Sample records for acc oxidase genes

  1. Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.

    PubMed

    Thrower, J S; Blalock, R; Klinman, J P

    2001-08-14

    1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

  2. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

    PubMed

    Blume, B; Grierson, D

    1997-10-01

    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  3. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  4. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

  5. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

  6. 1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein

    PubMed Central

    Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

    2013-01-01

    1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

  7. The Repeat Sequences and Elevated Substitution Rates of the Chloroplast accD Gene in Cupressophytes

    PubMed Central

    Li, Jia; Su, Yingjuan; Wang, Ting

    2018-01-01

    The plastid accD gene encodes a subunit of the acetyl-CoA carboxylase (ACCase) enzyme. The length of accD gene has been supposed to expand in Cryptomeria japonica, Taiwania cryptomerioides, Cephalotaxus, Taxus chinensis, and Podocarpus lambertii, and the main reason for this phenomenon was the existence of tandemly repeated sequences. However, it is still unknown whether the accD gene length in other cupressophytes has expanded. Here, in order to investigate how widespread this phenomenon was, 18 accD sequences and its surrounding regions of cupressophyte were sequenced and analyzed. Together with 39 GenBank sequence data, our taxon sampling covered all the extant gymnosperm orders. The repetitive elements and substitution rates of accD among 57 gymnosperm species were analyzed, the results show: (1) Reading frame length of accD gene in 18 cupressophytes species has also expanded. (2) Many repetitive elements were identified in accD gene of cupressophyte lineages. (3) The synonymous and non-synonymous substitution rates of accD were accelerated in cupressophytes. (4) accD was located in rearrangement endpoints. These results suggested that repetitive elements may mediate the chloroplast genome rearrangement and accelerated the substitution rates. PMID:29731764

  8. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    PubMed

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  9. Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

    PubMed

    Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

    1997-03-25

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

  10. Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.

    PubMed

    El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila

    2017-06-01

    1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Analysis of nodule senescence in pea (Pisum sativum L.) using laser microdissection, real-time PCR, and ACC immunolocalization.

    PubMed

    Serova, Tatiana A; Tikhonovich, Igor A; Tsyganov, Viktor E

    2017-05-01

    A delay in the senescence of symbiotic nodules could prolong active nitrogen fixation, resulting in improved crop yield and a reduced need for chemical fertilizers. The molecular genetic mechanisms underlying nodule senescence have not been extensively studied with a view to breeding varieties with delayed nodule senescence. In such studies, plant mutants with the phenotype of premature degradation of symbiotic structures are useful models to elucidate the genetic basis of nodule senescence. Using a dataset from transcriptome analysis of Medicago truncatula Gaertn. nodules and previous studies on pea (Pisum sativum L.) nodules, we developed a set of molecular markers based on genes that are known to be activated during nodule senescence. These genes encode cysteine proteases, a thiol protease, a bZIP transcription factor, enzymes involved in the biosynthesis of ethylene (ACS2 for ACC synthase and ACO1 for ACC oxidase) and ABA (AO3 for aldehyde oxidase), and an enzyme involved in catabolism of gibberellins (GA 2-oxidase). We analyzed the transcript levels of these genes in the nodules of two pea wild-types (cv. Sparkle and line Sprint-2) and two mutant lines, one showing premature nodule senescence (E135F (sym13)) and one showing no morphological signs of symbiotic structure degradation (Sprint-2Fix - (sym31)). Real-time PCR analyses revealed that all of the selected genes showed increased transcript levels during nodule aging in all phenotypes. Remarkably, at 4 weeks after inoculation (WAI), the transcript levels of all analyzed genes were significantly higher in the early senescent nodules of the mutant line E135F (sym13) and in nodules of the mutant Sprint-2Fix - (sym31) than in the active nitrogen-fixing nodules of wild-types. In contrast, the transcript levels of the same genes of both wild-types were significantly increased only at 6 WAI. We evaluated the expression of selected markers in the different histological nodule zones of pea cv. Sparkle and its

  12. Molecular Characterization of Lactobacillus plantarum Genes for β-Ketoacyl-Acyl Carrier Protein Synthase III (fabH) and Acetyl Coenzyme A Carboxylase (accBCDA), Which Are Essential for Fatty Acid Biosynthesis

    PubMed Central

    Kiatpapan, Pornpimon; Kobayashi, Hajime; Sakaguchi, Maki; Ono, Hisayo; Yamashita, Mitsuo; Kaneko, Yoshinobu; Murooka, Yoshikatsu

    2001-01-01

    Genes for subunits of acetyl coenzyme A carboxylase (ACC), which is the enzyme that catalyzes the first step in the synthesis of fatty acids in Lactobacillus plantarum L137, were cloned and characterized. We identified six potential open reading frames, namely, manB, fabH, accB, accC, accD, and accA, in that order. Nucleotide sequence analysis suggested that fabH encoded β-ketoacyl-acyl carrier protein synthase III, that the accB, accC, accD, and accA genes encoded biotin carboxyl carrier protein, biotin carboxylase, and the β and α subunits of carboxyltransferase, respectively, and that these genes were clustered. The organization of acc genes was different from that reported for Escherichia coli, for Bacillus subtilis, and for Pseudomonas aeruginosa. E. coli accB and accD mutations were complemented by the L. plantarum accB and accD genes, respectively. The predicted products of all five genes were confirmed by using the T7 expression system in E. coli. The gene product of accB was biotinylated in E. coli. Northern and primer extension analyses demonstrated that the five genes in L. plantarum were regulated polycistronically in an acc operon. PMID:11133475

  13. Ethylene Synthesis Regulated by Biphasic Induction of 1-Aminocyclopropane-1-Carboxylic Acid Synthase and 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Genes Is Required for Hydrogen Peroxide Accumulation and Cell Death in Ozone-Exposed Tomato1

    PubMed Central

    Moeder, Wolfgang; Barry, Cornelius S.; Tauriainen, Airi A.; Betz, Christian; Tuomainen, Jaana; Utriainen, Merja; Grierson, Donald; Sandermann, Heinrich; Langebartels, Christian; Kangasjärvi, Jaakko

    2002-01-01

    We show that above a certain threshold concentration, ozone leads to leaf injury in tomato (Lycopersicon esculentum). Ozone-induced leaf damage was preceded by a rapid increase in 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, ACC content, and ethylene emission. Changes in mRNA levels of specific ACC synthase, ACC oxidase, and ethylene receptor genes occurred within 1 to 5 h. Expression of the genes encoding components of ethylene biosynthesis and perception, and biochemistry of ethylene synthesis suggested that ozone-induced ethylene synthesis in tomato is under biphasic control. In transgenic plants containing an LE-ACO1 promoter-β-glucuronidase fusion construct, β-glucuronidase activity increased rapidly at the beginning of the O3 exposure and had a spatial distribution resembling the pattern of extracellular H2O2 production at 7 h, which coincided with the cell death pattern after 24 h. Ethylene synthesis and perception were required for active H2O2 production and cell death resulting in visible tissue damage. The results demonstrate a selective ozone response of ethylene biosynthetic genes and suggest a role for ethylene, in combination with the burst of H2O2 production, in regulating the spread of cell death. PMID:12481074

  14. Ethylene emission and PR protein synthesis in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions.

    PubMed

    Yim, Woojong; Seshadri, Sundaram; Kim, Kiyoon; Lee, Gillseung; Sa, Tongmin

    2013-06-01

    Bacteria of genus Methylobacterium have been found to promote plant growth and regulate the level of ethylene in crop plants. This work is aimed to test the induction of defense responses in tomato against bacterial wilt by stress ethylene level reduction mediated by the ACC deaminase activity of Methylobacterium strains. Under greenhouse conditions, the disease index value in Methylobacterium sp. inoculated tomato plants was lower than control plants. Plants treated with Methylobacterium sp. challenge inoculated with Ralstonia solanacearum (RS) showed significantly reduced disease symptoms and lowered ethylene emission under greenhouse condition. The ACC and ACO (1-aminocyclopropane-1-carboxylate oxidase) accumulation in tomato leaves were significantly reduced with Methylobacterium strains inoculation. While ACC oxidase gene expression was found higher in plants treated with R. solanacearum than Methylobacterium sp. treatment, PR proteins related to induced systemic resistance like β-1,3-glucanase, PAL, PO and PPO were increased in Methylobacterium sp. inoculated plants. A significant increase in β-1,3-glucanase and PAL gene expression was found in all the Methylobacterium spp. treatments compared to the R. solanacearum treatment. This study confirms the activity of Methylobacterium sp. in increasing the defense enzymes by modulating the ethylene biosynthesis pathway and suggests the use of methylotrophic bacteria as potential biocontrol agents in tomato cultivation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  15. Developmental characterization and environmental stress responses of Y-box binding protein 1 gene (AccYB-1) from Apis cerana cerana.

    PubMed

    Li, Guilin; Wang, Lijun; Wang, Ying; Li, Han; Liu, Zhenguo; Wang, Hongfang; Xu, Baohua; Guo, Xingqi

    2018-06-22

    Y-box binding protein 1 (YB-1) is a member of the cold shock domain protein superfamily and is involved in development, environmental stresses and DNA oxidative damage in many organisms. However, the precise functions of YB-1 are still not well understood in various insects, including bees. In the current study, we identified a YB-1 gene in Apis cerana cerana (AccYB-1). The predicted cis-acting elements in the promoter sequence of AccYB-1 indicated its possible roles in development and stress responses. AccYB-1 expression was higher in one-day-old larvae and dark-eyed pupae than in other development stages. Tissue-specific expression analysis showed that the mRNA level of AccYB-1 was higher in the thorax and midgut than in other tissues. The results from real-time PCR showed that AccYB-1 was induced by many environmental stresses. Silencing AccYB-1 downregulated the transcriptional level of some growth- and development-related genes and antioxidant genes and decreased the enzyme activities of several antioxidant-related enzymes, further indicating a possible function of AccYB-1 in growth, development and stress responses. Taken together, our findings suggest that AccYB-1 may play an indispensable role in growth and development and environmental stress responses in Apis cerana cerana. To our knowledge, this is the first paper to explore the role of YB-1 in bees. Copyright © 2018. Published by Elsevier B.V.

  16. [Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

    PubMed

    Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

    2003-02-01

    Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

  17. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

    PubMed

    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

    2016-06-01

    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

  18. Identification of a copper(I) intermediate in the conversion of 1-aminocyclopropane carboxylic acid (ACC) into ethylene by Cu(II)-ACC complexes and hydrogen peroxide.

    PubMed

    Ghattas, Wadih; Giorgi, Michel; Mekmouche, Yasmina; Tanaka, Tsunehiro; Rockenbauer, Antal; Réglier, Marius; Hitomi, Yutaka; Simaan, A Jalila

    2008-06-02

    Several Cu(II) complexes with ACC (=1-aminocyclopropane carboxylic acid) or AIB (=aminoisobutyric acid) were prepared using 2,2'-bipyridine, 1,10-phenanthroline, and 2-picolylamine ligands: [Cu(2,2'-bipyridine)(ACC)(H2O)](ClO4) (1a), [Cu(1,10-phenanthroline)(ACC)](ClO4) (2a), [Cu(2-picolylamine)(ACC)](ClO4) (3a), and [Cu(2,2'-bipyridine)(AIB)(H2O)](ClO4) (1b). All of the complexes were characterized by X-ray diffraction analysis. The Cu(II)-ACC complexes are able to convert the bound ACC moiety into ethylene in the presence of hydrogen peroxide, in an "ACC-oxidase-like" activity. A few equivalents of base are necessary to deprotonate H2O2 for optimum activity. The presence of dioxygen lowers the yield of ACC conversion into ethylene by the copper(II) complexes. During the course of the reaction of Cu(II)-ACC complexes with H2O2, brown species (EPR silent and lambda max approximately 435 nm) were detected and characterized as being the Cu(I)-ACC complexes that are obtained upon reduction of the corresponding Cu(II) complexes by the deprotonated form of hydrogen peroxide. The geometry of the Cu(I) species was optimized by DFT calculations that reveal a change from square-planar to tetrahedral geometry upon reduction of the copper ion, in accordance with the observed nonreversibility of the redox process. In situ prepared Cu(I)-ACC complexes were also reacted with hydrogen peroxide, and a high level of ethylene formation was obtained. We propose Cu(I)-OOH as a possible active species for the conversion of ACC into ethylene, the structure of which was examined by DFT calculation.

  19. Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

    PubMed

    Condino-Neto, A; Whitney, C; Newburger, P E

    1998-11-01

    We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

  20. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  1. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Treesearch

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  2. Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

    PubMed Central

    Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

    1996-01-01

    Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

  3. Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

    PubMed Central

    Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.

    2013-01-01

    Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

  4. Molecular evolution of the polyamine oxidase gene family in Metazoa

    PubMed Central

    2012-01-01

    Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

  5. Molecular evolution of the polyamine oxidase gene family in Metazoa.

    PubMed

    Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

    2012-06-20

    Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

  6. Effects of the inoculations using bacteria producing ACC deaminase on ethylene metabolism and growth of wheat grown under different soil water contents.

    PubMed

    Zhang, Guozhuang; Sun, Yonglin; Sheng, Hao; Li, Haichao; Liu, Xiping

    2018-04-01

    Crop growth and productivity are often impacted by the increased ethylene content induced by adverse environmental conditions such drought. Inoculations with bacteria producing ACC deaminase is considered as a potential biological approach to improve the growth and tolerance of stressed plants by lowering endogenous ethylene level. In this study, germinated wheat seeds were inoculated using three species of the rhizobacteria, which were isolated from the rhizosphere of wheat growing in dryland, and sown in pots. After three weeks, wheat seedlings were exposed to non-limiting water condition, medium drought and severe drought, respectively, for six weeks. The results showed that, irrespective of rhizobacterial inoculations, decreased soil water contents stimulated wheat ethylene metabolism, which was reflected by the significantly increased activity of ACC synthetase and ACC oxidase, besides an increased content of ACC both in the roots and leaves, and an enhanced capacity of leaves to release ethylene, concomitant with a significant decline in shoot and roots biomass. The inoculations of all three rhizobacterial species under each water condition reduced ACC content in wheat leaves, but effects of the inoculations on ACC synthase and ACC oxidase activity in the leaves and roots, ACC content in the roots, the capacity of leaves to release ethylene, and wheat growth varied with water conditions and bacterial species. Hence, both soil water conditions and rhizobacterial inoculations acted on all the processes of ethylene metabolism, with the former being dominant. The inoculations under non-limiting water condition and medium drought promoted shoot and root growth of wheat plants. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  7. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  8. Identification of a melatonin receptor type 1A gene ( AccMTNR1A) in Apis cerana cerana and its possible involvement in the response to low temperature stress

    NASA Astrophysics Data System (ADS)

    Li, Guilin; Zhang, Yanming; Ni, Yong; Wang, Ying; Xu, Baohua; Guo, Xingqi

    2018-04-01

    It is known that melatonin plays an indispensable role in the defense against some environment-induced stresses. The melatonin receptor (MTNR) is also closely linked to the environmental stress response in mammals. However, little is known about the function of the MTNR in insects, including honeybees. In this study, we identified a MTNR from Apis cerana cerana named AccMTNR1A, which contained a typical seven-transmembrane domain common to this family of receptors. A subcellular localization analysis showed that AccMTNR1A was localized in the cytomembrane. Additionally, we found that cold stress apparently boosted AccMTNR1A transcription, indicating that AccMTNR1A possibly connects to the cold stress response. The knockdown of AccMTNR1A attenuated the expression level of some genes associated with the cold stress response, suggesting that AccMTNR1A likely plays an analogous role with these genes during low temperature stress response. Moreover, silencing of AccMTNR1A also suppressed the transcription of some antioxidant genes, prompting the possibility that the response of AccMTNR1A to cold stress response may be related to antioxidant signaling pathways. Collectively, the findings presented here provide evidence that AccMTNR1A may play essential roles in protecting Apis cerana cerana from cold stress.

  9. Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana

    PubMed Central

    2012-01-01

    Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone). Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC) is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream signaling cascade, these are

  10. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  11. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  12. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu

    1999-01-01

    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  13. A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

    PubMed

    Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

    1998-01-01

    The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

  14. A functional polymorphism of the MAOA gene is associated with neural responses to induced anger control.

    PubMed

    Denson, Thomas F; Dobson-Stone, Carol; Ronay, Richard; von Hippel, William; Schira, Mark M

    2014-07-01

    Aggressiveness is highly heritable. Recent experimental work has linked individual differences in a functional polymorphism of the monoamine oxidase-A gene (MAOA) to anger-driven aggression. Other work has implicated the dorsal ACC (dACC) in cognitive-emotional control and the amygdala in emotional arousal. The present imaging genetics study investigated dACC and amygdala reactivity to induced anger control as a function of MAOA genotype. A research assistant asked 38 healthy male undergraduates to control their anger in response to an insult by a rude experimenter. Men with the low-expression allele showed increased dACC and amygdala activation after the insult, but men with the high-expression allele did not. Both dACC and amygdala activation independently mediated the relationship between MAOA genotype and self-reported anger control. Moreover, following the insult, men with the high-functioning allele showed functional decoupling between the amygdala and dACC, but men with the low-functioning allele did not. These results suggest that heightened dACC and amygdala activation and their connectivity are neuroaffective mechanisms underlying anger control in participants with the low-functioning allele of the MAOA gene.

  15. Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

    NASA Astrophysics Data System (ADS)

    Prayuni, Kinasih; Dwivany, Fenny M.

    2015-09-01

    Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

  16. ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.

    PubMed

    Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong

    2016-06-01

    Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

  17. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  18. Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

    PubMed

    Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

    2017-04-01

    The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

    PubMed

    Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

    2018-02-17

    Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

  20. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    PubMed

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  1. AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

    PubMed Central

    Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

    2018-01-01

    Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

  2. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  3. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

  4. [A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

    PubMed

    Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

    2013-08-04

    Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

  5. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  6. [Abundances of ammonia-oxidizing archaeal accA and amoA genes in response to NO2 - and NO3 - of hot springs in Yunnan province].

    PubMed

    Song, Zhaoqi; Wang, Li; Zhou, Enmin; Wang, Fengping; Xiao, Xiang; Zhang, Chuanlun; Li, Wenjun

    2014-12-04

    Yunnan hot springs have highly diverseammonia-oxidizing archaea (AOA), which are autotrophic and can fix CO2 using the 3-hydroxypropionate/ 4-hydroxybutyrate (HP/HD) pathway. In this study, we investigated the abundances of prokaryotic 16S rRNA gene and archaeal accA and amoA genes in the sediments of hot springs of Yunnan Province, and analysed the correlations between the above gene abundances and environmental factors. We selected the sediments of twenty representative hot springs, and detected the gene abundances by quantitative polymerase chain reaction (qPCR). The principal component analysis (PCA) and the Mantel test in the R software package were performed for the correlations of gene abundance and environmental variables. The bacterial and archaeal 16S rRNA gene abundances were from 6.6 x 10(7) to 4.19 x 10(11) and from 1.27 x 10(6) to 1.51 x 10(11) copies/g sediment, respectively; Archaeal accA and amoA genes were from 8.89 x 10(3) to 6.49 x 10(5) and from 7.64 x 10(3) to 4.36 x 10(5) copies/g sediment, respectively. The results of mantel test showed that accA gene was significantly (R = 0.98, P < 0.001) correlated with amoA gene; Both of them also were correlated significantly with NO2- and NO3 -, but not with pH. The abundances of bacterial and archaeal 16S rRNA genes and the ratio between them varied significantly among Yunnan hot springs. The archaealaccA and amoA genes showed significant correlation with each other, validating our previous finding that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  7. Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

    PubMed

    Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

    2002-07-19

    The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

  8. MONOAMINE OXIDASE: From Genes to Behavior

    PubMed Central

    Shih, J. C.; Chen, K.; Ridd, M. J.

    2010-01-01

    Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

  9. Genetic Profiling Reveals Cross-Contamination and Misidentification of 6 Adenoid Cystic Carcinoma Cell Lines: ACC2, ACC3, ACCM, ACCNS, ACCS and CAC2

    PubMed Central

    Phuchareon, Janyaporn; Ohta, Yoshihito; Woo, Jonathan M.; Eisele, David W.; Tetsu, Osamu

    2009-01-01

    Adenoid cystic carcinoma (ACC) is the second most common malignant neoplasm of the salivary glands. Most patients survive more than 5 years after surgery and postoperative radiation therapy. The 10 year survival rate, however, drops to 40%, due to locoregional recurrences and distant metastases. Improving long-term survival in ACC requires the development of more effective systemic therapies based on a better understanding of the biologic behavior of ACC. Much preclinical research in this field involves the use of cultured cells and, to date, several ACC cell lines have been established. Authentication of these cell lines, however, has not been reported. We performed DNA fingerprint analysis on six ACC cell lines using short tandem repeat (STR) examinations and found that all six cell lines had been contaminated with other cells. ACC2, ACC3, and ACCM were determined to be cervical cancer cells (HeLa cells), whereas the ACCS cell line was composed of T24 urinary bladder cancer cells. ACCNS and CAC2 cells were contaminated with cells derived from non-human mammalian species: the cells labeled ACCNS were mouse cells and the CAC2 cells were rat cells. These observations suggest that future studies using ACC cell lines should include cell line authentication to avoid the use of contaminated or non-human cells. PMID:19557180

  10. Engineered ACC deaminase-expressing free-living cells of Mesorhizobium loti show increased nodulation efficiency and competitiveness on Lotus spp.

    PubMed

    Conforte, Valeria P; Echeverria, Mariela; Sánchez, Cintia; Ugalde, Rodolfo A; Menéndez, Ana B; Lepek, Viviana C

    2010-08-01

    Ethylene inhibits the establishment of symbiosis between rhizobia and legumes. Several rhizobia species express the enzyme ACC deaminase, which degrades the ethylene precursor 1-cyclopropane-1-carboxilate (ACC), leading to reductions in the amount of ethylene evolved by the plant. M. loti has a gene encoding ACC deaminase, but this gene is under the activity of the NifA-RpoN-dependent promoter; thus, it is only expressed inside the nodule. The M. loti structural gene ACC deaminase (acdS) was integrated into the M. loti chromosome under a constitutive promoter activity. The resulting strain induced the formation of a higher number of nodules and was more competitive than the wild-type strain on Lotus japonicus and L. tenuis. These results suggest that the introduction of the ACC deaminase activity within M. loti in a constitutive way could be a novel strategy to increase nodulation competitiveness of the bacteria, which could be useful for the forage inoculants industry.

  11. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

    PubMed Central

    Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

    2014-01-01

    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

  12. A structural and functional model for the 1-aminocyclopropane-1-carboxylic acid oxidase.

    PubMed

    Sallmann, Madleen; Oldenburg, Fabio; Braun, Beatrice; Réglier, Marius; Simaan, A Jalila; Limberg, Christian

    2015-10-12

    The hitherto most realistic low-molecular-weight analogue for the 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) is reported. The ACCOs 2-His-1-carboxylate iron(II) active site was mimicked by a TpFe moiety, to which the natural substrate ACC could be bound. The resulting complex [Tp(Me,Ph) FeACC] (1), according to X-ray diffraction analysis performed for the nickel analogue, represents an excellent structural model, featuring ACC coordinated in a bidentate fashion-as proposed for the enzymatic substrate complex-as well as a vacant coordination site that forms the basis for the first successful replication also of the ACCO function: 1 is the first known ACC complex that reacts with O2 to produce ethylene. As a FeOOH species had been suggested as intermediate in the catalytic cycle, H2 O2 was tested as the oxidant, too, and indeed evolution of ethylene proceeded even more rapidly to give 65 % yield. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  14. [THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

    PubMed

    Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

    2015-11-01

    The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

  15. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming

    2006-05-01

    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the ACV-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  16. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming

    2006-09-01

    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the AVC-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  17. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

  18. Ethylene biosynthesis by 1-aminocyclopropane-1-carboxylic acid oxidase: a DFT study.

    PubMed

    Bassan, Arianna; Borowski, Tomasz; Schofield, Christopher J; Siegbahn, Per E M

    2006-11-24

    The reaction catalyzed by the plant enzyme 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) was investigated by using hybrid density functional theory. ACCO belongs to the non-heme iron(II) enzyme superfamily and carries out the bicarbonate-dependent two-electron oxidation of its substrate ACC (1-aminocyclopropane-1-carboxylic acid) concomitant with the reduction of dioxygen and oxidation of a reducing agent probably ascorbate. The reaction gives ethylene, CO(2), cyanide and two water molecules. A model including the mononuclear iron complex with ACC in the first coordination sphere was used to study the details of O-O bond cleavage and cyclopropane ring opening. Calculations imply that this unusual and complex reaction is triggered by a hydrogen atom abstraction step generating a radical on the amino nitrogen of ACC. Subsequently, cyclopropane ring opening followed by O-O bond heterolysis leads to a very reactive iron(IV)-oxo intermediate, which decomposes to ethylene and cyanoformate with very low energy barriers. The reaction is assisted by bicarbonate located in the second coordination sphere of the metal.

  19. Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

    PubMed

    Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

    2003-05-01

    Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

  20. Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

    PubMed

    Beecher, Brian S; Carter, Arron H; See, Deven R

    2012-05-01

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

  1. A colorimetric assay of 1-aminocyclopropane-1-carboxylate (ACC) based on ninhydrin reaction for rapid screening of bacteria containing ACC deaminase.

    PubMed

    Li, Z; Chang, S; Lin, L; Li, Y; An, Q

    2011-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase activity is an efficient marker for bacteria to promote plant growth by lowering ethylene levels in plants. We aim to develop a method for rapidly screening bacteria containing ACC deaminase, based on a colorimetric ninhydrin assay of ACC. A reliable colorimetric ninhydrin assay was developed to quantify ACC using heat-resistant polypropylene chimney-top 96-well PCR plates, having the wells evenly heated in boiling water, preventing accidental contamination from boiling water and limiting evaporation. With this method to measure bacterial consumption of ACC, 44 ACC-utilizing bacterial isolates were rapidly screened out from 311 bacterial isolates that were able to grow on minimal media containing ACC as the sole nitrogen source. The 44 ACC-utilizing bacterial isolates showed ACC deaminase activities and belonged to the genus Burkholderia, Pseudomonas or Herbaspirillum. Determination of bacterial ACC consumption by the PCR-plate ninhydrin-ACC assay is a rapid and efficient method for screening bacteria containing ACC deaminase from a large number of bacterial isolates. The PCR-plate ninhydrin-ACC assay extends the utility of the ninhydrin reaction and enables a rapid screening of bacteria containing ACC deaminase from large numbers of bacterial isolates. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  2. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    USDA-ARS?s Scientific Manuscript database

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  4. Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

    PubMed

    Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

    2003-10-01

    Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

  5. Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

    PubMed

    Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

    2004-10-01

    The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

  6. AccR Is a Master Regulator Involved in Carbon Catabolite Repression of the Anaerobic Catabolism of Aromatic Compounds in Azoarcus sp. CIB*

    PubMed Central

    Valderrama, J. Andrés; Shingler, Victoria; Carmona, Manuel; Díaz, Eduardo

    2014-01-01

    Here we characterized the first known transcriptional regulator that accounts for carbon catabolite repression (CCR) control of the anaerobic catabolism of aromatic compounds in bacteria. The AccR response regulator of Azoarcus sp. CIB controls succinate-responsive CCR of the central pathways for the anaerobic catabolism of aromatics by this strain. Phosphorylation of AccR to AccR-P triggers a monomer-to-dimer transition as well as the ability to bind to the target promoter and causes repression both in vivo and in vitro. Substitution of the Asp60 phosphorylation target residue of the N-terminal receiver motif of AccR to a phosphomimic Glu residue generates a constitutively active derivative that behaves as a superrepressor of the target genes. AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two different locations within the PN promoter of the bzd genes for anaerobic benzoate degradation. Because the DNA binding-proficient C-terminal domain of AccR is monomeric, we propose an activation mechanism in which phosphorylation of Asp60 of AccR alleviates interdomain repression mediated by the N-terminal domain. The presence of AccR-like proteins encoded in the genomes of other β-proteobacteria of the Azoarcus/Thauera group further suggests that AccR constitutes a master regulator that controls anaerobic CCR in these bacteria. PMID:24302740

  7. Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

    PubMed

    Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

    2011-03-01

    "Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

  8. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  9. Heterologous co-expression of accA, fabD, and thioesterase genes for improving long-chain fatty acid production in Pseudomonas aeruginosa and Escherichia coli.

    PubMed

    Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon

    2012-05-01

    The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.

  10. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  11. Obesity Drives Th17 Cell Differentiation by Inducing the Lipid Metabolic Kinase, ACC1.

    PubMed

    Endo, Yusuke; Asou, Hikari K; Matsugae, Nao; Hirahara, Kiyoshi; Shinoda, Kenta; Tumes, Damon J; Tokuyama, Hirotake; Yokote, Koutaro; Nakayama, Toshinori

    2015-08-11

    Chronic inflammation due to obesity contributes to the development of metabolic diseases, autoimmune diseases, and cancer. Reciprocal interactions between metabolic systems and immune cells have pivotal roles in the pathogenesis of obesity-associated diseases, although the mechanisms regulating obesity-associated inflammatory diseases are still unclear. In the present study, we performed transcriptional profiling of memory phenotype CD4 T cells in high-fat-fed mice and identified acetyl-CoA carboxylase 1 (ACC1, the gene product of Acaca) as an essential regulator of Th17 cell differentiation in vitro and of the pathogenicity of Th17 cells in vivo. ACC1 modulates the DNA binding of RORγt to target genes in differentiating Th17 cells. In addition, we found a strong correlation between IL-17A-producing CD45RO(+)CD4 T cells and the expression of ACACA in obese subjects. Thus, ACC1 confers the appropriate function of RORγt through fatty acid synthesis and regulates the obesity-related pathology of Th17 cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.

    2002-01-01

    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills…

  13. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

    PubMed

    Nawathean, P; Maslov, D A

    2000-08-01

    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

  14. A novel proteolytic processing of prolysyl oxidase

    PubMed Central

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

    2012-01-01

    Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

  15. A novel proteolytic processing of prolysyl oxidase.

    PubMed

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

    2011-01-01

    Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

  16. Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

    PubMed

    Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

    1979-12-01

    Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

  17. Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

    PubMed

    Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

    2013-02-01

    In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  19. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  20. Isolation and characterization of the pea cytochrome c oxidase Vb gene.

    PubMed

    Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

    2006-11-01

    Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

  1. Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

    PubMed

    Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

    2007-08-01

    A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

  2. Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Ramonell, K. M.; McClure, G.; Musgrave, M. E.

    2002-01-01

    An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.

  3. Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

    Treesearch

    Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

    2016-01-01

    The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

  4. Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

    PubMed

    Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

    2007-06-01

    Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

  5. Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

    PubMed

    Allam, Mai A; Saker, Mahmoud M

    2017-01-01

    The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

  6. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    PubMed

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  7. Reduced heart size and increased myocardial fuel substrate oxidation in ACC2 mutant mice

    PubMed Central

    Essop, M. Faadiel; Camp, Heidi S.; Choi, Cheol Soo; Sharma, Saumya; Fryer, Ryan M.; Reinhart, Glenn A.; Guthrie, Patrick H.; Bentebibel, Assia; Gu, Zeiwei; Shulman, Gerald I.; Taegtmeyer, Heinrich; Wakil, Salih J.; Abu-Elheiga, Lutfi

    2008-01-01

    The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC2) is a key regulator of mitochondrial fatty acid (FA) uptake via carnitine palmitoyltransferase 1 (CPT1). To test the hypothesis that oxidative metabolism is upregulated in hearts from animals lacking ACC2 (employing a transgenic Acc2-mutant mouse), we assessed cardiac function in vivo and determined rates of myocardial substrate oxidation ex vivo. When examined by echocardiography, there was no difference in systolic function, but left ventricular mass of the Acc2-mutant (MUT) mouse was significantly reduced (∼25%) compared with wild-types (WT). Reduced activation of the mammalian target of rapamycin (mTOR) and its downstream target p70S6K was found in MUT hearts. Exogenous oxidation rates of oleate were increased ∼22%, and, unexpectedly, exogenous glucose oxidation rates were also increased in MUT hearts. Using a hyperinsulinemic-euglycemic clamp, we found that glucose uptake in MUT hearts was increased by ∼83%. Myocardial triglyceride levels were significantly reduced in MUT vs. WT while glycogen content was the same. In parallel, transcript levels of PPARα and its target genes, pyruvate dehydrogenase kinase-4 (PDK-4), malonyl-CoA decarboxylase (MCD), and mCPT1, were downregulated in MUT mice. In summary, we report that 1) Acc2-mutant hearts exhibit a marked preference for the oxidation of both glucose and FAs coupled with greater utilization of endogenous fuel substrates (triglycerides), 2) attenuated mTOR signaling may result in reduced heart sizes observed in Acc2-mutant mice, and 3) Acc2-mutant hearts displayed normal functional parameters despite a significant decrease in size. PMID:18487439

  8. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    PubMed

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  9. GAD65 Promoter Polymorphism rs2236418 Modulates Harm Avoidance in Women via Inhibition/Excitation Balance in the Rostral ACC.

    PubMed

    Colic, Lejla; Li, Meng; Demenescu, Liliana Ramona; Li, Shija; Müller, Iris; Richter, Anni; Behnisch, Gusalija; Seidenbecher, Constanze I; Speck, Oliver; Schott, Björn H; Stork, Oliver; Walter, Martin

    2018-05-30

    Anxiety disorders are common and debilitating conditions with higher prevalence in women. However, factors that predispose women to anxiety phenotypes are not clarified. Here we investigated potential contribution of the single nucleotide polymorphism rs2236418 in GAD2 gene to changes in regional inhibition/excitation balance, anxiety-like traits, and related neural activity in both sexes. One hundred and five healthy individuals were examined with high-field (7T) multimodal magnetic resonance imaging (MRI); including resting-state functional MRI in combination with assessment of GABA and glutamate (Glu) levels via MR spectroscopy. Regional GABA/Glu levels in anterior cingulate cortex (ACC) subregions were assessed as mediators of gene-personality interaction for the trait harm avoidance and moderation by sex was tested. In AA homozygotes, with putatively lower GAD2 promoter activity, we observed increased intrinsic neuronal activity and higher inhibition/excitation balance in pregenual ACC (pgACC) compared with G carriers. The pgACC drove a significant interaction of genotype, region, and sex, where inhibition/excitation balance was significantly reduced only in female AA carriers. This finding was specific for rs2236418 as other investigated single nucleotide polymorphisms of the GABA synthesis related enzymes ( GAD1 , GAD2 , and GLS ) were not significant. Furthermore, only in women there was a negative association of pgACC GABA/Glu ratios with harm avoidance. A moderated-mediation model revealed that pgACC GABA/Glu also mediated the association between the genotype variant and level of harm avoidance, dependent on sex. Our data thus provide new insights into the neurochemical mechanisms that control emotional endophenotypes in humans and constitute predisposing factors for the development of anxiety disorders in women. SIGNIFICANCE STATEMENT Anxiety disorders are among the most common and burdensome psychiatric disorders, with higher prevalence rates in women

  10. Distal truncation of KCC3 in non-French Canadian HMSN/ACC families.

    PubMed

    Salin-Cantegrel, A; Rivière, J-B; Dupré, N; Charron, F M; Shekarabi, M; Karéméra, L; Gaspar, C; Horst, J; Tekin, M; Deda, G; Krause, A; Lippert, M M; Willemsen, M A A P; Jarrar, R; Lapointe, J-Y; Rouleau, G A

    2007-09-25

    Hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC) is a severe and progressive autosomal recessive polyneuropathy. Mutations in the potassium-chloride cotransporter 3 gene (KCC3) were identified as responsible for HMSN/ACC in the French Canadian (FC) population. In the present study, the authors were interested in finding new mutations in non-FC populations, assessing the activity of mutant proteins and refining genotype-phenotype correlations. The authors screened KCC3 for mutations using direct sequencing in six non-FC HMSN/ACC families. They then assessed the functionality of the most common mutant protein using a flux assay in Xenopus laevis oocytes. The authors identified mutations in exon 22 of KCC3: a novel mutation (del + 2994-3003; E1015X) in one family, as well as a known mutation (3031C-->T; R1011X) found in five unrelated families and associated with two different haplotypes. The function of the cotransporter was abolished, although a limited amount of mutant proteins were correctly localized at the membrane. KCC3 mutations in exon 22 constitute a recurrent mutation site for hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC), regardless of ethnic origin, and are the most common cause of HMSN/ACC in the non-French Canadian (FC) families analyzed so far. Therefore, for genetic analysis, exon 22 screening should be prioritized in non-FC populations. Finally, the R1011X mutation leads to the abrogation of KCC3's function in Xenopus laevis oocytes, likely due to impaired transit of the cotransporter.

  11. Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

    PubMed Central

    Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

    2009-01-01

    Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

  12. Isolated sulfite oxidase deficiency.

    PubMed

    Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

    1996-12-01

    Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

  13. Lattice QCD simulations using the OpenACC platform

    NASA Astrophysics Data System (ADS)

    Majumdar, Pushan

    2016-10-01

    In this article we will explore the OpenACC platform for programming Graphics Processing Units (GPUs). The OpenACC platform offers a directive based programming model for GPUs which avoids the detailed data flow control and memory management necessary in a CUDA programming environment. In the OpenACC model, programs can be written in high level languages with OpenMP like directives. We present some examples of QCD simulation codes using OpenACC and discuss their performance on the Fermi and Kepler GPUs.

  14. The final step of the ethylene biosynthesis pathway in turnip tops (Brassica rapa): molecular characterization of the 1-aminocyclopropane-1-carboxylate oxidase BrACO1 throughout zygotic embryogenesis and germination of heterogeneous seeds.

    PubMed

    Del Carmen Rodríguez-Gacio, María; Nicolás, Carlos; Matilla, Angel Jesús

    2004-05-01

    In a previous report from the present authors, it was shown that the 1-aminocyclopropane-1-carboxylate (ACC) oxidation may play a crucial role during zygotic embryogenesis of turnip tops seeds. The present study was performed to elucidate the contribution of the silique-wall and seeds in ethylene production during this developmental process. ACC content in the silique wall is only higher than in seeds during the middle phases of zygotic embryogenesis. The ACC-oxidase (ACO) activity peaks in the silique-wall and seeds during the onset of embryogenesis, declining gradually afterwards, being undetectable during desiccation period. Using reverse transcriptase-polymerase chain reaction, one cDNA clone coding for an ACO and called BrACO1, was isolated. The deduced protein for BrACO1 has a molecular weight of 36.8 kDa and a high homology with other crucifer ACOs. The heterologous expression of this cDNA confirmed that BrACO1 is an ACO. The expression of this gene was high during the first phases of silique-wall development, low during the middle phases and undetectable during desiccation. By contrast, BrACO1 transcript was accumulated only in the earliest phases of seed embryogenesis and may participate in the highest ACO activity and ethylene production by seeds at the beginning of embryogenesis. Finally, in this work a correlation between the heterogeneity of Brassica rapa L. cv. Rapa seeds and the ability to oxidize the ACC to ethylene has been demonstrated.

  15. Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

    PubMed Central

    Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

    2017-01-01

    Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

  16. Genetics Home Reference: cytochrome c oxidase deficiency

    MedlinePlus

    ... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

  17. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

  18. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

    PubMed

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-08-01

    A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

  19. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

  20. Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

    PubMed

    Castresana, J; Lübben, M; Saraste, M; Higgins, D G

    1994-06-01

    Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

  1. Altered gene expression in early postnatal monoamine oxidase A knockout mice.

    PubMed

    Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C

    2017-08-15

    We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

    PubMed Central

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

    2018-01-01

    Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a

  3. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

    PubMed

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

    2018-05-01

    Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

  4. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Treesearch

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  5. Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

    PubMed Central

    2014-01-01

    Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

  6. Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

    PubMed

    Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

    2003-04-01

    We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

  7. Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

    PubMed

    Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

    2017-03-01

    It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

  8. Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

    PubMed

    May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

    2009-07-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

  9. Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

    PubMed

    Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

    2009-01-01

    The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

  10. Selenium delays tomato fruit ripening by inhibiting ethylene biosynthesis and enhancing the antioxidant defense system.

    PubMed

    Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji

    2017-03-15

    The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

    PubMed Central

    Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

    2017-01-01

    Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

  12. Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

    PubMed

    Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

    2017-04-01

    The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  13. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

    PubMed

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  14. ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate.

    PubMed

    Keenan, Melissa M; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A; Murphy, Susan K; Lucas, Joseph; Muoio, Deborah M; Kim, So Young; Chi, Jen-Tsan

    2015-10-01

    In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future.

  15. ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate

    PubMed Central

    Keenan, Melissa M.; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D.; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A.; Murphy, Susan K.; Lucas, Joseph; Muoio, Deborah M.; Kim, So Young; Chi, Jen-Tsan

    2015-01-01

    In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future. PMID:26452058

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  17. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  18. Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

    PubMed

    Pöggeler, Stefanie

    2011-04-01

    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

  19. Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

    PubMed Central

    Smesrud, Logan; Tebo, Bradley M.

    2016-01-01

    ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

  20. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

  1. Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition.

    PubMed

    Kolla, Nathan J; Chiuccariello, Lina; Wilson, Alan A; Houle, Sylvain; Links, Paul; Bagby, R Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V; Pasricha, Suvercha; Meyer, Jeffrey H

    2016-01-15

    Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. [(11)C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p < .001). In BPD, PFC and ACC MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = -.44, p = .023). These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  2. R1, a novel repressor of the human monoamine oxidase A.

    PubMed

    Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

    2005-03-25

    Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

  3. Reward salience and risk aversion underlie differential ACC activity in substance dependence

    PubMed Central

    Alexander, William H.; Fukunaga, Rena; Finn, Peter; Brown, Joshua W.

    2015-01-01

    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed. PMID:26106528

  4. Reward salience and risk aversion underlie differential ACC activity in substance dependence.

    PubMed

    Alexander, William H; Fukunaga, Rena; Finn, Peter; Brown, Joshua W

    2015-01-01

    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed.

  5. Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

    PubMed

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2010-01-01

    ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

  6. Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

    PubMed

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2011-08-01

    ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features, and to compare results to solid ACC. Genome wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, four with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), and five solid ACC. In addition, Ki67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

  7. Genotype-specific enrichment of ACC deaminase-positive bacteria in winter wheat rhizospheres

    USDA-ARS?s Scientific Manuscript database

    Bacteria that produce ACC deaminase promote plant growth and development by lowering levels of the stress hormone ethylene through deamination of 1-aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Therefore, it is hypothesized that ACC deaminase positive (ACC+) bacteri...

  8. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

    PubMed Central

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

    2000-01-01

    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  9. Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

    PubMed

    Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

    1991-01-01

    Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

  10. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  11. Genetic Profile of Adenoid Cystic Carcinomas (ACC) with High-Grade Transformation versus Solid Type

    PubMed Central

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2010-01-01

    Background: ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. Methods: Genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. Results: ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. Conclusion: ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC. PMID:20978318

  12. The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening[OPEN

    PubMed Central

    Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui

    2017-01-01

    The plant hormone ethylene is critical for ripening in climacteric fruits, including apple (Malus domestica). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1, an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2, encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3, encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1. This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1. Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. PMID:28550149

  13. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  14. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana.

    PubMed

    Huang, Shih-Jhe; Chang, Chia-Lun; Wang, Po-Hsun; Tsai, Min-Chieh; Hsu, Pang-Hung; Chang, Ing-Feng

    2013-11-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis.

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  16. Epistatic interaction between the monoamine oxidase A and serotonin transporter genes in anorexia nervosa.

    PubMed

    Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick

    2005-03-01

    The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.

  17. Asian Care Certificate (ACC): a care quality assurance framework.

    PubMed

    Talaie, Tony

    2018-04-16

    Purpose Quality assuring elderly care through a viable and feasible standard framework is a major challenge for Asian governments. Although several attempts have been made to tackle foreign care worker (FCW) shortage, assuring the quality of the care they provide has been overlooked. The original framework allowed a better control over service quality to assure the elderly about their care according to the agreed standards. The paper aims to discuss these issues. Design/methodology/approach Through several Japanese Governmental meetings, a new Asian Care Certificate (ACC) program is discussed based on the Japanese Care Certificate (JCC). The governments' representatives adopted the JCC to form the ACC, which enables the ACC board to evaluate care workers and to intervene whenever the desired quality level is not achieved. Findings The author describes a new program. The findings of this paper will be confirmed when the ACC is implemented. Practical implications Using the ACC framework, the challenge in providing a high-quality care service using FCWs across Asia would be partly resolved. FCWs' quality of life might also gradually improve especially regarding to their human rights. Originality/value The ACC provides a new framework. Its value is recognized if one considers that many Asian populations are rapidly aging and many governments compromise quality by employing overseas workers to solve care worker shortages.

  18. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development REGULATIONS RELATING TO... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

  19. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development Regulations Relating to... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

  20. Androgen receptor and monoamine oxidase polymorphism in wild bonobos

    PubMed Central

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-01-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  1. The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

    PubMed

    Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

    2006-01-01

    The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

  2. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

  3. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

  4. Recovery of choline oxidase activity by in vitro recombination of individual segments.

    PubMed

    Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

    2008-11-01

    Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

  5. Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

    PubMed Central

    Liu, Lei

    2012-01-01

    Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

  6. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

  7. 24 CFR 882.403 - ACC, housing assistance payments contract, and lease.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC, housing assistance payments... Procedures for Moderate Rehabilitation-Basic Policies § 882.403 ACC, housing assistance payments contract, and lease. (a) Maximum Total ACC Commitments. The maximum total annual contribution that may be...

  8. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  9. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    PubMed

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  10. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  11. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  12. Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

    PubMed

    Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

    2000-10-01

    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

  13. Genetics Home Reference: isolated sulfite oxidase deficiency

    MedlinePlus

    ... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

  14. A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

    PubMed Central

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

    2014-01-01

    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  15. Portable LQCD Monte Carlo code using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Calore, Enrico; Coscetti, Simone; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Fabio Schifano, Sebastiano; Silvi, Giorgio; Tripiccione, Raffaele

    2018-03-01

    Varying from multi-core CPU processors to many-core GPUs, the present scenario of HPC architectures is extremely heterogeneous. In this context, code portability is increasingly important for easy maintainability of applications; this is relevant in scientific computing where code changes are numerous and frequent. In this talk we present the design and optimization of a state-of-the-art production level LQCD Monte Carlo application, using the OpenACC directives model. OpenACC aims to abstract parallel programming to a descriptive level, where programmers do not need to specify the mapping of the code on the target machine. We describe the OpenACC implementation and show that the same code is able to target different architectures, including state-of-the-art CPUs and GPUs.

  16. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R

    1983-01-01

    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  17. A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

    PubMed

    Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

    2013-05-01

    A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

  18. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Identification of methylated genes in salivary gland adenoid cystic carcinoma xenografts using global demethylation and methylation microarray screening

    PubMed Central

    LING, SHIZHANG; RETTIG, ELENI M.; TAN, MARIETTA; CHANG, XIAOFEI; WANG, ZHIMING; BRAIT, MARIANA; BISHOP, JUSTIN A.; FERTIG, ELANA J.; CONSIDINE, MICHAEL; WICK, MICHAEL J.; HA, PATRICK K.

    2016-01-01

    Salivary gland adenoid cystic carcinoma (ACC) is a rare head and neck malignancy without molecular biomarkers that can be used to predict the chemotherapeutic response or prognosis of ACC. The regulation of gene expression of oncogenes and tumor suppressor genes (TSGs) through DNA promoter methylation may play a role in the carcinogenesis of ACC. To identify differentially methylated genes in ACC, a global demethylating agent, 5-aza-2′-deoxycytidine (5-AZA) was utilized to unmask putative TSG silencing in ACC xenograft models in mice. Fresh xenografts were passaged, implanted in triplicate in mice that were treated with 5-AZA daily for 28 days. These xenografts were then evaluated for genome-wide DNA methylation patterns using the Illumina Infinium HumanMethylation27 BeadChip array. Validation of the 32 candidate genes was performed by bisulfite sequencing (BS-seq) in a separate cohort of 6 ACC primary tumors and 6 normal control salivary gland tissues. Hypermethylation was identified in the HCN2 gene promoter in all 6 control tissues, but hypomethylation was found in all 6 ACC tumor tissues. Quantitative validation of HCN2 promoter methylation level in the region detected by BS-seq was performed in a larger cohort of primary tumors (n=32) confirming significant HCN2 hypomethylation in ACCs compared with normal samples (n=10; P=0.04). HCN2 immunohistochemical staining was performed on an ACC tissue microarray. HCN2 staining intensity and H-score, but not percentage of the positively stained cells, were significantly stronger in normal tissues than those of ACC tissues. With our novel screening and sequencing methods, we identified several gene candidates that were methylated. The most significant of these genes, HCN2, was actually hypomethylated in tumors. However, promoter methylation status does not appear to be a major determinant of HCN2 expression in normal and ACC tissues. HCN2 hypomethylation is a biomarker of ACC and may play an important role in the

  20. The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening.

    PubMed

    Li, Tong; Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui; Wang, Aide

    2017-06-01

    The plant hormone ethylene is critical for ripening in climacteric fruits, including apple ( Malus domestica ). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1 , an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2 , encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3 , encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1 This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1 Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. © 2017 American Society of Plant Biologists. All rights reserved.

  1. ACC Study Guide Series.

    ERIC Educational Resources Information Center

    Austin Community Coll., TX. Rio Grande Campus.

    Ten one-page instructional guides designed to assist Austin Community College (ACC) students in using the library and in writing research papers are presented in this series. The titles of the guides are: (1) "The Media Collection (We have more than books in the LRC)"; (2) "Encyclopedias"; (3) "Finding Books"; (4)…

  2. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

    PubMed

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

  3. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

    PubMed

    Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

    2012-03-01

    The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

  4. Exploiting algal NADPH oxidase for biophotovoltaic energy

    DOE PAGES

    Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

    2015-01-29

    Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

  5. Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

    PubMed Central

    Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

    2001-01-01

    It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

  6. Y Chromosome Regulation of Autism Susceptibility Genes

    DTIC Science & Technology

    2009-06-01

    with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

  7. A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

    PubMed

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

    2014-09-01

    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Ethylene and 1-Aminocyclopropane-1-carboxylate (ACC) in Plant–Bacterial Interactions

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Glick, Bernard R.

    2018-01-01

    Ethylene and its precursor 1-aminocyclopropane-1-carboxylate (ACC) actively participate in plant developmental, defense and symbiotic programs. In this sense, ethylene and ACC play a central role in the regulation of bacterial colonization (rhizospheric, endophytic, and phyllospheric) by the modulation of plant immune responses and symbiotic programs, as well as by modulating several developmental processes, such as root elongation. Plant-associated bacterial communities impact plant growth and development, both negatively (pathogens) and positively (plant-growth promoting and symbiotic bacteria). Some members of the plant-associated bacterial community possess the ability to modulate plant ACC and ethylene levels and, subsequently, modify plant defense responses, symbiotic programs and overall plant development. In this work, we review and discuss the role of ethylene and ACC in several aspects of plant-bacterial interactions. Understanding the impact of ethylene and ACC in both the plant host and its associated bacterial community is key to the development of new strategies aimed at increased plant growth and protection. PMID:29520283

  9. Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

    PubMed

    Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

    2017-01-23

    The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

  10. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development Regulations Relating... before ACC expiration. This part is not intended to preclude or restrict the demolition or disposition of... before the ACC Expiration Date. ...

  11. Polyamines and ethylene interact in rice grains in response to soil drying during grain filling.

    PubMed

    Chen, Tingting; Xu, Yunji; Wang, Jingchao; Wang, Zhiqin; Yang, Jianchang; Zhang, Jianhua

    2013-05-01

    This study tested the hypothesis that the interaction between polyamines and ethylene may mediate the effects of soil drying on grain filling of rice (Oryza sativa L.). Two rice cultivars were pot grown. Three treatments, well-watered, moderate soil drying (MD), and severe soil drying (SD), were imposed from 8 d post-anthesis until maturity. The endosperm cell division rate, grain-filling rate, and grain weight of earlier flowering superior spikelets showed no significant differences among the three treatments. However, those of the later flowering inferior spikelets were significantly increased under MD and significantly reduced under SD when compared with those which were well watered. The two cultivars showed the same tendencies. MD increased the contents of free spermidine (Spd) and free spermine (Spm), the activities of S-adenosyl-L-methionine decarboxylase and Spd synthase, and expression levels of polyamine synthesis genes, and decreased the ethylene evolution rate, the contents of 1-aminocylopropane-1-carboxylic acid (ACC) and hydrogen peroxide, the activities of ACC synthase, ACC oxidase, and polyamine oxidase, and the expression levels of ethylene synthesis genes in inferior spikelets. SD exhibited the opposite effects. Application of Spd, Spm, or an inhibitor of ethylene synthesis to rice panicles significantly reduced ethylene and ACC levels, but significantly increased Spd and Spm contents, grain-filling rate, and grain weight of inferior spikelets. The results were reversed when ACC or an inhibitor of Spd and Spm synthesis was applied. The results suggest that a potential metabolic interaction between polyamines and ethylene biosynthesis responds to soil drying and mediates the grain filling of inferior spikelets in rice.

  12. The monoamine oxidase A gene promoter repeat and prostate cancer risk.

    PubMed

    White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

    2012-11-01

    Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

  13. Tone-Evoked Acoustic Change Complex (ACC) Recorded in a Sedated Animal Model.

    PubMed

    Presacco, Alessandro; Middlebrooks, John C

    2018-05-10

    The acoustic change complex (ACC) is a scalp-recorded cortical evoked potential complex generated in response to changes (e.g., frequency, amplitude) in an auditory stimulus. The ACC has been well studied in humans, but to our knowledge, no animal model has been evaluated. In particular, it was not known whether the ACC could be recorded under the conditions of sedation that likely would be necessary for recordings from animals. For that reason, we tested the feasibility of recording ACC from sedated cats in response to changes of frequency and amplitude of pure-tone stimuli. Cats were sedated with ketamine and acepromazine, and subdermal needle electrodes were used to record electroencephalographic (EEG) activity. Tones were presented from a small loudspeaker located near the right ear. Continuous tones alternated at 500-ms intervals between two frequencies or two levels. Neurometric functions were created by recording neural response amplitudes while systematically varying the magnitude of steps in frequency centered in octave frequency around 2, 4, 8, and 16 kHz, all at 75 dB SPL, or in decibel level around 75 dB SPL tested at 4 and 8 kHz. The ACC could be recorded readily under this ketamine/azepromazine sedation. In contrast, ACC could not be recorded reliably under any level of isoflurane anesthesia that was tested. The minimum frequency (expressed as Weber fractions (df/f)) or level steps (expressed in dB) needed to elicit ACC fell in the range of previous thresholds reported in animal psychophysical tests of discrimination. The success in recording ACC in sedated animals suggests that the ACC will be a useful tool for evaluation of other aspects of auditory acuity in normal hearing and, presumably, in electrical cochlear stimulation, especially for novel stimulation modes that are not yet feasible in humans.

  14. 24 CFR 969.106 - ACC extension in absence of current operating subsidy.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

  15. 24 CFR 969.106 - ACC extension in absence of current operating subsidy.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

  16. OpenARC: Extensible OpenACC Compiler Framework for Directive-Based Accelerator Programming Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Seyong; Vetter, Jeffrey S

    2014-01-01

    Directive-based, accelerator programming models such as OpenACC have arisen as an alternative solution to program emerging Scalable Heterogeneous Computing (SHC) platforms. However, the increased complexity in the SHC systems incurs several challenges in terms of portability and productivity. This paper presents an open-sourced OpenACC compiler, called OpenARC, which serves as an extensible research framework to address those issues in the directive-based accelerator programming. This paper explains important design strategies and key compiler transformation techniques needed to implement the reference OpenACC compiler. Moreover, this paper demonstrates the efficacy of OpenARC as a research framework for directive-based programming study, by proposing andmore » implementing OpenACC extensions in the OpenARC framework to 1) support hybrid programming of the unified memory and separate memory and 2) exploit architecture-specific features in an abstract manner. Porting thirteen standard OpenACC programs and three extended OpenACC programs to CUDA GPUs shows that OpenARC performs similarly to a commercial OpenACC compiler, while it serves as a high-level research framework.« less

  17. 1-MCP EFFECTS ON ANTIOXIDANT ACTIVITY AND GENE EXPRESSION OF ACC-SYNTHASE AND ACC-OXIDASE IN COTTON FLOWERS

    USDA-ARS?s Scientific Manuscript database

    Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

  18. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  19. Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

    PubMed Central

    Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

    1998-01-01

    Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

  20. Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

    PubMed

    Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

    2018-05-01

    Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society

  1. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  2. Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension

    PubMed Central

    FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.

    2010-01-01

    Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159

  3. Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

    PubMed

    Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

    2012-12-30

    The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  4. Identification of NADPH oxidase family members associated with cold stress in strawberry.

    PubMed

    Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

    2018-04-01

    NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

  5. 24 CFR 882.805 - HA application process, ACC execution, and pre-rehabilitation activities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false HA application process, ACC... § 882.805 HA application process, ACC execution, and pre-rehabilitation activities. (a) Review. When... applications in accordance with the guidelines, rating criteria, and procedures published in the NOFA. (b) ACC...

  6. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

    PubMed Central

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

    2001-01-01

    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

  7. In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan

    2012-02-07

    We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

  8. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS RELATING... HOUSING AFTER COMPLETION OF DEBT SERVICE § 969.107 HUD approval of demolition or disposition before ACC..., HUD may authorize a PHA to demolish or dispose of public housing at any time before the ACC Expiration...

  9. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brunner, H.G.; Nelen, M.; Ropers, H.H.

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

  10. Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts

    PubMed Central

    de las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine

    2016-01-01

    Background The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. Methods We studied 5,238 participants from the KORA surveys S3 (1994–1995) and S4 (1999–2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000–2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. Results The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. Conclusions The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany. PMID:27732641

  11. Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts.

    PubMed

    de Las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine; Mahabadi, Amir Abbas; Koenig, Wolfgang

    2016-01-01

    The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. We studied 5,238 participants from the KORA surveys S3 (1994-1995) and S4 (1999-2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000-2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany.

  12. Driver's behavioral adaptation to adaptive cruise control (ACC): the case of speed and time headway.

    PubMed

    Bianchi Piccinini, Giulio Francesco; Rodrigues, Carlos Manuel; Leitão, Miguel; Simões, Anabela

    2014-06-01

    The Adaptive Cruise Control is an Advanced Driver Assistance System (ADAS) that allows maintaining given headway and speed, according to settings pre-defined by the users. Despite the potential benefits associated to the utilization of ACC, previous studies warned against negative behavioral adaptations that might occur while driving with the system activated. Unfortunately, up to now, there are no unanimous results about the effects induced by the usage of ACC on speed and time headway to the vehicle in front. Also, few studies were performed including actual users of ACC among the subjects. This research aimed to investigate the effect of the experience gained with ACC on speed and time headway for a group of users of the system. In addition, it explored the impact of ACC usage on speed and time headway for ACC users and regular drivers. A matched sample driving simulator study was planned as a two-way (2×2) repeated measures mixed design, with the experience with ACC as between-subjects factor and the driving condition (with ACC and manually) as within-subjects factor. The results show that the usage of ACC brought a small but not significant reduction of speed and, especially, the maintenance of safer time headways, being the latter result greater for ACC users, probably as a consequence of their experience in using the system. The usage of ACC did not cause any negative behavioral adaptations to the system regarding speed and time headway. Based on this research work, the Adaptive Cruise Control showed the potential to improve road safety for what concerns the speed and the time headway maintained by the drivers. The speed of the surrounding traffic and the minimum time headway settable through the ACC seem to have an important effect on the road safety improvement achievable with the system. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

    PubMed

    Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

    2014-05-01

    Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

  14. Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

    PubMed

    Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

    2001-06-01

    Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

  15. Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

    PubMed Central

    Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

    2001-01-01

    Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

  16. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  17. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

  18. Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

    PubMed Central

    Frisse, Andrea; Pimenta, Maria João; Lange, Theo

    2003-01-01

    Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

  19. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  20. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  1. Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum.

    PubMed

    Tang, Yuanman; Liu, Qiuping; Liu, Ying; Zhang, Linli; Ding, Wei

    2017-01-01

    Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA)-responsive genes NtPR1a/c , NtPR2 and NtCHN50 , JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26 . Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum . Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

  2. Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

    PubMed Central

    Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

    2017-01-01

    Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

  3. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

    2004-01-01

    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  4. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Biotin augments acetyl CoA carboxylase 2 gene expression in the hypothalamus, leading to the suppression of food intake in mice.

    PubMed

    Sone, Hideyuki; Kamiyama, Shin; Higuchi, Mutsumi; Fujino, Kaho; Kubo, Shizuka; Miyazawa, Masami; Shirato, Saya; Hiroi, Yuka; Shiozawa, Kota

    2016-07-29

    It is known that biotin prevents the development of diabetes by increasing the functions of pancreatic beta-cells and improving insulin sensitivity in the periphery. However, its anti-obesity effects such as anorectic effects remain to be clarified. Acetyl CoA carboxylase (ACC), a biotin-dependent enzyme, has two isoforms (ACC1 and ACC2) and serves to catalyze the reaction of acetyl CoA to malonyl CoA. In the hypothalamus, ACC2 increases the production of malonyl CoA, which acts as a satiety signal. In this study, we investigated whether biotin increases the gene expression of ACC2 in the hypothalamus and suppresses food intake in mice administered excessive biotin. Food intake was significantly decreased by biotin, but plasma regulators of appetite, including glucose, ghrelin, and leptin, were not affected. On the other hand, biotin notably accumulated in the hypothalamus and enhanced ACC2 gene expression there, but it did not change the gene expression of ACC1, malonyl CoA decarboxylase (a malonyl CoA-degrading enzyme), and AMP-activated protein kinase α-2 (an ACC-inhibitory enzyme). These findings strongly suggest that biotin potentiates the suppression of appetite by upregulating ACC2 gene expression in the hypothalamus. This effect of biotin may contribute to the prevention of diabetes by biotin treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Subchronic glucocorticoids, glutathione depletion and a postpartum model elevate monoamine oxidase a activity in the prefrontal cortex of rats.

    PubMed

    Raitsin, Sofia; Tong, Junchao; Kish, Stephen; Xu, Xin; Magomedova, Lilia; Cummins, Carolyn; Andreazza, Ana C; Scola, Gustavo; Baker, Glen; Meyer, Jeffrey H

    2017-07-01

    Recent human brain imaging studies implicate dysregulation of monoamine oxidase-A (MAO-A), in particular in the prefrontal cortex (PFC) and anterior cingulate cortex (ACC), in the development of major depressive disorder (MDD). This study investigates the influence of four alterations underlying important pathologies of MDD, namely, chronic elevation of glucocorticoid levels, glutathione depletion, changes in female gonadal sex hormones and serotonin concentration fluctuation, on MAO-A and MAO-B activities in rats. Young adult rats exposed chronically to the synthetic glucocorticoid dexamethasone at 0, 0.05, 0.5, and 2.0mg/kg/day (osmotic minipumps) for eight days showed significant dose-dependent increases in activities of MAO-A in PFC (+17%, p<0.001) and ACC (+9%, p<0.01) and MAO-B in PFC (+14%, p<0.001) and increased serotonin turnover in the PFC (+31%, p<0.01), not accounted for by dexamethasone-induced changes in serotonin levels, since neither serotonin depletion nor supplementation affected MAO-A activity. Sub-acute depletion of the major antioxidant glutathione by diethyl maleate (5mmol/kg, i.p.) for three days, which resulted in a 36% loss of glutathione in PFC (p=0.0005), modestly, but significantly, elevated activities of MAO-A in PFC and MAO-B in PFC, ACC and hippocampus (+6-9%, p<0.05). Changes in estrogen and progesterone representing pseudopregnancy were associated with significantly elevated MAO-A activity in the ACC day 4-7 postpartum (10-18%, p<0.05 to p<0.0001) but not the PFC or hippocampus. Hence, our study provides data in support of strategies targeting glucocorticoid and glutathione systems, as well as changes in female sex hormones for normalization of MAO-A activities and thus treatment of mood disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

    PubMed Central

    Peck, Ammon B.; Khan, Saeed R.

    2013-01-01

    A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

  8. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  9. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  10. The ACC strategy in biomineralization: the case of earthworm's amorphous spherulites

    NASA Astrophysics Data System (ADS)

    Briones, Maria J. I.; Alvarez-Otero, Rosa; Méndez, Jesús; Gago Duport, Luis

    2010-05-01

    The occurrence of amorphous calcium carbonate (ACC), an hydrated and highly soluble form of solid CaCO3, seems to be a common feature in all carbonate forming organisms such as mollusks, corals, echinoderms and crustaceans. The ubiquity of ACC in these Ca-carbonate biomineralizing systems, as a precursor of further crystalline phases, has recently open the interesting question about if the formation of an amorphous phase is a necessary step in the calcification process of all organisms and consequently, whether it would be possible to define the "amorphous precursor estategy" as a general mechanism in biomineralization. Neverthelees, although ACC appears to be widespread in these organisms very little is known about its particular role in the biomineralization scheme of the different phyla. The formation of CaCO3 spherulites in the calciferous glands of earthworms is a particular case of calcareous biomineralization involving the presence of ACC as a transient precursor phase [2]. Interestingly, the formation of crystalline carbonates via ACC in these organisms is not connected with skeleton building so it must play another functional role. In addition, the transient transformation stages can be followed by in situ spectrometric techniques and therefore, earthworms provide and adequate model to analyse the mutual interactions between ACC-solvent-and crystalline phases. In this study, we have analysed the morphological and structural transformations from the initial ACC spherulites until the formation of the crystalline phases: vaterite (and/or aragonite) and finally calcite, is accomplished. The characterization of ACC was done by performing in situ FT-IR, together with and HREM and Debye scherrer -XRD. The structural results were interpreted in the light of the histological study of the gland. The geometry of the secretory epithelium of the calciferous gland, as evidenced by TEM [2], shows the presence of irregulary shaped cells with their apical surface

  11. Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

    PubMed

    Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

    2015-03-24

    L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome

  12. Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

    PubMed Central

    Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

    2010-01-01

    Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

  13. Three 1-Aminocyclopropane-1-Carboxylate Synthase Genes Regulated by Primary and Secondary Pollination Signals in Orchid Flowers1

    PubMed Central

    Bui, Anhthu Q.; Neill, Sharman D. O'

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  14. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidasegene variations and the risk of noise-induced hearing loss].

    PubMed

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidasegene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidasegene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  15. AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel, E-mail: mfessop@sun.ac.za

    Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transientlymore » transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional

  16. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

    PubMed

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

    2015-03-01

    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  17. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  18. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    PubMed

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.

  19. Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.

    PubMed

    Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J

    2016-03-01

    An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action. © 2016 Society for Endocrinology.

  20. [Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

    PubMed

    Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

    2010-11-01

    Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

  1. Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

    PubMed Central

    Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

    2008-01-01

    Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

  2. Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

    PubMed

    Haruta, M; Murata, M; Kadokura, H; Homma, S

    1999-03-01

    An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

  3. Skeletal muscle ACC2 S212 phosphorylation is not required for the control of fatty acid oxidation during exercise.

    PubMed

    O'Neill, Hayley M; Lally, James S; Galic, Sandra; Pulinilkunnil, Thomas; Ford, Rebecca J; Dyck, Jason R B; van Denderen, Bryce J; Kemp, Bruce E; Steinberg, Gregory R

    2015-07-01

    During submaximal exercise fatty acids are a predominant energy source for muscle contractions. An important regulator of fatty acid oxidation is acetyl-CoA carboxylase (ACC), which exists as two isoforms (ACC1 and ACC2) with ACC2 predominating in skeletal muscle. Both ACC isoforms regulate malonyl-CoA production, an allosteric inhibitor of carnitine palmitoyltransferase 1 (CPT-1); the primary enzyme controlling fatty acyl-CoA flux into mitochondria for oxidation. AMP-activated protein kinase (AMPK) is a sensor of cellular energy status that is activated during exercise or by pharmacological agents such as metformin and AICAR. In resting muscle the activation of AMPK with AICAR leads to increased phosphorylation of ACC (S79 on ACC1 and S221 on ACC2), which reduces ACC activity and malonyl-CoA; effects associated with increased fatty acid oxidation. However, whether this pathway is vital for regulating skeletal muscle fatty acid oxidation during conditions of increased metabolic flux such as exercise/muscle contractions remains unknown. To examine this we characterized mice lacking AMPK phosphorylation sites on ACC2 (S212 in mice/S221 in humans-ACC2-knock-in [ACC2-KI]) or both ACC1 (S79) and ACC2 (S212) (ACC double knock-in [ACCD-KI]) during submaximal treadmill exercise and/or ex vivo muscle contractions. We find that surprisingly, ACC2-KI mice had normal exercise capacity and whole-body fatty acid oxidation during treadmill running despite elevated muscle ACC2 activity and malonyl-CoA. Similar results were observed in ACCD-KI mice. Fatty acid oxidation was also maintained in muscles from ACC2-KI mice contracted ex vivo. These findings indicate that pathways independent of ACC phosphorylation are important for regulating skeletal muscle fatty acid oxidation during exercise/muscle contractions. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  4. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  5. Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

    PubMed

    Barak, S; Nejidat, A; Heimer, Y; Volokita, M

    2001-03-01

    The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

  6. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  7. ACC Study Guide Series (Revised Edition).

    ERIC Educational Resources Information Center

    Staples, Katherine; And Others

    Designed for the beginning college student who needs to search for information, prepare written assignments, or take tests, the ACC (Austin Community College) Study Guide Series comprises 17 one-page study guides. Printed on card stock with colored headings, the guides are highlighted with cartoon illustrations and are intended to provide…

  8. 24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

  9. 24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

  10. Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

    PubMed

    Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

    2011-01-01

    Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

  11. Extradural Spinal Metastasis of Adenoid Cystic Carcinoma (ACC): A Case Report

    PubMed Central

    Nair, Rajesh; Upadhyaya, Sunil; Nayal, Bhavna; Shetty, Arjun

    2015-01-01

    Adenoid cystic carcinoma (ACC) is a rare malignant tumour of the major salivary glands. It accounts for 10-15% of all salivary gland tumours and 1% of all head and neck tumours. Surgical resection followed by radiation is the choice of treatment for ACC. However, late loco-regional recurrence and metastasis is often seen emphasizing the importance of long-term follow-up. We report an unusual case of extradural metastasis of ACC in the dorsal spine. The primary submandibular gland tumour was resected 11 y back. A recurrence had been detected two years prior to the occurrence of spinal metastasis. Surgical decompression was done which was followed by palliative radiotherapy. Patient is symptomatically better, ambulant and on regular follow-up. PMID:25738073

  12. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

    PubMed

    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

    2016-01-10

    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

    PubMed

    Kita, K; Konishi, K; Anraku, Y

    1986-01-01

    Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

  14. Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

    PubMed Central

    Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

    1999-01-01

    Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

  15. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-05

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

    PubMed Central

    Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

    2001-01-01

    Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

  17. A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

    PubMed

    Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

    2010-10-01

    DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

  18. Monoamine oxidase-A polymorphisms might modify the association between the dopamine D2 receptor gene and alcohol dependence.

    PubMed

    Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band

    2007-05-01

    Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.

  19. Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

    PubMed

    Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

    2017-08-01

    Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

  20. A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

    PubMed

    Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

    2007-09-05

    Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

  1. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

    PubMed

    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

  2. Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

    PubMed

    Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

    2002-04-01

    Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

  3. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    PubMed

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  4. Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

    PubMed

    Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

    2013-06-01

    Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

  5. Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

    PubMed

    Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

    2018-04-23

    Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

  7. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  8. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  9. OpenACC performance for simulating 2D radial dambreak using FVM HLLE flux

    NASA Astrophysics Data System (ADS)

    Gunawan, P. H.; Pahlevi, M. R.

    2018-03-01

    The aim of this paper is to investigate the performances of openACC platform for computing 2D radial dambreak. Here, the shallow water equation will be used to describe and simulate 2D radial dambreak with finite volume method (FVM) using HLLE flux. OpenACC is a parallel computing platform based on GPU cores. Indeed, from this research this platform is used to minimize computational time on the numerical scheme performance. The results show the using OpenACC, the computational time is reduced. For the dry and wet radial dambreak simulations using 2048 grids, the computational time of parallel is obtained 575.984 s and 584.830 s respectively for both simulations. These results show the successful of OpenACC when they are compared with the serial time of dry and wet radial dambreak simulations which are collected 28047.500 s and 29269.40 s respectively.

  10. Sister grouping of chimpanzees and humans as revealed by genome-wide phylogenetic analysis of brain gene expression profiles

    PubMed Central

    Uddin, Monica; Wildman, Derek E.; Liu, Guozhen; Xu, Wenbo; Johnson, Robert M.; Hof, Patrick R.; Kapatos, Gregory; Grossman, Lawrence I.; Goodman, Morris

    2004-01-01

    Gene expression profiles from the anterior cingulate cortex (ACC) of human, chimpanzee, gorilla, and macaque samples provide clues about genetic regulatory changes in human and other catarrhine primate brains. The ACC, a cerebral neocortical region, has human-specific histological features. Physiologically, an individual's ACC displays increased activity during that individual's performance of cognitive tasks. Of ≈45,000 probe sets on microarray chips representing transcripts of all or most human genes, ≈16,000 were commonly detected in human ACC samples and comparable numbers, 14,000–15,000, in gorilla and chimpanzee ACC samples. Phylogenetic results obtained from gene expression profiles contradict the traditional expectation that the non-human African apes (i.e., chimpanzee and gorilla) should be more like each other than either should be like humans. Instead, the chimpanzee ACC profiles are more like the human than like the gorilla; these profiles demonstrate that chimpanzees are the sister group of humans. Moreover, for those unambiguous expression changes mapping to important biological processes and molecular functions that statistically are significantly represented in the data, the chimpanzee clade shows at least as much apparent regulatory evolution as does the human clade. Among important changes in the ancestry of both humans and chimpanzees, but to a greater extent in humans, are the up-regulated expression profiles of aerobic energy metabolism genes and neuronal function-related genes, suggesting that increased neuronal activity required increased supplies of energy. PMID:14976249

  11. Further studies of auxin and ACC induced feminization in the cucumber plant using ethylene inhibitors

    NASA Technical Reports Server (NTRS)

    Takahashi, H.; Jaffe, M. J.

    1984-01-01

    The present study was designed to establish the role of an essential hormone controlling sex expression in cucumber. A potent anti-ethylene agent, AgNO3, completely inhibited pistillate flower formation caused by IAA, ACC or ethephon. Inhibitors of ethylene biosynthesis, AVG and CoCl2 also suppressed feminization due to exogenous IAA or ACC. Though AVG also suppressed ethephon-induced feminization, this may be due to the second effect of AVG rather than the effect on ACC biosynthesis. These results confirm that ethylene is a major factor regulating feminization and that exogenous auxin induces pistillate flower formation through its stimulation of ethylene production, rather than ACC production.

  12. A more accurate detection of codon 72 polymorphism and LOH of the TP53 gene.

    PubMed

    Baccouche, Sami; Mabrouk, Imed; Said, Salem; Mosbah, Ali; Jlidi, Rachid; Gargouri, Ali

    2003-01-10

    The polymorphism at codon 72 of the TP53 gene has been extensively studied for its involvement in cancerogenesis and loss of heterozygosity (LOH) detection. Usually, the exon 4 of the TP53 gene is amplified by polymerase chain reaction (PCR) on DNA extracted from blood and tumor tissues, then digested by AccII. In the case of heterozygosity, the comparison of AccII profile from blood and tumor DNA PCR products allowed the identification of a potential LOH in the TP53 locus. This method can be hindered by a partial AccII digestion and/or DNA contamination of non-tumor cells. To circumvent these problems, we have developed a new approach by using the AccII restriction site between exon 4 and exon 6. The PCR amplification of exon 4-6, followed by AccII digestion allowed us to detect without ambiguity any LOH case.

  13. Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications

    PubMed Central

    Vanderstraeten, Lisa; Van Der Straeten, Dominique

    2017-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy. PMID:28174583

  14. Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications.

    PubMed

    Vanderstraeten, Lisa; Van Der Straeten, Dominique

    2017-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy.

  15. Preliminary results from DIMES: Dispersion in the ACC

    NASA Astrophysics Data System (ADS)

    Balwada, D.; Speer, K.; LaCasce, J. H.; Owens, B.

    2012-04-01

    The Diapycnal and Isopynal Mixing Experiment in the Southern Ocean (DIMES) is a CLIVAR process study designed to study mixing in the Antarctic Circumpolar Current. The experiment includes tracer release, float, and small-scale turbulence components. This presentation will report on some results of the float component, from floats deployed across the ACC in the Southeast Pacific Ocean. These are the first subsurface Lagrangian trajectories from the ACC. Floats were deployed to follow approximately a constant density surface for a period of 1-3 years. To help aid the experimental results virtual floats were advected using AVISO data and basic statistics were derived from both deployed and virtual float trajectories. Experimental design, initial results, comparison to virtual floats and single particle and relative dispersion calculations will be presented.

  16. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

    PubMed Central

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-01-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  17. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

    Treesearch

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

    2004-01-01

    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  18. ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

    PubMed

    Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

    2011-07-20

    Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. An OpenACC-Based Unified Programming Model for Multi-accelerator Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Jungwon; Lee, Seyong; Vetter, Jeffrey S

    2015-01-01

    This paper proposes a novel SPMD programming model of OpenACC. Our model integrates the different granularities of parallelism from vector-level parallelism to node-level parallelism into a single, unified model based on OpenACC. It allows programmers to write programs for multiple accelerators using a uniform programming model whether they are in shared or distributed memory systems. We implement a prototype of our model and evaluate its performance with a GPU-based supercomputer using three benchmark applications.

  20. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

    2011-01-01

    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  1. Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

    PubMed

    Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

    2012-01-01

    Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

  2. Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

    PubMed

    Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

    2017-11-01

    Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Les grands accélérateurs de particules

    NASA Astrophysics Data System (ADS)

    Patoux, A.; Perot, J.

    1991-02-01

    The different types of accelerators are recalled with emphasis on the most powerful : the synchrotron particle colliders. The use of superconductors in accelerator magnets as well as in RF cavities is discussed. The characteristics of the large accelerators, existing and planned, are given together with the level of industry involvement in their construction. Details concerning superconducting magnets and cryogenic plants are investigated. Finally, detectors, the most important tool for physics, are mentionned. Après avoir rappelé les différents types d'accélérateurs utilisés, l'accent est mis sur les plus puissants, c'est-à-dire les synchrotrons fonctionnant en anneaux de collision. Le rôle des supraconducteurs est analysé aussi bien pour les aimants que pour les cavités accélératrices. Les caractéristiques des principaux accélérateurs existants ou en projet sont données ainsi que l'implication de l'industrie dans leur fabrication. On insiste plus particulièrement sur les aimants supraconducteurs et les installations cryogéniques. Enfin les détecteurs, éléments indispensables à la physique, sont également évoqués.

  4. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    PubMed

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  5. Precipitation of ACC in liposomes-a model for biomineralization in confined volumes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tester, Chantel C; Wu, Ching-Hsuan; Weigand, Steven

    2013-01-10

    Biomineralizing organisms frequently precipitate minerals in small phospholipid bilayer-delineated compartments. We have established an in vitro model system to investigate the effect of confinement in attoliter to femtoliter volumes on the precipitation of calcium carbonate. In particular, we analyze the growth and stabilization of liposome-encapsulated amorphous calcium carbonate (ACC) nanoparticles using a combination of in situ techniques, cryo-transmission electron microscopy (Cryo-TEM), and small angle X-ray scattering (SAXS). Herein, we discuss ACC nanoparticle growth rate as a function of liposome size, carbon dioxide flux across the liposome membrane, pH, and osmotic pressure. Based on these experiments, we argue that the stabilizationmore » of ACC nanoparticles in liposomes is a consequence of a low nucleation rate (high activation barrier) of crystalline polymorphs of calcium carbonate.« less

  6. Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI

    PubMed Central

    Zweerings, Jana; Pflieger, Eliza M.; Mathiak, Krystyna A.; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

    2018-01-01

    Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD. PMID:29899712

  7. Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI.

    PubMed

    Zweerings, Jana; Pflieger, Eliza M; Mathiak, Krystyna A; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

    2018-01-01

    Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD.

  8. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

  9. Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

    PubMed

    Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

    2013-01-01

    Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

  10. NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

    PubMed Central

    Ushio-Fukai, Masuko; Malik, Asrar B.

    2009-01-01

    Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

  11. [Isolation, identification and characterization of ACC deaminase-containing endophytic bacteria from halophyte Suaeda salsa].

    PubMed

    Teng, Songshan; Liu, Yanping; Zhao, Lei

    2010-11-01

    We Isolated and characterized 1-aminocyclopropane-1-carboxylate (ACC) deaminase-containing endophytic bacteria from halophyte Suaeda salsa to understand the interactions between endophytes and halophyte. ACC deaminase-containing endophytic bacteria were isolated from root, stalk and leaf of Suaeda salsa and were identified based on morphological, physiological-biochemical properties, API and 16S rRNA sequence analysis. Isolates were evaluated for their ACC deaminase, antifungal, protease activity, siderophores and phytohormones, such as indole-3-acetic acid, gibberellic acid and abscisic acid production, as well as atmospheric nitrogen fixation and phosphate solubilization. Four ACC deaminase-containing endophytic bacteria strains named as LP11, SS12, TW1 and TW2 were isolated and identified as Pseudomonas oryzihabitans, Pseudomonas sp., Pantoea agglomerans and Pseudomonas putida respectively. All the strains possessed the phosphate-solubilizing ability and could produce siderophores and phytohormones more or less. None of them could fix atmospheric nitrogen or produce protease. Only strain SS12 showed antagonism against two phytopathogenic fungi viz Fusarium oxysporum f. sp. conglutinans and F. oxysporum f. sp. cucumerinum. ACC deaminase-containing endophytic bacteria of Pseudomonas sp. and Pantoea sp. isolated from halophyte Suaeda salsa have abundant biological characteristics related to plant growth promotion, stress homeostasis regulation and biocontrol activity.

  12. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  13. Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

    PubMed

    Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

    2018-05-12

    The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

  14. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  15. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

    Treesearch

    Phil Kersten; Dan Cullen

    2014-01-01

    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

  16. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa

    2013-01-01

    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  17. An ACC Design Method for Achieving Both String Stability and Ride Comfort

    NASA Astrophysics Data System (ADS)

    Yamamura, Yoshinori; Seto, Yoji; Nishira, Hikaru; Kawabe, Taketoshi

    An investigation was made of a method for designing adaptive cruise control (ACC) so as to achieve a headway distance response that feels natural to the driver while at the same time obtaining high levels of both string stability and ride comfort. With this design method, the H∞ norm is adopted as the index of string stability. Additionally, two norms are introduced for evaluating ride comfort and natural vehicle behavior. The relationship between these three norms and headway distance response characteristics was analyzed, and an evaluation method was established for achieving high levels of the various performance characteristics required of ACC. An ACC system designed with this method was evaluated in driving tests conducted on a proving ground course, and the results confirmed that it achieved the targeted levels of string stability, ride comfort and natural vehicle behavior.

  18. Effectiveness of rhizobacteria containing ACC deaminase for growth promotion of peas (Pisum sativum) under drought conditions.

    PubMed

    Zahir, Z A; Munir, A; Asghar, H N; Shaharoona, B; Arshad, M

    2008-05-01

    A series of experiments were conducted to assess the effectiveness of rhizobacteria containing 1-aminocyclopropane- 1-carboxylate (ACC) deaminase for growth promotion of peas under drought conditions. Ten rhizobacteria isolated from the rhizosphere of different crops (peas, wheat, and maize) were screened for their growth promoting ability in peas under axenic condition. Three rhizobacterial isolates, Pseudomonas fluorescens biotype G (ACC-5), P. fluorescens (ACC-14), and P. putida biotype A (Q-7), were selected for pot trial on the basis of their source, ACC deaminase activity, root colonization, and growth promoting activity under axenic conditions. Inoculated and uninoculated (control) seeds of pea cultivar 2000 were sown in pots (4 seeds/pot) at different soil moisture levels (25, 50, 75, and 100% of field capacity). Results revealed that decreasing the soil moisture levels from 100 to 25% of field capacity significantly decreased the growth of peas. However, inoculation of peas with rhizobacteria containing ACC deaminase significantly decreased the "drought stress imposed effects" on growth of peas, although with variable efficacy at different moisture levels. At the lowest soil moisture level (25% field capacity), rhizobacterial isolate Pseudomonas fluorescens biotype G (ACC-5) was found to be more promising compared with the other isolates, as it caused maximum increases in fresh weight, dry weight, root length, shoot length, number of leaves per plant, and water use efficiency on fresh and dry weight basis (45, 150, 92, 45, 140, 46, and 147%, respectively) compared with respective uninoculated controls. It is highly likely that rhizobacteria containing ACC deaminase might have decreased the drought-stress induced ethylene in inoculated plants, which resulted in better growth of plants even at low moisture levels. Therefore, inoculation with rhizobacteria containing ACC deaminase could be helpful in eliminating the inhibitory effects of drought stress on the

  19. Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

    PubMed Central

    Dijkman, Willem P.

    2014-01-01

    In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

  20. Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

    PubMed

    Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

    1992-01-01

    Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

  1. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6

  2. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

    2015-01-01

    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

  3. Various effects of fluorescent bacteria of the genus Pseudomonas containing ACC deaminase on wheat seedling growth.

    PubMed

    Magnucka, Elżbieta G; Pietr, Stanisław J

    2015-12-01

    The study evaluates the effect of rhizobacteria having 1-aminocyclopropane-1-carboxylate deaminase (ACCd) on the development of wheat seedlings. This enzyme has been proposed to play a key role in microbe-plant association. Three fluorescent pseudomonads containing this deaminase were selected from 70 strains of pseudomonads isolated from rhizosphere of wheat (Triticum aestivum L.) and rape (Brassica napus L.). These bacteria, varied significantly in the ability to both biosynthesize auxins and hydrolyze ACC. Among them, Pseudomonas brassicacearum subsp. brassicacearum strain RZ310 presented the highest activities of ACC deaminase during 96h of growth in liquid Dworkin and Foster (DF) salt medium. Additionally, this rape rhizosphere strain did not produce indoles. Two other isolates, Pseudomonas sp. PO283 and Pseudomonas sp. PO366, secreted auxins only in the presence of their precursor. Phylogenetic analysis of the 16S rRNA gene and four other protein-encoding genes indicated that these wheat rhizosphere isolates belonged to the fluorescent Pseudomonas group. Moreover, the effects of these strains on wheat seedling growth under in vitro conditions were markedly dependent on both their cell suspensions used to grain inoculation and nutrient conditions. Strains tested had beneficial influence on wheat seedlings mainly at low cell densities. In addition, access to nutrients markedly changed bacteria action on cereal growth. Their presence generally favored the positive effects of pseudomonads on length and the estimated biomasses of wheat coleoptiles. Despite these general rules, impacts of each isolate on the growth parameters of cereal seedlings were unique. Copyright © 2015 Elsevier GmbH. All rights reserved.

  4. NADPH oxidase inhibitors: a patent review.

    PubMed

    Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

    2011-08-01

    NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

  5. A feasibility study on porting the community land model onto accelerators using OpenACC

    DOE PAGES

    Wang, Dali; Wu, Wei; Winkler, Frank; ...

    2014-01-01

    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflowmore » procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.« less

  6. A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

    PubMed

    Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

    2014-01-01

    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

  7. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

    2014-03-11

    Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

  8. Adenoid cystic carcinoma: emerging role of translocations and gene fusions

    PubMed Central

    Wysocki, Piotr T.; Izumchenko, Evgeny; Meir, Juliet; Ha, Patrick K.; Sidransky, David; Brait, Mariana

    2016-01-01

    Adenoid cystic carcinoma (ACC), the second most common salivary gland malignancy, is notorious for poor prognosis, which reflects the propensity of ACC to progress to clinically advanced metastatic disease. Due to high long-term mortality and lack of effective systemic treatment, the slow-growing but aggressive ACC poses a particular challenge in head and neck oncology. Despite the advancements in cancer genomics, up until recently relatively few genetic alterations critical to the ACC development have been recognized. Although the specific chromosomal translocations resulting in MYB-NFIB fusions provide insight into the ACC pathogenesis and represent attractive diagnostic and therapeutic targets, their clinical significance is unclear, and a substantial subset of ACCs do not harbor the MYB-NFIB translocation. Strategies based on detection of newly described genetic events (such as MYB activating super-enhancer translocations and alterations affecting another member of MYB transcription factor family-MYBL1) offer new hope for improved risk assessment, therapeutic intervention and tumor surveillance. However, the impact of these approaches is still limited by an incomplete understanding of the ACC biology, and the manner by which these alterations initiate and drive ACC remains to be delineated. This manuscript summarizes the current status of gene fusions and other driver genetic alterations in ACC pathogenesis and discusses new therapeutic strategies stemming from the current research. PMID:27533466

  9. [Relationship between the Fnu4HI site polymorphism of monoamine oxidase A gene and Parkinson's disease].

    PubMed

    Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao

    2003-06-01

    To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.

  10. The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

    PubMed Central

    Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

    1984-01-01

    We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

  11. Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

    PubMed

    Pils, D; Schmetterer, G

    2001-09-25

    Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

  12. Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

    PubMed Central

    Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

    2017-01-01

    The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

  13. [Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

    PubMed

    Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

    2011-01-01

    The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

  14. Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

    PubMed

    Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

    2001-05-01

    Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

  15. Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

    PubMed

    Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

    2016-10-01

    Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

  16. The transformation of amorphous calcium carbonate, ACC, to crystalline phases as function of time and temperature.

    NASA Astrophysics Data System (ADS)

    Gies, Hermann; Happel, Marian; Niedermayr, Andrea; Immenhauser, Adrian

    2017-04-01

    We present results from a structural study of the transformation of freeze dried amorphous calcium carbonate, ACC, in crystalline material using pair distribution function analysis, PDF analysis, of X-ray powder diffraction data, XPD data. PDF analysis allows for the analysis of local order of structural subunit in the range between molecular unit (1. and 2. coordination sphere) and long range periodicity as in crystalline materials. ACC was precipitated from aqueous solutions at 298 K and 278 K using different amounts of Mg cations as stabilizer. The samples were immediately separated from the solution and freeze dried. For the transformation study, the samples were heated and analysed using XPD until they were crystallized. The radial distribution obtained from the XPD data were compared to simulated radial distributions of the calcium carbonate polymorphs and their hydrated phases. An ACC precipitated from a solution with Ca:Mg:CO3 = 1:5:4 at 298 K (ration in mmol, pH = 8.2) and freeze dried right after isolation from the solution revealed a close resemblance with ikaite in its local order. Another ACC with Ca:Mg:CO3 = 1:10:1.4 (T = 298, pH = 8.7) showed distinctly different local order resembling monohydrocalcite. Both ACC, however, still had considerable amounts of water dominating the Ca-coordination sphere. During the transformation to calcite, the structural changes in the sample concerned the hydrate water coordinating Ca which was removed and replaced by the carbonate oxygens. The study shows that ACC obtained from different starting solutions show specific local order. Freeze drying leads to solid ACC powder which still contain considerable amounts of hydrate water. Structural subunits are distinct in ACC and different from the crystalline phase. The study supplements recent reports presented by Konrad et al., Purgstaller et al., and Tobler et al.. F. Konrad et al., Cryst. Growth Des. 16, 6310-6317(2016) B. Purgstaller et al., Geochimica et Cosmochimica

  17. Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

    PubMed

    Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

    2014-05-01

    In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

  18. Norrie disease gene is distinct from the monoamine oxidase genes.

    PubMed

    Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

    1989-09-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

  19. A halotolerant Enterobacter sp. displaying ACC deaminase activity promotes rice seedling growth under salt stress.

    PubMed

    Sarkar, Anumita; Ghosh, Pallab Kumar; Pramanik, Krishnendu; Mitra, Soumik; Soren, Tithi; Pandey, Sanjeev; Mondal, Monohar Hossain; Maiti, Tushar Kanti

    2018-01-01

    Agricultural productivity is proven to be hampered by the synthesis of reactive oxygen species (ROS) and production of stress-induced ethylene under salinity stress. One-aminocyclopropane-1-carboxylic acid (ACC) is the direct precursor of ethylene synthesized by plants. Bacteria possessing ACC deaminase activity can use ACC as a nitrogen source preventing ethylene production. Several salt-tolerant bacterial strains displaying ACC deaminase activity were isolated from rice fields, and their plant growth-promoting (PGP) properties were determined. Among them, strain P23, identified as an Enterobacter sp. based on phenotypic characteristics, matrix-assisted laser desorption ionization-time of flight mass spectrometry data and the 16S rDNA sequence, was selected as the best-performing isolate for several PGP traits, including phosphate solubilization, IAA production, siderophore production, HCN production, etc. Enterobacter sp. P23 was shown to promote rice seedling growth under salt stress, and this effect was correlated with a decrease in antioxidant enzymes and stress-induced ethylene. Isolation of an acdS mutant strain enabled concluding that the reduction in stress-induced ethylene content after inoculation of strain P23 was linked to ACC deaminase activity. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

    PubMed

    Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

    2015-11-01

    MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. © 2015 Scandinavian Plant Physiology Society.

  1. Targeting NADPH oxidases in vascular pharmacology

    PubMed Central

    Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

    2012-01-01

    Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

  2. Design and optimization of a portable LQCD Monte Carlo code using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Coscetti, Simone; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Calore, Enrico; Schifano, Sebastiano Fabio; Silvi, Giorgio; Tripiccione, Raffaele

    The present panorama of HPC architectures is extremely heterogeneous, ranging from traditional multi-core CPU processors, supporting a wide class of applications but delivering moderate computing performance, to many-core Graphics Processor Units (GPUs), exploiting aggressive data-parallelism and delivering higher performances for streaming computing applications. In this scenario, code portability (and performance portability) become necessary for easy maintainability of applications; this is very relevant in scientific computing where code changes are very frequent, making it tedious and prone to error to keep different code versions aligned. In this work, we present the design and optimization of a state-of-the-art production-level LQCD Monte Carlo application, using the directive-based OpenACC programming model. OpenACC abstracts parallel programming to a descriptive level, relieving programmers from specifying how codes should be mapped onto the target architecture. We describe the implementation of a code fully written in OpenAcc, and show that we are able to target several different architectures, including state-of-the-art traditional CPUs and GPUs, with the same code. We also measure performance, evaluating the computing efficiency of our OpenACC code on several architectures, comparing with GPU-specific implementations and showing that a good level of performance-portability can be reached.

  3. Norrie disease gene is distinct from the monoamine oxidase genes

    PubMed Central

    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

    1989-01-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935

  4. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  5. Sulcal Polymorphisms of the IFC and ACC Contribute to Inhibitory Control Variability in Children and Adults

    PubMed Central

    Linzarini, Adriano; Dollfus, Sonia; Etard, Olivier; Orliac, François; Houdé, Olivier

    2018-01-01

    Abstract Inhibitory control (IC) is a core executive function that enables humans to resist habits, temptations, or distractions. IC efficiency in childhood is a strong predictor of academic and professional success later in life. Based on analysis of the sulcal pattern, a qualitative feature of cortex anatomy determined during fetal life and stable during development, we searched for evidence that interindividual differences in IC partly trace back to prenatal processes. Using anatomical magnetic resonance imaging (MRI), we analyzed the sulcal pattern of two key regions of the IC neural network, the dorsal anterior cingulate cortex (ACC) and the inferior frontal cortex (IFC), which limits the inferior frontal gyrus. We found that the sulcal pattern asymmetry of both the ACC and IFC contributes to IC (Stroop score) in children and adults: participants with asymmetrical ACC or IFC sulcal patterns had better IC efficiency than participants with symmetrical ACC or IFC sulcal patterns. Such additive effects of IFC and ACC sulcal patterns on IC efficiency suggest that distinct early neurodevelopmental mechanisms targeting different brain regions likely contribute to IC efficiency. This view shares some analogies with the “common variant–small effect” model in genetics, which states that frequent genetic polymorphisms have small effects but collectively account for a large portion of the variance. Similarly, each sulcal polymorphism has a small but additive effect: IFC and ACC sulcal patterns, respectively, explained 3% and 14% of the variance of the Stroop interference scores. PMID:29527565

  6. Sulcal Polymorphisms of the IFC and ACC Contribute to Inhibitory Control Variability in Children and Adults.

    PubMed

    Tissier, Cloélia; Linzarini, Adriano; Allaire-Duquette, Geneviève; Mevel, Katell; Poirel, Nicolas; Dollfus, Sonia; Etard, Olivier; Orliac, François; Peyrin, Carole; Charron, Sylvain; Raznahan, Armin; Houdé, Olivier; Borst, Grégoire; Cachia, Arnaud

    2018-01-01

    Inhibitory control (IC) is a core executive function that enables humans to resist habits, temptations, or distractions. IC efficiency in childhood is a strong predictor of academic and professional success later in life. Based on analysis of the sulcal pattern, a qualitative feature of cortex anatomy determined during fetal life and stable during development, we searched for evidence that interindividual differences in IC partly trace back to prenatal processes. Using anatomical magnetic resonance imaging (MRI), we analyzed the sulcal pattern of two key regions of the IC neural network, the dorsal anterior cingulate cortex (ACC) and the inferior frontal cortex (IFC), which limits the inferior frontal gyrus. We found that the sulcal pattern asymmetry of both the ACC and IFC contributes to IC (Stroop score) in children and adults: participants with asymmetrical ACC or IFC sulcal patterns had better IC efficiency than participants with symmetrical ACC or IFC sulcal patterns. Such additive effects of IFC and ACC sulcal patterns on IC efficiency suggest that distinct early neurodevelopmental mechanisms targeting different brain regions likely contribute to IC efficiency. This view shares some analogies with the "common variant-small effect" model in genetics, which states that frequent genetic polymorphisms have small effects but collectively account for a large portion of the variance. Similarly, each sulcal polymorphism has a small but additive effect: IFC and ACC sulcal patterns, respectively, explained 3% and 14% of the variance of the Stroop interference scores.

  7. Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

    PubMed

    Poyau, A; Buchet, K; Godinot, C

    1999-12-03

    The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

  8. A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

    PubMed

    Nishitani, Goh; Yoshida, Masaki

    2018-06-01

    This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

  9. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  10. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

    2012-01-01

    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  11. Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

    PubMed Central

    Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

    2012-01-01

    Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

  12. Potential US Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

    PubMed

    Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

    2018-01-09

    The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among US adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9 623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce US population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among US adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of US adults, respectively. Nonpharmacological intervention is advised for the 9.4% of US adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among US adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of US adults recommended for antihypertensive medication, and more intensive BP lowering for many

  13. The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

    PubMed

    Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

    2008-05-01

    The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

  14. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  15. Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

    PubMed

    Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

    2017-02-01

    Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Influence of Magnesium Content on the Local Structure of Amorphous Calcium Carbonate (ACC): Real Time Determination by In Situ PDF Analysis

    NASA Astrophysics Data System (ADS)

    Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

    2016-12-01

    Calcium carbonate minerals are an essential component in the exoskeletons of crustaceans and mollusks. The onset of exoskeleton mineralization includes the precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that later transforms to produce diverse structures. Despite the importance of ACC as a critical phase during skeleton formation, the chemical and physical properties are not well characterized at conditions that approximate biological environments. Of particular interest are the solubility of ACC, the short-range structure at the time of formation, and the evolution of ACC structure to final products. Recent advances showing the widespread occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015) underline the importance of understanding amorphous intermediates. Using quantitative laboratory techniques developed by our research group (Blue et al., 2013; Blue and Dove, 2015; Blue et al., in press), this experimental study quantifies the solubility of ACC in parallel with the physical characterization of the corresponding structure. We measured ACC solubility at specific time points during the precipitation and during its subsequent evolution under the mild pH conditions that approximate biological and environmental conditions. In parallel experiments, structural data were collected from in situ pair distribution function (PDF) analyses were conducted to follow the evolution of individual samples from initial precipitation to final product. The measurements are leading to a quantitative solubility function for ACC with variable Mg contents and an x-ray based understanding of ACC structure in the same particles. We are also finding temporal changes in the short-range order of ACC after precipitation and this order is dependent upon Mg content. Moreover, the data show Mg distribution through the ACC particles is dependent upon total alkalinity. Insights from this study hold promise

  17. A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

    PubMed Central

    Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

    2017-01-01

    ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of

  18. Representation of cardiovascular magnetic resonance in the AHA / ACC guidelines.

    PubMed

    von Knobelsdorff-Brenkenhoff, Florian; Pilz, Guenter; Schulz-Menger, Jeanette

    2017-09-25

    Whereas evidence supporting the diagnostic value of cardiovascular magnetic resonance (CMR) has increased, there exists significant worldwide variability in the clinical utilization of CMR. A recent study demonstrated that CMR is represented in the majority of European Society for Cardiology (ESC) guidelines, with a large number of specific recommendations in particular regarding coronary artery disease. To further investigate the gap between the evidence and clinical use of CMR, this study analyzed the role of CMR in the guidelines of the American College of Cardiology (ACC) and American Heart Association (AHA). Twenty-four AHA/ACC original guidelines, updates and new editions, published between 2006 and 2017, were screened for the terms "magnetic", "MRI", "CMR", "MR" and "imaging". Non-cardiovascular MR examinations were excluded. All CMR-related paragraphs and specific recommendations for CMR including the level of evidence (A, B, C) and the class of recommendation (I, IIa, IIb, III) were extracted. Twelve of the 24 guidelines (50.0%) contain specific recommendations regarding CMR. Four guidelines (16.7%) mention CMR in the text only, and 8 (33.3%) do not mention CMR. The 12 guidelines with recommendations for CMR contain in total 65 specific recommendations (31 class-I, 23 class-IIa, 6 class-IIb, 5 class-III). Most recommendations have evidence level C (44/65; 67.7%), followed by level B (21/65; 32.3%). There are no level A recommendations. 22/65 recommendations refer to vascular imaging, 17 to congenital heart disease, 8 to cardiomyopathies, 8 to myocardial stress testing, 5 to left and right ventricular function, 3 to viability, and 2 to valvular heart disease. CMR is represented in two thirds of the AHA/ACC guidelines, which contain a number of specific recommendations for the use of CMR. In a simplified comparison with the ESC guidelines, CMR is less represented in the AHA/ACC guidelines in particular in the field of coronary artery disease.

  19. Ectopic expression of pumpkin gibberellin oxidases alters gibberellin biosynthesis and development of transgenic Arabidopsis plants.

    PubMed

    Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

    2006-02-01

    Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.

  20. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  1. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  2. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  3. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  4. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  5. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    PubMed

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  6. Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase gene expression in bees from two populations.

    PubMed

    Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto

    2018-04-01

    Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.

  7. The Role of Ethylene and Cold Temperature in the Regulation of the Apple POLYGALACTURONASE1 Gene and Fruit Softening1[W][OA

    PubMed Central

    Tacken, Emma; Ireland, Hilary; Gunaseelan, Kularajathevan; Karunairetnam, Sakuntala; Wang, Daisy; Schultz, Keith; Bowen, Judith; Atkinson, Ross G.; Johnston, Jason W.; Putterill, Jo; Hellens, Roger P.; Schaffer, Robert J.

    2010-01-01

    Fruit softening in apple (Malus × domestica) is associated with an increase in the ripening hormone ethylene. Here, we show that in cv Royal Gala apples that have the ethylene biosynthetic gene ACC OXIDASE1 suppressed, a cold treatment preconditions the apples to soften independently of added ethylene. When a cold treatment is followed by an ethylene treatment, a more rapid softening occurs than in apples that have not had a cold treatment. Apple fruit softening has been associated with the increase in the expression of cell wall hydrolase genes. One such gene, POLYGALACTURONASE1 (PG1), increases in expression both with ethylene and following a cold treatment. Transcriptional regulation of PG1 through the ethylene pathway is likely to be through an ETHYLENE-INSENSITIVE3-like transcription factor, which increases in expression during apple fruit development and transactivates the PG1 promoter in transient assays in the presence of ethylene. A cold-related gene that resembles a COLD BINDING FACTOR (CBF) class of gene also transactivates the PG1 promoter. The transactivation by the CBF-like gene is greatly enhanced by the addition of exogenous ethylene. These observations give a possible molecular mechanism for the cold- and ethylene-regulated control of fruit softening and suggest that either these two pathways act independently and synergistically with each other or cold enhances the ethylene response such that background levels of ethylene in the ethylene-suppressed apples is sufficient to induce fruit softening in apples. PMID:20237022

  8. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

    PubMed

    Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

    2009-09-01

    Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

  9. Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus

    PubMed Central

    Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric

    2016-01-01

    ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these

  10. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

    PubMed

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

    2006-11-01

    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

  11. ACCE/ACS National Educator and Leader of the Year Winners: AEC Congratulates These Outstanding Educators

    ERIC Educational Resources Information Center

    Australian Educational Computing, 2012

    2012-01-01

    This article presents the ACCE/ACS National Educator and Leader of the Year winners. Anne Mirtschin is the recipient of the ACCE/ACS 2012 Educator of the Year Award. Mirtschin is an innovative teacher at Hawkesdale P-12 College a small rural school that is isolated culturally and geographically. She uses online tools and technology to create…

  12. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

  13. A glutathione S-transferase gene associated with antioxidant properties isolated from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Liu, Shuchang; Liu, Feng; Jia, Haihong; Yan, Yan; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-06-01

    Glutathione S-transferases (GSTs) are an important family of multifunctional enzymes in aerobic organisms. They play a crucial role in the detoxification of exogenous compounds, especially insecticides, and protection against oxidative stress. Most previous studies of GSTs in insects have largely focused on their role in insecticide resistance. Here, we isolated a theta class GST gene designated AccGSTT1 from Apis cerana cerana and aimed to explore its antioxidant and antibacterial attributes. Analyses of homology and phylogenetic relationships suggested that the predicted amino acid sequence of AccGSTT1 shares a high level of identity with the other hymenopteran GSTs and that it was conserved during evolution. Quantitative real-time PCR showed that AccGSTT1 is most highly expressed in adult stages and that the expression profile of this gene is significantly altered in response to various abiotic stresses. These results were confirmed using western blot analysis. Additionally, a disc diffusion assay showed that a recombinant AccGSTT1 protein may be roughly capable of inhibiting bacterial growth and that it reduces the resistance of Escherichia coli cells to multiple adverse stresses. Taken together, these data indicate that AccGSTT1 may play an important role in antioxidant processes under adverse stress conditions.

  14. Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection

    PubMed Central

    Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin

    2017-01-01

    The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330

  15. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    PubMed

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  16. Development of an EMG-ACC-Based Upper Limb Rehabilitation Training System.

    PubMed

    Ling Liu; Xiang Chen; Zhiyuan Lu; Shuai Cao; De Wu; Xu Zhang

    2017-03-01

    This paper focuses on the development of an upper limb rehabilitation training system designed for use by children with cerebral palsy (CP). It attempts to meet the requirements of in-home training by taking advantage of the combination of portable accelerometers (ACC) and surface electromyography (SEMG) sensors worn on the upper limb to capture functional movements. In the proposed system, the EMG-ACC acquisition device works essentially as wireless game controller, and three rehabilitation games were designed for improving upper limb motor function under a clinician's guidance. The games were developed on the Android platform based on a physical engine called Box2D. The results of a system performance test demonstrated that the developed games can respond to the upper limb actions within 210 ms. Positive questionnaire feedbacks from twenty CP subjects who participated in the game test verified both the feasibility and usability of the system. Results of a long-term game training conducted with three CP subjects demonstrated that CP patients could improve in their game performance through repetitive training, and persistent training was needed to improve and enhance the rehabilitation effect. According to our experimental results, the novel multi-feedback SEMG-ACC-based user interface improved the users' initiative and performance in rehabilitation training.

  17. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Treesearch

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  18. New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

    PubMed

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-03-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

  19. SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

    PubMed Central

    Hirsch, James G.

    1953-01-01

    Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805

  20. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    USDA-ARS?s Scientific Manuscript database

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  1. Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

    PubMed Central

    Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

    2013-01-01

    The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

  2. Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

    PubMed

    Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

    2015-01-01

    Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other

  3. Expression of MdCAS1 and MdCAS2, encoding apple beta-cyanoalanine synthase homologs, is concomitantly induced during ripening and implicates MdCASs in the possible role of the cyanide detoxification in Fuji apple (Malus domestica Borkh.) fruits.

    PubMed

    Han, Sang Eun; Seo, Young Sam; Kim, Daeil; Sung, Soon-Kee; Kim, Woo Taek

    2007-08-01

    Fruit ripening involves complex biochemical and physiological changes. Ethylene is an essential hormone for the ripening of climacteric fruits. In the process of ethylene biosynthesis, cyanide (HCN), an extremely toxic compound, is produced as a co-product. Thus, most cyanide produced during fruit ripening should be detoxified rapidly by fruit cells. In higher plants, the key enzyme involved in the detoxification of HCN is beta-cyanoalanine synthase (beta-CAS). As little is known about the molecular function of beta-CAS genes in climacteric fruits, we identified two homologous genes, MdCAS1 and MdCAS2, encoding Fuji apple beta-CAS homologs. The structural features of the predicted polypeptides as well as an in vitro enzyme activity assay with bacterially expressed recombinant proteins indicated that MdCAS1 and MdCAS2 may indeed function as beta-CAS isozymes in apple fruits. RNA gel-blot studies revealed that both MdCAS1 and MdCAS2 mRNAs were coordinately induced during the ripening process of apple fruits in an expression pattern comparable with that of ACC oxidase and ethylene production. The MdCAS genes were also activated effectively by exogenous ethylene treatment and mechanical wounding. Thus, it seems like that, in ripening apple fruits, expression of MdCAS1 and MdCAS2 genes is intimately correlated with a climacteric ethylene production and ACC oxidase activity. In addition, beta-CAS enzyme activity was also enhanced as the fruit ripened, although this increase was not as dramatic as the mRNA induction pattern. Overall, these results suggest that MdCAS may play a role in cyanide detoxification in ripening apple fruits.

  4. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

    PubMed

    Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

    2007-06-01

    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.

  5. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

    PubMed Central

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-01-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

  6. Establishing the solubility and local structure(s) of Amorphous Calcium Carbonate (ACC): Toward an understanding of invertebrate biomineralization

    NASA Astrophysics Data System (ADS)

    Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

    2017-12-01

    Recent advances in high-resolution imaging show the widespreadd occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015, Science). For example, carbonate biomineralization often involves precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that subsequently transforms to crystalline products with diverse structures. Although current carbonate mineral proxies are based upon the composition of final crystalline products, the final signatures may be recording the properties of the initial amorphous phase. Thus, it is critical to establish the physical properties of ACC and understand the factors that influence its evolution to final products at conditions that approximate biological environments. This disconnect limits our ability to build a process-based understanding of when/how minor and trace elements are recorded in mineral composition proxies. In this experimental study, we quantified the chemical and physical properties of ACC and its evolution to final products. We first determined ACC solubility under controlled chemical conditions using a new type of flow-through reactor developed by our research group (Blue and Dove, 2015, GCA; Blue et al., 2017, GCA). The experimental design varied Mg concentration and total alkalinity while maintaining a mild pH that approximates biological environments. ACC solubility was measured at specific time points during the precipitation (from super- and undersaturated conditions) and during its subsequent evolution. Parallel experiments characterized the structure of the corresponding amorphous products using in situ pair distribution function (PDF) and small-angle x-ray scattering (SAXS) analyses. The measurements demonstrate at least two types of ACC can be produced by tuning Mg concentration and alkalinity. Each "phase" exhibits distinct short-range ordering that demonstrates structure-specific solubility. We also find temporal changes in the

  7. Genetic analysis of the agrocinopine catabolic region of Agrobacterium tumefaciens Ti plasmid pTiC58, which encodes genes required for opine and agrocin 84 transport.

    PubMed Central

    Hayman, G T; Beck von Bodman, S; Kim, H; Jiang, P; Farrand, S K

    1993-01-01

    The acc region, subcloned from pTiC58 of classical nopaline and agrocinopine A and B Agrobacterium tumefaciens C58, allowed agrobacteria to grow using agrocinopine B as the sole source of carbon and energy. acc is approximately 6 kb in size. It consists of at least five genes, accA through accE, as defined by complementation analysis using subcloned fragments and transposon insertion mutations of acc carried on different plasmids within the same cell. All five regions are required for agrocin 84 sensitivity, and at least four are required for agrocinopine and agrocin 84 uptake. The complementation results are consistent with the hypothesis that each of the five regions is separately transcribed. Maxicell experiments showed that the first of these genes, accA, encodes a 60-kDa protein. Analysis of osmotic shock fractions showed this protein to be located in the periplasm. The DNA sequence of the accA region revealed an open reading frame encoding a predicted polypeptide of 59,147 Da. The amino acid sequence encoded by this open reading frame is similar to the periplasmic binding proteins OppA and DppA of Escherichia coli and Salmonella typhimurium and OppA of Bacillus subtilis. Images PMID:8366042

  8. Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

    DTIC Science & Technology

    2013-10-01

    Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal

  9. ETHY. A theory of fruit climacteric ethylene emission.

    PubMed

    Génard, Michel; Gouble, Barbara

    2005-09-01

    A theory of fruit climacteric ethylene emission was developed and used as the basis of a simulation model called ETHY. According to the theory, the biosynthetic pathway of ethylene is supplied by ATP and is regulated by 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase. The conjugation of ACC with malonate to form MACC was taken into account as a way to decrease the availability of ACC. Because of the seasonal increase of fruit volume, the dilution of biochemical compounds used in ETHY was taken into account. Finally, the ethylene diffusion across the skin was considered. The theory took into account the effect of temperature and O(2) and CO(2) internal concentrations on ethylene. The model was applied to peach (Prunus persica) fruit over 3 years, several leaf:fruit ratios, and irrigation conditions. An adequate ethylene increase was predicted without considering any increase in respiration during the ripening period, which suggests that the respiratory climacteric may not be required for ripening. Another important result of this study is the high sensitivity of ETHY to the parameters involved in the calculation of ACC oxidase and ACC synthase activities, ATP production, and skin surface and permeability. ETHY was also highly sensitive to changes in fruit growth and temperature.

  10. ETHY. A Theory of Fruit Climacteric Ethylene Emission1

    PubMed Central

    Génard, Michel; Gouble, Barbara

    2005-01-01

    A theory of fruit climacteric ethylene emission was developed and used as the basis of a simulation model called ETHY. According to the theory, the biosynthetic pathway of ethylene is supplied by ATP and is regulated by 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase. The conjugation of ACC with malonate to form MACC was taken into account as a way to decrease the availability of ACC. Because of the seasonal increase of fruit volume, the dilution of biochemical compounds used in ETHY was taken into account. Finally, the ethylene diffusion across the skin was considered. The theory took into account the effect of temperature and O2 and CO2 internal concentrations on ethylene. The model was applied to peach (Prunus persica) fruit over 3 years, several leaf:fruit ratios, and irrigation conditions. An adequate ethylene increase was predicted without considering any increase in respiration during the ripening period, which suggests that the respiratory climacteric may not be required for ripening. Another important result of this study is the high sensitivity of ETHY to the parameters involved in the calculation of ACC oxidase and ACC synthase activities, ATP production, and skin surface and permeability. ETHY was also highly sensitive to changes in fruit growth and temperature. PMID:16143642

  11. Portable multi-node LQCD Monte Carlo simulations using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Calore, Enrico; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Sanfilippo, Francesco; Schifano, Sebastiano Fabio; Silvi, Giorgio; Tripiccione, Raffaele

    This paper describes a state-of-the-art parallel Lattice QCD Monte Carlo code for staggered fermions, purposely designed to be portable across different computer architectures, including GPUs and commodity CPUs. Portability is achieved using the OpenACC parallel programming model, used to develop a code that can be compiled for several processor architectures. The paper focuses on parallelization on multiple computing nodes using OpenACC to manage parallelism within the node, and OpenMPI to manage parallelism among the nodes. We first discuss the available strategies to be adopted to maximize performances, we then describe selected relevant details of the code, and finally measure the level of performance and scaling-performance that we are able to achieve. The work focuses mainly on GPUs, which offer a significantly high level of performances for this application, but also compares with results measured on other processors.

  12. Effects of losartan on hepatic expression of nonphagocytic NADPH oxidase and fibrogenic genes in patients with chronic hepatitis C.

    PubMed

    Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere

    2009-10-01

    Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.

  13. Report of the Annual Scientific Session of the American College of Cardiology (ACC) 2018, Orlando.

    PubMed

    Hashimoto, Takuya; Ako, Junya

    2018-04-28

    The 67 th Annual Scientific Session and Expo of the American College of Cardiology (ACC) were held at the Orange County Convention Center, Orlando, from March 10-12, 2018. This meeting offered 2,700 accepted abstracts presented in oral and poster sessions by 2,100 experts and 37 Late-Breaking Clinical Trials and Featured Clinical Research presentations. This report introduces the key presentations and highlights from the ACC 2018 Scientific Session.

  14. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  15. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

    PubMed

    Sytykiewicz, Hubert

    2016-07-22

    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Congenital hypothyroidism, dwarfism, and hearing impairment caused by a missense mutation in the mouse dual oxidase 2 gene, Duox2.

    PubMed

    Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae

    2007-07-01

    Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.

  17. New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

    PubMed Central

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-01-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

  18. Red light regulation of ethylene biosynthesis and gravitropism in etiolated pea stems

    NASA Technical Reports Server (NTRS)

    Steed, C. L.; Taylor, L. K.; Harrison, M. A.

    2004-01-01

    During gravitropism, the accumulation of auxin in the lower side of the stem causes increased growth and the subsequent curvature, while the gaseous hormone ethylene plays a modulating role in regulating the kinetics of growth asymmetries. Light also contributes to the control of gravitropic curvature, potentially through its interaction with ethylene biosynthesis. In this study, red-light pulse treatment of etiolated pea epicotyls was evaluated for its effect on ethylene biosynthesis during gravitropic curvature. Ethylene biosynthesis analysis included measurements of ethylene; the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC); malonyl-conjugated ACC (MACC); and expression levels of pea ACC oxidase (Ps-ACO1) and ACC synthase (Ps-ACS1, Ps-ACS2) genes by reverse transcriptase-polymerase chain reaction analysis. Red-pulsed seedlings were given a 6 min pulse of 11 micromoles m-2 s-1 red-light 15 h prior to horizontal reorientation for consistency with the timeline of red-light inhibition of ethylene production. Red-pulse treatment significantly reduced ethylene production and MACC levels in epicotyl tissue. However, there was no effect of red-pulse treatment on ACC level, or expression of ACS or ACO genes. During gravitropic curvature, ethylene production increased from 60 to 120 min after horizontal placement in both control and red-pulsed epicotyls. In red-pulsed tissues, ACC levels increased by 120 min after horizontal reorientation, accompanied by decreased MACC levels in the lower portion of the epicotyl. Overall, our results demonstrate that ethylene production in etiolated epicotyls increases after the initiation of curvature. This ethylene increase may inhibit cell growth in the lower portion of the epicotyl and contribute to tip straightening and reduced overall curvature observed after the initial 60 min of curvature in etiolated pea epicotyls.

  19. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

    2012-08-15

    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

  20. Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

    PubMed

    Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

    2014-01-01

    Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

  1. The ACCE 2012 Study Tour: Reflections on Reoccurring Themes

    ERIC Educational Resources Information Center

    Clements, Di; Grover, David; Grover, Pam; Hearne, Dominic; Knipe, Steven; Martin, Kim; Pazzi, Georgina; Pollard, Edward; Prestridge, Sarah

    2012-01-01

    Transformational leadership is essential in education as it empowers educators to make positive changes to the way they think, feel and act in improving learning for all. Reflection is a vital element of leading the change process. In relation to participating in the ACCE study tour experience, reflection allows one to sit and think about the…

  2. Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†

    PubMed Central

    Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie

    1999-01-01

    Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149

  3. Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

    PubMed Central

    Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

    2006-01-01

    Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

  4. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  5. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  6. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Treesearch

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  7. Population impact of the 2017 ACC/AHA guidelines compared with the 2013 ESH/ESC guidelines for hypertension management.

    PubMed

    Vaucher, Julien; Marques-Vidal, Pedro; Waeber, Gérard; Vollenweider, Peter

    2018-01-01

    Background The 2017 ACC/AHA guidelines on hypertension management recommend the introduction of antihypertensive treatment for patients with new stage 1 hypertension thresholds (130-139/80-89 mm Hg) and with a cardiovascular disease or related condition. We compared the Swiss population and economic impact of antihypertensive treatment of the 2017 ACC/AHA guidelines with the 2013 European guidelines. Methods Analyses were based on 4438 participants (aged 45-85 years; 2448 women) of the CoLaus|PsyCoLaus study recruited between 2014-2017. Participants eligible for antihypertensive treatment according to the 2017 ACC/AHA and 2013 European guidelines were sex and age standardised using the Swiss population for 2016. In addition, we estimated the population-wide annual costs of antihypertensive treatment. Results Individuals eligible for antihypertensive treatment were 40.3% (95% confidence interval 38.5-42.1) and 31.3% (29.7-32.9) according to the 2017 ACC/AHA and 2013 European guidelines, respectively. That difference would translate into approximately 250,000 additional individuals eligible for antihypertensive treatment, corresponding to an additional annual cost of 72.5 million CHF (63.0 million EUR). Conclusion The 2017 ACC/AHA guidelines on the management of hypertension substantially increase the number of individuals eligible for antihypertensive treatment compared to the 2013 European guidelines. While implementation of the 2017 ACC/AHA guidelines is expected to lead to cost reduction by preventing cardiovascular diseases, that reduction might be mitigated by the costs incurred by antihypertensive treatments in a larger proportion of the population.

  8. Haplotypes of the IL10 Gene as Potential Protection Factors in Leprosy Patients

    PubMed Central

    Garcia, Patricia; Alencar, Dayse; Pinto, Pablo; Santos, Ney; Salgado, Claudio; Sortica, Vinicius A.; Hutz, Mara H.; Santos, Sidney

    2013-01-01

    Leprosy is an infectious disease caused by Mycobacterium leprae characterized by dermatoneurological signs and symptoms that has a large number of new cases worldwide. Several studies have associated interleukin 10 with susceptibility/resistance to several diseases. We investigated haplotypes formed by three single nucleotide polymorphisms (SNPs) located in the IL10 gene (A-1082G, C-819T, and C-592A) in order to better understand the susceptibility to and severity of leprosy in an admixed northern Brazil population, taking into account estimates of interethnic admixture. We observed the genotypes ACC/ACC (P = 0.021, odds ratio [OR] [95% confidence interval (CI)] = 0.290 [0.085 to 0823]) and ACC/GCC (P = 0.003, OR [95% CI] = 0.220 [0.504 to 0.040]) presenting significant results for protection against leprosy development, framed in the profiles of low and medium interleukin production, respectively. Therefore, we suggest that genotypes A-1082G, C-819T, and C-592A formed by interleukin-10 polymorphisms are closely related to protection of the leprosy development in an admixed northern Brazil population, in particular ACC/ACC and ACC/GCC genotypes. PMID:23966553

  9. Increased statin eligibility based on ACC/AHA versus NCEP guidelines for high cholesterol management in Chile.

    PubMed

    Echeverría, Guadalupe; Dussaillant, Catalina; Villarroel, Luis; Rigotti, Attilio

    2016-01-01

    In 2013, the American College of Cardiology and the American Heart Association (ACC/AHA) jointly released new guidelines for cardiovascular risk assessment and cholesterol management that substantially modified the previous recommendations proposed by the National Cholesterol Education Program (NCEP) in 2001. The relative impact of these new guidelines on potential statin use has not been estimated in Latin American populations. To estimate and compare eligibility for statin therapy based on ACC/AHA and NCEP guidelines in adult Chilean population. Using data from the last National Health Survey (2009-2010 NHS), we conducted a cross-sectional analysis in a ​representative sample of the Chilean adult population and calculated the proportion of individuals that would receive statins under each set of guidelines. According to ACC/AHA guidelines, the population eligible for statin treatment increased from 21.7% (NCEP guidelines) to 33.2% (overall 53% increase). This effect was more pronounced among women (29.6% under ACC/AHA vs 15.6% under NCEP) and with those of advanced age (75% of the subjects >60 years of age compared with 46% under NCEP). The newly eligible group included more women and older subjects and individuals with lower LDL cholesterol levels. Compared with NCEP recommendations, the new ACC/AHA guidelines significantly increased the number of Chilean adults eligible for statin therapy. Full implementation of the new recommendations may have important public health implications in Chile and other Latin American countries, as more women and older subjects without cardiovascular disease would qualify for statin treatment. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  10. [Study on garlic oil combined with 5-FU induced apoptosis of adenoid cystic carcinoma cell line ACC-M].

    PubMed

    Wu, Fayin; Zhou, Hefeng; Fan, Zhiying; Zhu, Yawen; Li, Yongye; Yao, Yukun; Ran, Dan

    2014-02-01

    To observe the effect of garlic oil combined with 5-FU induced apoptosis of adenoid cystic carcinoma cell line ACC-M. Human salivary in adenoid cystic carcinoma cell line AC-M was cultured, divided into the experimental group (5-FU group, garlic oil group, garlic oil + 5-FU group) and the control group, to observe the growth activity of tumor cells by MTT methods; to analyse the changes of cell cycle and apoptosis rate by flow cytometry. MTT experiments showed that 5-FU, garlic oil, garlic oil and 5-FU on ACC-M cells have inhibition in different concentration, with the increase of concentration and action time of the rise; Cell cycle analysis showed significant changes in flow cytometry. With the increase of concentration and the acting time, the G0/G1, phase of the cell ratio increased, S had no significant change, but G2/M phase cells decreased. Apoptosis rate display showed garlic oil combined with 5-FU induced apoptosis of ACC-M cells was significantly stronger than single group. Garlic oil can effectively induce the apoptosis of adenoid cystic carcinoma cell line ACC-M. The effect of garlic oil combined with 5-FU on ACC-M cells was stronger than the garlic oil, 5-FU used alone.

  11. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  12. ACC deaminase and IAA producing growth promoting bacteria from the rhizosphere soil of tropical rice plants.

    PubMed

    Bal, Himadri Bhusan; Das, Subhasis; Dangar, Tushar K; Adhya, Tapan K

    2013-12-01

    Beneficial plant-associated bacteria play a key role in supporting and/or promoting plant growth and health. Plant growth promoting bacteria present in the rhizosphere of crop plants can directly affect plant metabolism or modulate phytohormone production or degradation. We isolated 355 bacteria from the rhizosphere of rice plants grown in the farmers' fields in the coastal rice field soil from five different locations of the Ganjam district of Odisha, India. Six bacteria producing both ACC deaminase (ranging from 603.94 to 1350.02 nmol α-ketobutyrate mg(-1)  h(-1) ) and indole acetic acid (IAA; ranging from 10.54 to 37.65 μM ml(-1) ) in pure cultures were further identified using polyphasic taxonomy including BIOLOG((R)) , FAME analysis and the 16S rRNA gene sequencing. Phylogenetic analyses of the isolates resulted into five major clusters to include members of the genera Bacillus, Microbacterium, Methylophaga, Agromyces, and Paenibacillus. Seed inoculation of rice (cv. Naveen) by the six individual PGPR isolates had a considerable impact on different growth parameters including root elongation that was positively correlated with ACC deaminase activity and IAA production. The cultures also had other plant growth attributes including ammonia production and at least two isolates produced siderophores. Study indicates that presence of diverse rhizobacteria with effective growth-promoting traits, in the rice rhizosphere, may be exploited for a sustainable crop management under field conditions. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*

    PubMed Central

    Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

    2014-01-01

    Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

  14. Discovery and identification of candidate genes from the chitinase gene family for Verticillium dahliae resistance in cotton

    PubMed Central

    Xu, Jun; Xu, Xiaoyang; Tian, Liangliang; Wang, Guilin; Zhang, Xueying; Wang, Xinyu; Guo, Wangzhen

    2016-01-01

    Verticillium dahliae, a destructive and soil-borne fungal pathogen, causes massive losses in cotton yields. However, the resistance mechanism to V. dahilae in cotton is still poorly understood. Accumulating evidence indicates that chitinases are crucial hydrolytic enzymes, which attack fungal pathogens by catalyzing the fungal cell wall degradation. As a large gene family, to date, the chitinase genes (Chis) have not been systematically analyzed and effectively utilized in cotton. Here, we identified 47, 49, 92, and 116 Chis from four sequenced cotton species, diploid Gossypium raimondii (D5), G. arboreum (A2), tetraploid G. hirsutum acc. TM-1 (AD1), and G. barbadense acc. 3–79 (AD2), respectively. The orthologous genes were not one-to-one correspondence in the diploid and tetraploid cotton species, implying changes in the number of Chis in different cotton species during the evolution of Gossypium. Phylogenetic classification indicated that these Chis could be classified into six groups, with distinguishable structural characteristics. The expression patterns of Chis indicated their various expressions in different organs and tissues, and in the V. dahliae response. Silencing of Chi23, Chi32, or Chi47 in cotton significantly impaired the resistance to V. dahliae, suggesting these genes might act as positive regulators in disease resistance to V. dahliae. PMID:27354165

  15. Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Liao, Yalin

    2017-12-01

    Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

  16. Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.

    PubMed

    Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T

    2001-06-29

    Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.

  17. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  18. Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior.

    PubMed

    Bergauer, Kristin; Sintes, Eva; van Bleijswijk, Judith; Witte, Harry; Herndl, Gerhard J

    2013-06-01

    Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (accA subunit), a key enzyme powering inter alia the 3-hydroxypropionate/4-hydroxybutyrate cycle (HP/HB) and the archaeal ammonia monooxygenase (amoA). Quantification of accA-like genes revealed a consistent depth profile in the upper mesopelagial with increasing gene abundances from subsurface layers towards the oxygen minimum zone (OMZ), coinciding with an increase in archaeal amoA gene abundance. Gene abundance profiles of metabolic marker genes (accA, amoA) were correlated with thaumarchaeal 16S rRNA gene abundances as well as CO2 fixation rates to link the genetic potential to actual rate measurements. AccA gene abundances correlated with archaeal amoA gene abundance throughout the water column (r(2)  = 0.309, P < 0.0001). Overall, a substantial genetic predisposition of CO2 fixation was present in the dark realm of the tropical Atlantic in both Archaea and Bacteria. Hence, dark ocean CO2 fixation might be more widespread among prokaryotes inhabiting the oxygenated water column of the ocean's interior than hitherto assumed. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  19. Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

    PubMed

    Hinkkanen, A; Maly, F E; Decker, K

    1983-04-01

    The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

  20. Identification of seven polyamine oxidase genes in tomato (Solanum lycopersicum L.) and their expression profiles under physiological and various stress conditions.

    PubMed

    Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo

    2018-05-15

    Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.

  1. Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay

    PubMed Central

    He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry

    2011-01-01

    Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

  2. Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

    PubMed

    Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

    2013-09-10

    Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans

    PubMed Central

    Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

    2014-01-01

    Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

  4. Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.

    PubMed

    Lee, J; Hofhaus, G; Lisowsky, T

    2000-07-14

    The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.

  5. Transport of sup 14 C-IAA and sup 14 C-ACC within floral organs of Ipomoea nil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiss, H.G.; Maurice, H.R.; Koning, R.E.

    1989-04-01

    The transport of {sup 14}C-IAA {sup 14}C-ACC from agarose donor blocks applied to I. nil filaments their recovery as {sup 14}C-accumulation into floral organs was examined. The accumulation of the isotopes in the corolla tissue was greater when {sup 14}C-ACC was applied than {sup 14}C-IAA in intact isolated flower buds. Greater levels of the isotopes accumulated in the pistil, with minimal levels in receptacle and calyx tissues from isolated buds. With intact buds, greater levels of the isotopes were recovered in pistil, calyx receptacle tissues. This study provides further evidence for the role of the filaments as transport vectors formore » IAA ACC for the production of ethylene.« less

  6. Cytochrome oxidase assembly does not require catalytically active cytochrome C.

    PubMed

    Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

    2003-03-14

    Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

  7. Health Literacy: Readability of ACC/AHA Online Patient Education Material.

    PubMed

    Kapoor, Karan; George, Praveen; Evans, Matthew C; Miller, Weldon J; Liu, Stanley S

    To determine whether the online patient education material offered by the American College of Cardiology (ACC) and the American Heart Association (AHA) is written at a higher level than the 6th-7th grade level recommended by the National Institute of Health (NIH). Online patient education material from each website was subjected to reading grade level (RGL) analysis using the Readability Studio Professional Edition. One-sample t testing was used to compare the mean RGLs obtained from 8 formulas to the NIH-recommended 6.5 grade level and 8th grade national mean. In total, 372 articles from the ACC website and 82 from the AHA were studied. Mean (±SD) RGLs for the 454 articles were 9.6 ± 2.1, 11.2 ± 2.1, 11.9 ± 1.6, 10.8 ± 1.6, 9.7 ± 2.1, 10.8 ± 0.8, 10.5 ± 2.6, and 11.7 ± 3.5 according to the Flesch-Kincaid grade level (FKGL), Simple Measure of Gobbledygook (SMOG Index), Coleman-Liau Index (CLI), Gunning-Fog Index (GFI), New Dale-Chall reading level formula (NDC), FORCAST, Raygor Readability Estimate (RRE), and Fry Graph (Fry), respectively. All analyzed articles had significantly higher RGLs than both the NIH-recommended grade level of 6.5 and the national mean grade level of 8 (p < 0.00625). Patient education material provided on the ACC and AHA websites is written above the NIH-recommended 6.5 grade level and 8th grade national mean reading level. Additional studies are required to demonstrate whether lowering the RGL of this material improves outcomes among patients with cardiovascular disease. © 2017 S. Karger AG, Basel.

  8. Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants

    PubMed Central

    Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

    1980-01-01

    Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

  9. Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

    PubMed Central

    Lermontova, Inna; Grimm, Bernhard

    2000-01-01

    The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

  10. Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

    PubMed

    Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

    2008-10-05

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

  11. Deficiency of Rac1 Blocks NADPH Oxidase Activation, Inhibits Endoplasmic Reticulum Stress, and Reduces Myocardial Remodeling in a Mouse Model of Type 1 Diabetes

    PubMed Central

    Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing

    2010-01-01

    OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592

  12. Development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS): An observation-based tool for assessing cognitive behavioral therapy competence.

    PubMed

    Muse, Kate; McManus, Freda; Rakovshik, Sarah; Thwaites, Richard

    2017-05-01

    This article outlines the development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS) rating scale. The ACCS aims to provide a novel assessment framework to deliver formative and summative feedback regarding therapists' performance within observed cognitive-behavioral treatment sessions, and for therapists to rate and reflect on their own performance. Findings from 3 studies are outlined: (a) a feedback study (n = 66) examining content validity, face validity and usability; (b) a focus group (n = 9) evaluating usability and utility; and (c) an evaluation of the psychometric properties of the ACCS in real world cognitive behavioral therapy (CBT) training and routine clinical practice contexts. Results suggest that the ACCS has good face validity, content validity, and usability and provides a user-friendly tool that is useful for promoting self-reflection and providing formative feedback. Scores on both the self and assessor-rated versions of the ACCS demonstrate good internal consistency, interrater reliability, and discriminant validity. In addition, ACCS scores were found to be correlated with, but distinct from, the Revised Cognitive Therapy Scale (CTS-R) and were comparable to CTS-R scores in terms of internal consistency and discriminant validity. In addition, the ACCS may have advantages over the CTS-R in terms of interrater reliability of scores. The studies also provided insight into areas for refinement and a number of modifications were undertaken to improve the scale. In summary, the ACCS is an appropriate and useful measure of CBT competence that can be used to promote self-reflection and provide therapists with formative and summative feedback. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  13. Waste management facility accident analysis (WASTE ACC) system: software for analysis of waste management alternatives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kohout, E.F.; Folga, S.; Mueller, C.

    1996-03-01

    This paper describes the Waste Management Facility Accident Analysis (WASTE{underscore}ACC) software, which was developed at Argonne National Laboratory (ANL) to support the US Department of Energy`s (DOE`s) Waste Management (WM) Programmatic Environmental Impact Statement (PEIS). WASTE{underscore}ACC is a decision support and database system that is compatible with Microsoft{reg_sign} Windows{trademark}. It assesses potential atmospheric releases from accidents at waste management facilities. The software provides the user with an easy-to-use tool to determine the risk-dominant accident sequences for the many possible combinations of process technologies, waste and facility types, and alternative cases described in the WM PEIS. In addition, its structure willmore » allow additional alternative cases and assumptions to be tested as part of the future DOE programmatic decision-making process. The WASTE{underscore}ACC system demonstrates one approach to performing a generic, systemwide evaluation of accident risks at waste management facilities. The advantages of WASTE{underscore}ACC are threefold. First, the software gets waste volume and radiological profile data that were used to perform other WM PEIS-related analyses directly from the WASTE{underscore}MGMT system. Second, the system allows for a consistent analysis across all sites and waste streams, which enables decision makers to understand more fully the trade-offs among various policy options and scenarios. Third, the system is easy to operate; even complex scenario runs are completed within minutes.« less

  14. Polymorphisms in the canine monoamine oxidase a (MAOA) gene: identification and variation among five broad dog breed groups.

    PubMed

    Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael

    2017-01-01

    In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.

  15. A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

    PubMed Central

    Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

    2013-01-01

    Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID

  16. Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.

    PubMed Central

    Okamura, H; Murooka, Y; Harada, T

    1976-01-01

    Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974

  17. Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells

    PubMed Central

    Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.

    2017-01-01

    Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230

  18. [The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

    PubMed

    Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

    2009-01-01

    Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

  19. A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

    PubMed

    Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

    2015-01-01

    The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.

  20. Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

    PubMed

    Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

    2012-12-01

    Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

  1. The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

    PubMed Central

    Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

    2001-01-01

    We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

  2. NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

    PubMed

    dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

    2007-02-01

    Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

  3. NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.

    PubMed

    Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J

    2015-01-01

    Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.

  4. The ability of the 2013 ACC/AHA cardiovascular risk score to identify rheumatoid arthritis patients with high coronary artery calcification scores

    PubMed Central

    Kawai, Vivian K.; Chung, Cecilia P.; Solus, Joseph F.; Oeser, Annette; Raggi, Paolo; Stein, C. Michael

    2014-01-01

    Objective Patients with rheumatoid arthritis (RA) have increased risk of atherosclerotic cardiovascular disease (ASCVD) that is underestimated by the Framingham risk score (FRS). We hypothesized that the 2013 ACC/AHA 10-year risk score would perform better than the FRS and the Reynolds risk score (RRS) in identifying RA patients known to have elevated cardiovascular risk based on high coronary artery calcification (CAC) scores. Methods Among 98 RA patients eligible for risk stratification using the ACC/AHA score we identified 34 patients with high CAC (≥ 300 Agatston units or ≥75th percentile) and compared the ability of the 10-year FRS, RRS and the ACC/AHA risk scores to correctly assign these patients to an elevated risk category. Results All three risk scores were higher in patients with high CAC (P values <0.05). The percentage of patients with high CAC correctly assigned to the elevated risk category was similar among the three scores (FRS 32%, RRS 32%, ACC/AHA 41%) (P=0.233). The c-statistics for the FRS, RRS and ACC/AHA risk scores predicting the presence of high CAC were 0.65, 0.66, and 0.65, respectively. Conclusions The ACC/AHA 10-year risk score does not offer any advantage compared to the traditional FRS and RRS in the identification of RA patients with elevated risk as determined by high CAC. The ACC/AHA risk score assigned almost 60% of patients with high CAC into a low risk category. Risk scores and standard risk prediction models used in the general population do not adequately identify many RA patients with elevated cardiovascular risk. PMID:25371313

  5. Inhibition of arsenic induced-rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-{beta}/Smad activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan Xinjuan; Dai Yujie; Li Xing

    2011-08-01

    Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines

  6. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

    2016-01-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

  7. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

    PubMed

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-05-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

  8. NADPH oxidases of the brain: distribution, regulation, and function.

    PubMed

    Infanger, David W; Sharma, Ram V; Davisson, Robin L

    2006-01-01

    The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.

  9. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  10. Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

    PubMed Central

    Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

    2017-01-01

    Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

  11. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  12. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  13. Adolescents with current major depressive disorder show dissimilar patterns of age-related differences in ACC and thalamus

    PubMed Central

    Hagan, Cindy C.; Graham, Julia M.E.; Tait, Roger; Widmer, Barry; van Nieuwenhuizen, Adrienne O.; Ooi, Cinly; Whitaker, Kirstie J.; Simas, Tiago; Bullmore, Edward T.; Lennox, Belinda R.; Sahakian, Barbara J.; Goodyer, Ian M.; Suckling, John

    2015-01-01

    Objective There is little understanding of the neural system abnormalities subserving adolescent major depressive disorder (MDD). In a cross-sectional study we compare currently unipolar depressed with healthy adolescents to determine if group differences in grey matter volume (GMV) were influenced by age and illness severity. Method Structural neuroimaging was performed on 109 adolescents with current MDD and 36 healthy controls, matched for age, gender, and handedness. GMV differences were examined within the anterior cingulate cortex (ACC) and across the whole-brain. The effects of age and self-reported depressive symptoms were also examined in regions showing significant main or interaction effects. Results Whole-brain voxel based morphometry revealed no significant group differences. At the whole-brain level, both groups showed a main effect of age on GMV, although this effect was more pronounced in controls. Significant group-by-age interactions were noted: A significant regional group-by-age interaction was observed in the ACC. GMV in the ACC showed patterns of age-related differences that were dissimilar between adolescents with MDD and healthy controls. GMV in the thalamus showed an opposite pattern of age-related differences in adolescent patients compared to healthy controls. In patients, GMV in the thalamus, but not the ACC, was inversely related with self-reported depressive symptoms. Conclusions The depressed adolescent brain shows dissimilar age-related and symptom-sensitive patterns of GMV differences compared with controls. The thalamus and ACC may comprise neural markers for detecting these effects in youth. Further investigations therefore need to take both age and level of current symptoms into account when disaggregating antecedent neural vulnerabilities for MDD from the effects of MDD on the developing brain. PMID:25685707

  14. Adolescents with current major depressive disorder show dissimilar patterns of age-related differences in ACC and thalamus.

    PubMed

    Hagan, Cindy C; Graham, Julia M E; Tait, Roger; Widmer, Barry; van Nieuwenhuizen, Adrienne O; Ooi, Cinly; Whitaker, Kirstie J; Simas, Tiago; Bullmore, Edward T; Lennox, Belinda R; Sahakian, Barbara J; Goodyer, Ian M; Suckling, John

    2015-01-01

    There is little understanding of the neural system abnormalities subserving adolescent major depressive disorder (MDD). In a cross-sectional study we compare currently unipolar depressed with healthy adolescents to determine if group differences in grey matter volume (GMV) were influenced by age and illness severity. Structural neuroimaging was performed on 109 adolescents with current MDD and 36 healthy controls, matched for age, gender, and handedness. GMV differences were examined within the anterior cingulate cortex (ACC) and across the whole-brain. The effects of age and self-reported depressive symptoms were also examined in regions showing significant main or interaction effects. Whole-brain voxel based morphometry revealed no significant group differences. At the whole-brain level, both groups showed a main effect of age on GMV, although this effect was more pronounced in controls. Significant group-by-age interactions were noted: A significant regional group-by-age interaction was observed in the ACC. GMV in the ACC showed patterns of age-related differences that were dissimilar between adolescents with MDD and healthy controls. GMV in the thalamus showed an opposite pattern of age-related differences in adolescent patients compared to healthy controls. In patients, GMV in the thalamus, but not the ACC, was inversely related with self-reported depressive symptoms. The depressed adolescent brain shows dissimilar age-related and symptom-sensitive patterns of GMV differences compared with controls. The thalamus and ACC may comprise neural markers for detecting these effects in youth. Further investigations therefore need to take both age and level of current symptoms into account when disaggregating antecedent neural vulnerabilities for MDD from the effects of MDD on the developing brain.

  15. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed

    2009-06-05

    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less

  16. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase.

    PubMed

    Long, C M; Rohrmann, G F; Merrill, G F

    2009-06-05

    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  17. Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

    PubMed Central

    Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

    2011-01-01

    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

  18. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  19. Calcium transport in vesicles energized by cytochrome oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, Randy N.

    1979-01-01

    Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less

  20. Comprehensive analysis of the MYB-NFIB gene fusion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance.

    PubMed

    Mitani, Yoshitsugu; Li, Jie; Rao, Pulivarthi H; Zhao, Yi-Jue; Bell, Diana; Lippman, Scott M; Weber, Randal S; Caulin, Carlos; El-Naggar, Adel K

    2010-10-01

    The objectives of this study were to determine the incidence of the MYB-NFIB fusion in salivary adenoid cystic carcinoma (ACC), to establish the clinicopathologic significance of the fusion, and to analyze the expression of MYB in ACCs in the context of the MYB-NFIB fusion. We did an extensive analysis involving 123 cancers of the salivary gland, including primary and metastatic ACCs, and non-ACC salivary carcinomas. MYB-NFIB fusions were identified by reverse transcriptase-PCR (RT-PCR) and sequencing of the RT-PCR products, and confirmed by fluorescence in situ hybridization. MYB RNA expression was determined by quantitative RT-PCR and protein expression was analyzed by immunohistochemistry. The MYB-NFIB fusion was detected in 28% primary and 35% metastatic ACCs, but not in any of the non-ACC salivary carcinomas analyzed. Different exons in both the MYB and NFIB genes were involved in the fusions, resulting in expression of multiple chimeric variants. Notably, MYB was overexpressed in the vast majority of the ACCs, although MYB expression was significantly higher in tumors carrying the MYB-NFIB fusion. The presence of the MYB-NFIB fusion was significantly associated (P = 0.03) with patients older than 50 years of age. No correlation with other clinicopathologic markers, factors, and survival was found. We conclude that the MYB-NFIB fusion characterizes a subset of ACCs and contributes to MYB overexpression. Additional mechanisms may be involved in MYB overexpression in ACCs lacking the MYB-NFIB fusion. These findings suggest that MYB may be a specific novel target for tumor intervention in patients with ACC. ©2010 AACR.

  1. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  2. Key role of alternative oxidase in lovastatin solid-state fermentation.

    PubMed

    Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

    2017-10-01

    Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

  3. Chromium downregulates the expression of Acetyl CoA Carboxylase 1 gene in lipogenic tissues of domestic goats: a potential strategy for meat quality improvement.

    PubMed

    Najafpanah, Mohammad Javad; Sadeghi, Mostafa; Zali, Abolfazl; Moradi-Shahrebabak, Hossein; Mousapour, Hojatollah

    2014-06-15

    Acetyl CoA Carboxylase 1 (ACC1) is a biotin-dependent enzyme that catalyzes the carboxylation of Acetyl CoA to form Malonyl CoA, the key intermediate metabolite in fatty acid synthesis. In this study, the mRNA expression of the ACC1 gene was evaluated in four different tissues (liver, visceral fat, subcutaneous fat, and longissimus muscle) of the domestic goat (Capra hircus) kids feeding on four different levels of trivalent chromium (0, 0.5, 1, and 1.5mg/day) as food supplementation. RT-qPCR technique was used for expression analyses and heat shock protein 90 gene (HSP-90) was considered as reference gene for data normalization. Our results revealed that 1.5mg/day chromium significantly reduced the expression of the ACC1 gene in liver, visceral fat, and subcutaneous fat tissues, but not in longissimus muscles (P<0.05). We measured some phenotypic traits of kid's carcasses to detect their probable correlations with chromium-mediated downregulation of ACC1 expression. Interestingly, changes in ACC1 expression were accompanied with decreased accumulation of fats in adipose tissues such that the subcutaneous fat thickness and heart fat percentage decreased in kids feeding on chromium. By contrast, chromium supplemented kids showed higher percentage of muscles despite the fact that their total body weight did not differ from that of non-supplemented kids. Our study suggests that trivalent chromium alters the direction of energy accumulation towards muscles rather than fats and provides insights into application of chromium supplementation as a useful strategy for improvement of meat quality in domestic animals. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Enzymatic improvement of mitochondrial thiol oxidase Erv1 for oxidized glutathione fermentation by Saccharomyces cerevisiae.

    PubMed

    Kobayashi, Jyumpei; Sasaki, Daisuke; Hara, Kiyotaka Y; Hasunuma, Tomohisa; Kondo, Akihiko

    2017-03-15

    Oxidized glutathione (GSSG) is the preferred form for industrial mass production of glutathione due to its high stability compared with reduced glutathione (GSH). In our previous study, over-expression of the mitochondrial thiol oxidase ERV1 gene was the most effective for high GSSG production in Saccharomyces cerevisiae cells among three types of different thiol oxidase genes. We improved Erv1 enzyme activity for oxidation of GSH and revealed that S32 and N34 residues are critical for the oxidation. Five engineered Erv1 variant proteins containing S32 and/or N34 replacements exhibited 1.7- to 2.4-fold higher in vitro GSH oxidation activity than that of parental Erv1, whereas the oxidation activities of these variants for γ-glutamylcysteine were comparable. According to three-dimensional structures of Erv1 and protein stability assays, S32 and N34 residues interact with nearby residues through hydrogen bonding and greatly contribute to protein stability. These results suggest that increased flexibility by amino acid replacements around the active center decrease inhibitory effects on GSH oxidation. Over-expressions of mutant genes coding these Erv1 variants also increased GSSG and consequently total glutathione production in S. cerevisiae cells. Over-expression of the ERV1 S32A gene was the most effective for GSSG production in S. cerevisiae cells among the parent and other mutant genes, and it increased GSSG production about 1.5-fold compared to that of the parental ERV1 gene. This is the first study demonstrating the pivotal effects of S32 and N34 residues to high GSH oxidation activity of Erv1. Furthermore, in vivo validity of Erv1 variants containing these S32 and N34 replacements were also demonstrated. This study indicates potentials of Erv1 for high GSSG production.

  5. Potential U.S. Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

    PubMed

    Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

    2018-01-16

    The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among U.S. adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9,623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce U.S. population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among U.S. adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of U.S. adults, respectively. Nonpharmacological intervention is advised for the 9.4% of U.S. adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among U.S. adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of U.S. adults recommended for antihypertensive medication, and more intensive BP

  6. Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.

    PubMed

    Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo

    2015-05-01

    Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.

  7. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

    PubMed

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

    2017-02-09

    In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  8. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

  9. Primary Prevention With Statins: ACC/AHA Risk-Based Approach Versus Trial-Based Approaches to Guide Statin Therapy.

    PubMed

    Mortensen, Martin B; Afzal, Shoaib; Nordestgaard, Børge G; Falk, Erling

    2015-12-22

    Guidelines recommend initiating primary prevention for atherosclerotic cardiovascular disease (ASCVD) with statins based on absolute ASCVD risk assessment. Recently, alternative trial-based and hybrid approaches were suggested for statin treatment eligibility. This study compared these approaches in a direct head-to-head fashion in a contemporary population. The study used the CGPS (Copenhagen General Population Study) with 37,892 subjects aged 40 to 75 years recruited in 2003 to 2008, all free of ASCVD, diabetes, and statin use at baseline. Among the population studied, 42% were eligible for statin therapy according to the 2013 American College of Cardiology/American Heart Association (ACC/AHA) risk assessment and cholesterol treatment guidelines approach, versus 56% with the trial-based approach and 21% with the hybrid approach. Among these statin-eligible subjects, the ASCVD event rate per 1,000 person-years was 9.8, 6.8, and 11.2, respectively. The ACC/AHA-recommended absolute risk score was well calibrated around the 7.5% 10-year ASCVD risk treatment threshold and discriminated better than the trial-based or hybrid approaches. Compared with the ACC/AHA risk-based approach, the net reclassification index for eligibility for statin therapy among 40- to 75-year-old subjects from the CGPS was -0.21 for the trial-based approach and -0.13 for the hybrid approach. The clinical performance of the ACC/AHA risk-based approach for primary prevention of ASCVD with statins was superior to the trial-based and hybrid approaches. Our results indicate that the ACC/AHA guidelines will prevent more ASCVD events than the trial-based and hybrid approaches, while treating fewer people compared with the trial-based approach. Copyright © 2015 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  10. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    PubMed Central

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  11. Ethylene biosynthesis in detached young persimmon fruit is initiated in calyx and modulated by water loss from the fruit.

    PubMed

    Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

    2003-01-01

    Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production.

  12. Identification of vascular patients at very high risk for recurrent cardiovascular events: validation of the current ACC/AHA very high risk criteria.

    PubMed

    van den Berg, M Johanneke; Bhatt, Deepak L; Kappelle, L Jaap; de Borst, Gert J; Cramer, Maarten J; van der Graaf, Yolanda; Steg, Ph Gabriel; Visseren, Frank L J

    2017-11-14

    To validate and assess performance of the current ACC/AHA very high risk criteria in patients with clinically manifest arterial disease. Data were used from the SMART study (n = 7216) and REACH Registry (n = 48 322), two prospective cohorts of patients with manifest atherosclerotic arterial disease. Prevalence and incidence rates of recurrent major adverse cardiovascular events (MACE) were calculated, according to the ACC/AHA VHR criteria (cardiovascular disease combined with diabetes, smoking, dyslipidaemia, and/or recent recurrent coronary events). Performance of the ACC/AHA criteria was compared with single very high risk factors in terms of C-statistics and Net Reclassification Index. All patients were at VHR according to the ESC guidelines (incidence of recurrent MACE in SMART was 2.4/100PY, with 95% CI 2.3-2.5/100PY and in REACH 5.1/100PY with 95% CI 5.0-5.3/100PY). In SMART 57% of the patients were at VHR according to the ACC/AHA criteria (incidence of recurrent MACE 2.7/100PY, 95% CI 2.5-2.9/100PY) and in REACH this was 64% (5.9/100PY, 95% CI 5.7-6.1/100PY). The C-statistic for the ACC/AHA VHR criteria was 0.53 in REACH and 0.54 in SMART. Very high risk factors with comparable or slightly better performance were eGFR < 45, polyvascular disease and age >70 years. Around two third of the patients meeting the ACC/AHA VHR criteria had a predicted 10-year risk of recurrent MACE <30%. The ACC/AHA VHR criteria have limited discriminative power. Identifying patients with clinically manifest arterial disease at VHR for recurrent vascular events using eGFR <45, polyvascular disease, or age >70 years performs as well as the ACC/AHA VHR criteria. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions, please email: journals.permissions@oup.com.

  13. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  14. Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols

    PubMed Central

    Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.

    2009-01-01

    Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836

  15. Current status of NADPH oxidase research in cardiovascular pharmacology.

    PubMed

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  16. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  17. HMSN/ACC truncation mutations disrupt brain-type creatine kinase-dependant activation of K+/Cl- co-transporter 3.

    PubMed

    Salin-Cantegrel, Adèle; Shekarabi, Masoud; Holbert, Sébastien; Dion, Patrick; Rochefort, Daniel; Laganière, Janet; Dacal, Sandra; Hince, Pascale; Karemera, Liliane; Gaspar, Claudia; Lapointe, Jean-Yves; Rouleau, Guy A

    2008-09-01

    The potassium-chloride co-transporter 3 (KCC3) is mutated in hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC); however, the molecular mechanisms of HMSN/ACC pathogenesis and the exact role of KCC3 in the development of the nervous system remain poorly understood. The functional regulation of this transporter by protein partners is also largely unknown. Using a yeast two-hybrid approach, we discovered that the C-terminal domain (CTD) of KCC3, which is lost in most HMSN/ACC-causing mutations, directly interacts with brain-specific creatine kinase (CK-B), an ATP-generating enzyme that is also a partner of KCC2. The interaction of KCC3 with CK-B was further confirmed by in vitro glutathione S-transferase pull-down assay, followed by sequencing of the pulled-down complexes. In transfected cultured cells, immunofluorescence labeling showed that CK-B co-localizes with wild-type KCC3, whereas the kinase fails to interact with the inactive truncated KCC3. Finally, CK-B's inhibition by DNFB results in reduction of activity of KCC3 in functional assays using Xenopus laevis oocytes. This physical and functional association between the co-transporter and CK-B is, therefore, the first protein-protein interaction identified to be potentially involved in the pathophysiology of HMSN/ACC.

  18. Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

    PubMed Central

    Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.

    2012-01-01

    Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578

  19. Oxygen activation in flavoprotein oxidases: the importance of being positive.

    PubMed

    Gadda, Giovanni

    2012-04-03

    The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.

  20. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  1. Partially dissociable roles of OFC and ACC in stimulus-guided and action-guided decision making.

    PubMed

    Khani, Abbas

    2014-05-01

    Recently, the functional specialization of prefrontal areas of the brain, and, specifically, the functional dissociation of the orbitofrontal cortex (OFC) and the anterior cingulate cortex (ACC), during decision making have become a particular focus of research. A number of neuropsychological and lesion studies have shown that the OFC and ACC have dissociable functions in various dimensions of decision making, which are supported by their different anatomical connections. A recent single-neuron study, however, described a more complex picture of the functional dissociation between these two frontal regions during decision making. Here, I discuss the results of that study and consider alternative interpretations in connection with other findings.

  2. Generating disulfides with the quiescin sulfhydryl oxidases

    PubMed Central

    Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin

    2008-01-01

    The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160

  3. Doctors' knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore.

    PubMed

    Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

    2015-01-01

    There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians' response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40-80 mg and rosuvastatin 20-40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations.

  4. The ACC/AHA 2013 pooled cohort equations compared to a Korean Risk Prediction Model for atherosclerotic cardiovascular disease.

    PubMed

    Jung, Keum Ji; Jang, Yangsoo; Oh, Dong Joo; Oh, Byung-Hee; Lee, Sang Hoon; Park, Seong-Wook; Seung, Ki-Bae; Kim, Hong-Kyu; Yun, Young Duk; Choi, Sung Hee; Sung, Jidong; Lee, Tae-Yong; Kim, Sung Hi; Koh, Sang Baek; Kim, Moon Chan; Chang Kim, Hyeon; Kimm, Heejin; Nam, Chungmo; Park, Sungha; Jee, Sun Ha

    2015-09-01

    To evaluate the performance of the American College of Cardiology/American Heart Association (ACC/AHA) 2013 Pooled Cohort Equations in the Korean Heart Study (KHS) population and to develop a Korean Risk Prediction Model (KRPM) for atherosclerotic cardiovascular disease (ASCVD) events. The KHS cohort included 200,010 Korean adults aged 40-79 years who were free from ASCVD at baseline. Discrimination, calibration, and recalibration of the ACC/AHA Equations in predicting 10-year ASCVD risk in the KHS cohort were evaluated. The KRPM was derived using Cox model coefficients, mean risk factor values, and mean incidences from the KHS cohort. In the discriminatory analysis, the ACC/AHA Equations' White and African-American (AA) models moderately distinguished cases from non-cases, and were similar to the KRPM: For men, the area under the receiver operating characteristic curve (AUROCs) were 0.727 (White model), 0.725 (AA model), and 0.741 (KRPM); for women, the corresponding AUROCs were 0.738, 0.739, and 0.745. Absolute 10-year ASCVD risk for men in the KHS cohort was overestimated by 56.5% (White model) and 74.1% (AA model), while the risk for women was underestimated by 27.9% (White model) and overestimated by 29.1% (AA model). Recalibration of the ACC/AHA Equations did not affect discriminatory ability but improved calibration substantially, especially in men in the White model. Of the three ASCVD risk prediction models, the KRPM showed best calibration. The ACC/AHA Equations should not be directly applied for ASCVD risk prediction in a Korean population. The KRPM showed best predictive ability for ASCVD risk. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Doctors’ knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore

    PubMed Central

    Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

    2015-01-01

    Purpose There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians’ response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. Methods This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Results Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40–80 mg and rosuvastatin 20–40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Conclusion Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations. PMID:26082642

  6. Mentoring in 2 + 2 Programs: LISD/ACC 2 + 2 Articulation Project.

    ERIC Educational Resources Information Center

    Center for Occupational Research and Development, Inc., Waco, TX.

    The role of mentoring in the 2 + 2 Instrumentation and Control (I&C) articulation project between the Leander Independent School District (LISD) and Austin Community College (ACC) is discussed in this document. Following a brief history of the origin and function of the mentor, the paper explains the need for the mentoring system in the I&C…

  7. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression is Moderated by dACC Reactivity to Rejection

    PubMed Central

    Chester, David S.; DeWall, C. Nathan

    2015-01-01

    Objective Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissist’s motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Method Thirty participants (15 females; MAge=18.86, SD=1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively towards one of the rejecters by blasting them with unpleasant noise. Results When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Conclusions Narcissism’s role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain’s discrepancy detector registers the newly-created gap between the grandiose and threatened selves. PMID:25564936

  8. Parametric modulation of reward sequences during a reversal task in ACC and VMPFC but not amygdala and striatum.

    PubMed

    Becker, Michael P I; Nitsch, Alexander M; Hewig, Johannes; Miltner, Wolfgang H R; Straube, Thomas

    2016-12-01

    Several regions of the frontal cortex interact with striatal and amygdala regions to mediate the evaluation of reward-related information and subsequent adjustment of response choices. Recent theories discuss the particular relevance of dorsal anterior cingulate cortex (dACC) for switching behavior; consecutively, ventromedial prefrontal cortex (VMPFC) is involved in mediating exploitative behaviors by tracking reward values unfolding after the behavioral switch. Amygdala, on the other hand, has been implied in coding the valence of stimulus-outcome associations and the ventral striatum (VS) has consistently been shown to code a reward prediction error (RPE). Here, we used fMRI data acquired in humans during a reversal task to parametrically model different sequences of positive feedback in order to unravel differential contributions of these brain regions to the tracking and exploitation of rewards. Parameters from an Optimal Bayesian Learner accurately predicted the divergent involvement of dACC and VMPFC during feedback processing: dACC signaled the first, but not later, presentations of positive feedback, while VMPFC coded trial-by-trial accumulations in reward value. Our results confirm that dACC carries a prominent confirmatory signal during processing of first positive feedback. Amygdala coded positive feedbacks more uniformly, while striatal regions were associated with RPE. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

    PubMed Central

    Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

    2012-01-01

    Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974

  10. Monoamine Oxidase A gene polymorphisms and self reported aggressive behaviour in a Pakistani ethnic group.

    PubMed

    Shah, Syed Shoaib; Mohyuddin, Aisha; Colonna, Vincenza; Mehdi, Syed Qasim; Ayub, Qasim

    2015-08-01

    To investigate the association of monoamine oxidase Agene polymorphisms with aggression. The study was conducted in an ethnic community in Lahore, Pakistan, from August 2008 to December 2009 on the basis of data that was collected through a questionnaire between August 2004 and September 2005. It analysed 10 single nucleotide polymorphisms of monoamine oxidase A in unrelated males from the same ethnic background who were administered a Punjabi translation of the Buss and Perry aggression questionnaire. SPSS 13 was used for statistical analysis. Of the total 133 haplotypes studied, 52(39%) were Haplotype A, 58(43.6%) B, 8(6%) C, 3(2.3%) D, 9(6.8%) E and 3(2.3%) F. The six haplotypes were analysed for association with scores of the four subscales of the aggression questionnaire and multivariate analysis of variance showed no significant differences (p>0.05 each) in the error variances of the total scores and scores for three of the sub-scales across the haplotypes. The variance was significantly different only for the anger sub-scale (p<0.05). The association of an extended haplotype with low levels of self-reported aggression in this study should assist in characterisation of functional variants responsible for non-aggressive behaviour in male subjects.

  11. Comparison of the ACC/AHA and Framingham algorithms to assess cardiovascular risk in HIV-infected patients.

    PubMed

    Pinto Neto, Lauro Ferreira da Silva; Dias, Fernanda Rezende; Bressan, Flavia Feres; Santos, Carolina Rocio Oliveira

    The aim of this study was to compare the predictions of Framingham cardiovascular (CV) risk score (FRS) and the American College of Cardiology/American Heart Association (ACC/AHA) risk score in an HIV outpatient clinic in the city of Vitoria, Espirito Santo, Brazil. In a cross-sectional study 341 HIV infected patients over 40 years old consecutively recruited were interviewed. Cohen's kappa coefficient was used to assess agreement between the two algorithms. 61.3% were stratified as low risk by Framingham score, compared with 54% by ACC/AHA score (Spearman correlation 0.845; p<0.000). Only 26.1% were classified as cardiovascular high risk by Framingham compared to 46% by ACC/AHA score (Kappa=0.745; p<0.039). Only one out of eight patients had cardiovascular high risk by Framingham at the time of a myocardial infarction event registered up to five years before the study period. Both cardiovascular risk scores but especially Framingham underestimated high-risk patients in this HIV-infected population. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  12. Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of banana fruit.

    PubMed

    Inaba, Akitsugu; Liu, Xuejun; Yokotani, Naoki; Yamane, Miki; Lu, Wang-Jin; Nakano, Ryohei; Kubo, Yasutaka

    2007-01-01

    The feedback regulation of ethylene biosynthesis in banana [Musa sp. (AAA group, Cavendish subgroup) cv. Grand Nain] fruit was investigated in an attempt to clarify the opposite effect of 1-methylcyclopropene (1-MCP), an ethylene action inhibitor, before and after the onset of ripening. 1-MCP pre-treatment completely prevented the ripening-induced effect of propylene in pre-climacteric banana fruit, whereas treatment after the onset of ripening stimulated ethylene production. In pre-climacteric fruit, higher concentrations of propylene suppressed ethylene production more strongly, despite their earlier ethylene-inducing effect. Exposure of the fruit ripened by propylene to 1-MCP increased ethylene production concomitantly with an increase in 1-aminocyclopropane-1-carboxylate (ACC) synthase activity and ACC content, and prevented a transient decrease in MA-ACS1 transcripts in the pulp tissues. In contrast, in the peel of ripening fruit, 1-MCP prevented the increase in ethylene production and subsequently the ripening process by reduction of the increase in MA-ACS1 and MA-ACO1 transcripts and of ACC synthase and ACC oxidase activities. These results suggest that ethylene biosynthesis in ripening banana fruit may be controlled negatively in the pulp tissue and positively in the peel tissue. This differential regulation by ethylene in pulp and peel tissues was also observed for MA-PL, MA-Exp, and MA-MADS genes.

  13. Applicability of the 2013 ACC/AHA Risk Assessment and Cholesterol Treatment Guidelines in the real world: results from a multiethnic case-control study.

    PubMed

    Magnoni, Marco; Berteotti, Martina; Norata, Giuseppe Danilo; Limite, Luca Rosario; Peretto, Giovanni; Cristell, Nicole; Maseri, Attilio; Cianflone, Domenico

    2016-01-01

    The 2013 ACC/AHA cholesterol treatment guidelines have introduced a new cardiovascular risk assessment approach (PCE) and have revisited the threshold for prescribing statins. This study aims to compare the ex ante application of the ACC/AHA and the ATP-III guideline models by using a multiethnic case-control study. ATP-III-FRS and PCE were assessed in 739 patients with first STEMI and 739 age- and gender-matched controls; the proportion of cases and controls that would have been eligible for statin as primary prevention therapy and the discriminatory ability of both models were evaluated. The application of the ACC/AHA compared to the ATP-III model, resulted in an increase in sensitivity [94% (95%CI: 91%-95%) vs. 65% (61%-68%), p< 0.0001], a reduction in specificity [19% (15%-22%) vs. 55% (51%-59%), p< 0.0001] with similar global accuracy [0.56 (0.53-0.59) vs.0.59 (0.57-0.63), p ns]. When stratifying for ethnicity, the accuracy of the ACC/AHA model was higher in Europeans than in Chinese (p = 0.003) and to identified premature STEMI patients within Europeans much better compared to the ATP-III model (p = 0.0289). The application of the ACC/AHA model resulted in a significant reduction of first STEMI patients who would have escaped from preventive treatment. Age and ethnicity affected the accuracy of the ACC/AHA model improving the identification of premature STEMI among Europeans only. Key messages According to the ATP-III guideline model, about one-third of patients with STEMI would not be eligible for primary preventive treatment before STEMI. The application of the new ACC/AHA cholesterol treatment guideline model leads to a significant reduction of the percentage of patients with STEMI who would have been considered at lower risk before the STEMI. The global accuracy of the new ACC/AHA model is higher in the Europeans than in the Chinese and, moreover, among the Europeans, the application of the new ACC/AHA guideline model also improved

  14. Gene expression analyses in tomato near isogenic lines provide evidence for ethylene and abscisic acid biosynthesis fine-tuning during arbuscular mycorrhiza development.

    PubMed

    Fracetto, Giselle Gomes Monteiro; Peres, Lázaro Eustáquio Pereira; Lambais, Marcio Rodrigues

    2017-07-01

    Plant responses to the environment and microorganisms, including arbuscular mycorrhizal fungi, involve complex hormonal interactions. It is known that abscisic acid (ABA) and ethylene may be involved in the regulation of arbuscular mycorrhiza (AM) and that part of the detrimental effects of ABA deficiency in plants is due to ethylene overproduction. In this study, we aimed to determine whether the low susceptibility to mycorrhizal colonization in ABA-deficient mutants is due to high levels of ethylene and whether AM development is associated with changes in the steady-state levels of transcripts of genes involved in the biosynthesis of ethylene and ABA. For that, tomato (Solanum lycopersicum) ethylene overproducer epinastic (epi) mutant and the ABA-deficient notabilis (not) and sitiens (sit) mutants, in the same Micro-Tom (MT) genetic background, were inoculated with Rhizophagus clarus, and treated with the ethylene biosynthesis inhibitor aminoethoxyvinylglycine (AVG). The development of AM, as well as the steady-state levels of transcripts involved in ethylene (LeACS2, LeACO1 and LeACO4) and ABA (LeNCED) biosynthesis, was determined. The intraradical colonization in epi, not and sit mutants was significantly reduced compared to MT. The epi mutant completely restored the mycorrhizal colonization to the levels of MT with the application of 10 µM of AVG, probably due to the inhibition of the ACC synthase gene expression. The steady-state levels of LeACS2 and LeACO4 transcripts were induced in mycorrhizal roots of MT, whereas the steady-state levels of LeACO1 and LeACO4 transcripts were significantly induced in sit, and the steady-state levels of LeNCED transcripts were significantly induced in all genotypes and in mycorrhizal roots of epi mutants treated with AVG. The reduced mycorrhizal colonization in sit mutants seems not to be limited by ethylene production via ACC oxidase regulation. Both ethylene overproduction and ABA deficiency impaired AM fungal

  15. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  16. THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE

    PubMed Central

    Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.

    1944-01-01

    1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382

  17. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

    PubMed

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

    2018-03-16

    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  18. Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

    PubMed

    Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

    2013-02-01

    Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

  19. Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

    PubMed

    Gudkova, O O; Latyshko, N V; Shandrenko, S G

    2016-01-01

    In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

  20. Why Orange Guaymas Basin Beggiatoa spp. Are Orange: Single-Filament-Genome-Enabled Identification of an Abundant Octaheme Cytochrome with Hydroxylamine Oxidase, Hydrazine Oxidase, and Nitrite Reductase Activities

    PubMed Central

    Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas

    2013-01-01

    Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (μLC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958

  1. Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

    PubMed

    Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

    1995-07-01

    Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

  2. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    PubMed Central

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  3. Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina.

    PubMed

    Malagnac, Fabienne; Lalucque, Hervé; Lepère, Gersende; Silar, Philippe

    2004-11-01

    NADPH oxidases are enzymes that produce reactive oxygen species (ROS) using electrons derived from intracellular NADPH. In plants and mammals, ROS have been proposed to be second messengers that signal defence responses or cell proliferation. By inactivating PaNox1 and PaNox2, two genes encoding NADPH oxidases, we demonstrate the crucial role of these enzymes in the control of two key steps of the filamentous fungus Podospora anserina life cycle. PaNox1 mutants are impaired in the differentiation of fruiting bodies from their progenitor cells, and the deletion of the PaNox2 gene specifically blocks ascospore germination. Furthermore, we show that PaNox1 likely acts upstream of PaASK1, a MAPKKK previously implicated in stationary phase differentiation and cell degeneration. Using nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) assays, we detect a regulated secretion of both superoxide and peroxide during P. anserina vegetative growth. In addition, two oxidative bursts are shown to occur during fruiting body development and ascospore germination. Analysis of mutants establishes that PaNox1, PaNox2, and PaASK1, as well as a still unknown additional source of ROS, modulate these secretions. Altogether, our data point toward a role for NADPH oxidases in signalling fungal developmental transitions with respect to nutrient availability. These enzymes are conserved in other multicellular eukaryotes, suggesting that early eukaryotes were endowed with a redox network used for signalling purposes.

  4. Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

    PubMed

    Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

    2017-06-05

    Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

  5. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

    PubMed Central

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-01-01

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398

  6. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

    PubMed

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-03-17

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

  7. Heterologous expression and characterization of mouse spermine oxidase.

    PubMed

    Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo

    2003-02-14

    Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.

  8. Carbonate mineralization via an amorphous calcium carbonate (ACC) pathway: Tuning polymorph selection by Mg, pH, and mixing environment

    NASA Astrophysics Data System (ADS)

    Dove, P. M.; Blue, C.; Mergelsberg, S. T.; Giuffre, A. J.; Han, N.; De Yoreo, J. J.

    2017-12-01

    Mineral formation by nonclassical processes is widespread with many pathways that include aggregation of nanoparticles, oriented attachment of fully formed crystals, and sequential nucleation/transformation of amorphous phases (De Yoreo et al., 2015, Science). Field observations indicate amorphous calcium carbonate (ACC) can be the initial precipitate when local conditions promote high supersaturations for short time periods. Examples include microbial mats, marine porewaters that undergo pulses of increased alkalinity, closed basin lakes, and sabkhas. The crystalline products exhibit diverse morphologies and complex elemental and isotopic signatures. This study quantifies relationships between solution composition and the crystalline polymorphs that transform from ACC (Blue et al., GCA, 2017). Our experimental design synthesized ACC under controlled conditions for a suite of compositions by tuning input pH, Mg/Ca, and total carbonate concentration. ACC products were allowed to transform within output suspensions under stirred or quiescent mixing while characterizing the polymorph and composition of evolving solutions and solids. We find that ACC transforms to crystalline polymorphs with a systematic relationship to solution composition to give a quantitative framework based upon solution aMg2+/aCa2+ and aCO32-/aCa2+. We also measure a polymorph-specific evolution of pH and Mg/Ca during the transformation that indicates the initial polymorph to form. Pathway is further modulated by stirring versus quiescent conditions. The findings reconcile discrepancies among previous studies of ACC to crystalline products and supports claims that monohydrocalcite may be an overlooked, transient phase during formation of some aragonite and calcite deposits. Organic additives and extreme pH are not required to tune composition and polymorph. Insights from this study reiterate the need to revisit long-standing dogmas regarding controls on CaCO3 polymorph selection. Classical models

  9. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.

  10. Monoamine Oxidase A (MAOA) Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

    PubMed Central

    Xu, Man K.; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J. S.; Croudace, Tim J.; Barnett, Jennifer H.; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B.

    2017-01-01

    Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits. PMID:29075213

  11. Monoamine Oxidase A (MAOA) Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation.

    PubMed

    Xu, Man K; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J S; Croudace, Tim J; Barnett, Jennifer H; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B

    2017-01-01

    Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene ( MAOA ) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = -0.167; CI: -0.289, -0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

  12. Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

    PubMed

    Löw, Hans; Crane, Frederick L; Morré, D James

    2012-11-01

    The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

    PubMed

    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

    2016-07-09

    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

  14. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  15. GATEWAY Report Brief: Tunable-White Lighting at the ACC Care Center

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None, None

    Summary of a GATEWAY program report that documented the performance of tunable-white LED lighting systems installed in several spaces within the ACC Care Center, a senior-care facility in Sacramento, CA. The project results included energy savings and improved lighting quality, as well as other possible health-related benefits that may have been attributable, at least in part, to the lighting changes.

  16. Characterization of oxidative phosphorylation in the colorless chlorophyte Polytomella sp. Its mitochondrial respiratory chain lacks a plant-like alternative oxidase.

    PubMed

    Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego

    2002-07-01

    The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.

  17. Thermostable and highly specific L-aspartate oxidase from Thermococcus litoralis DSM 5473: cloning, overexpression, and enzymological properties.

    PubMed

    Washio, Tsubasa; Oikawa, Tadao

    2018-01-01

    We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.

  18. NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.

    PubMed

    Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong

    2012-06-01

    Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.

  19. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

    PubMed

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

    2016-12-01

    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of type-2-copper-depleted ascorbate oxidase.

    PubMed

    O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F

    1984-08-15

    The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.

  1. Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

    PubMed

    Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

    2003-12-01

    Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

  2. Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.

    PubMed

    Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D

    2004-06-18

    To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.

  3. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression Is Moderated by dACC Reactivity to Rejection.

    PubMed

    Chester, David S; DeWall, C Nathan

    2016-06-01

    Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissists' motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Thirty participants (15 females; Mage  = 18.86, SD = 1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively toward one of the rejecters by blasting him or her with unpleasant noise. When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Narcissism's role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain's discrepancy detector registers the newly created gap between the grandiose and threatened selves. © 2015 Wiley Periodicals, Inc.

  4. ACCE Study Tour to ISTE2011 (San Francisco, New York, Washington, Philadelphia)

    ERIC Educational Resources Information Center

    Gronn, Donna; Romeo, Geoff

    2011-01-01

    In June/July this year a group of 28 educators from across Australia travelled to the US on the 2011 ACCE ISTE Study Tour. The group comprised a very broad section of educators--primary, secondary and tertiary classroom teachers, ICT coordinators, managers, private consultants and regional office managers. The government, catholic and independent…

  5. In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.

    PubMed

    Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh

    2007-08-01

    In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.

  6. Mitochondrial cytochrome c oxidase subunit 1 gene and nuclear rDNA regions of Enterobius vermicularis parasitic in captive chimpanzees with special reference to its relationship with pinworms in humans.

    PubMed

    Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo

    2006-12-01

    Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.

  7. Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.

    PubMed

    Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W

    2016-11-04

    By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

    PubMed

    Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

    2008-02-01

    The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.

  9. How effective are the ESC/EAS and 2013 ACC/AHA guidelines in treating dyslipidemia? Lessons from a lipid clinic.

    PubMed

    Barkas, Fotios; Milionis, Haralampos; Kostapanos, Michael S; Mikhailidis, Dimitri P; Elisaf, Moses; Liberopoulos, Evangelos

    2015-02-01

    There is a paucity of data regarding the attainment of lipid-lowering treatment goals according to the recent American College of Cardiology/American Heart Association (ACC/AHA) guidelines. The aim of the present study was to assess how applicable these 2013 recommendations are in the setting of an Outpatient University Hospital Lipid Clinic. This was a retrospective (from 1999 to 2013) observational study including 1000 consecutive adults treated for hyperlipidemia and followed up for ≥3 years. Comparisons for the applicability of current European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) and recent ACC/AHA guidelines were performed. Achievement rates of low density lipoprotein cholesterol (LDL-C) targets set by ESC/EAS were 21%, 44% and 62% among patients at very high, high and moderate cardiovascular risk, respectively, receiving statin monotherapy. Among individuals on high-intensity statins only 47% achieved the anticipated ≥50% LDL-C reduction, i.e. the ACC/AHA target. The corresponding rate was significantly greater among those on statin + ezetimibe (76%, p < 0.05). Likewise, higher rates of LDL-C target attainment according to ESC/EAS guidelines were observed in patients on statin + ezetimibe compared with statin monotherapy (37, 50 and 71% for the three risk groups, p < 0.05 for the very high risk group). The application of the ACC/AHA guidelines may be associated with undertreatment of high risk patients due to suboptimal LDL-C response to high-intensity statins in clinical practice. Adding ezetimibe substantially increases the rate of the ESC/EAS LDL-C target achievement together with the rate of LDL-C lowering response suggested by the ACC/AHA.

  10. The Allende multicompound chondrule (ACC)—Chondrule formation in a local super-dense region of the early solar system

    NASA Astrophysics Data System (ADS)

    Bischoff, Addi; Wurm, Gerhard; Chaussidon, Marc; Horstmann, Marian; Metzler, Knut; Weyrauch, Mona; Weinauer, Julia

    2017-05-01

    In Allende, a very complex compound chondrule (Allende compound chondrule; ACC) was found consisting of at least 16 subchondrules (14 siblings and 2 independents). Its overall texture can roughly be described as a barred olivine object (BO). The BO texture is similar in all siblings, but does not exist in the two independents, which appear as relatively compact olivine-rich units. Because of secondary alteration of pristine Allende components and the ACC in particular, only limited predictions can be made concerning the original compositions of the colliding melt droplets. Based on textural and mineralogical characteristics, the siblings must have been formed on a very short time scale in a dense, local environment. This is also supported by oxygen isotope systematics showing similar compositions for all 16 subchondrules. Furthermore, the ACC subchondrules are isotopically distinct from typical Allende chondrules, indicating formation in or reaction with a more 16O-poor reservoir. We modeled constraints on the particle density required at the ACC formation location, using textural, mineral-chemical, and isotopic observations on this multicompound chondrule to define melt droplet collision conditions. In this context, we discuss the possible relationship between the formation of complex chondrules and the formation of macrochondrules and cluster chondrites. While macrochondrules may have formed under similar or related conditions as complex chondrules, cluster chondrites certainly require different formation conditions. Cluster chondrites represent a mixture of viscously deformed, seemingly young chondrules of different chemical and textural types and a population of older chondrules. Concerning the formation of ACC calculations suggest the existence of very local, kilometer-sized, and super-dense chondrule-forming regions with extremely high solid-to-gas mass ratios of 1000 or more.

  11. Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.

    PubMed

    Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo

    2016-10-01

    Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process.

  12. Plant sterol biosynthesis: identification of two distinct families of sterol 4alpha-methyl oxidases.

    PubMed Central

    Darnet, Sylvain; Rahier, Alain

    2004-01-01

    In plants, the conversion of cycloartenol into functional phytosterols requires the removal of the two methyl groups at C-4 by an enzymic complex including a sterol 4alpha-methyl oxidase (SMO). We report the cloning of candidate genes for SMOs in Arabidopsis thaliana, belonging to two distinct families termed SMO1 and SMO2 and containing three and two isoforms respectively. SMO1 and SMO2 shared low sequence identity with each other and were orthologous to the ERG25 gene from Saccharomyces cerevisiae which encodes the SMO. The plant SMO amino acid sequences possess all the three histidine-rich motifs (HX3H, HX2HH and HX2HH), characteristic of the small family of membrane-bound non-haem iron oxygenases that are involved in lipid oxidation. To elucidate the precise functions of SMO1 and SMO2 gene families, we have reduced their expression by using a VIGS (virus-induced gene silencing) approach in Nicotiana benthamiana. SMO1 and SMO2 cDNA fragments were inserted into a viral vector and N. benthamiana inoculated with the viral transcripts. After silencing with SMO1, a substantial accumulation of 4,4-dimethyl-9beta,19-cyclopropylsterols (i.e. 24-methylenecycloartanol) was obtained, whereas qualitative and quantitative levels of 4alpha-methylsterols were not affected. In the case of silencing with SMO2, a large accumulation of 4alpha-methyl-Delta7-sterols (i.e. 24-ethylidenelophenol and 24-ethyllophenol) was found, with no change in the levels of 4,4-dimethylsterols. These clear and distinct biochemical phenotypes demonstrate that, in contrast with animals and fungi, in photosynthetic eukaryotes, these two novel families of cDNAs are coding two distinct types of C-4-methylsterol oxidases controlling the level of 4,4-dimethylsterol and 4alpha-methylsterol precursors respectively. PMID:14653780

  13. d-Aspartate oxidase influences glutamatergic system homeostasis in mammalian brain.

    PubMed

    Cristino, Luigia; Luongo, Livio; Squillace, Marta; Paolone, Giovanna; Mango, Dalila; Piccinin, Sonia; Zianni, Elisa; Imperatore, Roberta; Iannotta, Monica; Longo, Francesco; Errico, Francesco; Vescovi, Angelo Luigi; Morari, Michele; Maione, Sabatino; Gardoni, Fabrizio; Nisticò, Robert; Usiello, Alessandro

    2015-05-01

    We have investigated the relevance of d-aspartate oxidase, the only enzyme known to selectively degrade d-aspartate (d-Asp), in modulating glutamatergic system homeostasis. Interestingly, the lack of the Ddo gene, by raising d-Asp content, induces a substantial increase in extracellular glutamate (Glu) levels in Ddo-mutant brains. Consistent with an exaggerated and persistent N-methyl-d-aspartate receptor (NMDAR) stimulation, we documented in Ddo knockouts severe age-dependent structural and functional alterations mirrored by expression of active caspases 3 and 7 along with appearance of dystrophic microglia and reactive astrocytes. In addition, prolonged elevation of d-Asp triggered in mutants alterations of NMDAR-dependent synaptic plasticity associated to reduction of hippocampal GluN1 and GluN2B subunits selectively located at synaptic sites and to increase in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-to-N-methyl-d-aspartate ratio. These effects, all of which converged on a progressive hyporesponsiveness at NMDAR sites, functionally resulted in a greater vulnerability to phencyclidine-induced prepulse inhibition deficits in mutants. In conclusion, our results indicate that d-aspartate oxidase, by strictly regulating d-Asp levels, impacts on the homeostasis of glutamatergic system, thus preventing accelerated neurodegenerative processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard

    2016-01-01

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  15. Chemoheterotrophic Growth of the Cyanobacterium Anabaena sp. Strain PCC 7120 Dependent on a Functional Cytochrome c Oxidase

    PubMed Central

    Stebegg, Ronald; Wurzinger, Bernhard; Mikulic, Markus

    2012-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium commonly used as a model organism for studying cyanobacterial cell differentiation and nitrogen fixation. For many decades, this cyanobacterium was considered an obligate photo-lithoautotroph. We now discovered that this strain is also capable of mixotrophic, photo-organoheterotrophic, and chemo-organoheterotrophic growth if high concentrations of fructose (at least 50 mM and up to 200 mM) are supplied. Glucose, a substrate used by some facultatively organoheterotrophic cyanobacteria, is not effective in Anabaena sp. PCC 7120. The gtr gene from Synechocystis sp. PCC 6803 encoding a glucose carrier was introduced into Anabaena sp. PCC 7120. Surprisingly, the new strain containing the gtr gene did not grow on glucose but was very sensitive to glucose, with a 5 mM concentration being lethal, whereas the wild-type strain tolerated 200 mM glucose. The Anabaena sp. PCC 7120 strain containing gtr can grow mixotrophically and photo-organoheterotrophically, but not chemo-organoheterotrophically with fructose. Anabaena sp. PCC 7120 contains five respiratory chains ending in five different respiratory terminal oxidases. One of these enzymes is a mitochondrial-type cytochrome c oxidase. As in almost all cyanobacteria, this enzyme is encoded by three adjacent genes called coxBAC1. When this locus was disrupted, the cells lost the capability for chemo-organoheterotrophic growth. PMID:22730128

  16. Tuning the light in senior care: Evaluating a trial LED lighting system at the ACC Care Center in Sacramento, CA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davis, Robert G.; Wilkerson, Andrea M.

    This report summarizes the results from a trial installation of light-emitting diode (LED) lighting systems in several spaces within the ACC Care Center in Sacramento, CA. The Sacramento Municipal Utility District (SMUD) coordinated the project and invited the U.S. Department of Energy (DOE) to document the performance of the LED lighting systems as part of a GATEWAY evaluation. DOE tasked the Pacific Northwest National Laboratory (PNNL) to conduct the investigation. SMUD and ACC staff coordinated and completed the design and installation of the LED systems, while PNNL and SMUD staff evaluated the photometric performance of the systems. ACC staff alsomore » track behavioral and health measures of the residents; some of those results are reported here, although PNNL staff were not directly involved in collecting or interpreting those data. The trial installation took place in a double resident room and a single resident room, and the corridor that connects those (and other) rooms to the central nurse station. Other spaces in the trial included the nurse station, a common room called the family room located near the nurse station, and the ACC administrator’s private office.« less

  17. Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise

    PubMed Central

    Li, Mengyao; Verdijk, Lex B.; Sakamoto, Kei; Ely, Brian; van Loon, Luc J.C.; Musi, Nicolas

    2012-01-01

    AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. PMID:23000302

  18. Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise.

    PubMed

    Li, Mengyao; Verdijk, Lex B; Sakamoto, Kei; Ely, Brian; van Loon, Luc J C; Musi, Nicolas

    2012-01-01

    AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. Published by Elsevier Ireland Ltd.

  19. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

  20. Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

    PubMed

    Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

    2015-03-28

    Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.