2. Scalable Earth-observation Analytics for Geoscientists: Spacetime Extensions to the Array Database SciDB

    NASA Astrophysics Data System (ADS)

    Appel, Marius; Lahn, Florian; Pebesma, Edzer; Buytaert, Wouter; Moulds, Simon

    2016-04-01

    Today's amount of freely available data requires scientists to spend large parts of their work on data management. This is especially true in environmental sciences when working with large remote sensing datasets, such as obtained from earth-observation satellites like the Sentinel fleet. Many frameworks like SpatialHadoop or Apache Spark address the scalability but target programmers rather than data analysts, and are not dedicated to imagery or array data. In this work, we use the open-source data management and analytics system SciDB to bring large earth-observation datasets closer to analysts. Its underlying data representation as multidimensional arrays fits naturally to earth-observation datasets, distributes storage and computational load over multiple instances by multidimensional chunking, and also enables efficient time-series based analyses, which is usually difficult using file- or tile-based approaches. Existing interfaces to R and Python furthermore allow for scalable analytics with relatively little learning effort. However, interfacing SciDB and file-based earth-observation datasets that come as tiled temporal snapshots requires a lot of manual bookkeeping during ingestion, and SciDB natively only supports loading data from CSV-like and custom binary formatted files, which currently limits its practical use in earth-observation analytics. To make it easier to work with large multi-temporal datasets in SciDB, we developed software tools that enrich SciDB with earth observation metadata and allow working with commonly used file formats: (i) the SciDB extension library scidb4geo simplifies working with spatiotemporal arrays by adding relevant metadata to the database and (ii) the Geospatial Data Abstraction Library (GDAL) driver implementation scidb4gdal allows to ingest and export remote sensing imagery from and to a large number of file formats. Using added metadata on temporal resolution and coverage, the GDAL driver supports time-based ingestion of

  3. Differential Impact and Use of a Telehealth Intervention by Persons with MS or SCI.

    PubMed

    Mercier, Hannah W; Ni, Pensheng; Houlihan, Bethlyn V; Jette, Alan M

    2015-11-01

    The objective of this study was to compare outcomes and patterns of engaging with a telehealth intervention (CareCall) by adult wheelchair users with severe mobility limitations with a diagnosis of multiple sclerosis (MS) or spinal cord injury (SCI). The design of this study is a secondary analysis from a pilot randomized controlled trial with 106 participants with SCI and 36 participants with MS. General linear model results showed that an interaction between baseline depression score and study group significantly predicted reduced depression at 6 mos for subjects with both diagnoses (P = 0.01). For those with MS, CareCall increased participants' physical independence (P < 0.001). No statistically significant differences in skin integrity were found between study groups for subjects with either diagnosis. All participants were similarly satisfied with CareCall, although those with MS engaged in almost double the amount of calls per person than those with SCI (P = 0.005). Those with SCI missed more calls (P < 0.001) and required more extensive support from a nurse (P = 0.006) than those with MS. An interactive telephone intervention was effective in reducing depression in adult wheelchair users with either MS or SCI, and in increasing health care access and physical independence for those with a diagnosis of MS. Future research should aim to enhance the efficacy of such an intervention for participants with SCI.

  4. Pressure Relief Behaviors and Weight-Shifting Activities to Prevent Pressure Ulcers in Persons with SCI

    DTIC Science & Technology

    2014-10-01

    Prevent Pressure Ulcers in Persons with SCI PRINCIPAL INVESTIGATOR: Stephen Sprigle, PhD CONTRACTING ORGANIZATION: Georgia Tech Research...Pressure Ulcers in Persons with SCI 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0387 5c. PROGRAM ELEMENT NUMBER...SUPPLEMENTARY NOTES 14. ABSTRACT Pressure ulcers (PU) are the most costly secondary complication following an SCI. In addition to the medical costs

  5. Novel Target for Ameliorating Pain and Other Problems after SCI: Spontaneous Activity in Nociceptors

    DTIC Science & Technology

    2013-10-01

    pretest , post -SCI, and post -TRPV1 intervention). Mechanical hypersensitivity was tested with a single series of cal- ibrated von Frey filaments (Stoelting... test sequence ( pretest , post -SCI, postinjection) [F(2,17) = 11.37; P = 0.007] and drug treat- ment [F(1,11) = 10.70; P = 0.008], with latencies for...revealed a significant effect of the test sequence ( pretest , post -SCI, post -ODN) [F(2,18) = 22.78; P < 0.0001] and ODN treatment [F(1,9) = 11.03; P

  6. Natural Killer (NK) Cell Functionality after human Spinal Cord Injury (SCI): protocol of a prospective, longitudinal study.

    PubMed

    Laginha, Inês; Kopp, Marcel A; Druschel, Claudia; Schaser, Klaus-Dieter; Brommer, Benedikt; Hellmann, Rick C; Watzlawick, Ralf; Ossami-Saidi, Ramin-Raul; Prüss, Harald; Failli, Vieri; Meisel, Christian; Liebscher, Thomas; Prilipp, Erik; Niedeggen, Andreas; Ekkernkamp, Axel; Grittner, Ulrike; Piper, Sophie K; Dirnagl, Ulrich; Killig, Monica; Romagnani, Chiara; Schwab, Jan M

    2016-09-13

    Natural killer (NK) cells comprise the main components of lymphocyte-mediated nonspecific immunity. Through their effector function they play a crucial role combating bacterial and viral challenges. They are also thought to be key contributors to the systemic spinal cord injury-induced immune-deficiency syndrome (SCI-IDS). SCI-IDS increases susceptibility to infection and extends to the post-acute and chronic phases after SCI. The prospective study of NK cell function after traumatic SCI was carried out in two centers in Berlin, Germany. SCI patients and control patients with neurologically silent vertebral fracture also undergoing surgical stabilization were enrolled. Furthermore healthy controls were included to provide reference data. The NK cell function was assessed at 7 (5-9) days, 14 days (11-28) days, and 10 (8-12) weeks post-trauma. Clinical documentation included the American Spinal Injury Association (ASIA) impairment scale (AIS), neurological level of injury, infection status, concomitant injury, and medications. The primary endpoint of the study is CD107a expression by NK cells (cytotoxicity marker) 8-12 weeks following SCI. Secondary endpoints are the NK cell's TNF-α and IFN-γ production by the NK cells 8-12 weeks following SCI. The protocol of this study was developed to investigate the hypotheses whether i) SCI impairs NK cell function throughout the post-acute and sub-acute phases after SCI and ii) the degree of impairment relates to lesion height and severity. A deeper understanding of the SCI-IDS is crucial to enable strategies for prevention of infections, which are associated with poor neurological outcome and elevated mortality. DRKS00009855 .

  7. Emotional Intelligence in Patients with Spinal Cord Injury (SCI)

    PubMed Central

    SABERI, Hooshang; GHAJARZADEH, Mahsa

    2017-01-01

    Background: Spinal Cord Injury (SCI) is a devastating situation. Spinal Cord Injury affects functional, psychological and socioeconomic aspects of patients’ lives. The ability to accomplish and explicate the one’s own and other’s feelings and emotions to spread over appropriate information for confirming thoughts and actions is defined as emotional intelligence (EI). The goal of this study was to evaluate depression and EI in SCI patients in comparison with healthy subjects. Methods: One-hundred-ten patients with SCI and 80 healthy subjects between Aug 2014 and Aug 2015 were enrolled. The study was conducted in Imam Hospital, Tehran, Iran. All participants were asked to fill valid and reliable Persian version Emotional Quotient inventory (EQ-i) and Beck Depression Inventory (BDI). All data were analyzed using SPSS. Data were presented as Mean±SD for continuous or frequencies for categorical variables. Continuous variables compared by means of independent sample t-test. P-values less than 0.05 were considered as significant. Results: Mean age of patients was 28.7 and mean age of controls was 30.2 yr. Spinal cord injury in 20 (18.3%) were at cervical level, in 83 (75.4%) were thoracic and in 7 (6.3%) were lumbar. Mean values of independence, stress tolerance, self-actualization, emotional Self-Awareness, reality testing, Impulse Control, flexibility, responsibility, and assertiveness were significantly different between cases and controls. Mean values of stress tolerance, optimism, self-regard, and responsibility were significantly different between three groups with different injury level. Most scales were not significantly different between male and female cases. Conclusion: Emotional intelligence should be considered in SCI cases as their physical and psychological health is affected by their illness. PMID:28560199

  8. Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP)

    PubMed Central

    Seton, Jacinta M.; Washington, Monique; Tomlinson, Suk C.; Phrasavath, Douangmala; Farrell, Karen R.; Goldstein, Barry

    2016-01-01

    Background A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Methods Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Results Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. Conclusion SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot. PMID:24617497

  9. Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP).

    PubMed

    Woo, Christine; Seton, Jacinta M; Washington, Monique; Tomlinson, Suk C; Phrasavath, Douangmala; Farrell, Karen R; Goldstein, Barry

    2016-01-01

    A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot.

  10. Documentation of preventive care for pressure ulcers initiated during annual evaluations in SCI

    PubMed Central

    2016-01-01

    Objective Community-acquired pressure ulcers (PrUs) are a frequent cause of hospitalization of Veterans with spinal cord injury (SCI). The Veterans Health Administration (VHA) recommends that SCI annual evaluations include assessment of PrU risk factors, a thorough skin inspection and sharing of recommendations for PrU prevention strategies. We characterized consistency of preventive skin care during annual evaluations for Veterans with SCI as a first step in identifying strategies to more actively promote PrU prevention care in other healthcare encounters. Design/setting/participants Retrospective cross-sectional observational design, including review of electronic medical records for 206 Veterans with SCI admitted to 2 VA SCI centers from January-December, 2011. Outcome measures Proportion of applicable skin health elements documented (number of applicable elements/skin health elements documented). Results Our sample was primarily white (78%) male (96.1%), and mean age = 61 years. 40% of participants’ were hospitalized for PrU treatment, with a mean of 294 days (median = 345 days) from annual evaluation to the index admission. On average, Veterans received an average of 75.5% (IQR 68-86%) of applicable skin health elements. Documentation of applicable skin health elements was significantly higher during inpatient vs. outpatient annual evaluations (mean elements received = 80.3% and 64.3%, respectively, P > 0.001). No significant differences were observed in documentation of skin health elements by Veterans at high vs. low PrU risk. Conclusion Additional PrU preventive care in the VHA outpatient setting may increase identification and detection of PrU risk factors and early PrU damage for Veterans with SCI in the community, allowing for earlier intervention. PMID:26763668

  11. Documentation of preventive care for pressure ulcers initiated during annual evaluations in SCI.

    PubMed

    Guihan, Marylou; Murphy, Deidre; Rogers, Thea J; Parachuri, Ramadevi; Sae Richardson, Michael; Lee, Kenneth K; Bates-Jensen, Barbara M

    2016-05-01

    Community-acquired pressure ulcers (PrUs) are a frequent cause of hospitalization of Veterans with spinal cord injury (SCI). The Veterans Health Administration (VHA) recommends that SCI annual evaluations include assessment of PrU risk factors, a thorough skin inspection and sharing of recommendations for PrU prevention strategies. We characterized consistency of preventive skin care during annual evaluations for Veterans with SCI as a first step in identifying strategies to more actively promote PrU prevention care in other healthcare encounters. Retrospective cross-sectional observational design, including review of electronic medical records for 206 Veterans with SCI admitted to 2 VA SCI centers from January-December, 2011. Proportion of applicable skin health elements documented (number of applicable elements/skin health elements documented). Our sample was primarily white (78%) male (96.1%), and mean age = 61 years. 40% of participants' were hospitalized for PrU treatment, with a mean of 294 days (median = 345 days) from annual evaluation to the index admission. On average, Veterans received an average of 75.5% (IQR 68-86%) of applicable skin health elements. Documentation of applicable skin health elements was significantly higher during inpatient vs. outpatient annual evaluations (mean elements received = 80.3% and 64.3%, respectively, P > 0.001). No significant differences were observed in documentation of skin health elements by Veterans at high vs. low PrU risk. Additional PrU preventive care in the VHA outpatient setting may increase identification and detection of PrU risk factors and early PrU damage for Veterans with SCI in the community, allowing for earlier intervention.

  12. Impact of an implanted neuroprosthesis on community ambulation in incomplete SCI.

    PubMed

    Lombardo, Lisa M; Kobetic, Rudolf; Pinault, Gilles; Foglyano, Kevin M; Bailey, Stephanie N; Selkirk, Stephen; Triolo, Ronald J

    2018-03-01

    Test the effect of a multi-joint control with implanted electrical stimulation on walking after spinal cord injury (SCI). Single subject research design with repeated measures. Hospital-based biomechanics laboratory and user assessment of community use. Female with C6 AIS C SCI 30 years post injury. Lower extremity muscle activation with an implanted pulse generator and gait training. Walking speed, maximum distance, oxygen consumption, upper extremity (UE) forces, kinematics and self-assessment of technology. Short distance walking speed at one-year follow up with or without stimulation was not significantly different from baseline. However, average walking speed was significantly faster (0.22 m/s) with stimulation over longer distances than volitional walking (0.12 m/s). In addition, there was a 413% increase in walking distance from 95 m volitionally to 488 m with stimulation while oxygen consumption and maximum upper extremity forces decreased by 22 and 16%, respectively. Stimulation also produced significant (P ≤ 0.001) improvements in peak hip and knee flexion, ankle angle at foot off and at mid-swing. An implanted neuroprosthesis enabled a subject with incomplete SCI to walk longer distances with improved hip and knee flexion and ankle dorsiflexion resulting in decreased oxygen consumption and UE support. Further research is required to determine the robustness, generalizability and functional implications of implanted neuroprostheses for community ambulation after incomplete SCI.

  13. Microlithography and resist technology information at your fingertips via SciFinder

    NASA Astrophysics Data System (ADS)

    Konuk, Rengin; Macko, John R.; Staggenborg, Lisa

    1997-07-01

    Finding and retrieving the information you need about microlithography and resist technology in a timely fashion can make or break your competitive edge in today's business environment. Chemical Abstracts Service (CAS) provides the most complete and comprehensive database of the chemical literature in the CAplus, REGISTRY, and CASREACT files including 13 million document references, 15 million substance records and over 1.2 million reactions. This includes comprehensive coverage of positive and negative resist formulations and processing, photoacid generation, silylation, single and multilayer resist systems, photomasks, dry and wet etching, photolithography, electron-beam, ion-beam and x-ray lithography technologies and process control, optical tools, exposure systems, radiation sources and steppers. Journal articles, conference proceedings and patents related to microlithography and resist technology are analyzed and indexed by scientific information analysts with strong technical background in these areas. The full CAS database, which is updated weekly with new information, is now available at your desktop, via a convenient, user-friendly tool called 'SciFinder.' Author, subject and chemical substance searching is simplified by SciFinder's smart search features. Chemical substances can be searched by chemical structure, chemical name, CAS registry number or molecular formula. Drawing chemical structures in SciFinder is easy and does not require compliance with CA conventions. Built-in intelligence of SciFinder enables users to retrieve substances with multiple components, tautomeric forms and salts.

  14. Antidepressants Are Effective in Decreasing Neuropathic Pain After SCI: A Meta-Analysis.

    PubMed

    Mehta, Swati; Guy, Stacey; Lam, Tracey; Teasell, Robert; Loh, Eldon

    2015-01-01

    To systematically review and assess the effectiveness and safety of antidepressants for neuropathic pain among individuals with spinal cord injury (SCI). A systematic search was conducted using multiple databases for relevant articles published from 1980 to April 2014. Randomized controlled trials (RCTs) involving antidepressant treatment of neuropathic pain with ≥ 3 individuals and ≥ 50% of study population with SCI were included. Two independent reviewers selected studies based on inclusion criteria and then extracted data. Pooled analysis using Cohen's d to calculate standardized mean difference, standard error, and 95% confidence interval for primary (pain) and other secondary outcomes was conducted. Four RCTs met inclusion criteria. Of these, 2 studies assessed amitriptyline, 1 trazadone, and 1 duloxetine among individuals with neuropathic SCI pain. A small effect was seen in the effectiveness of antidepressants in decreasing pain among individuals with SCI (standardized mean difference = 0.34 ± 0.15; 95% CI, 0.05-0.62; P = .02). A number needed to treat of 3.4 for 30% or more pain relief was found by pooling 2 studies. Of these, significantly higher risk of experiencing constipation (risk ratio [RR] = 1.74; 95% CI, 1.09-2.78; P = .02) and dry mouth (RR = 1.39; 95% CI, 1.04-1.85; P = .02) was found amongst individuals receiving antidepressant treatment compared to those in the control group. The current meta-analysis demonstrates that antidepressants are effective in reducing neuropathic SCI pain. However, this should be interpreted with caution due to the limited number of studies. Further evaluation of long-term therapeutic options may be required.

  15. Pressure Relief Behaviors and Weight Shifting Activities to Prevent Pressure Ulcers in Persons with SCI

    DTIC Science & Technology

    2015-10-01

    AWARD NUMBER: W81XWH-13-1-0387 TITLE: Pressure Relief Behaviors and Weight-Shifting Activities to Prevent Pressure Ulcers in Persons with SCI... Pressure Ulcers in Persons with SCI 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0387 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Stephen Sprigle, PhD...Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Pressure ulcers (PU) are the most costly secondary complication following an SCI. In addition to the

  16. Improvement in Student Science Proficiency Through InSciEd Out

    PubMed Central

    Sonju, James D.; Leicester, Jean E.; Hoody, Maggie; LaBounty, Thomas J.; Frimannsdottir, Katrin R.; Ekker, Stephen C.

    2012-01-01

    Abstract Integrated Science Education Outreach (InSciEd Out) is a collaboration formed between Mayo Clinic, Winona State University, and Rochester Public Schools (MN) with the shared vision of achieving excellence in science education. InSciEd Out employs an equitable partnership model between scientists, teachers, education researchers, and the community. Teams of teachers from all disciplines within a single school experience cutting-edge science using the zebrafish model system, as well as current pedagogical methods, during a summer internship at the Mayo Clinic. Within the internship, the teachers produce new curriculum that directly addresses opportunities for science education improvement at their own school. Zebrafish are introduced within the new curriculum to support a living model of the practice of science. Following partnership with the InSciEd Out program and 2 years of implementation in the classroom, teacher-interns from a K–8 public school reported access to local scientific technology and expertise they had not previously recognized. Teachers also reported improved integration of other disciplines into the scientific curriculum and a flow of concepts vertically from K through 8. Students more than doubled selection of an Honors science track in high school to nearly 90%. 98% of students who took the Minnesota Comprehensive Assessments in their 5th and 8th grade year (a span that includes 2 years of InSciEd Out) showed medium or high growth in science proficiency. These metrics indicate that cooperation between educators and scientists can result in positive change in student science proficiency and demonstrate that a higher expectation in science education can be achieved in US public schools. PMID:23244687

  17. [SciELO: A cooperative project for the dissemination of science].

    PubMed

    Bojo Canales, C; Fraga Medín, C; Hernández Villegas, S; Primo Peña, E

    2009-10-01

    The article describes the SciELO (Scientific Electronic Library Online) model for the electronic publication and dissemination of scientific journals, its origin and evolution, methodology, components, services and potential, and its implantation in Spain. It consists of thirteen participant countries with eight certified web portals, with another 5 under development and another two thematic ones. In February 2009 Scielo.org had 611 magazines and 195,789 articles of which 46% were about health sciences. Spain became a project member in 1999 and launched the SciELO web portal in 2001, as well as 4 magazines. It currently has 39 titles in the field of Health Sciences; one of which is the Revista Española de Sanidad Penitenciaria, which joined the project in 2007 and which currently has 6 issues from 2007 and 2008 available. This makes it one of the most important open access initiatives existing. The report concludes by stating that the SciELO model contributes to the development of research and science by offering an effective and efficient method of promoting and increasing the dissemination of scientific publications in Latin America.

  18. Science Classroom Inquiry (SCI) Simulations: A Novel Method to Scaffold Science Learning

    PubMed Central

    Peffer, Melanie E.; Beckler, Matthew L.; Schunn, Christian; Renken, Maggie; Revak, Amanda

    2015-01-01

    Science education is progressively more focused on employing inquiry-based learning methods in the classroom and increasing scientific literacy among students. However, due to time and resource constraints, many classroom science activities and laboratory experiments focus on simple inquiry, with a step-by-step approach to reach predetermined outcomes. The science classroom inquiry (SCI) simulations were designed to give students real life, authentic science experiences within the confines of a typical classroom. The SCI simulations allow students to engage with a science problem in a meaningful, inquiry-based manner. Three discrete SCI simulations were created as website applications for use with middle school and high school students. For each simulation, students were tasked with solving a scientific problem through investigation and hypothesis testing. After completion of the simulation, 67% of students reported a change in how they perceived authentic science practices, specifically related to the complex and dynamic nature of scientific research and how scientists approach problems. Moreover, 80% of the students who did not report a change in how they viewed the practice of science indicated that the simulation confirmed or strengthened their prior understanding. Additionally, we found a statistically significant positive correlation between students’ self-reported changes in understanding of authentic science practices and the degree to which each simulation benefitted learning. Since SCI simulations were effective in promoting both student learning and student understanding of authentic science practices with both middle and high school students, we propose that SCI simulations are a valuable and versatile technology that can be used to educate and inspire a wide range of science students on the real-world complexities inherent in scientific study. PMID:25786245

  19. Science classroom inquiry (SCI) simulations: a novel method to scaffold science learning.

    PubMed

    Peffer, Melanie E; Beckler, Matthew L; Schunn, Christian; Renken, Maggie; Revak, Amanda

    2015-01-01

    Science education is progressively more focused on employing inquiry-based learning methods in the classroom and increasing scientific literacy among students. However, due to time and resource constraints, many classroom science activities and laboratory experiments focus on simple inquiry, with a step-by-step approach to reach predetermined outcomes. The science classroom inquiry (SCI) simulations were designed to give students real life, authentic science experiences within the confines of a typical classroom. The SCI simulations allow students to engage with a science problem in a meaningful, inquiry-based manner. Three discrete SCI simulations were created as website applications for use with middle school and high school students. For each simulation, students were tasked with solving a scientific problem through investigation and hypothesis testing. After completion of the simulation, 67% of students reported a change in how they perceived authentic science practices, specifically related to the complex and dynamic nature of scientific research and how scientists approach problems. Moreover, 80% of the students who did not report a change in how they viewed the practice of science indicated that the simulation confirmed or strengthened their prior understanding. Additionally, we found a statistically significant positive correlation between students' self-reported changes in understanding of authentic science practices and the degree to which each simulation benefitted learning. Since SCI simulations were effective in promoting both student learning and student understanding of authentic science practices with both middle and high school students, we propose that SCI simulations are a valuable and versatile technology that can be used to educate and inspire a wide range of science students on the real-world complexities inherent in scientific study.

  20. Astronomical Data Processing Using SciQL, an SQL Based Query Language for Array Data

    NASA Astrophysics Data System (ADS)

    Zhang, Y.; Scheers, B.; Kersten, M.; Ivanova, M.; Nes, N.

    2012-09-01

    SciQL (pronounced as ‘cycle’) is a novel SQL-based array query language for scientific applications with both tables and arrays as first class citizens. SciQL lowers the entrance fee of adopting relational DBMS (RDBMS) in scientific domains, because it includes functionality often only found in mathematics software packages. In this paper, we demonstrate the usefulness of SciQL for astronomical data processing using examples from the Transient Key Project of the LOFAR radio telescope. In particular, how the LOFAR light-curve database of all detected sources can be constructed, by correlating sources across the spatial, frequency, time and polarisation domains.

  1. SciJourn is magic: construction of a science journalism community of practice

    NASA Astrophysics Data System (ADS)

    Nicholas, Celeste R.

    2017-06-01

    This article is the first to describe the discoursal construction of an adolescent community of practice (CoP) in a non-school setting. CoPs can provide optimal learning environments. The adolescent community centered around science journalism and positioned itself dichotomously in relationship to school literacy practices. The analysis focuses on recordings from a panel-style research interview from an early implementation of the Science Literacy Through Science Journalism (SciJourn) project. Researchers trained high school students participating in a youth development program to write science news articles. Students engaged in the authentic practices of professional science journalists, received feedback from a professional editor, and submitted articles for publication. I used a fine-grained critical discourse analysis of genre, discourse, and style to analyze student responses about differences between writing in SciJourn and in school. Students described themselves as agentic in SciJourn and passive in school, using an academic writing discourse of deficit to describe schooling experiences. They affiliated with and defined a SciJourn CoP, constructing positive journalistic identities therein. Educators are encouraged to develop similar CoPs. The discursive features presented may be used to monitor the development of communities of practice in a variety of settings.

  2. Performance Engineering Research Institute SciDAC-2 Enabling Technologies Institute Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lucas, Robert

    2013-04-20

    Enhancing the performance of SciDAC applications on petascale systems had high priority within DOE SC at the start of the second phase of the SciDAC program, SciDAC-2, as it continues to do so today. Achieving expected levels of performance on high-end computing (HEC) systems is growing ever more challenging due to enormous scale, increasing architectural complexity, and increasing application complexity. To address these challenges, the University of Southern California?s Information Sciences Institute organized the Performance Engineering Research Institute (PERI). PERI implemented a unified, tripartite research plan encompassing: (1) performance modeling and prediction; (2) automatic performance tuning; and (3) performance engineeringmore » of high profile applications. Within PERI, USC?s primary research activity was automatic tuning (autotuning) of scientific software. This activity was spurred by the strong user preference for automatic tools and was based on previous successful activities such as ATLAS, which automatically tuned components of the LAPACK linear algebra library, and other recent work on autotuning domain-specific libraries. Our other major component was application engagement, to which we devoted approximately 30% of our effort to work directly with SciDAC-2 applications. This report is a summary of the overall results of the USC PERI effort.« less

  3. 76 FR 55070 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-06

    ...). Publications: 1. Robbins JB, et al. Synthesis, characterization, and immunogenicity in mice of Shigella sonnei O-specific oligosaccharide- core-protein conjugates. Proc Natl Acad Sci U S A. 2009 May 12;106(19...

  4. What Are the Treatments for Spinal Cord Injury (SCI)?

    MedlinePlus

    ... potential risk factors for persons with SCI) Functional electrical stimulation for assistance with restoration of neuromuscular function, ... A-Z Topics Rehabilitation Medicine Rehabilitative and Assistive Technology Pediatric Injury NICHD News and Features Focus on ...

  5. Exploring Student and Supervisor Interaction during the SciPro Thesis Process: Two Use Cases

    ERIC Educational Resources Information Center

    Hansen, Preben; Hansson, Henrik

    2017-01-01

    Common problems identified by students during their interaction with supervisors are too little instructions as well as infrequent and insufficient supervisor feedback. The SciPro system has been developed to tackle these problems. This paper describes, analyzes and discusses the interaction between students and supervisors using the SciPro…

  6. Measuring stigma after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Stigma item bank and short form.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Pace, Natalie; Victorson, David; Choi, Seung W; Heinemann, Allen W

    2015-05-01

    To develop a calibrated item bank and computer adaptive test (CAT) to assess the effects of stigma on health-related quality of life in individuals with spinal cord injury (SCI). Grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, and item response theory (IRT)-based psychometric analyses. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. SCI-QOL Stigma Item Bank A sample of 611 individuals with traumatic SCI completed 30 items assessing SCI-related stigma. After 7 items were iteratively removed, factor analyses confirmed a unidimensional pool of items. Graded Response Model IRT analyses were used to estimate slopes and thresholds for the final 23 items. The SCI-QOL Stigma item bank is unique not only in the assessment of SCI-related stigma but also in the inclusion of individuals with SCI in all phases of its development. Use of confirmatory factor analytic and IRT methods provide flexibility and precision of measurement. The item bank may be administered as a CAT or as a 10-item fixed-length short form and can be used for research and clinical applications.

  7. Using the autonomic standards to assess orthostatic hypotension in persons with SCI: a case series.

    PubMed

    Wecht, Jill M; Wilson, James; Previnaire, Jean-Gabriel

    2017-01-01

    Spinal cord injury (SCI) creates a complex and unique syndrome of medical issues related to disruption of somatic and autonomic pathways. Among these impaired control of blood pressure (BP) can significantly impede patients' activities of daily living. The International Standards for the Assessment of Autonomic Function after SCI (ISAFSCI) is used to document the impact of SCI on resting BP (abnormal if below 90 mmHg) and the presence or absence of orthostatic hypotension (OH), defined as a symptomatic or asymptomatic decrease in BP (>/=20/10 mmHg) upon moving to an upright position. Case 1 documents the adverse influence of prescribed medications (antidepressants for neuropathic pain) on OH; case 2 describes the influence of bladder management on cardiovascular instability (autonomic dysreflexia and subsequent OH); case 3 describes the association between spasticity and OH; case 4 describes OH associated with a Valsalva maneuver. Impaired control of BP can stem from a combination of medical issues and autonomic dysfunction in persons with SCI. Management strategies for OH will vary depending on the stage of the SCI, the root cause of the OH and other confounding medical conditions. Non-pharmacological treatment should be considered as a first line of intervention and consideration should be given to cessation of potentially contributory medications prior to implementing pharmaceutical interventions. The systematic use of ISAFSCI by clinicians is recommended to document BP irregularities and to describe the effects of treatment strategies aimed at improving BP control in the SCI population.

  8. A pilot study examining correlates of body image among women living with SCI.

    PubMed

    Bassett, R L; Martin Ginis, K A; Buchholz, A C

    2009-06-01

    Cross-sectional pilot study. To explore correlates of body image among women with spinal cord injury (SCI), within the framework of Cash's cognitive behavioral model of body image. Hamilton, Ontario, Canada. Women with SCI (N=11, 64% with tetraplegia) reported their functional and appearance body image (Adult Body Satisfaction Questionnaire). A 3-day recall of leisure time physical activity (LTPA), three measures of body composition (that is, weight, waist circumference, body fat) and several demographic variables were assessed as potential correlates. Appearance satisfaction was negatively correlated with all three measures of body composition and positively correlated with years postinjury. Functional satisfaction was positively correlated with years postinjury, and negatively correlated with various LTPA variables. Functional and appearance body image may improve with time following SCI. Body composition may impact satisfaction with physical appearance for some women. The negative relationship between LTPA and functional satisfaction merits further examination, as functional dissatisfaction may motivate individuals to engage in certain types and intensities of LTPA. Correlates of body image differ between appearance and functional satisfaction. Future research should examine appearance and functional satisfaction separately among women with SCI.

  9. A Structured Clinical Interview for Kleptomania (SCI-K): preliminary validity and reliability testing.

    PubMed

    Grant, Jon E; Kim, Suck Won; McCabe, James S

    2006-06-01

    Kleptomania presents difficulties in diagnosis for clinicians. This study aimed to develop and test a DSM-IV-based diagnostic instrument for kleptomania. To assess for current kleptomania the Structured Clinical Interview for Kleptomania (SCI-K) was administered to 112 consecutive subjects requesting psychiatric outpatient treatment for a variety of disorders. Reliability and validity were determined. Classification accuracy was examined using the longitudinal course of illness. The SCI-K demonstrated excellent test-retest (Phi coefficient = 0.956 (95% CI = 0.937, 0.970)) and inter-rater reliability (phi coefficient = 0.718 (95% CI = 0.506, 0.848)) in the diagnosis of kleptomania. Concurrent validity was observed with a self-report measure using DSM-IV kleptomania criteria (phi coefficient = 0.769 (95% CI = 0.653, 0.850)). Discriminant validity was observed with a measure of depression (point biserial coefficient = -0.020 (95% CI = -0.205, 0.166)). The SCI-K demonstrated both high sensitivity and specificity based on longitudinal assessment. The SCI-K demonstrated excellent reliability and validity in diagnosing kleptomania in subjects presenting with various psychiatric problems. These findings require replication in larger groups, including non-psychiatric populations, to examine their generalizability. Copyright (c) 2006 John Wiley & Sons, Ltd.

  10. Ertapenem-associated neurotoxicity in the Spinal Cord Injury (SCI) population: a case series.

    PubMed

    Patel, Ursula C; Fowler, Mallory A

    2017-09-06

    Context Ertapenem, a broad spectrum carbapenem antibiotic, is used often in Spinal Cord Injury (SCI) patients due to increased risk factors for multi-drug resistant (MDR) infections in this population. Neurotoxicity, specifically seizures, due to ertapenem is a known adverse effect and has been described previously. Other manifestations such as delirium and visual hallucinations have rarely been reported, and no literature, to the best of our knowledge, specifically describes these effects solely in the SCI population. Findings Four cases of mental status changes and hallucinations in SCI patients attributed to ertapenem therapy are described. Onset of symptoms began between one and six days following initiation of ertapenem and resolved between two to 42 days following discontinuation. Based on the Naranjo probability scale, a probable relationship exists between the adverse events and ertapenem for three out of the four cases. Possible overestimation of renal function and hypoalbuminemia may be contributing factors to the noted adverse reactions. Conclusion/Clinical Relevance The cases described highlight the importance of recognizing ertapenem-associated hallucinations in SCI patients. The population is particularly vulnerable due to risk factors for MDR infections necessitating ertapenem use, possible overestimation of renal function, and a high prevalence of hypoalbuminemia.

  11. Looking into Pandora's Box: The Content of Sci-Hub and its Usage.

    PubMed

    Greshake, Bastian

    2017-01-01

    Despite the growth of Open Access, potentially illegally circumventing paywalls to access scholarly publications is becoming a more mainstream phenomenon. The web service Sci-Hub is amongst the biggest facilitators of this, offering free access to around 62 million publications. So far it is not well studied how and why its users are accessing publications through Sci-Hub. By utilizing the recently released corpus of Sci-Hub and comparing it to the data of  ~28 million downloads done through the service, this study tries to address some of these questions. The comparative analysis shows that both the usage and complete corpus is largely made up of recently published articles, with users disproportionately favoring newer articles and 35% of downloaded articles being published after 2013. These results hint that embargo periods before publications become Open Access are frequently circumnavigated using Guerilla Open Access approaches like Sci-Hub. On a journal level, the downloads show a bias towards some scholarly disciplines, especially Chemistry, suggesting increased barriers to access for these. Comparing the use and corpus on a publisher level, it becomes clear that only 11% of publishers are highly requested in comparison to the baseline frequency, while 45% of all publishers are significantly less accessed than expected. Despite this, the oligopoly of publishers is even more remarkable on the level of content consumption, with 80% of all downloads being published through only 9 publishers. All of this suggests that Sci-Hub is used by different populations and for a number of different reasons, and that there is still a lack of access to the published scientific record. A further analysis of these openly available data resources will undoubtedly be valuable for the investigation of academic publishing.

  12. The Impact of Health Behaviors and Health Management on Employment After SCI: Physical Health and Functioning.

    PubMed

    Meade, Michelle A; Reed, Karla S; Krause, James S

    2016-01-01

    Background : Research has shown that employment following spinal cord injury (SCI) is related to health and functioning, with physical health and functioning after SCI frequently identified as a primary barrier to employment. Objective: To examine the relationship between employment and behaviors associated with the management of physical health and functioning as described by individuals with SCI who have been employed post injury. Methods: A qualitative approach using 6 focus groups at 2 sites included 44 participants with SCI who had worked at some time post injury. Heterogeneous and homogeneous groups were created based on specific characteristics, such as education, gender, or race. A semi-structured interview format asked questions about personal, environmental, and policy-related factors influencing employment after SCI. Groups were recorded, transcribed, and entered into NVivo before coding by 2 reviewers. Results: Within the area of behaviors and management of physical health and functioning, 4 overlapping themes were identified: (1) relearning your own body and what it can do; (2) general health and wellness behaviors; (3) communication, education, and advocacy; and (4) secondary conditions and aging. Specific themes articulate the many types of behaviors individuals must master and their impact on return to work as well as on finding, maintaining, and deciding to leave employment. Conclusions: Individuals with SCI who are successfully employed after injury must learn how to perform necessary behaviors to manage health and function in a work environment. The decision to leave employment often appears to be associated with secondary complications and other conditions that occur as persons with SCI age.

  13. Publishing datasets with eSciDoc and panMetaDocs

    NASA Astrophysics Data System (ADS)

    Ulbricht, D.; Klump, J.; Bertelmann, R.

    2012-04-01

    Currently serveral research institutions worldwide undertake considerable efforts to have their scientific datasets published and to syndicate them to data portals as extensively described objects identified by a persistent identifier. This is done to foster the reuse of data, to make scientific work more transparent, and to create a citable entity that can be referenced unambigously in written publications. GFZ Potsdam established a publishing workflow for file based research datasets. Key software components are an eSciDoc infrastructure [1] and multiple instances of the data curation tool panMetaDocs [2]. The eSciDoc repository holds data objects and their associated metadata in container objects, called eSciDoc items. A key metadata element in this context is the publication status of the referenced data set. PanMetaDocs, which is based on PanMetaWorks [3], is a PHP based web application that allows to describe data with any XML-based metadata schema. The metadata fields can be filled with static or dynamic content to reduce the number of fields that require manual entries to a minimum and make use of contextual information in a project setting. Access rights can be applied to set visibility of datasets to other project members and allow collaboration on and notifying about datasets (RSS) and interaction with the internal messaging system, that was inherited from panMetaWorks. When a dataset is to be published, panMetaDocs allows to change the publication status of the eSciDoc item from status "private" to "submitted" and prepare the dataset for verification by an external reviewer. After quality checks, the item publication status can be changed to "published". This makes the data and metadata available through the internet worldwide. PanMetaDocs is developed as an eSciDoc application. It is an easy to use graphical user interface to eSciDoc items, their data and metadata. It is also an application supporting a DOI publication agent during the process of

  14. Acute spinal cord injury (SCI) transforms how GABA affects nociceptive sensitization.

    PubMed

    Huang, Yung-Jen; Lee, Kuan H; Murphy, Lauren; Garraway, Sandra M; Grau, James W

    2016-11-01

    Noxious input can sensitize pain (nociceptive) circuits within the spinal cord, inducing a lasting increase in spinal cord neural excitability (central sensitization) that is thought to contribute to chronic pain. The development of spinally-mediated central sensitization is regulated by descending fibers and GABAergic interneurons. The current study provides evidence that spinal cord injury (SCI) transforms how GABA affects nociceptive transmission within the spinal cord, recapitulating an earlier developmental state wherein GABA has an excitatory effect. In spinally transected rats, noxious electrical stimulation and inflammation induce enhanced mechanical reactivity (EMR), a behavioral index of nociceptive sensitization. Pretreatment with the GABA A receptor antagonist bicuculline blocked these effects. Peripheral application of an irritant (capsaicin) also induced EMR. Both the induction and maintenance of this effect were blocked by bicuculline. Cellular indices of central sensitization [c-fos expression and ERK phosphorylation (pERK)] were also attenuated. In intact (sham operated) rats, bicuculline had the opposite effect. Pretreatment with a GABA agonist (muscimol) attenuated nociceptive sensitization in intact, but not spinally injured, rats. The effect of SCI on GABA function was linked to a reduction in the Cl - transporter, KCC2, leading to a reduction in intracellular Cl - that would attenuate GABA-mediated inhibition. Pharmacologically blocking the KCC2 channel (with i.t. DIOA) in intact rats mimicked the effect of SCI. Conversely, a pharmacological treatment (bumetanide) that should increase intracellular Cl - levels blocked the effect of SCI. The results suggest that GABAergic neurons drive, rather than inhibit, the development of nociceptive sensitization after spinal injury. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Pediatric SCI/D caregiver mental health and family dynamics in Colombia, South America.

    PubMed

    Doyle, Sarah T; Perrin, Paul B; Nicholls, Elizabeth; Olivera, Silvia Leonor; Quintero, Lorena Medina; Otálvaro, Nadezda Yulieth Méndez; Arango-Lasprilla, Juan Carlos

    2016-01-01

    This study examined the connections between family dynamics and the mental health of caregivers of youth with spinal cord injuries/disorders (SCI/D) caregivers from Colombia, South America. It was hypothesized that lower family functioning would be associated with poorer caregiver mental health. A cross-sectional study of self-report data collected from caregivers through the Hospital Universatario Hernando Moncaleano Perdomo in Neiva, Colombia. Thirty caregivers of children with SCI/D from Nevia, Colombia who were a primary caregiver for ≥3 months, providing care for an individual who was ≥6 months post-injury/diagnosis, familiar with the patient's history, and without neurological or psychiatric conditions. Caregivers' average age was 41.30 years (SD = 10.98), and 90% were female. Caregivers completed Spanish versions of instruments assessing their own mental health and family dynamics. Family dynamics explained 43.2% of the variance in caregiver burden and 50.1% of the variance in satisfaction with life, although family dynamics were not significantly associated with caregiver depression in the overall analysis. Family satisfaction was the only family dynamics variable to yield a significant unique association with any index of caregiver mental health (satisfaction with life). If similar findings emerge in future intervention research, interventions for pediatric SCI/D caregivers in Colombia and other similar global regions could benefit from including techniques to improve family dynamics, especially family satisfaction, given the strong potentially reciprocal connection between these dynamics and caregiver mental health. The degree of disability resulting from SCI/D can vary greatly depending on the severity and level of the lesion, though permanent impairment is often present that profoundly impacts both physical and psychological functioning. Very little is known about the impact of pediatric SCI/D in developing countries, despite the high rates of

  16. Measuring stigma after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Stigma item bank and short form

    PubMed Central

    Kisala, Pamela A.; Tulsky, David S.; Pace, Natalie; Victorson, David; Choi, Seung W.; Heinemann, Allen W.

    2015-01-01

    Objective To develop a calibrated item bank and computer adaptive test (CAT) to assess the effects of stigma on health-related quality of life in individuals with spinal cord injury (SCI). Design Grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, and item response theory (IRT)-based psychometric analyses. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Main Outcome Measures SCI-QOL Stigma Item Bank Results A sample of 611 individuals with traumatic SCI completed 30 items assessing SCI-related stigma. After 7 items were iteratively removed, factor analyses confirmed a unidimensional pool of items. Graded Response Model IRT analyses were used to estimate slopes and thresholds for the final 23 items. Conclusions The SCI-QOL Stigma item bank is unique not only in the assessment of SCI-related stigma but also in the inclusion of individuals with SCI in all phases of its development. Use of confirmatory factor analytic and IRT methods provide flexibility and precision of measurement. The item bank may be administered as a CAT or as a 10-item fixed-length short form and can be used for research and clinical applications. PMID:26010973

  17. MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.

    PubMed

    Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng

    2016-01-01

    MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.

  18. Genetics Home Reference: mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes

    MedlinePlus

    ... my area? Other Names for This Condition MELAS MELAS syndrome mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like ... basic concepts, clinical phenotype, and therapeutic management of MELAS syndrome. Ann N Y Acad Sci. 2008 Oct;1142: ...

  19. Neuroinflammatory contributions to pain after SCI: roles for central glial mechanisms and nociceptor-mediated host defense.

    PubMed

    Walters, Edgar T

    2014-08-01

    Neuropathic pain after spinal cord injury (SCI) is common, often intractable, and can be severely debilitating. A number of mechanisms have been proposed for this pain, which are discussed briefly, along with methods for revealing SCI pain in animal models, such as the recently applied conditioned place preference test. During the last decade, studies of animal models have shown that both central neuroinflammation and behavioral hypersensitivity (indirect reflex measures of pain) persist chronically after SCI. Interventions that reduce neuroinflammation have been found to ameliorate pain-related behavior, such as treatment with agents that inhibit the activation states of microglia and/or astroglia (including IL-10, minocycline, etanercept, propentofylline, ibudilast, licofelone, SP600125, carbenoxolone). Reversal of pain-related behavior has also been shown with disruption by an inhibitor (CR8) and/or genetic deletion of cell cycle-related proteins, deletion of a truncated receptor (trkB.T1) for brain-derived neurotrophic factor (BDNF), or reduction by antisense knockdown or an inhibitor (AMG9810) of the activity of channels (TRPV1 or Nav1.8) important for electrical activity in primary nociceptors. Nociceptor activity is known to drive central neuroinflammation in peripheral injury models, and nociceptors appear to be an integral component of host defense. Thus, emerging results suggest that spinal and systemic effects of SCI can activate nociceptor-mediated host defense responses that interact via neuroinflammatory signaling with complex central consequences of SCI to drive chronic pain. This broader view of SCI-induced neuroinflammation suggests new targets, and additional complications, for efforts to develop effective treatments for neuropathic SCI pain. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Web life: Planet SciCast

    NASA Astrophysics Data System (ADS)

    2009-08-01

    So what is the site about? Planet SciCast is an online repository for short films about science - a bit like a science-specific, moderated version of YouTube. As of July 2009, the site hosts over 150 films on topics ranging from CERN's Large Hadron Collider to fun things to do with treacle. New content appears on the site every few weeks, and some films include links to information about related experiments, demos and activities. The site also runs an annual competition aimed at getting more people involved in making science films, with prizes in categories like "best original score" and "best presenter".

  1. Use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students: Study in six countries in Latin America

    PubMed Central

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Miñan-Tapia, Armando; Serrano, Felipe T.; Tobler-Gómez, Liz E.; Pereda-Castro, William; Mendoza-Flores, Cynthia R.; Mundaca-Manay, Maria Y.; Valladares-Garrido, Danai

    2017-01-01

    Introduction Sci-Hub is a useful web portal for people working in science as it provides access to millions of free scientific articles. Satisfaction and usage should be explored in the Latino student population. The objective of this study was to evaluate the use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students from Latin America. Methodology A multicenter, observational, analytical study was conducted in 6632 medical students from 6 countries in Latin America. We surveyed from a previously validated instrument, delving into knowledge, monthly average usage, satisfaction level, and perception of the scientific contributions provided by Sci-Hub. Frequencies and percentages are described, and generalized linear models were used to establish statistical associations. Results Only 19.2% of study participants knew of Sci-Hub and its function, while the median use was twice a month. 29.9% of Sci-Hub-aware participants claimed they always find the desired scientific information in their Sci-Hub search; 62.5% of participants affirmed that Sci-Hub contributes to scientific investigation; only 2.2% reported that Sci-Hub does not contribute to science. Conclusion The majority of Latino students are not aware of Sci-Hub. PMID:28982181

  2. Use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students: Study in six countries in Latin America.

    PubMed

    Mejia, Christian R; Valladares-Garrido, Mario J; Miñan-Tapia, Armando; Serrano, Felipe T; Tobler-Gómez, Liz E; Pereda-Castro, William; Mendoza-Flores, Cynthia R; Mundaca-Manay, Maria Y; Valladares-Garrido, Danai

    2017-01-01

    Sci-Hub is a useful web portal for people working in science as it provides access to millions of free scientific articles. Satisfaction and usage should be explored in the Latino student population. The objective of this study was to evaluate the use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students from Latin America. A multicenter, observational, analytical study was conducted in 6632 medical students from 6 countries in Latin America. We surveyed from a previously validated instrument, delving into knowledge, monthly average usage, satisfaction level, and perception of the scientific contributions provided by Sci-Hub. Frequencies and percentages are described, and generalized linear models were used to establish statistical associations. Only 19.2% of study participants knew of Sci-Hub and its function, while the median use was twice a month. 29.9% of Sci-Hub-aware participants claimed they always find the desired scientific information in their Sci-Hub search; 62.5% of participants affirmed that Sci-Hub contributes to scientific investigation; only 2.2% reported that Sci-Hub does not contribute to science. The majority of Latino students are not aware of Sci-Hub.

  3. Differences in the use of everyday technology among persons with MCI, SCI and older adults without known cognitive impairment.

    PubMed

    Malinowsky, Camilla; Kottorp, Anders; Wallin, Anders; Nordlund, Arto; Björklund, Eva; Melin, Ilse; Pernevik, Anette; Rosenberg, Lena; Nygård, Louise

    2017-07-01

    To use valid subjective reports sensible to cognitive decline is vital to identify very early signs of dementia development. Use of everyday technology (ET) has been shown to be sensitive to differentiate adults with mild cognitive impairment (MCI) from controls, but the group with subjective cognitive impairment (SCI) has not yet been examined. This study aims to investigate and compare self-perceived ability in ET use and number of ETs reported as actually used in a sample of older adults with SCI, MCI, and older adults with no known cognitive impairment, i.e. Older adults with MCI (n = 29), SCI ( n = 26), and controls (n = 30) were interviewed with the short version of the Everyday Technology Use Questionnaire (S-ETUQ) to capture self-perceived ability in ET use and number of ETs used. To generate individual measures of ability to use ET, Rasch analysis was used. The measures were then compared group-wise using ANCOVA. The numbers of ETs used were compared group-wise with ANOVA. Controls versus SCI and MCI differed significantly regarding ETs reported as used, but not SCI versus MCI. Similarly, in ability to use ET, controls versus SCI and MCI differed significantly but not SCI versus MCI. The significantly lower numbers of ETs reported as actually used and the lower ability in SCI and MCI groups compared to controls suggest that ET use is affected already in very minor cognitive decline. This indicates that self-reported ET use based on the S-ETUQ is sensitive to detect changes already in SCI.

  4. An international age- and gender-controlled model for the Spinal Cord Injury Ability Realization Measurement Index (SCI-ARMI).

    PubMed

    Scivoletto, Giorgio; Glass, Clive; Anderson, Kim D; Galili, Tal; Benjamin, Yoav; Front, Lilach; Aidinoff, Elena; Bluvshtein, Vadim; Itzkovich, Malka; Aito, Sergio; Baroncini, Ilaria; Benito-Penalva, Jesùs; Castellano, Simona; Osman, Aheed; Silva, Pedro; Catz, Amiram

    2015-01-01

    Background. A quadratic formula of the Spinal Cord Injury Ability Realization Measurement Index (SCI-ARMI) has previously been published. This formula was based on a model of Spinal Cord Independence Measure (SCIM95), the 95th percentile of the SCIM III values, which correspond with the American Spinal Injury Association Motor Scores (AMS) of SCI patients. Objective. To further develop the original formula. Setting. Spinal cord injury centers from 6 countries and the Statistical Laboratory, Tel-Aviv University, Israel. Methods. SCIM95 of 661 SCI patients was modeled, using a quantile regression with or without adjustment for age and gender, to calculate SCI-ARMI values. SCI-ARMI gain during rehabilitation and its correlations were examined. Results. A new quadratic SCIM95 model was created. This resembled the previously published model, which yielded similar SCIM95 values in all the countries, after adjustment for age and gender. Without this adjustment, however, only 86% of the non-Israeli SCIM III observations were lower than those SCIM95 values (P < .0001). Adding the variables age and gender to the new model affected the SCIM95 value significantly (P < .04). Adding country information did not add a significant effect (P > .1). SCI-ARMI gain was positive (38.8 ± 22 points, P < .0001) and correlated weakly with admission age and AMS. Conclusions. The original quadratic SCI-ARMI formula is valid for an international population after adjustment for age and gender. The new formula considers more factors that affect functional ability following SCI. © The Author(s) 2014.

  5. Valproic Acid Arrests Proliferation but Promotes Neuronal Differentiation of Adult Spinal NSPCs from SCI Rats.

    PubMed

    Chu, Weihua; Yuan, Jichao; Huang, Lei; Xiang, Xin; Zhu, Haitao; Chen, Fei; Chen, Yanyan; Lin, Jiangkai; Feng, Hua

    2015-07-01

    Although the adult spinal cord contains a population of multipotent neural stem/precursor cells (NSPCs) exhibiting the potential to replace neurons, endogenous neurogenesis is very limited after spinal cord injury (SCI) because the activated NSPCs primarily differentiate into astrocytes rather than neurons. Valproic acid (VPA), a histone deacetylase inhibitor, exerts multiple pharmacological effects including fate regulation of stem cells. In this study, we cultured adult spinal NSPCs from chronic compressive SCI rats and treated with VPA. In spite of inhibiting the proliferation and arresting in the G0/G1 phase of NSPCs, VPA markedly promoted neuronal differentiation (β-tubulin III(+) cells) as well as decreased astrocytic differentiation (GFAP(+) cells). Cell cycle regulator p21(Cip/WAF1) and proneural genes Ngn2 and NeuroD1 were increased in the two processes respectively. In vivo, to minimize the possible inhibitory effects of VPA to the proliferation of NSPCs as well as avoid other neuroprotections of VPA in acute phase of SCI, we carried out a delayed intraperitoneal injection of VPA (150 mg/kg/12 h) to SCI rats from day 15 to day 22 after injury. Both of the newborn neuron marker doublecortin and the mature neuron marker neuron-specific nuclear protein were significantly enhanced after VPA treatment in the epicenter and adjacent segments of the injured spinal cord. Although the impaired corticospinal tracks had not significantly improved, Basso-Beattie-Bresnahan scores in VPA treatment group were better than control. Our study provide the first evidence that administration of VPA enhances the neurogenic potential of NSPCs after SCI and reveal the therapeutic value of delayed treatment of VPA to SCI.

  6. 75 FR 19626 - Notice of Intent To Grant Exclusive Patent License: SciTech Medical Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-15

    ... DEPARTMENT OF DEFENSE Department of the Navy Notice of Intent To Grant Exclusive Patent License: SciTech Medical Inc. AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant a partially exclusive license to SciTech Medical...

  7. Research progress from the SCI Model Systems (SCIMS): An interactive discussion on future directions.

    PubMed

    Boninger, Michael L; Field-Fote, Edelle C; Kirshblum, Steven C; Lammertse, Daniel P; Dyson-Hudson, Trevor A; Hudson, Lesley; Heinemann, Allen W

    2018-03-01

    To describe current and future directions in spinal cord injury (SCI) research. The SCI Model Systems (SCIMS) programs funded by the National Institute on Disability, Independent Living, and Rehabilitation Research (NIDILRR) during the 2011 to 2016 cycle provided abstracts describing findings from current research projects. Discussion among session participants generated ideas for research opportunities. Pre-conference workshop before the 2016 American Spinal Injury Association (ASIA) annual meeting. A steering committee selected by the SCIMS directors that included the moderators of the sessions at the ASIA pre-conference workshop, researchers presenting abstracts during the session, and the audience of over 100 attending participants in the pre-conference workshop. Group discussion followed presentations in 5 thematic areas of (1) Demographics and Measurement; (2) Functional Training; (3) Psychosocial Considerations; (4) Assistive Technology; and (5) Secondary Conditions. The steering committee reviewed and summarized discussion points on future directions for research and made recommendations for research based on the discussion in each of the five areas. Significant areas in need of research in SCI remain, the goal of which is continued improvement in the quality of life of individuals with SCI.

  8. The CanPain SCI Clinical Practice Guidelines for Rehabilitation Management of Neuropathic Pain after Spinal Cord: screening and diagnosis recommendations.

    PubMed

    Mehta, S; Guy, S D; Bryce, T N; Craven, B C; Finnerup, N B; Hitzig, S L; Orenczuk, S; Siddall, P J; Widerström-Noga, E; Casalino, A; Côté, I; Harvey, D; Kras-Dupuis, A; Lau, B; Middleton, J W; Moulin, D E; O'Connell, C; Parrent, A G; Potter, P; Short, C; Teasell, R; Townson, A; Truchon, C; Wolfe, D; Bradbury, C L; Loh, E

    2016-08-01

    Clinical practice guidelines. To develop the first Canadian clinical practice guidelines for screening and diagnosis of neuropathic pain in people with spinal cord injury (SCI). The guidelines are relevant for inpatient and outpatient SCI rehabilitation settings in Canada. The CanPainSCI Working Group reviewed evidence to address clinical questions regarding screening and diagnosis of neuropathic pain after SCI. A consensus process was followed to achieve agreement on recommendations and clinical considerations. Twelve recommendations, based on expert consensus, were developed for the screening and diagnosis of neuropathic pain after SCI. The recommendations address methods for assessment, documentation tools, team member accountability, frequency of screening and considerations for diagnostic investigation. Important clinical considerations accompany each recommendation. The expert Working Group developed recommendations for the screening and diagnosis of neuropathic pain after SCI that should be used to inform practice.

  9. Spinal cord injury (SCI) rehabilitation: systematic analysis of communication from the biopsychosocial perspective.

    PubMed

    Hartley, Naomi A

    2015-07-02

    Communication is powerful predictor of health-related quality of life and overall well-being, yet its role in promoting rehabilitation outcomes in spinal cord injury (SCI) is rarely mentioned. This article systematically analyzes and synthesizes literature from multiple disciplines according to a biopsychosocial perspective, providing an evidence base for clinical practice and clear direction for future research. Systematic literature review and analysis, incorporating mapping to International Classification of Functioning, Disability and Health (ICF) codes. In total 4338 entries were retrieved from CINAHL, PsychInfo, Medline, PubMed and SpeechBite databases for the period 1990-2014. A total of 115 treatment and observational studies (quantitative and qualitative) detailed aspects of communication according to structure, function, activity, participation and environmental factors; evident of the complex interactions between communicative function with daily living after SCI. Communication is a relative strength in SCI, key to empowerment, independence, social interaction, and well-being, yet its potential to enhance SCI rehabilitation outcomes remains largely underexplored and untapped. Through elucidating interactions between communication and functioning, the adapted ICF framework affords clinicians and researchers insight into areas of intervention most likely to result in widespread gains. Conscious consideration should be given to the role of communication, within an integrative, strengths-based, multidisciplinary approach to clinical practice and future research. Implications for Rehabilitation Communication fosters empowerment, independence and greater participation in life roles; recognized as a powerful predictor of health-related quality of life and overall well-being. The ICF framework elucidates influences to communicative function, and components which are influenced by communication, providing valuable insight for clinicians and researchers

  10. What Makes Things Happen? Study Guide. Unit B. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Dube, Peter

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  11. Looking at Life. Study Guide. Unit A2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  12. [Analysis on acupuncture literature in Science Citation Index (SCI) periodicals in 2007].

    PubMed

    Gao, Liang; Tian, Li-xin; Guo, Yi

    2009-06-01

    To grasp the international developing tendency of acupuncture research and provide some references for promoting acupuncture and moxibustion internationalization process, the articles about acupuncture in Science Citation Index (SCI) periodicals in 2007 were retrieved by adopting the retrieval tactics on line in combination with database searching. Results indicate that 257 articles about acupuncture had been retrived from the SCI Web databases. These articles were published in 125 journals respectively, most of which were Euramerican journals. Among these journals, the impact factor of the Journal of the American Medical Association (JAMA), 25. 547, is the highest one. It is shown that the impact factors of the SCI periodicals, in which acupuncture articles embodied are increased, the quality of these articles are improved obviously and the types of the articles are various in 2007, but there is obvious difference in the results of these studies due to the difference of experimental methods, the subjects of these experiments and acupuncture manipulations. Therefore, standardization of many problems arising from the researches on acupuncture is extremely imminent.

  13. Measurement properties of the Spinal Cord Injury-Functional Index (SCI-FI) short forms.

    PubMed

    Heinemann, Allen W; Dijkers, Marcel P; Ni, Pengsheng; Tulsky, David S; Jette, Alan

    2014-07-01

    To evaluate the psychometric properties of the Spinal Cord Injury-Functional Index (SCI-FI) short forms (basic mobility, self-care, fine motor, ambulation, manual wheelchair, and power wheelchair) based on internal consistency; correlations between short forms banks, full item bank forms, and a 10-item computer adaptive test version; magnitude of ceiling and floor effects; and test information functions. Cross-sectional cohort study. Six rehabilitation hospitals in the United States. Individuals with traumatic spinal cord injury (N=855) recruited from 6 national Spinal Cord Injury Model Systems facilities. Not applicable. SCI-FI full item bank, 10-item computer adaptive test, and parallel short form scores. The SCI-FI short forms (with separate versions for individuals with paraplegia and tetraplegia) demonstrate very good internal consistency, group-level reliability, excellent correlations between short forms and scores based on the total item bank, and minimal ceiling and floor effects (except ceiling effects for persons with paraplegia on self-care, fine motor, and power wheelchair ability and floor effects for persons with tetraplegia on self-care, fine motor, and manual wheelchair ability). The test information functions are acceptable across the range of scores where most persons in the sample performed. Clinicians and researchers should consider the SCI-FI short forms when computer adaptive testing is not feasible. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  14. Does the CDC Definition of Fever Accurately Predict Inflammation and Infection in Persons With SCI?

    PubMed

    Trbovich, Michelle; Li, Carol; Lee, Shuko

    2016-01-01

    Background: Pneumonia and septicemia have the greatest impact on reduced life expectancy in persons with spinal cord injury (SCI). Fever is often the first presenting symptom of infection or inflammation. Thermoregulatory dysfunction in persons with SCI may preclude a typical febrile response to infection or inflammation and thus delay diagnostic workup. Objective: To determine the core temperature of persons with SCI in the setting of infection or inflammation and the frequency with which it meets criteria for the CDC definition of fever (>100.4°F). Methods: Retrospective review of hospitalized SCI patients over 5 years with a diagnosis of infection or inflammation (DI), defined by serum leukocytosis. In this study, 458 persons with paraplegia (PP) and 483 persons with tetraplegia (TP) had 4,191 DI episodes. Aural temperatures (T au ) on the day of DI, 7 days prior, and 14 days afterwards were abstracted from medical records. Main outcome measures were average T au at DI, frequency of temperatures >100.4°F at DI, and average baseline temperatures before and after DI. Results: Average T au at DI was 98.2°F (±1.5) and 98.2°F (±1.4) in the TP and PP groups, respectively, with only 11.6% to 14% of DI resulting in T au >100.4°F. Baseline temperatures ranged from 97.9°F (±0.7) to 98.0°F (±0.8). Conclusion: SCI persons with leukocytosis infrequently mount a fever as defined by the CDC, and baseline temperatures were subnormal (<98.6°F). Thermoregulatory dysfunction likely accounts for these findings. T au >100.4°F is not a sensitive predictor of infection or inflammation in persons with SCI. Clinicians should be vigilant for alternative symptoms of infection and inflammation in these patients, so diagnostic workup is not delayed.

  15. SCI Hospital in Home Program: Bringing Hospital Care Home for Veterans With Spinal Cord Injury.

    PubMed

    Madaris, Linda L; Onyebueke, Mirian; Liebman, Janet; Martin, Allyson

    2016-01-01

    The complex nature of spinal cord injury (SCI) and the level of care required for health maintenance frequently result in repeated hospital admissions for recurrent medical complications. Prolonged hospitalizations of persons with SCI have been linked to the increased risk of hospital-acquired infections and development or worsening pressure ulcers. An evidence-based alternative for providing hospital-level care to patients with specific diagnoses who are willing to receive that level of care in the comfort of their home is being implemented in a Department of Veterans Affairs SCI Home Care Program. The SCI Hospital in Home (HiH) model is similar to a patient-centered interdisciplinary care model that was first introduced in Europe and later tested as part of a National Demonstration and Evaluation Study through Johns Hopkins School of Medicine and School of Public Health. This was funded by the John A. Hartford Foundation and the Department of Veterans Affairs. The objectives of the program are to support veterans' choice and access to patient-centered care, reduce the reliance on inpatient medical care, allow for early discharge, and decrease medical costs. Veterans with SCI who are admitted to the HiH program receive daily oversight by a physician, daily visits by a registered nurse, access to laboratory services, oxygen, intravenous medications, and nursing care in the home setting. In this model, patients may typically access HiH services either as an "early discharge" from the hospital or as a direct admit to the program from the emergency department or SCI clinic. Similar programs providing acute hospital-equivalent care in the home have been previously implemented and are successfully demonstrating decreased length of stay, improved patient access, and increased patient satisfaction.

  16. Does the CDC Definition of Fever Accurately Predict Inflammation and Infection in Persons With SCI?

    PubMed Central

    Li, Carol; Lee, Shuko

    2016-01-01

    Background: Pneumonia and septicemia have the greatest impact on reduced life expectancy in persons with spinal cord injury (SCI). Fever is often the first presenting symptom of infection or inflammation. Thermoregulatory dysfunction in persons with SCI may preclude a typical febrile response to infection or inflammation and thus delay diagnostic workup. Objective: To determine the core temperature of persons with SCI in the setting of infection or inflammation and the frequency with which it meets criteria for the CDC definition of fever (>100.4°F). Methods: Retrospective review of hospitalized SCI patients over 5 years with a diagnosis of infection or inflammation (DI), defined by serum leukocytosis. In this study, 458 persons with paraplegia (PP) and 483 persons with tetraplegia (TP) had 4,191 DI episodes. Aural temperatures (Tau) on the day of DI, 7 days prior, and 14 days afterwards were abstracted from medical records. Main outcome measures were average Tau at DI, frequency of temperatures >100.4°F at DI, and average baseline temperatures before and after DI. Results: Average Tau at DI was 98.2°F (±1.5) and 98.2°F (±1.4) in the TP and PP groups, respectively, with only 11.6% to 14% of DI resulting in Tau >100.4°F. Baseline temperatures ranged from 97.9°F (±0.7) to 98.0°F (±0.8). Conclusion: SCI persons with leukocytosis infrequently mount a fever as defined by the CDC, and baseline temperatures were subnormal (<98.6°F). Thermoregulatory dysfunction likely accounts for these findings. Tau >100.4°F is not a sensitive predictor of infection or inflammation in persons with SCI. Clinicians should be vigilant for alternative symptoms of infection and inflammation in these patients, so diagnostic workup is not delayed. PMID:29339867

  17. The Small Carry-on Impactor (SCI) and the Hayabusa2 Impact Experiment

    NASA Astrophysics Data System (ADS)

    Saiki, T.; Imamura, H.; Arakawa, M.; Wada, K.; Takagi, Y.; Hayakawa, M.; Shirai, K.; Yano, H.; Okamoto, C.

    2017-07-01

    Hayabusa2 is a sample return mission of JAXA launched on 3 December 2014. Hayabusa2 is the successor of Hayabusa, which returned samples from the asteroid Itokawa to the Earth. Although the design of Hayabusa2 follows that of Hayabusa, the former is equipped with some new components. The small carry-on impactor (SCI) is one of those components. The SCI is a compact kinetic impactor designed to remove the asteroid surface regolith locally and create an artificial crater. One of the most important scientific objectives of Hayabusa2 is to investigate the chemical and physical properties of the internal materials and structures of the target body, asteroid Ryugu. Hayabusa2 will attempt to observe the resultant crater with some scientific instruments and to get samples from around the crater. High kinetic energy is required to create a meaningful crater, however, the impact system design needs to fit within strict constraints. Complicated functions, such as a guidance and control system, are not permitted. A special type of shaped charge is used for the acceleration of the impactor of the SCI in order to make system simpler. Using this explosion technique makes it possible to accelerate the impactor very quickly and to hit the asteroid without a guidance system. However, the impact operation will be complicated because the explosive is very powerful and it scatters high-speed debris at the detonation. This paper describes an overview of the SCI system, the results of the development testing and an outline of the impact experiment of the Hayabusa2 mission.

  18. Particles in Action. Study Guide. Unit C2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a four-part unit…

  19. Valproic acid improves locomotion in vivo after SCI and axonal growth of neurons in vitro.

    PubMed

    Lv, Lei; Han, Xiang; Sun, Yan; Wang, Xin; Dong, Qiang

    2012-02-01

    Previous studies have found that valproic acid (VPA), a histone deacetylases (HDAC) inhibitor, improves outcomes in a rat model of spinal cord injury (SCI). The study here aimed to further illuminate the neuroprotective effects of VPA against SCI, both in vivo and in vitro. First, spinal cord injury was performed in rats using NYU impactor. Delayed VPA injection (8 h following SCI) significantly accelerated locomotor recovery. VPA therapy also suppressed SCI-induced hypoacetylation of histone and promoted expressions of BDNF and GDNF. Next, the influence of VPA on axonal growth inhibited by a myelin protein was tested. Neurons from embryonic spinal cord or hippocampus were cultured on plates coated with Nogo-A peptide, and escalating concentrations of VPA were added into the cultures. VPA treatment, in a concentration dependent manner, allowed neurons to overcome Nogo-A inhibition of neurite outgrowth. Meanwhile, VPA exposure increased the level of histone acetylation and expression of BDNF in spinal neurons. Cumulatively, these findings indicate that VPA is possibly a promising medication and deserves translational trials for spinal cord injury. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Recommendations for the National Institute for Neurologic Disorders and Stroke spinal cord injury common data elements for children and youth with SCI.

    PubMed

    Mulcahey, M J; Vogel, L C; Sheikh, M; Arango-Lasprilla, J C; Augutis, M; Garner, E; Hagen, E M; Jakeman, L B; Kelly, E; Martin, R; Odenkirchen, J; Scheel-Sailer, A; Schottler, J; Taylor, H; Thielen, C C; Zebracki, K

    2017-04-01

    In 2014, the adult spinal cord injury (SCI) common data element (CDE) recommendations were made available. This project was a review of the adult SCI CDE for relevance to children and youth with SCI. The objective of this study was to review the National Institute of Neurologic Disorders and Stroke (NINDS) adult SCI CDEs for relevance to children and youth with SCI. International. The pediatric working group consisted of international members with varied fields of expertise related to pediatric SCI. The group convened biweekly meetings for 6 months in 2015. All of the adult SCI CDEs were reviewed, evaluated and modified/created for four age groups: 0-5 years, 6-12 years, 13-15 years and 16-18 years. Whenever possible, results of published research studies were used to guide recommendations. In the absence of empirical support, grey literature and international content expert consensus were garnered. Existing pediatric NINDS CDEs and new CDEs were developed in areas where adult recommendations were not appropriate. After internal working group review of domain recommendations, these pediatric CDEs were vetted during a public review from November through December 2015. Version 1.0 of the pediatric SCI CDEs was posted in February 2016. The pediatric SCI CDEs are incorporated directly into the NINDS SCI CDE sets and can be found at https://commondataelements.ninds.nih.gov.

  1. Social Competence Intervention for Parents (SCI-P): Comparing Outcomes for a Parent Education Program Targeting Adolescents with ASD

    PubMed Central

    Schultz, Tia R.; Stichter, Janine P.; Herzog, Melissa J.; McGhee, Stephanie D.; Lierheimer, Kristin

    2012-01-01

    Research has shown that parent education programs can address some of the distinct challenges that parents of youth with autism spectrum disorders (ASDs) encounter. This study examined the effectiveness of the Social Competence Intervention for Parents (SCI-P), a parent education program, administered in conjunction with a social competence intervention that targeted youth with ASD ages 11–14 (SCI-A). Using a quasi-experimental pre-post design, parents were assigned to either the SCI-P group (n = 16) or to the waitlist comparison group (n = 10). Analyses of covariance (ANCOVAs) revealed a significant effect for parent education participation such that SCI-P participants experienced significantly greater reductions in levels of stress and a trend for increases in parenting sense of competence from pre- to post-intervention. Moreover, parents in the SCI-P group reported high satisfaction with the program. These findings suggest that parent education can result in positive outcomes for parents' well being. PMID:22934178

  2. Orthostatic Responses to Anticholinesterase Inhibition in Persons with SCI

    PubMed Central

    Wecht, Jill M.; Cirnigliaro, Christopher M.; Azarelo, Frank; Bauman, William A.; Kirshblum, Steven C.

    2015-01-01

    Acetylcholine (Ach) is the pre-synaptic neurotransmitter of the sympathetic nervous system. Increased pre-synaptic Ach may augment post-synaptic release of norepinephrine thereby increasing systemic blood pressure (BP). The primary objective of this investigation was to determine the hemodynamic effect of pyridostigmine bromide (PYRIDO: 60 mg), an Ach inhibitor (AchI), compared to no-drug (NO-D) during head-up tilt (HUT) in individuals with spinal cord injury (SCI). Secondarily we aimed to determine the effects of PYRIDO compared to NO-D on symptoms of orthostatic intolerance (OI) and adverse event reporting (AE). Ten individuals with SCI (C4–C7) were studied on 2 occasions: visit 1) NO-D and visit 2) PYRIDO. On each visit subjects underwent a progressive HUT maneuver to 15°, 25°, 35° for 5 minutes at each angle and 45 minutes at 45°. Supine and orthostatic heart rate (HR), systolic and diastolic BP (SBP & DBP) were monitored and symptoms of OI and AE recorded. Supine hemodynamics did not differ between the trials. The significant fall in SBP during the NO-D trial was diminished with PYRIDO and five subjects had an increased DBP during HUT with PYRIDO compared to the NO-D trial. Individuals that responded to PYRIDO with an increase in orthostatic BP had significantly lower resting HR than non-responders (p<0.01), which suggests increased levels of pre-synaptic Ach. Subjective symptoms of OI and AE reporting did not differ between the two trials. These preliminary data suggest that PYRIDO is safe and may be effective at ameliorating the orthostatic fall in BP in select individuals with SCI. PMID:25916633

  3. a Study on the Document Information Service of the National Agricultural Library for Agricultural Sci-Tech Innovation in China

    NASA Astrophysics Data System (ADS)

    Xu, Qian; Meng, Xianxue

    This paper presents the significant function of the Chinese National Agricultural Library (CNAL) in the agricultural sci-tech innovation system in China, analyses the development of collection and service in the CNAL, explores the challenge towards sustain and develop information services for the agricultural sci-tech research and innovation, at last proposes the strategy for sci-tech document information service development.

  4. Secretory expression and surface display of a new and biologically active single-chain insulin (SCI-59) analog by lactic acid bacteria.

    PubMed

    Mao, Ruifeng; Wu, Dongli; Hu, Shimeng; Zhou, Kangping; Wang, Man; Wang, Yefu

    2017-04-01

    Insulin plays an important role in drug therapies for diabetes mellitus and as the main route of insulin delivery, subcutaneous injection may cause local discomfort, hypoglycemia, hyperinsulinemia, and patient non-compliance. Therefore, oral delivery of insulin is more preferred. However, there is a low bioavailability due to insulin degradation by proteolytic enzymes and severe pH conditions along the gastrointestinal tract. In order to use the food-grade bacteria lactic acid bacteria (LAB) as oral delivery vehicles, a new and bioactive single-chain insulin (SCI-59) analog, containing the insulin B- and A-chains connected by an eight-residue linker (RSRGLPFR), was secretory expressed in Lactococcus lactis NZ3900 without using an antibiotic resistance gene and displayed onto the surface of various non-viable bacteria (NVBs) without genetic modification. Both the free SCI-59 and SCI-59 displayed on the surface of NVBs are biologically active as assayed by their ability to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Modification of the pH of the medium by NaOH addition at early time during induction can enhance the bioactivity of SCI-59. The C-terminal fused anchoring domain, three LysM repeats, does not affect the formation of disulfide bonds and/or the folding of SCI-59, and SCI-59 could be exposed properly and fully when SCI-59-3LysM bound to the surface of NVBs. Compared to the free form SCI-59, SCI-59 displayed on the surface of NVBs is more stable in simulate gastric juice. It may open new prospects for possible oral treatments of diabetes using live LAB secreting or NVBs carrying bioactive SCI analogs.

  5. The regulatory effect of electro-acupuncture on the expression of NMDA receptors in a SCI rat model.

    PubMed

    Tu, Wen-Zhan; Chen, Wen-Ci; Xia, Wan; He, Rong; Hu, Jie; Jiang, Ming-Chen; Jiang, Song-He

    2017-05-15

    In early spinal cord injury (SCI), glutamate receptors, including N-methyl-d-aspartate (NMDA) receptors (NMDARs), are over-stimulated by excessively released glutamate. The enhanced activity of NMDARs may cause cell death by overloading calcium (Ca 2+ ) into cells based on their high permeability to Ca 2+ . Studies in SCI animals have shown that treatment with electro-acupuncture (EA) is able to reduce cell death and to improve functional recovery. One possible mechanism of this neuroprotective effect is that EA has regulatory effect on NMDARs. To test whether EA could protect the spinal cord after SCI by decreasing the expression levels of NR1 and NR2A. We conducted EA treatment on a rat SCI model produced with a New York University (NYU) Impactor and measured hindlimb locomotor function by Basso, Beattie and Bresnahan Locomotor Rating Scale (BBB Scale). The expression of NR1 and NR2, the subunits of NMDARs, in the injured spinal cord was measured by Immunofluorescence stainings, western blot and real-time quantitative PCR (RT-qPCR). Our results showed that two days after the SCI the expression of NR1 and NR2 were dramatically enhanced at both protein and mNRA levels, which were significantly reduced by EA treatment at two specific acupoints, Dazhui (DU14) and Mingmen (DU4). EA is a potential therapeutic method for treating early SCI in human. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Enhancing health care professionals' and trainees' knowledge of physical activity guidelines for adults with and without SCI.

    PubMed

    Shirazipour, Celina H; Tomasone, Jennifer R; Martin Ginis, Kathleen A

    2018-01-11

    Health care providers (HCPs) are preferred sources of physical activity (PA) information; however, minimal research has explored HCPs' knowledge of spinal cord injury (SCI) PA guidelines, and no research has examined HCP trainees' PA guideline knowledge. The current study explored HCPs' and trainees' initial knowledge of PA guidelines for both adults with SCI and the general population, and the utility of an event-based intervention for improving this knowledge. Participants (HCPs n = 129; trainees n = 573) reported guideline knowledge for both sets of guidelines (SCI and general population) immediately after, one-month, and six-months following the intervention. Frequencies determined guideline knowledge at each timepoint, while chi-squared tests examined differences in knowledge of both guidelines, as well as knowledge differences in the short- and long-term. Results demonstrated that HCPs and trainees lack knowledge of PA guidelines, particularly guidelines for adults with SCI. The results further suggest that a single event-based intervention is not effective for improving long-term guideline knowledge. Suggestions are made for future research with the aim of improving interventions that target HCP and HCP trainees' long-term guideline knowledge for adults with SCI and the general population.

  7. Ranking Business and Economics Journals in South America Using the Scientific Electronic Library Online (SciELO)

    ERIC Educational Resources Information Center

    Alexander, Jennifer K.; Pradenas, Lorena; Parada, Victor; Scherer, Robert F.

    2012-01-01

    Access to published research for knowledge creation and education in the administrative science disciplines in South America has been enhanced since the introduction of the Scientific Electronic Library Online (SciELO). Although SciELO has been available as an online journal indexing and publication service since 1998, there have been no…

  8. [Analysis of the citation of the articles published in National Journal of Andrology by SCI periodicals from 2002 to 2008].

    PubMed

    Huang, Hai

    2009-03-01

    Science Citation Index (SCI) is one of the world's most important and influential information retrieval systems. Today Web of Science covers over 9000 international and regional journals and book series in every field of natural sciences, social sciences, and arts and humanities. More and more Chinese periodicals have been cited by SCI. This paper briefly introduces the SCI database and its selection process and analyzes the citation of the articles published in National Journal of Andrology (NJA) by SCI journals from 2002 to 2008, aiming to provide some information for the internationalization of NJA.

  9. Simultaneous Monitoring of Vascular Oxygenation and Tissue Oxygen Tension of Breast Tumors Under Hyperbaric Oxygen Exposure

    DTIC Science & Technology

    2008-04-01

    28. Alagoz, T., R. Buller, B. Anderson, K. Terrell , R...and oxygenation Ann . New Acad. Sci. 838 29–45 Chapman J D, Stobbe C C, Arnfield M R, Santus R, Lee J and McPhee M S 1991 Oxygen dependency of tumor

  10. A faster and more reliable data acquisition system for the full performance of the SciCRT

    DOE PAGES

    Sasai, Y.; Matsubara, Y.; Itow, Y.; ...

    2017-01-03

    The SciBar Cosmic Ray Telescope (SciCRT) is a massive scintillator tracker to observe cosmic rays at a very high-altitude environment in Mexico. The fully active tracker is based on the Scintillator Bar (SciBar) detector developed as a near detector for the KEK-to-Kamioka long-baseline neutrino oscillation experiment (K2K) in Japan. Since the data acquisition (DAQ) system was developed for the accelerator experiment, we determined to develop a new robust DAQ system to optimize it to our cosmic-ray experiment needs at the top of Mt. Sierra Negra (4600 m). One of our special requirements is to achieve a 10 times faster readoutmore » rate. We started to develop a new fast readout back-end board (BEB) based on 100 Mbps SiTCP, a hardware network processor developed for DAQ systems for high energy physics experiments. Then we developed the new BEB which has a potential of 20 times faster than the current one in the case of observing neutrons. Lastly, we installed the new DAQ system including the new BEBs to a part of the SciCRT in July 2015. The system has been operating since then. In this article, we describe the development, the basic performance of the new BEB, the status after the installation in the SciCRT, and the future performance.« less

  11. Assembling Large, Multi-Sensor Climate Datasets Using the SciFlo Grid Workflow System

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Manipon, G.; Xing, Z.; Fetzer, E.

    2008-12-01

    NASA's Earth Observing System (EOS) is the world's most ambitious facility for studying global climate change. The mandate now is to combine measurements from the instruments on the A-Train platforms (AIRS, AMSR-E, MODIS, MISR, MLS, and CloudSat) and other Earth probes to enable large-scale studies of climate change over periods of years to decades. However, moving from predominantly single-instrument studies to a multi-sensor, measurement-based model for long-duration analysis of important climate variables presents serious challenges for large-scale data mining and data fusion. For example, one might want to compare temperature and water vapor retrievals from one instrument (AIRS) to another instrument (MODIS), and to a model (ECMWF), stratify the comparisons using a classification of the cloud scenes from CloudSat, and repeat the entire analysis over years of AIRS data. To perform such an analysis, one must discover & access multiple datasets from remote sites, find the space/time matchups between instruments swaths and model grids, understand the quality flags and uncertainties for retrieved physical variables, and assemble merged datasets for further scientific and statistical analysis. To meet these large-scale challenges, we are utilizing a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data query, access, subsetting, co-registration, mining, fusion, and advanced statistical analysis. SciFlo is a semantically-enabled ("smart") Grid Workflow system that ties together a peer-to-peer network of computers into an efficient engine for distributed computation. The SciFlo workflow engine enables scientists to do multi-instrument Earth Science by assembling remotely-invokable Web Services (SOAP or http GET URLs), native executables, command-line scripts, and Python codes into a distributed computing flow. A scientist visually authors the graph of operation in the VizFlow GUI, or uses a

  12. Assembling Large, Multi-Sensor Climate Datasets Using the SciFlo Grid Workflow System

    NASA Astrophysics Data System (ADS)

    Wilson, B.; Manipon, G.; Xing, Z.; Fetzer, E.

    2009-04-01

    NASA's Earth Observing System (EOS) is an ambitious facility for studying global climate change. The mandate now is to combine measurements from the instruments on the "A-Train" platforms (AIRS, AMSR-E, MODIS, MISR, MLS, and CloudSat) and other Earth probes to enable large-scale studies of climate change over periods of years to decades. However, moving from predominantly single-instrument studies to a multi-sensor, measurement-based model for long-duration analysis of important climate variables presents serious challenges for large-scale data mining and data fusion. For example, one might want to compare temperature and water vapor retrievals from one instrument (AIRS) to another instrument (MODIS), and to a model (ECMWF), stratify the comparisons using a classification of the "cloud scenes" from CloudSat, and repeat the entire analysis over years of AIRS data. To perform such an analysis, one must discover & access multiple datasets from remote sites, find the space/time "matchups" between instruments swaths and model grids, understand the quality flags and uncertainties for retrieved physical variables, assemble merged datasets, and compute fused products for further scientific and statistical analysis. To meet these large-scale challenges, we are utilizing a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data query, access, subsetting, co-registration, mining, fusion, and advanced statistical analysis. SciFlo is a semantically-enabled ("smart") Grid Workflow system that ties together a peer-to-peer network of computers into an efficient engine for distributed computation. The SciFlo workflow engine enables scientists to do multi-instrument Earth Science by assembling remotely-invokable Web Services (SOAP or http GET URLs), native executables, command-line scripts, and Python codes into a distributed computing flow. A scientist visually authors the graph of operation in the Viz

  13. Sense from Senses. Study Guide. Unit J. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Simango, Sam

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  14. Understanding Electricity. Study Guide. Unit I1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  15. Using Electricity. Study Guide. Unit I2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  16. Measuring depression after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Depression item bank and linkage with PHQ-9.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Kalpakjian, Claire Z; Bombardier, Charles H; Pohlig, Ryan T; Heinemann, Allen W; Carle, Adam; Choi, Seung W

    2015-05-01

    To develop a calibrated spinal cord injury-quality of life (SCI-QOL) item bank, computer adaptive test (CAT), and short form to assess depressive symptoms experienced by individuals with SCI, transform scores to the Patient Reported Outcomes Measurement Information System (PROMIS) metric, and create a crosswalk to the Patient Health Questionnaire (PHQ)-9. We used grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, item response theory (IRT) analyses, and statistical linking techniques to transform scores to a PROMIS metric and to provide a crosswalk with the PHQ-9. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. Spinal Cord Injury--Quality of Life (SCI-QOL) Depression Item Bank Individuals with SCI were involved in all phases of SCI-QOL development. A sample of 716 individuals with traumatic SCI completed 35 items assessing depression, 18 of which were PROMIS items. After removing 7 non-PROMIS items, factor analyses confirmed a unidimensional pool of items. We used a graded response IRT model to estimate slopes and thresholds for the 28 retained items. The SCI-QOL Depression measure correlated 0.76 with the PHQ-9. The SCI-QOL Depression item bank provides a reliable and sensitive measure of depressive symptoms with scores reported in terms of general population norms. We provide a crosswalk to the PHQ-9 to facilitate comparisons between measures. The item bank may be administered as a CAT or as a short form and is suitable for research and clinical applications.

  17. Life, Beginning and Growing. Study Guide. Unit E1. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a three-part unit…

  18. Atoms and Molecules. Study Guide. Unit 2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Mandizha, George

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a four-part unit…

  19. Forces. 'O' Level Study Guide. Unit 1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Udwin, Martin

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a five-part unit…

  20. SciSpark: Highly Interactive and Scalable Model Evaluation and Climate Metrics

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Mattmann, C. A.; Waliser, D. E.; Kim, J.; Loikith, P.; Lee, H.; McGibbney, L. J.; Whitehall, K. D.

    2014-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark. Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based ApacheTM Hadoop by 100x in memory and by 10x on disk, and makes iterative algorithms feasible. SciSpark will enable scalable model evaluation by executing large-scale comparisons of A-Train satellite observations to model grids on a cluster of 100 to 1000 compute nodes. This 2nd generation capability for NASA's Regional Climate Model Evaluation System (RCMES) will compute simple climate metrics at interactive speeds, and extend to quite sophisticated iterative algorithms such as machine-learning (ML) based clustering of temperature PDFs, and even graph-based algorithms for searching for Mesocale Convective Complexes. The goals of SciSpark are to: (1) Decrease the time to compute comparison statistics and plots from minutes to seconds; (2) Allow for interactive exploration of time-series properties over seasons and years; (3) Decrease the time for satellite data ingestion into RCMES to hours; (4) Allow for Level-2 comparisons with higher-order statistics or PDF's in minutes to hours; and (5) Move RCMES into a near real time decision-making platform. We will report on: the architecture and design of SciSpark, our efforts to integrate climate science algorithms in Python and Scala, parallel ingest and partitioning (sharding) of A-Train satellite observations from HDF files and model grids from netCDF files, first parallel runs to compute comparison statistics and PDF

  1. SciNews: Incorporating Science Current Events in 21st Century Classrooms

    NASA Astrophysics Data System (ADS)

    DiMaggio, E.

    2011-12-01

    Middle school students are instructed with the aid of textbooks, lectures, and activities to teach topics that satisfy state standards. However, teaching materials created to convey standard-aligned science concepts often leave students asking how the content relates to their lives and why they should be learning it. Conveying relevance is important for student learning and retention, especially in science where abstract concepts can often be incorrectly perceived as irrelevant. One way to create an educational link between classroom content and everyday life is through the use of scientific current events. Students read, hear, and watch media coverage of natural events (such as the 2011 earthquake and tsunami in Japan), but do not necessarily relate the scientific information from media sources to classroom studies. Taking advantage of these brief 'teachable moments'--when student interest is high--provides a valuable opportunity to make classroom-to-everyday life associations and to incorporate inquiry based learning. To address this need, I create pre-packaged current event materials for middle to high school teachers that align to state standards, and which are short, effective, and easy to implement in the classroom. Each lesson takes approximately 15-30 minutes to implement, allowing teachers time to facilitate brief but meaningful discussions. I assemble materials within approximately one week of the regional or global science event, consisting of short slide shows, maps, videos, pictures, and real-time data. I use a listserv to send biweekly emails to subscribed instructors containing the current event topic and a link to download the materials. All materials are hosted on the Arizona State University Education Outreach SciNews website (http://sese.asu.edu/teacher-resources) and are archived. Currently, 285 educators subscribe to the SciNews listserv, representing 36 states and 19 countries. In order to assess the effectiveness and usefulness of Sci

  2. SciDAC Center for Gyrokinetic Particle Simulation of Turbulent Transport in Burning Plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Zhihong

    2013-12-18

    During the first year of the SciDAC gyrokinetic particle simulation (GPS) project, the GPS team (Zhihong Lin, Liu Chen, Yasutaro Nishimura, and Igor Holod) at the University of California, Irvine (UCI) studied the tokamak electron transport driven by electron temperature gradient (ETG) turbulence, and by trapped electron mode (TEM) turbulence and ion temperature gradient (ITG) turbulence with kinetic electron effects, extended our studies of ITG turbulence spreading to core-edge coupling. We have developed and optimized an elliptic solver using finite element method (FEM), which enables the implementation of advanced kinetic electron models (split-weight scheme and hybrid model) in the SciDACmore » GPS production code GTC. The GTC code has been ported and optimized on both scalar and vector parallel computer architectures, and is being transformed into objected-oriented style to facilitate collaborative code development. During this period, the UCI team members presented 11 invited talks at major national and international conferences, published 22 papers in peer-reviewed journals and 10 papers in conference proceedings. The UCI hosted the annual SciDAC Workshop on Plasma Turbulence sponsored by the GPS Center, 2005-2007. The workshop was attended by about fifties US and foreign researchers and financially sponsored several gradual students from MIT, Princeton University, Germany, Switzerland, and Finland. A new SciDAC postdoc, Igor Holod, has arrived at UCI to initiate global particle simulation of magnetohydrodynamics turbulence driven by energetic particle modes. The PI, Z. Lin, has been promoted to the Associate Professor with tenure at UCI.« less

  3. A cable-driven locomotor training system for restoration of gait in human SCI.

    PubMed

    Wu, Ming; Hornby, T George; Landry, Jill M; Roth, Heidi; Schmit, Brian D

    2011-02-01

    A novel cable-driven robotic locomotor training system was developed to provide compliant assistance/resistance forces to the legs during treadmill training in patients with incomplete spinal cord injury (SCI). Eleven subjects with incomplete SCI were recruited to participate in two experiments to test the feasibility of the robotic gait training system. Specifically, 10 subjects participated in one experimental session to test the characteristics of the robotic gait training system and one subject participated in repeated testing sessions over 8 weeks with the robotic device to test improvements in locomotor function. Limb kinematics were recorded in one experiment to evaluate the system characteristics of the cable-driven locomotor trainer and the overground gait speed and 6 min walking distance were evaluated at pre, 4 and 8 weeks post treadmill training of a single subject as well. The results indicated that the cable driven robotic gait training system improved the kinematic performance of the leg during treadmill walking and had no significant impact on the variability of lower leg trajectory, suggesting a high backdrivability of the cable system. In addition, results from a patient with incomplete SCI indicated that prolonged robotic gait training using the cable robot improved overground gait speed. Results from this study suggested that a cable driven robotic gait training system is effective in improving leg kinematic performance, yet allows variability of gait kinematics. Thus, it seems feasible to improve the locomotor function in human SCI using this cable driven robotic system, warranting testing with a larger group of patients. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Measuring anxiety after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Anxiety item bank and linkage with GAD-7.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Kalpakjian, Claire Z; Heinemann, Allen W; Pohlig, Ryan T; Carle, Adam; Choi, Seung W

    2015-05-01

    To develop a calibrated item bank and computer adaptive test to assess anxiety symptoms in individuals with spinal cord injury (SCI), transform scores to the Patient Reported Outcomes Measurement Information System (PROMIS) metric, and create a statistical linkage with the Generalized Anxiety Disorder (GAD)-7, a widely used anxiety measure. Grounded-theory based qualitative item development methods; large-scale item calibration field testing; confirmatory factor analysis; graded response model item response theory analyses; statistical linking techniques to transform scores to a PROMIS metric; and linkage with the GAD-7. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Spinal Cord Injury-Quality of Life (SCI-QOL) Anxiety Item Bank Seven hundred sixteen individuals with traumatic SCI completed 38 items assessing anxiety, 17 of which were PROMIS items. After 13 items (including 2 PROMIS items) were removed, factor analyses confirmed unidimensionality. Item response theory analyses were used to estimate slopes and thresholds for the final 25 items (15 from PROMIS). The observed Pearson correlation between the SCI-QOL Anxiety and GAD-7 scores was 0.67. The SCI-QOL Anxiety item bank demonstrates excellent psychometric properties and is available as a computer adaptive test or short form for research and clinical applications. SCI-QOL Anxiety scores have been transformed to the PROMIS metric and we provide a method to link SCI-QOL Anxiety scores with those of the GAD-7.

  5. Does spirituality facilitate adjustment and resilience among individuals and families after SCI?

    PubMed

    Jones, Kate; Simpson, Grahame Kenneth; Briggs, Lynne; Dorsett, Pat

    2016-01-01

    The purpose of this scoping review was to investigate the role of spirituality in facilitating adjustment and resilience after spinal cord injury (SCI) for the individual with SCI and their family members. METHOD-DATA SOURCES: Peer reviewed journals were identified using PsychInfo, MEDLINE, CINAHL, Embase and Sociological Abstracts search engines. After duplicates were removed, 434 abstracts were screened applying inclusion and exclusion criteria. The selected 28 studies were reviewed in detail and grouped according to methodological approach. Of the 28 studies relating to spirituality and related meaning-making constructs, 26 addressed the adjustment of the individual with SCI alone. Only two included family members as participants. Quantitative studies demonstrated that spirituality was positively associated with life satisfaction, quality of life, mental health and resilience. The utilisation of meaning-making and hope as coping strategies in the process of adjustment were highlighted within the qualitative studies. Clinical implications included recommendations that spirituality and meaning-making be incorporated in assessment and interventions during rehabilitation. The use of narratives and peer support was also suggested. Spirituality is an important factor in adjustment after SCI. Further research into the relationship between spirituality, family adjustment and resilience is needed. Higher levels of spirituality were associated with improved quality of life, life satisfaction, mental health, and resilience for individuals affected by spinal cord injury. Health professionals can enhance the role that spirituality plays in spinal rehabilitation by incorporating the spiritual beliefs of individuals and their family members into assessment and intervention. By drawing upon meaning-making tools, such as narrative therapy, incorporating peer support, and assisting clients who report a decline in spirituality, health professionals can provide additional support

  6. SCY-635, a Novel Nonimmunosuppressive Analog of Cyclosporine That Exhibits Potent Inhibition of Hepatitis C Virus RNA Replication In Vitro ▿ †

    PubMed Central

    Hopkins, Sam; Scorneaux, Bernard; Huang, Zhuhui; Murray, Michael G.; Wring, Stephen; Smitley, Craig; Harris, Richard; Erdmann, Frank; Fischer, Gunter; Ribeill, Yves

    2010-01-01

    SCY-635 is a novel nonimmunosuppressive cyclosporine-based analog that exhibits potent suppression of hepatitis C virus (HCV) replication in vitro. SCY-635 inhibited the peptidyl prolyl isomerase activity of cyclophilin A at nanomolar concentrations but showed no detectable inhibition of calcineurin phosphatase activity at concentrations up to 2 μM. Metabolic studies indicated that SCY-635 did not induce the major cytochrome P450 enzymes 1A2, 2B6, and 3A4. SCY-635 was a weak inhibitor and a poor substrate for P-glycoprotein. Functional assays with stimulated Jurkat cells and stimulated human peripheral blood mononuclear cells indicated that SCY-635 is a weaker inhibitor of interleukin-2 secretion than cyclosporine. A series of two-drug combination studies was performed in vitro. SCY-635 exhibited synergistic antiviral activity with alpha interferon 2b and additive antiviral activity with ribavirin. SCY-635 was shown to be orally bioavailable in multiple animal species and produced blood and liver concentrations of parent drug that exceeded the 50% effective dose determined in the bicistronic con1b-derived replicon assay. These results suggest that SCY-635 warrants further investigation as a novel therapeutic agent for the treatment of individuals who are chronically infected with HCV. PMID:19933795

  7. OCCURRENCE AND ORIENTATION OF PARALICHTHID FLOUNDERS (BOTHIDAE: PARALICHTYS) ON AN INTERTIDAL BEACH

    EPA Science Inventory

    Middaugh, Douglas P. and Charles L. McKenney, Jr. 2003. Occurrence and Orientation of Flounders (Bothidae: Paralichthys) on an Intertidal Beach. J. North Carol. Acad. Sci. 119(4):157-171. (ERL,GB 1172).

    The intertidal movement and burying pattern of paralichthid flounders...

  8. Engineering Bony Hybrid Organs In Vitro

    DTIC Science & Technology

    2006-11-01

    microfluidic cell culture system using elastomeric channels and Braille displays (Gu et al., 2004; Futai et al., 2004). We have now further developed this...Takayama S, 2004: Computerized microfluidic cell culture using elastomeric channels and braille displays. Proc. Natl. Acad. Sci. USA 101, 15861-15866

  9. Vaccination of High-Risk Breast Cancer Patients with Carbohydrate Mimicking Peptides

    DTIC Science & Technology

    2007-05-01

    and Wheat germ Agglutin (WGA) while mimotope 106 only reacts with WGA. These lectins see terminal monosaccharides . To demonstrate that autoimmunity...Westerink MAJ, Giardina PC, Apicella MA, Kieber-Emmons T. Pep- tide mimicry of the meningococcal group C capsular polysaccharide . Proc Natl Acad Sci

  10. Local delivery of FTY720 in PCL membrane improves SCI functional recovery by reducing reactive astrogliosis.

    PubMed

    Wang, Junjuan; Wang, Jiaqiu; Lu, Ping; Cai, Youzhi; Wang, Yafei; Hong, Lan; Ren, Hao; Heng, Boon Chin; Liu, Hua; Zhou, Jing; Ouyang, Hongwei

    2015-09-01

    FTY720 has recently been approved as an oral drug for treating relapsing forms of multiple sclerosis, and exerts its therapeutic effect by acting as an immunological inhibitor targeting the sphingosine-1-phosphate (S1P) receptor subtype (S1P1) of T cells. Recently studies demonstrated positive efficacy of this drug on spinal cord injury (SCI) in animal models after systemic administration, albeit with significant adverse side effects. We hereby hypothesize that localized delivery of FTY720 can promote SCI recovery by reducing pathological astrogliosis. The mechanistic functions of FTY720 were investigated in vitro and in vivo utilizing immunofluorescence, histology, MRI and behavioral analysis. The in vitro study showed that FTY720 can reduce astrocyte migration and proliferation activated by S1P. FTY720 can prolong internalization of S1P1 and exert antagonistic effects on S1P1. In vivo study of SCI animal models demonstrated that local delivery of FTY720 with polycaprolactone (PCL) membrane significantly decreased S1P1 expression and glial scarring compared with the control group. Furthermore, FTY720-treated groups exhibited less cavitation volume and neuron loss, which significantly improved recovery of motor function. These findings demonstrated that localized delivery of FTY720 can promote SCI recovery by targeting the S1P1 receptor of astrocytes, provide a new therapeutic strategy for SCI treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Impact of Health Behaviors and Health Management on Employment After SCI: Psychological Health and Health Management.

    PubMed

    Reed, Karla S; Meade, Michelle A; Krause, James S

    2016-01-01

    Objective: The purpose of this study was to examine the relationship between employment and psychological health and health management as described by individuals with spinal cord injury (SCI) who were employed at least once following injury. Methods: A qualitative approach used 6 focus groups at 2 sites with 44 participants who were at least 10 years post SCI. All had been employed at some point since injury. Heterogeneous and homogeneous groups were delineated based on specific characteristics, such as education, gender, or race. Group sessions followed a semi-structured interview format with questions about personal, environmental, and policy related factors influencing employment following SCI. All group sessions were recorded, transcribed, and coded into conceptual categories to identify topics, themes, and patterns. Inferences were drawn about their meaning. NVivo 10 software using the constant comparative method was used for data analysis. Results: Narratives discussed the relationship between employment and psychological and emotional health and health management. Four themes were identified: (1) adjustment and dealing with emotional reactions, (2) gaining self-confidence, (3) preventing burnout, and (4) attitudes and perspectives. Most themes reflected issues that varied based on severity of injury as well as stage of employment. Conclusions: Individuals with SCI who are successful in working following injury must determine how to perform the behaviors necessary to manage their health and prevent emotional or physical complications. The emotional consequences of SCI must be recognized and addressed and specific behaviors enacted in order to optimize employment outcomes.

  12. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

    2015-01-01

    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

  13. Measuring pain phenomena after spinal cord injury: Development and psychometric properties of the SCI-QOL Pain Interference and Pain Behavior assessment tools.

    PubMed

    Cohen, Matthew L; Kisala, Pamela A; Dyson-Hudson, Trevor A; Tulsky, David S

    2018-05-01

    To develop modern patient-reported outcome measures that assess pain interference and pain behavior after spinal cord injury (SCI). Grounded-theory based qualitative item development; large-scale item calibration field-testing; confirmatory factor analyses; graded response model item response theory analyses; statistical linking techniques to transform scores to the Patient Reported Outcome Measurement Information System (PROMIS) metric. Five SCI Model Systems centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. N/A. Spinal Cord Injury - Quality of Life (SCI-QOL) Pain Interference item bank, SCI-QOL Pain Interference short form, and SCI-QOL Pain Behavior scale. Seven hundred fifty-seven individuals with traumatic SCI completed 58 items addressing various aspects of pain. Items were then separated by whether they assessed pain interference or pain behavior, and poorly functioning items were removed. Confirmatory factor analyses confirmed that each set of items was unidimensional, and item response theory analyses were used to estimate slopes and thresholds for the items. Ultimately, 7 items (4 from PROMIS) comprised the Pain Behavior scale and 25 items (18 from PROMIS) comprised the Pain Interference item bank. Ten of these 25 items were selected to form the Pain Interference short form. The SCI-QOL Pain Interference item bank and the SCI-QOL Pain Behavior scale demonstrated robust psychometric properties. The Pain Interference item bank is available as a computer adaptive test or short form for research and clinical applications, and scores are transformed to the PROMIS metric.

  14. Psychological defense mechanisms among individuals with SCI with adjustment disorder.

    PubMed

    Yazdanshenas Ghazwin, Manijeh; Tavakoli, Seyed Amir Hossein; Latifi, Sahar; Saberi, Hooshang; Derakhshanrad, Nazi; Yekaninejad, Mir Saeed; Sadeghi, Majid; Emami Razavi, Seyed-Hassan; Norouzi Javidan, Abbas; Ghodsi, Seyed-Mohammad

    2017-09-01

    The used psychological defense styles among individuals with spinal cord injury (SCI) with adjustment disorders (AJD) have not yet been described. In the present investigation, the prevalence of AJD among people with SCI has been estimated and the pattern of used defense styles has been identified. Cross-sectional investigation. A tertiary rehabilitation center in Iran. Individuals referred to Brain and Spinal Cord Injury Research Center were invited to participate in a screening interview. AJD was diagnosed based on DSM-V criteria. Those with AJD diagnosis were scheduled for another interview to assess defense mechanisms. Demographic and injury-related variables were recorded. Defense mechanisms were assessed by the 40-item version of the Defense-Style Questionnaire (DSQ-40). Among 114 participants, 32 (28%) were diagnosed with AJD among whom 23 subjects attended the second interview. Mean age and time since injury were 29.57 ± 9.29 years and 11.70 ± 6.34 months, respectively. The majority of patients were using idealization defense mechanism (91.3%). In the second and third place, passive aggression (87.0%) and somatization (82.6%) defense mechanisms were observed, respectively. Neurotic style was dominantly used (11.52 ± 2.26). Sex, marital status, educational level, cause of the injury and injury level were not related to defense style (P: 0.38, 0.69, 0.88, 0.73, and P: 0.32, respectively). Prevalence of AJD is estimated to be 28% among individuals with SCI. The most prevalent defense style was neurotic and the dominant used defense mechanism was "idealization." The role of demographic and injury-related variables in determining the used defense mechanisms was insignificant.

  15. Stepping responses to treadmill perturbations vary with severity of motor deficits in human SCI.

    PubMed

    Chu, Virginia Way Tong; Hornby, T George; Schmit, Brian D

    2018-04-18

    In this study, we investigated the responses to tread perturbations during human stepping on a treadmill. Our approach was to test the effects of perturbations to a single leg using a split-belt treadmill in healthy participants and in participants with varying severity of spinal cord injury (SCI). We recruited 11 people with incomplete SCI and 5 noninjured participants. As participants walked on an instrumented treadmill, the belt on one side was stopped or accelerated briefly during mid to late stance. A majority of participants initiated an unnecessary swing when the treadmill was stopped in mid stance, although the likelihood of initiating a step was decreased in participants with more severe SCI. Accelerating or decelerating one belt of the treadmill during stance altered the characteristics of swing. We observed delayed swing initiation when the belt was decelerated (i.e. the hip was in a more flexed position at time of swing) and advanced swing initiation with acceleration (i.e. hip extended at swing initiation). Further, the timing and leg posture of heel strike appeared to remain constant, reflected by a sagittal plane hip angle at heel strike that remained the same regardless of the perturbation. In summary, our results supported the current understanding of the role of sensory feedback and central drive in the control of stepping in participants with incomplete SCI and noninjured participants. In particular, the observation of unnecessary swing during a stop perturbation highlights the interdependence of central and sensory drive in walking control.

  16. Collaborative Science Using Web Services and the SciFlo Grid Dataflow Engine

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Manipon, G.; Xing, Z.; Yunck, T.

    2006-12-01

    The General Earth Science Investigation Suite (GENESIS) project is a NASA-sponsored partnership between the Jet Propulsion Laboratory, academia, and NASA data centers to develop a new suite of Web Services tools to facilitate multi-sensor investigations in Earth System Science. The goal of GENESIS is to enable large-scale, multi-instrument atmospheric science using combined datasets from the AIRS, MODIS, MISR, and GPS sensors. Investigations include cross-comparison of spaceborne climate sensors, cloud spectral analysis, study of upper troposphere-stratosphere water transport, study of the aerosol indirect cloud effect, and global climate model validation. The challenges are to bring together very large datasets, reformat and understand the individual instrument retrievals, co-register or re-grid the retrieved physical parameters, perform computationally-intensive data fusion and data mining operations, and accumulate complex statistics over months to years of data. To meet these challenges, we have developed a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data access, subsetting, registration, mining, fusion, compression, and advanced statistical analysis. SciFlo leverages remote Web Services, called via Simple Object Access Protocol (SOAP) or REST (one-line) URLs, and the Grid Computing standards (WS-* &Globus Alliance toolkits), and enables scientists to do multi-instrument Earth Science by assembling reusable Web Services and native executables into a distributed computing flow (tree of operators). The SciFlo client &server engines optimize the execution of such distributed data flows and allow the user to transparently find and use datasets and operators without worrying about the actual location of the Grid resources. In particular, SciFlo exploits the wealth of datasets accessible by OpenGIS Consortium (OGC) Web Mapping Servers & Web Coverage Servers (WMS/WCS), and by Open Data

  17. Challenges of animal models in SCI research: Effects of pre-injury task-specific training in adult rats before lesion.

    PubMed

    May, Zacnicte; Fouad, Karim; Shum-Siu, Alice; Magnuson, David S K

    2015-09-15

    A rarely explored subject in animal research is the effect of pre-injury variables on behavioral outcome post-SCI. Low reporting of such variables may underlie some discrepancies in findings between laboratories. Particularly, intensive task-specific training before a SCI might be important, considering that sports injuries are one of the leading causes of SCI. Thus, individuals with SCI often underwent rigorous training before their injuries. In the present study, we asked whether training before SCI on a grasping task or a swimming task would influence motor recovery in rats. Swim pre-training impaired recovery of swimming 2 and 4 weeks post-injury. This result fits with the idea of motor learning interference, which posits that learning something new may disrupt learning of a new task; in this case, learning strategies to compensate for functional loss after SCI. In contrast to swimming, grasp pre-training did not influence grasping ability after SCI at any time point. However, grasp pre-trained rats attempted to grasp more times than untrained rats in the first 4 weeks post-injury. Also, lesion volume of grasp pre-trained rats was greater than that of untrained rats, a finding which may be related to stress or activity. The increased participation in rehabilitative training of the pre-trained rats in the early weeks post-injury may have potentiated spontaneous plasticity in the spinal cord and counteracted the deleterious effect of interference and bigger lesions. Thus, our findings suggest that pre-training plays a significant role in recovery after CNS damage and needs to be carefully controlled for. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. The Function of PTP1B in Neuroendocrine Differentation of Prostate Cancer

    DTIC Science & Technology

    2009-01-01

    TCTGTGGCTTCACCACTT TTCTC-30; for b-actin, 50-GCGGGAAATCGTGCGT GACATT-30 and 50-GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ...regenerating cell subpopulation that can initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR

  19. Development of an International Canine Spinal Cord Injury observational registry: a collaborative data-sharing network to optimize translational studies of SCI.

    PubMed

    Moore, Sarah A; Zidan, Natalia; Spitzbarth, Ingo; Nout-Lomas, Yvette S; Granger, Nicolas; da Costa, Ronaldo C; Levine, Jonathan M; Jeffery, Nick D; Stein, Veronika M; Tipold, Andrea; Olby, Natasha J

    2018-05-23

    Prospective cross-sectional cohort study. The canine spontaneous model of spinal cord injury (SCI) is as an important pre-clinical platform as it recapitulates key facets of human injury in a naturally occurring context. The establishment of an observational canine SCI registry constitutes a key step in performing epidemiologic studies and assessing the impact of therapeutic strategies to enhance translational research. Further, accumulating information on dogs with SCI may contribute to current "big data" approaches to enhance understanding of the disease using heterogeneous multi-institutional, multi-species datasets from both pre-clinical and human studies. Multiple veterinary academic institutions across the United States and Europe. Common data elements recommended for experimental and human SCI studies were reviewed and adapted for use in a web-based registry, to which all dogs presenting to member veterinary tertiary care facilities were prospectively entered over ~1 year. Analysis of data accumulated during the first year of the registry suggests that 16% of dogs with SCI present with severe, sensorimotor-complete injury and that 15% of cases are seen by a tertiary care facility within 8 h of injury. Similar to the human SCI population, 34% were either overweight or obese. Severity of injury and timing of presentation suggests that neuroprotective studies using the canine clinical model could be conducted efficiently using a multi-institutional approach. Additionally, pet dogs with SCI experience similar comorbidities to people with SCI, in particular obesity, and could serve as an important model to evaluate the effects of this condition.

  20. Energy for Living. Study Guide. Unit G1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide includes activities and…

  1. Reproducing by Flowers and Seeds. Study Guide. Unit E2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Zesaguli, Josie

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and environmental laboratories. This ZIM-SCI study guide consists of…

  2. Our Planet Earth. Teacher's Guide. Unit F1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities,…

  3. Differential Activity of the Oral Glucan Synthase Inhibitor SCY-078 against Wild-Type and Echinocandin-Resistant Strains of Candida Species.

    PubMed

    Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana

    2017-08-01

    SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.

  4. Final Report for DOE Project: Portal Web Services: Support of DOE SciDAC Collaboratories

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mary Thomas, PI; Geoffrey Fox, Co-PI; Gannon, D

    2007-10-01

    Grid portals provide the scientific community with familiar and simplified interfaces to the Grid and Grid services, and it is important to deploy grid portals onto the SciDAC grids and collaboratories. The goal of this project is the research, development and deployment of interoperable portal and web services that can be used on SciDAC National Collaboratory grids. This project has four primary task areas: development of portal systems; management of data collections; DOE science application integration; and development of web and grid services in support of the above activities.

  5. Boolean networks with veto functions

    NASA Astrophysics Data System (ADS)

    Ebadi, Haleh; Klemm, Konstantin

    2014-08-01

    Boolean networks are discrete dynamical systems for modeling regulation and signaling in living cells. We investigate a particular class of Boolean functions with inhibiting inputs exerting a veto (forced zero) on the output. We give analytical expressions for the sensitivity of these functions and provide evidence for their role in natural systems. In an intracellular signal transduction network [Helikar et al., Proc. Natl. Acad. Sci. USA 105, 1913 (2008), 10.1073/pnas.0705088105], the functions with veto are over-represented by a factor exceeding the over-representation of threshold functions and canalyzing functions in the same system. In Boolean networks for control of the yeast cell cycle [Li et al., Proc. Natl. Acad. Sci. USA 101, 4781 (2004), 10.1073/pnas.0305937101; Davidich et al., PLoS ONE 3, e1672 (2008), 10.1371/journal.pone.0001672], no or minimal changes to the wiring diagrams are necessary to formulate their dynamics in terms of the veto functions introduced here.

  6. The chimeric VirA-tar receptor protein is locked into a highly responsive state.

    PubMed Central

    Turk, S C; van Lange, R P; Sonneveld, E; Hooykaas, P J

    1993-01-01

    The wild-type VirA protein is known to be responsive not only to phenolic compounds but also to sugars via the ChvE protein (G. A. Cangelosi, R. G. Ankenbauer, and E. W. Nester, Proc. Natl. Acad. Sci. USA 87:6708-6712, 1990, and N. Shimoda, A. Toyoda-Yamamoto, J. Nagamine, S. Usami, M. Katayama, Y. Sakagami, and Y. Machida, Proc. Natl. Acad. Sci. USA 87:6684-6688, 1990). It is shown here that the mutant VirA(Ser-44, Arg-45) protein and the chimeric VirA-Tar protein are no longer responsive to sugars and the ChvE protein. However, whereas the chimeric VirA-Tar protein was found to be locked in a highly responsive state, the VirA(Ser-44, Arg-45) mutant protein appeared to be locked in a low responsive state. This difference turned out to be important for tumorigenicity of the host strains in virulence assays on Kalanchoë daigremontiana. Images PMID:8366057

  7. Influence of socio-economic status on access to different components of SCI management across Indian population.

    PubMed

    Chhabra, H S; Bhalla, A M

    2015-11-01

    To assess the influence of financial constraints on access to different components of spinal cord injury (SCI) management in various socio-economic strata of the Indian population. Indian Spinal Injuries Centre (ISIC). One hundred fifty SCI individuals who came for follow-up at ISIC between March 2009 and March 2013 with at least 1 year of community exposure after discharge were included in the study. Socio-economic classification was carried out according to the Kuppuswamy scale, a standard scale for the Indian population. A self-designed questionnaire was administered. No sample was available from the lower group. There was a statistically significant difference (P<0.05) for the levels of difficulty perceived by different socio-economic groups in accessing different components of SCI management. Aided upper lower group was dependent on welfare schemes for in-hospital treatment but could not access other components of management once discharged. Unaided upper lower group either faced severe difficulty or could not access management. Majority of lower middle group faced severe difficulty. Upper middle group was equally divided into facing severe, moderate or no difficulty. Most patients in the upper group faced no difficulty, whereas some faced moderate and a small number of severe difficulty. Financial constraints affected all components of SCI management in all except the upper group. The results of the survey suggest that a very large percentage of the Indian population would find it difficult to access comprehensive SCI management and advocate extension of essential medical coverage to unaided upper lower, lower middle and upper middle groups.

  8. Transporter Protein-Coupled DPCPX Nanoconjugates Induce Diaphragmatic Recovery after SCI by Blocking Adenosine A1 Receptors.

    PubMed

    Minic, Zeljka; Zhang, Yanhua; Mao, Guangzhao; Goshgarian, Harry G

    2016-03-23

    Respiratory complications in patients with spinal cord injury (SCI) are common and have a negative impact on the quality of patients' lives. Systemic administration of drugs that improve respiratory function often cause deleterious side effects. The present study examines the applicability of a novel nanotechnology-based drug delivery system, which induces recovery of diaphragm function after SCI in the adult rat model. We developed a protein-coupled nanoconjugate to selectively deliver by transsynaptic transport small therapeutic amounts of an A1 adenosine receptor antagonist to the respiratory centers. A single administration of the nanoconjugate restored 75% of the respiratory drive at 0.1% of the systemic therapeutic drug dose. The reduction of the systemic dose may obviate the side effects. The recovery lasted for 4 weeks (the longest period studied). These findings have translational implications for patients with respiratory dysfunction after SCI. The leading causes of death in humans following SCI are respiratory complications secondary to paralysis of respiratory muscles. Systemic administration of methylxantines improves respiratory function but also leads to the development of deleterious side effects due to actions of the drug on nonrespiratory sites. The importance of the present study lies in the novel drug delivery approach that uses nanotechnology to selectively deliver recovery-inducing drugs to the respiratory centers exclusively. This strategy allows for a reduction in the therapeutic drug dose, which may reduce harmful side effects and markedly improve the quality of life for SCI patients. Copyright © 2016 the authors 0270-6474/16/363441-12$15.00/0.

  9. Locomotor activity of rats with SCI is improved by dexmedetomidine by targeting the expression of inflammatory factors.

    PubMed

    Wang, Wei-Guo; Wang, Lin; Jiao, Zhen-Hua; Xue, Bin; Xu, Zhan-Wang

    2018-04-26

    Dexmedetomidine, a well‑known selective α‑2 adrenoceptor agonist, inhibits the apoptosis of neurons and protects other organs from oxidative damage. In the present study, the effect of dexmedetomidine on spinal cord injury (SCI) in a rat model was investigated. The SCI rat model was prepared using the weight‑drop method, and the effect of dexmedetomidine on locomotor activity was analyzed using the Basso, Beattie and Bresnahan (BBB) rating scale. Western blot analysis was used to observe changes in the expression of apoptosis‑related proteins, including B‑cell lymphoma 2 (Bcl‑2) and Bcl‑2‑associated X protein (Bax). The results revealed that treatment of the SCI rats with dexmedetomidine at a dose of 50 mg/kg significantly prevented the formation of edema in the tissues of the spinal cord. Dexmedetomidine also inhibited the SCI‑induced accumulation of neutrophils in the spinal cord. The BBB scores were significantly increased (P<0.05) in the rats with SCI treated with dexmedetomidine after 10 days. The results of grid walking test revealed a marked decrease in the number of missteps following 10 days of dexmedetomidine treatment. The expression levels of tumor necrosis factor (TNF)‑α and interleukin (IL)‑1β were significantly reduced (P<0.05) in the spinal cord tissues of the dexmedetomidine group, compared with those in the control group of rats. Dexmedetomidine treatment following SCI exerted an inhibitory effect on the SCI‑induced increase in the expression of Bax. The expression of Bcl‑2 was increased in the dexmedetomidine treated rats, compared with that in the control group. Taken together, dexmedetomidine improved the locomotor activity of the rats through the inhibition of edema, reduction in the expression levels of TNF‑α and IL‑1β, and inhibition of the induction of apoptosis. Therefore, dexmedetomidine may be of therapeutic importance for patients with SCI.

  10. Measurement of the absolute v μ-CCQE cross section at the SciBooNE experiment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aunion, Jose Luis Alcaraz

    2010-07-01

    This thesis presents the measurement of the charged current quasi-elastic (CCQE) neutrino-nucleon cross section at neutrino energies around 1 GeV. This measurement has two main physical motivations. On one hand, the neutrino-nucleon interactions at few GeV is a region where existing old data are sparse and with low statistics. The current measurement populates low energy regions with higher statistics and precision than previous experiments. On the other hand, the CCQE interaction is the most useful interaction in neutrino oscillation experiments. The CCQE channel is used to measure the initial and final neutrino fluxes in order to determine the neutrino fractionmore » that disappeared. The neutrino oscillation experiments work at low neutrino energies, so precise measurement of CCQE interactions are essential for flux measurements. The main goal of this thesis is to measure the CCQE absolute neutrino cross section from the SciBooNE data. The SciBar Booster Neutrino Experiment (SciBooNE) is a neutrino and anti-neutrino scattering off experiment. The neutrino energy spectrum works at energies around 1 GeV. SciBooNE was running from June 8th 2007 to August 18th 2008. In that period, the experiment collected a total of 2.65 x 10 20 protons on target (POT). This thesis has used full data collection in neutrino mode 0.99 x 10 20 POT. A CCQE selection cut has been performed, achieving around 70% pure CCQE sample. A fit method has been exclusively developed to determine the absolute CCQE cross section, presenting results in a neutrino energy range from 0.2 to 2 GeV. The results are compatible with the NEUT predictions. The SciBooNE measurement has been compared with both Carbon (MiniBoonE) and deuterium (ANL and BNL) target experiments, showing a good agreement in both cases.« less

  11. Sleep-Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2014-10-01

    SCI. In this prospective randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using...portable sleep studies, and systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize...randomized shortly. 15. SUBJECT TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a

  12. SciBox, an end-to-end automated science planning and commanding system

    NASA Astrophysics Data System (ADS)

    Choo, Teck H.; Murchie, Scott L.; Bedini, Peter D.; Steele, R. Josh; Skura, Joseph P.; Nguyen, Lillian; Nair, Hari; Lucks, Michael; Berman, Alice F.; McGovern, James A.; Turner, F. Scott

    2014-01-01

    SciBox is a new technology for planning and commanding science operations for Earth-orbital and planetary space missions. It has been incrementally developed since 2001 and demonstrated on several spaceflight projects. The technology has matured to the point that it is now being used to plan and command all orbital science operations for the MErcury Surface, Space ENvironment, GEochemistry, and Ranging (MESSENGER) mission to Mercury. SciBox encompasses the derivation of observing sequences from science objectives, the scheduling of those sequences, the generation of spacecraft and instrument commands, and the validation of those commands prior to uploading to the spacecraft. Although the process is automated, science and observing requirements are incorporated at each step by a series of rules and parameters to optimize observing opportunities, which are tested and validated through simulation and review. Except for limited special operations and tests, there is no manual scheduling of observations or construction of command sequences. SciBox reduces the lead time for operations planning by shortening the time-consuming coordination process, reduces cost by automating the labor-intensive processes of human-in-the-loop adjudication of observing priorities, reduces operations risk by systematically checking constraints, and maximizes science return by fully evaluating the trade space of observing opportunities to meet MESSENGER science priorities within spacecraft recorder, downlink, scheduling, and orbital-geometry constraints.

  13. Quantitative in Situ Assessment of the Somatostatin Receptor in Breast Cancer to Assess Response to Targeted Therapy with 111-In-Pentetreotide

    DTIC Science & Technology

    2005-05-01

    chondrosarcoma . Clin Nuc Med 1996 ;21 :1008-9 . 25. Redding TW, Schally AV . Inhibition of growth of the transplantable rat chondrosarcoma by analogs of...hypothalami c hormones . P Nat Acad Sci USA 1983 ;80 :1078-82 . 26. Reubi JC . A somatostatin analogue inhibits chondrosarcoma an d insulinoma tumor

  14. Mechanism of Prostate Cancer Prevention by Down-Regulation of the GH/IGF Axis

    DTIC Science & Technology

    2012-07-01

    apoptosis. Recent clinical trials indicate that elevated circulating IGF-I confers an increased risk for the development of prostate cancer. Our...hormone gene suppresses growth of transgenic mice. Proc Natl Acad Sci U S A 1990;87:5061-5. [6] Kopchick JJ, Parkinson C, Stevens EC, Trainer PJ. Growth

  15. Genetics Home Reference: carbonic anhydrase VA deficiency

    MedlinePlus

    ... implicates both enzymes in ammonia detoxification and glucose metabolism. Proc Natl Acad Sci U S A. 2013 Apr 30;110(18):7423-8. doi: 10.1073/pnas.1305805110. Epub 2013 Apr 15. Citation on PubMed or Free article on PubMed Central Sly WS, Hu PY. Human ...

  16. The gap of the area-weighted Motzkin spin chain is exponentially small

    NASA Astrophysics Data System (ADS)

    Levine, Lionel; Movassagh, Ramis

    2017-06-01

    We prove that the energy gap of the model proposed by Zhang et al (2016 arXiv:1606.07795) is exponentially small in the square of the system size. In Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) a class of exactly solvable quantum spin chain models was proposed that have integer spins (s), with a nearest neighbors Hamiltonian, and a unique ground state. The ground state can be seen as a uniform superposition of all s-colored Motzkin walks. The half-chain entanglement entropy provably violates the area law by a square root factor in the system’s size (˜\\sqrt{n} ) for s  >  1. For s  =  1, the violation is logarithmic (Bravyi et al 2012 Phys. Rev. Lett. 109 207202). Moreover in Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) it was proved that the gap vanishes polynomially and is O(n -c ) with c≥slant2 . Recently, a deformation of Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA), which we call ‘weighted Motzkin quantum spin chain’ was proposed Zhang et al (2016 arXiv:1606.07795). This model has a unique ground state that is a superposition of the s-colored Motzkin walks weighted by tarea\\{Motzkin walk\\} with t  >  1. The most surprising feature of this model is that it violates the area law by a factor of n. Here we prove that the gap of this model is upper bounded by 8ns t-n2/3 for t  >  1 and s  >  1.

  17. CitSci.org: A New Model for Managing, Documenting, and Sharing Citizen Science Data

    PubMed Central

    Wang, Yiwei; Kaplan, Nicole; Newman, Greg; Scarpino, Russell

    2015-01-01

    Citizen science projects have the potential to advance science by increasing the volume and variety of data, as well as innovation. Yet this potential has not been fully realized, in part because citizen science data are typically not widely shared and reused. To address this and related challenges, we built CitSci.org (see www.citsci.org), a customizable platform that allows users to collect and generate diverse datasets. We hope that CitSci.org will ultimately increase discoverability and confidence in citizen science observations, encouraging scientists to use such data in their own scientific research. PMID:26492521

  18. CitSci.org: A New Model for Managing, Documenting, and Sharing Citizen Science Data.

    PubMed

    Wang, Yiwei; Kaplan, Nicole; Newman, Greg; Scarpino, Russell

    2015-10-01

    Citizen science projects have the potential to advance science by increasing the volume and variety of data, as well as innovation. Yet this potential has not been fully realized, in part because citizen science data are typically not widely shared and reused. To address this and related challenges, we built CitSci.org (see www.citsci.org), a customizable platform that allows users to collect and generate diverse datasets. We hope that CitSci.org will ultimately increase discoverability and confidence in citizen science observations, encouraging scientists to use such data in their own scientific research.

  19. A pilot study to evaluate the role of the Spinal Cord Impairment Pressure Ulcer Monitoring Tool (SCI-PUMT) in clinical decisions for pressure ulcer treatment.

    PubMed

    Thomason, Susan S; Graves, Barbara Ann; Madaris, Linda

    2014-12-01

    The Spinal Cord Impairment Pressure Ulcer Monitoring Tool (SCI-PUMT) was designed to assess pressure ulcer (PrU) healing in the spinal cord impaired (SCI) population. The tool contains 7 variables: wound surface area, depth, edges, tunneling, undermining, exudate type, and necrotic tissue amount. A 2-phased, quantitative pilot study based on the Theory of Reasoned Action and Theory of Planned Behavior was conducted at a large SCI/Disorders Center in the Department of Veterans Affairs (VA). In the first phase of the study, a convenience sample of 5 physicians, 3 advanced practice registered nurses, and 3 certified wound care nurses (CWCN) was surveyed using a 2-part questionnaire to assess use of the SCI-PUMT instrument, its anticipated improvement in PrU assessment, and intent to use the SCI-PUMT in clinical practice. Attitudes, subjective norms, perceived behavioral controls, and barriers related to the intent to use the SCI-PUMT were evaluated using a 5-point Likert scale (range: 1= extremely likely, 5 = extremely unlikely). In the second phase of the study, the electronic health records (EHR) of 24 veterans (with 30 PrUs) who had at least 2 completed SCI-PUMT scores during a 4-week period were used to evaluate whether an association existed between magnitudes of change of total SCI-PUMT scores and ordered changes in PrU treatment. The overall mean score for intent to use SCI-PUMT was 1.80 (SD 0.75). The least favorable scores were for convenience and motivation to use the SCI-PUMT. Analysis of EHR data showed no significant difference in magnitudes of change in the SCI-PUMT score and changes in PrU treatment recommendations made by the CWCNs. The significance was not affected regardless of an increase or no change in the score (χ2 with 1 degree of freedom = 1.158, P = 0.282) or for a decrease in the score (χ2 with 1 degree of freedom = 0.5, P = 0.478). In this pilot study, the expressed intent to use the SCI-PUMT in making clinical decisions was generally

  20. Online Registries for Researchers: Using ORCID and SciENcv.

    PubMed

    Vrabel, Mark

    2016-12-01

    The Open Researcher and Contributor ID (ORCID) registry helps resolve name ambiguity by assigning persistent unique identifiers that automatically link to a researcher's publications, grants, and other activities. This article provides an overview of ORCID and its benefits, citing several examples of its use in cancer and nursing journals. The article also briefly describes My NCBI and the Science Experts Network Curriculum Vitae (SciENcv) and its connection to ORCID.

  1. Forces in Living Things. Study Guide. Unit H2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty; Zesaguli, Josie

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  2. Development of an evidence-informed leisure time physical activity resource for adults with spinal cord injury: the SCI Get Fit Toolkit.

    PubMed

    Arbour-Nicitopoulos, K P; Martin Ginis, K A; Latimer-Cheung, A E; Bourne, C; Campbell, D; Cappe, S; Ginis, S; Hicks, A L; Pomerleau, P; Smith, K

    2013-06-01

    To systematically develop an evidence-informed leisure time physical activity (LTPA) resource for adults with spinal cord injury (SCI). Canada. The Appraisal of Guidelines, Research and Evaluation (AGREE) II protocol was used to develop a toolkit to teach and encourage adults with SCI how to make smart and informed choices about being physically active. A multidisciplinary expert panel appraised the evidence and generated specific recommendations for the content of the toolkit. Pilot testing was conducted to refine the toolkit's presentation. Recommendations emanating from the consultation process were that the toolkit be a brief, evidence-based resource that contains images of adults with tetraplegia and paraplegia, and links to more detailed online information. The content of the toolkit should include the physical activity guidelines (PAGs) for adults with SCI, activities tailored to manual and power chair users, the benefits of LTPA, and strategies to overcome common LTPA barriers for adults with SCI. The inclusion of action plans and safety tips was also recommended. These recommendations have resulted in the development of an evidence-informed LTPA resource to assist adults with SCI in meeting the PAGs. This toolkit will have important implications for consumers, health care professionals and policy makers for encouraging LTPA in the SCI community.

  3. 75 FR 66104 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-27

    ... receptor gene exhibit impaired growth and resistance to thyroid hormone. Proc Natl Acad Sci U S A. 2000 Nov... overactivated. These mice have a knock-in dominantly negative mutant thyroid hormone receptor [beta] gene (TR... mutation in the thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse model...

  4. Effect of Dietary Intervention on Prostate Tumor Development in TRAMP Mice

    DTIC Science & Technology

    2006-05-01

    Proc.Natl.Acad.Sci.USA, 92, 3439-3443. 5. Gingrich,J.R., Barrios ,R.J., Morton,R.A., Boyce,B.F., DeMayo,F.J., Finegold,M.J., Angelopoulou,R., Rosen,J.M...the research effort Margot P. Cleary, Principal Investigator Michael Grossmann, Research Associate Patricia Grambsch, Statistician Olga Rogozin

  5. Exploiting for Breast Cancer Control a Proposed Unified Mechanism for Reduction of Human Breast Cancer Risk by the Hormones of Pregnancy

    DTIC Science & Technology

    2007-05-01

    Thordarson G, Chen X, Nandi S. Hormonal prevention of breast cancer: mimicking the protective effect of pregnancy. Proc Natl Acad Sci U S A. 1999 Mar...2;96(5):2520-5. 4. Rajkumar L, Guzman RC, Yang J, Thordarson G, Talamantes F, Nandi S. Prevention of mammary carcinogenesis by short-term

  6. Bibliometric analysis of the Korean Journal of Parasitology: measured from SCI, PubMed, Scopus, and Synapse databases.

    PubMed

    Lee, Choon Shil

    2009-10-01

    The Korean Journal of Parasitology (KJP) is the official journal of the Korean Society for Parasitology which is celebrating its 50th anniversary in 2009. To assess the contributions and achievements of the KJP, bibliometric analysis was conducted based on the citation data retrieved from 4 major databases; SCI, PubMed, Synapse, and Scopus. It was found that the KJP articles were constantly cited by the articles published in major international journals represented in these databases. More than 60% of 1,370 articles published in the KJP from 1963 to June 2009 were cited at least once by SCI articles. The overall average times cited by SCI articles are 2.6. The rate is almost 3 times higher for the articles published in the last 10 years compared to 1.0 for the articles of the 1960s. The SCI journal impact factor for 2008 is calculated as 0.871. It is increasing and it is expected to increase further with the introduction of the KJP in the database in 2008. The more realistic h-indices were measured from the study data set covering all the citations to the KJP; 17 for SCI, 6 for PubMed, 19 for Synapse, and 17 for Scopus. Synapse extensively picked up the citations to the earlier papers not retrievable from the other 3 databases. It identified many papers published in the 1960s and in the 1980s which have been cited heavily, proving the central role of the KJP in the dissemination of the important research findings over the last 5 decades.

  7. With a little help from my friends: social support and mental health in SCI caregivers from Neiva, Colombia.

    PubMed

    Morlett-Paredes, Alejandra; Perrin, Paul B; Olivera, Silvia Leonor; Rogers, Heather L; Perdomo, Jose Libardo; Arango, Jose Anselmo; Arango-Lasprilla, Juan Carlos

    2014-01-01

    The purpose of this study was to examine the influence of appraisal, belonging, and tangible social support on the mental health (depression, satisfaction with life, anxiety, and burden) of Colombian spinal cord injury (SCI) caregivers. Forty SCI caregivers from Neiva, Colombia completed questionnaires assessing their perceived social support and mental health. Four multiple regressions found that the three social support variables explained 42.8% of the variance in caregiver depression, 22.3% of the variance in satisfaction with life, 24.1% of the variance in anxiety, and 16.5% of the variance in burden, although the effect on burden was marginally significant. Within these regressions, higher belonging social support was uniquely associated with lower depression, and higher tangible social support was uniquely associated with higher caregiver satisfaction with life. Social support may have a particularly important influence on SCI caregiver mental health in Colombia, due in part to the high levels of collectivism and strong family values shown to exist in Latin America, and may therefore be an important target for SCI caregiver interventions in this region.

  8. Comparing NetCDF and SciDB on managing and querying 5D hydrologic dataset

    NASA Astrophysics Data System (ADS)

    Liu, Haicheng; Xiao, Xiao

    2016-11-01

    Efficiently extracting information from high dimensional hydro-meteorological modelling datasets requires smart solutions. Traditional methods are mostly based on files, which can be edited and accessed handily. But they have problems of efficiency due to contiguous storage structure. Others propose databases as an alternative for advantages such as native functionalities for manipulating multidimensional (MD) arrays, smart caching strategy and scalability. In this research, NetCDF file based solutions and the multidimensional array database management system (DBMS) SciDB applying chunked storage structure are benchmarked to determine the best solution for storing and querying 5D large hydrologic modelling dataset. The effect of data storage configurations including chunk size, dimension order and compression on query performance is explored. Results indicate that dimension order to organize storage of 5D data has significant influence on query performance if chunk size is very large. But the effect becomes insignificant when chunk size is properly set. Compression of SciDB mostly has negative influence on query performance. Caching is an advantage but may be influenced by execution of different query processes. On the whole, NetCDF solution without compression is in general more efficient than the SciDB DBMS.

  9. [Summarization and analysis on the acupuncture-related articles published in science citation index (SCI) periodicals in 2005].

    PubMed

    Yang, Jia-Yue; Wu, Li-Ping; Guo, Yi

    2007-04-01

    To retrieve, summarize and analyze journals and articles related to acupuncture published in SCI periodicals in 2005, so as to understand the international dynamics about acupuncture researches. The articles about treatment and mechanisms of acupuncture published in SCI periodicals in 2005 were found out and searched for by acupuncture information retrieval online and databank. Most of the 72 SCI periodicals retrieved are from the west, with 147 articles of acupuncture published, and Lancet has the highest impact factors of 23. 407. The kinds of the journals and articles publishing acupuncture researches are increasing, with varied types, rich and varied contents, and increasing the design level. However, the results of the studies are vastly different due to differences of experimental methods, objects and acupuncture manipulations. Therefore, standardization of acupuncture studies is extremely urgent.

  10. "Sci-Tech - Couldn't be without it !"

    NASA Astrophysics Data System (ADS)

    2002-03-01

    Launch of a Major European Outreach Programme Seven of Europe's leading Research Organizations [1] launch joint outreach programme for the European Science and Technology Week at the Technopolis Museum in Brussels on 22 March. Their aim is to show Europeans how today's society couldn't be without fundamental research . Could you imagine life without mobile phones, cars, CD players, TV, refrigerators, computers, the internet and the World Wide Web, antibiotics, vitamins, anaesthetics, vaccination, heating, pampers, nylon stockings, glue, bar codes, metal detectors, contact lenses, modems, laser printers, digital cameras, gameboys, play stations...? Technology is everywhere and used by everyone in today's society, but how many Europeans suspect that without studies on the structure of the atom, lasers would not exist, and neither would CD players? Most do not realise that most things they couldn't be without have required years of fundamental research . To fill this knowledge gap, the leading Research Organizations in Europe [1], with the support of the research directorate of the European Commission, have joined forces to inform Europeans how technology couldn't be without science, and how science can no longer progress without technology. The project is called...... Sci-Tech - Couldn't be without it! Sci-Tech - Couldn't be without it! invites Europeans to vote online in a survey to identify the top ten technologies they can't live without. It will show them through a dynamic and entertaining Web space where these top technologies really come from, and it will reveal their intimate links with research. Teaching kits will be developed to explain to students how their favourite gadgets actually work, and how a career in science can contribute to inventions that future generations couldn't be without. The results of the survey will be presented as a series of quiz shows live on the Internet during the Science Week, from 4 to 10 November. Sci-tech - Couldn't be without

  11. Health related quality of life and mental health in children with SCI/D from Neiva, Colombia.

    PubMed

    Leibach, Gillian G; Perrin, Paul B; Nicholls, Elizabeth; Leonor Olivera, Silvia; Medina Quintero, Lorena; Mauricio Velasco Trujillo, Diego; Carlos Arango-Lasprilla, Juan

    2015-01-01

    To date, no research has been published on the health related quality of life (HRQOL) and mental health of children with spinal cord injury and disorders (SCI/D) in Latin America, although limited previous research in Western countries has demonstrated the debilitating and chronic nature of these conditions in children. The aim was to examine the connections between HRQOL and mental health in children with SCI/D from Neiva, Colombia. Thirty children (8- 17 years) were recruited from the Hospital Universatario Hernando Mocaleano Perdomo in Neiva, Colombia. Participants completed self-report measures administered verbally by trained research staff. A correlation matrix generally suggested that higher HRQOL was robustly associated with better mental health. A series of multiple regressions found that HRQOL explained 50.5% of the variance in children's depression, 31.5% of the variance in worry, and 41.9% of the variance in social anxiety. Within these regressions, emotional and social functioning were uniquely associated with depression, and emotional functioning was uniquely associated with social anxiety. This is the first published study to examine psychosocial outcomes in children with SCI/D in Latin America, and its findings suggest that future research and interventions for children with SCI/D in Colombia - and possibly in other regions of Latin America - would benefit from emphasizing emotional and social functioning.

  12. The novel oral glucan synthase inhibitor SCY-078 shows in vitro activity against sessile and planktonic Candida spp.

    PubMed

    Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús

    2017-07-01

    We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P  <0.001). In contrast, SCY-078 and micafungin showed essentially the same activity against the biofilms with the exception of Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P  <0.001). These observations were confirmed by assessing biofilm structure by scanning electron microscopy after antifungal treatment. Our study showed that the high in vitro activity of SCY-078 against invasive Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. SciSpark: Highly Interactive and Scalable Model Evaluation and Climate Metrics

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Palamuttam, R. S.; Mogrovejo, R. M.; Whitehall, K. D.; Mattmann, C. A.; Verma, R.; Waliser, D. E.; Lee, H.

    2015-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark under a NASA AIST grant (PI Mattmann). Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based ApacheTM Hadoop by 100x in memory and by 10x on disk. SciSpark will enable scalable model evaluation by executing large-scale comparisons of A-Train satellite observations to model grids on a cluster of 10 to 1000 compute nodes. This 2nd generation capability for NASA's Regional Climate Model Evaluation System (RCMES) will compute simple climate metrics at interactive speeds, and extend to quite sophisticated iterative algorithms such as machine-learning based clustering of temperature PDFs, and even graph-based algorithms for searching for Mesocale Convective Complexes. We have implemented a parallel data ingest capability in which the user specifies desired variables (arrays) as several time-sorted lists of URL's (i.e. using OPeNDAP model.nc?varname, or local files). The specified variables are partitioned by time/space and then each Spark node pulls its bundle of arrays into memory to begin a computation pipeline. We also investigated the performance of several N-dim. array libraries (scala breeze, java jblas & netlib-java, and ND4J). We are currently developing science codes using ND4J and studying memory behavior on the JVM. On the pyspark side, many of our science codes already use the numpy and SciPy ecosystems. The talk will cover: the architecture of SciSpark, the design of the scientific RDD (sRDD) data structure, our

  14. A Program Design To Motivate Individuals with SCI for Self-Care.

    ERIC Educational Resources Information Center

    Scotzin, Martha

    The report compares a skin care education program with a standard rehabilitation program to determine whether the program improved the self care motivations of spinal cord injury (SCI) paraplegic and quadriplegic inpatients (N=42). Study findings suggest that the skin care educational program was successful in changing patients' thinking about…

  15. Plasminogen Activator Inhibitor: A Regulator of Ancrod-Induced Fibrin Deposition in Rabbits

    DTIC Science & Technology

    1987-03-01

    Acad Sci Invest 51:2841. 1972 82:8710. 1985 15. Alving BM, Evait BI., Bell WR: Stimulation of librinogen 4. Colucci M, Paramo JA. Collen D: Generation in... Paramo IA. Stassen .1M. Collen ): Influence of 1986 the fast-acting inhibitor on in vivo thrombolysis induced b, tissue- 7. Wiman B. Ljungberg B

  16. Control of Growth Within Drosophila Peripheral Nerves by Ras and Protein Kinase A

    DTIC Science & Technology

    2009-02-01

    channel gene on behavior and axonal excitability. Genetics 124: 133– 143 . 20. Chouinard SW, Wilson GF, Schlimgen AK, Ganetzky B (1995) A potassium...channel beta subunit related to the aldo- keto reductase superfamily is encoded by the Drosophila hyperkinetic locus. Proc Natl Acad Sci U S A 92: 6763–6767

  17. Genetics Home Reference: megacystis-microcolon-intestinal hypoperistalsis syndrome

    MedlinePlus

    ... mice. Proc Natl Acad Sci U S A. 2017 Mar 28;114(13):E2739-E2747. doi: 10.1073/pnas.1620507114. Epub 2017 Mar 14. Citation on PubMed or Free article on ... megacystis-microcolon-intestinal hypoperistalsis syndrome. PLoS Genet. 2014 Mar 27;10(3):e1004258. doi: 10.1371/journal. ...

  18. Isolating a Cell Maximally Secreting Acetylcholinesterase

    DTIC Science & Technology

    1985-04-01

    have been obtained through a researh collaboration with Novo Laboratories in Denmark for characterization of antigens found in the different forms of...Biochem. M33, 450-456. 5. Soreq, H., Pavari, R. and Silman, I. (1982) Proc. Natl. Acad. Sci. USA I9, 830-834. 6. Silver, A. (1974) The Biology of

  19. Apoptosis and Tumor Progressionin Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    control. Proc Natl Acad Sci USA 94: 10057- 10062 . 5. Colombel M, Symmans F, et al. (1993): Detection of the apoptosis-suppressing oncoprotein bcl-2 in...hours prior to treatment. After treatment, cells were washed with phosphate buffered saline ( PBS ) and fixed in 500 [tL 0.2% glutaraldehyde in water for

  20. ADP Regulates the Structure and Function of the Protein KaiC

    DTIC Science & Technology

    2016-08-11

    J. S., Lee, Y., Kang, S., Lee, D., Li, S., Britt, R. D., Rust , M., J., Golden, S., S., LiWang, A. (2015) A protein fold switch joins the circadian... Rust , M.J. (2013). Robust and tunable circadian rhythms from differentially sensitive catalytic domains. Proc. Natl. Acad. Sci. USA 110, 1124- 1129

  1. SciEthics Interactive: Science and Ethics Learning in a Virtual Environment

    ERIC Educational Resources Information Center

    Nadolny, Larysa; Woolfrey, Joan; Pierlott, Matthew; Kahn, Seth

    2013-01-01

    Learning in immersive 3D environments allows students to collaborate, build, and interact with difficult course concepts. This case study examines the design and development of the TransGen Island within the SciEthics Interactive project, a National Science Foundation-funded, 3D virtual world emphasizing learning science content in the context of…

  2. The SciELO Open Access: A Gold Way from the South

    ERIC Educational Resources Information Center

    Packer, Abel L.

    2009-01-01

    Open access has long emphasized access to scholarly materials. However, open access can also mean access to the means of producing visible and recognized journals. This issue is particularly important in developing and emergent countries. The SciELO (Scientific Electronic Library On-line) project, first started in Brazil and, shortly afterward, in…

  3. ISSN Exercise & Sport Nutrition Review: Research & Recommendations

    PubMed Central

    Kreider, Richard B; Almada, Anthony L; Antonio, Jose; Broeder, Craig; Earnest, Conrad; Greenwood, Mike; Incledon, Thomas; Kalman, Douglas S; Kleiner, Susan M; Leutholtz, Brian; Lowery, Lonnie M; Mendel, Ron; Stout, Jeffrey R; Willoughby, Darryn S; Ziegenfuss, Tim N

    2004-01-01

    Sport nutrition is a constantly evolving field with literally thousands of research papers published annually. For this reason, keeping up to date with the literature is often difficult. This paper presents a well-referenced overview of the current state of the science related to how to optimize training through nutrition. More specifically, this article discusses: 1.) how to evaluate the scientific merit of nutritional supplements; 2.) general nutritional strategies to optimize performance and enhance recovery; and, 3.) our current understanding of the available science behind weight gain, weight loss, and performance enhancement supplements. Our hope is that ISSN members find this review useful in their daily practice and consultation with their clients.

  4. CSF Aβ1-42, but not p-Tau181, differentiates aMCI from SCI.

    PubMed

    Rizzi, Liara; Maria Portal, Marcelle; Batista, Carlos Eduardo Alves; Missiaggia, Luciane; Roriz-Cruz, Matheus

    2018-01-01

    Individuals with amnestic mild cognitive impairment (aMCI) are at a high risk to develop Alzheimer's disease (AD). We compared CSF levels of biomarkers of amyloidosis (Aβ 1-42 ) and neurodegeneration (p-Tau 181 ) in individuals with aMCI and with subjective cognitive impairment (SCI) in order to ascertain diagnostic accuracy and predict the odds ratio associated with aMCI. We collected CSF of individuals clinically diagnosed with aMCI (33) and SCI (12) of a memory clinic of Southern Brazil. Levels of Aβ 1-42 and p-Tau 181 were measured by immunoenzymatic assay. Participants also underwent neuropsychological testing including the verbal memory test subscore of the Consortium to Establish a Registry for Alzheimer's Disease (VM-CERAD). CSF concentration of Aβ 1-42 was significantly lower (p: .007) and p-Tau 181 /Aβ 1-42 ratio higher (p: .014) in aMCI individuals than in SCI. However, isolate p-Tau 181 levels were not associated with aMCI (p: .166). There was a statistically significant association between Aβ 1-42 and p-Tau 181 (R 2 : 0.177; β: -4.43; p: .017). ROC AUC of CSF Aβ 1-42 was 0.768 and of the p-Tau 181 /Aβ 1-42 ratio equals 0.742. Individuals with Aβ 1-42  < 823 pg/mL levels were 6.0 times more likely to be diagnosed with aMCI (p: .019), with a 68.9% accuracy. Those with p-Tau 181 /Aβ 1-42 ratio > 0.071 were at 4.6 increased odds to have aMCI (p: .043), with a 64.5% accuracy. VM-CERAD was significantly lower in aMCI than among SCI (p: .041). CSF Aβ 1-42 , but not p-Tau 181, level was significantly associated with aMCI. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. SciDB versus Spark: A Preliminary Comparison Based on an Earth Science Use Case

    NASA Astrophysics Data System (ADS)

    Clune, T.; Kuo, K. S.; Doan, K.; Oloso, A.

    2015-12-01

    We compare two Big Data technologies, SciDB and Spark, for performance, usability, and extensibility, when applied to a representative Earth science use case. SciDB is a new-generation parallel distributed database management system (DBMS) based on the array data model that is capable of handling multidimensional arrays efficiently but requires lengthy data ingest prior to analysis, whereas Spark is a fast and general engine for large scale data processing that can immediately process raw data files and thereby avoid the ingest process. Once data have been ingested, SciDB is very efficient in database operations such as subsetting. Spark, on the other hand, provides greater flexibility by supporting a wide variety of high-level tools including DBMS's. For the performance aspect of this preliminary comparison, we configure Spark to operate directly on text or binary data files and thereby limit the need for additional tools. Arguably, a more appropriate comparison would involve exploring other configurations of Spark which exploit supported high-level tools, but that is beyond our current resources. To make the comparison as "fair" as possible, we export the arrays produced by SciDB into text files (or converting them to binary files) for the intake by Spark and thereby avoid any additional file processing penalties. The Earth science use case selected for this comparison is the identification and tracking of snowstorms in the NASA Modern Era Retrospective-analysis for Research and Applications (MERRA) reanalysis data. The identification portion of the use case is to flag all grid cells of the MERRA high-resolution hourly data that satisfies our criteria for snowstorm, whereas the tracking portion connects flagged cells adjacent in time and space to form a snowstorm episode. We will report the results of our comparisons at this presentation.

  6. Development of a Small Molecule P2X7R Antagonist as a Treatment for Acute SCI

    DTIC Science & Technology

    2012-10-01

    in isolated spinal astrocytes and microglia, concentrating on P2X7R activity -dependent transcription. In year 1, we established the injury...astroglia and microglia in response to SCI. Besides defining the effects of P2X7R activation and its blockade on phenotype-specific gene expression...injury (SCI) in isolated spinal astrocytes and microglia, concentrating on P2X7R activity - dependent transcription. In year 1, we established the injury

  7. Fitness and Independence after SCI: Defining Meaningful Change and Thresholds

    DTIC Science & Technology

    2016-10-01

    STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Quality of life after SCI/D is depends more on...determine if low fitness is limiting transfer ability. 15. SUBJECT TERMS Spinal Cord Injury, Fitness, Independence, Quality of Life 16. SECURITY... quality of life . Examples include: • data or databases; • physical collections; • audio or video products; • software; • models; • educational aids

  8. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.

    In this work we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system of themore » detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  9. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE PAGES

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.; ...

    2016-02-16

    In this study we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm 2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system ofmore » the detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  10. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.

    In this study we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm 2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system ofmore » the detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  11. The Chemicals of the Earth. Study Guide. Unit F2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  12. Living Things and Their Food. Study Guide. Unit G2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  13. Evidence for an intense solar outburst in prehistory

    NASA Astrophysics Data System (ADS)

    Peratt, A. L.; Yao, W. F.

    2008-10-01

    A past intense solar outburst and its effect on Earth was proposed by Gold (1962 Pontificiae Acad. Sci. Scr. Varia 25 159) who, along with others, based his hypotheses on strong astronomical and geophysical evidence. The discovery that objects from the Neolithic or Early Bronze Age carry patterns associated with high-current Z-pinches, as would result from an intense plasma impinging Earth, provides a possible insight into the origin and meaning of these ancient symbols produced by humans. Peratt (2003 Trans. Plasma Sci. 31 1192) dealt with the comparison of graphical and radiation data from high-current Z-pinches to petroglyphs, geoglyphs and megaliths. Peratt (2007 Trans. Plasma Sci. 35 778) focused primarily, but not exclusively, on petroglyphs of some 84 different morphologies; pictures found in laboratory experiments and carved on rock. These corresponded to mankind's visual observations of ancient aurora as might be produced if the solar wind had increased at times between one and two orders of magnitude, millennia ago (Gold 1962 Pontificiae Acad. Sci. Scr. Varia 25 159). In Peratt (2007 Trans. Plasma Sci. 35 778), the data were given on the source of light and its temporal change from a current-increasing Z-pinch or dense plasma focus aurora. Orientation and field-of-view data are given as surveyed and contributed from 139 countries, from sites and fields containing several millions of these objects, the latest data coming from a 300 km survey along the Orinoco river basin in Venezuela. In this paper, we include additional petroglyph figures derivable from experiment and computer. This information allows a reconstruction of the auroral form presumably associated with extreme geomagnetic storms and shows, based on existent geophysical evidence, relativistic electron flow inward at Earth's south polar axis and hypervelocity proton impacts around the north polar axis.

  14. Effect of COX-2 (PGE2) and IL-6 on Prostate Cancer Bone Metastases

    DTIC Science & Technology

    2008-02-02

    to stimulate both bone targeting and bone reaction (4). Several factors, such as basic fibroblast growth factor (4), osteocalcin, bone sialoprotein (8...Proc Natl Acad Sci U S A 1990;87:75–9. 8. Huang WC, Xie Z, Konaka H, Sodek J, Zhau HE, Chung LWK. Human osteocalcin and bone sialoprotein medi- ating

  15. The Role of VDR in Phosphorylation in Vitamin D-Induced Apoptosis

    DTIC Science & Technology

    2001-07-01

    nuclear pellet was resuspended in Buffer A, Cytometer (Coulter Corp., Miami, FL) equipped with an argon laser . sonicated 2 x 10 s, and stored at -80 ’C...rickets type II with alopecia . Proc Natl Acad Sci [45] Mezzetti G, Barbiroli B, Oka T. 1,25-Dihydroxycholecalciferol re- USA 1997;94:9831-5. ceptor

  16. Targeted Nanoparticles for Kidney Cancer Therapy

    DTIC Science & Technology

    2012-10-01

    24 hrs. Clonogenic survival was assessed 7-10 days after CNT incubation after plating 200-300 cells/well (Figure 7). Similar trends were seen using... ferritin on angiogenesis. Proc Natl Acad Sci U S A. 2009;106(2):570-5. PMCID: 2626744. 4. Burke A, Ding X, Singh R, Kraft RA, Levi-Polyachenko N, Rylander

  17. Early Detection of Breast Cancer Using Posttranslationally Modified Biomarkers

    DTIC Science & Technology

    2011-03-01

    1 and 2 in Globo H synthesis , Proc Natl Acad Sci U S A 105, 11667-11672. 18. Gilewski, T., Ragupathi, G., Bhuta, S., Williams, L. J., Musselli, C...carmustine and new proline analog of nitrosourea on antioxidant system in breast carcinoma cells (MCF-7), Drug Chem Toxicol 33, 55-63. 34. Galijasevic, S

  18. The Plasmodium falciparum Sexual Development Transcriptome: A Microarray Analysis using Ontology-Based Pattern Identification

    DTIC Science & Technology

    2005-06-17

    ciparum. Mol Biochem Parasitol 1992;56(2):239–50. [56] Vinetz JM, Dave SK, Specht CA, et al. The chitinase PfCHT1 from the human malaria parasite Plasmodium...falciparum lacks proenzyme and chitin -binding domains and displays unique substrate prefer- ences. Proc Natl Acad Sci USA 1999;96(24):14061–6. [57

  19. Possible Effects of Noise from Offshore Oil and Gas Drilling Activities on Marine Mammals: A Survey of the Literature

    DTIC Science & Technology

    1982-01-01

    in Baleen Whales, New York Acad Sci, 188, p 110-141, 1971. 61 Penner, RI and J Kadane, Tursiops Biosonar Detection in Noise, In: Animal Sonar Systems... Biosonar Detection in Noise, In: Animal Sonar Systems, RF Busnel and JF Fish, eds, p 957-959, Plenum Press, 1980. 62. Nishiwake, M and A Sasao, Human

  20. Involvement and Regulation of Heparanase in Prostate Cancer Progression

    DTIC Science & Technology

    2007-02-01

    1995). On the other hand, some promoters are negatively regulated by wt p53. These include MMP-1 (Sun et al., 1999), alpha - fetoprotein (Lee et al...necrosis factor alpha is formed from the extracellular matrix by the enzyme heparanase. Proc Natl Acad Sci U S A. 1995;92: 5037-5041. 29. Zcharia E

  1. Pathobiology of HIV in the Human Monocyte-Macrophage

    DTIC Science & Technology

    1993-12-03

    dementia, was obtained from I S Y Chen through sues of tropism and cytopathicity of HIV in megakaryo- the AIDS Researh anid Rekferenc Re~nt Program...Natl. Acad. Sci. USA 88:6632-6636. 10. Bielawska, A., Linardic, C. N. and Y. A. Hannun, Y. A. 1992. Ceramide-mediated Biology . J. Biol. Chem. 267:18493

  2. Clinical Trial of AC105 (Mg/PEG) for Treatment of Acute Spinal Cord Injury (SCI). Phase 2

    DTIC Science & Technology

    2013-10-01

    glycol with a molecular weight of 3350 Daltons ( PEG 3350 ), is manufactured by Dow Chemical Company and complies with NF, FCC and EurPh requirements...Mg/ PEG ) for Treatment of Acute Spinal Cord Injury (SCI) PRINCIPAL INVESTIGATOR: Andrew Blight, PhD RECIPIENT: Acorda Therapeutics...of AC105 (Mg/ PEG ) for Treatment of Acute Spinal Cord Injury (SCI) 5b. GRANT NUMBER W81XWH-12-2 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d

  3. Methane concentrations in water wells unrelated to proximity to existing oil and gas wells in northeastern Pennsylvania.

    PubMed

    Siegel, Donald I; Azzolina, Nicholas A; Smith, Bert J; Perry, A Elizabeth; Bothun, Rikka L

    2015-04-07

    Recent studies in northeastern Pennsylvania report higher concentrations of dissolved methane in domestic water wells associated with proximity to nearby gas-producing wells [ Osborn et al. Proc. Natl. Acad. Sci. U. S. A. 2011 , 108 , 8172 ] and [ Jackson et al. Proc. Natl. Acad. Sci. U. S. A. , 2013 , 110 , 11250 ]. We test this possible association by using Chesapeake Energy's baseline data set of over 11,300 dissolved methane analyses from domestic water wells, densely arrayed in Bradford and nearby counties (Pennsylvania), and near 661 pre-existing oil and gas wells. The majority of these, 92%, were unconventional wells, drilled with horizontal legs and hydraulically fractured. Our data set is hundreds of times larger than data sets used in prior studies. In contrast to prior findings, we found no statistically significant relationship between dissolved methane concentrations in groundwater from domestic water wells and proximity to pre-existing oil or gas wells. Previous analyses used small sample sets compared to the population of domestic wells available, which may explain the difference in prior findings compared to ours.

  4. MiR-103 alleviates autophagy and apoptosis by regulating SOX2 in LPS-injured PC12 cells and SCI rats.

    PubMed

    Li, Guowei; Chen, Tao; Zhu, Yingxian; Xiao, Xiaoyu; Bu, Juyuan; Huang, Zongwen

    2018-03-01

    Recent studies revealed that microRNAs (miRNAs) may play crucial roles in the responses and pathologic processes of spinal cord injury (SCI). This study aimed to investigate the effect and the molecular basis of miR-103 on LPS-induced injuries in PC12 cells in vitro and SCI rats in vivo . PC12 cells were exposed to LPS to induce cell injuries to mimic the in vitro model of SCI. The expression of miR-103 and SOX2 in PC12 cells were altered by transient transfections. Cell viability and apoptotic cell rate were measured by CCK-8 assay and flow cytometry assay. Furthermore, Western blot analysis was performed to detect the expression levels of apoptosis- and autophagy- related proteins, MAPK/ERK pathway- and JAK/STAT pathway-related proteins. In addition, we also assessed the effect of miR-103 agomir on SCI rats. LPS exposure induced cell injuries in PC12 cells. miR-103 overexpression significantly increased cell viability, reduced cell apoptosis and autophagy, and opposite results were observed in miR-103 inhibition. miR-103 attenuated LPS-induced injuries by indirect upregulation of SOX2. SOX2 overexpression protected PC12 cells against LPS-induced injuries, while SOX2 inhibition expedited LPS-induced cell injuries. Furthermore, miR-103 overexpression inhibited MAPK/ERK pathway and JAK/STAT pathway through upregulation of SOX2. We also found that miR-103 agomir inhibited cell apoptosis and autophagy in SCI rats. This study demonstrates that miR-103 may represent a protective effect against cell apoptosis and autophagy in LPS-injured PC12 cells and SCI rats by upregulation of SOX2 expression.

  5. SciDB and Geoinformatics Analysis

    NASA Astrophysics Data System (ADS)

    Brown, Paul

    2015-04-01

    The SciDB project took as its design goals a list of features identified as being critical to scientific data management in a survey of working scientists (Stonebraker et al 2009). Earth scientists working with remote sensing data were well represented among those polled so it should come as no surprise that the platform has been embraced by that community. In this talk we focus on work done by researchers at NASA and INPE, and on applications created by commercial data providers in Korea and the United States. For each use-case, we will review the project team's objectives, the nature and quantity of the data involved, the their workload queries. As we discuss each use-case we will describe what is emerging as "best practice" for data management and analysis in this space. M. Stonebraker, J. Becla, D. J. DeWitt, K. T. Lim, D. Maier, O. Ratzesberger, and S. B. Zdonik. Requirements for science data bases and scidb. In CIDR 2009, Fourth Biennial Conference on Innovative Data Systems Research, Asilomar, CA, USA, January 4-7, 2009, Online Proceedings, 2009.

  6. Developing a spinal cord injury research strategy using a structured process of evidence review and stakeholder dialogue. Part I: rapid review of SCI prioritisation literature.

    PubMed

    Bragge, P; Piccenna, L; Middleton, J W; Williams, S; Creasey, G; Dunlop, S; Brown, D; Gruen, R L

    2015-10-01

    This is a rapid evidence review. The objective of this study was to gain an overview of the volume, nature and findings of studies regarding priorities for spinal cord injury (SCI) research. A worldwide literature search was conducted. Six medical literature databases and Google Scholar were searched for reviews in which the primary aim was to identify SCI research priorities. Two systematic reviews were identified-one of quantitative and one of qualitative studies. The quality of the reviews was variable. Collectively, the reviews identified 31 primary studies; 24 quantitative studies totalling 5262 participants and 7 qualitative studies totalling 120 participants. Despite the difference in research paradigms, there was convergence in review findings in the areas of body impairments and relationships. The vast majority of literature within the reviews focused on the SCI patient perspective. The reviews inform specific research topics and highlight other important research considerations, most notably those pertaining to SCI patients' perspectives on quality of life, which may be of use in determining meaningful research outcome measures. The views of other SCI research stakeholders such as researchers, clinicians, policymakers, funders and carers would help shape a bigger picture of SCI research priorities, ultimately optimising research outputs and translation into clinical practice and health policy change. Review findings informed subsequent activities in developing a regional SCI research strategy, as described in two companion papers. This project was funded by the Victorian Transport Accident Commission and the Australian and New Zealand SCI Network.

  7. Reactions of the rat musculoskeletal system to compressive spinal cord injury (SCI) and whole body vibration (WBV) therapy

    PubMed Central

    Schwarz, A.; Pick, C.; Harrach, R.; Stein, G.; Bendella, H.; Ozsoy, O.; Ozsoy, U.; Schoenau, E.; Jaminet, P.; Sarikcioglu, L.; Dunlop, S.; Angelov, D.N.

    2015-01-01

    Traumatic spinal cord injury (SCI) causes a loss of locomotor function with associated compromise of the musculo-skeletal system. Whole body vibration (WBV) is a potential therapy following SCI, but little is known about its effects on the musculo-skeletal system. Here, we examined locomotor recovery and the musculo-skeletal system after thoracic (T7-9) compression SCI in adult rats. Daily WBV was started at 1, 7, 14 and 28 days after injury (WBV1-WBV28 respectively) and continued over a 12-week post-injury period. Intact rats, rats with SCI but no WBV (sham-treated) and a group that received passive flexion and extension (PFE) of their hind limbs served as controls. Compared to sham-treated rats, neither WBV nor PFE improved motor function. Only WBV14 and PFE improved body support. In line with earlier studies we failed to detect signs of soleus muscle atrophy (weight, cross sectional diameter, total amount of fibers, mean fiber diameter) or bone loss in the femur (length, weight, bone mineral density). One possible explanation is that, despite of injury extent, the preservation of some axons in the white matter, in combination with quadripedal locomotion, may provide sufficient trophic and neuronal support for the musculoskeletal system. PMID:26032204

  8. Reactions of the rat musculoskeletal system to compressive spinal cord injury (SCI) and whole body vibration (WBV) therapy.

    PubMed

    Schwarz, A; Pick, C; Harrach, R; Stein, G; Bendella, H; Ozsoy, O; Ozsoy, U; Schoenau, E; Jaminet, P; Sarikcioglu, L; Dunlop, S; Angelov, D N

    2015-06-01

    Traumatic spinal cord injury (SCI) causes a loss of locomotor function with associated compromise of the musculo-skeletal system. Whole body vibration (WBV) is a potential therapy following SCI, but little is known about its effects on the musculo-skeletal system. Here, we examined locomotor recovery and the musculo-skeletal system after thoracic (T7-9) compression SCI in adult rats. Daily WBV was started at 1, 7, 14 and 28 days after injury (WBV1-WBV28 respectively) and continued over a 12-week post-injury period. Intact rats, rats with SCI but no WBV (sham-treated) and a group that received passive flexion and extension (PFE) of their hind limbs served as controls. Compared to sham-treated rats, neither WBV nor PFE improved motor function. Only WBV14 and PFE improved body support. In line with earlier studies we failed to detect signs of soleus muscle atrophy (weight, cross sectional diameter, total amount of fibers, mean fiber diameter) or bone loss in the femur (length, weight, bone mineral density). One possible explanation is that, despite of injury extent, the preservation of some axons in the white matter, in combination with quadripedal locomotion, may provide sufficient trophic and neuronal support for the musculoskeletal system.

  9. Langevin Theory of Anomalous Brownian Motion Made Simple

    ERIC Educational Resources Information Center

    Tothova, Jana; Vasziova, Gabriela; Glod, Lukas; Lisy, Vladimir

    2011-01-01

    During the century from the publication of the work by Einstein (1905 "Ann. Phys." 17 549) Brownian motion has become an important paradigm in many fields of modern science. An essential impulse for the development of Brownian motion theory was given by the work of Langevin (1908 "C. R. Acad. Sci.", Paris 146 530), in which he proposed an…

  10. The Effects of Letter Spacing and Coloured Overlays on Reading Speed and Accuracy in Adult Dyslexia

    ERIC Educational Resources Information Center

    Sjoblom, Amanda M.; Eaton, Elizabeth; Stagg, Steven D.

    2016-01-01

    Background: Zorzi et al. (2012, Proc. Natl. Acad. Sci. U.S.A., 109, 11455) found evidence that extra-large letter spacing aids children with dyslexia, but the evidence for the coloured overlays is contradictory (e.g., Henderson et al., 2013, "J. Res. Special Educ. Needs," 13, 57; Wilkins, 2002, "Ophthalmic Physiol. Opt.," 22,…

  11. How Gender and Reformed Introductory Physics Impacts Student Success in Advanced Physics Courses and Continuation in the Physics Major

    ERIC Educational Resources Information Center

    Rodriguez, Idaykis; Potvin, Geoff; Kramer, Laird H.

    2016-01-01

    Active-learning approaches to teaching introductory physics have been found to improve student learning and affective gains on short-term outcomes [S. Freeman et al., "Proc. Natl. Acad. Sci. U.S.A. 111," 8410 (2014)]; however, whether or not the benefits of active learning impact women to the same degree as men has been a point of…

  12. Genome-wide Analysis of Germline CNPs and SNPs in Prostate Cancer

    DTIC Science & Technology

    2010-03-01

    colorectal adenomas. Proc Natl Acad Sci U S A. 2004 Nov 9;101(45):15992-7. 12) Iliopoulos D, Guler G, Han SY, Druck T, Ottey M, McCorkell KA...SNPs and copy number variation. Nat Genet. 2008 Oct;40(10):1166-74. 17) Qin HR, Iliopoulos D, Semba S, Fabbri M, Druck T, Volinia S, Croce CM

  13. Role of Hunk and Punc in Breast Cancer and Mammary Development

    DTIC Science & Technology

    2001-08-01

    of the 4 small cell lung carcinoma cell lines, but is detected in only one of ten other lung cancer cell Lung < branchio adeno Kids ml Pell CNS PNCK 3...polarity in Schizosaccharomyces Schnurch, H., and Risau, W. (1993). Expression of tie-2, a member of porn be. Proc. Natl. Acad. Sci. USA 87: 8272-8276

  14. New Organisational Structures and the Transformation of Academic Work

    ERIC Educational Resources Information Center

    Nyhagen, Gigliola Mathisen; Baschung, Lukas

    2013-01-01

    This article will particularly focus on Norway and the consequences for academic work. Frequently in studies of academic work, focus has been on academics' individual autonomy and to what extent the latter is challenged (Altbach in "Ann Am Acad Pol Soc Sci" 448:1-14, 1980; Shattock in "High Educ" 41:27-47, 2001). One of the…

  15. Cooperative Interactions During Human Mammary Epithelial Cell Immortalization

    DTIC Science & Technology

    2005-07-01

    papilloma virus 16 E6 or E7. Proc. Nat. Acad. Sci. USA, 92: 3687-3691, 1995. 6. Huschtscha, L. I., Neumann, A. A., Noble, J. R., and Reddel, R. R. Effects...Oncology, In press. 5. Wazer, D. E., Liu, X.-L., Chu, Q., Gao, Q., and Band, V. Immortalization of distinct human mammary epithelial cell types by human

  16. Systematic Characterization of the Molecular Mechanisms That Regulate and Mediate Alternative Lengthening of Telomeres in Breast Carcinoma

    DTIC Science & Technology

    2013-04-01

    2009). 14. L. J. Ng, J. E. Cropley , H. A. Pickett, R. R. Reddel, C. M. Suter, Telomerase activity is associated with an increase in DNA methylation...bodies. Proc Natl Acad Sci U S A 100: 10635–10640. 38. Ng LJ, Cropley JE, Pickett HA, Reddel RR, Suter CM (2009) Telomerase activity is associated with an

  17. Treatment of Neuropathic Pain after SCI with a Catalytic Oxidoreductant

    DTIC Science & Technology

    2014-10-01

    Ashcraft,1 Ping Fan,4 Dewhirst, M. W.,1 David S. Warner,2 Zeljko Vujaskovic,4 Ines Batinic-Haberle1 and Ivan Spasojevic,6* Departments of Radiation...Subcontract project management and oversee the mouse SCI induction OTHER FUNDING SUPPORT DUKE NAME IVAN SPASOJEVICK, PH.D. PROJECT ROLE CO-I...Fan,4 Dewhirst, M. W.,1 David S. Warner,2 Zeljko Vujaskovic,4 Ines Batinic-Haberle1 and Ivan Spasojevic,6* Departments of Radiation Oncology,1

  18. FES-Rowing versus Zoledronic Acid to Improve Bone Health in SCI

    DTIC Science & Technology

    2015-10-01

    although the risk is high in this population of osteoporosis -related bone fracture. This study aims to learn if the severe osteoporosis in lower... Osteoporosis , FES-rowing, zoledronic acid, exercise, bone health 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a...9 Introduction Serious spinal cord injury (SCI) causes osteoporosis in the lower extremities, significantly increasing

  19. Measuring resilience after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Resilience item bank and short form.

    PubMed

    Victorson, David; Tulsky, David S; Kisala, Pamela A; Kalpakjian, Claire Z; Weiland, Brian; Choi, Seung W

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury--Quality of Life (SCI-QOL) Resilience item bank and short form. Using a mixed-methods design, we developed and tested a resilience item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory based analytic approaches, including tests of model fit and differential item functioning (DIF). We tested a 32-item pool at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital and the James J. Peters/Bronx Department of Veterans Affairs medical center. A total of 717 individuals with SCI completed the Resilience items. A unidimensional model was observed (CFI=0.968; RMSEA=0.074) and measurement precision was good (theta range between -3.1 and 0.9). Ten items were flagged for DIF, however, after examination of effect sizes we found this to be negligible with little practical impact on score estimates. The final calibrated item bank resulted in 21 retained items. This study indicates that the SCI-QOL Resilience item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available.

  20. Family dynamics and psychosocial functioning in children with SCI/D from Colombia, South America

    PubMed Central

    Nicolais, Christina J.; Perrin, Paul B.; Panyavin, Ivan; Nicholls, Elizabeth G.; Olivera Plaza, Silvia Leonor; Quintero, Lorena Medina; Arango-Lasprilla, Juan Carlos

    2016-01-01

    Objective The purpose of this study was to examine the connections between family dynamics and the psychosocial functioning of children with spinal cord injuries and disorders (SCI/D). Design Cross-sectional. Setting Participants were recruited from communities in Neiva, Colombia. Participants Thirty children with SCI/D and their primary caregiver participated. Children were between 8 and 17 years of age, and had sustained their injury at least six months prior to data collection. Interventions NA. Outcome measures Participating children completed measures assessing their own psychosocial functioning (Children's Depression Inventory, Revised Children's Manifest Anxiety Scale-2, Pediatric Quality of Life Inventory), and their primary caregiver completed measures of family dynamics (Family Adaptability and Cohesion Evaluation Scale- Fourth Edition, Family Communication Scale, Family Assessment Device- General Functioning, Family Satisfaction Scale, Relationship-Focused Coping Scale). Results A correlation matrix showed a number of significant bivariate correlations between child and family variables, and three multiple regressions showed that family satisfaction, empathy, and flexibility significantly explained 27% of the variance in child worry; family satisfaction and communication explained 18% of the variance in child social anxiety; and family cohesion and communication explained 23% of the variance in child emotional functioning. Conclusions These findings highlight the importance of rehabilitation professionals considering the association between family dynamics and the psychosocial functioning of children with SCI/D when working with this population. PMID:25582185

  1. Immunogenicity of Sci-B-Vac (a Third-Generation Hepatitis B Vaccine) in HIV-Positive Adults.

    PubMed

    Alon, Danny; Stein, Gideon Y; Hadas-Golan, Vered; Tau, Luba; Brosh, Tal; Turner, Dan

    2017-03-01

    Guidelines recommend hepatitis B virus (HBV) vaccination of all adults positive for human immunodeficiency virus (HIV). Immune responses to single-antigen HBV vaccine among HIV-positive patients are low when compared with HIV-negative adults. Sci-B-Vac™ is a recombinant third-generation HBV that may be advantageous in this population. To examine the immune responses to Sci-B-Vac among HIV-positive adults. We conducted a prospective cohort study involving HIV-positive adults who had negative HBV serology (HBSAg, HBSAb, HBcoreAb). Sci-B-Vac at 10 µg/dose was administered intramuscularly upon recruitment and after 1 and 6 months. HBSAb levels were checked 1 month after each dose; a level > 10 mlU/ml was considered protective. Data regarding age, gender, CD4 level, and viral load were collected. The study group comprised 31 patients. Average CD4 count was 503 ± 281 cells/ml, and average viral load was 44 copies/ml. Median interquartile range (IQR) HBVAb titers after the first, second and third immunizations were 0 (0, 3.5), 30 (6, 126) and 253 (81, 408) mlU/ml. Significant titer elevations were found between the second and third immunizations (P = 0.0003). The rate of patients considered protected was 16% after the first, 65% after the second (P < 0.0001), and 84% after the third dose (P = 0.045). No adverse events were reported. More patients under the age of 40 years responded to the first immunization (28% vs. 0%, P = 0.038). CD4 level had no influence on immunization rates. Sci-B-Vac might achieve better immunization rates among HIV-positive adults compared to the single-antigen vaccine and thus deserves further evaluation in a randomized, double-blind study in this population.

  2. Complete spinal cord injury (SCI) transforms how brain derived neurotrophic factor (BDNF) affects nociceptive sensitization.

    PubMed

    Huang, Yung-Jen; Lee, Kuan H; Grau, James W

    2017-02-01

    Noxious stimulation can induce a lasting increase in neural excitability within the spinal cord (central sensitization) that can promote pain and disrupt adaptive function (maladaptive plasticity). Brain-derived neurotrophic factor (BDNF) is known to regulate the development of plasticity and has been shown to impact the development of spinally-mediated central sensitization. The latter effect has been linked to an alteration in GABA-dependent inhibition. Prior studies have shown that, in spinally transected rats, exposure to regular (fixed spaced) stimulation can counter the development of maladaptive plasticity and have linked this effect to an up-regulation of BDNF. Here it is shown that application of the irritant capsaicin to one hind paw induces enhanced mechanical reactivity (EMR) after spinal cord injury (SCI) and that the induction of this effect is blocked by pretreatment with fixed spaced shock. This protective effect was eliminated if rats were pretreated with the BDNF sequestering antibody TrkB-IgG. Intrathecal (i.t.) application of BDNF prevented, but did not reverse, capsaicin-induced EMR. BDNF also attenuated cellular indices (ERK and pERK expression) of central sensitization after SCI. In uninjured rats, i.t. BDNF enhanced, rather than attenuated, capsaicin-induced EMR and ERK/pERK expression. These opposing effects were related to a transformation in GABA function. In uninjured rats, BDNF reduced membrane-bound KCC2 and the inhibitory effect of the GABA A agonist muscimol. After SCI, BDNF increased KCC2 expression, which would help restore GABAergic inhibition. The results suggest that SCI transforms how BDNF affects GABA function and imply that the clinical usefulness of BDNF will depend upon the extent of fiber sparing. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Multiple mediation path model of pain's cascading influence on physical disability in individuals with SCI from Colombia, South America.

    PubMed

    Perrin, Paul B; Paredes, Alejandra Morlett; Olivera, Silvia Leonor; Lozano, Juan Esteban; Leal, Wendy Tatiana; Ahmad, Usman F; Arango-Lasprilla, Juan Carlos

    2017-01-01

    Research has begun to document the bivariate connections between pain in individuals with spinal cord injury (SCI) and various aspects of health related quality of life (HRQOL), such as fatigue, social functioning, mental health, and physical functioning. The purpose of this study was to construct and test a theoretical path model illuminating the stage-wise and sequential (cascading) HRQOL pathways through which pain increases physical disability in individuals with SCI in a sample from Colombia, South America. It was hypothesized that increased pain would lead to decreased energy, which would lead to decreased mental health and social functioning, which both would lead to emotional role limitations, which finally would lead to physical role limitations. A cross-sectional study assessed individuals with SCI (n = 40) in Neiva, Colombia. Participants completed a measure indexing various aspects of HRQOL. The path model overall showed excellent fit indices, and each individual path within the model was statistically significant. Pain exerted significant indirect effects through all possible mediators in the model, ultimately suggesting that energy, mental health, social functioning, and role limitations-emotional were likely pathways through which pain exerted its effects on physical disability in individuals with SCI. These findings uncover several potential nodes for clinical intervention which if targeted in the context of rehabilitation or outpatient services, could result in salubrious direct and indirect effects reverberating down the theoretical causal chain and ultimately reducing physical disability in individuals with SCI.

  4. SciDAC-Data, A Project to Enabling Data Driven Modeling of Exascale Computing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mubarak, M.; Ding, P.; Aliaga, L.

    The SciDAC-Data project is a DOE funded initiative to analyze and exploit two decades of information and analytics that have been collected by the Fermilab Data Center on the organization, movement, and consumption of High Energy Physics data. The project will analyze the analysis patterns and data organization that have been used by the NOvA, MicroBooNE, MINERvA and other experiments, to develop realistic models of HEP analysis workflows and data processing. The SciDAC-Data project aims to provide both realistic input vectors and corresponding output data that can be used to optimize and validate simulations of HEP analysis. These simulations aremore » designed to address questions of data handling, cache optimization and workflow structures that are the prerequisites for modern HEP analysis chains to be mapped and optimized to run on the next generation of leadership class exascale computing facilities. We will address the use of the SciDAC-Data distributions acquired from Fermilab Data Center’s analysis workflows and corresponding to around 71,000 HEP jobs, as the input to detailed queuing simulations that model the expected data consumption and caching behaviors of the work running in HPC environments. In particular we describe in detail how the Sequential Access via Metadata (SAM) data handling system in combination with the dCache/Enstore based data archive facilities have been analyzed to develop the radically different models of the analysis of HEP data. We present how the simulation may be used to analyze the impact of design choices in archive facilities.« less

  5. Impact of SciELO and MEDLINE indexing on submissions to Jornal de Pediatria.

    PubMed

    Blank, Danilo; Buchweitz, Claudia; Procianoy, Renato S

    2005-01-01

    To evaluate the impact of SciELO and MEDLINE indexing on the number of articles submitted to Jornal de Pediatria. Analysis of total article submission, submission of articles from foreign countries and acceptance figures in the following periods: stage I - pre-website (Jan 2000-Mar 2001); stage II - website (Apr 2001-Jul 2002); stage III - SciELO (Aug 2002-Aug 2003); stage IV - MEDLINE (Sep 2003-Dec 2004). There was a significant trend toward linear increase in the number of submissions along the study period (p = 0.009). The number of manuscripts submitted in stages I through IV was 184, 240, 297, and 482, respectively. The number of submissions was similar in stages I and II (p = 0.148), but statistically higher in Stage III (p < 0.001 vs. Stage I and p = 0.006 vs. Stage II) and Stage IV (p < 0.001 vs. stages I and II, and p < 0.05 vs. stage III). The rate of article acceptance decreased during the study period. The number of original articles published has been stable since the 2001 March/April issue (n = 10), when the journal reached a printed page limit, leading to stricter judgment criteria and a relative decrease in acceptance rate. The number of foreign submissions in stages I through IV was 1, 2, zero and 17, respectively, with p < 0.001 for the comparison of stage IV with previous stages. SciELO indexing was associated with an increase in Brazilian manuscript submissions to Jornal de Pediatria, whereas MEDLINE indexing led to an increase in both Brazilian and foreign submissions.

  6. The Fulldome Curriculum for the Spitz SciDome Digital Planetarium: Volume 2

    NASA Astrophysics Data System (ADS)

    Bradstreet, David H.; Sanders, S. J.; Huggins, S.

    2014-01-01

    The Spitz Fulldome Curriculum (FDC) for the SciDome digital planetarium ushered in a new and innovative way to present astronomical pedagogy via its use of the unique teaching attributes of the digital planetarium. In the case of the FDC, which uses the ubiquitous Starry Night planetarium software as its driving engine, these engaging and novel teaching techniques have also been made usable to desktop computers and flat-screen video projectors for classroom use. Volume 2 of the FDC introduces exciting new classes and mini-lessons to further enlighten and invigorate students as they struggle with often difficult three dimensional astronomical concepts. Additionally, other topics with related astronomical ties have been created to integrate history into planetarium presentations. One of the strongest advantages of the SciDome is its use of Starry Night as its astronomical engine. With it students can create their own astronomical configurations in the computer lab or at home, using the PC or Mac version. They can then simply load their creations onto the SciDome planetarium system and display them for their classmates on the dome. This poster will discuss and illustrate some of the new content that has been developed for Volume 2. Topics covered in Volume 2 include eclipses, plotting planet locations on a curtate orbit chart by observing their positions in the sky, time and timekeeping (including sidereal day, hour angles, sidereal time, LAST, LMST, time zones and the International Date Line), teaching to the Boy Scout Merit Badge requirements, plotting scale analemmas on the surface of planets and interpreting them, precession, astronomical events in revolutionary Boston, the Lincoln Almanac Trial, eclipsing binaries, lunar librations, a trip through the universe, watching the speed of light move in real time, stellar sizes and the Milky Way.

  7. Measuring resilience after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Resilience item bank and short form

    PubMed Central

    Victorson, David; Tulsky, David S.; Kisala, Pamela A.; Kalpakjian, Claire Z.; Weiland, Brian; Choi, Seung W.

    2015-01-01

    Objective To describe the development and psychometric properties of the Spinal Cord Injury - Quality of Life (SCI-QOL) Resilience item bank and short form. Design Using a mixed-methods design, we developed and tested a resilience item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory based analytic approaches, including tests of model fit and differential item functioning (DIF). Setting We tested a 32-item pool at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital and the James J. Peters/Bronx Department of Veterans Affairs medical center. Participants A total of 717 individuals with SCI completed the Resilience items. Results A unidimensional model was observed (CFI = 0.968; RMSEA = 0.074) and measurement precision was good (theta range between −3.1 and 0.9). Ten items were flagged for DIF, however, after examination of effect sizes we found this to be negligible with little practical impact on score estimates. The final calibrated item bank resulted in 21 retained items. Conclusion This study indicates that the SCI-QOL Resilience item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available. PMID:26010971

  8. Scientific support of SciTech museum exhibits and outreach programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peshkin, M.

    SciTech (Science and Technology Interactive Center) is a small hands-on science museum located in Aurora, Illinois, not far from Argonne National Laboratory. Its constituency includes prosperous suburbs and economically disadvantaged minority communities in Aurora and Chicago. Its mission is to contribute to the country`s scientific literacy initiative by offering hands-on experiences on the museum floor and through outreach programs extended to school children, their teachers, and other groups. Argonne`s participation is focused mainly on the development of exhibits to carry the ideas of modern science and technology to the public. This is an area in which traditional museums are weak,more » but in which SciTech has become a nationally recognized leader with the assistance of Argonne, Fermilab, nearby technological companies, and many volunteer scientists and engineers. We also participate in development and improvement of the museum`s general exhibits and outreach programs. Argonne`s Director, Alan Schriesheim, serves as a member of the museum`s Board of Directors. Murray Peshkin serves part-time as the museum`s Senior Scientist. Dale Henderson serves part-time as an exhibit developer. That work is supported by the Laboratory Director`s discretionary funds. In addition, several members of the Physics Division voluntarily assist with exhibit development and the Division makes facilities available for that effort.« less

  9. SciELO, Scientific Electronic Library Online, a Database of Open Access Journals

    ERIC Educational Resources Information Center

    Meneghini, Rogerio

    2013-01-01

    This essay discusses SciELO, a scientific journal database operating in 14 countries. It covers over 1000 journals providing open access to full text and table sets of scientometrics data. In Brazil it is responsible for a collection of nearly 300 journals, selected along 15 years as the best Brazilian periodicals in natural and social sciences.…

  10. What's Manifest in the History of SciTech: Reflections on The History Manifesto.

    PubMed

    Kevles, Daniel J

    2016-06-01

    Making nuts-and-bolts public policy is not--and never has been--the long suit of professional historians, but general historical work, whatever its durée, has done a good deal to shape discourse on public issues. Jo Guldi and David Armitage neglect that fact, as well as the opinion-shaping influence of history conveyed via nonprint media. They also ignore the large body of scholarship produced in all media during recent decades in the history of science, technology, and science-related medicine (SciTech), even though SciTech itself looms enormously large in the modern era as an instrument of national and international security, a driver of the economy, and a transformer of medicine, public health, and the environment. Much of this scholarship, even though of short durée, can illuminate salient contemporary issues, including innovation; patronage and practice; government and policy; imperialism and globalization; intellectual property; science and religion; and human rights, environment, energy, and disasters.

  11. Governance of Cutaneous Photocarcinogenesis by Chronic UVA-Exposed Dermal Fibroblasts

    DTIC Science & Technology

    2014-09-01

    UV lamp (Ted...repair of oxidative DNA damage and UV -induced photoproducts. Proc Natl Acad Sci USA 107:12180–5 RW Redmond et al. Bystander Oxidative Stress Due to UVA Irradiation 1090 Journal of Investigative Dermatology (2014), Volume 134 ...component of terrestrial UV radiation and is also the predominant constituent of indoor sunlamps, both of which have been shown to increase

  12. Inverse Faraday Effect in Hemoglobin Detected by Raman Spectroscopy: An Example of Magnetic Resonance Raman Activity.

    DTIC Science & Technology

    1985-06-03

    d.E - m.H + and is a truncated form of Equ. (9) intepreted according to the diagrammatic perturbation theory approach of Wallace [51]; n is the...A.L., 1972, 3. Chem. Phys. 56, 4073. 87. Gouterman, M., 1973, Ann. N.Y. Acad. Sci. 206, 70. -27- NADC-85074-60 This Page Intentionally Left Blank -28 - FILM -ED 11-85 DTIC

  13. FGF Signaling and Dietary Factors in the Prostate

    DTIC Science & Technology

    2005-03-01

    Signaling 3. Mohammadi, M., Dionne, C. A., Li, W., Li, N., Spivak, T., Honegger, A. M., 25. Spruck, C. H., de Miguel , M. P., Smith, A. P., Ryan, A., Stein...Acad. Sci. U. S. A. 98, 8578-8583 91, 2176-2180 14. Melillo, R. M., Santoro , M., Ong, S. H., Billaud, M., Fusco, A., Hadari, Y. R., 34. Zhang, Y

  14. Exploiting for Breast Cancer Control a Proposed Unified Mechanism for Reduction of Human Breast Cancer Risk by the Hormones of Pregnancy

    DTIC Science & Technology

    2006-05-01

    methyl-1-nitrosourea- Induced Mammary Cancer. Carcinogenesis. 4 (4): 495-497. 3. Rajkumar L., R.C. Guzman, J. Yang, G. Thordarson , F. Talamantes, and...5. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S. Hormonal prevention of breast cancer: mimicking the protective effect of pregnancy. Proc Natl Acad Sci U S A. 1999 Mar 2;96(5):2520-5.

  15. Constitutively reduced sensory capacity promotes better recovery after spinal cord-injury (SCI) in blind rats of the dystrophic RCS strain.

    PubMed

    Rink, Svenja; Bendella, Habib; Alsolivany, Kurdin; Meyer, Carolin; Woehler, Aliona; Jansen, Ramona; Isik, Zeynep; Stein, Gregor; Wennmachers, Sina; Nakamura, Makoto; Angelov, Doychin N

    2018-01-01

    We compared functional, electrophysiological and morphological parameters after SCI in two groups of rats Sprague Dawley (SD) rats with normal vision and blind rats from a SD-substrain "Royal College of Surgeons" (SD/RCS) who lose their photoreceptor cells after birth due to a genetic defect in the retinal pigment epithelium. For these animals skin-, intramuscular-, and tendon receptors are major available means to resolve spatial information. The purpose of this study was to check whether increased sensitivity in SD/RCS rats would promote an improved recovery after SCI. All rats were subjected to severe compression of the spinal cord at vertebra Th8, spinal cord segment Th10. Recovery of locomotion was analyzed at 1, 3, 6, 9, and 12 weeks after SCI using video recordings of beam walking and inclined ladder climbing. Five functional parameters were studied: foot-stepping angle (FSA), rump-height index (RHI) estimating paw placement and body weight support, respectively, number of correct ladder steps (CLS) assessing skilled hindlimb movements, the BBB-locomotor score and an established urinary bladder score (BS). Sensitivity tests were followed by electrophysiological measurement of M- and H-wave amplitudes from contractions of the plantar musculature after stimulation of the tibial nerve. The closing morphological measurements included lesion volume and expression of astro- and microglia below the lesion. Numerical assessments of BBB, FSA, BS, lesion volume and GFAP-expression revealed no significant differences between both strains. However, compared to SD-rats, the blind SD/RCS animals significantly improved RHI and CLS by 6 - 12 weeks after SCI. To our surprise the withdrawal latencies in the blind SD/RCS rats were longer and the amplitudes of M- and H-waves lower. The expression of IBA1-immunoreactivity in the lumbar enlargement was lower than in the SD-animals. The longer withdrawal latencies suggest a decreased sensitivity in the blind SD/RCS rats, which

  16. Impact of legal regulations and administrative policies on persons with SCI: identifying potential research priorities through expert interviews.

    PubMed

    Trezzini, Bruno; Phillips, Barbara

    2014-01-01

    To identify research gaps and potential research priorities regarding the impact that legal regulations and administrative policies might have on people with spinal cord injury (SCI) living in Switzerland. We conducted semi-structured interviews with 14 healthcare professionals working for or being associated with the largest SCI clinic in Switzerland. The transcribed interviews were content analyzed, involving qualitative description, and thematic analysis techniques. Four interrelated clusters of issues were corroborated: (1) social insurance, (2) caregiving, (3) work integration, and (4) aging. In addition, two overarching themes were identified: (1) fairness considerations and (2) unavailability of systematic empirical evidence. Work capacity assessment and family caregiving were deemed to be the most pressing research priority areas. Legal frameworks do play both a direct and an indirect role in the lives of people with SCI in Switzerland. This is particularly true with regard to various issues related to the social insurance system, such as family caregiving and work capacity assessment. The salience of these topics is closely related to major sociodemographic and political driving forces, i.e. aging and social insurance reforms. Research directly involving people with SCI is needed to further substantiate and refine the findings of this study. When dealing with issues related to work reintegration, aging, social insurance, and caregiving, rehabilitation professionals should take existing legal frameworks into account. Eligibility criteria for disability benefits may influence the therapy motivation of rehabilitation clients.

  17. Research Report for GeSci Meta-Review of ICT in Education: Phase Two

    ERIC Educational Resources Information Center

    LeBaron, John; McDonough, Elizabeth

    2009-01-01

    This second phase of a comprehensive meta-review of educational ICT research and practice addresses global developments reflected in the research and development literature appearing since 2006. Completed in April 2009, the Phase One (P1) report comprised a synopsis of research related to GeSci's five thematic inquiry priorities. Preliminary…

  18. It is a marathon rather than a sprint: an initial exploration of unmet needs and support preferences of caregivers of children with SCI.

    PubMed

    Ryerson Espino, Susan L; Kelly, Erin H; Rivelli, Anne; Zebracki, Kathy; Vogel, Lawrence C

    2018-03-01

    Focus group study. Explore unmet needs and support preferences of caregivers of youth with spinal cord injury (SCI). One pediatric specialty rehabilitation hospital system in the United States. Four focus groups were conducted with a convenience sample of 26 caregivers who were primarily mothers (96%) and married (65%), and had at least some college education (85%). Children living with SCI were on average 12.8 years old (SD = 3.3, 8-18). The average age of injury was 4.7 years (SD = 4.4, 0-16.2); mean injury duration was 8.2 years (SD = 3.9, 2-16); 77% had paraplegia; and 58% were male. Focus groups were digitally recorded, transcribed verbatim, and coded using thematic analysis and NVivo. Qualitative data highlighted caregiver perspectives on unmet needs relating to two phases of care: acute and rehabilitation vs. current life with SCI, and two kinds of stressors: those associated with SCI and care vs. those related to other areas of the caregivers' lives, especially their families. Caregivers described stressful interactions with care systems and community services, articulated several concerns regarding well-being of family members, and noted that both they and their children with SCI experienced isolation. Caregivers articulated preferences for additional support from professionals and peers. Data suggest the need for ongoing caregiver interventions and strengthened family-centered care systems, including professional assistance navigating health systems and peer support. Intervention development would benefit from further qualitative data collection with additional caregivers of youth with SCI, including multiple family members, and families from more diverse care settings.

  19. SCI Survey to Determine Pressure Ulcer Vulnerability in the Outpatient Population

    DTIC Science & Technology

    2013-10-01

    of transportation, mobility, caregiver status, bowel and bladder continence, level of education , mental health status or illicit drug use. Key...coded a number of variables. For example, we created a new variable: “Good Nutrition ”, reflecting nutritional status using the recorded albumin and...no difference in age, level of education or marital status and presence of PrUs. Violence as the etiology of SCI was more common among those with ≥ 1

  20. How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy

    PubMed Central

    Singh, Natalia N.; Howell, Matthew D.; Androphy, Elliot J.; Singh, Ravindra N.

    2017-01-01

    Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7 during pre-mRNA splicing. With the recent FDA approval of nusinersen (Spinraza™), the potential for correction of SMN2 exon 7 splicing as a SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions. PMID:28485722

  1. How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy.

    PubMed

    Singh, N N; Howell, M D; Androphy, E J; Singh, R N

    2017-09-01

    Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 because of predominant skipping of exon 7 during pre-mRNA splicing. With the recent US Food and Drug Administration approval of nusinersen (Spinraza), the potential for correction of SMN2 exon 7 splicing as an SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here, we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions.

  2. A Comprehensive Evaluation of H2SO4 formation from OH and sCI pathways in high BVOC environments

    NASA Astrophysics Data System (ADS)

    Kim, S.; Seco, R.; Park, J. H.; Guenther, A. B.; Smith, J. N.; Kuang, C.; Bustillos, J. O. V.; Tota, J.; Souza, R. A. F. D.

    2014-12-01

    The recently highlighted importance of stabilized Criegee intermediates (sCI) as an oxidant for atmospheric SO2 triggered a number of studies to assess the atmospheric implications of H2SO4 formation from the sCI reaction pathway. In addition, it has not been clear why new particle formation events are not observed in the Amazon rain forest. The mostly widely speculated reason has been a very low H2SO4 level. We will present quantitative assessments of SO2 oxidation by sCI leading to the H2SO4 production using a comprehensive observational dataset from a tropical rainforest study during the GOAmazon field campaign at the T3 site in Manacapuru, Amazonas, Brazil. To our best knowledge, this is the first observation of H2SO4 and OH in Amazon and is unique for all tropical sites due to the accompanying comprehensive gas and aerosol observations such as CO, NOX, SO2, VOCs, and physical and chemical characteristics of aerosols. We will discuss observed H2SO4 levels during the GOAmazon field campaigns to demonstrate 1) H2SO4 formation potential from OH and sCI oxidation pathways by contrasting extremely clean and relatively polluted air masses and 2) the Implications of the observed H2SO4 levels in new particle formation and particle growth events.

  3. Musculoskeletal Model-Guided, Customizable Selection of Shoulder and Elbow Muscles for a C5 SCI Neuroprosthesis

    PubMed Central

    Hincapie, Juan Gabriel; Blana, Dimitra; Chadwick, Edward K.; Kirsch, Robert F.

    2010-01-01

    Individuals with C5/C6 spinal cord injury (SCI) have a number of paralyzed muscles in their upper extremities that can be electrically activated in a coordinated manner to restore function. The selection of a practical subset of paralyzed muscles for stimulation depends on the specific condition of the individual, the functions targeted for restoration, and surgical considerations. This paper presents a musculoskeletal model-based approach for optimizing the muscle set used for functional electrical stimulation (FES) of the shoulder and elbow in this population. Experimentally recorded kinematics from able-bodied subjects served as inputs to a musculoskeletal model of the shoulder and elbow, which was modified to reflect the reduced muscle force capacities of an individual with C5 SCI but also the potential of using FES to activate paralyzed muscles. A large number of inverse dynamic simulations mimicking typical activities of daily living were performed that included 1) muscles with retained voluntary control and 2) many different combinations of stimulated paralyzed muscles. These results indicate that a muscle set consisting of the serratus anterior, infraspinatus and triceps would enable the greatest range of relevant movements. This set will become the initial target in a C5 SCI neuroprosthesis to restore shoulder and elbow function. PMID:18586604

  4. Solubility of pharmaceuticals: A comparison between SciPharma, a PC-SAFT-based approach, and NRTL-SAC

    NASA Astrophysics Data System (ADS)

    Bouillot, Baptiste; Spyriouni, Theodora; Teychené, Sébastien; Biscans, Béatrice

    2017-04-01

    The solubility of seven pharmaceutical compounds (paracetamol, benzoic acid, 4-aminobenzoic acid, salicylic acid, ibuprofen, naproxen and temazepam) in pure and mixed solvents as a function of temperature is calculated with SciPharma, a semi-empirical approach based on PC-SAFT, and the NRTL-SAC model. To conduct a fair comparison between the approaches, the parameters of the compounds were regressed against the same solubility data, chosen to account for hydrophilic, polar and hydrophobic interactions. Only these solubility data were used by both models for predicting solubility in other pure and mixed solvents for which experimental data were available for comparison. A total of 386 pure solvent data points were used for the comparison comprising one or more temperatures per solvent. SciPharma is found to be more accurate than NRTL-SAC on the pure solvent data used especially in the description of the temperature dependence. This is due to the appropriate parameterization of the pharmaceuticals and the temperature-dependent description of the activity coefficient in PC-SAFT. The solubility in mixed solvents is predicted satisfactorily with SciPharma. NRTL-SAC tends to overestimate the solubility in aqueous solutions of alcohols or shows invariable solubility with composition in other cases.

  5. SCiP at 35: an idiosyncratic history of the society for computers in psychology.

    PubMed

    Wolfe, Christopher R

    2006-05-01

    SCiP history may be divided into three eras: the Paleozoic (1971-1982), the Mesozoic (1982-1994), and the Cenozoic (1994-present). Following a list of Secretary-Treasurers, a list of all SCiP Presidents is provided in Table 1. Next I present personal highlights, including the first symposium on psychology and the World-Wide Web; David Rumelhart's mathematical explanation of connectionism; and Stevan Hamad's discussion of "freeing" the journal literature. I observe that a small conference is becoming more intimate and that much of our mission involves figuring out how to conduct high-quality scientific research with consumer-grade electronics. I argue that we are an increasingly international organization, that graduate students are welcome, and that we should become more inclusive in the areas of gender and ethnicity and should make membership more meaningful I conclude by looking ahead and attempting to predict the future.

  6. Measuring self-esteem after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Self-esteem item bank and short form.

    PubMed

    Kalpakjian, Claire Z; Tate, Denise G; Kisala, Pamela A; Tulsky, David S

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury-Quality of Life (SCI-QOL) Self-esteem item bank. Using a mixed-methods design, we developed and tested a self-esteem item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory-(IRT) based analytic approaches, including tests of model fit, differential item functioning (DIF) and precision. We tested a pool of 30 items at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters/Bronx Department of Veterans Affairs hospital. A total of 717 individuals with SCI completed the self-esteem items. A unidimensional model was observed (CFI=0.946; RMSEA=0.087) and measurement precision was good (theta range between -2.7 and 0.7). Eleven items were flagged for DIF; however, effect sizes were negligible with little practical impact on score estimates. The final calibrated item bank resulted in 23 retained items. This study indicates that the SCI-QOL Self-esteem item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available.

  7. A Novel Approach for Effectively Treating SCI Pain, Improving Opioid Efficacy, and Preventing Opioid-Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2016-12-01

    Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Spinal cord injury (SCI) is a disabling and costly condition...23 11. Appendices…………………………………………………………. 24 INTRODUCTION   Spinal cord injury (SCI) is a disabling and costly condition... learned everything taught in the renowned Spinal Cord Injury Training Program. Since Gaudet already has training in SCI research, further training

  8. Cell-type specific expression of constitutively-active Rheb promotes regeneration of bulbospinal respiratory axons following cervical SCI.

    PubMed

    Urban, Mark W; Ghosh, Biswarup; Strojny, Laura R; Block, Cole G; Blazejewski, Sara M; Wright, Megan C; Smith, George M; Lepore, Angelo C

    2018-05-01

    Damage to respiratory neural circuitry and consequent loss of diaphragm function is a major cause of morbidity and mortality in individuals suffering from traumatic cervical spinal cord injury (SCI). Repair of CNS axons after SCI remains a therapeutic challenge, despite current efforts. SCI disrupts inspiratory signals originating in the rostral ventral respiratory group (rVRG) of the medulla from their phrenic motor neuron (PhMN) targets, resulting in loss of diaphragm function. Using a rat model of cervical hemisection SCI, we aimed to restore rVRG-PhMN-diaphragm circuitry by stimulating regeneration of injured rVRG axons via targeted induction of Rheb (ras homolog enriched in brain), a signaling molecule that regulates neuronal-intrinsic axon growth potential. Following C2 hemisection, we performed intra-rVRG injection of an adeno-associated virus serotype-2 (AAV2) vector that drives expression of a constitutively-active form of Rheb (cRheb). rVRG neuron-specific cRheb expression robustly increased mTOR pathway activity within the transduced rVRG neuron population ipsilateral to the hemisection, as assessed by levels of phosphorylated ribosomal S6 kinase. By co-injecting our novel AAV2-mCherry/WGA anterograde/trans-synaptic axonal tracer into rVRG, we found that cRheb expression promoted regeneration of injured rVRG axons into the lesion site, while we observed no rVRG axon regrowth with AAV2-GFP control. AAV2-cRheb also significantly reduced rVRG axonal dieback within the intact spinal cord rostral to the lesion. However, cRheb expression did not promote any recovery of ipsilateral hemi-diaphragm function, as assessed by inspiratory electromyography (EMG) burst amplitudes. This lack of functional recovery was likely because regrowing rVRG fibers did not extend back into the caudal spinal cord to synaptically reinnervate PhMNs that we retrogradely-labeled with cholera toxin B from the ipsilateral hemi-diaphragm. Our findings demonstrate that enhancing neuronal

  9. Theoretical Risk and Prevention Model for Secondary Health Conditions and Mortality After SCI: 15 Years of Research

    PubMed Central

    Krause, James S.; Saunders, Lee L.; DiPiro, Nicole D.; Reed, Karla S.

    2013-01-01

    Background: To successfully prevent secondary health conditions (SHCs) and promote longevity after spinal cord injury (SCI), we must first understand the risk factors precipitating their occurrence and develop strategies to address these risk factors. Conceptual models may aid in identifying the nature of SHCs and guide research, clinical practice, and the development of prevention strategies. Objective: Our purpose is to review and refine an existing theoretical risk and prevention model (TRPM) as a means of classifying risk and protective factors for SHCs and mortality after SCI and for identifying points of intervention. Methods: We describe conceptual work within the field of SCI research and SHCs, including a description of the TRPM, a review of research using the TRPM, and conceptual enhancements to the TRPM based on previous research. Conclusions: The enhanced TRPM directs research to the timing and chronicity of the SHCs and their relationship with overall health and physiologic decline. Future research should identify differences in the nature of SHCs, the extent to which they relate to risk and protective factors, and the degree to which they may be prevented with appropriate research-based strategies. PMID:23459002

  10. DoD Information Security Program and Protection of Sensitive Compartmented Information (SCI)

    DTIC Science & Technology

    2016-04-21

    collateral, special access program, SCI, and controlled unclassified information ( CUI ) within an overarching DoD Information Security Program...classified, safeguarded, and declassified in accordance with References (c), (d), and DoD Manual 5200.01 (Reference (i)). CUI will be identified...Information will not be classified, continue to be maintained as classified, or fail to be declassified, or be designated CUI under any circumstances in

  11. Sleep-Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2015-10-01

    randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using portable sleep studies, and...systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize participants to 4 months of PAP...TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a

  12. Sleep Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2015-11-30

    randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using portable sleep studies, and...systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize participants to 4 months of PAP...TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a

  13. Platelet Glycoprotein lb-1X and Malignancy

    DTIC Science & Technology

    2011-09-01

    Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets. Proc Natl Acad Sci...JM, Hakim J, de Prost D. Vascular endothelial growth factor production by fibroblasts in response to factor VIIa binding to tissue factor involves...interactions in vitro. (14) The extrinsic pathway of coagulation triggered by factor VII ( FVII ) and tissue factor can be activated in cancer patients. (15

  14. Biomarkers for PTSD

    DTIC Science & Technology

    2014-07-01

    Molecular evidence of stress- induced acute heart injury in a mouse model simulating posttraumatic stress disorder. Proc Natl Acad Sci U S A. 2014 Feb...obtaining measures aligned with the core neurocognitive domains: IQ, working memory ( auditory /visual), processing speed, verbal memory (immediate...in the test sample and combined sample with a similar pattern for the validation sample. Similarly, performance on tests of auditory and visual

  15. Preclinical Mouse Models of Neurofibromatosis

    DTIC Science & Technology

    2006-10-01

    Patients. Persons with NF1 are predisposed to benign neurofibromas, optic nerve gliomas, and to specific malignant neoplasms . Individuals with NF1...malignant neoplasms seen in NF1 patients include astrocytoma, malignant peripheral nerve sheath tumor (MPNST), pheochromocytoma, and juvenile...Kras in hematopoietic cells initiates a rapidly fatal myeloproliferative disorder. Proc Natl Acad Sci U S A 2004;101(2):597-602. 14. Chan IT, Kutok JL

  16. Pointwise approximation of modified conjugate functions by matrix operators of conjugate Fourier series of [Formula: see text]-periodic functions.

    PubMed

    Kubiak, Mateusz; Łenski, Włodzimierz; Szal, Bogdan

    2018-01-01

    We extend the results of Xh. Z. Krasniqi (Acta Comment. Univ. Tartu Math. 17:89-101, 2013) and the authors (Acta Comment. Univ. Tartu Math. 13:11-24, 2009; Proc. Est. Acad. Sci. 67:50-60, 2018) to the case when considered function is [Formula: see text]-periodic and the measure of approximation depends on r -differences of the entries of the considered matrices.

  17. Effects of Chronic Alcohol Exposure on Kainate Receptor-Mediated Neurotransmission in the Hippocampus

    DTIC Science & Technology

    2004-09-01

    hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235

  18. Use of Synthetic Antibodies Targeted to the Jak/Stat Pathway in Breast Cancer

    DTIC Science & Technology

    2011-03-01

    substance P ( SP ), an 11 amino acid neuropeptide that is rapidly internalized through specific interaction...no. 27 11011–11015 BI O CH EM IS TR Y Results Engineering a Delivery Vehicle Based on Substance P . Substance P ( SP ) is an 11 amino acid... substance P variant for receptor-mediated delivery of synthetic antibodies into tumor cells, Proc Natl Acad Sci USA. 106:11011- 5 , 2009.

  19. A Nonlinear Transfer Operator Theorem

    NASA Astrophysics Data System (ADS)

    Pollicott, Mark

    2017-02-01

    In recent papers, Kenyon et al. (Ergod Theory Dyn Syst 32:1567-1584 2012), and Fan et al. (C R Math Acad Sci Paris 349:961-964 2011, Adv Math 295:271-333 2016) introduced a form of non-linear thermodynamic formalism based on solutions to a non-linear equation using matrices. In this note we consider the more general setting of Hölder continuous functions.

  20. Costs and Length of Stay for the Acute Care of Patients with Motor-Complete Spinal Cord Injury Following Cervical Trauma: The Impact of Early Transfer to Specialized Acute SCI Center.

    PubMed

    Richard-Denis, Andréane; Ehrmann Feldman, Debbie; Thompson, Cynthia; Bourassa-Moreau, Étienne; Mac-Thiong, Jean-Marc

    2017-07-01

    Acute spinal cord injury (SCI) centers aim to optimize outcome following SCI. However, there is no timeframe to transfer patients from regional to SCI centers in order to promote cost-efficiency of acute care. Our objective was to compare costs and length of stay (LOS) following early and late transfer to the SCI center. A retrospective cohort study involving 116 individuals was conducted. Group 1 (n = 87) was managed in an SCI center promptly after the trauma, whereas group 2 (n = 29) was transferred to the SCI center only after surgery. Direct comparison and multivariate linear regression analyses were used to assess the relationship between costs, LOS, and timing to transfer to the SCI center. Length of stay was significantly longer for group 2 (median, 93.0 days) as compared with group 1 (median, 40.0 days; P < 10), and average costs were also higher (median, Canadian $17,920.0 vs. $10,521.6; P = 0.004) for group 2, despite similar characteristics. Late transfer to the SCI center was the main predictive factor of longer LOS and increased costs. Early admission to the SCI center was associated with shorter LOS and lower costs for patients sustaining tetraplegia. Early referral to an SCI center before surgery could lower the financial burden for the health care system. Complete the self-assessment activity and evaluation online at http://www.physiatry.org/JournalCME CME OBJECTIVES: Upon completion of this article, the reader should be able to: (1) Determine the optimal timing for transfer of individuals with cervical traumatic spinal cord injury (SCI) in order to decrease acute care resource utilization; (2) Determine benefits of a complete perioperative management in a specialized SCI center; and (3) Identify factors that may influence resource utilization for acute care following motor-complete tetraplegia. Advanced ACCREDITATION: The Association of Academic Physiatrists is accredited by the Accreditation Council for Continuing Medical Education to provide

  1. SciTech Clubs for Girls. [Final report], September 1, 1991--April 30, 1994

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Malamud, E.; Diaz, O.; Cox, J.

    1994-12-31

    The program of SciTech Clubs for Girls and its progress are described. This is a program that promotes the learning of science and mathematics by girls in the age range of 9 to 13 years through the process of building exhibits and learning from local professionals. A list of exhibits and a critique of the program are given.

  2. Measuring self-esteem after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Self-esteem item bank and short form

    PubMed Central

    Kalpakjian, Claire Z.; Tate, Denise G.; Kisala, Pamela A.; Tulsky, David S.

    2015-01-01

    Objective To describe the development and psychometric properties of the Spinal Cord Injury-Quality of Life (SCI-QOL) Self-esteem item bank. Design Using a mixed-methods design, we developed and tested a self-esteem item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory- (IRT) based analytic approaches, including tests of model fit, differential item functioning (DIF) and precision. Setting We tested a pool of 30 items at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters/Bronx Department of Veterans Affairs hospital. Participants A total of 717 individuals with SCI completed the self-esteem items. Results A unidimensional model was observed (CFI = 0.946; RMSEA = 0.087) and measurement precision was good (theta range between −2.7 and 0.7). Eleven items were flagged for DIF; however, effect sizes were negligible with little practical impact on score estimates. The final calibrated item bank resulted in 23 retained items. Conclusion This study indicates that the SCI-QOL Self-esteem item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available. PMID:26010972

  3. SciStarter 2.0: A Digital Platform to Foster and Study Sustained Engagement in Citizen Science

    NASA Astrophysics Data System (ADS)

    Hoffman, C.

    2016-12-01

    SciStarter is a popular online hotspot for citizen science. As a Match.com meets Amazon for citizen science projects, we connect the millions of citizen scientists to thousands of projects and events, and to the resources they need to participate. These opportunities represent ways for the general public from kids to adults to get involved in scientific research. Recently, SciStarter developed a new digital infrastructure to support sustained engagement in citizen science, and research into the behaviors and motivations of participants. The new digital infrastructure of SciStarter includes contribution tracking tools to make it easier to participate in multiple projects, enhanced GIS information to promote locally relevant projects, an online personal dashboard to keep track of contributions, and the use of these tools (contribution tracking, GIS, dashboard) by project owners and researchers to better understand and respond to the needs and interests of citizen science participants. We will provide an overview of these tools and the research behind their development. We will then explore how these new tools advance citizen science towards a future with more pathways to participatory policymaking, expanded access to informal STEM experiences, and lowered barriers to citizen science. Finally, we will present the research questions that can and will be answered through the site by practitioners in the diverse science and citizen science fields.

  4. panMetaDocs, eSciDoc, and DOIDB - an infrastructure for the curation and publication of file-based datasets for 'GFZ Data Services'

    NASA Astrophysics Data System (ADS)

    Ulbricht, Damian; Elger, Kirsten; Bertelmann, Roland; Klump, Jens

    2016-04-01

    With the foundation of DataCite in 2009 and the technical infrastructure installed in the last six years it has become very easy to create citable dataset DOIs. Nowadays, dataset DOIs are increasingly accepted and required by journals in reference lists of manuscripts. In addition, DataCite provides usage statistics [1] of assigned DOIs and offers a public search API to make research data count. By linking related information to the data, they become more useful for future generations of scientists. For this purpose, several identifier systems, as ISBN for books, ISSN for journals, DOI for articles or related data, Orcid for authors, and IGSN for physical samples can be attached to DOIs using the DataCite metadata schema [2]. While these are good preconditions to publish data, free and open solutions that help with the curation of data, the publication of research data, and the assignment of DOIs in one software seem to be rare. At GFZ Potsdam we built a modular software stack that is made of several free and open software solutions and we established 'GFZ Data Services'. 'GFZ Data Services' provides storage, a metadata editor for publication and a facility to moderate minted DOIs. All software solutions are connected through web APIs, which makes it possible to reuse and integrate established software. Core component of 'GFZ Data Services' is an eSciDoc [3] middleware that is used as central storage, and has been designed along the OAIS reference model for digital preservation. Thus, data are stored in self-contained packages that are made of binary file-based data and XML-based metadata. The eSciDoc infrastructure provides access control to data and it is able to handle half-open datasets, which is useful in embargo situations when a subset of the research data are released after an adequate period. The data exchange platform panMetaDocs [4] makes use of eSciDoc's REST API to upload file-based data into eSciDoc and uses a metadata editor [5] to annotate the files

  5. Evaluating the Impact of Data Placement to Spark and SciDB with an Earth Science Use Case

    NASA Technical Reports Server (NTRS)

    Doan, Khoa; Oloso, Amidu; Kuo, Kwo-Sen; Clune, Thomas; Yu, Hongfeng; Nelson, Brian; Zhang, Jian

    2016-01-01

    We investigate the impact of data placement for two Big Data technologies, Spark and SciDB, with a use case from Earth Science where data arrays are multidimensional. Simultaneously, this investigation provides an opportunity to evaluate the performance of the technologies involved. Two datastores, HDFS and Cassandra, are used with Spark for our comparison. It is found that Spark with Cassandra performs better than with HDFS, but SciDB performs better yet than Spark with either datastore. The investigation also underscores the value of having data aligned for the most common analysis scenarios in advance on a shared nothing architecture. Otherwise, repartitioning needs to be carried out on the fly, degrading overall performance.

  6. Measurement of K + production cross section by 8 GeV protons using high energy neutrino interactions in the SciBooNE detector

    DOE PAGES

    Cheng, G.

    2011-07-28

    The SciBooNE Collaboration reports K + production cross section and rate measurements using high energy daughter muon neutrino scattering data off the SciBar polystyrene (C 8H 8) target in the SciBooNE detector. The K + mesons are produced by 8 GeV protons striking a beryllium target in Fermilab Booster Neutrino Beam line (BNB). Using observed neutrino and antineutrino events in SciBooNE, we measure d 2σ/dpdΩ = (5.34 ±0.76) mb/(GeV/c x sr) for p + Be =K + + X at mean K + energy of 3.9 GeV and angle (with respect to the proton beam direction) of 3.7 degrees, correspondingmore » to the selected K + sample. Compared to Monte Carlo predictions using previous higher energy K + production measurements, this measurement, which uses the NUANCE neutrino interaction generator, is consistent with a normalization factor of 0.85 ± 0.12. This agreement is evidence that the extrapolation of the higher energy K + measurements to an 8 GeV beam energy using Feynman scaling is valid. This measurement reduces the error on the K + production cross section from 40% to 14%.« less

  7. A randomized controlled trial to test the efficacy of the SCI Get Fit Toolkit on leisure-time physical activity behaviour and social-cognitive processes in adults with spinal cord injury.

    PubMed

    Arbour-Nicitopoulos, Kelly P; Sweet, Shane N; Lamontagne, Marie-Eve; Ginis, Kathleen A Martin; Jeske, Samantha; Routhier, François; Latimer-Cheung, Amy E

    2017-01-01

    Single blind, two-group randomized controlled trial. To evaluate the efficacy of the SCI Get Fit Toolkit delivered online on theoretical constructs and moderate-to-vigorous physical activity (MVPA) among adults with SCI. Ontario and Quebec, Canada. Inactive, English- and French-speaking Canadian adults with traumatic SCI with Internet access, and no self-reported cognitive or memory impairments. Participants ( N =90 M age =48.12±11.29 years; 79% male) were randomized to view the SCI Get Fit Toolkit or the Physical Activity Guidelines for adults with SCI (PAG-SCI) online. Primary (intentions) and secondary (outcome expectancies, self-efficacy, planning and MVPA behaviour) outcomes were assessed over a 1-month period. Of the 90 participants randomized, 77 were included in the analyses. Participants viewed the experimental stimuli only briefly, reading the 4-page toolkit for approximately 2.5 min longer than the 1-page guideline document. No condition effects were found for intentions, outcome expectancies, self-efficacy, and planning (ΔR 2 ⩽0.03). Individuals in the toolkit condition were more likely to participate in at least one bout of 20 min of MVPA behaviour at 1-week post-intervention compared to individuals in the guidelines condition (OR=3.54, 95% CI=0.95, 13.17). However, no differences were found when examining change in weekly minutes of MVPA or comparing whether participants met the PAG-SCI. No firm conclusions can be made regarding the impact of the SCI Get Fit Toolkit in comparison to the PAG-SCI on social cognitions and MVPA behaviour. The limited online access to this resource may partially explain these null findings.

  8. Calibration of the soil conditioning index (SCI) to soil organic carbon in the southeastern USA

    USDA-ARS?s Scientific Manuscript database

    Prediction of soil organic C sequestration with adoption of various conservation agricultural management approaches is needed to meet the emerging market for environmental services provided by agricultural land stewardship. The soil conditioning index (SCI) is a relatively simple model used by the ...

  9. Comparison of predicted pesticide concentrations in groundwater from SCI-GROW and PRZM-GW models with historical monitoring data.

    PubMed

    Estes, Tammara L; Pai, Naresh; Winchell, Michael F

    2016-06-01

    A key factor in the human health risk assessment process for the registration of pesticides by the US Environmental Protection Agency (EPA) is an estimate of pesticide concentrations in groundwater used for drinking water. From 1997 to 2011, these estimates were obtained from the EPA empirical model SCI-GROW. Since 2012, these estimates have been obtained from the EPA deterministic model PRZM-GW, which has resulted in a significant increase in estimated groundwater concentrations for many pesticides. Historical groundwater monitoring data from the National Ambient Water Quality Assessment (NAWQA) Program (1991-2014) were compared with predicted groundwater concentrations from both SCI-GROW (v.2.3) and PRZM-GW (v.1.07) for 66 different pesticides of varying environmental fate properties. The pesticide environmental fate parameters associated with over- and underprediction of groundwater concentrations by the two models were evaluated. In general, SCI-GROW2.3 predicted groundwater concentrations were close to maximum historically observed groundwater concentrations. However, for pesticides with soil organic carbon content values below 1000 L kg(-1) and no simulated hydrolysis, PRZM-GW overpredicted, often by greater than 100 ppb. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  10. Serotonin receptor and dendritic plasticity in the spinal cord mediated by chronic serotonergic pharmacotherapy combined with exercise following complete SCI in the adult rat.

    PubMed

    Ganzer, Patrick D; Beringer, Carl R; Shumsky, Jed S; Nwaobasi, Chiemela; Moxon, Karen A

    2018-06-01

    Severe spinal cord injury (SCI) damages descending motor and serotonin (5-HT) fiber projections leading to paralysis and serotonin depletion. 5-HT receptors (5-HTRs) subsequently upregulate following 5-HT fiber degeneration, and dendritic density decreases indicative of atrophy. 5-HT pharmacotherapy or exercise can improve locomotor behavior after SCI. One might expect that 5-HT pharmacotherapy acts on upregulated spinal 5-HTRs to enhance function, and that exercise alone can influence dendritic atrophy. In the current study, we assessed locomotor recovery and spinal proteins influenced by SCI and therapy. 5-HT, 5-HT 2A R, 5-HT 1A R, and dendritic densities were quantified both early (1 week) and late (9 weeks) after SCI, and also following therapeutic interventions (5-HT pharmacotherapy, bike therapy, or a combination). Interestingly, chronic 5-HT pharmacotherapy largely normalized spinal 5-HTR upregulation following injury. Improvement in locomotor behavior was not correlated to 5-HTR density. These results support the hypothesis that chronic 5-HT pharmacotherapy can mediate recovery following SCI, despite acting on largely normal spinal 5-HTR levels. We next assessed spinal dendritic plasticity and its potential role in locomotor recovery. Single therapies did not normalize the loss of dendritic density after SCI. Groups displaying significantly atrophied dendritic processes were rarely able to achieve weight supported open-field locomotion. Only a combination of 5-HT pharmacotherapy and bike therapy enabled significant open-field weigh-supported stepping, mediated in part by restoring spinal dendritic density. These results support the use of combined therapies to synergistically impact multiple markers of spinal plasticity and improve motor recovery. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. ISSN exercise & sport nutrition review: research & recommendations

    PubMed Central

    2010-01-01

    Sports nutrition is a constantly evolving field with hundreds of research papers published annually. For this reason, keeping up to date with the literature is often difficult. This paper is a five year update of the sports nutrition review article published as the lead paper to launch the JISSN in 2004 and presents a well-referenced overview of the current state of the science related to how to optimize training and athletic performance through nutrition. More specifically, this paper provides an overview of: 1.) The definitional category of ergogenic aids and dietary supplements; 2.) How dietary supplements are legally regulated; 3.) How to evaluate the scientific merit of nutritional supplements; 4.) General nutritional strategies to optimize performance and enhance recovery; and, 5.) An overview of our current understanding of the ergogenic value of nutrition and dietary supplementation in regards to weight gain, weight loss, and performance enhancement. Our hope is that ISSN members and individuals interested in sports nutrition find this review useful in their daily practice and consultation with their clients.

  12. Exercise therapy and recovery after SCI: evidence that shows early intervention improves recovery of function

    PubMed Central

    Brown, AK; Woller, SA; Moreno, G; Grau, JW; Hook, MA

    2011-01-01

    Study design This was designed as an experimental study. Objectives Locomotor training is one of the most effective strategies currently available for facilitating recovery of function after an incomplete spinal cord injury (SCI). However, there is still controversy regarding the timing of treatment initiation for maximal recovery benefits. To address this issue, the present study compares the effects of exercise initiated in the acute and secondary phase of SCI. Setting Texas A&M University, College Station, TX, USA. Methods Rats received a moderate spinal contusion injury and began an exercise program 1 (D1-EX) or 8 days (D8-EX) later. They were individually placed into transparent exercise balls for 60 min per day, for 14 consecutive days. Control rats were placed in exercise balls that were rendered immobile. Motor and sensory recovery was assessed for 28 days after injury. Results The D1-EX rats recovered significantly more locomotor function (BBB scale) than controls and D8-EX rats. Moreover, analyses revealed that rats in the D8-EX group had significantly lower tactile reactivity thresholds compared with control and D1-EX rats, and symptoms of allodynia were not reversed by exercise. Rats in the D8-EX group also had significantly larger areas of damage across spinal sections caudal to the injury center compared with the D1-EX group. Conclusion These results indicate that implementing an exercise regimen in the acute phase of SCI maximizes the potential for recovery of function. PMID:21242998

  13. The End of Alchemy? The Repudiation and Persistence of Chrysopoeia at the Académie Royale des Sciences in the Eighteenth Century.

    PubMed

    Principe, Lawrence M

    2014-01-01

    The general abandonment of serious endeavor toward metallic transmutation represents a major development in the history of chemistry, yet its exact causes and timing remain unclear. This essay examines the fate of chrysopoeia at the eighteenth-century Académie Royale des Sciences. It reveals a long-standing tension between Académie chemists, who pursued transmutation, and administrators, who tried to suppress it. This tension provides background for Etienne-François Geoffroy's 1722 paper describing fraudulent practices around transmutation. Although transmutation seems to disappear after Geoffroy's paper, manuscripts reveal that most of the institution's chemists continued to pursue it privately until at least the 1760s, long after widely accepted dates for the "demise of alchemy" in learned circles.

  14. Assessment of Attention to Clothing and Impact of Its Restrictive Factors in Iranian Patients with Traumatic Spinal Cord Injury (ACIRF-SCI): Introduction of a New Questionnaire.

    PubMed

    Laleh, Leila; Latifi, Sahar; Koushki, Davood; Matin, Marzieh; Javidan, Abbas Norouzi; Yekaninejad, Mir Saeed

    2015-01-01

    Patients with spinal cord injury (SCI) deal with various restrictive factors regarding their clothing, such as disability and difficulty with access to shopping centers. We designed a questionnaire to assess attention to clothing and impact of its restrictive factors among Iranian patients with SCI (ACIRF-SCI). The ACIRF-SCI has 5 domains: functional, medical, attitude, aesthetic, and emotional. The first 3 domains reflect the impact of restrictive factors (factors that restrict attention to clothing), and the last 2 domains reflect attention to clothing and fashion. Functional restrictive factors include disability and dependence. Medical restrictive factors include existence of specific medical conditions that interfere with clothing choice. Construct validity was assessed by factorial analysis, and reliability was expressed by Cronbach's alpha. A total of 100 patients (75 men and 25 women) entered this study. Patients with a lower injury level had a higher total score (P < .0001), and similarly, patients with paraplegia had higher scores than those with tetraplegia (P < .0001), which illustrates an admissible discriminant validity. Postinjury duration was positively associated with total scores (r = 0.21, P = .04). Construct validity was 0.97, and Cronbach's alpha was 0.61. Iranian patients with SCI who have greater ability and independence experience a lower impact of restrictive factors related to clothing. The ACIRF-SCI reveals that this assumption is statistically significant, which shows its admissible discriminant validity. The measured construct validity (0.97) and reliability (internal consistency expressed by alpha = 0.61) are acceptable.

  15. Testing and refining the Science in Risk Assessment and Policy (SciRAP) web-based platform for evaluating the reliability and relevance of in vivo toxicity studies.

    PubMed

    Beronius, Anna; Molander, Linda; Zilliacus, Johanna; Rudén, Christina; Hanberg, Annika

    2018-05-28

    The Science in Risk Assessment and Policy (SciRAP) web-based platform was developed to promote and facilitate structure and transparency in the evaluation of ecotoxicity and toxicity studies for hazard and risk assessment of chemicals. The platform includes sets of criteria and a colour-coding tool for evaluating the reliability and relevance of individual studies. The SciRAP method for evaluating in vivo toxicity studies was first published in 2014 and the aim of the work presented here was to evaluate and develop that method further. Toxicologists and risk assessors from different sectors and geographical areas were invited to test the SciRAP criteria and tool on a specific set of in vivo toxicity studies and to provide feedback concerning the scientific soundness and user-friendliness of the SciRAP approach. The results of this expert assessment were used to refine and improve both the evaluation criteria and the colour-coding tool. It is expected that the SciRAP web-based platform will continue to be developed and enhanced to keep up to date with the needs of end-users. Copyright © 2018 John Wiley & Sons, Ltd.

  16. 10th Annual Systems Engineering Conference - Focusing on Improving Performance of Defense Systems Programs. Volume 1. Tuesday Presentations

    DTIC Science & Technology

    2007-10-25

    Exchange Platforms Publishers Resellers iTunes Non-Profit/ Government/ Self- Managed Library of Congress Library Consortia Fed. Tech Transfer Sites Univ...Thompson Dialog – Thomson MicroPatent – Thomson Pharma – WIPO Digital Patent Library* (*nonprofit organization) • iTunes • IP Exchange Platforms...Elsevier SciDirect – Nat’l Acad. Press – Lexis, Westlaw – Newspaper web sites • iTunes • Resellers of Copyrighted Material – JSTOR – EBSCOHost

  17. Carbon Monoxide Poisoning: Death on Mount McKinley,

    DTIC Science & Technology

    1987-05-08

    Additionally, studies by Astrup(5) and Thomas(6) have reported decreased erythrocytic 2, 3- diphosphoglycerate (2, 3-DPG) concentrations with acute...Halebian, et al found no significant difference in measured 02 consumption or extraction between dogs subjected to CO poisoning vs nitrogen anoxia .(9...Astrup P: Intraerythrocytic 2,3- diphosphoglycerate and carbon monoxide exposure. Ann NY Acad Sci 1970;174:252-254. 6. Thomas MF, Penny DG: Hematologic

  18. Zebrafish Functional Genetics Approach to the Pathogenesis of Well-Differentiated Liposarcoma

    DTIC Science & Technology

    2015-12-01

    humans, and predis- posing factors include exposure to dioxin-containing herbicidal agents used during the Vietnam War (Agent Orange) and radiation...Acad Sci U S A (2011);108:16386-91. PMCID: 3182699 Institute of Medicine (1994). Veterans and Agent Orange: Health Effects of Herbicides Used in...to phenoxy herbicides , chlorophenols, and dioxins. An expanded and updated international cohort study." Am J Epidemiol (1997);145:1061-75. PMCID

  19. Systemic and Pulmonary Hypertension After Resuscitation with Cell-Free Hemoglobin

    DTIC Science & Technology

    1992-07-01

    Endotoxin was measured using a kinetic turbidimetric modification of the Limulus amoebocyte lysate assay (9). The rabbit pyrogen test was performed...renal failure. This injury occurred in half of the animals that were resuscitated with HPLC purified, pyrogen -negative, low-residual- phosphate HbAo...oxide: an endogenous modulator of leukocyte adhesion. Proc. Nat. Acad. Sci. USA 88:4651-4655, 1991. 17. Moncada, S., K. M. J. Palmer, E. A. Higgs. Nitric

  20. The Relationship of African Apes, Man, and Old World Monkeys

    PubMed Central

    Leakey, L. S. B.

    1970-01-01

    The conclusions of Wilson and Sarich (Proc. Nat. Acad. Sci. USA, 63, 1088-1093 (1969) that the human lineage diverged from that leading to the African apes about 4 to 5 million years ago is shown to be based upon a wholly unsupported assumption that the Superfamilies Hominoidea and Cercopithecoidea only separated from each other some 30 million years ago. This is entirely contrary to most recent palaeontological evidence. PMID:5002096

  1. Biological versus Electronic Adaptive Coloration: How Can One Inform the Other?

    DTIC Science & Technology

    2012-01-01

    Hyperspectral imaging of cuttlefish camouflage indicates good color match in the eyes of fish predators. Proc. Natl Acad. Sci. USA 108, 9148–9153. (doi...Patrick B. Dennis, Rajesh R. Naik, Eric Forsythe and inform the other? Biological versus electronic adaptive coloration : how can one References...TYPE 3. DATES COVERED 00-00-2012 to 00-00-2012 4. TITLE AND SUBTITLE Biological versus electronic adaptive coloration : how can one inform the

  2. Structure Function Analysis of the Ferric Uptake Regulator (Fur) of Helicobacter pylori

    DTIC Science & Technology

    2010-03-17

    Escherichia coli, Listeria monocytogenes, and Vibrio vulnificus and hemochromatosis (125). In addition, iron overload in haemodialysis patients is...transcriptional regulation of an iron-regulated virulence gene in Vibrio cholerae. Proc Natl Acad Sci U S A 88:1125-9. 89. Goodwin, C. S., J. A...via direct interaction of Fur in a pathogenic bacterium, Vibrio vulnificus. J Bacteriol 189:2629-36. 76 130. Lee, H. J., K. J. Park, A. Y

  3. Activation of Antitumorigenic Stat3beta in Breast Cancer by Splicing Redirection

    DTIC Science & Technology

    2013-07-01

    4175) model system REPORTABLE OUTCOMES 1. Lee Spraggon and Luca Cartegni; Antisense Modulation of RNA Processing as a Therapeutic Approach in...modulation. Proc Natl Acad Sci U S A 108: 17779-17784. 26. Spraggon L, Cartegni L (2013) Antisense modulation of RNA processing as a therapeutic...pre-print copy 1 Antisense Modulation of RNA Processing as a Therapeutic Approach in Cancer Therapy Lee Spraggon and Luca Cartegni Molecular

  4. Undergraduate Training in Mammary Gland Biology and Breast Cancer

    DTIC Science & Technology

    2005-05-01

    1994) Toward a Physiological Approach to Breast Cancer Prevention. Cancer Epidemiol Biomarkers Prev. 3(4): 353-364. 10. Thordarson , G., Jin, E...Yang, J., Rajkumar, L., Thordarson , G., Chen, X., and Nandi, S. (1999) Hormonal Prevention of Breast Cancer: Mimicking the protective effect of pregnancy...Proc. Natl. Acad. Sci., 96: 2520-2525. 19. Rajkumar, L., Guzman, R.C., Yang, J., Thordarson , G., Talamantes, F., Nandi, S. (2001) Short-term

  5. Iowa State University – Final Report for SciDAC3/NUCLEI

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vary, James P

    The Iowa State University (ISU) contributions to the NUCLEI project are focused on developing, implementing and running an efficient and scalable configuration interaction code (Many-Fermion Dynamics – nuclear or MFDn) for leadership class supercomputers addressing forefront research problems in low-energy nuclear physics. We investigate nuclear structure and reactions with realistic nucleon-nucleon (NN) and three-nucleon (3N) interactions. We select a few highlights from our work that has produced a total of more than 82 refereed publications and more than 109 invited talks under SciDAC3/NUCLEI.

  6. Effect of and satisfaction with www.elearnSCI.org for training of nurse students: a submodule pilot study.

    PubMed

    Liu, N; Li, X W; Zhou, M W; Krassioukov, A V; Biering-Sørensen, F

    2014-10-01

    Interventional training session. To investigate the effect and satisfaction with didactic training using printed text of a submodule of www.elearnSCI.org for nurse students and to assess the answers of each question. A Peking University teaching hospital. Twenty-eight nurse students in two groups (14 in each) were involved. Only group A received a translated print-out of the slides from the 'Nursing management' submodule in www.elearnSCI.org for 1-h self-study before the class. At the beginning of class, both groups were tested using the self assessment questions. Then, a lecture according to the content of this submodule was carried out and afterwards both groups answered the self assessment questions again. Finally, both groups filled in a training course satisfaction questionnaire. At the beginning of the class, the mean score (max 9) of the self assessment in group A was 7.1 ± 1.1, which was significantly higher than that in group B (4.9 ± 1.7, P = 0.001). After the lecture, the mean score of the self assessment in group A had insignificantly increased to 7.4 ± 1.3, whereas in group B it increased significantly to 6.9 ± 0.8 (P < 0.001). The mean score (max 50) of the training course satisfaction questionnaire was 42.8 ± 5.2. Sixty-four percentage of the students indicated that they were very satisfied (overall score ⩾ 42) with the training and no students were unsatisfied (overall score < 30). Self-study and lecture presentation are effective methods for training the content of www.elearnSCI.org to nurse students. The training satisfaction of this submodule within the www.elearnSCI.org is favorable.

  7. eSciMart: Web Platform for Scientific Software Marketplace

    NASA Astrophysics Data System (ADS)

    Kryukov, A. P.; Demichev, A. P.

    2016-10-01

    In this paper we suggest a design of a web marketplace where users of scientific application software and databases, presented in the form of web services, as well as their providers will have presence simultaneously. The model, which will be the basis for the web marketplace is close to the customer-to-customer (C2C) model, which has been successfully used, for example, on the auction sites such as eBay (ebay.com). Unlike the classical model of C2C the suggested marketplace focuses on application software in the form of web services, and standardization of API through which application software will be integrated into the web marketplace. A prototype of such a platform, entitled eSciMart, is currently being developed at SINP MSU.

  8. Effects of Testosterone and Evoked Resistance Exercise after Spinal Cord Injury (TEREX-SCI): study protocol for a randomised controlled trial.

    PubMed

    Gorgey, Ashraf S; Khalil, Refka E; Gill, Ranjodh; O'Brien, Laura C; Lavis, Timothy; Castillo, Teodoro; Cifu, David X; Savas, Jeannie; Khan, Rehan; Cardozo, Christopher; Lesnefsky, Edward J; Gater, David R; Adler, Robert A

    2017-04-04

    Individuals with spinal cord injury (SCI) are at a lifelong risk of obesity and chronic metabolic disorders including insulin resistance and dyslipidemia. Within a few weeks of injury, there is a significant decline in whole body fat-free mass, particularly lower extremity skeletal muscle mass, and subsequent increase in fat mass (FM). This is accompanied by a decrease in anabolic hormones including testosterone. Testosterone replacement therapy (TRT) has been shown to increase skeletal muscle mass and improve metabolic profile. Additionally, resistance training (RT) has been shown to increase lean mass and reduce metabolic disturbances in SCI and other clinical populations. 26 individuals with chronic, motor complete SCI between 18 and 50 years old were randomly assigned to a RT+TRT group (n=13) or a TRT group (n=13). 22 participants completed the initial 16-week training phase of the study and 4 participants withdrew. 12 participants of the 22 completed 16 weeks of detraining. The TRT was provided via transdermal testosterone patches (4-6 mg/day). The RT+TRT group had 16 weeks of supervised unilateral progressive RT using surface neuromuscular electrical stimulation with ankle weights. This study will investigate the effects of evoked RT+TRT or TRT alone on body composition (muscle cross-sectional area, visceral adipose tissue, %FM) and metabolic profile (glucose and lipid metabolism) in individuals with motor complete SCI. Findings from this study may help in designing exercise therapies to alleviate the deterioration in body composition after SCI and decrease the incidence of metabolic disorders in this clinical population. The study is currently approved by the McGuire VA Medical Center and Virginia Commonwealth University. All participants read and signed approved consent forms. Results will be submitted to peer-reviewed journals and presented at national and international conferences. Pre-result, NCT01652040. Published by the BMJ Publishing Group

  9. Effects of Testosterone and Evoked Resistance Exercise after Spinal Cord Injury (TEREX-SCI): study protocol for a randomised controlled trial

    PubMed Central

    Gorgey, Ashraf S; Khalil, Refka E; Gill, Ranjodh; O'Brien, Laura C; Lavis, Timothy; Castillo, Teodoro; Cifu, David X; Savas, Jeannie; Khan, Rehan; Cardozo, Christopher; Lesnefsky, Edward J; Gater, David R; Adler, Robert A

    2017-01-01

    Introduction Individuals with spinal cord injury (SCI) are at a lifelong risk of obesity and chronic metabolic disorders including insulin resistance and dyslipidemia. Within a few weeks of injury, there is a significant decline in whole body fat-free mass, particularly lower extremity skeletal muscle mass, and subsequent increase in fat mass (FM). This is accompanied by a decrease in anabolic hormones including testosterone. Testosterone replacement therapy (TRT) has been shown to increase skeletal muscle mass and improve metabolic profile. Additionally, resistance training (RT) has been shown to increase lean mass and reduce metabolic disturbances in SCI and other clinical populations. Methods and analysis 26 individuals with chronic, motor complete SCI between 18 and 50 years old were randomly assigned to a RT+TRT group (n=13) or a TRT group (n=13). 22 participants completed the initial 16-week training phase of the study and 4 participants withdrew. 12 participants of the 22 completed 16 weeks of detraining. The TRT was provided via transdermal testosterone patches (4–6 mg/day). The RT+TRT group had 16 weeks of supervised unilateral progressive RT using surface neuromuscular electrical stimulation with ankle weights. This study will investigate the effects of evoked RT+TRT or TRT alone on body composition (muscle cross-sectional area, visceral adipose tissue, %FM) and metabolic profile (glucose and lipid metabolism) in individuals with motor complete SCI. Findings from this study may help in designing exercise therapies to alleviate the deterioration in body composition after SCI and decrease the incidence of metabolic disorders in this clinical population. Ethics and dissemination The study is currently approved by the McGuire VA Medical Center and Virginia Commonwealth University. All participants read and signed approved consent forms. Results will be submitted to peer-reviewed journals and presented at national and international conferences. Trial

  10. Data supporting Al-Abed et al., Environ. Sci.: Nano, 2016,

    EPA Pesticide Factsheets

    Data files representing each of the Figures and Tables published in Al-Abed et al., Environ. Sci.: Nano, 2016,3, 593. The data file names identify the Figure or Table and each file contains an internal set of data definitionsThis dataset is associated with the following publication:Al-Abed, S.R., J. Virkutyte, J. Ortenzio , R.M. McCarrick, L. Degn, R. Zucker , N. Coates , K. Cleveland, H. Ma, S. Diamond, K. Dreher , and W. Boyes. Environmental aging alters AI(OH)3 coating of TiO2 nanoparticles enhancing their photocatalytic and phototoxicity activities. Environmental Science: Nano. RSC Publishing, Cambridge, UK, N/A, (2016).

  11. More than looking good: impact on quality of life moderates the relationship between functional body image and physical activity in men with SCI.

    PubMed

    Bassett, R L; Martin Ginis, K A

    2009-03-01

    Cross-sectional. To examine the relationship between body image and leisure time physical activity (LTPA) among men with spinal cord injury (SCI). Specifically, to examine the moderating function of the perceived impact of body image on quality of life (QOL). Ontario, Canada. Men with SCI (N=50, 50% paraplegic) reported, (a) their functional and appearance body image (Adult Body Satisfaction Questionnaire), (b) their perceived impact of body image on QOL and (c) LTPA performed over the previous 3 days. Body image was in the 'normal' range compared with the general population. Linear regression analysis found a significant LTPA x body image impact on QOL interaction beta=0.39, P<0.05. Post hoc analysis showed that among individuals who reported a negative effect of body image on QOL, those who engaged in LTPA were less satisfied with their physical function than those who did not. For those who did not perceive their body image to negatively impact their QOL, there was generally no difference in functional body image between those who engaged in LTPA and those who did not. Appearance body image is not related to LTPA for men with SCI. It has been suggested that body dissatisfaction may motivate some individuals to engage in LTPA. However, for men living with SCI, functional body image may be associated with LTPA only when a negative effect on QOL is perceived. Future research should consider the moderating function of the perceived impact of body image on QOL when examining the relationship between LTPA and body image among men living with SCI.

  12. Assessment of Attention to Clothing and Impact of Its Restrictive Factors in Iranian Patients with Traumatic Spinal Cord Injury (ACIRF-SCI): Introduction of a New Questionnaire

    PubMed Central

    Laleh, Leila; Koushki, Davood; Matin, Marzieh; Javidan, Abbas Norouzi; Yekaninejad, Mir Saeed

    2015-01-01

    Background: Patients with spinal cord injury (SCI) deal with various restrictive factors regarding their clothing, such as disability and difficulty with access to shopping centers. Objectives: We designed a questionnaire to assess attention to clothing and impact of its restrictive factors among Iranian patients with SCI (ACIRF-SCI). Methods: The ACIRF-SCI has 5 domains: functional, medical, attitude, aesthetic, and emotional. The first 3 domains reflect the impact of restrictive factors (factors that restrict attention to clothing), and the last 2 domains reflect attention to clothing and fashion. Functional restrictive factors include disability and dependence. Medical restrictive factors include existence of specific medical conditions that interfere with clothing choice. Construct validity was assessed by factorial analysis, and reliability was expressed by Cronbach’s alpha. Results: A total of 100 patients (75 men and 25 women) entered this study. Patients with a lower injury level had a higher total score (P < .0001), and similarly, patients with paraplegia had higher scores than those with tetraplegia (P < .0001), which illustrates an admissible discriminant validity. Postinjury duration was positively associated with total scores (r = 0.21, P = .04). Construct validity was 0.97, and Cronbach’s alpha was 0.61. Conclusion: Iranian patients with SCI who have greater ability and independence experience a lower impact of restrictive factors related to clothing. The ACIRF-SCI reveals that this assumption is statistically significant, which shows its admissible discriminant validity. The measured construct validity (0.97) and reliability (internal consistency expressed by alpha = 0.61) are acceptable. PMID:26363593

  13. NASA/DOD Aerospace Knowledge Diffusion Research Project. Paper 27: Knowledge diffusion and US government technology policy: Issues and opportunities for sci/tech librarians

    NASA Technical Reports Server (NTRS)

    Pinelli, Thomas E.; Barclay, Rebecca O.; Hannah, Stan; Lawrence, Barbara; Kennedy, John M.

    1992-01-01

    Federal involvement in simulating economic growth through the development and application of technology policy is currently the subject of serious debate. A recession and the recognition that an internationally competitive economy is a prerequisite for the attainment of national goals have fostered a number of technology policy initiatives aimed at improving the economic competitiveness of American industry. This paper suggests that the successful implementation of U.S. technology policy will require the adoption of a knowledge diffusion model, the development of user oriented information products and services, and a more 'activist' approach on the part of sci/tech librarians in the provision of scientific and technical information (STI). These changes will have a dramatic impact on the sci/tech library of the future and the preparation of sci/tech librarians.

  14. Contributions to the NUCLEI SciDAC-3 Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bogner, Scott; Nazarewicz, Witek

    This is the Final Report for Michigan State University for the NUCLEI SciDAC-3 project. The NUCLEI project, as defined by the scope of work, has developed, implemented and run codes for large-scale computations of many topics in low-energy nuclear physics. Physics studied included the properties of nuclei and nuclear decays, nuclear structure and reactions, and the properties of nuclear matter. The computational techniques used included Configuration Interaction, Coupled Cluster, and Density Functional methods. The research program emphasized areas of high interest to current and possible future DOE nuclear physics facilities, including ATLAS at ANL and FRIB at MSU (nuclear structuremore » and reactions, and nuclear astrophysics), TJNAF (neutron distributions in nuclei, few body systems, and electroweak processes), NIF (thermonuclear reactions), MAJORANA and FNPB (neutrinoless double-beta decay and physics beyond the Standard Model), and LANSCE (fission studies).« less

  15. Results of a Telephone Survey of Television Station Managers Concerning the NASA SCI Files(TM) and NASA CONNECT(TM)

    NASA Technical Reports Server (NTRS)

    Pinelli, Thomas E.; Perry, Jeannine

    2004-01-01

    A telephone survey of television station managers concerning 2 instructional television programs, the NASA SCI Files(TM) and NASA CONNECT(TM), offered by the NASA Langley Center for Distance Learning (CDL) was conducted. Using a 4-point scale, with 4 being very satisfied, survey participants reported that they were either very satisfied (77.1 percent) or satisfied (19.9 percent) with the overall (educational and technical) quality of the NASA SCI Files(TM). Using a 4-point scale, with 4 being very satisfied, survey participants reported that they were either very satisfied (77.9 percent) or satisfied (19.1 percent) with the overall (educational and technical) quality of NASA CONNECT(TM) .

  16. Psychosocial and Behavioral Factors Associated with Bowel and Bladder Management after SCI

    DTIC Science & Technology

    2015-10-01

    depression after first being injured, and dealing with insurance companies. A second focus group session was planned for caregivers of those with SCI...Physical Health and Depression scores as a function of response shift – those showing no changes or response shift had the lowest PROMIS scores. 5b...stay away from depression … Don’t get upset with it. Deal with it. It’s who you are now. You have to… It’s just Self-rated Quality of Life: 9 21

  17. MySci Advisors: Establishing a Peer-Mentoring Program for First Year Science Student Support

    ERIC Educational Resources Information Center

    Poling, Kirsten

    2015-01-01

    Would you like to help your students adjust to university life? Perhaps you are simply interested in allowing them to feel more integrated into a department right from the start of their first year? These were the types of issues that we were hoping to address when we founded the MySci Advisors Program, a peer-mentoring group for first year…

  18. [Influence of journals indexed by Science Citation Index (SCI) on Chinese medical journals based on the data of published articles by Chinese authors from 2000 - 2009].

    PubMed

    Fu, Xiao-Xia; Li, Gui-Cun

    2011-04-01

    This study was designed to investigate the influence of journals indexed by Science Citation Index (SCI) on Chinese medical journals. Articles on medicine written by Chinese and the journals that published these articles from 2000 to 2009 were searched using Science Citation Index Expanded (SCI-E) database, and the status and variation tendency of the impact factors (IF) of these journals were analyzed. Data of articles on medicine included Chinese Scientific and Technical Paper and Citations Data (CSTPCD) from 2000 to 2008 were searched (the data of 2009 have not been released). The included articles and the time-dependent changing profile were studied. These outcomes were evaluated as the fixed base relative or link relative when compared with the data of 2000 or those of last year, respectively. Geometric mean was used when mean increase was calculated and IF distribution was described with median. Totally 3774 articles from China were published by journals indexed by SCI-E in 2000, and the number of articles published by Chinese authors increased every year. In 2008, 16 714 articles were indexed by SCI-E, 442.87% higher than those of 2000. The increment was 161.54% higher than that of articles published in the journals indexed by CSTPCD (281.33%) during the same period. From 2000 to 2009, the geometric mean of increase in the number of published articles from China in journals indexed by SCI-E was 20.87% but it was 18.21% in CSTPCD. From 2000 to 2009, the median of IF of SCI-E indexed journals that published Chinese medical articles was 1.866, 2.073, 2.390, 2.702, 2.409, 2.496, 2.380, 2.218, 2.280 and 2.331, respectively, and they did not increase or even decreased. The number of the articles indexed by SCI-E increased year by year, much faster than that of CSTPCD. However, it does not necessarily mean the increase in impact.

  19. What Makes Things Happen? Teacher's Guide. Unit B. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Dube, Peter

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  20. Looking at Life. Teacher's Guide. Unit A2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  1. Particles in Action. Teacher's Guide. Unit C2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  2. The Virtual Earth-Solar Observatory of the SCiESMEX

    NASA Astrophysics Data System (ADS)

    De la Luz, V.; Gonzalez-Esparza, A.; Cifuentes-Nava, G.

    2015-12-01

    The Mexican Space Weather Service (SCiESMEX, http://www.sciesmex.unam.mx) started operations in October 2014. The project includes the Virtual Earth-Solar Observatory (VESO, http://www.veso.unam.mx). The VESO is a improved project wich objetive is integrate the space weather instrumentation network from the National Autonomous University of Mexico (UNAM). The network includes the Mexican Array Radiotelescope (MEXART), the Callisto receptor (MEXART), a Neutron Telescope, a Cosmic Ray Telescope. the Schumann Antenna, the National Magnetic Service, and the mexican GPS network (TlalocNet). The VESO facility is located at the Geophysics Institute campus Michoacan (UNAM). We offer the service of data store, real-time data, and quasi real-time data. The hardware of VESO includes a High Performance Computer (HPC) dedicated specially to big data storage.

  3. A Computer Simulation for Predicting the Time Course of Thermal and Cardiovascular Responses to Various Combinations of Heat Stress, Clothing and Exercise

    DTIC Science & Technology

    1991-06-01

    Anderson and A. Keys, Densitometric analysis of body composition : revision of some quantitative assumptions. Ann. N.Y. Acad. Sci. 110: 113-140, 1963. 6...cylinder at midpoint between adjacent compartments [cm] A, = effective radiating area of the body surface [M’] BF,, n rate of blood flow through...Sutalation for Predicting the Time Cou~rse of ’Thermal and Cardiovrascular Responses to varicus Cmtinations of Heat Stresso Clothing and Excercise 6. AUTHOR

  4. Novel Magnetic Resonance Detection and Profiling of Ovarian Cancer Across Specimens

    DTIC Science & Technology

    2012-10-01

    Cancer Cells in Fine - Needle Aspirates. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 12459–12464. 25. Han,H. S.; Devaraj,N. K.; Lee, J.; Hilderbrand, S.A... fine needle aspirates, biopsies, ascites, blood, sputum), which are inherently complex in composition, as well as heterogeneous and variable in cell...in ascitic fluid, we anticipate that this method could similarly be applied to fine needle aspirates, blood, biopsy spec- imens, sputum, and other

  5. International Conference on Internal Friction and Ultrasonic Attenuation in Solids (ICIFUAS) (10th) held in Roma, Italy on September 6 - 9, 1993

    DTIC Science & Technology

    1993-09-09

    decomposition in Fe-Cr system on non-elastic properties were investigated. Taking mechanism of appearing of microplastic deformation as the base, the...found out the general principles of LPT- induced microplasticity and examined several particular cases. The basic idea is the great change of the line...Physics, Russian Acad. of Sci., 142432 Chernogolovka, Moscow distr., Russia on heefect o sea stes V103 If S The investigations were c rried o4 on

  6. Annotated Bibliography for Lake Erie. Volume II. Chemical,

    DTIC Science & Technology

    1974-10-01

    on the ecology of Presque Isle Bay, Erie , Pennsylvania . Environmental Sciences, Inc. Pittsburg, Pa. 232 p. Water quality in Presque Isle Bay is...Gottschall, Russell Y. 1930. Preliminary report on the phytoplankton and pollution in Presque Isle Bay, Lake Erie . Proc. Pa. Acad. Sci. 4:69-74. The...waters of Presque Isle Bay and vicinity are contaminated with sewage from the city of Erie . No evidence to date has been found of anaerobic respiration or

  7. Translational Studies of GALGT2 Gene Therapy for Duchenne Muscular Dystrophy

    DTIC Science & Technology

    2013-10-01

    muscles once the experimental problems related to expression are solved. Figure 2. Percentage change in specific force after GALGT2 treatment of wild...cytotoxic T cell GalNAc transferase in skeletal muscle inhibits muscular dystrophy in mdx mice. Proc Natl Acad Sci U S A 99, 5616-5621 (2002). 3. Xu, R...Camboni, M. & Martin, P.T. Postnatal overexpression of the CT GalNAc transferase inhibits muscular dystrophy in mdx mice without altering muscle growth

  8. Early Detection of Ovarian Cancer by Contrast-Enhanced Ultrasound-Targeted Imaging

    DTIC Science & Technology

    2012-07-01

    the sections with an antigen-unmasking solution (Vector Laboratories, Burlingame, CA) for 20 minutes in a microwave oven . Endogenous peroxidase in the...and Cooper MD (2000). Paired Ig-like receptor homologs in birds and mammals share a common ancestor with mammalian Fc receptors. Proc Natl Acad Sci...CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON a . REPORT b. ABSTRACT c. THIS PAGE 19b

  9. Immunologic Control of Diarrheal Disease Due to Enterotoxigenic Escherichia coli: Reactogenicity, Immunogenicity, and Efficacy Studies of Pili Vaccines

    DTIC Science & Technology

    1981-09-01

    pathogens that lack CFA/I including enteropathogenic E. coli, some ETEC ana Vibrio cholerae (Figure 1). The mean change in net O.D. between the paired...intestine. In a further analogy, we have found that 20% of 50 recipients of a highly ad- hesive non-toxigenic Vibrio cholerae attenuated iaccine strain...and Characteristics of a Vibrio cholerae Mutant Lacking the A (ADP-Ribosylating) Portion of the Cholera Enterotoxin. Proc. Nat. Acad. Sci. USA 76:2052

  10. TrkB Activators for the Treatment of Traumatic Vision Loss

    DTIC Science & Technology

    2015-10-01

    immunemodulator fingolimod on acute ischemic stroke . Proc Natl Acad Sci USA 111:18315-20. Gauthier R., Joly S., Pernet V., Lachapelle P. and Di Polo A...it has shown clinical efficacy in the treatment of stroke and multiple sclerosis patients (Noda et al., 2013; Yang et al., 2014; Fu et al., 2014...prevents inflammation-sensitized hypoxic- ischemic brain injury in newborns. J Neurosci. 34: 16467-81. Appendix 1. Copy of ARVO abstract

  11. The Mechanism of E2F/P130 Mediated Repression and Its Potential Tumor Suppressor Function in Breast Cancer

    DTIC Science & Technology

    2000-07-01

    conserved PLDLS motif. JBC 273, 8549-8552 (1998). 4. Nibu, Y., Zhang, H., and Levine, M . Interaction of short-range repressors with Drosophila CtBP in...oncogenic transformation. Proc. Natl. Acad. Sci. USA 92, 10467-10471 (1995). 11. Poortinga,G., Watanabe, M . & Parkhurst,S.M. Drosophila CtBP: A hairy...Levine, M . Groucho and dCtBP mediate separate pathways of transcriptional repression in the Drosophila embryo. Developmental Biology 96, 535-540 (1999). 13

  12. Effects of Long-Term Immunization with Multiple Antigens.

    DTIC Science & Technology

    1980-01-01

    to infectious mononucleosis . Proc. Natl. Acad. Sci. USA 59:94-101, 1968. 23. Holt, S., D. Hudgins, K. R. Krishnan, and E. M. R. Critchley. Diffuse...and J. C. Bausher. Epstein-Barr virus infection in relation to infectious mononucleosis and Burkitt’s lymphoma. Annu. Rev. Med. 23:39-56, 1972. 54...Army Biological Laboratory at Fort Detrick, Maryland, it had been the prac- tice to immunize workers repeatedly with multiple antigens of infectious

  13. Membrane Estrogen Receptor Alpha Targeting and its Association with SHC in Regulating Breast Cancer Cell Proliferation

    DTIC Science & Technology

    2004-06-01

    American Society for Cell Biology, San Francisco , California, Dec. 13-17, 2003. 3. Invited speaker in one of symposiums "Recognition of estrogen receptor in...Oncology, Bahamonde MI, Mann GE, Vergara C, Latorre R 1999 University of Virginia Health Science Center, Charlottesville, Acute activation of Maxi-K...intracellular Bahamonde, G.E. Mann, C. Vergara , R. Latorre, Acute activa- calcium, Proc. Nati. Acad. Sci. USA. 96 (1999) 4686-4691. tion of Maxi-K channels by

  14. O2-MAVS: an Instrument for Measuring Oxygen Flux

    DTIC Science & Technology

    2010-06-01

    al. (2007), “ Coral reefs under rapid climate change and ocean acidification ,” Science 318:1737-1742 [20] K.R.N. Anthony, D.I. Kline, S. Dove, and...O. Hoegh-Guldberg (2008), “ Ocean acidification causes bleaching and productivity loss in coral reef builders,” Proc. Nat. Acad. of Sci. 105:doi...deployments were made on shallow, warm-water coral reefs in La Parguera, Puerto Rico. Time series of net production obtained using the boundary

  15. Identification of a CAPA-PVK (IXORI-PVK) from Single Cells of the Gulf Coast Tick, Amblyomma maculatum

    DTIC Science & Technology

    2008-01-01

    neurons of the abdominal ganglia and are likely to be released as hormones from the abdominal perisympatic organs ( PSOs ) into the hemolymph. The...CAPs) in the VNC/ PSOs of the tobacco hawk moth, Manduca sexta. Indeed, in a recent study we have identified the first peptidergic neurohormone from...discussions on the manuscript. REFERENCES [1] Coast G.M., Garside C.S., Ann . NY Acad Sci., 2005, 1040,1-8. [2] Pietrantonio P.V., Jagge C., Taneja

  16. Role of p53 in Mammary Epithelial Cell Senescence

    DTIC Science & Technology

    2009-05-01

    Cellular Senescence and Skin Aging . In Skin Aging Handbook: Market Perspectives, Pharmacology, Formulation, and Evaluation Techniques, ed., N. Dayan...identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A, 1995. 92(20): p. 9363-7. 12. Dimri, G.P., et al...NIH): ZAI1- BDP- I(J2), RFA-AI-08-012 ( Rejuvenating the Aged Immune System) 2009: Online Reviewer USAMRMC BCRP Concept

  17. Water Quality, Macroinvertebrates, and Fisheries in Tailwaters and Related Streams. An Annotated Bibliography.

    DTIC Science & Technology

    1981-05-01

    Cladophora mats (mayflies). If this study had been completed during the summer months, rather than March, a higher insect mortality probably would have been...each river station during 1960 and 1961. Cladophora was observed growing in dense mats in the riffle areas in the first 6 miles of river below the dam...of Muddy Fork, Jefferson County, Kentucky. Trans. Ky. Acad. Sci. 24:81-84. Cladophora glomerata occurs as a characteristic stream community with

  18. Pulsed Electric Fields for Biological Weapons Defense

    DTIC Science & Technology

    2008-09-30

    multifunctional biological transporters and near - infrared agents for selective cancer cell destruction. Proc Natl Acad Sci U S A 102, 11600-5. 45. Heller, D. A...controlled biochemical manipulation. Nanotechnology 14,551-556. 47. Cherukuri, P., Bachilo, S. M., Litovsky, S. H., and Weisman, R. B. (2004). Near - infrared ...Pulsed Electric Fields for Biological Weapons Defense AFOSR Grant No. FA9550-05-1-0081 P.I. Martin Gundersen atrophaeus and isolates from dental patients

  19. Mechanisms of Cytotoxicity of the Aids Virus

    DTIC Science & Technology

    1994-08-01

    al., 1987; Luciw et al., 1989), sheep (visna virus) (Haas et al., 1985), goats (caprine-arthritis encepha- litis virus) (Narayan & Cork , 1985), and...into therapeutic maneuvers which may suppress virus replication and/or cytopathicity, and assist in the development of a vaccine for WIV prevention. 7...and AIDS. Narayan and Cork , 1985, Rev. Infect. Dis. 7:89. Niederran et al., 1989, Proc. Natl. Acad. Sci. 86:1128. Pederson et al., 1987, Science 235

  20. Granulopoietic Growth Factor Secretion in Ovarian Carcinoma as a Mechanism for the Emergence of Immune Suppressive Myeloid Subsets

    DTIC Science & Technology

    2014-08-01

    levels will be determined and tracked biweekly during the course of tumor growth. Age/ gender -matched non-tumor-bearing mice will serve as controls for...parameter flow cytometry, we compared 21 ovarian cancer patients reflecting stages II - IV to 22 gender - race- and age-matched controls. All patient...Sitkovsky, M. A2A adenosine receptors protect tumors from anti- tumor T cells. (*equal authorship ) Proc. Natl. Acad. Sci. USA 103: 13132-13137, 2006

  1. Integrating the perspectives of individuals with spinal cord injuries, their family caregivers and healthcare professionals from the time of rehabilitation admission to community reintegration: protocol for a scoping study on SCI needs

    PubMed Central

    Moreno, Alexander; Zidarov, Diana; Raju, Chandhana; Boruff, Jill; Ahmed, Sara

    2017-01-01

    Introduction There is fragmented information about the different needs following a spinal cord injury (SCI). Expressed SCI needs can be met or unmet, they change along the rehabilitation continuum (eg, acute, rehabilitation and reintegration into the community) and can be different for traumatic and non traumatic SCI. The general objective of this scoping study is to evaluate and integrate the needs of individuals with traumatic and non-traumatic SCI, their family caregivers and those reported by rehabilitation professionals from the time of rehabilitation admission to community reintegration. The specific objectives are to: (A) synthesise the needs of individuals with SCI as perceived by themselves, their family caregivers and rehabilitation professionals using two theoretical models, (B) classify needs as met and unmet, (C) explore the evolution of met/unmet needs from the time of rehabilitation admission to community reintegration and (D) provide recommendations to improve SCI care. Methods and analysis (A) identifying the most frequent met and unmet needs reported by adults with traumatic and non-traumatic SCI, their family caregivers and their rehabilitation professionals from the time of rehabilitation admission to community reintegration; (B) identifying relevant studies with a search in electronic databases; (C) charting the data based on categories refined and adjusted with a stakeholder group; (D) collating, summarising and reporting the results using two analytical frameworks (Maslow’s hierarchical model of human needs and the Ferrans et al’s model of health-related quality of life) and (E) a stakeholder consultation phase. Ethics and dissemination The results of this scoping study will allow understanding SCI needs from the time of rehabilitation admission to community reintegration from the perspective of different stakeholders. An integrated master report combining the needs of individuals with SCI from the perspectives of different stakeholders

  2. The neuroprotective effect of rat adipose tissue-derived mesenchymal stem cell-conditioned medium on cortical neurons using an in vitro model of SCI inflammation.

    PubMed

    Szekiova, Eva; Slovinska, Lucia; Blasko, Juraj; Plsikova, Jana; Cizkova, Dasa

    2018-04-01

    Objectives In this study, a new approach was used with an in vitro model in which neural cells were exposed to conditioned media from the injured spinal cord (SCI-CM) mimicking a local inflammatory microenvironment . Subsequently, the neuroprotective effect of rat adipose tissue-derived msesenchymal stem cell-conditioned media (ATMSC-CM) was investigated through a cell-free based therapy, which was used to treat cortical neurons and astrocytes under inflammation. Methods Primary cell cultures isolated from postnatal day (P6) Wistar rat brain cortex were exposed to SCI-CM derived from the central lesion, rostral and caudal segments of injured spinal cord. After 48 h incubation, the SCI-CM was replaced and primary cultures were cultivated either in DMEM media alone or in ATMSC-CM for 72 h. The impact of ATMSC-CM on the viability of neurons and astrocytes was assessed using a CyQUANT® Direct Cell Proliferation Assay Kit as well as immunocytochemistry analysis. Results Immunocytochemical analysis revealed significant decrease in the number of MAP2 positive neurons exposed to SCI-CM compared to Control. Protection by ATMSC-CM was associated with increased survival of neurons compared to primary culture cultivated in DMEM media alone. The ATMSC-CM effect on astrocytes was more variable and without any significant impact. Conclusion The results demonstrate that SCI-CM mimicking inflammation can reduce cortical neuron survival, and subsequent exposure to ATMSC-CM can stabilize the neuronal population most likely via released neuroprotective and trophic factors. In addition, astrogliosis was not affected by ATMSC-CM.

  3. Public Data Set: Erratum: "Multi-point, high-speed passive ion velocity distribution diagnostic on the Pegasus Toroidal Experiment" [Rev. Sci. Instrum. 83, 10D516 (2012)

    DOE Data Explorer

    Burke, Marcus G. [University of Wisconsin-Madison] (ORCID:0000000176193724); Fonck, Raymond J. [University of Wisconsin-Madison] (ORCID:0000000294386762); Bongard, Michael W. [University of Wisconsin-Madison] (ORCID:0000000231609746); Schlossberg, David J. [University of Wisconsin-Madison] (ORCID:0000000287139448); Winz, Gregory R. [University of Wisconsin-Madison] (ORCID:0000000177627184)

    2016-07-18

    This data set contains openly-documented, machine readable digital research data corresponding to figures published in M.G. Burke et al., 'Erratum: "Multi-point, high-speed passive ion velocity distribution diagnostic on the Pegasus Toroidal Experiment" [Rev. Sci. Instrum. 83, 10D516 (2012)],' Rev. Sci. Instrum. 87, 079902 (2016).

  4. Preclinical Pharmacokinetics and Pharmacodynamic Target of SCY-078, a First-in-Class Orally Active Antifungal Glucan Synthesis Inhibitor, in Murine Models of Disseminated Candidiasis.

    PubMed

    Wring, Stephen A; Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna

    2017-04-01

    SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing <15% and <25% of hepatic blood flow, respectively. The terminal elimination-phase half-life was 5.5 to 8.7 h in rodents, and it was ∼9.3 h in dogs. The volume of distribution at steady-state was high (4.7 to 5.3 liters/kg), a finding suggestive of extensive tissue distribution. Exposure of SCY-078 in kidney tissue, a target organ for invasive fungal disease such as candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC 0-∞ ) and C max SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices C max /MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC 0-24 , was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. Copyright © 2017 Wring et al.

  5. Preclinical Pharmacokinetics and Pharmacodynamic Target of SCY-078, a First-in-Class Orally Active Antifungal Glucan Synthesis Inhibitor, in Murine Models of Disseminated Candidiasis

    PubMed Central

    Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna

    2017-01-01

    ABSTRACT SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing <15% and <25% of hepatic blood flow, respectively. The terminal elimination-phase half-life was 5.5 to 8.7 h in rodents, and it was ∼9.3 h in dogs. The volume of distribution at steady-state was high (4.7 to 5.3 liters/kg), a finding suggestive of extensive tissue distribution. Exposure of SCY-078 in kidney tissue, a target organ for invasive fungal disease such as candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC0–∞) and Cmax. SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices Cmax/MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC0–24, was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. PMID:28137806

  6. [Letters to the editor published in Peruvian biomedical journals indexed in SciELO-Peru 2006-2013].

    PubMed

    Montenegro-Idrogo, Juan José; Mejía-Dolores, Jhon William; Chalco-Huamán, Joel L

    2015-01-01

    This bibliometric study describes the characteristics of letters to the editor published between 2006-2013 in biomedical journals indexed in SciELO-Peru.253 letters (10.3% of total publications) were collected. Most letters (139) were in the Peruvian Journal of Experimental Medicine and Public Health, with marked increase throughout those years. 25% of letters submitted included medical student participation. 14% of authors presented with international affiliations and 27% with endogenous affiliation - common in university journals (Anales de la Facultad de Medicina, Revista Médica Herediana).The usual criteria justifying the publication of letters were: opinion of medical fact or public domain (35.6%) and discussion of results, methodological flaws or interpretation (22.9%). In biomedical journals indexed in SciELO Peru the letters to the editor comprise a percentage of publications that has increased in recent years, with low publication of letters of findings or primary data, compared with opinion or criticism.

  7. NASA/DoD Aerospace Knowledge Diffusion Research Project. XXVII - Knowledge diffusion and U.S. government technology policy: Issues and opportunities for sci/tech librarians

    NASA Technical Reports Server (NTRS)

    Pinelli, Thomas E.; Barclay, Rebecca O.; Hannah, Stan; Lawrence, Barbara; Kennedy, John M.

    1992-01-01

    Federal involvement in stimulating economic growth through the development and application of technology policy is currently the subject of serious debate. A recession and the recognition that an internationally competitive economy is a prerequisite for the attainment of national goals have fostered a number of technology policy initiatives aimed at improving the economic competitiveness of American industry. This paper suggests that the successful implementation of U.S. technology policy will require the adoption of a knowledge diffusion model, the development of user oriented information products and services, and a more 'activist' approach on the part of sci/tech librarians in the provision of scientific and technical information (STI). These changes will have a dramatic impact on the sci/tech library of the future and the preparation of sci/tech librarians.

  8. Performance Engineering Research Institute SciDAC-2 Enabling Technologies Institute Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hall, Mary

    2014-09-19

    Enhancing the performance of SciDAC applications on petascale systems has high priority within DOE SC. As we look to the future, achieving expected levels of performance on high-end com-puting (HEC) systems is growing ever more challenging due to enormous scale, increasing archi-tectural complexity, and increasing application complexity. To address these challenges, PERI has implemented a unified, tripartite research plan encompassing: (1) performance modeling and prediction; (2) automatic performance tuning; and (3) performance engineering of high profile applications. The PERI performance modeling and prediction activity is developing and refining performance models, significantly reducing the cost of collecting the data upon whichmore » the models are based, and increasing model fidelity, speed and generality. Our primary research activity is automatic tuning (autotuning) of scientific software. This activity is spurred by the strong user preference for automatic tools and is based on previous successful activities such as ATLAS, which has automatically tuned components of the LAPACK linear algebra library, and other re-cent work on autotuning domain-specific libraries. Our third major component is application en-gagement, to which we are devoting approximately 30% of our effort to work directly with Sci-DAC-2 applications. This last activity not only helps DOE scientists meet their near-term per-formance goals, but also helps keep PERI research focused on the real challenges facing DOE computational scientists as they enter the Petascale Era.« less

  9. Assessment of Spasticity by a Pendulum Test in SCI Patients Who Exercise FES Cycling or Receive Only Conventional Therapy.

    PubMed

    Popovic-Maneski, Lana; Aleksic, Antonina; Metani, Amine; Bergeron, Vance; Cobeljic, Radoje; Popovic, Dejan B

    2018-01-01

    Increased muscle tone and exaggerated tendon reflexes characterize most of the individuals after a spinal cord injury (SCI). We estimated seven parameters from the pendulum test and used them to compare with the Ashworth modified scale of spasticity grades in three populations (retrospective study) to assess their spasticity. Three ASIA B SCI patients who exercised on a stationary FES bicycle formed group F, six ASIA B SCI patients who received only conventional therapy were in the group C, and six healthy individuals constituted the group H. The parameters from the pendulum test were used to form a single measure, termed the PT score, for each subject. The pendulum test parameters show differences between the F and C groups, but not between the F and H groups, however, statistical significance was limited due to the small study size. Results show a small deviation from the mean for all parameters in the F group and substantial deviations from the mean for the parameters in the C group. PT scores show significant differences between the F and C groups and the C and H groups and no differences between the F and C groups. The correlation between the PT score and Ashworth score was 0.88.

  10. GENESIS SciFlo: Choreographing Interoperable Web Services on the Grid using a Semantically-Enabled Dataflow Execution Environment

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Manipon, G.; Xing, Z.

    2007-12-01

    The General Earth Science Investigation Suite (GENESIS) project is a NASA-sponsored partnership between the Jet Propulsion Laboratory, academia, and NASA data centers to develop a new suite of Web Services tools to facilitate multi-sensor investigations in Earth System Science. The goal of GENESIS is to enable large-scale, multi-instrument atmospheric science using combined datasets from the AIRS, MODIS, MISR, and GPS sensors. Investigations include cross-comparison of spaceborne climate sensors, cloud spectral analysis, study of upper troposphere-stratosphere water transport, study of the aerosol indirect cloud effect, and global climate model validation. The challenges are to bring together very large datasets, reformat and understand the individual instrument retrievals, co-register or re-grid the retrieved physical parameters, perform computationally-intensive data fusion and data mining operations, and accumulate complex statistics over months to years of data. To meet these challenges, we have developed a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data access, subsetting, registration, mining, fusion, compression, and advanced statistical analysis. SciFlo leverages remote Web Services, called via Simple Object Access Protocol (SOAP) or REST (one-line) URLs, and the Grid Computing standards (WS-* & Globus Alliance toolkits), and enables scientists to do multi- instrument Earth Science by assembling reusable Web Services and native executables into a distributed computing flow (tree of operators). The SciFlo client & server engines optimize the execution of such distributed data flows and allow the user to transparently find and use datasets and operators without worrying about the actual location of the Grid resources. In particular, SciFlo exploits the wealth of datasets accessible by OpenGIS Consortium (OGC) Web Mapping Servers & Web Coverage Servers (WMS/WCS), and by Open Data

  11. National Computational Infrastructure for Lattice Gauge Theory SciDAC-2 Closeout Report Indiana University Component

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gottlieb, Steven Arthur; DeTar, Carleton; Tousaint, Doug

    This is the closeout report for the Indiana University portion of the National Computational Infrastructure for Lattice Gauge Theory project supported by the United States Department of Energy under the SciDAC program. It includes information about activities at Indian University, the University of Arizona, and the University of Utah, as those three universities coordinated their activities.

  12. Assessing Forelimb Function after Unilateral Cervical SCI using Novel Tasks: Limb Step-alternation, Postural Instability and Pasta Handling

    PubMed Central

    Schallert, Timothy; Schmidt, Christine E.

    2013-01-01

    Cervical spinal cord injury (cSCI) can cause devastating neurological deficits, including impairment or loss of upper limb and hand function. A majority of the spinal cord injuries in humans occur at the cervical levels. Therefore, developing cervical injury models and developing relevant and sensitive behavioral tests is of great importance. Here we describe the use of a newly developed forelimb step-alternation test after cervical spinal cord injury in rats. In addition, we describe two behavioral tests that have not been used after spinal cord injury: a postural instability test (PIT), and a pasta-handling test. All three behavioral tests are highly sensitive to injury and are easy to use. Therefore, we feel that these behavioral tests can be instrumental in investigating therapeutic strategies after cSCI. PMID:24084700

  13. Assessing forelimb function after unilateral cervical SCI using novel tasks: limb step-alternation, postural instability and pasta handling.

    PubMed

    Khaing, Zin Z; Geissler, Sydney A; Schallert, Timothy; Schmidt, Christine E

    2013-09-16

    Cervical spinal cord injury (cSCI) can cause devastating neurological deficits, including impairment or loss of upper limb and hand function. A majority of the spinal cord injuries in humans occur at the cervical levels. Therefore, developing cervical injury models and developing relevant and sensitive behavioral tests is of great importance. Here we describe the use of a newly developed forelimb step-alternation test after cervical spinal cord injury in rats. In addition, we describe two behavioral tests that have not been used after spinal cord injury: a postural instability test (PIT), and a pasta-handling test. All three behavioral tests are highly sensitive to injury and are easy to use. Therefore, we feel that these behavioral tests can be instrumental in investigating therapeutic strategies after cSCI.

  14. Observing Some Life Cycles. Teacher's Guide. Unit E3. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Chitepo, Thoko; And Others

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide contains instructional…

  15. Integrating the perspectives of individuals with spinal cord injuries, their family caregivers and healthcare professionals from the time of rehabilitation admission to community reintegration: protocol for a scoping study on SCI needs.

    PubMed

    Moreno, Alexander; Zidarov, Diana; Raju, Chandhana; Boruff, Jill; Ahmed, Sara

    2017-08-04

    There is fragmented information about the different needs following a spinal cord injury (SCI). Expressed SCI needs can be met or unmet, they change along the rehabilitation continuum (eg, acute, rehabilitation and reintegration into the community) and can be different for traumatic and non traumatic SCI. The general objective of this scoping study is to evaluate and integrate the needs of individuals with traumatic and non-traumatic SCI, their family caregivers and those reported by rehabilitation professionals from the time of rehabilitation admission to community reintegration. The specific objectives are to: (A) synthesise the needs of individuals with SCI as perceived by themselves, their family caregivers and rehabilitation professionals using two theoretical models, (B) classify needs as met and unmet, (C) explore the evolution of met/unmet needs from the time of rehabilitation admission to community reintegration and (D) provide recommendations to improve SCI care. METHODS AND ANALYSIS: (A) identifying the most frequent met and unmet needs reported by adults with traumatic and non-traumatic SCI, their family caregivers and their rehabilitation professionals from the time of rehabilitation admission to community reintegration; (B) identifying relevant studies with a search in electronic databases; (C) charting the data based on categories refined and adjusted with a stakeholder group; (D) collating, summarising and reporting the results using two analytical frameworks (Maslow's hierarchical model of human needs and the Ferrans et al 's model of health-related quality of life) and (E) a stakeholder consultation phase. The results of this scoping study will allow understanding SCI needs from the time of rehabilitation admission to community reintegration from the perspective of different stakeholders. An integrated master report combining the needs of individuals with SCI from the perspectives of different stakeholders from the time of rehabilitation admission

  16. Role of Growth Hormone in Prostate Cancer

    DTIC Science & Technology

    2007-02-01

    syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 94:13215... Laron mouse, in which the gene coding for both GHR and GH binding protein has been disrupted or knocked out, with the C3(1)/Tag mouse, which develops...the Laron mouse). Nevertheless, the new model presented here demonstrates that the loss of GHR produced a significant reduction in the level of PIN in

  17. Algorithms for Automated DNA Assembly

    DTIC Science & Technology

    2010-01-01

    polyketide synthase gene cluster. Proc. Natl Acad. Sci. USA, 101, 15573–15578. 16. Shetty,R.P., Endy,D. and Knight,T.F. Jr (2008) Engineering BioBrick vectors...correct theoretical construction scheme is de- veloped manually, it is likely to be suboptimal by any number of cost metrics. Modular, robust and...to an exhaustive search on a small synthetic dataset and our results show that our algorithms can quickly find an optimal solution. Comparison with

  18. Mechanism of RhoB/FTI Action in Breast Cancer

    DTIC Science & Technology

    2004-05-01

    deprival conditions, respectively, as de - lysis in lX radioimmunoprecipitation (RIPA) buffer supplemented with 10 scribed previously (5). MtL/mL Protease... adenocarcinoma cells. Neoplasia 2000;2:261-72. FTI responses in the clinic based on cytotoxic susceptibility. To date, 20. Amundadottir LT, Nass SJ, Berchem GJ...and are fertile whereas cyclin B I-null mice die in utero . Proc Natl Acad Sci USA 47. Kumar J, Yu H, Sheetz MP. Kinectin, an essential anchor for

  19. An Approach for the Adaptive Solution of Optimization Problems Governed by Partial Differential Equations with Uncertain Coefficients

    DTIC Science & Technology

    2012-05-01

    Acad. Sci. Fennicae. Ser. A. I. Math.-Phys., 1947(37):79, 1947. [65] G. E. Karniadakis, C.-H. Su, D. Xiu, D. Lucor, C. Schwab, and R. A. Todor ...treatment of uncertainties in aerodynamic design. AIAA Journal, 47(3):646–654, 2009. [106] C. Schwab and R. A. Todor . Karhunen-Loève approximation of random...integrals. Prentice-Hall Inc., Englewood Cliffs, N.J., 1971. Prentice-Hall Series in Automatic Computation. [113] R. A. Todor and C. Schwab

  20. Complex Host Genetics Influence the Microbiome in Inflammatory Bowel Disease

    DTIC Science & Technology

    2016-09-09

    specific bacterial taxa. Methods Ethics and consent This study was approved by the Partners Human Re- search Committee, 116 Huntington Avenue, Boston, MA...microbial ecology . Proc Natl Acad Sci U S A 2005, 102:11070–11075. 17. Hashimoto T, Perlot T, Rehman A, Trichereau J, Ishiguro H, Paolino M, Sigl V...JM: ACE2 links amino acid malnutrition to microbial ecology and intestinal inflammation. Nature 2012, 487:477–481. 18. Cortes A, Brown MA: Promise and

  1. Wavelength Independent Optical Lithography.

    DTIC Science & Technology

    1986-06-06

    lamp because it has a smooth, broadband output in the visible and near UV. High Density Optical Intormation Storage The NSOM concept can be combined...stringent control can be maintained over the temperature of the entire apparatus. Ideally, both of these methods should be used. - . * S P. .~ V: -:V- TwT ...DNA helixes : enantiomers of tris(4, 7-diphenylpheanthroline)ruthenium (II). Proc. Natl. Acad. Sci. U.S.A. 81, 7 (1984). 27. J.M. Fernandez, E. Neher

  2. Unobserved time effects confound the identification of climate change impacts.

    PubMed

    Auffhammer, Maximilian; Vincent, Jeffrey R

    2012-07-24

    A recent study by Feng et al. [Feng S, Krueger A, Oppenheimer M (2010) Proc Natl Acad Sci USA 107:14257-14262] in PNAS reported statistical evidence of a weather-driven causal effect of crop yields on human migration from Mexico to the United States. We show that this conclusion is based on a different statistical model than the one stated in the paper. When we correct for this mistake, there is no evidence of a causal link.

  3. P53 Suppression of Homologous Recombination and Tumorigenesis

    DTIC Science & Technology

    2013-07-01

    cell cycle [22] and is known to have an important role in responding to oxygen concentration, particularly hypoxia (,1% O2) [23] or hyperoxia (95% O2...appropriate oxygen tension for in vitro culture? Mol Hum Reprod 12: 653. 2. Csete M (2005) Oxygen in the cultivation of stem cells . Ann N Y Acad Sci 1049: 1...culture that were derived from somatic mesenchymal cells that display a reasonable level of clonality. Yet, given the highly proliferative nature

  4. A Molecular Epidemiologic Case-Case Study of Prostate Cancer Susceptibility.

    DTIC Science & Technology

    1999-09-01

    Thompson, P.A., and Barbour, A. A flagella-less mutant as a live attenuated vaccine against Borrelia Burgdorferi infection in mouse model of lyme ...Immunol., 148:3385, 1992. Sadienze A., Rosa, P. A., Thompson, P. A., Hogan, D. M., and. Barbou,r A. G. Antibody-resistant mutants of Borrelia ...cells and OspA protein of Borrelia burgdorferi. New York Acad. Sci. 797:140-150, 1996. Thompson, P. A. and Berton, M. T. STAT6 is required for IL-4

  5. Targeting the Estrogen Receptor for Ubiquitination and Degradation in Breast Cancer Cells

    DTIC Science & Technology

    2004-10-01

    Seery, J.; Daikh, Y.; Moore, C; Chen, L. L.; Pepinsky, B.; Barsoum, J. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 664-668. aminocaproic acid ...proteins. Although the Hnker length has not been fully explored, a spacer consisting of two aminocaproic acids (12 atoms) has been shown to be flexible...amino acid protein," is conjugated to the target protein by a three-part process. First, the C-terminal carboxyl group of ubiquitin is activated by

  6. Regulation of Breast Cancer Stem Cells by Tissue Rigidity

    DTIC Science & Technology

    2015-06-01

    investigated whether the TWIST1–G3BP2 mechanotrans- duction pathway has a significant role in human cancer progression. We first analysed The Cancer Genome ... the central conserved region. Proc. Natl Acad. Sci. USA 96, 9112–9117 (1999). 38. Singh, S. & Gramolini, A. O. Characterization of sequences in human...breast cancer gene expression data set (TCGA BRCA G4502A_07_3) was downloaded from the UCSC Cancer Genome Browser (https:// genome -cancer.ucsc.edu

  7. Blood-feeding Behaviors of Anopheles stephensi But Not Phlebotomus papatasi are Influenced by Actively Warming Guinea Pigs (Cavia porcellus) Under General Anesthesia

    DTIC Science & Technology

    2015-01-01

    response in mosquitoes. Proc Natl Acad Sci 108:8026–8029. Davis EE, Sokolove PG. 1975. Temperature responses of antennal receptors of the mosquito, Aedes ...books/NBK54050/ Peterson D, Brown A. 1951. Studies of the responses of the female Aedes mosquito. Part III. The response of Aedes aegypti (L.) to a warm...Hyg 33:1232–1238. Walker ED, Edman JD. 1985. Feeding-site selection and blood-feeding behavior of Aedes triseriatus (Diptera: Culicidae) on rodent

  8. Complement and Antibody-Mediated Enhancement of Erythrocyte Invasion by Plasmodium Falciparum

    DTIC Science & Technology

    2016-04-01

    Waki et al., 1995; Yoneto et al., 2001). However, the doses of antibody in those studies were much higher, usually given in milligram amounts and...erythrocyte receptor for Plasmodium falciparum PfRh4 invasion ligand. Proc. Natl. Acad. Sci. U. S. A. 107, 17327–17332. Waki , S., Uehara, S., Kanbe, K...infections. J. Immunol. 126, 1826–1828. Wold Health Organization, 2013. World Malaria Report 2013 (Geneva). Yoneto, T., Waki , S., Takai, T., Tagawa, Y

  9. Tandem Repeat Regions within the Burkholderia pseudomallei Genome and their Application for High-Resolution Genotyping

    DTIC Science & Technology

    2007-03-30

    is marked by gene dele- tions and intra-chromosomal rearrangements [4-7]. B. mallei , the etiologic agent of glanders , is an obligate para- site of the...CM: Structural flexi- bility in the Burkholderia mallei genome. Proc Natl Acad Sci U S A 2004, 101(39):14246-14251. 6. Godoy D, Randle G, Simpson AJ...and glanders , Burkholderia pseudomallei and Burkholderia mal- lei. J Clin Microbiol 2003, 41(5):2068-2079. 7. Kim HS, Schell MA, Yu Y, Ulrich RL

  10. Learning Complex Cell Invariance from Natural Videos: A Plausibility Proof

    DTIC Science & Technology

    2007-12-26

    is in the McGovern Institute for Brain Research at MIT, as well as in the Dept. of Brain & Cognitive Sciences, and which is affiliated with the...stimulation induce plasticity? Proc. Nat. Acad. Sci. USA, 92:9682–9686. Deco, G. and Rolls, E. T. (2004). A neurodynamical cor- tical model of visual attention...and invariant object recognition. Vision Res, 44(6):621–42. Deco, G. and Rolls, E. T. (2005). Neurodynamics of biased competition and cooperation for

  11. Octanoyl-Homoserine Lactone Is the Cognate Signal for Burkholderia mallei BmaR1-BmaI1 Quorum Sensing

    DTIC Science & Technology

    2007-07-01

    of genes. Acyl-HSL sig- naling was first identified in the luminescent marine bacterium Vibrio fischeri, which produces blue light at high cell...with shaking at 16°C, cells were harvested by centrifugation at 2,750 g for 20 min. Cell pellets were frozen, thawed at room temperature, suspended in...the Vibrio fischeri strain ATCC7744. Proc. Natl. Acad. Sci. USA 86:5688–5692. 11. Engebrecht, J., and M. Silverman. 1984. Identification of genes and

  12. The Shoreline Vegetation of Lake Oahe a Man Made Fluctuating Water Level Reservoir of the Upper Missouri River Basin.

    DTIC Science & Technology

    1973-06-01

    VANDERVEEN ET AL . UNCLASSIFIED 01 JUN 73 DACW45-73-C-0002 F/G 6/6. NL mmmmmmmmIIIIIIIIIIIIIu IIEIIIEEIIIIEE EEIIIIIIIIIEEE IIIIIIIIIIIIIIfl L 2. i~iIi...fluctuation to be the most impor- tant factor affecting vegetation along reservoir shorelines. Hall et al . (1946) studied reservoirs in the Tennessee Valley...Hall, T. F. et al . 1946. Water level relationships of plants in the Tennessee valley. Tenn. Acad. Sci. 10: 18-60. Houston, W. R. 1960. Effects of water

  13. A Novel Approach for Preventing HIV Infection and Reducing Risk to U.S. Military Personnel

    DTIC Science & Technology

    2013-09-01

    infection. Cell 131:1059-1071. 3. Hauber I, Hohenberg H, Holstermann B, Hunstein W, Hauber J. (2009) The main green tea polyphenol epigallocatechin -3... gallate counteracts semen- mediated enhancement of HIV infection. Proc Natl Acad Sci U S A 106:9033- 9038. 4. Roan NR, Munch J, Arhel N, Mothes W...specimen and the range of inhibition by EGCG . AIDS research and therapy 9:2. 11. Robert M, Gibbs BF, Jacobson E, Gagnon C. (1997) Characterization

  14. Chemoprevention of Breast Cancer by Mimicking the Protective Effect of Early First Birth

    DTIC Science & Technology

    2009-06-01

    mammary gland. Mol Endocrinol 2002;16:2034–51. 7. Thordarson G, Jin E, Guzman RC, Swanson SM, Nandi S, Talamantes F. Refractoriness to mammary tumori... Thordarson G, Talamantes F, Nandi S. Short-term exposure to preg- nancy levels of estrogen prevents mammary carcino- genesis. Proc Natl Acad Sci U S...A 2001;98:11755–9. 12. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S. Hormonal prevention of breast cancer: mimicking the protective

  15. Epithelial Plasticity in Castration-Resistant Prostate Cancer: Biology of the Lethal Phenotype

    DTIC Science & Technology

    2011-07-01

    Sorg BS, Albrecht T et al. Alternative inclusion of fibroblast growth factor receptor 2 exon IIIc in Dunning prostate tumors reveals unexpected... exon 658IIIc in Dunning prostate tumors reveals unexpected epithelial 659mesenchymal plasticity. Proc Natl Acad Sci U S A 2006;103: 66014116–21. 24...variant isoforms (such as, for example FGFR2 that includes or excludes either exon IIIc or exon IIIb), or CD133, or any combination of two or more

  16. Forces. 'O' Level Teacher's Guide. Unit 1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Udwin, Martin

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  17. Sense from Senses. Teacher's Guide. Unit J. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Simango, Sam

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  18. Understanding Electricity. Teacher's Guide. Unit I1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  19. Using Electricity. Teacher's Guide. Unit I2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be used in…

  20. Open and scalable analytics of large Earth observation datasets: From scenes to multidimensional arrays using SciDB and GDAL

    NASA Astrophysics Data System (ADS)

    Appel, Marius; Lahn, Florian; Buytaert, Wouter; Pebesma, Edzer

    2018-04-01

    Earth observation (EO) datasets are commonly provided as collection of scenes, where individual scenes represent a temporal snapshot and cover a particular region on the Earth's surface. Using these data in complex spatiotemporal modeling becomes difficult as soon as data volumes exceed a certain capacity or analyses include many scenes, which may spatially overlap and may have been recorded at different dates. In order to facilitate analytics on large EO datasets, we combine and extend the geospatial data abstraction library (GDAL) and the array-based data management and analytics system SciDB. We present an approach to automatically convert collections of scenes to multidimensional arrays and use SciDB to scale computationally intensive analytics. We evaluate the approach in three study cases on national scale land use change monitoring with Landsat imagery, global empirical orthogonal function analysis of daily precipitation, and combining historical climate model projections with satellite-based observations. Results indicate that the approach can be used to represent various EO datasets and that analyses in SciDB scale well with available computational resources. To simplify analyses of higher-dimensional datasets as from climate model output, however, a generalization of the GDAL data model might be needed. All parts of this work have been implemented as open-source software and we discuss how this may facilitate open and reproducible EO analyses.

  1. The Fulldome Curriculum for the Spitz SciDome Digital Planetarium: A New Age for Planetarium Education

    NASA Astrophysics Data System (ADS)

    Bradstreet, David H.; Huggins, S. L.

    2010-01-01

    Astronomy education received a huge boost from the Space Program in the 1960's and early 1970's as evidenced by a large increase in school planetariums built nationwide at that time. But with the waning of manned explorations so also went the push for astronomy in the schools, and many school planetariums are underutilized or not used at all. This poster will discuss and illustrate some of the new Fulldome Curriculum that has been developed specifically for the Spitz SciDome digital planetarium powered by Starry Night. It is now possible to teach astronomical concepts in new and exciting ways and present topics that were extremely difficult to convey to lay audiences in the past. One of the strongest advantages of the SciDome is that, since it uses Starry Night as its astronomical engine, students can create their own astronomical configurations in the computer lab or at home using the PC or Mac version and then simply load them onto the SciDome planetarium system and display them for the class on the dome. Additionally, the instructor can create artificial bodies to pose "What if” scenarios, for example, "What would the Moon look like if it didn't rotate synchronously?", or "What would the analemma look like if the Earth's orbit were circular and not an ellipse?" Topics covered in the series include The Moon, Seasons, Coordinate Systems, Roemer's Method of Measuring the Speed of Light, Analemmas in the Solar System, Precession, Mimas and the Cassini Division, Halley's Comet in 1910, Dog Days, Galactic Distributions of Celestial Bodies, Retrograde Paths of Mars, Mercury's Orbit and the Length of the Mercurian Day, Altitude of the North Celestial Pole, Why Polaris Appears Mostly Stationary, Circumpolar Contellations, Planet Definition, Scale of the Solar System, Stonehenge, The Changing Aspect of Saturn's Appearance and Scorpio's Claws.

  2. Evaluation of the Walking Index for Spinal Cord Injury II (WISCI-II) in children with Spinal Cord Injury (SCI).

    PubMed

    Calhoun Thielen, C; Sadowsky, C; Vogel, L C; Taylor, H; Davidson, L; Bultman, J; Gaughan, J; Mulcahey, M J

    2017-05-01

    Mixed methods were used in this study. The appropriateness of the levels of the Walking Index for Spinal Cord Injury II (WISCI-II) for application in children was critically reviewed by physical therapists using the Modified Delphi Technique, and the inter- and intra-rater reliability of the WISCI-II in children was evaluated. To examine the construct validity, and to establish reliability of the WISCI-II related to its use in children with spinal cord injury (SCI). United States of America. Using a Modified Delphi Technique, physical therapists critically reviewed the WISCI-II levels for pediatric utilization. Concurrently, ambulatory children under age 18 years with SCI were evaluated using the WISCI-II on two occasions by the same therapist to establish intra-rater reliability. One trial was photographed and de-identified. Each photograph was reviewed by four different physical therapists who gave WISCI-II scores to establish inter-rater reliability. Summary and descriptive statistics were used to calculate the frequency of yes/no responses for each WISCI-II level question and to determine the percent agreement for each question. Inter- and intra-rater reliability was calculated using interclass correlation coefficients (ICCs) with 95% confidence intervals (CI). Construct validity was confirmed after one Delphi round during which at least 80% agreement was established by 51 physical therapists on the appropriateness of the WISCI-II levels for children. Fifty-two children with SCI aged 2-17 years completed repeated WISCI-II assessments and 40 de-identified photographs were scored by four physical therapists. Intra- and inter-rater reliability was high (ICC=0.997, CI=0.995-0.998 and ICC=0.97, CI=0.95-0.98, respectively). This study demonstrates support for the use of the WISCI-II in ambulatory children with SCI. This study was funded by the Craig H Neilsen Foundation, Spinal Cord Injury Research on the Translation Spectrum, Senior Research Award #282592 (Mulcahey

  3. The impact of SciDAC on US climate change research and the IPCCAR4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wehner, Michael

    2005-07-08

    SciDAC has invested heavily in climate change research. We offer a candid opinion as to the impact of the DOE laboratories' SciDAC projects on the upcoming Fourth Assessment Report of the Intergovernmental Panel on Climate Change. As a result of the direct importance of climate change to society, climate change research is highly coordinated at the international level. The Intergovernmental Panel on Climate Change (IPCC) is charged with providing regular reports on the state of climate change research to government policymakers. These reports are the product of thousands of scientists efforts. A series of reviews involving both scientists and policymakersmore » make them among the most reviewed documents produced in any scientific field. The high profile of these reports acts a driver to many researchers in the climate sciences. The Fourth Assessment Report (AR4) is scheduled to be released in 2007. SciDAC sponsored research has enabled the United States climate modeling community to make significant contributions to this report. Two large multi-Laboratory SciDAC projects are directly relevant to the activities of the IPCC. The first, entitled ''Collaborative Design and Development of the Community Climate System Model for Terascale Computers'', has made important software contributions to the recently released third version of the Community Climate System Model (CCSM3.0) developed at the National Center for Atmospheric Research. This is a multi-institutional project involving Los Alamos National Laboratory, Oak Ridge National Laboratory, Lawrence Berkeley National Laboratory, Pacific Northwest National Laboratory, Argonne National Laboratory, Lawrence Livermore National Laboratory and the National Center for Atmospheric Research. The original principal investigators were Robert Malone and John B. Drake. The current principal investigators are Phil Jones and John B. Drake. The second project, entitled ''Earth System Grid II: Turning Climate Datasets into

  4. General topology meets model theory, on and

    PubMed Central

    Malliaris, Maryanthe; Shelah, Saharon

    2013-01-01

    Cantor proved in 1874 [Cantor G (1874) J Reine Angew Math 77:258–262] that the continuum is uncountable, and Hilbert’s first problem asks whether it is the smallest uncountable cardinal. A program arose to study cardinal invariants of the continuum, which measure the size of the continuum in various ways. By Gödel [Gödel K (1939) Proc Natl Acad Sci USA 25(4):220–224] and Cohen [Cohen P (1963) Proc Natl Acad Sci USA 50(6):1143–1148], Hilbert’s first problem is independent of ZFC (Zermelo-Fraenkel set theory with the axiom of choice). Much work both before and since has been done on inequalities between these cardinal invariants, but some basic questions have remained open despite Cohen’s introduction of forcing. The oldest and perhaps most famous of these is whether “,” which was proved in a special case by Rothberger [Rothberger F (1948) Fund Math 35:29–46], building on Hausdorff [Hausdorff (1936) Fund Math 26:241–255]. In this paper we explain how our work on the structure of Keisler’s order, a large-scale classification problem in model theory, led to the solution of this problem in ZFC as well as of an a priori unrelated open question in model theory. PMID:23836659

  5. R-loops: targets for nuclease cleavage and repeat instability.

    PubMed

    Freudenreich, Catherine H

    2018-01-11

    R-loops form when transcribed RNA remains bound to its DNA template to form a stable RNA:DNA hybrid. Stable R-loops form when the RNA is purine-rich, and are further stabilized by DNA secondary structures on the non-template strand. Interestingly, many expandable and disease-causing repeat sequences form stable R-loops, and R-loops can contribute to repeat instability. Repeat expansions are responsible for multiple neurodegenerative diseases, including Huntington's disease, myotonic dystrophy, and several types of ataxias. Recently, it was found that R-loops at an expanded CAG/CTG repeat tract cause DNA breaks as well as repeat instability (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Two factors were identified as causing R-loop-dependent breaks at CAG/CTG tracts: deamination of cytosines and the MutLγ (Mlh1-Mlh3) endonuclease, defining two new mechanisms for how R-loops can generate DNA breaks (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Following R-loop-dependent nicking, base excision repair resulted in repeat instability. These results have implications for human repeat expansion diseases and provide a paradigm for how RNA:DNA hybrids can cause genome instability at structure-forming DNA sequences. This perspective summarizes mechanisms of R-loop-induced fragility at G-rich repeats and new links between DNA breaks and repeat instability.

  6. Patient-cooperative control increases active participation of individuals with SCI during robot-aided gait training

    PubMed Central

    2010-01-01

    Background Manual body weight supported treadmill training and robot-aided treadmill training are frequently used techniques for the gait rehabilitation of individuals after stroke and spinal cord injury. Current evidence suggests that robot-aided gait training may be improved by making robotic behavior more patient-cooperative. In this study, we have investigated the immediate effects of patient-cooperative versus non-cooperative robot-aided gait training on individuals with incomplete spinal cord injury (iSCI). Methods Eleven patients with iSCI participated in a single training session with the gait rehabilitation robot Lokomat. The patients were exposed to four different training modes in random order: During both non-cooperative position control and compliant impedance control, fixed timing of movements was provided. During two variants of the patient-cooperative path control approach, free timing of movements was enabled and the robot provided only spatial guidance. The two variants of the path control approach differed in the amount of additional support, which was either individually adjusted or exaggerated. Joint angles and torques of the robot as well as muscle activity and heart rate of the patients were recorded. Kinematic variability, interaction torques, heart rate and muscle activity were compared between the different conditions. Results Patients showed more spatial and temporal kinematic variability, reduced interaction torques, a higher increase of heart rate and more muscle activity in the patient-cooperative path control mode with individually adjusted support than in the non-cooperative position control mode. In the compliant impedance control mode, spatial kinematic variability was increased and interaction torques were reduced, but temporal kinematic variability, heart rate and muscle activity were not significantly higher than in the position control mode. Conclusions Patient-cooperative robot-aided gait training with free timing of movements

  7. A Novel Approach for Effectively Treating SCI Pain, Improving Opioid Efficacy, and Preventing Opioid Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2016-10-01

    treatment ; current therapies including opioids only provide ~50% pain relief in 1 out of 2-3 people (3) and the therapies are even less effective in...military blast SCI due to the complexity of the injury (4). This level of treatment efficacy is unacceptable for war fighters, military personnel...veterans, and citizens as a whole. SCI patients are almost universally treated with opioids as a first-line treatment , but recent evidence in the animal

  8. The Emerging Pathogen Candida auris: Growth Phenotype, Virulence Factors, Activity of Antifungals, and Effect of SCY-078, a Novel Glucan Synthesis Inhibitor, on Growth Morphology and Biofilm Formation.

    PubMed

    Larkin, Emily; Hager, Christopher; Chandra, Jyotsna; Mukherjee, Pranab K; Retuerto, Mauricio; Salem, Iman; Long, Lisa; Isham, Nancy; Kovanda, Laura; Borroto-Esoda, Katyna; Wring, Steve; Angulo, David; Ghannoum, Mahmoud

    2017-05-01

    Candida auris , a new multidrug-resistant Candida spp. which is associated with invasive infection and high rates of mortality, has recently emerged. Here, we determined the virulence factors (germination, adherence, biofilm formation, phospholipase and proteinase production) of 16 C. auris isolates and their susceptibilities to 11 drugs belonging to different antifungal classes, including a novel orally bioavailable 1,3-β-d-glucan synthesis inhibitor (SCY-078). We also examined the effect of SCY-078 on the growth, ultrastructure, and biofilm-forming abilities of C. auris Our data showed that while the tested strains did not germinate, they did produce phospholipase and proteinase in a strain-dependent manner and had a significantly reduced ability to adhere and form biofilms compared to that of Candida albicans ( P = 0.01). C. auris isolates demonstrated reduced susceptibility to fluconazole and amphotericin B, while, in general, they were susceptible to the remaining drugs tested. SCY-078 had an MIC 90 of 1 mg/liter against C. auris and caused complete inhibition of the growth of C. auris and C. albicans Scanning electron microscopy analysis showed that SCY-078 interrupted C. auris cell division, with the organism forming abnormal fused fungal cells. Additionally, SCY-078 possessed potent antibiofilm activity, wherein treated biofilms demonstrated significantly reduced metabolic activity and a significantly reduced thickness compared to the untreated control ( P < 0.05 for both comparisons). Our study shows that C. auris expresses several virulence determinants (albeit to a lesser extent than C. albicans ) and is resistant to fluconazole and amphotericin B. SCY-078, the new orally bioavailable antifungal, had potent antifungal/antibiofilm activity against C. auris , indicating that further evaluation of this antifungal is warranted. Copyright © 2017 Larkin et al.

  9. Role of the Integrin-Linked Kinase, ILK, in Mammary Carcinogensis

    DTIC Science & Technology

    2000-08-01

    have been implicated in environmental stress clonei 6-10 responses in yeasts, plants and mammals, as well as regulating abscisic acid signal transduction...phosphatase 2C involved in abscisic acid signal transduction in higher plants. Proc. Natl Acad. Sci. USA, 95, 975-980. Strovel,E.T., Wu,D. and Sussman,D.J...contain a 450bp open reading frame, coding for 149 amino acids and a poly A tail 245bp downstream of the stop codon, although no polyadenylation site

  10. Flaviviruses

    DTIC Science & Technology

    1990-01-01

    R, Paryanonda A. Human immunoglobulin M anti- virus de lots de moustiques adultes males et femelles. Med body in the serodiagnosis of Japanese...Immun 274. Roche JC, Cordellier R, Hervy JP, et al. Isolement de 96 1984;43:429-43 1. souches de virus dengue 2 a partir de moustiques captures en...dengue chez les moustiques . C R Acad Sci Paris persisting virus. Acta Virol (Praha) 1981 ;25:352-360. 1987;304:347-350. 257. Pool WA, Brownlee A, Wilson

  11. Formulated Delivery of Enzyme/Prodrug and Cytokine Gene Therapy to Promote Immune Reduction of Treated and Remote Tumors in Mouse Models of Prostate Cancer

    DTIC Science & Technology

    2007-01-01

    Cunha GR, Donjacour AA, Matusik RJ, Rosen JM. Prostate cancer in a transgenic mouse . Proc Natl Acad Sci U S A.1995;92(8):3439- 43 . Kanai F...data not shown). GFP expression in all cell lines was confirmed by UV microscopy and flow cytometry . Evaluation of RM1 cells for assessment of CDUPRT...for prostate cancer in a mouse model that imitates the development of human disease. J. Gene Med. (2004) 6(1): 43 -54. 108. MARTINIELLO-WILKS R

  12. Fibroblast Growth Factor Receptor-4 and Prostate Cancer Progression

    DTIC Science & Technology

    2007-10-01

    difference between the two FGFR-4 variants? Achondroplasia (dwarfism) is caused by a similar mutation in FGFR-3 (Gly380 to Arg380). Increased FGFR-3...what is the molecular basis for the difference between the two FGFR-4 variants? Achondroplasia is caused by a similar mutation in FGFR-3 (Gly380 to...lysosomal targeting of activated fibroblast growth factor receptor 3 in achondroplasia . Proc Natl Acad Sci U S A 2004;101(2):609-14. 27. Hyun TS, Rao DS

  13. A Search for Gene Fusions/Translocations in Breast Cancer

    DTIC Science & Technology

    2013-11-01

    Ramnarayanan K, Brenner JC, Yu J , Kim JH, Han B, Tan P, Kumar-Sinha C, Lonigro RJ, Palanisamy N, Maher CA, Chinnaiyan AM. Science. 2008 Dec 12;322...Barrette TR, Grasso C, Yu J , Lonigro RJ, Schroth G, Kumar-Sinha C, Chinnaiyan AM. Proc Natl Acad Sci U S A. 2009 Jul 10. [Epub ahead of print]. PMID...CA, Palanisamy N, Mehra R, Kominsky HD, Siddiqui J , Yu J , Qin ZS, Chinnaiyan AM. Deep sequencing reveals distinct patterns of DNA methylation in

  14. Genome-Wide Nucleic Acid/Protein Interaction in Breast Cancer

    DTIC Science & Technology

    2005-04-01

    Chen W, Zhang J et al: Large-scale genotyping of complex DNA. Nat Biotechnol 2003, 21(10):1233-1237. 25. Bolstad BM, Irizarry RA, Astrand M, Speed TP...2124836802660188/sup8.xls 235 Analysis of RNA-protein interactions by flow cytometry Alexander S Brodsky’*, Angus PR Johnston 2, Matt Trau 2 & Pamela A Silver1...Natl Acad Sci USA (2001) 98(23):12954-12959. genotyping using the Qbead system: A quantum dot-encoded microsphere-based assay. Nucleic Acids Res (2003

  15. Leukemia in US Navy Enlisted Personnel

    DTIC Science & Technology

    1989-02-03

    the health efects of living near or working in Hiroshima and Nagasaki, 1946-64. 1. Distribution, inci- with electricity generation and transmission...Non-Hodgkin’s lymphoma in U.S. Navy personnel. Arch posure. Ann NY Acad Sci 1976;27:143-51. Environ Health 1988;43:425-9. 40. Fishbeck WA, Townsend JC...human lym- benzene. Arch EnvL.on Health 1978;33:3-10. phocytes. Cell Calcium 1987;8:412-27. 43. Rushton L, Alderson MR. A case-control study to

  16. Proton-coupled oligopeptide transport by rat renal cortical brush border membrane vesicles: a functional analysis using ACE inhibitors to determine the isoform of the transporter.

    PubMed

    Temple, C S; Boyd, C A

    1998-08-14

    We demonstrate that the angiotensin-converting enzyme inhibitors enalapril and captopril inhibit the transport of D-Phe-L-Gln into PepT1-expressing Xenopus oocytes and into rat renal cortical brush border membrane vesicles (BBMV). The kinetics of inhibition are competitive. Enalapril and captopril are not substrates for PepT2 (Boll et al., Proc. Natl. Acad. Sci. 93 (1996) 284-289). Therefore we conclude that in rat renal cortical BBMV this neutral dipeptide is transported via PepT1.

  17. Bio-Inspired Metallo-Supramolecular Polymers for Combined Mechanical Properties

    DTIC Science & Technology

    2010-01-01

    3 4 5 6 0 50 100 150 200 Temp (°C) H ea t F lo w (m W ) Figure 8. DSC trace of polymer 7. 1H NMR analysis indicated complete reaction of the...static and dynamic mechanical analysis methods. 11 5. References 1. Guan, Z. Polymer International 2007, 56, 467. 2. Oberhauser, A. F ...Hansma, P. K.; Carrion-Vazques, M.; Fernandez, J. M. Proc. Natl. Acad. Sci. USA 2001, 98, 468. 3. Reif, M. Gautel, M.; Oesterhelt, F .; Fernandez, J

  18. Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

    DTIC Science & Technology

    2013-09-01

    lethal prostate cancers. Proc. Natl Acad. Sci. USA 108, 17087–17092 (2011). 5. Parsons, D. W. et al. The genetic landscape of the childhood cancer...7. Stransky, N. et al. The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157–1160 (2011). 8. Nik-Zainal, S. et al...Mutational processes molding the genomes of 21 breast cancers. Cell 149, 979–993 (2012). 9. Stephens, P. J. et al. The landscape of cancer genes and

  19. Molecular Cloning and Function of FAS/APO1 Associated Protein in Breast Cancer.

    DTIC Science & Technology

    1996-06-01

    Ariyama T, Abe T, Druck T, Ohta M, Huebner K, Yanagisawa J, Reed JC, Sato T: PTPN13, a Fas-associated protein tyrosine phosphatase, is located on...20. Yang, Q., and Tonks, N. K. (1991). Isolation of a cDNA clone encoding a human protein-tyrosine phosphatase with homology 7. Huebner, K., Druck , T...Acad. Sci. U.S.A. 91, 7477 (1994). Res. 53, 1945 (1993).(Fig. 3D ). In contrast to Jurkat cells which 13. The original description of PTP-BAS (12

  20. Molecular Profiles for Lung Cancer Pathogenesis and Detection in US Veterans

    DTIC Science & Technology

    2011-10-01

    expression data was analyzed using the BRB-ArrayTools v .4.1.0 developed by Dr. Richard Simon and the BRB-ArrayTools Development Team and then normalized...14. Spira A, Beane J, Shah V , et al. Effects of cigarette smoke on the human airway epithelial cell transcriptome. Proc Natl Acad Sci U S A 2004;101...10143-10148 15. Spira A, Beane JE, Shah V , et al. Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer

  1. Molecular Profiles for Lung Cancer Pathogenesis and Detection in US Veterans

    DTIC Science & Technology

    2011-10-01

    data was analyzed using the BRB-ArrayTools v .4.1.0 developed by Dr. Richard Simon and the BRB-ArrayTools Development Team and then normalized and log...Spira A, Beane J, Shah V , et al. Effects of cigarette smoke on the human airway epithelial cell transcriptome. Proc Natl Acad Sci U S A 2004;101:10143...10148 15. Spira A, Beane JE, Shah V , et al. Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer. Nat

  2. Genome-Wide Analysis of Translational Control in Tuberous Sclerosis Complex

    DTIC Science & Technology

    2013-07-01

    INTRODUCTION The mammalian target of rapamycin (mTOR) is a highly conserved serine/ threonine kinase that is named for its inhibition by the drug...Natl. Acad. Sci. U.S.A. 108, E1070–E1079 (2011). 9. R. Zoncu, A. Efeyan, D. M. Sabatini, mTOR: From growth signal integration to cancer, diabetes ...signaling: At the cross- roads of obesity, diabetes and cancer. Trends Mol. Med. 13, 252–259 (2007). 26. C. G. Proud, mTOR signalling in health and

  3. Comparative Histopathology of Acanthocephalan Infections in Some Freshwater Fishes

    DTIC Science & Technology

    1980-08-01

    Zool. 48:19-42. Choquette, L. P. E. 1951. Parasites of fresh-vater fish. V. Parasitic helminths of the muskellunge, Estox in. niasqu ltoni MitchllI. ill...G. W. and W. J. lluffines. 1973. Histopatiology assoa-iated with endoparasimic helminths in bass. .1. Parasit . 59:306-313. Jansson, B. and R. Olsson...R. 1966. Some helminths of Itasca Park fishes. J. M’linnesota Acad. Sci. 33:99-101. Meyer, M. C. 1954. The larger animial parasites of the freshwater

  4. The Isolation and Characterization of Human Prostate Cancer Stem Cells

    DTIC Science & Technology

    2015-05-01

    GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

  5. Chemoprevention of Breast Cancer by Mimicking the Protective Effect of Early First Birth

    DTIC Science & Technology

    2006-06-01

    and differentiation in the rodent mammary gland. Mol Endocrinol 2002;16:2034–51. 7. Thordarson G, Jin E, Guzman RC, Swanson SM, Nandi S, Talamantes F...8. 11. Rajkumar L, Guzman RC, Yang J, Thordarson G, Talamantes F, Nandi S. Short-term exposure to preg- nancy levels of estrogen prevents mammary...carcino- genesis. Proc Natl Acad Sci U S A 2001;98:11755–9. 12. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S. Hormonal prevention of

  6. Laser Hazards Bibliography - October 1984,

    DTIC Science & Technology

    1984-10-31

    and wound healing, Zentrabl Chir , 102(20): 124-150 (1977) (English abstract, German). 11. Bach, J. L., The amazing laser, medicine’s newest research...Langebecks Arch Chir , 347: 367-371 (1978). 77. Ketcham, A. S., Hoye, R. C., and Riggle, G. C., A surgeon’s appraisal of the laser, Surg Clin N Am, 47: 1249...clinical practice, Acta Chir Acad Sci Hung, 9: 349-357 (1968). 96. Minton, J. P., et al., Pulsed laser energy in the management of * multiple pulmonary

  7. Development of an Implantable Pudendal Nerve Stimulator To Restore Bladder Function in Humans After SCI

    DTIC Science & Technology

    2016-10-01

    new version of the stimulator will be manufactured and tested again. This design-build-test cycle will be repeated multiple times during the second...AWARD NUMBER: W81XWH-15-C-0066 TITLE: Development of an Implantable Pudendal Nerve Stimulator To Restore Bladder Function in Humans After SCI...response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and

  8. Measuring psychological trauma after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Psychological Trauma item bank and short form

    PubMed Central

    Kisala, Pamela A.; Victorson, David; Pace, Natalie; Heinemann, Allen W.; Choi, Seung W.; Tulsky, David S.

    2015-01-01

    Objective To describe the development and psychometric properties of the SCI-QOL Psychological Trauma item bank and short form. Design Using a mixed-methods design, we developed and tested a Psychological Trauma item bank with patient and provider focus groups, cognitive interviews, and item response theory based analytic approaches, including tests of model fit, differential item functioning (DIF) and precision. Setting We tested a 31-item pool at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital and the James J. Peters/Bronx Veterans Administration hospital. Participants A total of 716 individuals with SCI completed the trauma items Results The 31 items fit a unidimensional model (CFI=0.952; RMSEA=0.061) and demonstrated good precision (theta range between 0.6 and 2.5). Nine items demonstrated negligible DIF with little impact on score estimates. The final calibrated item bank contains 19 items Conclusion The SCI-QOL Psychological Trauma item bank is a psychometrically robust measurement tool from which a short form and a computer adaptive test (CAT) version are available. PMID:26010967

  9. Energy for Living. Teacher's Guide. Unit G1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  10. Reproducing by Flowers and Seeds. Teacher's Guide. Unit E2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Zesaguli, Josie

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  11. Our Planet Earth. Study Guide. Unit F1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  12. Development and psychometric characteristics of the SCI-QOL Ability to Participate and Satisfaction with Social Roles and Activities item banks and short forms.

    PubMed

    Heinemann, Allen W; Kisala, Pamela A; Hahn, Elizabeth A; Tulsky, David S

    2015-05-01

    To develop a spinal cord injury (SCI)-focused version of PROMIS and Neuro-QOL social domain item banks; evaluate the psychometric properties of items developed for adults with SCI; and report information to facilitate clinical and research use. We used a mixed-methods design to develop and evaluate Ability to Participate in Social Roles and Activities and Satisfaction with Social Roles and Activities items. Focus groups helped define the constructs; cognitive interviews helped revise items; and confirmatory factor analysis and item response theory methods helped calibrate item banks and evaluate differential item functioning related to demographic and injury characteristics. Five SCI Model System sites and one Veterans Administration medical center. The calibration sample consisted of 641 individuals; a reliability sample consisted of 245 individuals residing in the community. A subset of 27 Ability to Participate and 35 Satisfaction items demonstrated good measurement properties and negligible differential item functioning related to demographic and injury characteristics. The SCI-specific measures correlate strongly with the PROMIS and Neuro-QOL versions. Ten item short forms correlate >0.96 with the full banks. Variable-length CATs with a minimum of 4 items, variable-length CATs with a minimum of 8 items, fixed-length CATs of 10 items, and the 10-item short forms demonstrate construct coverage and measurement error that is comparable to the full item bank. The Ability to Participate and Satisfaction with Social Roles and Activities CATs and short forms demonstrate excellent psychometric properties and are suitable for clinical and research applications.

  13. ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy.

    PubMed

    Ottesen, Eric W

    2017-01-01

    Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 ( SMN1 ) gene. SMN2 , a nearly identical copy of SMN1 , cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza ™ (synonyms: Nusinersen, IONIS-SMN RX , ISIS-SMN RX ), an antisense drug based on ISS-N1 target. Spinraza ™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza ™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza ™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols.

  14. ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy

    PubMed Central

    Ottesen, Eric W.

    2017-01-01

    Abstract Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 (SMN1) gene. SMN2, a nearly identical copy of SMN1, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza™ (synonyms: Nusinersen, IONIS-SMNRX, ISIS-SMNRX), an antisense drug based on ISS-N1 target. Spinraza™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols. PMID:28400976

  15. Lack of Impact by SCY-078, a First-in-Class Oral Fungicidal Glucan Synthase Inhibitor, on the Pharmacokinetics of Rosiglitazone, a Substrate for CYP450 2C8, Supports the Low Risk for Clinically Relevant Metabolic Drug-Drug Interactions.

    PubMed

    Wring, Stephen; Murphy, Gail; Atiee, George; Corr, Christy; Hyman, Michele; Willett, Michael; Angulo, David

    2018-05-10

    SCY-078, the first in a new class of β 1,3-glucan synthesis inhibitors, is being developed as an oral and intravenous antifungal treatment for Candida and Aspergillus species fungal infections. In vitro, studies indicated SCY-078 is an inhibitor of cytochrome P450 (CYP) 2C8 with markedly lower effect over other CYP isozymes. To examine clinically relevant effects of the potential interaction with SCY-078, this phase 1, open-label, 2-period crossover study evaluated the pharmacokinetic parameters of rosiglitazone, a sensitive substrate of CYP2C8 metabolism, in the absence and presence of SCY-078 dosed to therapeutically relevant SCY-078 concentration exposure after repeat dosing. Healthy adult subjects were randomized to 2 treatment sequences: a single oral 4-mg rosiglitazone dose alone on day 1 or a 1250-mg SCY-078 loading dose on day 1 followed by a once-daily 750-mg SCY-078 dose for an additional 7 days (reflecting the clinical regimen evaluated during phase 2 studies for infections by Candida species) and concurrent administration of a single oral 4-mg rosiglitazone dose on day 3, before alternating following a ≥10-day washout. The exposure to SCY-078 observed in this study was in line with the intended exposure for treatment of invasive fungal infections. The 90% confidence intervals for rosiglitazone exposure geometric mean ratios were within the prespecified no effect interval of 0.70-1.43. Additionally, maximum concentration values for rosiglitazone and its metabolite, N-desmethylrosiglitazone, were not significantly affected by co-administration with SCY-078. Overall, rosiglitazone exposure was not impacted to a clinically meaningful extent with co-administration of therapeutically relevant SCY-078 concentration exposure after repeat dosing. The results are indicative of low risk for interaction of SCY-078 with drugs metabolized via the CYP family of enzymes. © 2018, The Authors. The Journal of Clinical Pharmacology published by Wiley Periodicals, Inc

  16. Exploring Earth and the Solar System: Educational Outreach Through NASA's Space Place, SciJinks, and Climate Kids Websites

    NASA Technical Reports Server (NTRS)

    Meneses, Joseph Chistopher

    2012-01-01

    NASA's Space Place team publishes engaging content and creates an effective environment to inspire a young audience to dare mighty things. NASA uses the Space Place, Climate Kids, and SciJinks websites to cultivate interest among elementary-school-aged children in both science and technology. During my summer internship at Jet Propulsion Laboratory I used Adobe Flash and ActionScript 3 to develop content for the Space Place, Climate Kids, and SciJinks sites. In addition, I was involved in the development process for ongoing and new projects during my internship. My involvement allowed me to follow a project from concept to design, implementation, and release. I personally worked on three projects this summer, two of which are currently in deployment. The first is a scrambled letter-tile guessing game titled Solar System Scramble. The second, Butterfrog Mix-Up, is a rotating-tile puzzle game. The third project is a unfinished prototype for a maze game.

  17. Determine the Role of Canonical Wnt Signaling in Ovarian Tumorigenesis

    DTIC Science & Technology

    2012-10-01

    Acad Sci U S A, 1999. 96(4): p. 1603-8. 11. Kuilman, T., et al., The essence of senescence. Genes Dev, 2010. 24(22): p. 2463- 79. 12. Bernardi, R...Tu,1 Katherine M. Aird,1 Benjamin G. Bitler,1 Jasmine P. Nicodemus,1 Neil Beeharry,2 Bing Xia,3 Tim J. Yen,2 and Rugang Zhang1,2,* 1Women’s Cancer...Bitler, Jasmine P. Nicodemus, Hua Li, et al. Senescence Wnt5a Suppresses Epithelial Ovarian Cancer by Promoting Cellular Updated Version

  18. Origin and Properties of Prostatic Stem Cells

    DTIC Science & Technology

    2007-02-01

    Brinster RL. beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999;96(10):5504-9. 14. Tsujimura ...G. R., Donjacour, A. A., Cooke, P. S., Mee, S., Bigsby, R. M., Higgins, S. J. & Sugimura, Y. (1987) Endocr. Rev. 8, 338–362. 9. Tsujimura , A...90. 4 Tsujimura A, Koikawa Y, Salm S et al. Proximal location of mouse prostate epithelial stem cells: A model of prostatic homeostasis. J Cell Biol

  19. Characterization of a SUMO Ligase that is Essential for DNA Damage-Induced NF-Kappa B Activation

    DTIC Science & Technology

    2008-03-01

    DNA damage. Oncogene 18, 2261 – 2271. 80 Jung , M., Zhang, Y., Lee, S. and Dritschilo, A. (1995) Correction of radiation sensitivity in ataxia...telangiectasia cells by a truncated I kappaB-alpha. Science 268, 1619 – 1621. 81 Lee, S. J., Dimtchev, A., Lavin,M. F., Dritschilo, A. and Jung , M. (1998) A...CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94, 2927 – 2932. 98 Kuo , H. Y., Chang, C. C., Jeng, J. C

  20. Improved Performance of Protected Catecholic Polysiloxanes for Bioinspired Wet Adhesion to Surface Oxides

    DTIC Science & Technology

    2012-11-26

    1374. (2) Cho, Y.; Sundaram, H. S.; Finlay , J. A.; Dimitriou, M. D.; Callow, M. E.; Callow, J. A.; Kramer, E. J.; Ober, C. K. Biomacromolecules 2012...139−144. (11) Zeng, H.; Hwang, D. S.; Israelachvili, J. N .; Waite, J. H. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 12850−12853. (12) Holten-Andersen, N ...Haeshin, L.; Dellatore, S. M.; Miller, W. M.; Messersmith, P. B. Science 2007, 318, 426−430. (14) Ling, D.; Park, W.; Park, Y. I.; Lee, N .; Li, F

  1. Accumulation of the Cyclobutane Thymine Dimer in Defined Sequences of Free and Nucleosomal DNA

    DTIC Science & Technology

    2013-08-01

    cyclobutane dimer in a single-stranded vector , Proc. Natl. Acad. Sci. U. S. A., 1988, 85, 8141–8145. 11 C. A. Smith, M. Wang, N. Jiang, L. Che, X. Zhao and...J.-S. Taylor, Mutation spectra of M13 vectors containing site-specific cis–syn, trans–syn-I, (6-4), and Dewar pyrimi- done photoproducts of thymidylyl...Bypass of a site-specific cis–syn thymine dimer in a SV40 vector during in vitro replication by HeLa and XPV cell-free extracts, Biochemistry, 1998

  2. Chaperone Function in Androgen-Independent Prostate Cancer

    DTIC Science & Technology

    2012-05-01

    differentiation. Proc Natl Acad Sci U S A 92, 11081-11085. Yong, W., Yang, Z., Periyasamy, S., Chen, H., Yucel, S., Li, W., Lin, L. Y., Wolf , I. M., Cohn, M...Biol Chem 282, 5026-5036. Yong, W., Yang, Z., Periyasamy, S., Chen, H., Yucel, S., Li, W., Lin, L. Y., Wolf , I. M., Cohn, M. J., Baskin, L. S., et... Reintroduction of AR into PC-3 cells activates the endogenous FKBP51 gene, an observation that is consistent with AR regulation of FKBP51 expression

  3. Fast Parallel Tree Codes for Gravitational and Fluid Dynamical N-Body Problems

    DTIC Science & Technology

    1993-01-01

    The particles represent the so-called " Dark Matter " eral times the the full message latency for every remote which is believed to dominate the mass...Katz, L. Herquist, and D. H. Weinberg. Galax- R. Acad. Sci. Paris, 306(I):739-742, 1988. ies and gas in a cold dark matter universe. Ap. J., [111 A...57(3):566-569, 1983. dark matter halos. Ap. J., 378:496, 1991. [30] G. Pedrizzetti. Insight into singular vortex flows. [17] C. C. Dyer and P. S. S

  4. Comparison of the Side Populations in Pretreatment and Postrelapse Neuroblastoma Cell Lines

    DTIC Science & Technology

    2010-08-01

    396–401. [15] Hansford LM, McKee AE, Zhang L, George RE, Gerstle JT, Thorner PS, Smith KM, Look AT, Yeger H, Miller FD, et al. (2007). Neuroblastoma...Acad Sci USA 103, 11154–11159. [32] Wu C, Wei Q , Utomo V, Nadesan P, Whetstone H, Kandel R, Wunder JS, and Alman BA (2007). Side population cells...Jeter CR, Badeaux M, Choy G, Chandra D, Patrawala L, Liu C, Calhoun- Davis T, Zaehres H, Daley GQ, and Tang DG (2009). Functional evidence that the

  5. Molecular Profiles for Lung Cancer Pathogenesis and Detection in US Veterans

    DTIC Science & Technology

    2011-10-01

    raw image files that were subsequently converted to probe set data. Raw expression data was analyzed using the BRB-ArrayTools v .4.1.0 developed by Dr...epithelium of cigarette smokers. Am J Respir Cell Mol Biol 2003;29:331-343 14. Spira A, Beane J, Shah V , et al. Effects of cigarette smoke on the...human airway epithelial cell transcriptome. Proc Natl Acad Sci U S A 2004;101:10143-10148 15. Spira A, Beane JE, Shah V , et al. Airway epithelial gene

  6. The Role of Amplified Wild-Type Neu in the Etiology of Breast Cancer

    DTIC Science & Technology

    2004-07-01

    mutations that were found, only one (a C - T change of chromosome 5 (data not shown). DAPI banding patterns of nucleotide 2137) was present in clones...activation. Proc. NatI. Acad. Sci. USA 93, 8878-8883. Koelsch, B.U. (1998). Assignment of erbB2 to rat chromosome band 1Oq32.1 by in situ...was used to map the integration site of the neu transgene in lines 6500 and 2477. Line 6500 contained -3-6 copies of the transgene in chromosome 10

  7. Periodicity of mass extinctions without an extraterrestrial cause.

    PubMed

    Lipowski, Adam

    2005-05-01

    We study a lattice model of a multispecies prey-predator system. Numerical results show that for a small mutation rate the model develops irregular long-period oscillatory behavior with sizeable changes in a number of species. The periodicity of extinctions on Earth was suggested by Raup and Sepkoski [Proc. Natl. Acad. Sci. 81, 801 (1984)], but thus far is lacking a satisfactory explanation. Our model indicates that this might be a natural consequence of the ecosystem dynamics and not the result of any extraterrestrial cause.

  8. Chemoprevention of Breast Cancer by Mimicking the Protective Effect of Early First Birth. Addendum

    DTIC Science & Technology

    2013-03-01

    changes in growth factors, TGF-h3, and differentiation in the rodent mammary gland. Mol Endocrinol 2002;16:2034–51. 7. Thordarson G, Jin E, Guzman RC...rats. Carcinogenesis 1999;20:623–8. 11. Rajkumar L, Guzman RC, Yang J, Thordarson G, Talamantes F, Nandi S. Short-term exposure to preg- nancy levels of...estrogen prevents mammary carcino- genesis. Proc Natl Acad Sci U S A 2001;98:11755–9. 12. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S

  9. Chemoprevention of Breast Cancer by Mimicking the Protective Effect of Early First Birth

    DTIC Science & Technology

    2008-06-01

    growth factors, TGF-h3, and differentiation in the rodent mammary gland. Mol Endocrinol 2002;16:2034–51. 7. Thordarson G, Jin E, Guzman RC, Swanson...Carcinogenesis 1999;20:623–8. 11. Rajkumar L, Guzman RC, Yang J, Thordarson G, Talamantes F, Nandi S. Short-term exposure to preg- nancy levels of...estrogen prevents mammary carcino- genesis. Proc Natl Acad Sci U S A 2001;98:11755–9. 12. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S

  10. Test-retest reliability at the item level and total score level of the Norwegian version of the Spinal Cord Injury Falls Concern Scale (SCI-FCS).

    PubMed

    Roaldsen, Kirsti Skavberg; Måøy, Åsa Blad; Jørgensen, Vivien; Stanghelle, Johan Kvalvik

    2016-05-01

    Translation of the Spinal Cord Injury Falls Concern Scale (SCI-FCS), and investigation of test-retest reliability on item-level and total-score-level. Translation, adaptation and test-retest study. A specialized rehabilitation setting in Norway. Fifty-four wheelchair users with a spinal cord injury. The median age of the cohort was 49 years, and the median number of years after injury was 13. Interventions/measurements: The SCI-FCS was translated and back-translated according to guidelines. Individuals answered the SCI-FCS twice over the course of one week. We investigated item-level test-retest reliability using Svensson's rank-based statistical method for disagreement analysis of paired ordinal data. For relative reliability, we analyzed the total-score-level test-retest reliability with intraclass correlation coefficients (ICC2.1), the standard error of measurement (SEM), and the smallest detectable change (SDC) for absolute reliability/measurement-error assessment and Cronbach's alpha for internal consistency. All items showed satisfactory percentage agreement (≥69%) between test and retest. There were small but non-negligible systematic disagreements among three items; we recovered an 11-13% higher chance for a lower second score. There was no disagreement due to random variance. The test-retest agreement (ICC2.1) was excellent (0.83). The SEM was 2.6 (12%), and the SDC was 7.1 (32%). The Cronbach's alpha was high (0.88). The Norwegian SCI-FCS is highly reliable for wheelchair users with chronic spinal cord injuries.

  11. Impact of locomotion training with a neurologic controlled hybrid assistive limb (HAL) exoskeleton on neuropathic pain and health related quality of life (HRQoL) in chronic SCI: a case study (.).

    PubMed

    Cruciger, Oliver; Schildhauer, Thomas A; Meindl, Renate C; Tegenthoff, Martin; Schwenkreis, Peter; Citak, Mustafa; Aach, Mirko

    2016-08-01

    Chronic neuropathic pain (CNP) is a common condition associated with spinal cord injury (SCI) and has been reported to be severe, disabling and often treatment-resistant and therefore remains a clinical challenge for the attending physicians. The treatment usually includes pharmacological and/or nonpharmacological approaches. Body weight supported treadmill training (BWSTT) and locomotion training with driven gait orthosis (DGO) have evolved over the last decades and are now considered to be an established part in the rehabilitation of SCI patients. Conventional locomotion training goes along with improvements of the patients' walking abilities in particular speed and gait pattern. The neurologic controlled hybrid assistive limb (HAL®, Cyberdyne Inc., Ibraki, Japan) exoskeleton, however, is a new tailored approach to support motor functions synchronously to the patient's voluntary drive. This report presents two cases of severe chronic and therapy resistant neuropathic pain due to chronic SCI and demonstrates the beneficial effects of neurologic controlled exoskeletal intervention on pain severity and health-related quality of life (HRQoL). Both of these patients were engaged in a 12 weeks period of daily HAL®-supported locomotion training. In addition to improvements in motor functions and walking abilities, both show significant reduction in pain severity and improvements in all HRQoL domains. Although various causal factors likely contribute to abatement of CNP, the reported results occurred due to a new approach in the rehabilitation of chronic spinal cord injury patients. These findings suggest not only the feasibility of this new approach but in conclusion, demonstrate the effectiveness of neurologic controlled locomotion training in the long-term management of refractory neuropathic pain. Implications for Rehabilitation CNP remains a challenge in the rehabilitation of chronic SCI patients. Locomotion training with the HAL exoskeleton seems to improve CNP

  12. Effect of tendon vibration during wide-pulse neuromuscular electrical stimulation (NMES) on muscle force production in people with spinal cord injury (SCI).

    PubMed

    Bochkezanian, Vanesa; Newton, Robert U; Trajano, Gabriel S; Vieira, Amilton; Pulverenti, Timothy S; Blazevich, Anthony J

    2018-02-13

    Neuromuscular electrical stimulation (NMES) is commonly used in skeletal muscles in people with spinal cord injury (SCI) with the aim of increasing muscle recruitment and thus muscle force production. NMES has been conventionally used in clinical practice as functional electrical stimulation (FES), using low levels of evoked force that cannot optimally stimulate muscular strength and mass improvements, and thus trigger musculoskeletal changes in paralysed muscles. The use of high intensity intermittent NMES training using wide-pulse width and moderate-intensity as a strength training tool could be a promising method to increase muscle force production in people with SCI. However, this type of protocol has not been clinically adopted because it may generate rapid muscle fatigue and thus prevent the performance of repeated high-intensity muscular contractions in paralysed muscles. Moreover, superimposing patellar tendon vibration onto the wide-pulse width NMES has been shown to elicit further increases in impulse or, at least, reduce the rate of fatigue in repeated contractions in able-bodied populations, but there is a lack of evidence to support this argument in people with SCI. Nine people with SCI received two NMES protocols with and without superimposing patellar tendon vibration on different days (i.e. STIM and STIM+vib), which consisted of repeated 30 Hz trains of 58 wide-pulse width (1000 μs) symmetric biphasic pulses (0.033-s inter-pulse interval; 2 s stimulation train; 2-s inter-train interval) being delivered to the dominant quadriceps femoris. Starting torque was 20% of maximal doublet-twitch torque and stimulations continued until torque declined to 50% of the starting torque. Total knee extensor impulse was calculated as the primary outcome variable. Total knee extensor impulse increased in four subjects when patellar tendon vibration was imposed (59.2 ± 15.8%) but decreased in five subjects (- 31.3 ± 25.7%). However, there were no

  13. Atoms and Molecules. 'O' Level. Teacher's Guide. Unit 2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Mandizha, George

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be used in…

  14. Participation rates, response bias and response behaviours in the community survey of the Swiss Spinal Cord Injury Cohort Study (SwiSCI).

    PubMed

    Fekete, Christine; Segerer, Wolfgang; Gemperli, Armin; Brinkhof, Martin W G

    2015-10-08

    Surveying persons with disabilities is challenging, as targeted subjects may experience specific barriers to survey participation. Here we report on participation rates and response behaviour in a community survey of people with spinal cord injury (SCI) in Switzerland. The cross-sectional survey was implemented as part of the Swiss Spinal Cord Injury Cohort Study (SwiSCI) and represents the largest population-based SCI survey in Europe including nearly 2000 persons. Design features to enhance participation rates included the division of the questionnaire volume over three successive modules; recurrent and mixed-mode reminding of non-responders; and mixed-mode options for response. We describe participation rates of the SwiSCI community survey (absolute and cumulative cooperation, contact, response, and attrition rates) and report on response rates in relation to recruitment efforts. Potential non-response bias and the association between responders' characteristics and response behaviour (response speed: reminding until participation; response mode: paper-pencil vs. online completion) were assessed using regression modelling. Over the successive modules, absolute response rates were 61.1, 80.6 and 87.3% which resulted in cumulative response rates of 49.3 and 42.6% for the second and third modules. Written reminders effectively increased response rates, with the first reminder showing the largest impact. Telephone reminders, partly with direct telephone interviewing, enhanced response rate to the first module, but were essentially redundant in subsequent modules. Non-response to the main module was related to current age, membership of Swiss Paraplegic Association (SPA) and time since injury, but not to gender, lesion level and preferred language of response. Response speed increased with household income, but was not associated to other sociodemographic factors, lesion characteristics or health indicators. We found significant associations between online completion

  15. A Global Scale Scenario for Prebiotic Chemistry: Silica-Based Self-Assembled Mineral Structures and Formamide

    PubMed Central

    2016-01-01

    The pathway from simple abiotically made organic compounds to the molecular bricks of life, as we know it, is unknown. The most efficient geological abiotic route to organic compounds results from the aqueous dissolution of olivine, a reaction known as serpentinization (Sleep, N.H., et al. (2004) Proc. Natl. Acad. Sci. USA 101, 12818–12822). In addition to molecular hydrogen and a reducing environment, serpentinization reactions lead to high-pH alkaline brines that can become easily enriched in silica. Under these chemical conditions, the formation of self-assembled nanocrystalline mineral composites, namely silica/carbonate biomorphs and metal silicate hydrate (MSH) tubular membranes (silica gardens), is unavoidable (Kellermeier, M., et al. In Methods in Enzymology, Research Methods in Biomineralization Science (De Yoreo, J., Ed.) Vol. 532, pp 225–256, Academic Press, Burlington, MA). The osmotically driven membranous structures have remarkable catalytic properties that could be operating in the reducing organic-rich chemical pot in which they form. Among one-carbon compounds, formamide (NH2CHO) has been shown to trigger the formation of complex prebiotic molecules under mineral-driven catalytic conditions (Saladino, R., et al. (2001) Biorganic & Medicinal Chemistry, 9, 1249–1253), proton irradiation (Saladino, R., et al. (2015) Proc. Natl. Acad. Sci. USA, 112, 2746–2755), and laser-induced dielectric breakdown (Ferus, M., et al. (2015) Proc Natl Acad Sci USA, 112, 657–662). Here, we show that MSH membranes are catalysts for the condensation of NH2CHO, yielding prebiotically relevant compounds, including carboxylic acids, amino acids, and nucleobases. Membranes formed by the reaction of alkaline (pH 12) sodium silicate solutions with MgSO4 and Fe2(SO4)3·9H2O show the highest efficiency, while reactions with CuCl2·2H2O, ZnCl2, FeCl2·4H2O, and MnCl2·4H2O showed lower reactivities. The collections of compounds forming inside and outside the tubular

  16. A Global Scale Scenario for Prebiotic Chemistry: Silica-Based Self-Assembled Mineral Structures and Formamide.

    PubMed

    Saladino, Raffaele; Botta, Giorgia; Bizzarri, Bruno Mattia; Di Mauro, Ernesto; Garcia Ruiz, Juan Manuel

    2016-05-17

    The pathway from simple abiotically made organic compounds to the molecular bricks of life, as we know it, is unknown. The most efficient geological abiotic route to organic compounds results from the aqueous dissolution of olivine, a reaction known as serpentinization (Sleep, N.H., et al. (2004) Proc. Natl. Acad. Sci. USA 101, 12818-12822). In addition to molecular hydrogen and a reducing environment, serpentinization reactions lead to high-pH alkaline brines that can become easily enriched in silica. Under these chemical conditions, the formation of self-assembled nanocrystalline mineral composites, namely silica/carbonate biomorphs and metal silicate hydrate (MSH) tubular membranes (silica gardens), is unavoidable (Kellermeier, M., et al. In Methods in Enzymology, Research Methods in Biomineralization Science (De Yoreo, J., Ed.) Vol. 532, pp 225-256, Academic Press, Burlington, MA). The osmotically driven membranous structures have remarkable catalytic properties that could be operating in the reducing organic-rich chemical pot in which they form. Among one-carbon compounds, formamide (NH2CHO) has been shown to trigger the formation of complex prebiotic molecules under mineral-driven catalytic conditions (Saladino, R., et al. (2001) Biorganic & Medicinal Chemistry, 9, 1249-1253), proton irradiation (Saladino, R., et al. (2015) Proc. Natl. Acad. Sci. USA, 112, 2746-2755), and laser-induced dielectric breakdown (Ferus, M., et al. (2015) Proc Natl Acad Sci USA, 112, 657-662). Here, we show that MSH membranes are catalysts for the condensation of NH2CHO, yielding prebiotically relevant compounds, including carboxylic acids, amino acids, and nucleobases. Membranes formed by the reaction of alkaline (pH 12) sodium silicate solutions with MgSO4 and Fe2(SO4)3·9H2O show the highest efficiency, while reactions with CuCl2·2H2O, ZnCl2, FeCl2·4H2O, and MnCl2·4H2O showed lower reactivities. The collections of compounds forming inside and outside the tubular membrane are

  17. The Intracellular Juxtamembrane Domain of the Epidermal Growth Factor (EGF) Receptor Is Responsible for the Allosteric Regulation of EGF Binding*S⃞♦

    PubMed Central

    Macdonald-Obermann, Jennifer L.; Pike, Linda J.

    2009-01-01

    We have previously shown that the binding of epidermal growth factor (EGF) to its receptor can best be described by a model that involves negative cooperativity in an aggregating system (Macdonald, J. L., and Pike, L. J. (2008) Proc. Natl. Acad. Sci. U. S. A. 105, 112–117). However, despite the fact that biochemical analyses indicate that EGF induces dimerization of its receptor, the binding data provided no evidence for positive linkage between EGF binding and dimer assembly. By analyzing the binding of EGF to a number of receptor mutants, we now report that in naive, unphosphorylated EGF receptors, ligand binding is positively linked to receptor dimerization but the linkage is abolished upon autophosphorylation of the receptor. Both phosphorylated and unphosphorylated EGF receptors exhibit negative cooperativity, indicating that mechanistically, cooperativity is distinct from the phenomenon of linkage. Nonetheless, both the positive linkage and the negative cooperativity observed in EGF binding require the presence of the intracellular juxtamembrane domain. This indicates the existence of inside-out signaling in the EGF receptor system. The intracellular juxtamembrane domain has previously been shown to be required for the activation of the EGF receptor tyrosine kinase (Thiel, K. W., and Carpenter, G. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 19238–19243). Our experiments expand the role of this domain to include the allosteric control of ligand binding by the extracellular domain. PMID:19336395

  18. The effect of complex rehabilitation training for 12 weeks on trunk muscle function and spine deformation of patients with SCI.

    PubMed

    Sung, Dong-Hun; Yoon, Seong-Deok; Park, Gi Duck

    2015-03-01

    [Purpose] It is important for patients with incomplete spinal cord injury (SCI) to strengthen their muscle strength and return to the work force one of the ultimate objectives of rehabilitation. This study reports how a single patient with SCI became stabilized in terms of abdominal muscles and back extension muscles, as well as returning the back to the neutral position from spinal deformation, as result of complex exercises performed for 12 weeks. [Subjects] The degree of damage of the subject was rated as C grade. The subject of this study had unstable posture due to paralysis in the lower extremities of the left side after removal of a malignant tumor by surgical operation, and tilting and torsion in the pelvis increased followed by increase of kyphosis in the thoracolumbar spine. The subject was more than two years since diagnosis of incomplete SCI after surgery. [Methods] Using isokinetic lumbar muscle strength measurement equipment, peak torque/weight, total work and average power in flexion and extension of the lumbar region were measured. A trunk measurement system (Formetric 4D, DIERS, Germany), which is a 3D image processing apparatus with high resolution for vertebrae, was used in order to measure 3D vertebrae and pelvis deformation as well as static balance abilities. As an exercise method, a foam roller was used to conduct fascia relaxation massage for warming-up, and postural kyphosis was changed into postural lordosis by lat pull-down using equipment, performed in 5 sets of 15 times preset at 60% intensity of 1RM 4 set of 10 crunch exercises per set using Togu's were done while sitting at the end of Balance pad, and 4 sets of 15 bridge exercises. [Results] All angular speed tests showed a gradual increase in muscle strength. Flexion and extension showed 10% and 3% improvements, respectively. The spine deformation test showed that isokinetic exercise and lat pull-down exercise for 12 weeks resulted in improved spinal shape. [Conclusion] In this study

  19. Decrease of spasticity after hybrid assistive limb® training for a patient with C4 quadriplegia due to chronic SCI.

    PubMed

    Ikumi, Akira; Kubota, Shigeki; Shimizu, Yukiyo; Kadone, Hideki; Marushima, Aiki; Ueno, Tomoyuki; Kawamoto, Hiroaki; Hada, Yasushi; Matsumura, Akira; Sankai, Yoshiyuki; Yamazaki, Masashi

    2017-09-01

    Recently, locomotor training with robotic assistance has been found effective in treating spinal cord injury (SCI). Our case report examined locomotor training using the robotic suit hybrid assistive limb (HAL) in a patient with complete C4 quadriplegia due to chronic SCI. This is the first report examining HAL in complete C4 quadriplegia. The patient was a 19-year-old man who dislocated C3/4 during judo 4 years previously. Following the injury, he underwent C3/4 posterior spinal fusion but remained paralyzed despite rehabilitation. There was muscle atrophy under C5 level and no sensation around the anus, but partial sensation of pressure remained in the limbs. The American Spinal Injury Association impairment scale was Grade A (complete motor C4 lesion). HAL training was administered in 10 sessions (twice per week). The training sessions consisted of treadmill walking with HAL. For safety, 2 physicians and 1 therapist supported the subject for balance and weight-bearing. The device's cybernic autonomous control mode provides autonomic physical support based on predefined walking patterns. We evaluated the adverse events, walking time and distance, and the difference in muscle spasticity before and after HAL-training using a modified Ashworth scale (mAs). No adverse events were observed that required discontinuation of rehabilitation. Walking distance and time increased from 25.2 meters/7.6 minutes to 148.3 meter/15 minutes. The mAs score decreased after HAL training. Our case report indicates that HAL training is feasible and effective for complete C4 quadriplegia in chronic SCI.

  20. Supplemental Stimulation Improves Swing Phase Kinematics During Exoskeleton Assisted Gait of SCI Subjects With Severe Muscle Spasticity.

    PubMed

    Ekelem, Andrew; Goldfarb, Michael

    2018-01-01

    Spasticity is a common comorbidity associated with spinal cord injury (SCI). Robotic exoskeletons have recently emerged to facilitate legged mobility in people with motor complete SCI. Involuntary muscle activity attributed to spasticity, however, can prevent such individuals from using an exoskeleton. Specifically, although most exoskeleton technologies can accommodate low to moderate spasticity, the presence of moderate to severe spasticity can significantly impair gait kinematics when using an exoskeleton. In an effort to potentially enable individuals with moderate to severe spasticity to use exoskeletons more effectively, this study investigates the use of common peroneal stimulation in conjunction with exoskeleton gait assistance. The electrical stimulation is timed with the exoskeleton swing phase, and is intended to acutely suppress extensor spasticity through recruitment of the flexion withdrawal reflex (i.e., while the stimulation is activated) to enable improved exoskeletal walking. In order to examine the potential efficacy of this approach, two SCI subjects with severe extensor spasticity (i.e., modified Ashworth ratings of three to four) walked in an exoskeleton with and without supplemental stimulation while knee and hip motion was measured during swing phase. Stimulation was alternated on and off every ten steps to eliminate transient therapeutic effects, enabling the acute effects of stimulation to be isolated. These experiments indicated that common peroneal stimulation on average increased peak hip flexion during the swing phase of walking by 21.1° (236%) and peak knee flexion by 14.4° (56%). Additionally, use of the stimulation decreased the swing phase RMS motor current by 228 mA (15%) at the hip motors and 734 mA (38%) at the knee motors, indicating improved kinematics were achieved with reduced effort from the exoskeleton. Walking with the exoskeleton did not have a significant effect on modified Ashworth scores, indicating the common

  1. Supplemental Stimulation Improves Swing Phase Kinematics During Exoskeleton Assisted Gait of SCI Subjects With Severe Muscle Spasticity

    PubMed Central

    Ekelem, Andrew; Goldfarb, Michael

    2018-01-01

    Spasticity is a common comorbidity associated with spinal cord injury (SCI). Robotic exoskeletons have recently emerged to facilitate legged mobility in people with motor complete SCI. Involuntary muscle activity attributed to spasticity, however, can prevent such individuals from using an exoskeleton. Specifically, although most exoskeleton technologies can accommodate low to moderate spasticity, the presence of moderate to severe spasticity can significantly impair gait kinematics when using an exoskeleton. In an effort to potentially enable individuals with moderate to severe spasticity to use exoskeletons more effectively, this study investigates the use of common peroneal stimulation in conjunction with exoskeleton gait assistance. The electrical stimulation is timed with the exoskeleton swing phase, and is intended to acutely suppress extensor spasticity through recruitment of the flexion withdrawal reflex (i.e., while the stimulation is activated) to enable improved exoskeletal walking. In order to examine the potential efficacy of this approach, two SCI subjects with severe extensor spasticity (i.e., modified Ashworth ratings of three to four) walked in an exoskeleton with and without supplemental stimulation while knee and hip motion was measured during swing phase. Stimulation was alternated on and off every ten steps to eliminate transient therapeutic effects, enabling the acute effects of stimulation to be isolated. These experiments indicated that common peroneal stimulation on average increased peak hip flexion during the swing phase of walking by 21.1° (236%) and peak knee flexion by 14.4° (56%). Additionally, use of the stimulation decreased the swing phase RMS motor current by 228 mA (15%) at the hip motors and 734 mA (38%) at the knee motors, indicating improved kinematics were achieved with reduced effort from the exoskeleton. Walking with the exoskeleton did not have a significant effect on modified Ashworth scores, indicating the common

  2. Photoinduced Partial Unfolding of Tubulin Bound to Meso-tetrakis(sulfonatophenyl) Porphyrin Leads to Inhibition of Microtubule Formation In Vitro

    DTIC Science & Technology

    2013-07-30

    H. Nettles, B . Cornett, K . H. Downing, and E. Nogales, Proc. Natl. Acad. Sci. 98, 5312–5316 (2001). B . McMicken et al.: Photoinduced unfolding of...and R. K . Pandey, Chem Soc Rev. 40, 340–362 (2011). [23] B . C. Wilson and M. S. Patterson, Phys Med Biol. 53, R61–R109 (2008). [24] E. D. Sternberg, D... K . Subbarao and R. C. MacDonald, Analyst 118, 913–916 (1993). [30] F. V. Bright and C. Munson, Anal. Chim. Acta 500, 71–104 (2003). [31] Z. Li, T. Lu

  3. Identification of Genes Differentially Expressed During Heat Shock Treatment in Aedes aegypti

    DTIC Science & Technology

    2009-01-01

    Chan, C. W. Cheng, and R. S. Wu. 2003. Cloning of theHSP70 gene in barnacle larvae and its expression under hypoxic conditions. Mar. Pollut. Bull. 46...665Ð671. Chuang, K. H., S. H. Ho, and Y. L. Song. 2007. Cloning and expression analysis of heat shock cognate 70 gene pro- moter in tiger shrimp ...in larvae , but not adults, of a polar insect. Proc. Natl. Acad. Sci. U.S.A. 103: 14223Ð14227. Robich, R. M., J. P. Rinehart, L. J. Kitchen, and D. L

  4. A simplified method for extracting androgens from avian egg yolks

    USGS Publications Warehouse

    Kozlowski, C.P.; Bauman, J.E.; Hahn, D.C.

    2009-01-01

    Female birds deposit significant amounts of steroid hormones into the yolks of their eggs. Studies have demonstrated that these hormones, particularly androgens, affect nestling growth and development. In order to measure androgen concentrations in avian egg yolks, most authors follow the extraction methods outlined by Schwabl (1993. Proc. Nat. Acad. Sci. USA 90:11446-11450). We describe a simplified method for extracting androgens from avian egg yolks. Our method, which has been validated through recovery and linearity experiments, consists of a single ethanol precipitation that produces substantially higher recoveries than those reported by Schwabl.

  5. Phase Equilibria of Stored Chemical Energy Reactants.

    DTIC Science & Technology

    1984-07-25

    aluminate-lithium ferrate system. Detection of a Li1 Al4/7Fe 3/704 compound: C. R. Acad. Sci., Ser. C, V. 273, No. 15, p. 888-90. McNicol, B. D. and Pott...thermodynamic properties of lithium ferrate (LiO.5Fe2 .504) and lithium aluminate (LiO 5Al 2 504) from 5 to 545 K: J. Chem. Thermodyn., V. 7, No. 7, p. 693- 2...1977, Study of low-temperature hydrothermal crystallization in lithium oxide-silicon dioxide-water, potassium oxide-silicon dioxide-water, and

  6. Measurement of Neutron and Muon Fluxes 100~m Underground with the SciBath Detector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garrison, Lance

    2014-01-01

    The SciBath detector is an 80 liter liquid scintillator detector read out by a three dimensional grid of 768 wavelength-shifting fibers. Initially conceived as a fine-grained charged particle detector for neutrino studies that could image charged particle tracks in all directions, it is also sensitive to fast neutrons (15-200 MeV). In fall of 2011 the apparatus performed a three month run to measure cosmic-induced muons and neutrons 100~meters underground in the FNAL MINOS near-detector area. Data from this run has been analyzed and resulted in measurements of the cosmic muon flux as \

  7. The Chemicals of the Earth. Teacher's Guide. Unit F2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  8. Living Things and Their Food. Teacher's Guide. Unit G2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This teaching guide, designed to be read in…

  9. [The "Académie nationale de Médecine" and the "Société française d'Histoire de la Médecine"].

    PubMed

    Lefebvre, Pierre

    2003-01-01

    The "Académie nationale de Médecine" was created in 1902 in Paris in the same time as the "Société française d'Histoire de la Médecine" but the relationship between the two societies depended upon the characters rather than the institutions. Thus two recent common experiences of the recent past urged to strengthen their links.

  10. STARtorialist: Astronomy Outreach via Fashion, Sci-Fi, & Pop Culture

    NASA Astrophysics Data System (ADS)

    Rice, Emily L.; Ash, Summer

    2015-01-01

    Astronomical images in the public domain have increasingly been used as inspiration and patterns for clothing, accessories, and home decor. These 'AstroFashion' items are as diverse as DIY projects, handmade and boutique products, mass-produced commercial items, and haute couture. STARtorialist is a Tumblr-based blog that curates the proliferation of these products with the goal of celebrating the beauty of the universe and highlighting the science behind the images. The blog also includes sci-fi, space, and science-related aspects of popular culture. Each post features images and descriptions of the products, and often where/how we found them and/or the people wearing them, with links to the original astronomical images or other relevant science content. The popularity of each post is evident in the number of 'notes', including 'faves' (personal bookmarks) and 'reblogs' (shares with other users). Since launching the blog in December 2013, with an average of one post per day, we've attracted hundreds of followers on Tumblr and Twitter and thousands of notes on Tumblr. We will present our most popular posts and recommend how education, outreach, and press offices can add Tumblr to their social media repertoire.

  11. A quantitative and qualitative evaluation of reports of clinical trials published in six Brazilian dental journals indexed in the Scientific Electronic Library Online (SciELO).

    PubMed

    de Souza, Raphael Freitas; Chaves, Carolina de Andrade Lima; Nasser, Mona; Fedorowicz, Zbys

    2010-01-01

    Open access publishing is becoming increasingly popular within the biomedical sciences. SciELO, the Scientific Electronic Library Online, is a digital library covering a selected collection of Brazilian scientific journals many of which provide open access to full-text articles.This library includes a number of dental journals some of which may include reports of clinical trials in English, Portuguese and/or Spanish. Thus, SciELO could play an important role as a source of evidence for dental healthcare interventions especially if it yields a sizeable number of high quality reports. The aim of this study was to identify reports of clinical trials by handsearching of dental journals that are accessible through SciELO, and to assess the overall quality of these reports. Electronic versions of six Brazilian dental Journals indexed in SciELO were handsearched at www.scielo.br in September 2008. Reports of clinical trials were identified and classified as controlled clinical trials (CCTs - prospective, experimental studies comparing 2 or more healthcare interventions in human beings) or randomized controlled trials (RCTs - a random allocation method is clearly reported), according to Cochrane eligibility criteria. CRITERIA TO ASSESS METHODOLOGICAL QUALITY INCLUDED: method of randomization, concealment of treatment allocation, blinded outcome assessment, handling of withdrawals and losses and whether an intention-to-treat analysis had been carried out. The search retrieved 33 CCTs and 43 RCTs. A majority of the reports provided no description of either the method of randomization (75.3%) or concealment of the allocation sequence (84.2%). Participants and outcome assessors were reported as blinded in only 31.2% of the reports. Withdrawals and losses were only clearly described in 6.5% of the reports and none mentioned an intention-to-treat analysis or any similar procedure. The results of this study indicate that a substantial number of reports of trials and systematic

  12. [Analysis on acupuncture related articles published in periodicals in science citation index (SCI) in 2008].

    PubMed

    Wang, Chao; He, Wen-Ju; Guo, Yi

    2010-09-01

    Acupuncture related articles published in periodicals in Science Citation Index (SCI) in 2008 were summarized and analyzed. About 583 articles were collected using "acupuncture" and "in 2008" as keywords in the Web of Science data base by information retrieval. These papers were summarized and analyzed from various aspects of country, language, subject category, literature type, publication sources, impact factor, research method, acupoints, disease category and needling methods by using Excel software combined with manual sorting of the literature, the aim is to provide a reference for domestic acupuncture research.

  13. The influence of question design on the response to self-assessment in www.elearnSCI.org: a submodule pilot study.

    PubMed

    Liu, N; Li, X-W; Zhou, M-W; Biering-Sørensen, F

    2015-08-01

    This is an interventional training session. The objective of this study was to investigate the difference in response to self-assessment questions in the original and an adjusted version for a submodule of www.elearnSCI.org for student nurses. The study was conducted in a teaching hospital affiliated to Peking University, China. In all, 28 student nurses divided into two groups (groups A and B; 14 in each) received a print-out of a Chinese translation of the slides from the 'Maintaining skin integrity following spinal cord injury' submodule in www.elearnSCI.org for self-study. Both groups were then tested using the 10 self-assessment multiple-choice questions (MCQs) related to the same submodule. Group A used the original questions, whereas group B received an adjusted questionnaire. The responses to four conventional single-answer MCQs were nearly all correct in both groups. However, in three questions, group A, with the option 'All of the above', had a higher number of correct answers than group B, with multiple-answer MCQs. In addition, in another three questions, group A, using the original multiple-answer MCQs, had fewer correct answers than group B, where it was only necessary to tick a single incorrect answer. Variations in design influence the response to questions. The use of conventional single-answer MCQs should be reconsidered, as they only examine the recall of isolated knowledge facts. The 'All of the above' option should be avoided because it would increase the number of correct answers arrived at by guessing. When using multiple-answer MCQs, it is recommended that the questions asked should be in accordance with the content within the www.elearnSCI.org.

  14. Development of a Small Molecule P2X7R Antagonist as a Treatment for Acute SCI

    DTIC Science & Technology

    2013-10-01

    microglia in response to SCI, and of the role of P2X7 receptor activation in that process . Indeed, in parallel work using uninjured human brain tissue...distinct glial fates are instructed, and how that process may be manipulated for therapeutic purposes. Thus, on the basis of the injury-associated...autocrine loop for the self -maintenance of glial progenitors, the perturbation of which might dictate progenitor recruitment as either reactive glia or

  15. "Publish SCI Papers or No Degree": Practices of Chinese Doctoral Supervisors in Response to the Publication Pressure on Science Students

    ERIC Educational Resources Information Center

    Li, Yongyan

    2016-01-01

    Publishing English papers in journals listed in Science Citation Index (SCI) has become a requirement for degree conferment for doctoral science students at many universities in China. The publication requirement engenders high pressure for doctoral students and their supervisors and shapes the politics of the relationship between the two parties.…

  16. The influence of a home-based exercise intervention on human health indices in individuals with chronic spinal cord injury (HOMEX-SCI): study protocol for a randomised controlled trial.

    PubMed

    Nightingale, Tom E; Walhin, Jean-Philippe; Turner, James E; Thompson, Dylan; Bilzon, James L J

    2016-06-08

    Spinal cord injury (SCI) creates a complex pathology that can lead to an increase in sedentary behaviours and deleterious changes in body composition. Consequently, individuals with SCI are at increased risk of developing cardiovascular disease and type-2 diabetes mellitus. While the role of physical activity on the reduction of chronic disease risk is well documented in non-disabled individuals the evidence is less conclusive for persons with SCI. The aim of this methodological paper is to outline the design of a study that will assess the role of a home-based exercise intervention on biomarkers of metabolic and cardiovascular health in persons with SCI: the HOMEX-SCI study. Eligible participants will be inactive (physical activity level ≤1.60) individuals, with a chronic (more than 1 year) spinal cord lesion between the second thoracic and the fifth lumbar vertebrae, and aged between 18 and 65 years. Following baseline laboratory testing and lifestyle monitoring, participants will be randomly allocated to a control (CON) group or a 6-week home-based exercise intervention (INT) group. The INT consists of 45 minutes of moderate-intensity (60-65 % peak oxygen uptake) arm-crank exercise four times per week. Participants assigned to the CON group will be asked to maintain their normal lifestyle. The main outcomes of this study (biomarkers of metabolic and cardiovascular health) are obtained from venous blood samples, collected in the fasted and postprandial state. Eight other measurement categories will be assessed: (1) body composition, (2) physical activity, (3) energy intake, (4) measures of health and wellbeing, (5) resting metabolic rate, heart rate and blood pressure, (6) aerobic capacity, (7) immune function, and (8) adipose tissue gene expression. This study will explore the feasibility of home-based moderate-intensity exercise and ascertain its impact on metabolic and cardiovascular health in comparison to a lifestyle maintenance CON group. Findings

  17. On the Chemical Emergence of Phosphate-Based Biochemistry

    NASA Astrophysics Data System (ADS)

    Kee, Terence

    Contemporary organisms use orthophosphate derivatives (PO43-) in their cell biochemistry,1 yet questions remain as to how Nature was able to accumulate, activate and exploit the or-thophosphate group from geological sources with both poorly solubility and low chemical activ-ity.2 Gulick argued3 a central role for reduced oxidation state phosphorus (P) oxyacids such as H-phosphonates (H2PO3-) and especially H-phosphinates (H2PO2-) in prebiotic chemistry on account of the greater water solubility of their metal salts and, with the presence of P-H bonds, a different reactivity profile to that expected of orthophosphate. The recent demonstration that hydrothermal corrosion of P-rich mineral phases such as schreibersite (Fe,Ni)3P within iron meteorites leads to production of various P-oxyacids including H-phosphonic (H3PO3)4 and H-phosphinic5 acids as well as orthophosphate has reignited interest in reduced oxida-tion state P chemistry in prebiotic environments. We are examining the prebiotic potential of reduced oxidation state P-chemistry through reactions with carbonyl substrates with rea-sonable prebiotic provenance including formaldehyde glycolaldehyde, both intimately involved in the formose reaction for sugar synthesis6 and pyruvic acid,7 a product of glycolysis and feed-stock for the citric acid cycle, a fundamental cellular metablic process whose heritage is considered an ancient one. In this contribution we present some of our latest results on the H-phosphinate-pyruvate system. References: [1] Lodish H et al. (2000) Molecular Cell Biology, 4th Ed., W. H. Freeman Co., New York. [2] Gulick A. (1955) Am. Sci., 43, 479. [3] Gulick A. (1957) Ann. N. Y. Acad. Sci. 69, 309. [4] Pasek M. A. (2008) Proc. Nat. Acad. Sci. USA, 105, 853. [5] Bryant D. E.and Kee T. P. (2006) Chem. Commun. 2344. [6] Weber A. L. (2000) Origins of Life and Evol. Biosph., 30, 33. [7] Cody G. D. et. al. (2000) Science 289, 1337.

  18. Evaluation of a training program for persons with SCI paraplegia using the Parastep 1 ambulation system: part 4. Effect on physical self-concept and depression.

    PubMed

    Guest, R S; Klose, K J; Needham-Shropshire, B M; Jacobs, P L

    1997-08-01

    To determine whether persons with spinal cord injury (SCI) paraplegia who participated in an electrical stimulation walking program experienced changes in measures of physical self-concept and depression. Before-after trial. Human SCI applied research laboratory. Volunteer sample of 12 men and 3 women with SCI paraplegia, mean age 28.75 +/- 6.6yrs and mean duration of injury 3.8 +/- 3.2yrs. Thirty-two FNS ambulation training sessions using a commercially available system (Parastep 1). The hybrid system consists of a microprocessor-controlled stimulator and a modified walking frame with finger-operated switches that permit the user to control the stimulation parameters and activate the stepping. The Tennessee Self-Concept Scale (TSCS) and the Beck Depression Inventory (BDI) were administered before and after training. Only the Physical Self subscale of the TSCS was analyzed. After training, individual interviews were performed to assess participants' subjective reactions to the training program. A repeated measures analysis of variance indicated that desired directional and statistically significant changes occurred on the Physical Self subscale of the TSCS (F(1,14) = 8.54, p < .011) and on the BDI (F(1,14) = 5.42, p < .035). Subsequent to the ambulation training program there were statistically significant increases in physical self-concept scores and decreases in depression scores.

  19. Altered spinal cord activity during sexual stimulation in women with SCI: a pilot fMRI study.

    PubMed

    Alexander, Marcalee; Kozyrev, Natalie; Figley, Chase R; Richards, J Scott

    2017-01-01

    The objective of this study was to assess the feasibility of the use of functional magnetic resonance imaging (fMRI) to evaluate the spinal activation during sexual response of the thoracic, lumbar and sacral spinal cord. This is a laboratory-based pilot study in human females at a University-based medical center in the United States. In three healthy spinal cord injury (SCI) females, spinal cord activations during sexual audiovisual stimulation (alone), genital self-stimulation (alone) and simultaneous audiovisual and genital self-stimulation (combined) were assessed and then compared with each subjects' remaining sensory and motor function. Spinal fMRI responses of the intermediolateral columns were found during audiovisual stimulation in both subjects with incomplete injuries, but they were not observed in the subject with a complete injury. Moreover, sacral responses to combined stimulation differed greatly between the subjects with complete and incomplete injuries. These results not only provide the first in vivo documentation of spinal fMRI responses associated with sexual arousal in women with SCIs, but also suggest that spinal cord fMRI is capable of distinguishing between injury subtypes. Therefore, although there are certain limitations associated with fMRI during sexual stimulation (for example, movement artifacts, an artificially controlled environment and so), these findings demonstrate the potential utility of incorporating spinal cord fMRI in future research to evaluate the impact of specific patterns of SCI on sexual responses and/or the effects of treatment.

  20. A quantitative and qualitative evaluation of reports of clinical trials published in six Brazilian dental journals indexed in the Scientific Electronic Library Online (SciELO)

    PubMed Central

    de SOUZA, Raphael Freitas; CHAVES, Carolina de Andrade Lima; CHAVES, Carolina de Andrade Lima; CHAVES, Carolina de Andrade Lima; NASSER, Mona; FEDOROWICZ, Zbys

    2010-01-01

    Open access publishing is becoming increasingly popular within the biomedical sciences. SciELO, the Scientific Electronic Library Online, is a digital library covering a selected collection of Brazilian scientific journals many of which provide open access to full-text articles. This library includes a number of dental journals some of which may include reports of clinical trials in English, Portuguese and/or Spanish. Thus, SciELO could play an important role as a source of evidence for dental healthcare interventions especially if it yields a sizeable number of high quality reports. Objective The aim of this study was to identify reports of clinical trials by handsearching of dental journals that are accessible through SciELO, and to assess the overall quality of these reports. Material and methods Electronic versions of six Brazilian dental Journals indexed in SciELO were handsearched at www.scielo.br in September 2008. Reports of clinical trials were identified and classified as controlled clinical trials (CCTs - prospective, experimental studies comparing 2 or more healthcare interventions in human beings) or randomized controlled trials (RCTs - a random allocation method is clearly reported), according to Cochrane eligibility criteria. Criteria to assess methodological quality included: method of randomization, concealment of treatment allocation, blinded outcome assessment, handling of withdrawals and losses and whether an intention-totreat analysis had been carried out. Results The search retrieved 33 CCTs and 43 RCTs. A majority of the reports provided no description of either the method of randomization (75.3%) or concealment of the allocation sequence (84.2%). Participants and outcome assessors were reported as blinded in only 31.2% of the reports. Withdrawals and losses were only clearly described in 6.5% of the reports and none mentioned an intention-totreat analysis or any similar procedure. Conclusions The results of this study indicate that a