Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Ethylene biosynthesis in detached young persimmon fruit is initiated in calyx and modulated by water loss from the fruit.

PubMed

Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

2003-01-01

Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production.

Ethylene Biosynthesis in Detached Young Persimmon Fruit Is Initiated in Calyx and Modulated by Water Loss from the Fruit1

PubMed Central

Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

2003-01-01

Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production. PMID:12529535

1-MCP EFFECTS ON ANTIOXIDANT ACTIVITY AND GENE EXPRESSION OF ACC-SYNTHASE AND ACC-OXIDASE IN COTTON FLOWERS

USDA-ARS?s Scientific Manuscript database

Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel, E-mail: mfessop@sun.ac.za

Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transientlymore » transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.« less

Proteomic changes in the base of chrysanthemum cuttings during adventitious root formation

PubMed Central

2013-01-01

Background A lack of competence to form adventitious roots by cuttings of Chrysanthemum (Chrysanthemum morifolium) is an obstacle for the rapid fixation of elite genotypes. We performed a proteomic analysis of cutting bases of chrysanthemum cultivar ‘Jinba’ during adventitious root formation (ARF) in order to identify rooting ability associated protein and/or to get further insight into the molecular mechanisms controlling adventitious rooting. Results The protein profiles during ARF were analyzed by comparing the 2-DE gels between 0-day-old (just severed from the stock plant) and 5-day-old cutting bases of chrysanthemum. A total of 69 differentially accumulated protein spots (two-fold change; t-test: 95% significance) were excised and analyzed using MALDI-TOF/TOF, among which 42 protein spots (assigned as 24 types of proteins and 7 unknown proteins) were confidently identified using the NCBI database. The results demonstrated that 19% proteins were related to carbohydrate and energy metabolism, 16% to photosynthesis, 10% to protein fate, 7% to plant defense, 6% to cell structure, 7% to hormone related, 3% to nitrate metabolism, 3% to lipid metabolism, 3% to ascorbate biosynthesis and 3% to RNA binding, 23% were unknown proteins. Twenty types of differentially accumulated proteins including ACC oxidase (CmACO) were further analyzed at the transcription level, most of which were in accordance with the results of 2-DE. Moreover, the protein abundance changes of CmACO are supported by western blot experiments. Ethylene evolution was higher during the ARF compared with day 0 after cutting, while silver nitrate, an inhibitor of ethylene synthesis, pretreatment delayed the ARF. It suggested that ACC oxidase plays an important role in ARF of chrysanthemum. Conclusions The proteomic analysis of cutting bases of chrysanthemum allowed us to identify proteins whose expression was related to ARF. We identified auxin-induced protein PCNT115 and ACC oxidase positively or negatively correlated to ARF, respectively. Several other proteins related to carbohydrate and energy metabolism, protein degradation, photosynthetic and cell structure were also correlated to ARF. The induction of protein CmACO provide a strong case for ethylene as the immediate signal for ARF. This strongly suggests that the proteins we have identified will be valuable for further insight into the molecular mechanisms controlling ARF. PMID:24369042

Transcriptional profiling reveals elevated CO2 and elevated O3 alter resistance of soybean (Glycine max) to Japanese beetles (Popillia japonica).

PubMed

Casteel, Clare L; O'Neill, Bridget F; Zavala, Jorge A; Bilgin, Damla D; Berenbaum, May R; Delucia, Evan H

2008-04-01

The accumulation of CO2 and O3 in the troposphere alters phytochemistry which in turn influences the interactions between plants and insects. Using microarray analysis of field-grown soybean (Glycine max), we found that the number of transcripts in the leaves affected by herbivory by Japanese beetles (Popillia japonica) was greater when plants were grown under elevated CO2, elevated O3 and the combination of elevated CO2 plus elevated O3 than when grown in ambient atmosphere. The effect of herbivory on transcription diminished strongly with time (<1% of genes were affected by herbivory after 3 weeks), and elevated CO2 interacted more strongly with herbivory than elevated O3. The majority of transcripts affected by elevated O3 were related to antioxidant metabolism. Constitutive levels and the induction by herbivory of key transcripts associated with defence and hormone signalling were down-regulated under elevated CO2; 1-aminocyclopropane-1-carboxylate (ACC) synthase, lipoxygenase (LOX), allene oxide synthase (AOS), allene oxide cyclase (AOC), chalcone synthase (CHS), polyphenol oxidase (PPO) and cysteine protease inhibitor (CystPI) were lower in abundance compared with levels under ambient conditions. By suppressing the ability to mount an effective defence, elevated CO2 may decrease resistance of soybean to herbivory.

Novel functions of the Arabidopsis transcription factor TCP5 in petal development and ethylene biosynthesis.

PubMed

van Es, Sam W; Silveira, Sylvia R; Rocha, Diego I; Bimbo, Andrea; Martinelli, Adriana P; Dornelas, Marcelo C; Angenent, Gerco C; Immink, Richard G H

2018-06-01

The flowers of most dicotyledons have petals that, together with the sepals, initially protect the reproductive organs. Later during development petals are required to open the flower and to attract pollinators. This diverse set of functions demands tight temporal and spatial regulation of petal development. We studied the functioning of the Arabidopsis thaliana TCP5-like transcription factors (TFs) in petals. Overexpression of TCP5 in petal epidermal cells results in smaller petals, whereas tcp5 tcp13 tcp17 triple knockout lines have wider petals with an increased surface area. Comprehensive expression studies revealed effects of TCP5-like TFs on the expression of genes related to the cell cycle, growth regulation and organ growth. Additionally, the ethylene biosynthesis genes 1-amino-cyclopropane-1-carboxylate (ACC) synthase 2 (ACS2) and ACC oxidase 2 (ACO2) and several ETHYLENE RESPONSE FACTORS (ERFs) are found to be differentially expressed in TCP5 mutant and overexpression lines. Chromatin immunoprecipitation-quantitative PCR showed direct binding of TCP5 to the ACS2 locus in vivo. Ethylene is known to influence cell elongation, and the petal phenotype of the tcp5 tcp13 tcp17 mutant could be complemented by treatment of the plants with an ethylene pathway inhibitor. Taken together, this reveals a novel role for TCP5-like TFs in the regulation of ethylene-mediated petal development and growth. © 2018 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

Antioxidative properties of the essential oil from Pinus mugo.

PubMed

Grassmann, Johanna; Hippeli, Susanne; Vollmann, Renate; Elstner, Erich F

2003-12-17

The essential oil from Pinus mugo (PMEO) was tested on its antioxidative capacity. For this purpose, several biochemical test systems were chosen (e.g., the Fenton System, the xanthine oxidase assay, or the copper-induced oxidation of low-density lipoprotein (LDL)). The results show that there is moderate or weak antioxidative activity when tested in aqueous environments, like in the Fenton system, xanthine oxidase induced superoxide radical formation, or in the HOCl driven fragmentation of 1-aminocyclopropane-1-carboxylic acid (ACC). In contrast, when tested in more lipophilic environments (e.g., the ACC-cleavage by activated neutrophils in whole blood) the PMEO exhibits good antioxidative activity. PMEO does also show good antioxidative capacity in another lipophilic test system (i.e., the copper induced oxidation of LDL). Some components of PMEO (i.e., Delta(3)-carene, camphene, alpha-pinene, (+)-limonene and terpinolene) were also tested. As the PMEO, they showed weak or no antioxidant activity in aqueous environments, but some of them were effective antioxidants regarding ACC-cleavage by activated neutrophils in whole blood or copper-induced LDL-oxidation. Terpinolene, a minor component of PMEO, exhibited remarkable protection against LDL-oxidation.

Ethylene biosynthesis by 1-aminocyclopropane-1-carboxylic acid oxidase: a DFT study.

PubMed

Bassan, Arianna; Borowski, Tomasz; Schofield, Christopher J; Siegbahn, Per E M

2006-11-24

The reaction catalyzed by the plant enzyme 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) was investigated by using hybrid density functional theory. ACCO belongs to the non-heme iron(II) enzyme superfamily and carries out the bicarbonate-dependent two-electron oxidation of its substrate ACC (1-aminocyclopropane-1-carboxylic acid) concomitant with the reduction of dioxygen and oxidation of a reducing agent probably ascorbate. The reaction gives ethylene, CO(2), cyanide and two water molecules. A model including the mononuclear iron complex with ACC in the first coordination sphere was used to study the details of O-O bond cleavage and cyclopropane ring opening. Calculations imply that this unusual and complex reaction is triggered by a hydrogen atom abstraction step generating a radical on the amino nitrogen of ACC. Subsequently, cyclopropane ring opening followed by O-O bond heterolysis leads to a very reactive iron(IV)-oxo intermediate, which decomposes to ethylene and cyanoformate with very low energy barriers. The reaction is assisted by bicarbonate located in the second coordination sphere of the metal.

Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition.

PubMed

Kolla, Nathan J; Chiuccariello, Lina; Wilson, Alan A; Houle, Sylvain; Links, Paul; Bagby, R Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V; Pasricha, Suvercha; Meyer, Jeffrey H

2016-01-15

Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. [(11)C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p < .001). In BPD, PFC and ACC MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = -.44, p = .023). These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Assay Methods for ACS Activity and ACS Phosphorylation by MAP Kinases In Vitro and In Vivo.

PubMed

Han, Xiaomin; Li, Guojing; Zhang, Shuqun

2017-01-01

Ethylene, a gaseous phytohormone, has profound effects on plant growth, development, and adaptation to the environment. Ethylene-regulated processes begin with the induction of ethylene biosynthesis. There are two key steps in ethylene biosynthesis. The first is the biosynthesis of 1-aminocyclopropane-1-carboxylic acid (ACC) from S-Adenosyl-Methionine (SAM), a common precursor in many metabolic pathways, which is catalyzed by ACC synthase (ACS). The second is the oxidative cleavage of ACC to form ethylene under the action of ACC oxidase (ACO). ACC biosynthesis is the committing and generally the rate-limiting step in ethylene biosynthesis. As a result, characterizing the cellular ACS activity and understanding its regulation are important. In this chapter, we detail the methods used to measure, (1) the enzymatic activity of both recombinant and native ACS proteins, and (2) the phosphorylation of ACS protein by mitogen-activated protein kinases (MAPKs) in vivo and in vitro.

NAC Transcription Factor SPEEDY HYPONASTIC GROWTH Regulates Flooding-Induced Leaf Movement in Arabidopsis[W

PubMed Central

Rauf, Mamoona; Arif, Muhammad; Fisahn, Joachim; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd

2013-01-01

In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important architectural stress response that critically determines plant performance in natural habitats. The directional growth is based on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis thaliana, governed by the NAC transcription factor SPEEDY HYPONASTIC GROWTH (SHYG). Overexpression of SHYG in transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several EXPANSIN and XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE genes encoding cell wall–loosening proteins was enhanced in SHYG overexpressors but lowered in shyg. We identified ACC OXIDASE5 (ACO5), encoding a key enzyme of ET biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging. PMID:24363315

NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis.

PubMed

Rauf, Mamoona; Arif, Muhammad; Fisahn, Joachim; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd

2013-12-01

In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important architectural stress response that critically determines plant performance in natural habitats. The directional growth is based on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis thaliana, governed by the NAC transcription factor speedy hyponastic growth (SHYG). Overexpression of SHYG in transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several expansin and xyloglucan endotransglycosylase/hydrolase genes encoding cell wall-loosening proteins was enhanced in SHYG overexpressors but lowered in shyg. We identified ACC oxidase5 (ACO5), encoding a key enzyme of ET biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging.

Polyamines and ethylene interact in rice grains in response to soil drying during grain filling.

PubMed

Chen, Tingting; Xu, Yunji; Wang, Jingchao; Wang, Zhiqin; Yang, Jianchang; Zhang, Jianhua

2013-05-01

This study tested the hypothesis that the interaction between polyamines and ethylene may mediate the effects of soil drying on grain filling of rice (Oryza sativa L.). Two rice cultivars were pot grown. Three treatments, well-watered, moderate soil drying (MD), and severe soil drying (SD), were imposed from 8 d post-anthesis until maturity. The endosperm cell division rate, grain-filling rate, and grain weight of earlier flowering superior spikelets showed no significant differences among the three treatments. However, those of the later flowering inferior spikelets were significantly increased under MD and significantly reduced under SD when compared with those which were well watered. The two cultivars showed the same tendencies. MD increased the contents of free spermidine (Spd) and free spermine (Spm), the activities of S-adenosyl-L-methionine decarboxylase and Spd synthase, and expression levels of polyamine synthesis genes, and decreased the ethylene evolution rate, the contents of 1-aminocylopropane-1-carboxylic acid (ACC) and hydrogen peroxide, the activities of ACC synthase, ACC oxidase, and polyamine oxidase, and the expression levels of ethylene synthesis genes in inferior spikelets. SD exhibited the opposite effects. Application of Spd, Spm, or an inhibitor of ethylene synthesis to rice panicles significantly reduced ethylene and ACC levels, but significantly increased Spd and Spm contents, grain-filling rate, and grain weight of inferior spikelets. The results were reversed when ACC or an inhibitor of Spd and Spm synthesis was applied. The results suggest that a potential metabolic interaction between polyamines and ethylene biosynthesis responds to soil drying and mediates the grain filling of inferior spikelets in rice.

Ethylene Synthesis Regulated by Biphasic Induction of 1-Aminocyclopropane-1-Carboxylic Acid Synthase and 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Genes Is Required for Hydrogen Peroxide Accumulation and Cell Death in Ozone-Exposed Tomato1

PubMed Central

Moeder, Wolfgang; Barry, Cornelius S.; Tauriainen, Airi A.; Betz, Christian; Tuomainen, Jaana; Utriainen, Merja; Grierson, Donald; Sandermann, Heinrich; Langebartels, Christian; Kangasjärvi, Jaakko

2002-01-01

We show that above a certain threshold concentration, ozone leads to leaf injury in tomato (Lycopersicon esculentum). Ozone-induced leaf damage was preceded by a rapid increase in 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, ACC content, and ethylene emission. Changes in mRNA levels of specific ACC synthase, ACC oxidase, and ethylene receptor genes occurred within 1 to 5 h. Expression of the genes encoding components of ethylene biosynthesis and perception, and biochemistry of ethylene synthesis suggested that ozone-induced ethylene synthesis in tomato is under biphasic control. In transgenic plants containing an LE-ACO1 promoter-β-glucuronidase fusion construct, β-glucuronidase activity increased rapidly at the beginning of the O3 exposure and had a spatial distribution resembling the pattern of extracellular H2O2 production at 7 h, which coincided with the cell death pattern after 24 h. Ethylene synthesis and perception were required for active H2O2 production and cell death resulting in visible tissue damage. The results demonstrate a selective ozone response of ethylene biosynthetic genes and suggest a role for ethylene, in combination with the burst of H2O2 production, in regulating the spread of cell death. PMID:12481074

Ethylene emission and PR protein synthesis in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions.

PubMed

Yim, Woojong; Seshadri, Sundaram; Kim, Kiyoon; Lee, Gillseung; Sa, Tongmin

2013-06-01

Bacteria of genus Methylobacterium have been found to promote plant growth and regulate the level of ethylene in crop plants. This work is aimed to test the induction of defense responses in tomato against bacterial wilt by stress ethylene level reduction mediated by the ACC deaminase activity of Methylobacterium strains. Under greenhouse conditions, the disease index value in Methylobacterium sp. inoculated tomato plants was lower than control plants. Plants treated with Methylobacterium sp. challenge inoculated with Ralstonia solanacearum (RS) showed significantly reduced disease symptoms and lowered ethylene emission under greenhouse condition. The ACC and ACO (1-aminocyclopropane-1-carboxylate oxidase) accumulation in tomato leaves were significantly reduced with Methylobacterium strains inoculation. While ACC oxidase gene expression was found higher in plants treated with R. solanacearum than Methylobacterium sp. treatment, PR proteins related to induced systemic resistance like β-1,3-glucanase, PAL, PO and PPO were increased in Methylobacterium sp. inoculated plants. A significant increase in β-1,3-glucanase and PAL gene expression was found in all the Methylobacterium spp. treatments compared to the R. solanacearum treatment. This study confirms the activity of Methylobacterium sp. in increasing the defense enzymes by modulating the ethylene biosynthesis pathway and suggests the use of methylotrophic bacteria as potential biocontrol agents in tomato cultivation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Gene expression analyses in tomato near isogenic lines provide evidence for ethylene and abscisic acid biosynthesis fine-tuning during arbuscular mycorrhiza development.

PubMed

Fracetto, Giselle Gomes Monteiro; Peres, Lázaro Eustáquio Pereira; Lambais, Marcio Rodrigues

2017-07-01

Plant responses to the environment and microorganisms, including arbuscular mycorrhizal fungi, involve complex hormonal interactions. It is known that abscisic acid (ABA) and ethylene may be involved in the regulation of arbuscular mycorrhiza (AM) and that part of the detrimental effects of ABA deficiency in plants is due to ethylene overproduction. In this study, we aimed to determine whether the low susceptibility to mycorrhizal colonization in ABA-deficient mutants is due to high levels of ethylene and whether AM development is associated with changes in the steady-state levels of transcripts of genes involved in the biosynthesis of ethylene and ABA. For that, tomato (Solanum lycopersicum) ethylene overproducer epinastic (epi) mutant and the ABA-deficient notabilis (not) and sitiens (sit) mutants, in the same Micro-Tom (MT) genetic background, were inoculated with Rhizophagus clarus, and treated with the ethylene biosynthesis inhibitor aminoethoxyvinylglycine (AVG). The development of AM, as well as the steady-state levels of transcripts involved in ethylene (LeACS2, LeACO1 and LeACO4) and ABA (LeNCED) biosynthesis, was determined. The intraradical colonization in epi, not and sit mutants was significantly reduced compared to MT. The epi mutant completely restored the mycorrhizal colonization to the levels of MT with the application of 10 µM of AVG, probably due to the inhibition of the ACC synthase gene expression. The steady-state levels of LeACS2 and LeACO4 transcripts were induced in mycorrhizal roots of MT, whereas the steady-state levels of LeACO1 and LeACO4 transcripts were significantly induced in sit, and the steady-state levels of LeNCED transcripts were significantly induced in all genotypes and in mycorrhizal roots of epi mutants treated with AVG. The reduced mycorrhizal colonization in sit mutants seems not to be limited by ethylene production via ACC oxidase regulation. Both ethylene overproduction and ABA deficiency impaired AM fungal colonization in tomato roots, indicating that, besides hormonal interactions, a fine-tuning of each hormone level is required for AM development.

Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

PubMed Central

Li, S J; Cronan, J E

1993-01-01

Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

A functional polymorphism of the MAOA gene is associated with neural responses to induced anger control.

PubMed

Denson, Thomas F; Dobson-Stone, Carol; Ronay, Richard; von Hippel, William; Schira, Mark M

2014-07-01

Aggressiveness is highly heritable. Recent experimental work has linked individual differences in a functional polymorphism of the monoamine oxidase-A gene (MAOA) to anger-driven aggression. Other work has implicated the dorsal ACC (dACC) in cognitive-emotional control and the amygdala in emotional arousal. The present imaging genetics study investigated dACC and amygdala reactivity to induced anger control as a function of MAOA genotype. A research assistant asked 38 healthy male undergraduates to control their anger in response to an insult by a rude experimenter. Men with the low-expression allele showed increased dACC and amygdala activation after the insult, but men with the high-expression allele did not. Both dACC and amygdala activation independently mediated the relationship between MAOA genotype and self-reported anger control. Moreover, following the insult, men with the high-functioning allele showed functional decoupling between the amygdala and dACC, but men with the low-functioning allele did not. These results suggest that heightened dACC and amygdala activation and their connectivity are neuroaffective mechanisms underlying anger control in participants with the low-functioning allele of the MAOA gene.

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

PubMed

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Identification of a melatonin receptor type 1A gene ( AccMTNR1A) in Apis cerana cerana and its possible involvement in the response to low temperature stress

NASA Astrophysics Data System (ADS)

Li, Guilin; Zhang, Yanming; Ni, Yong; Wang, Ying; Xu, Baohua; Guo, Xingqi

2018-04-01

It is known that melatonin plays an indispensable role in the defense against some environment-induced stresses. The melatonin receptor (MTNR) is also closely linked to the environmental stress response in mammals. However, little is known about the function of the MTNR in insects, including honeybees. In this study, we identified a MTNR from Apis cerana cerana named AccMTNR1A, which contained a typical seven-transmembrane domain common to this family of receptors. A subcellular localization analysis showed that AccMTNR1A was localized in the cytomembrane. Additionally, we found that cold stress apparently boosted AccMTNR1A transcription, indicating that AccMTNR1A possibly connects to the cold stress response. The knockdown of AccMTNR1A attenuated the expression level of some genes associated with the cold stress response, suggesting that AccMTNR1A likely plays an analogous role with these genes during low temperature stress response. Moreover, silencing of AccMTNR1A also suppressed the transcription of some antioxidant genes, prompting the possibility that the response of AccMTNR1A to cold stress response may be related to antioxidant signaling pathways. Collectively, the findings presented here provide evidence that AccMTNR1A may play essential roles in protecting Apis cerana cerana from cold stress.

Identification of a copper(I) intermediate in the conversion of 1-aminocyclopropane carboxylic acid (ACC) into ethylene by Cu(II)-ACC complexes and hydrogen peroxide.

PubMed

Ghattas, Wadih; Giorgi, Michel; Mekmouche, Yasmina; Tanaka, Tsunehiro; Rockenbauer, Antal; Réglier, Marius; Hitomi, Yutaka; Simaan, A Jalila

2008-06-02

Several Cu(II) complexes with ACC (=1-aminocyclopropane carboxylic acid) or AIB (=aminoisobutyric acid) were prepared using 2,2'-bipyridine, 1,10-phenanthroline, and 2-picolylamine ligands: [Cu(2,2'-bipyridine)(ACC)(H2O)](ClO4) (1a), [Cu(1,10-phenanthroline)(ACC)](ClO4) (2a), [Cu(2-picolylamine)(ACC)](ClO4) (3a), and [Cu(2,2'-bipyridine)(AIB)(H2O)](ClO4) (1b). All of the complexes were characterized by X-ray diffraction analysis. The Cu(II)-ACC complexes are able to convert the bound ACC moiety into ethylene in the presence of hydrogen peroxide, in an "ACC-oxidase-like" activity. A few equivalents of base are necessary to deprotonate H2O2 for optimum activity. The presence of dioxygen lowers the yield of ACC conversion into ethylene by the copper(II) complexes. During the course of the reaction of Cu(II)-ACC complexes with H2O2, brown species (EPR silent and lambda max approximately 435 nm) were detected and characterized as being the Cu(I)-ACC complexes that are obtained upon reduction of the corresponding Cu(II) complexes by the deprotonated form of hydrogen peroxide. The geometry of the Cu(I) species was optimized by DFT calculations that reveal a change from square-planar to tetrahedral geometry upon reduction of the copper ion, in accordance with the observed nonreversibility of the redox process. In situ prepared Cu(I)-ACC complexes were also reacted with hydrogen peroxide, and a high level of ethylene formation was obtained. We propose Cu(I)-OOH as a possible active species for the conversion of ACC into ethylene, the structure of which was examined by DFT calculation.

The role of monamine oxidase inhibition in the acute toxicity of chlordimeform.

DOT National Transportation Integrated Search

1977-08-01

This paper presents data from experiments on male rats performed to determine whether drugs which interfere with central amine mechanisms would decrease the lethality of the acaricide chlordimeform (and thus be of potential value as antidotes for acc...

Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

PubMed

Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

2013-01-01

Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

Selenium delays tomato fruit ripening by inhibiting ethylene biosynthesis and enhancing the antioxidant defense system.

PubMed

Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji

2017-03-15

The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

PubMed

Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

2003-02-01

Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

PubMed

Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

2014-05-01

In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

The influence of abscisic acid on the ethylene biosynthesis pathway in the functioning of the flower abscission zone in Lupinus luteus.

PubMed

Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan

2016-11-01

Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.

ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate.

PubMed

Keenan, Melissa M; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A; Murphy, Susan K; Lucas, Joseph; Muoio, Deborah M; Kim, So Young; Chi, Jen-Tsan

2015-10-01

In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future.

ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate

PubMed Central

Keenan, Melissa M.; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D.; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A.; Murphy, Susan K.; Lucas, Joseph; Muoio, Deborah M.; Kim, So Young; Chi, Jen-Tsan

2015-01-01

In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future. PMID:26452058

A Chemogenomic Screen Reveals Novel Snf1p/AMPK Independent Regulators of Acetyl-CoA Carboxylase.

PubMed

Bozaquel-Morais, Bruno L; Madeira, Juliana B; Venâncio, Thiago M; Pacheco-Rosa, Thiago; Masuda, Claudio A; Montero-Lomeli, Monica

2017-01-01

Acetyl-CoA carboxylase (Acc1p) is a key enzyme in fatty acid biosynthesis and is essential for cell viability. To discover new regulators of its activity, we screened a Saccharomyces cerevisiae deletion library for increased sensitivity to soraphen A, a potent Acc1p inhibitor. The hits identified in the screen (118 hits) were filtered using a chemical-phenotype map to exclude those associated with pleiotropic drug resistance. This enabled the identification of 82 ORFs that are genetic interactors of Acc1p. The main functional clusters represented by these hits were "transcriptional regulation", "protein post-translational modifications" and "lipid metabolism". Further investigation of the "transcriptional regulation" cluster revealed that soraphen A sensitivity is poorly correlated with ACC1 transcript levels. We also studied the three top unknown ORFs that affected soraphen A sensitivity: SOR1 (YDL129W), SOR2 (YIL092W) and SOR3 (YJR039W). Since the C18/C16 ratio of lipid acyl lengths reflects Acc1p activity levels, we evaluated this ratio in the three mutants. Deletion of SOR2 and SOR3 led to reduced acyl lengths, suggesting that Acc1p is indeed down-regulated in these strains. Also, these mutants showed no differences in Snf1p/AMPK activation status and deletion of SNF1 in these backgrounds did not revert soraphen A sensitivity completely. Furthermore, plasmid maintenance was reduced in sor2Δ strain and this trait was shared with 18 other soraphen A sensitive hits. In summary, our screen uncovered novel Acc1p Snf1p/AMPK-independent regulators.

Salicylic Acid Regulation of Respiration in Higher Plants: Alternative Oxidase Expression.

PubMed Central

Rhoads, DM; McIntosh, L

1992-01-01

Alternative respiratory pathway capacity increases during the development of the thermogenic appendix of a voodoo lily inflorescence. The levels of the alternative oxidase proteins increased dramatically between D-4 (4 days prior to the day of anthesis) and D-3 and continued to increase until the day of anthesis (D-day). The level of salicylic acid (SA) in the appendix is very low early on D-1, but increases to a high level in the evening of D-1. Thermogenesis occurs after a few hours of light on D-day. Therefore, the initial accumulation of the alternative oxidase proteins precedes the increase in SA by 3 days, indicating that other regulators may be involved. A 1.6-kb transcript encoding the alternative oxidase precursor protein accumulated to a high level in the appendix tissue by D-1. Application of SA to immature appendix tissue caused an increase in alternative pathway capacity and a dramatic accumulation of the alternative oxidase proteins and the 1.6-kb transcript. Time course experiments showed that the increase in capacity, protein levels, and transcript level corresponded precisely. The response to SA was blocked by cycloheximide or actinomycin D, indicating that de novo transcription and translation are required. However, nuclear, in vitro transcription assays indicated that the accumulation of the 1.6-kb transcript did not result from a simple increase in the rate of transcription of aox1. PMID:12297672

Increase in ACC oxidase levels and activities during paradormancy release of leafy spurge (Euphorbia esula) buds

USDA-ARS?s Scientific Manuscript database

The plant hormone ethylene is known to affect various developmental processes including dormancy and growth. Yet, little information is available about ethylene’s role during paradormancy break in adventitious buds of leafy spurge. In this study, we examined changes in ethylene evolution and the eth...

Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.

PubMed

El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila

2017-06-01

1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.

Targeting the Oncogenic Transcriptional Regulator MYB in Adenoid Cystic Carcinoma by Inhibition of IGF1R/AKT Signaling.

PubMed

Andersson, Mattias K; Afshari, Maryam K; Andrén, Ywonne; Wick, Michael J; Stenman, Göran

2017-09-01

Adenoid cystic carcinoma (ACC) is an aggressive cancer with no curative treatment for patients with recurrent/metastatic disease. The MYB-NFIB gene fusion is the main genomic hallmark and a potential therapeutic target. Oncogenic signaling pathways were studied in cultured cells and/or tumors from 15 ACC patients. Phospho-receptor tyrosine kinase (RTK) arrays were used to study the activity of RTKs. Effects of RTK inhibition on cell proliferation were analyzed with AlamarBlue, sphere assays, and two ACC xenograft models (n = 4-9 mice per group). The molecular effects of MYB-NFIB knockdown and IGF1R inhibition were studied with quantitative polymerase chain reaction, immunoblot, and gene expression microarrays. All statistical tests were two-sided. The MYB-NFIB fusion drives proliferation of ACC cells and is crucial for spherogenesis. Intriguingly, the fusion is regulated through AKT-dependent signaling induced by IGF1R overexpression and is downregulated upon IGF1R-inhibition (% expression of control ± SD = 27.2 ± 1.3, P < .001). MYB-NFIB regulates genes involved in cell cycle control, DNA replication/repair, and RNA processing. The transcriptional program induced by MYB-NFIB affects critical oncogenic mediators normally controlled by MYC and is reversed by pharmacological inhibition of IGF1R. Co-activation of epidermal growth factor receptor (EGFR) and MET promoted proliferation of ACC cells, and combined targeting of IGFR1/EGFR/MET induced differentiation and synergistically inhibited the growth of patient-derived xenografted ACCs (ACCX5M1, % growth of control ± SD = 34.9 ± 20.3, P = .006; ACCX6, % growth of control ± SD = 24.1 ± 17.5, P = .04). MYB-NFIB is an oncogenic driver and a key therapeutic target in ACC that is regulated by AKT-dependent IGF1R signaling. Our studies uncover a new strategy to target an oncogenic transcriptional master regulator and provide new important insights into the biology and treatment of ACC. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear 'Gold Nijisseiki'.

PubMed

Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping

2014-09-01

To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Extreme Hypoxic Conditions Induce Selective Molecular Responses and Metabolic Reset in Detached Apple Fruit

PubMed Central

Cukrov, Dubravka; Zermiani, Monica; Brizzolara, Stefano; Cestaro, Alessandro; Licausi, Francesco; Luchinat, Claudio; Santucci, Claudio; Tenori, Leonardo; Van Veen, Hans; Zuccolo, Andrea; Ruperti, Benedetto; Tonutti, Pietro

2016-01-01

The ripening physiology of detached fruit is altered by low oxygen conditions with profound effects on quality parameters. To study hypoxia-related processes and regulatory mechanisms, apple (Malus domestica, cv Granny Smith) fruit, harvested at commercial ripening, were kept at 1°C under normoxic (control) and hypoxic (0.4 and 0.8 kPa oxygen) conditions for up to 60 days. NMR analyses of cortex tissue identified eight metabolites showing significantly different accumulations between samples, with ethanol and alanine displaying the most pronounced difference between hypoxic and normoxic treatments. A rapid up-regulation of alcohol dehydrogenase and pyruvate-related metabolism (lactate dehydrogenase, pyruvate decarboxylase, alanine aminotransferase) gene expression was detected under both hypoxic conditions with a more pronounced effect induced by the lowest (0.4 kPa) oxygen concentration. Both hypoxic conditions negatively affected ACC synthase and ACC oxidase transcript accumulation. Analysis of RNA-seq data of samples collected after 24 days of hypoxic treatment identified more than 1000 genes differentially expressed when comparing 0.4 vs. 0.8 kPa oxygen concentration samples. Genes involved in cell-wall, minor and major CHO, amino acid and secondary metabolisms, fermentation and glycolysis as well as genes involved in transport, defense responses, and oxidation-reduction appeared to be selectively affected by treatments. The lowest oxygen concentration induced a higher expression of transcription factors belonging to AUX/IAA, WRKY, HB, Zinc-finger families, while MADS box family genes were more expressed when apples were kept under 0.8 kPa oxygen. Out of the eight group VII ERF members present in apple genome, two genes showed a rapid up-regulation under hypoxia, and western blot analysis showed that apple MdRAP2.12 proteins were differentially accumulated in normoxic and hypoxic samples, with the highest level reached under 0.4 kPa oxygen. These data suggest that ripe apple tissues finely and specifically modulate sensing and regulatory mechanisms in response to different hypoxic stress conditions. PMID:26909091

Subchronic glucocorticoids, glutathione depletion and a postpartum model elevate monoamine oxidase a activity in the prefrontal cortex of rats.

PubMed

Raitsin, Sofia; Tong, Junchao; Kish, Stephen; Xu, Xin; Magomedova, Lilia; Cummins, Carolyn; Andreazza, Ana C; Scola, Gustavo; Baker, Glen; Meyer, Jeffrey H

2017-07-01

Recent human brain imaging studies implicate dysregulation of monoamine oxidase-A (MAO-A), in particular in the prefrontal cortex (PFC) and anterior cingulate cortex (ACC), in the development of major depressive disorder (MDD). This study investigates the influence of four alterations underlying important pathologies of MDD, namely, chronic elevation of glucocorticoid levels, glutathione depletion, changes in female gonadal sex hormones and serotonin concentration fluctuation, on MAO-A and MAO-B activities in rats. Young adult rats exposed chronically to the synthetic glucocorticoid dexamethasone at 0, 0.05, 0.5, and 2.0mg/kg/day (osmotic minipumps) for eight days showed significant dose-dependent increases in activities of MAO-A in PFC (+17%, p<0.001) and ACC (+9%, p<0.01) and MAO-B in PFC (+14%, p<0.001) and increased serotonin turnover in the PFC (+31%, p<0.01), not accounted for by dexamethasone-induced changes in serotonin levels, since neither serotonin depletion nor supplementation affected MAO-A activity. Sub-acute depletion of the major antioxidant glutathione by diethyl maleate (5mmol/kg, i.p.) for three days, which resulted in a 36% loss of glutathione in PFC (p=0.0005), modestly, but significantly, elevated activities of MAO-A in PFC and MAO-B in PFC, ACC and hippocampus (+6-9%, p<0.05). Changes in estrogen and progesterone representing pseudopregnancy were associated with significantly elevated MAO-A activity in the ACC day 4-7 postpartum (10-18%, p<0.05 to p<0.0001) but not the PFC or hippocampus. Hence, our study provides data in support of strategies targeting glucocorticoid and glutathione systems, as well as changes in female sex hormones for normalization of MAO-A activities and thus treatment of mood disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

High-molecular-weight fibronectin synthesized by adenoid cystic carcinoma cells of salivary gland origin.

PubMed

Toyoshima, K; Kimura, S; Cheng, J; Oda, Y; Mori, K J; Saku, T

1999-03-01

To understand the morphogenesis of characteristic cribriform structures and the frequent invasion of salivary adenoid cystic carcinomas (ACC) along such basement membrane-rich structures as peripheral nerves, we have isolated fibronectin (FN) from the culture media of ACC3 cells established from a parotid ACC and characterized its glycosylation and alternative splicing status. FN isolated from ACC3 cells (ACC-FN) showed a molecular mass of 315 kDa in SDS-PAGE and was less heterogeneous and larger than plasma FN (pFN) or FNs from other cell sources. Differential enzymatic treatments of immunoprecipitated ACC-FN with neuraminidase, peptide-N-glycosidase F and endo-alpha-N-acetylgalactosaminidase revealed that ACC-FN was composed of a polypeptide chain of 270 kDa, with 10 kDa each of N-linked and O-linked oligosaccharide chains. Reverse transcription polymerase chain reaction (RT-PCR), in-situ hybridization, and immunofluorescence studies showed that most ACC-FNs contained ED-A, ED-B and IIICS regions in the molecules. This alternative splicing status of ACC-FN seemed to contribute to its less heterogeneous and larger molecular form. Cell attachment assay demonstrated that ACC-FN was more potent than pFN in adhesion of ACC3 cells. The results indicated that ACC-FN may function as a substrate for attachment of ACC3 cells, or that ACC3 cells trap and retain ACC-FN in their pericellular space. This isoform of FN may play an important role in the mode of invasion of ACC and the formation of stromal pseudocysts in the characteristic cribriform structure of ACC.

Permethrin Induces Overexpression of Cytochrome c Oxidase Subunit 3 in Aedes aegypti

USDA-ARS?s Scientific Manuscript database

Using quantitative PCR (QPCR), the relative transcriptional levels of cytochrome c oxidase subunit 3 (CO3) were studied in Aedes aegypti (L.) in response to treatments with acetone, permethrin, or fipronil. The transcriptional levels of CO3 were significantly (p <0.05) higher in acetone-treated Ae. ...

Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

NASA Astrophysics Data System (ADS)

Prayuni, Kinasih; Dwivany, Fenny M.

2015-09-01

Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

Resistance Responses of Potato to Vesicular-Arbuscular Mycorrhizal Fungi under Varying Abiotic Phosphorus Levels.

PubMed

McArthur, D A; Knowles, N R

1992-09-01

In mycorrhizal symbioses, susceptibility of a host plant to infection by fungi is influenced by environmental factors, especially the availability of soil phosphorus. This study describes morphological and biochemical details of interactions between a vesicular-arbuscular mycorrhizal (VAM) fungus and potato (Solanum tuberosum L. cv Russet Burbank) plants, with a particular focus on the physiological basis for P-induced resistance of roots to infection. Root infection by the VAM fungus Glomus fasciculatum ([Thaxt. sensu Gerdemann] Gerdemann and Trappe) was extensive for plants grown with low abiotic P supply, and plant biomass accumulation was enhanced by the symbiosis. The capacity of excised roots from P-deficient plants to produce ethylene in the presence or absence of exogenous 1-amino cyclopropane-1-carboxylic acid (ACC) was markedly reduced by VAM infection. This apparent inhibition of ACC oxidase (ACC(ox)) activity was localized to areas containing infected roots, as demonstrated in split-root studies. Furthermore, leachate from VAM roots contained a potent water-soluble inhibitor of ethylene generation from exogenous ACC by nonmycorrhizal (NM) roots. The leachate from VAM-infected roots had a higher concentration of phenolics, relative to that from NM roots. Moreover, the rates of ethylene formation and phenolic concentration in leachates from VAM roots were inversely correlated, suggesting that this inhibitor may be of a phenolic nature. The specific activity of extracellular peroxidase recovered in root leachates was not stimulated by VAM infection, although activity on a fresh weight basis was significantly enhanced, reflecting the fact that VAM roots had higher protein content than NM roots. Polyphenol oxidase activity of roots did not differ between NM and VAM roots. These results characterize the low resistance response of P-deficient plants to VAM infection. When plants were grown with higher abiotic P supply, the relative benefit of the VAM symbiosis to plant growth decreased and root infection was lower. The in vivo ACC(ox) activity was also greater in roots of plants grown on high levels of P compared with those grown on low levels, although the influence of VAM infection was partially to counteract the nutritional effect of P on ACC(ox) activity. Similar to ACC(ox) activity, extracellular peroxidase activity of roots increased linearly with increasing abiotic P supply, thus indicating a greater potential for resistance to VAM infection. These findings suggest that VAM fungi may alter phenolic metabolism of roots so as to hinder ethylene production and the root's ability to invoke a defense response. Raising the abiotic P supply to plants at least partially restores the capacity of roots to produce ethylene and may, in this way, increase the root's resistance to VAM infection.

Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

NASA Astrophysics Data System (ADS)

Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

2013-02-01

Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

NASA Astrophysics Data System (ADS)

Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

2016-04-01

Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

Adenoid cystic carcinoma: emerging role of translocations and gene fusions

PubMed Central

Wysocki, Piotr T.; Izumchenko, Evgeny; Meir, Juliet; Ha, Patrick K.; Sidransky, David; Brait, Mariana

2016-01-01

Adenoid cystic carcinoma (ACC), the second most common salivary gland malignancy, is notorious for poor prognosis, which reflects the propensity of ACC to progress to clinically advanced metastatic disease. Due to high long-term mortality and lack of effective systemic treatment, the slow-growing but aggressive ACC poses a particular challenge in head and neck oncology. Despite the advancements in cancer genomics, up until recently relatively few genetic alterations critical to the ACC development have been recognized. Although the specific chromosomal translocations resulting in MYB-NFIB fusions provide insight into the ACC pathogenesis and represent attractive diagnostic and therapeutic targets, their clinical significance is unclear, and a substantial subset of ACCs do not harbor the MYB-NFIB translocation. Strategies based on detection of newly described genetic events (such as MYB activating super-enhancer translocations and alterations affecting another member of MYB transcription factor family-MYBL1) offer new hope for improved risk assessment, therapeutic intervention and tumor surveillance. However, the impact of these approaches is still limited by an incomplete understanding of the ACC biology, and the manner by which these alterations initiate and drive ACC remains to be delineated. This manuscript summarizes the current status of gene fusions and other driver genetic alterations in ACC pathogenesis and discusses new therapeutic strategies stemming from the current research. PMID:27533466

Interaction of Light and Ethylene on Stem Gravitropism

NASA Technical Reports Server (NTRS)

Harrison, Marcia A.

1996-01-01

The major objective of this study was to evaluate light-regulated ethylene production during gravitropic bending in etiolated pea stems. Previous investigations indicated that ethylene production increases after gravistimulation and is associated with the later (counter-reactive) phase of bending. Additionally, changes in the counter-reaction and locus of curvature during gravitropism are greatly influenced by red light and ethylene production. Ethylene production may be regulated by the levels of available precursor (1-aminocyclopropane-l-carboxylic acid, ACC) via its synthesis, conjugation to malonyl-ACC or glutamyl-ACC, or oxidation to ethylene. The regulation of ethylene production by quantifying ACC and conjugated ACC levels in gravistimulated pea stemswas examined. Also measured was the changes in protein and enzyme activity associated with gravitropic curvature by electrophoretic and spectrophotometric techniques. An image analysis system was used to visualize and quantify enzymatic activity and transcriptional products in gravistimulated and red-light treated etiolated pea stem tissues.

Novel chromosomal rearrangements and break points at the t(6;9) in salivary adenoid cystic carcinoma: association with MYB-NFIB chimeric fusion, MYB expression, and clinical outcome.

PubMed

Mitani, Yoshitsugu; Rao, Pulivarthi H; Futreal, P Andrew; Roberts, Dianna B; Stephens, Philip J; Zhao, Yi-Jue; Zhang, Li; Mitani, Mutsumi; Weber, Randal S; Lippman, Scott M; Caulin, Carlos; El-Naggar, Adel K

2011-11-15

To investigate the molecular genetic heterogeneity associated with the t(6:9) in adenoid cystic carcinoma (ACC) and correlate the findings with patient clinical outcome. Multimolecular and genetic techniques complemented with massive pair-ended sequencing and single-nucleotide polymorphism array analyses were used on tumor specimens from 30 new and 52 previously analyzed fusion transcript-negative ACCs by reverse transcriptase PCR (RT-PCR). MYB mRNA expression level was determined by quantitative RT-PCR. The results of 102 tumors (30 new and 72 previously reported cases) were correlated with the clinicopathologic factors and patients' survival. The FISH analysis showed 34 of 82 (41.5%) fusion-positive tumors and molecular techniques identified fusion transcripts in 21 of the 82 (25.6%) tumors. Detailed FISH analysis of 11 out the 15 tumors with gene fusion without transcript formation showed translocation of NFIB sequences to proximal or distal sites of the MYB gene. Massive pair-end sequencing of a subset of tumors confirmed the proximal translocation to an NFIB sequence and led to the identification of a new fusion gene (NFIB-AIG1) in one of the tumors. Overall, MYB-NFIB gene fusion rate by FISH was in 52.9% whereas fusion transcript forming incidence was 38.2%. Significant statistical association between the 5' MYB transcript expression and patient survival was found. We conclude that: (i) t(6;9) results in complex genetic and molecular alterations in ACC, (ii) MYB-NFIB gene fusion may not always be associated with chimeric transcript formation, (iii) noncanonical MYB-NFIB gene fusions occur in a subset of tumors, (iv) high MYB expression correlates with worse patient survival.

Novel Chromosomal Rearrangements and breakpoints at the t(6;9) in Salivary Adenoid Cystic Carcinoma: association with MYB-NFIB chimeric fusion, MYB expression, and clinical outcome

PubMed Central

Mitani, Yoshitsugu; Rao, Pulivarthi H.; Futreal, P. Andrew; Roberts, Dianna B.; Stephens, Philip J.; Zhao, Yi-Jue; Zhang, Li; Mitani, Mutsumi; Weber, Randal S.; Lippman, Scott M.; Caulin, Carlos; El-Naggar, Adel K.

2011-01-01

Objective To investigate the molecular-genetic heterogeneity associated with the t(6:9) in adenoid cystic carcinoma (ACC) and correlate the findings with patient clinical outcome. Experimental Design Multi-molecular and genetic techniques complemented with massive pair-ended sequencing and SNP array analyses were used on tumor specimens from 30 new and 52 previously RT-PCR analyzed fusion transcript negative ACCs. MYB mRNA expression level was determined by quantitative RT-PCR. The results of 102 tumors (30 new and 72 previously reported cases) were correlated with the clinicopathologic factors and patients’ survival. Results The FISH analysis showed 34/82 (41.5%) fusion positive tumors and molecular techniques identified fusion transcripts in 21 of the 82 (25.6%) tumors. Detailed FISH analysis of 11 out the 15 tumors with gene fusion without transcript formation showed translocation of NFIB sequences to proximal or distal sites of the MYB gene. Massive pair-end sequencing of a subset of tumors confirmed the proximal translocation to an NFIB sequence and led to the identification of a new fusion gene (NFIB-AIG1) in one of the tumors. Overall, MYB-NFIB gene fusion rate by FISH was in 52.9% while fusion transcript forming incidence was 38.2%. Significant statistical association between the 5′ MYB transcript expression and patient survival was found. Conclusions We conclude that: 1) t(6;9) results in a complex genetic and molecular alterations in ACC, 2) MYB-NFIB gene fusion may not always be associated with chimeric transcript formation, 3) non-canonical MYB, NFIB gene fusions occur in a subset of tumors, 4) high MYB expression correlates with worse patient survival. PMID:21976542

Spine growth in the anterior cingulate cortex is necessary for the consolidation of contextual fear memory

PubMed Central

Vetere, Gisella; Restivo, Leonardo; Cole, Christina J.; Ross, P. Joel; Ammassari-Teule, Martine; Josselyn, Sheena A.; Frankland, Paul W.

2011-01-01

Remodeling of cortical connectivity is thought to allow initially hippocampus-dependent memories to be expressed independently of the hippocampus at remote time points. Consistent with this, consolidation of a contextual fear memory is associated with dendritic spine growth in neurons of the anterior cingulate cortex (aCC). To directly test whether such cortical structural remodeling is necessary for memory consolidation, we disrupted spine growth in the aCC at different times following contextual fear conditioning in mice. We took advantage of previous studies showing that the transcription factor myocyte enhancer factor 2 (MEF2) negatively regulates spinogenesis both in vitro and in vivo. We found that increasing MEF2-dependent transcription in the aCC during a critical posttraining window (but not at later time points) blocked both the consolidation-associated dendritic spine growth and subsequent memory expression. Together, these data strengthen the causal link between cortical structural remodeling and memory consolidation and, further, identify MEF2 as a key regulator of these processes. PMID:21531906

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

PubMed

Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

2017-04-01

The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

Combined transcriptome studies identify AFF3 as a mediator of the oncogenic effects of β-catenin in adrenocortical carcinoma

PubMed Central

Lefèvre, L; Omeiri, H; Drougat, L; Hantel, C; Giraud, M; Val, P; Rodriguez, S; Perlemoine, K; Blugeon, C; Beuschlein, F; de Reyniès, A; Rizk-Rabin, M; Bertherat, J; Ragazzon, B

2015-01-01

Adrenocortical cancer (ACC) is a very aggressive tumor, and genomics studies demonstrate that the most frequent alterations of driver genes in these cancers activate the Wnt/β-catenin signaling pathway. However, the adrenal-specific targets of oncogenic β-catenin-mediating tumorigenesis have not being established. A combined transcriptomic analysis from two series of human tumors and the human ACC cell line H295R harboring a spontaneous β-catenin activating mutation was done to identify the Wnt/β-catenin targets. Seven genes were consistently identified in the three studies. Among these genes, we found that AFF3 mediates the oncogenic effects of β-catenin in ACC. The Wnt response element site located at nucleotide position −1408 of the AFF3 transcriptional start sites (TSS) mediates the regulation by the Wnt/β-catenin signaling pathway. AFF3 silencing decreases cell proliferation and increases apoptosis in the ACC cell line H295R. AFF3 is located in nuclear speckles, which play an important role in RNA splicing. AFF3 overexpression in adrenocortical cells interferes with the organization and/or biogenesis of these nuclear speckles and alters the distribution of CDK9 and cyclin T1 such that they accumulate at the sites of AFF3/speckles. We demonstrate that AFF3 is a new target of Wnt/β-catenin pathway involved in ACC, acting on transcription and RNA splicing. PMID:26214578

Effect of 1-methylcyclopropene on shelf life, visual quality and nutritional quality of netted melon.

PubMed

Shi, Y; Wang, B L; Shui, D J; Cao, L L; Wang, C; Yang, T; Wang, X Y; Ye, H X

2015-04-01

The effects of 1-methylcyclopropene (1-MCP) on shelf life, fruit visual quality and nutritional quality were investigated. Netted melons were treated with air (control) and 0.6 µl l(-1) 1-MCP at 25 ℃ for 24 h, and then stored at 25 ℃ or 10 ℃ for 10 days. 1-MCP significantly extended the shelf life, inhibited weight loss and delayed firmness decline of melon fruits. Ethylene production was also inhibited and respiration rate was declined. 1-MCP retarded 1-aminocyclopropane-1-carboxylic acid (ACC) increases and inhibited ACC synthase and ACC oxidase activity. Moreover, 1-MCP treatment reduced the decrease in total soluble solids and titratable acidity, as well as the decrease of the content of sugars (sucrose, fructose and glucose). These results indicated that 1-MCP treatment is a good method to extend melon shelf life and maintain fruit quality, and the combination of 1-MCP and low temperature storage resulted in more acceptable fruit quality. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Red light regulation of ethylene biosynthesis and gravitropism in etiolated pea stems

NASA Technical Reports Server (NTRS)

Steed, C. L.; Taylor, L. K.; Harrison, M. A.

2004-01-01

During gravitropism, the accumulation of auxin in the lower side of the stem causes increased growth and the subsequent curvature, while the gaseous hormone ethylene plays a modulating role in regulating the kinetics of growth asymmetries. Light also contributes to the control of gravitropic curvature, potentially through its interaction with ethylene biosynthesis. In this study, red-light pulse treatment of etiolated pea epicotyls was evaluated for its effect on ethylene biosynthesis during gravitropic curvature. Ethylene biosynthesis analysis included measurements of ethylene; the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC); malonyl-conjugated ACC (MACC); and expression levels of pea ACC oxidase (Ps-ACO1) and ACC synthase (Ps-ACS1, Ps-ACS2) genes by reverse transcriptase-polymerase chain reaction analysis. Red-pulsed seedlings were given a 6 min pulse of 11 micromoles m-2 s-1 red-light 15 h prior to horizontal reorientation for consistency with the timeline of red-light inhibition of ethylene production. Red-pulse treatment significantly reduced ethylene production and MACC levels in epicotyl tissue. However, there was no effect of red-pulse treatment on ACC level, or expression of ACS or ACO genes. During gravitropic curvature, ethylene production increased from 60 to 120 min after horizontal placement in both control and red-pulsed epicotyls. In red-pulsed tissues, ACC levels increased by 120 min after horizontal reorientation, accompanied by decreased MACC levels in the lower portion of the epicotyl. Overall, our results demonstrate that ethylene production in etiolated epicotyls increases after the initiation of curvature. This ethylene increase may inhibit cell growth in the lower portion of the epicotyl and contribute to tip straightening and reduced overall curvature observed after the initial 60 min of curvature in etiolated pea epicotyls.

AccR Is a Master Regulator Involved in Carbon Catabolite Repression of the Anaerobic Catabolism of Aromatic Compounds in Azoarcus sp. CIB*

PubMed Central

Valderrama, J. Andrés; Shingler, Victoria; Carmona, Manuel; Díaz, Eduardo

2014-01-01

Here we characterized the first known transcriptional regulator that accounts for carbon catabolite repression (CCR) control of the anaerobic catabolism of aromatic compounds in bacteria. The AccR response regulator of Azoarcus sp. CIB controls succinate-responsive CCR of the central pathways for the anaerobic catabolism of aromatics by this strain. Phosphorylation of AccR to AccR-P triggers a monomer-to-dimer transition as well as the ability to bind to the target promoter and causes repression both in vivo and in vitro. Substitution of the Asp60 phosphorylation target residue of the N-terminal receiver motif of AccR to a phosphomimic Glu residue generates a constitutively active derivative that behaves as a superrepressor of the target genes. AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two different locations within the PN promoter of the bzd genes for anaerobic benzoate degradation. Because the DNA binding-proficient C-terminal domain of AccR is monomeric, we propose an activation mechanism in which phosphorylation of Asp60 of AccR alleviates interdomain repression mediated by the N-terminal domain. The presence of AccR-like proteins encoded in the genomes of other β-proteobacteria of the Azoarcus/Thauera group further suggests that AccR constitutes a master regulator that controls anaerobic CCR in these bacteria. PMID:24302740

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

PubMed Central

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Stamen-derived bioactive gibberellin is essential for male flower development of Cucurbita maxima L.

PubMed Central

Pimenta Lange, Maria João; Knop, Nicole; Lange, Theo

2012-01-01

Gibberellin (GA) signalling during pumpkin male flower development is highly regulated, including biosynthetic, perception, and transduction pathways. GA 20-oxidases, 3-oxidases, and 2-oxidases catalyse the final part of GA synthesis. Additionally, 7-oxidase initiates this part of the pathway in some cucurbits including Cucurbita maxima L. (pumpkin). Expression patterns for these GA-oxidase-encoding genes were examined by competitive reverse transcription-PCR (RT-PCR) and endogenous GA levels were determined during pumpkin male flower development. In young flowers, GA20ox3 transcript levels are high in stamens, followed by high levels of the GA precursor GA9. Later, just before flower opening, transcript levels for GA3ox3 and GA3ox4 increase in the hypanthium and stamens, respectively. In the stamen, following GA3ox4 expression, bioactive GA4 levels rise dramatically. Accordingly, catabolic GA2ox2 and GA2ox3 transcript levels are low in developing flowers, and increase in mature flowers. Putative GA receptor GID1b and DELLA repressor GAIPb transcript levels do not change in developing flowers, but increase sharply in mature flowers. Emasculation arrests floral development completely and leads to abscission of premature flowers. Application of GA4 (but not of its precursors GA12-aldehyde or GA9) restores normal growth of emasculated flowers. These results indicate that de novo GA4 synthesis in the stamen is under control of GA20ox3 and GA3ox4 genes just before the rapid flower growth phase. Stamen-derived bioactive GA is essential and sufficient for male flower development, including the petal and the pedicel growth. PMID:22268154

Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xianwei, E-mail: XWang2@UAMS.edu; Lu, Jingjun; Khaidakov, Magomed

Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiacmore » fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac fibroblast growth and collagen formation. ► Aspirin decreases the transcription of angiotensin II type 1 receptor by inhibiting NADPH oxidase–NF-κB pathway. ► The inhibition of angiotensin II type 1 receptor expression may be the basis for reduction in fibroblast growth and collagen formation. ► The effects of aspirin appear to be mediated via its salicylate moiety.« less

Developmental characterization and environmental stress responses of Y-box binding protein 1 gene (AccYB-1) from Apis cerana cerana.

PubMed

Li, Guilin; Wang, Lijun; Wang, Ying; Li, Han; Liu, Zhenguo; Wang, Hongfang; Xu, Baohua; Guo, Xingqi

2018-06-22

Y-box binding protein 1 (YB-1) is a member of the cold shock domain protein superfamily and is involved in development, environmental stresses and DNA oxidative damage in many organisms. However, the precise functions of YB-1 are still not well understood in various insects, including bees. In the current study, we identified a YB-1 gene in Apis cerana cerana (AccYB-1). The predicted cis-acting elements in the promoter sequence of AccYB-1 indicated its possible roles in development and stress responses. AccYB-1 expression was higher in one-day-old larvae and dark-eyed pupae than in other development stages. Tissue-specific expression analysis showed that the mRNA level of AccYB-1 was higher in the thorax and midgut than in other tissues. The results from real-time PCR showed that AccYB-1 was induced by many environmental stresses. Silencing AccYB-1 downregulated the transcriptional level of some growth- and development-related genes and antioxidant genes and decreased the enzyme activities of several antioxidant-related enzymes, further indicating a possible function of AccYB-1 in growth, development and stress responses. Taken together, our findings suggest that AccYB-1 may play an indispensable role in growth and development and environmental stress responses in Apis cerana cerana. To our knowledge, this is the first paper to explore the role of YB-1 in bees. Copyright © 2018. Published by Elsevier B.V.

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum.

PubMed

Tang, Yuanman; Liu, Qiuping; Liu, Ying; Zhang, Linli; Ding, Wei

2017-01-01

Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA)-responsive genes NtPR1a/c , NtPR2 and NtCHN50 , JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26 . Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum . Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans

PubMed Central

Ewald, Collin Yvès; Hourihan, John M; Bland, Monet S; Obieglo, Carolin; Katic, Iskra; Moronetti Mazzeo, Lorenza E; Alcedo, Joy; Blackwell, T Keith; Hynes, Nancy E

2017-01-01

Transient increases in mitochondrially-derived reactive oxygen species (ROS) activate an adaptive stress response to promote longevity. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidases produce ROS locally in response to various stimuli, and thereby regulate many cellular processes, but their role in aging remains unexplored. Here, we identified the C. elegans orthologue of mammalian mediator of ErbB2-driven cell motility, MEMO-1, as a protein that inhibits BLI-3/NADPH oxidase. MEMO-1 is complexed with RHO-1/RhoA/GTPase and loss of memo-1 results in an enhanced interaction of RHO-1 with BLI-3/NADPH oxidase, thereby stimulating ROS production that signal via p38 MAP kinase to the transcription factor SKN-1/NRF1,2,3 to promote stress resistance and longevity. Either loss of memo-1 or increasing BLI-3/NADPH oxidase activity by overexpression is sufficient to increase lifespan. Together, these findings demonstrate that NADPH oxidase-induced redox signaling initiates a transcriptional response that protects the cell and organism, and can promote both stress resistance and longevity. DOI: http://dx.doi.org/10.7554/eLife.19493.001 PMID:28085666

SLC12A7 alters adrenocortical carcinoma cell adhesion properties to promote an aggressive invasive behavior.

PubMed

Brown, Taylor C; Murtha, Timothy D; Rubinstein, Jill C; Korah, Reju; Carling, Tobias

2018-06-08

Altered expression of Solute Carrier Family 12 Member 7 (SLC12A7) is implicated to promote malignant behavior in multiple cancer types through an incompletely understood mechanism. Recent studies have shown recurrent gene amplifications and overexpression of SLC12A7 in adrenocortical carcinoma (ACC). The potential mechanistic effect(s) of SLC12A7 amplifications in portending an aggressive behavior in ACC has not been previously studied and is investigated here using two established ACC cell lines, SW-13 and NCI-H295R. SW-13 cells, which express negligible amounts of SLC12A7, were enforced to express SLC12A7 constitutively, while RNAi gene silencing was performed in NCI-H295R cells, which have robust endogenous expression of SLC12A7. In vitro studies tested the outcomes of experimental alterations in SLC12A7 expression on malignant characteristics, including cell viability, growth, colony formation potential, motility, invasive capacity, adhesion and detachment kinetics, and cell membrane organization. Further, potential alterations in transcription regulation downstream to induced SLC12A7 overexpression was explored using targeted transcription factor expression arrays. Enforced SLC12A7 overexpression in SW-13 cells robustly promoted motility and invasive characteristics (p < 0.05) without significantly altering cell viability, growth, or colony formation potential. SLC12A7 overexpression also significantly increased rates of cellular attachment and detachment turnover (p < 0.05), potentially propelled by increased filopodia formation and/or Ezrin interaction. In contrast, RNAi gene silencing of SLC12A7 stymied cell attachment strength as well as migration and invasion capacity in NCI-H295R cells. Transcription factor expression analysis identified multiple signally pathways potentially affected by SLC12A7 overexpression, including osmotic stress, bone morphogenetic protein, and Hippo signaling pathways. Amplification of SLC12A7 observed in ACCs is shown here, in vitro, to exacerbate the malignant behavior of ACC cells by promoting invasive capacities, possibly mediated by alterations in multiple signaling pathways, including the osmotic stress pathway.

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

Primary pulmonary adenoid cystic carcinoma: clinicopathological analyses of 12 cases.

PubMed

Qing, Song; Zhou, Keming; Liu, Xia; Li, Xiaohong; Deng, Feiyan; Ma, Yuqing

2015-01-01

Adenoid cystic primary pulmonary carcinomas (adenoid cystic carcinomas or ACCs) are rare tumors, so we described the clinical and pathological features of these tumors and related these findings with diagnosis and prognosis of ACC, comparing our data to the existing literature. Clinical and pathological features of 12 ACC cases were observed and described. Immunohistochemical EnVision staining, fluorescent PCR detection, and FISH were used to characterize tumor samples and the literature was reviewed. Of the 12 ACC cases (7 male; average 53.1 years-of-age; range 33-78 years), the chief presentation symptom was cough, followed by expectoration, gasping, and bloody sputum. Microscopically, histopathology revealed cribriform, tubular, or solid cords. CD117 was overexpressed in glandular epithelia in 9 cases and calcitonin and thyroid transcription factor-1 (TTF-1) were overexpressed in 4 cases. One case was positive for EML4 ALK gene rearrangement. ACC is a low-grade malignant tumor with poor prognosis and high recurrence and metastases. TTF-1 expression indicates a primary tumor and CD117 expression is not significant to prognosis.

A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

PubMed Central

Chang, Ing-Feng

2013-01-01

Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana.

PubMed

Huang, Shih-Jhe; Chang, Chia-Lun; Wang, Po-Hsun; Tsai, Min-Chieh; Hsu, Pang-Hung; Chang, Ing-Feng

2013-11-01

Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis.

Deficiencies in acetyl-CoA carboxylase and fatty acid synthase 1 differentially affect eggshell formation and blood meal digestion in Aedes aegypti.

PubMed

Alabaster, Amy; Isoe, Jun; Zhou, Guoli; Lee, Ada; Murphy, Ashleigh; Day, W Anthony; Miesfeld, Roger L

2011-12-01

To better understand the mechanism of de novo lipid biosynthesis in blood fed Aedes aegypti mosquitoes, we quantitated acetyl-CoA carboxylase (ACC) and fatty acid synthase 1 (FAS1) transcript levels in blood fed mosquitoes, and used RNAi methods to generate ACC and FAS1 deficient mosquitoes. Using the ketogenic amino acid (14)C-leucine as a metabolic precursor of (14)C-acetyl-CoA, we found that (14)C-triacylglycerol and (14)C-phospholipid levels were significantly reduced in both ACC and FAS1 deficient mosquitoes, confirming that ACC and FAS1 are required for de novo lipid biosynthesis after blood feeding. Surprisingly however, we also found that ACC deficient mosquitoes, but not FAS1 deficient mosquitoes, produced defective oocytes, which lacked an intact eggshell and gave rise to inviable eggs. This severe phenotype was restricted to the 1st gonotrophic cycle, suggesting that the eggshell defect was due to ACC deficiencies in the follicular epithelial cells, which are replaced after each gonotrophic cycle. Consistent with lower amounts of de novo lipid biosynthesis, both ACC and FAS1 deficient mosquitoes produced significantly fewer eggs than control mosquitoes in both the 1st and 2nd gonotrophic cycles. Lastly, FAS1 deficient mosquitoes, but not ACC deficient mosquitoes, showed delayed blood meal digestion, suggesting that a feedback control mechanism may coordinate rates of fat body lipid biosynthesis and midgut digestion during feeding. We propose that decreased ACC and FAS1 enzyme levels lead to reduced lipid biosynthesis and lower fecundity, whereas altered levels of the regulatory metabolites acetyl-CoA and malonyl-CoA account for the observed defects in eggshell formation and blood meal digestion, respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

Deficiencies in acetyl-CoA carboxylase and fatty acid synthase 1 differentially affect eggshell formation and blood meal digestion in Aedes aegypti

PubMed Central

Alabaster, Amy; Isoe, Jun; Zhou, Guoli; Lee, Ada; Murphy, Ashleigh; Day, W. Anthony; Miesfeld, Roger L.

2011-01-01

To better understand the mechanism of de novo lipid biosynthesis in blood fed Ae. aegypti mosquitoes, we quantitated acetyl-CoA carboxylase (ACC) and fatty acid synthase 1 (FAS1) transcript levels in blood fed mosquitoes, and used RNAi methods to generate ACC and FAS1 deficient mosquitoes. Using the ketogenic amino acid 14C-leucine as a metabolic precursor of 14C-acetyl-CoA, we found that 14C-triacylglycerol and 14C-phospholipid levels were significantly reduced in both ACC and FAS1 deficient mosquitoes, confirming that ACC and FAS1 are required for de novo lipid biosynthesis after blood feeding. Surprisingly however, we also found that ACC deficient mosquitoes, but not FAS1 deficient mosquitoes, produced defective oocytes, which lacked an intact eggshell and gave rise to inviable eggs. This severe phenotype was restricted to the 1st gonotrophic cycle, suggesting that the eggshell defect was due to ACC deficiencies in the follicular epithelial cells, which are replaced after each gonotrophic cycle. Consistent with lower amounts of de novo lipid biosynthesis, both ACC and FAS1 deficient mosquitoes produced significantly fewer eggs than control mosquitoes in both the 1st and 2nd gonotrophic cycles. Lastly, FAS1 deficient mosquitoes, but not ACC deficient mosquitoes, showed delayed blood meal digestion, suggesting that a feedback control mechanism may coordinate rates of fat body lipid biosynthesis and midgut digestion during feeding. We propose that decreased ACC and FAS1 enzyme levels lead to reduced lipid biosynthesis and lower fecundity, whereas altered levels of the regulatory metabolites acetyl-CoA and malonyl-CoA account for the observed defects in eggshell formation and blood meal digestion, respectively. PMID:21971482

The Role of Ethylene and Cold Temperature in the Regulation of the Apple POLYGALACTURONASE1 Gene and Fruit Softening1[W][OA

PubMed Central

Tacken, Emma; Ireland, Hilary; Gunaseelan, Kularajathevan; Karunairetnam, Sakuntala; Wang, Daisy; Schultz, Keith; Bowen, Judith; Atkinson, Ross G.; Johnston, Jason W.; Putterill, Jo; Hellens, Roger P.; Schaffer, Robert J.

2010-01-01

Fruit softening in apple (Malus × domestica) is associated with an increase in the ripening hormone ethylene. Here, we show that in cv Royal Gala apples that have the ethylene biosynthetic gene ACC OXIDASE1 suppressed, a cold treatment preconditions the apples to soften independently of added ethylene. When a cold treatment is followed by an ethylene treatment, a more rapid softening occurs than in apples that have not had a cold treatment. Apple fruit softening has been associated with the increase in the expression of cell wall hydrolase genes. One such gene, POLYGALACTURONASE1 (PG1), increases in expression both with ethylene and following a cold treatment. Transcriptional regulation of PG1 through the ethylene pathway is likely to be through an ETHYLENE-INSENSITIVE3-like transcription factor, which increases in expression during apple fruit development and transactivates the PG1 promoter in transient assays in the presence of ethylene. A cold-related gene that resembles a COLD BINDING FACTOR (CBF) class of gene also transactivates the PG1 promoter. The transactivation by the CBF-like gene is greatly enhanced by the addition of exogenous ethylene. These observations give a possible molecular mechanism for the cold- and ethylene-regulated control of fruit softening and suggest that either these two pathways act independently and synergistically with each other or cold enhances the ethylene response such that background levels of ethylene in the ethylene-suppressed apples is sufficient to induce fruit softening in apples. PMID:20237022

Withaferin A suppresses the up-regulation of acetyl-coA carboxylase 1 and skin tumor formation in a skin carcinogenesis mouse model.

PubMed

Li, Wenjuan; Zhang, Chunjing; Du, Hongyan; Huang, Vincent; Sun, Brandi; Harris, John P; Richardson, Quitin; Shen, Xinggui; Jin, Rong; Li, Guohong; Kevil, Christopher G; Gu, Xin; Shi, Runhua; Zhao, Yunfeng

2016-11-01

Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has been launched to test WA in treating melanoma. Herein, WA's chemopreventive potential was tested in a chemically-induced skin carcinogenesis mouse model. Pathological examinations revealed that WA significantly suppressed skin tumor formation. Morphological observations of the skin tissues suggest that WA suppressed cell proliferation rather than inducing apoptosis during skin carcinogenesis. Antibody Micro array analysis demonstrated that WA blocked carcinogen-induced up-regulation of acetyl-CoA carboxylase 1 (ACC1), which was further confirmed in a skin cell transformation model. Overexpression of ACC1 promoted whereas knockdown of ACC1 suppressed anchorage-independent growth and oncogene activation of transformable skin cells. Further studies demonstrated that WA inhibited tumor promotor-induced ACC1 gene transcription by suppressing the activation of activator protein 1. In melanoma cells, WA was also able to suppress the expression levels of ACC1. Finally, results using human skin cancer tissues confirmed the up-regulation of ACC1 in tumors than adjacent normal tissues. In summary, our results suggest that withaferin A may have a potential in chemoprevention and ACC1 may serve as a critical target of WA. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

PubMed

Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

2014-05-01

Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

Inhibition of ethylene production by putrescine alleviates aluminium-induced root inhibition in wheat plants.

PubMed

Yu, Yan; Jin, Chongwei; Sun, Chengliang; Wang, Jinghong; Ye, Yiquan; Zhou, Weiwei; Lu, Lingli; Lin, Xianyong

2016-01-08

Inhibition of root elongation is one of the most distinct symptoms of aluminium (Al) toxicity. Although putrescine (Put) has been identified as an important signaling molecule involved in Al tolerance, it is yet unknown how Put mitigates Al-induced root inhibition. Here, the possible mechanism was investigated by using two wheat genotypes differing in Al resistance: Al-tolerant Xi Aimai-1 and Al-sensitive Yangmai-5. Aluminium caused more root inhibition in Yangmai-5 and increased ethylene production at the root apices compared to Xi Aimai-1, whereas the effects were significantly reversed by ethylene biosynthesis inhibitors. The simultaneous exposure of wheat seedlings to Al and ethylene donor, ethephon, or ethylene biosynthesis precursor, 1-aminocyclopropane-1-carboxylic acid (ACC), increased ethylene production and aggravated root inhibition, which was more pronounced in Xi Aimai-1. In contrast, Put treatment decreased ethylene production and alleviated Al-induced root inhibition in both genotypes, and the effects were more conspicuous in Yangmai-5. Furthermore, our results indicated that Al-induced ethylene production was mediated by ACC synthase (ACS) and ACC oxidase, and that Put decreased ethylene production by inhibiting ACS. Altogether, these findings indicate that ethylene is involved in Al-induced root inhibition and this process could be alleviated by Put through inhibiting ACS activity.

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

PubMed Central

Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.

2013-01-01

Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

Reduced heart size and increased myocardial fuel substrate oxidation in ACC2 mutant mice

PubMed Central

Essop, M. Faadiel; Camp, Heidi S.; Choi, Cheol Soo; Sharma, Saumya; Fryer, Ryan M.; Reinhart, Glenn A.; Guthrie, Patrick H.; Bentebibel, Assia; Gu, Zeiwei; Shulman, Gerald I.; Taegtmeyer, Heinrich; Wakil, Salih J.; Abu-Elheiga, Lutfi

2008-01-01

The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC2) is a key regulator of mitochondrial fatty acid (FA) uptake via carnitine palmitoyltransferase 1 (CPT1). To test the hypothesis that oxidative metabolism is upregulated in hearts from animals lacking ACC2 (employing a transgenic Acc2-mutant mouse), we assessed cardiac function in vivo and determined rates of myocardial substrate oxidation ex vivo. When examined by echocardiography, there was no difference in systolic function, but left ventricular mass of the Acc2-mutant (MUT) mouse was significantly reduced (∼25%) compared with wild-types (WT). Reduced activation of the mammalian target of rapamycin (mTOR) and its downstream target p70S6K was found in MUT hearts. Exogenous oxidation rates of oleate were increased ∼22%, and, unexpectedly, exogenous glucose oxidation rates were also increased in MUT hearts. Using a hyperinsulinemic-euglycemic clamp, we found that glucose uptake in MUT hearts was increased by ∼83%. Myocardial triglyceride levels were significantly reduced in MUT vs. WT while glycogen content was the same. In parallel, transcript levels of PPARα and its target genes, pyruvate dehydrogenase kinase-4 (PDK-4), malonyl-CoA decarboxylase (MCD), and mCPT1, were downregulated in MUT mice. In summary, we report that 1) Acc2-mutant hearts exhibit a marked preference for the oxidation of both glucose and FAs coupled with greater utilization of endogenous fuel substrates (triglycerides), 2) attenuated mTOR signaling may result in reduced heart sizes observed in Acc2-mutant mice, and 3) Acc2-mutant hearts displayed normal functional parameters despite a significant decrease in size. PMID:18487439

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Whole-transcriptome RNA-seq, gene set enrichment pathway analysis, and exon coverage analysis of two plastid RNA editing mutants.

PubMed

Hackett, Justin B; Lu, Yan

2017-05-04

In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.

15-Deoxy-∆12,14-PGJ 2, by activating peroxisome proliferator-activated receptor-gamma, suppresses p22phox transcription to protect brain endothelial cells against hypoxia-induced apoptosis.

PubMed

Wu, Jui-Sheng; Tsai, Hsin-Da; Huang, Chien-Yu; Chen, Jin-Jer; Lin, Teng-Nan

2014-08-01

15-Deoxy-∆(12,14)-PGJ(2) (15d-PGJ(2)) and thiazolidinedione attenuate reactive oxygen species (ROS) production via a peroxisome proliferator-activated receptor-gamma (PPAR-γ)-dependent pathway. Nonetheless, how PPAR-γ mediates ROS production to ameliorate ischemic brain injury is not clear. Recent studies indicated that nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is the major source of ROS in the vascular system. In the present study, we used an in vitro oxygen-glucose deprivation and reoxygenation (hypoxia reoxygenation [HR]) paradigm to study whether PPAR-γ interacts with NADPH oxidase, thereby regulating ROS formation in cerebral endothelial cells (CECs). With pharmacological (PPAR-γ antagonist GW9662), loss-of-function (PPAR-γ siRNA), and gain-of-function (Ad-PPAR-γ) approaches, we first demonstrated that 15d-PGJ(2) protected HR-treated CECs against ROS-induced apoptosis in a PPAR-γ-dependent manner. Results of promoter and subcellular localization analyses further revealed that 15d-PGJ(2), by activating PPAR-γ, blocked HR-induced NF-κB nuclear translocation, which led to inhibited transcription of the NADPH oxidase subunit p22phox. In summary, we report a novel transrepression mechanism whereby PPAR-γ downregulates hypoxia-activated p22phox transcription and the subsequent NADPH oxidase activation, ROS formation, and CEC apoptosis.

Obesity Drives Th17 Cell Differentiation by Inducing the Lipid Metabolic Kinase, ACC1.

PubMed

Endo, Yusuke; Asou, Hikari K; Matsugae, Nao; Hirahara, Kiyoshi; Shinoda, Kenta; Tumes, Damon J; Tokuyama, Hirotake; Yokote, Koutaro; Nakayama, Toshinori

2015-08-11

Chronic inflammation due to obesity contributes to the development of metabolic diseases, autoimmune diseases, and cancer. Reciprocal interactions between metabolic systems and immune cells have pivotal roles in the pathogenesis of obesity-associated diseases, although the mechanisms regulating obesity-associated inflammatory diseases are still unclear. In the present study, we performed transcriptional profiling of memory phenotype CD4 T cells in high-fat-fed mice and identified acetyl-CoA carboxylase 1 (ACC1, the gene product of Acaca) as an essential regulator of Th17 cell differentiation in vitro and of the pathogenicity of Th17 cells in vivo. ACC1 modulates the DNA binding of RORγt to target genes in differentiating Th17 cells. In addition, we found a strong correlation between IL-17A-producing CD45RO(+)CD4 T cells and the expression of ACACA in obese subjects. Thus, ACC1 confers the appropriate function of RORγt through fatty acid synthesis and regulates the obesity-related pathology of Th17 cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Sister grouping of chimpanzees and humans as revealed by genome-wide phylogenetic analysis of brain gene expression profiles

PubMed Central

Uddin, Monica; Wildman, Derek E.; Liu, Guozhen; Xu, Wenbo; Johnson, Robert M.; Hof, Patrick R.; Kapatos, Gregory; Grossman, Lawrence I.; Goodman, Morris

2004-01-01

Gene expression profiles from the anterior cingulate cortex (ACC) of human, chimpanzee, gorilla, and macaque samples provide clues about genetic regulatory changes in human and other catarrhine primate brains. The ACC, a cerebral neocortical region, has human-specific histological features. Physiologically, an individual's ACC displays increased activity during that individual's performance of cognitive tasks. Of ≈45,000 probe sets on microarray chips representing transcripts of all or most human genes, ≈16,000 were commonly detected in human ACC samples and comparable numbers, 14,000–15,000, in gorilla and chimpanzee ACC samples. Phylogenetic results obtained from gene expression profiles contradict the traditional expectation that the non-human African apes (i.e., chimpanzee and gorilla) should be more like each other than either should be like humans. Instead, the chimpanzee ACC profiles are more like the human than like the gorilla; these profiles demonstrate that chimpanzees are the sister group of humans. Moreover, for those unambiguous expression changes mapping to important biological processes and molecular functions that statistically are significantly represented in the data, the chimpanzee clade shows at least as much apparent regulatory evolution as does the human clade. Among important changes in the ancestry of both humans and chimpanzees, but to a greater extent in humans, are the up-regulated expression profiles of aerobic energy metabolism genes and neuronal function-related genes, suggesting that increased neuronal activity required increased supplies of energy. PMID:14976249

Ethylene-dependent aerenchyma formation in adventitious roots is regulated differently in rice and maize.

PubMed

Yamauchi, Takaki; Tanaka, Akihiro; Mori, Hitoshi; Takamure, Itsuro; Kato, Kiyoaki; Nakazono, Mikio

2016-10-01

In roots of gramineous plants, lysigenous aerenchyma is created by the death and lysis of cortical cells. Rice (Oryza sativa) constitutively forms aerenchyma under aerobic conditions, and its formation is further induced under oxygen-deficient conditions. However, maize (Zea mays) develops aerenchyma only under oxygen-deficient conditions. Ethylene is involved in lysigenous aerenchyma formation. Here, we investigated how ethylene-dependent aerenchyma formation is differently regulated between rice and maize. For this purpose, in rice, we used the reduced culm number1 (rcn1) mutant, in which ethylene biosynthesis is suppressed. Ethylene is converted from 1-aminocyclopropane-1-carboxylic acid (ACC) by the action of ACC oxidase (ACO). We found that OsACO5 was highly expressed in the wild type, but not in rcn1, under aerobic conditions, suggesting that OsACO5 contributes to aerenchyma formation in aerated rice roots. By contrast, the ACO genes in maize roots were weakly expressed under aerobic conditions, and thus ACC treatment did not effectively induce ethylene production or aerenchyma formation, unlike in rice. Aerenchyma formation in rice roots after the initiation of oxygen-deficient conditions was faster and greater than that in maize. These results suggest that the difference in aerenchyma formation in rice and maize is due to their different mechanisms for regulating ethylene biosynthesis. © 2016 John Wiley & Sons Ltd.

Proteomic profiling of γ-ECS overexpressed transgenic Nicotiana in response to drought stress.

PubMed

Kumar, Deepak; Datta, Riddhi; Sinha, Ragini; Ghosh, Aparupa; Chattopadhyay, Sharmila

2014-01-01

The contribution of Glutathione (GSH) in drought stress tolerance is an established fact. However, the proteins which are directly or indirectly related to the increased level of GSH in response to drought stress are yet to be known. To explore this, here, transgenic tobacco plants (NtGp11) overexpressing gamma-glutamylcysteine synthetase (γ-ECS) was tested for tolerance against drought stress. NtGp11 conferred tolerance to drought stress by increased germination rate, water retention, water recovery, chlorophyll, and proline content compared with wild-type plants. Semi-quantitative RT-PCR analysis revealed that the transcript levels of stress-responsive genes were higher in NtGp11 compared with wild-type in response to drought stress. Two-dimensional gel electrophoresis (2-DE) coupled with MALDI TOF-TOF MS/MS analysis has been used to identify 43 differentially expressed proteins in response to drought in wild-type and NtGp11 plants. The results demonstrated the up-accumulation of 58.1% of proteins among which 36%, 24%, and 20% of them were related to stress and defense, carbon metabolism and energy metabolism categories, respectively. Taken together, our results demonstrated that GSH plays an important role in combating drought stress in plants by inducing stress related genes and proteins like HSP70, chalcone synthase, glutathione peroxidase, thioredoxin peroxidase, ACC oxidase, and heme oxygenase I.

Proteomic profiling of γ-ECS overexpressed transgenic Nicotiana in response to drought stress.

PubMed

Kumar, Deepak; Datta, Riddhi; Sinha, Ragini; Ghosh, Aparupa; Chattopadhyay, Sharmila

2014-05-20

The contribution of Glutathione (GSH) in drought stress tolerance is an established fact. However, the proteins which are directly or indirectly related to the increased level of GSH in response to drought stress are yet to be known. To explore this, here, transgenic tobacco plants (NtGp 11) overexpressing gamma-glutamylcysteine synthetase (γ-ECS) was tested for tolerance against drought stress. NtGp 11 conferred tolerance to drought stress by increased germination rate, water retention, water recovery, chlorophyll, and proline content compared with wild-type plants. Semi-quantitative RT-PCR analysis revealed that the transcript levels of stress-responsive genes were higher in NtGp 11 compared with wild-type in response to drought stress. Two-dimensional gel electrophoresis (2-DE) coupled with MALDI TOF-TOF MS/MS analysis has been used to identify 43 differentially expressed proteins in response to drought in wild-type and NtGp 11 plants. The results demonstrated the up-accumulation of 58.1% of proteins among which 36%, 24%, and 20% of them were related to stress and defense, carbon metabolism and energy metabolism categories, respectively. Taken together, our results demonstrated that GSH plays an important role in combating drought stress in plants by inducing stress related genes and proteins like HSP70, chalcone synthase, glutathione peroxidase, thioredoxin peroxidase, ACC oxidase, and heme oxygenase I.

Expression of MdCAS1 and MdCAS2, encoding apple beta-cyanoalanine synthase homologs, is concomitantly induced during ripening and implicates MdCASs in the possible role of the cyanide detoxification in Fuji apple (Malus domestica Borkh.) fruits.

PubMed

Han, Sang Eun; Seo, Young Sam; Kim, Daeil; Sung, Soon-Kee; Kim, Woo Taek

2007-08-01

Fruit ripening involves complex biochemical and physiological changes. Ethylene is an essential hormone for the ripening of climacteric fruits. In the process of ethylene biosynthesis, cyanide (HCN), an extremely toxic compound, is produced as a co-product. Thus, most cyanide produced during fruit ripening should be detoxified rapidly by fruit cells. In higher plants, the key enzyme involved in the detoxification of HCN is beta-cyanoalanine synthase (beta-CAS). As little is known about the molecular function of beta-CAS genes in climacteric fruits, we identified two homologous genes, MdCAS1 and MdCAS2, encoding Fuji apple beta-CAS homologs. The structural features of the predicted polypeptides as well as an in vitro enzyme activity assay with bacterially expressed recombinant proteins indicated that MdCAS1 and MdCAS2 may indeed function as beta-CAS isozymes in apple fruits. RNA gel-blot studies revealed that both MdCAS1 and MdCAS2 mRNAs were coordinately induced during the ripening process of apple fruits in an expression pattern comparable with that of ACC oxidase and ethylene production. The MdCAS genes were also activated effectively by exogenous ethylene treatment and mechanical wounding. Thus, it seems like that, in ripening apple fruits, expression of MdCAS1 and MdCAS2 genes is intimately correlated with a climacteric ethylene production and ACC oxidase activity. In addition, beta-CAS enzyme activity was also enhanced as the fruit ripened, although this increase was not as dramatic as the mRNA induction pattern. Overall, these results suggest that MdCAS may play a role in cyanide detoxification in ripening apple fruits.

Urate oxidase is imported into peroxisomes recognizing the C-terminal SKL motif of proteins.

PubMed

Miura, S; Oda, T; Funai, T; Ito, M; Okada, Y; Ichiyama, A

1994-07-01

Rat liver urate oxidase synthesized from cDNA through coupled transcription and translation was incubated at 26 degrees C for 60 min with purified peroxisomes from rat liver. Urate oxidase was efficiently imported into the peroxisomes, as determined by resistance to externally added proteinase K. The amount of imported urate oxidase increased with time and the import was temperature dependent. A synthetic peptide composed of the C-terminal 10 amino acid residues of acyl-CoA oxidase (the C-terminal tripeptide is Ser-Lys-Leu) inhibited the import of urate oxidase, whereas other peptides, in which the C-terminal Ser-Lys-Leu (SKL) sequence was deleted or mutated, were not effective. Two mutant urate oxidase proteins in which the C-terminal Ser-Arg-Leu (SRL) sequence was deleted or mutated to Ser-Glu-Leu (SEL) were not imported into peroxisomes. With substitution of a lysine residue for arginine in the SRL tripeptide at the C-terminus the import activity was retained. These results show that urate oxidase is important into peroxisomes via a common pathway with acyl-CoA oxidase, and that the C-terminal SRL sequence functions as a peroxisomal-targeting signal.

Identification of vimentin- and elastin-like transcripts specifically expressed in developing notochord of Atlantic salmon (Salmo salar L.).

PubMed

Sagstad, Anita; Grotmol, Sindre; Kryvi, Harald; Krossøy, Christel; Totland, Geir K; Malde, Ketil; Wang, Shou; Hansen, Tom; Wargelius, Anna

2011-11-01

The notochord functions as the midline structural element of all vertebrate embryos, and allows movement and growth at early developmental stages. Moreover, during embryonic development, notochord cells produce secreted factors that provide positional and fate information to a broad variety of cells within adjacent tissues, for instance those of the vertebrae, central nervous system and somites. Due to the large size of the embryo, the salmon notochord is useful to study as a model for exploring notochord development. To investigate factors that might be involved in notochord development, a normalized cDNA library was constructed from a mix of notochords from ∼500 to ∼800 day°. From the 1968 Sanger-sequenced transcripts, 22 genes were identified to be predominantly expressed in the notochord compared to other organs of salmon. Twelve of these genes were found to show expressional regulation around mineralization of the notochord sheath; 11 genes were up-regulated and one gene was down-regulated. Two genes were found to be specifically expressed in the notochord; these genes showed similarity to vimentin (acc. no GT297094) and elastin (acc. no GT297478). In-situ results showed that the vimentin- like transcript was expressed in both chordocytes and chordoblasts, whereas the elastin- like transcript was uniquely expressed in the chordoblasts lining the notochordal sheath. In salmon aquaculture, vertebral deformities are a common problem, and some malformations have been linked to the notochord. The expression of identified transcripts provides further insight into processes taking place in the developing notochord, prior to and during the early mineralization period.

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Human protoporphyrinogen oxidase: expression, purification, and characterization of the cloned enzyme.

PubMed Central

Dailey, T. A.; Dailey, H. A.

1996-01-01

Protoporphyrinogen oxidase (E.C.1.3.3.4) catalyzes the oxygen-dependent oxidation of protoporphyrinogen IX to protoporphyrin IX. The enzyme from human placenta has been cloned, sequenced, expressed in Escherichia coli, purified to homogeneity, and characterized. Northern blot analysis of eight different human tissues show evidence for only a single transcript in all tissue types and the size of this transcript is approximately 1.8 kb. The human cDNA has been inserted into an expression vector for E. coli and the protein produced at high levels in these cells. The protein is found in both membrane and cytoplasmic fractions. The enzyme was purified to homogeneity in the presence of detergents using a metal chelate affinity column. The purified protein is a homodimer composed of subunits of molecular weight of 51,000. The enzyme contains one noncovalently bound FAD per dimer, has a monomer extinction coefficient of 48,000 at 270 nm and contains no detectable redox active metals. The apparent K(m) and Kcat for protoporphyrinogen IX are 1.7 microM and 10.5 min-1, respectively. The enzyme does not use coproporphyrinogen III as a substrate and is inhibited by micromolar concentrations of the herbicide acifluorfen. Protein database searches reveal significant homology between protoporphyrinogen oxidase and monoamine oxidase. PMID:8771201

[Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

PubMed

Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

2011-01-01

The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

Effects of ethylene on photosystem II and antioxidant enzyme activity in Bermuda grass under low temperature.

PubMed

Hu, Zhengrong; Fan, Jibiao; Chen, Ke; Amombo, Erick; Chen, Liang; Fu, Jinmin

2016-04-01

The phytohormone ethylene has been reported to mediate plant response to cold stress. However, it is still debated whether the effect of ethylene on plant response to cold stress is negative or positive. The objective of the present study was to explore the role of ethylene in the cold resistance of Bermuda grass (Cynodon dactylon (L).Pers.). Under control (warm) condition, there was no obvious effect of the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) or the antagonist Ag(+) of ethylene signaling on electrolyte leakage (EL) and malondialdehyde (MDA) content. Under cold stress conditions, ACC-treated plant leaves had a greater level of EL and MDA than the untreated leaves. However, the EL and MDA values were lower in the Ag(+) regime versus the untreated. In addition, after 3 days of cold treatment, ACC remarkably reduced the content of soluble protein and also altered antioxidant enzyme activity. Under control (warm) condition, there was no significant effect of ACC on the performance of photosystem II (PS II) as monitored by chlorophyll α fluorescence transients. However, under cold stress, ACC inhibited the performance of PS II. Under cold condition, ACC remarkably reduced the performance index for energy conservation from excitation to the reduction of intersystem electron acceptors (PI(ABS)), the maximum quantum yield of primary photochemistry (φP0), the quantum yield of electron transport flux from Q(A) to Q(B) (φE0), and the efficiency/probability of electron transport (ΨE0). Simultaneously, ACC increased the values of specific energy fluxes for absorption (ABS/RC) and dissipation (DI0/RC) after 3 days of cold treatment. Additionally, under cold condition, exogenous ACC altered the expressions of several related genes implicated in the induction of cold tolerance (LEA, SOD, POD-1 and CBF1, EIN3-1, and EIN3-2). The present study thus suggests that ethylene affects the cold tolerance of Bermuda grass by impacting the antioxidant system, photosystem II, as well as the CBF transcriptional regulatory cascade.

Transcriptional regulation of the novel monoamine oxidase renalase: Crucial roles of transcription factors Sp1, STAT3, and ZBP89.

PubMed

Sonawane, Parshuram J; Gupta, Vinayak; Sasi, Binu K; Kalyani, Ananthamohan; Natarajan, Bhargavi; Khan, Abrar A; Sahu, Bhavani S; Mahapatra, Nitish R

2014-11-11

Renalase, a novel monoamine oxidase, is emerging as an important regulator of cardiovascular, metabolic, and renal diseases. However, the mechanism of transcriptional regulation of this enzyme remains largely unknown. We undertook a systematic analysis of the renalase gene to identify regulatory promoter elements and transcription factors. Computational analysis coupled with transfection of human renalase promoter/luciferase reporter plasmids (5'-promoter-deletion constructs) into various cell types (HEK-293, IMR32, and HepG2) identified two crucial promoter domains at base pairs -485 to -399 and -252 to -150. Electrophoretic mobility shift assays using renalase promoter oligonucleotides with and without potential binding sites for transcription factors Sp1, STAT3, and ZBP89 displayed formation of specific complexes with HEK-293 nuclear proteins. Consistently, overexpression of Sp1, STAT3, and ZBP89 augmented renalase promoter activity; additionally, siRNA-mediated downregulation of Sp1, STAT3, and ZBP89 reduced the level of endogenous renalase transcription as well as the transfected renalase promoter activity. In addition, chromatin immunoprecipitation assays showed in vivo interactions of these transcription factors with renalase promoter. Interestingly, renalase promoter activity was augmented by nicotine and catecholamines; while Sp1 and STAT3 synergistically activated the nicotine-induced effect, Sp1 appeared to enhance epinephrine-evoked renalase transcription. Moreover, renalase transcript levels in mouse models of human essential hypertension were concomitantly associated with endogenous STAT3 and ZBP89 levels, suggesting crucial roles for these transcription factors in regulating renalase gene expression in cardiovascular pathological conditions.

A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

NASA Astrophysics Data System (ADS)

Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

2009-05-01

The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean amoA clones and corresponded to the sequences retrieved from the less deep compartments of the world's ocean, most likely reflecting the higher temperature at the depth of the Mediterranean Sea. In order to verify whether these phylotypes might represent important Crenarchaeota in the functioning of the Mediterranean bathypelagic ecosystem, expression of crenarchaeal amoA gene was monitored by direct RNA retrieval and following analysis of amoA-related mRNA transcripts. Surprisingly, all mRNA-derived sequences formed a tight monophyletic group, which fell into large Shallow Marine Group I cluster with sequences retrieved from shallow (up to 200 m) waters, sediments and corals. This group was not detected in DNA-based clone library, obviously, due to an overwhelming dominance of the Deep Marine Group I. The failure to recover the amoA transcripts, related to Deep Marine Group I of Crenarchaeota, was unanticipated and likely resulted from the physiology of these strongly adapted deep-sea organisms. As far as all seawater samples were treated on-board under atmospheric pressure conditions and sunlight, the decompression and/or photoinhibition likely affected their metabolic activity, followed by the strong decay of gene expression.

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Coupling of Physiological and Proteomic Analysis to Understand the Ethylene- and Chilling-Induced Kiwifruit Ripening Syndrome

PubMed Central

Minas, Ioannis S.; Tanou, Georgia; Karagiannis, Evangelos; Belghazi, Maya; Molassiotis, Athanassios

2016-01-01

Kiwifruit [Actinidia deliciosa (A. Chev.) C.F. Liang et A.R. Ferguson, cv. “Hayward”] is classified as climacteric fruit and the initiation of endogenous ethylene production following harvest is induced by exogenous ethylene or chilling exposure. To understand the biological basis of this “dilemma,” kiwifruit ripening responses were characterized at 20°C following treatments with exogenous ethylene (100 μL L−1, 20°C, 24 h) or/and chilling temperature (0°C, 10 days). All treatments elicited kiwifruit ripening and induced softening and endogenous ethylene biosynthesis, as determined by 1-aminocyclopropane-1-carboxylic acid (ACC) content and ACC synthase (ACS) and ACC oxidase (ACO) enzyme activities after 10 days of ripening at 20°C. Comparative proteomic analysis using two-dimensional gel electrophoresis (2DE-PAGE) and nanoscale liquid chromatography coupled to tandem mass spectrometry (nanoLC-MS/MS) revealed 81 kiwifruit proteins associated with ripening. Thirty-one kiwifruit proteins were identified as commonly regulated by the three treatments accompanied by dynamic changes of 10 proteins specific to exogenous ethylene, 2 to chilling treatment, and 12 to their combination. Ethylene and/or chilling-responsive proteins were mainly involved in disease/defense, energy, protein destination/storage, and cell structure/cell wall. Interactions between the identified proteins were demonstrated by bioinformatics analysis, allowing a more complete insight into biological pathways and molecular functions affected by ripening. The present approach provides a quantitative basis for understanding the ethylene- and chilling-induced kiwifruit ripening and climacteric fruit ripening in general. PMID:26913040

Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.

PubMed

Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

2009-10-01

Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

Oxymatrine attenuates hepatic steatosis in non-alcoholic fatty liver disease rats fed with high fructose diet through inhibition of sterol regulatory element binding transcription factor 1 (Srebf1) and activation of peroxisome proliferator activated receptor alpha (Pparα).

PubMed

Shi, Li-juan; Shi, Lei; Song, Guang-yao; Zhang, He-fang; Hu, Zhi-juan; Wang, Chao; Zhang, Dong-hui

2013-08-15

The aim of this study was to examine the therapeutic effect of oxymatrine, a monomer isolated from the medicinal plant Sophora flavescens Ait, on the hepatic lipid metabolism in non-alcoholic fatty liver (NAFLD) rats and to explore the potential mechanism. Rats were fed with high fructose diet for 8 weeks to establish the NAFLD model, then were given oxymatrine treatment (40, 80, and 160 mg/kg, respectively) for another 8 weeks. Body weight gain, liver index, serum and liver lipids, and histopathological evaluation were measured. Enzymatic activity and gene expression of the key enzymes involved in the lipogenesis and fatty acid oxidation were assayed. The results showed that oxymatrine treatment reduced body weight gain, liver weight, liver index, dyslipidemia, and liver triglyceride level in a dose dependant manner. Importantly, the histopathological examination of liver confirmed that oxymatrine could decrease the liver lipid accumulation. The treatment also decreased the fatty acid synthase (FAS) enzymatic activity and increased the carnitine palmitoyltransferase 1A (CPT1A) enzymatic activity. Besides, oxymatrine treatment decreased the mRNA expression of sterol regulatory element binding transcription factor 1(Srebf1), fatty acid synthase (Fasn), and acetyl CoA carboxylase (Acc), and increased the mRNA expression of peroxisome proliferator activated receptor alpha (Pparα), carnitine palmitoyltransferase 1A (Cpt1a), and acyl CoA oxidase (Acox1) in high fructose diet induced NAFLD rats. These results suggested that the therapeutic effect of oxymatrine on the hepatic steatosis in high fructose diet induced fatty liver rats is partly due to down-regulating Srebf1 and up-regulating Pparα mediated metabolic pathways simultaneously. © 2013 Elsevier B.V. All rights reserved.

Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

PubMed

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

2013-11-01

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

PubMed

Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

2015-07-01

Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP) that regulate MAOA gene expression in a coordinated manner. Aberrant MAOA expression under pathophysiological conditions including inflammation and ischemia is mediated by altered binding of GATA2/Sp1/TBP with MAOA proximal promoter. Thus, these findings provide new insights into pathogenesis of several common diseases. GATA2, GATA-binding protein 2; Sp1, specificity protein 1; TBP, TATA-binding protein. © 2015 International Society for Neurochemistry.

A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens

PubMed Central

El Sahili, Abbas; Li, Si-Zhe; Lang, Julien; Virus, Cornelia; Planamente, Sara; Ahmar, Mohammed; Guimaraes, Beatriz G.; Aumont-Nicaise, Magali; Vigouroux, Armelle; Soulère, Laurent; Reader, John; Queneau, Yves; Faure, Denis; Moréra, Solange

2015-01-01

Periplasmic binding proteins (PBPs) in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3’-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the rational design of antibiotic and anti-virulence compounds against A. tumefaciens or other pathogens possessing similar PBPs. PMID:26244338

A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens.

PubMed

El Sahili, Abbas; Li, Si-Zhe; Lang, Julien; Virus, Cornelia; Planamente, Sara; Ahmar, Mohammed; Guimaraes, Beatriz G; Aumont-Nicaise, Magali; Vigouroux, Armelle; Soulère, Laurent; Reader, John; Queneau, Yves; Faure, Denis; Moréra, Solange

2015-08-01

Periplasmic binding proteins (PBPs) in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3'-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the rational design of antibiotic and anti-virulence compounds against A. tumefaciens or other pathogens possessing similar PBPs.

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L.

PubMed

Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit

2012-05-01

Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis. Copyright © 2012 Elsevier GmbH. All rights reserved.

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

Ethylene and nitric oxide interact to regulate the magnesium deficiency-induced root hair development in Arabidopsis.

PubMed

Liu, Miao; Liu, Xing Xing; He, Xiao Lin; Liu, Li Juan; Wu, Hao; Tang, Cai Xian; Zhang, Yong Song; Jin, Chong Wei

2017-02-01

Nitric oxide (NO) and ethylene respond to biotic and abiotic stresses through either similar or independent processes. This study examines the mechanism underlying the effects of NO and ethylene on promoting root hair development in Arabidopsis under magnesium (Mg) deficiency. The interaction between NO and ethylene in the regulation of Mg deficiency-induced root hair development was investigated using NO- and ethylene-related mutants and pharmacological methods. Mg deficiency triggered a burst of NO and ethylene, accompanied by a stimulated development of root hairs. Interestingly, ethylene facilitated NO generation by activation of both nitrate reductase and nitric oxide synthase-like (NOS-L) in the roots of Mg-deficient plants. In turn, NO enhanced ethylene synthesis through stimulating the activities of 1-aminocyclopropane-1-carboxylate (ACC) oxidase and ACC synthase (ACS). These two processes constituted an NO-ethylene feedback loop. Blocking either of these two processes inhibited the stimulation of root hair development under Mg deficiency. In conclusion, we suggest that Mg deficiency increases the production of NO and ethylene in roots, each influencing the accumulation and role of the other, and thus these two signals interactively regulate Mg deficiency-induced root hair morphogenesis. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Short-Term Effects of gamma-Irradiation on 1-Aminocyclopropane-1-Carboxylic Acid Metabolism in Early Climacteric Cherry Tomatoes : Comparison with Wounding.

PubMed

Larrigaudière, C; Latché, A; Pech, J C; Triantaphylidès, C

1990-03-01

gamma-Irradiation of early climacteric (breaker) cherry tomatoes (Lycopersicon pimpinellifollium L.) caused a sharp burst in ethylene production during the first hour. The extent of ethylene production was dose dependent and was maximum at about 3 kilograys. The content of 1-aminocyclopropane-1-carboxylic acid (ACC), followed the same evolution as ethylene production, while malonyl ACC increased steadily with time in irradiated fruits. The burst in ethylene production was accompanied by a sharp stimulation of ACC synthase activity which began 15 minutes after irradiation. The stimulation was completely prevented by cycloheximide, but not by actinomycin d or cordycepin. In contrast with irradiation, mechanical wounding continuously stimulated ethylene production over several hours. gamma-Irradiation and cordycepin applied to wounded tissues both caused the cessation of this continuous increase, but the initial burst was still persisting. These data suggest that gamma-irradiation, like wounding, stimulates the translation of preexisting mRNAs. It also reduces, at least temporarily, the subsequent transcription-dependent stimulation of ethylene production. gamma-Irradiation greatly inhibited the activity of ethylene-forming enzyme at doses higher than 1 kilogray. Such sensitivity is in accordance with a highly integrated membranebound enzyme.

WHOLE-GENOME SEQUENCING OF SALIVARY GLAND ADENOID CYSTIC CARCINOMA

PubMed Central

Rettig, Eleni M; Talbot, C Conover; Sausen, Mark; Jones, Sian; Bishop, Justin A; Wood, Laura D; Tokheim, Collin; Niknafs, Noushin; Karchin, Rachel; Fertig, Elana J; Wheelan, Sarah J; Marchionni, Luigi; Considine, Michael; Ling, Shizhang; Fakhry, Carole; Papadopoulos, Nickolas; Kinzler, Kenneth W; Vogelstein, Bert; Ha, Patrick K; Agrawal, Nishant

2016-01-01

Adenoid cystic carcinomas (ACCs) of the salivary glands are challenging to understand, treat, and cure. To better understand the genetic alterations underlying the pathogenesis of these tumors, we performed comprehensive genome analyses of 25 fresh-frozen tumors, including whole genome sequencing, expression and pathway analyses. In addition to the well-described MYB-NFIB fusion which was found in 11 tumors (44%), we observed five different rearrangements involving the NFIB transcription factor gene in seven tumors (28%). Taken together, NFIB translocations occurred in 15 of 25 samples (60%, 95%CI=41–77%). In addition, mRNA expression analysis of 17 tumors revealed overexpression of NFIB in ACC tumors compared with normal tissues (p=0.002). There was no difference in NFIB mRNA expression in tumors with NFIB fusions compared to those without. We also report somatic mutations of genes involved in the axonal guidance and Rho family signaling pathways. Finally, we confirm previously described alterations in genes related to chromatin regulation and Notch signaling. Our findings suggest a separate role for NFIB in ACC oncogenesis and highlight important signaling pathways for future functional characterization and potential therapeutic targeting. PMID:26862087

Short-Term Effects of γ-Irradiation on 1-Aminocyclopropane-1-Carboxylic Acid Metabolism in Early Climacteric Cherry Tomatoes 1

PubMed Central

Larrigaudière, Christian; Latché, Alain; Pech, Jean Claude; Triantaphylidès, Christian

1990-01-01

γ-Irradiation of early climacteric (breaker) cherry tomatoes (Lycopersicon pimpinellifollium L.) caused a sharp burst in ethylene production during the first hour. The extent of ethylene production was dose dependent and was maximum at about 3 kilograys. The content of 1-aminocyclopropane-1-carboxylic acid (ACC), followed the same evolution as ethylene production, while malonyl ACC increased steadily with time in irradiated fruits. The burst in ethylene production was accompanied by a sharp stimulation of ACC synthase activity which began 15 minutes after irradiation. The stimulation was completely prevented by cycloheximide, but not by actinomycin d or cordycepin. In contrast with irradiation, mechanical wounding continuously stimulated ethylene production over several hours. γ-Irradiation and cordycepin applied to wounded tissues both caused the cessation of this continuous increase, but the initial burst was still persisting. These data suggest that γ-irradiation, like wounding, stimulates the translation of preexisting mRNAs. It also reduces, at least temporarily, the subsequent transcription-dependent stimulation of ethylene production. γ-Irradiation greatly inhibited the activity of ethylene-forming enzyme at doses higher than 1 kilogray. Such sensitivity is in accordance with a highly integrated membranebound enzyme. PMID:16667318

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

FLO11 expression and lipid biosynthesis are required for air-liquid biofilm formation in a Saccharomyces cerevisiae flor strain.

PubMed

Zara, Giacomo; Goffrini, Paola; Lodi, Tiziana; Zara, Severino; Mannazzu, Ilaria; Budroni, Marilena

2012-11-01

Air-liquid biofilm formation is largely dependent on Flo11p and seems related to cell lipid content and composition. Here, it is shown that in the presence of cerulenin, a known inhibitor of the fatty acid synthase complex, biofilm formation is inhibited together with FLO11 transcription in a flor strain of Saccharomyces cerevisiae, while the administration of saturated fatty acids to cerulenin-containing medium restores biofilm formation and FLO11 transcription. It is also shown that, in biofilm cells, the FLO11 transcription is accompanied by the transcription of ACC1, ACS1 and INO1 key genes in lipid biosynthesis and that biofilm formation is affected by the lack of inositol in flor medium. These results are compatible with the hypothesis that the air-liquid biofilm formation depends on FLO11 transcription levels as well as on fatty acids biosynthesis. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Characterisation of ethylene pathway components in non-climacteric capsicum.

PubMed

Aizat, Wan M; Able, Jason A; Stangoulis, James C R; Able, Amanda J

2013-11-28

Climacteric fruit exhibit high ethylene and respiration levels during ripening but these levels are limited in non-climacteric fruit. Even though capsicum is in the same family as the well-characterised climacteric tomato (Solanaceae), it is non-climacteric and does not ripen normally in response to ethylene or if harvested when mature green. However, ripening progresses normally in capsicum fruit when they are harvested during or after what is called the 'Breaker stage'. Whether ethylene, and components of the ethylene pathway such as 1-aminocyclopropane 1-carboxylate (ACC) oxidase (ACO), ACC synthase (ACS) and the ethylene receptor (ETR), contribute to non-climacteric ripening in capsicum has not been studied in detail. To elucidate the behaviour of ethylene pathway components in capsicum during ripening, further analysis is therefore needed. The effects of ethylene or inhibitors of ethylene perception, such as 1-methylcyclopropene, on capsicum fruit ripening and the ethylene pathway components may also shed some light on the role of ethylene in non-climacteric ripening. The expression of several isoforms of ACO, ACS and ETR were limited during capsicum ripening except one ACO isoform (CaACO4). ACS activity and ACC content were also low in capsicum despite the increase in ACO activity during the onset of ripening. Ethylene did not stimulate capsicum ripening but 1-methylcyclopropene treatment delayed the ripening of Breaker-harvested fruit. Some of the ACO, ACS and ETR isoforms were also differentially expressed upon treatment with ethylene or 1-methylcyclopropene. ACS activity may be the rate limiting step in the ethylene pathway of capsicum which restricts ACC content. The differential expression of several ethylene pathway components during ripening and upon ethylene or 1-methylclopropene treatment suggests that the ethylene pathway may be regulated differently in non-climacteric capsicum compared to the climacteric tomato. Ethylene independent pathways may also exist in non-climacteric ripening as evidenced by the up-regulation of CaACO4 during ripening onset despite being negatively regulated by ethylene exposure. However, some level of ethylene perception may still be needed to induce ripening especially during the Breaker stage. A model of capsicum ripening is also presented to illustrate the probable role of ethylene in this non-climacteric fruit.

Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

PubMed

Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

2015-11-01

MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. © 2015 Scandinavian Plant Physiology Society.

Phytohormonal Networks Promote Differentiation of Fiber Initials on Pre-Anthesis Cotton Ovules Grown In Vitro and In Planta

PubMed Central

Kim, Hee Jin; Hinchliffe, Doug J.; Triplett, Barbara A.; Chen, Z. Jeffrey; Stelly, David M.; Yeater, Kathleen M.; Moon, Hong S.; Gilbert, Matthew K.; Thyssen, Gregory N.; Turley, Rickie B.; Fang, David D.

2015-01-01

The number of cotton (Gossypium sp.) ovule epidermal cells differentiating into fiber initials is an important factor affecting cotton yield and fiber quality. Despite extensive efforts in determining the molecular mechanisms regulating fiber initial differentiation, only a few genes responsible for fiber initial differentiation have been discovered. To identify putative genes directly involved in the fiber initiation process, we used a cotton ovule culture technique that controls the timing of fiber initial differentiation by exogenous phytohormone application in combination with comparative expression analyses between wild type and three fiberless mutants. The addition of exogenous auxin and gibberellins to pre-anthesis wild type ovules that did not have visible fiber initials increased the expression of genes affecting auxin, ethylene, ABA and jasmonic acid signaling pathways within 1 h after treatment. Most transcripts expressed differentially by the phytohormone treatment in vitro were also differentially expressed in the ovules of wild type and fiberless mutants that were grown in planta. In addition to MYB25-like, a gene that was previously shown to be associated with the differentiation of fiber initials, several other differentially expressed genes, including auxin/indole-3-acetic acid (AUX/IAA) involved in auxin signaling, ACC oxidase involved in ethylene biosynthesis, and abscisic acid (ABA) 8'-hydroxylase an enzyme that controls the rate of ABA catabolism, were co-regulated in the pre-anthesis ovules of both wild type and fiberless mutants. These results support the hypothesis that phytohormonal signaling networks regulate the temporal expression of genes responsible for differentiation of cotton fiber initials in vitro and in planta. PMID:25927364

A biohybrid hydrogel for the urate-responsive release of urate oxidase.

PubMed

Geraths, Christian; Daoud-El Baba, Marie; Charpin-El Hamri, Ghislaine; Weber, Wilfried

2013-10-10

Functional biomaterials that detect and correct pathological parameters hold high promises for biomedical application. In this study we describe a biohybrid hydrogel that detects elevated concentrations of uric acid and responds by dissolution and the release of uric acid-degrading urate oxidase. This material was synthesized by incorporating PEG-stabilized urate oxidase into a polyacrylamide hydrogel that was crosslinked by the uric acid-sensitive interaction between the uric acid transcription factor HucR and its operator hucO. We characterize the uric acid responsiveness of the material and demonstrate that it can effectively be applied to counteract flares of uric acid in a mouse model. This approach might be a first step towards a biomedical device autonomously managing uric acid burst associated to gouty arthritis and the tumor lysis syndrome. © 2013.

The role of gibberellins in improving the resistance of tebuconazole-coated maize seeds to chilling stress by microencapsulation

NASA Astrophysics Data System (ADS)

Yang, Lijuan; Yang, Daibin; Yan, Xiaojing; Cui, Li; Wang, Zhenying; Yuan, Huizhu

2016-11-01

Chilling stress during germination often causes severe injury. In the present study, maize seed germination and shoot growth under chilling stress were negatively correlated with the dose of tebuconazole in an exponential manner as predicted by the model Y = A + B × e(-x/k). Microencapsulation was an effective means of eliminating potential phytotoxic risk. The gibberellins (GAs) contents were higher after microencapsulation treatment than after conventional treatment when the dose of tebuconazole was higher than 0.12 g AI (active ingredient) kg-1 seed. Further analysis indicated that microencapsulation can stimulate ent-kaurene oxidase (KO) activity to some extent, whereas GA 3-oxidase (GA3ox) and GA 2-oxidase (GA2ox) activities remained similar to those in the control. Genes encoding GA metabolic enzymes exhibited different expression patterns. Transcript levels of ZmKO1 increased in the microcapsule treatments compared to the control. Even when incorporated into microcapsules, tebuconazole led to the upregulation of ZmGA3ox1 at doses of less than 0.12 g AI kg-1 seed and to the upregulation of ZmGA3ox2 when the dose was higher than 0.12 g AI kg-1 seed. With increasing doses of microencapsulated tebuconazole, the transcript levels of ZmGA2ox4, ZmGA2ox5 and ZmGA2ox6 exhibited upward trends, whereas the transcript levels of ZmGA2ox7 exhibited a downward trend.

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

RHON1 mediates a Rho-like activity for transcription termination in plastids of Arabidopsis thaliana.

PubMed

Chi, Wei; He, Baoye; Manavski, Nikolay; Mao, Juan; Ji, Daili; Lu, Congming; Rochaix, Jean David; Meurer, Jörg; Zhang, Lixin

2014-12-01

Although transcription termination is essential to generate functional RNAs, its underlying molecular mechanisms are still poorly understood in plastids of vascular plants. Here, we show that the RNA binding protein RHON1 participates in transcriptional termination of rbcL (encoding large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase) in Arabidopsis thaliana. Inactivation of RHON1 leads to enhanced rbcL read-through transcription and to aberrant accD (encoding β-subunit of the acetyl-CoA carboxylase) transcriptional initiation, which may result from inefficient transcription termination of rbcL. RHON1 can bind to the mRNA as well as to single-stranded DNA of rbcL, displays an RNA-dependent ATPase activity, and terminates transcription of rbcL in vitro. These results suggest that RHON1 terminates rbcL transcription using an ATP-driven mechanism similar to that of Rho of Escherichia coli. This RHON1-dependent transcription termination occurs in Arabidopsis but not in rice (Oryza sativa) and appears to reflect a fundamental difference between plastomes of dicotyledonous and monocotyledonous plants. Our results point to the importance and significance of plastid transcription termination and provide insights into its machinery in an evolutionary context. © 2014 American Society of Plant Biologists. All rights reserved.

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

PubMed Central

Giacomelli, Lisa

2013-01-01

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Common Genetic Denominators for Ca++-Based Skeleton in Metazoa: Role of Osteoclast-Stimulating Factor and of Carbonic Anhydrase in a Calcareous Sponge

PubMed Central

Müller, Werner E. G.; Wang, Xiaohong; Grebenjuk, Vlad A.; Korzhev, Michael; Wiens, Matthias; Schloßmacher, Ute; Schröder, Heinz C.

2012-01-01

Calcium-based matrices serve predominantly as inorganic, hard skeletal systems in Metazoa from calcareous sponges [phylum Porifera; class Calcarea] to proto- and deuterostomian multicellular animals. The calcareous sponges form their skeletal elements, the spicules, from amorphous calcium carbonate (ACC). Treatment of spicules from Sycon raphanus with sodium hypochlorite (NaOCl) results in the disintegration of the ACC in those skeletal elements. Until now a distinct protein/enzyme involved in ACC metabolism could not been identified in those animals. We applied the technique of phage display combinatorial libraries to identify oligopeptides that bind to NaOCl-treated spicules: those oligopeptides allowed us to detect proteins that bind to those spicules. Two molecules have been identified, the (putative) enzyme carbonic anhydrase and the (putative) osteoclast-stimulating factor (OSTF), that are involved in the catabolism of ACC. The complete cDNAs were isolated and the recombinant proteins were prepared to raise antibodies. In turn, immunofluorescence staining of tissue slices and qPCR analyses have been performed. The data show that sponges, cultivated under standard condition (10 mM CaCl2) show low levels of transcripts/proteins for carbonic anhydrase or OSTF, compared to those animals that had been cultivated under Ca2+-depletion condition (1 mM CaCl2). Our data identify with the carbonic anhydrase and the OSTF the first two molecules which remain conserved in cells, potentially involved in Ca-based skeletal dissolution, from sponges (sclerocytes) to human (osteoclast). PMID:22506035

Expression of BTBD7 in primary salivary adenoid cystic carcinoma and correlation with Slug and prognosis.

PubMed

Yang, Liu; Wang, Tiejun; Zhang, Jun; Liu, Zhonghao; Wang, Xuxia

2016-06-24

BTB/POZ domain-containing protein 7 (BTBD7) is recognized as a regulatory gene that regulates epithelial cell dynamics and branching morphogenesis. It is also reported for regulating epithelial-mesenchymal transition (EMT) molecules and involved in the process of invasion and metastasis of lung cancer and hepatocellular carcinoma. Slug is a transcriptional factor of EMT which plays a crucial role in the process of primary salivary adenoid cystic carcinoma (SACC). However, the role of BTBD7 in SACC and the correlation with Slug have not been identified. This study investigated the expression of BTBD7 and correlation with Slug, as well as the prognostic significance of BTBD7 in SACC. The expression of BTBD7 and Slug were examined in ACC-LM and ACC-83 cell lines and immunohistochemically in paraffin embedded tissue specimens from 66 primary SACC patients. Statistical analyses were performed to evaluate the correlation between BTBD7 expression and Slug expression and the prognostic significance of BTBD7 expression. BTBD7 protein expression was initially verified in ACC-LM and ACC-83 cell lines. The positive rate of BTBD7 expression was 62.1% in SACC to 20% in normal salivary tissues comparatively. BTBD7 expression was significantly correlated with Slug expression in SACC (P< 0.05). Increased BTBD7 expression was significantly associated with the TNM stage, tissue typing, distant metastasis and patients' poor clinical outcome. Positive expression of BTBD7 in SACC could play an important role in the development of cancer and may serve as a favorable predictor for diagnosis and poor prognosis of patients.

Resistance Responses of Potato to Vesicular-Arbuscular Mycorrhizal Fungi under Varying Abiotic Phosphorus Levels 1

PubMed Central

McArthur, David A. J.; Knowles, N. Richard

1992-01-01

In mycorrhizal symbioses, susceptibility of a host plant to infection by fungi is influenced by environmental factors, especially the availability of soil phosphorus. This study describes morphological and biochemical details of interactions between a vesicular-arbuscular mycorrhizal (VAM) fungus and potato (Solanum tuberosum L. cv Russet Burbank) plants, with a particular focus on the physiological basis for P-induced resistance of roots to infection. Root infection by the VAM fungus Glomus fasciculatum ([Thaxt. sensu Gerdemann] Gerdemann and Trappe) was extensive for plants grown with low abiotic P supply, and plant biomass accumulation was enhanced by the symbiosis. The capacity of excised roots from P-deficient plants to produce ethylene in the presence or absence of exogenous 1-amino cyclopropane-1-carboxylic acid (ACC) was markedly reduced by VAM infection. This apparent inhibition of ACC oxidase (ACCox) activity was localized to areas containing infected roots, as demonstrated in split-root studies. Furthermore, leachate from VAM roots contained a potent water-soluble inhibitor of ethylene generation from exogenous ACC by nonmycorrhizal (NM) roots. The leachate from VAM-infected roots had a higher concentration of phenolics, relative to that from NM roots. Moreover, the rates of ethylene formation and phenolic concentration in leachates from VAM roots were inversely correlated, suggesting that this inhibitor may be of a phenolic nature. The specific activity of extracellular peroxidase recovered in root leachates was not stimulated by VAM infection, although activity on a fresh weight basis was significantly enhanced, reflecting the fact that VAM roots had higher protein content than NM roots. Polyphenol oxidase activity of roots did not differ between NM and VAM roots. These results characterize the low resistance response of P-deficient plants to VAM infection. When plants were grown with higher abiotic P supply, the relative benefit of the VAM symbiosis to plant growth decreased and root infection was lower. The in vivo ACCox activity was also greater in roots of plants grown on high levels of P compared with those grown on low levels, although the influence of VAM infection was partially to counteract the nutritional effect of P on ACCox activity. Similar to ACCox activity, extracellular peroxidase activity of roots increased linearly with increasing abiotic P supply, thus indicating a greater potential for resistance to VAM infection. These findings suggest that VAM fungi may alter phenolic metabolism of roots so as to hinder ethylene production and the root's ability to invoke a defense response. Raising the abiotic P supply to plants at least partially restores the capacity of roots to produce ethylene and may, in this way, increase the root's resistance to VAM infection. Images Figure 1 PMID:16652967

After-Ripening Induced Transcriptional Changes of Hormonal Genes in Wheat Seeds: The Cases of Brassinosteroids, Ethylene, Cytokinin and Salicylic Acid

PubMed Central

Yao, Zhen; Jordan, Mark C.; Park, Seokhoon; Ayele, Belay T.

2014-01-01

Maintenance and release of seed dormancy is regulated by plant hormones; their levels and seed sensitivity being the critical factors. This study reports transcriptional regulation of brassinosteroids (BR), ethylene (ET), cytokinin (CK) and salicylic acid (SA) related wheat genes by after-ripening, a period of dry storage that decays dormancy. Changes in the expression of hormonal genes due to seed after-ripening did not occur in the anhydrobiotic state but rather in the hydrated state. After-ripening induced dormancy decay appears to be associated with imbibition mediated increase in the synthesis and signalling of BR, via transcriptional activation of de-etiolated2, dwarf4 and brassinosteroid signaling kinase, and repression of brassinosteroid insensitive 2. Our analysis is also suggestive of the significance of increased ET production, as reflected by enhanced transcription of 1-aminocyclopropane-1-carboxylic acid oxidase in after-ripened seeds, and tight regulation of seed response to ET in regulating dormancy decay. Differential transcriptions of lonely guy, zeatin O-glucosyltransferases and cytokinin oxidases, and pseudo-response regulator between dormant and after-ripened seeds implicate CK in the regulation of seed dormancy in wheat. Our analysis also reflects the association of dormancy decay in wheat with seed SA level and NPR independent SA signaling that appear to be regulated transcriptionally by phenylalanine ammonia lyase, and whirly and suppressor of npr1 inducible1 genes, respectively. Co-expression clustering of the hormonal genes implies the significance of synergistic and antagonistic interaction between the different plant hormones in regulating wheat seed dormancy. These results contribute to further our understanding of the molecular features controlling seed dormancy in wheat. PMID:24498132

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

MAOA genotype influences neural response during an inhibitory task in adolescents with conduct disorder.

PubMed

Sun, Xiaoqiang; Ma, Ren; Jiang, Yali; Gao, Yidian; Ming, Qingsen; Wu, Qiong; Dong, Daifeng; Wang, Xiang; Yao, Shuqiao

2018-05-31

Conduct disorder (CD), a common psychiatric disorder in children and adolescents, is characterized by encroaching upon other rights and violations of age-appropriate social expectations repeatedly and persistently. Individuals with CD often have high aggressiveness and low inhibitory capacity. The monoamine oxidase A (MAOA) gene has long been associated with aggression. Effects of MAOA genotype on inhibitory control have been examined in general population. Several studies had revealed reduced activation in prefrontal areas, especially the anterior cingulate cortex (ACC), in low-expression MAOA (MAOA-L) allele carriers compared to high-expression MAOA (MAOA-H) allele carriers. However, little is known about its genetic risk influences on inhibitory processes in clinical samples. In this study, functional magnetic resonance imaging (fMRI) was administered to a sample of adolescent boys with CD during the performance of a GoStop task, 29 of whom carrying MAOA-L allele and 24 carrying MAOA-H allele. Relative to MAOA-H carriers, MAOA-L carriers in CD showed more pronounced deactivation in the precuneus, supplementary motor area (SMA) and dorsal anterior cingulate cortex (dACC). Deactivation within the default mode network (DMN) and inhibitory-related areas in MAOA-L carriers may be related to compensation for low sensitivity to inhibition and/or an atypical allocation of cognitive resources. The results suggested a possible neural mechanism through which MAOA affects inhibitory processes in a clinical sample.

The NADPH-oxidase AtRbohI plays a positive role in drought-stress response in Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Huan; Yan, Jingwei; Yu, Xiaoyun

As the major resource of reactive oxygen species (ROS), the NADPH oxidases (Rbohs) have been shown to play important roles in plant cells under normal growth and stress conditions. Although many family members of Rbohs were studied, little is known about the function of RbohI in Arabidopsis thaliana. Here, we report that exogenous ABA application decreases RbohI expression and mannitol significantly increases RbohI expression at transcript level. The RbohI transcripts were strongly detected in dry seeds and roots. The loss-of-function mutant rbohI exhibited sensitivity to ABA and mannitol stress during germination. Furthermore, the lateral root growth of rbohI was severelymore » inhibited after treatment with mannitol stress. Overexpression of RbohI in Arabidopsis significantly improves the drought tolerance. Moreover, more H 2O 2 accumulated in RbohI overexpressors than in wild type plants in response to mannitol stress. Our conclusion is that AtRbohI functions in drought-stress response in Arabidopsis thaliana.« less

Chloride Channel 3 Channels in the Activation and Migration of Human Blood Eosinophils in Allergic Asthma.

PubMed

Gaurav, Rohit; Bewtra, Againdra K; Agrawal, Devendra K

2015-08-01

Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is responsible for respiratory burst in immune cells. Chloride channel 3 (CLC3) has been linked to the respiratory burst in eosinophils and neutrophils. The effect of cytokines and the involvement of CLC3 in the regulation of NADPH-dependent oxidative stress and on cytokine-mediated migration of eosinophils are not known. Human peripheral blood eosinophils were isolated from healthy individuals and from individuals with asthma by negative selection. Real-time PCR was used to detect the expression of NADPH oxidases in eosinophils. Intracellular reactive oxygen species (ROS) measurement was done with flow cytometry. Superoxide generation was measured with transforming growth factor (TGF)-β, eotaxin, and CLC3 blockers. CLC3 dependence of eosinophils in TGF-β- and eotaxin-induced migration was also examined. The messenger RNA (mRNA) transcripts of NADPH oxidase (NOX) 2, dual oxidase (DUOX) 1, and DUOX2 were detected in blood eosinophils, with very low expression of NOX1, NOX3, and NOX5 and no NOX4 mRNA. The level of NOX2 mRNA transcripts increased with disease severity in the eosinophils of subjects with asthma compared with healthy nonatopic volunteers. Change in granularity and size in eosinophils, but no change in intracellular ROS, was observed with phorbol myristate acetate (PMA). PMA, TGF-β, and eotaxin used the CLC3-dependent pathway to increase superoxide radicals. TGF-β and eotaxin induced CLC3-dependent chemotaxis of eosinophils. These findings support the requirement of CLC3 in the activation and migration of human blood eosinophils and may provide a potential novel therapeutic target to regulate eosinophil hyperactivity in allergic airway inflammation in asthma.

Chloride Channel 3 Channels in the Activation and Migration of Human Blood Eosinophils in Allergic Asthma

PubMed Central

Gaurav, Rohit; Bewtra, Againdra K.

2015-01-01

Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is responsible for respiratory burst in immune cells. Chloride channel 3 (CLC3) has been linked to the respiratory burst in eosinophils and neutrophils. The effect of cytokines and the involvement of CLC3 in the regulation of NADPH-dependent oxidative stress and on cytokine-mediated migration of eosinophils are not known. Human peripheral blood eosinophils were isolated from healthy individuals and from individuals with asthma by negative selection. Real-time PCR was used to detect the expression of NADPH oxidases in eosinophils. Intracellular reactive oxygen species (ROS) measurement was done with flow cytometry. Superoxide generation was measured with transforming growth factor (TGF)-β, eotaxin, and CLC3 blockers. CLC3 dependence of eosinophils in TGF-β– and eotaxin-induced migration was also examined. The messenger RNA (mRNA) transcripts of NADPH oxidase (NOX) 2, dual oxidase (DUOX) 1, and DUOX2 were detected in blood eosinophils, with very low expression of NOX1, NOX3, and NOX5 and no NOX4 mRNA. The level of NOX2 mRNA transcripts increased with disease severity in the eosinophils of subjects with asthma compared with healthy nonatopic volunteers. Change in granularity and size in eosinophils, but no change in intracellular ROS, was observed with phorbol myristate acetate (PMA). PMA, TGF-β, and eotaxin used the CLC3-dependent pathway to increase superoxide radicals. TGF-β and eotaxin induced CLC3-dependent chemotaxis of eosinophils. These findings support the requirement of CLC3 in the activation and migration of human blood eosinophils and may provide a potential novel therapeutic target to regulate eosinophil hyperactivity in allergic airway inflammation in asthma. PMID:25514499

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-01-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Heat stress differentially modifies ethylene biosynthesis and signaling in pea floral and fruit tissues.

PubMed

Savada, Raghavendra P; Ozga, Jocelyn A; Jayasinghege, Charitha P A; Waduthanthri, Kosala D; Reinecke, Dennis M

2017-10-01

Ethylene biosynthesis is regulated in reproductive tissues in response to heat stress in a manner to optimize resource allocation to pollinated fruits with developing seeds. High temperatures during reproductive development are particularly detrimental to crop fruit/seed production. Ethylene plays vital roles in plant development and abiotic stress responses; however, little is known about ethylene's role in reproductive tissues during development under heat stress. We assessed ethylene biosynthesis and signaling regulation within the reproductive and associated tissues of pea during the developmental phase that sets the stage for fruit-set and seed development under normal and heat-stress conditions. The transcript abundance profiles of PsACS [encode enzymes that convert S-adenosyl-L-methionine to 1-aminocyclopropane-1-carboxylic acid (ACC)] and PsACO (encode enzymes that convert ACC to ethylene), and ethylene evolution were developmentally, environmentally, and tissue-specifically regulated in the floral/fruit/pedicel tissues of pea. Higher transcript abundance of PsACS and PsACO in the ovaries, and PsACO in the pedicels was correlated with higher ethylene evolution and ovary senescence and pedicel abscission in fruits that were not pollinated under control temperature conditions. Under heat-stress conditions, up-regulation of ethylene biosynthesis gene expression in pre-pollinated ovaries was also associated with higher ethylene evolution and lower retention of these fruits. Following successful pollination and ovule fertilization, heat-stress modified PsACS and PsACO transcript profiles in a manner that suppressed ovary ethylene evolution. The normal ethylene burst in the stigma/style and petals following pollination was also suppressed by heat-stress. Transcript abundance profiles of ethylene receptor and signaling-related genes acted as qualitative markers of tissue ethylene signaling events. These data support the hypothesis that ethylene biosynthesis is regulated in reproductive tissues in response to heat stress to modulate resource allocation dynamics.

Hypoxia-Inducible Factor 1-Regulated Lysyl Oxidase Is Involved in Staphylococcus aureus Abscess Formation

PubMed Central

Beerlage, Christiane; Greb, Jessica; Kretschmer, Dorothee; Assaggaf, Mohammad; Trackman, Philip C.; Hansmann, Martin-Leo; Bonin, Michael; Eble, Johannes A.; Peschel, Andreas; Brüne, Bernhard

2013-01-01

Hypoxia-inducible factor 1 (HIF-1) is the key transcription factor involved in the adaptation of mammals to hypoxia and plays a crucial role in cancer angiogenesis. Recent evidence suggests a leading role for HIF-1 in various inflammatory and infectious diseases. Here we describe the role of HIF-1 in Staphylococcus aureus infections by investigating the HIF-1-dependent host cell response. For this purpose, transcriptional profiling of HIF-1α-deficient HepG2 and control cells, both infected with Staphylococcus aureus, was performed. Four hours after infection, the expression of 190 genes, 24 of which were regulated via HIF-1, was influenced. LOX (encoding lysyl oxidase) was one of the upregulated genes with a potential impact on the course of S. aureus infection. LOX is an amine oxidase required for biosynthetic cross-linking of extracellular matrix components. LOX was upregulated in vitro in different cell cultures infected with S. aureus and also in vivo, in kidney abscesses of mice intravenously infected with S. aureus and in clinical skin samples from patients with S. aureus infections. Inhibition of LOX by β-aminopropionitrile (BAPN) did not affect the bacterial load in kidneys or blood but significantly influenced abscess morphology and collagenization. Our data provide evidence for a crucial role of HIF-1-regulated LOX in abscess formation. PMID:23649089

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein.

PubMed

Choudhury, Swarup Roy; Roy, Sujit; Saha, Progya Paramita; Singh, Sanjay Kumar; Sengupta, Dibyendu N

2008-07-01

MA-ACS1 and MA-ACO1 are the two major ripening genes in banana and play crucial role in the regulation of ethylene production during ripening. Here, we report a comparative ripening pattern in five different naturally occurring banana cultivars namely Cavendish (AAA), Rasthali (AAB), Kanthali (AB), Poovan (AAB) and Monthan (ABB), which have distinct genome composition. We found a distinct variation in the climacteric ethylene production and in-vivo ACC oxidase activity level during the ripening stages in the five cultivars. We identified the cDNAs for MA-ACS1 and MA-ACO1 from the five cultivars and studied the transcript accumulation patterns of the two genes, which correlated well with the differential timing in the expression of these two genes during ripening. The GCC-box is one of the ethylene-responsive elements (EREs) found in the promoters of many ethylene-inducible genes. We have identified a GCC-box motif (putative ERE) in the promoters of MA-ACS1 and MA-ACO1 in banana cultivars. DNA-protein interaction studies revealed the presence of a GCC-box-specific DNA-binding activity in the fruit nuclear extract and such DNA-binding activity was enhanced following ethylene treatment. South-Western blotting revealed a 25-kDa nuclear protein that binds specifically to GCC-box DNA in the climacteric banana fruit. Together, these results indicate the probable involvement of the GCC-box motif as the cis-acting ERE in the regulation of MA-ACS1 and MA-ACO1 during ripening in banana fruits via binding of specific ERE-binding protein.

A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

PubMed Central

Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

2013-01-01

Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID:23840306

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

PubMed Central

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-01-01

The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

Krüppel-like factor 6 regulates mitochondrial function in the kidney

PubMed Central

Mallipattu, Sandeep K.; Horne, Sylvia J.; D’Agati, Vivette; Narla, Goutham; Liu, Ruijie; Frohman, Michael A.; Dickman, Kathleen; Chen, Edward Y.; Ma’ayan, Avi; Bialkowska, Agnieszka B.; Ghaleb, Amr M.; Nandan, Mandayam O.; Jain, Mukesh K.; Daehn, Ilse; Chuang, Peter Y.; Yang, Vincent W.; He, John C.

2015-01-01

Maintenance of mitochondrial structure and function is critical for preventing podocyte apoptosis and eventual glomerulosclerosis in the kidney; however, the transcription factors that regulate mitochondrial function in podocyte injury remain to be identified. Here, we identified Krüppel-like factor 6 (KLF6), a zinc finger domain transcription factor, as an essential regulator of mitochondrial function in podocyte apoptosis. We observed that podocyte-specific deletion of Klf6 increased the susceptibility of a resistant mouse strain to adriamycin-induced (ADR-induced) focal segmental glomerulosclerosis (FSGS). KLF6 expression was induced early in response to ADR in mice and cultured human podocytes, and prevented mitochondrial dysfunction and activation of intrinsic apoptotic pathways in these podocytes. Promoter analysis and chromatin immunoprecipitation studies revealed that putative KLF6 transcriptional binding sites are present in the promoter of the mitochondrial cytochrome c oxidase assembly gene (SCO2), which is critical for preventing cytochrome c release and activation of the intrinsic apoptotic pathway. Additionally, KLF6 expression was reduced in podocytes from HIV-1 transgenic mice as well as in renal biopsies from patients with HIV-associated nephropathy (HIVAN) and FSGS. Together, these findings indicate that KLF6-dependent regulation of the cytochrome c oxidase assembly gene is critical for maintaining mitochondrial function and preventing podocyte apoptosis. PMID:25689250

Characterisation of ethylene pathway components in non-climacteric capsicum

PubMed Central

2013-01-01

Background Climacteric fruit exhibit high ethylene and respiration levels during ripening but these levels are limited in non-climacteric fruit. Even though capsicum is in the same family as the well-characterised climacteric tomato (Solanaceae), it is non-climacteric and does not ripen normally in response to ethylene or if harvested when mature green. However, ripening progresses normally in capsicum fruit when they are harvested during or after what is called the ‘Breaker stage’. Whether ethylene, and components of the ethylene pathway such as 1-aminocyclopropane 1-carboxylate (ACC) oxidase (ACO), ACC synthase (ACS) and the ethylene receptor (ETR), contribute to non-climacteric ripening in capsicum has not been studied in detail. To elucidate the behaviour of ethylene pathway components in capsicum during ripening, further analysis is therefore needed. The effects of ethylene or inhibitors of ethylene perception, such as 1-methylcyclopropene, on capsicum fruit ripening and the ethylene pathway components may also shed some light on the role of ethylene in non-climacteric ripening. Results The expression of several isoforms of ACO, ACS and ETR were limited during capsicum ripening except one ACO isoform (CaACO4). ACS activity and ACC content were also low in capsicum despite the increase in ACO activity during the onset of ripening. Ethylene did not stimulate capsicum ripening but 1-methylcyclopropene treatment delayed the ripening of Breaker-harvested fruit. Some of the ACO, ACS and ETR isoforms were also differentially expressed upon treatment with ethylene or 1-methylcyclopropene. Conclusions ACS activity may be the rate limiting step in the ethylene pathway of capsicum which restricts ACC content. The differential expression of several ethylene pathway components during ripening and upon ethylene or 1-methylclopropene treatment suggests that the ethylene pathway may be regulated differently in non-climacteric capsicum compared to the climacteric tomato. Ethylene independent pathways may also exist in non-climacteric ripening as evidenced by the up-regulation of CaACO4 during ripening onset despite being negatively regulated by ethylene exposure. However, some level of ethylene perception may still be needed to induce ripening especially during the Breaker stage. A model of capsicum ripening is also presented to illustrate the probable role of ethylene in this non-climacteric fruit. PMID:24286334

Lysyl Oxidase-like-2 (LOXL2) Is a Major Isoform in Chondrocytes and Is Critically Required for Differentiation*

PubMed Central

Iftikhar, Mussadiq; Hurtado, Paola; Bais, Manish V.; Wigner, Nate; Stephens, Danielle N.; Gerstenfeld, Louis C.; Trackman, Philip C.

2011-01-01

The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1–4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. PMID:21071451

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

PubMed Central

Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

2016-01-01

Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Involvement of NADPH oxidase isoforms in the production of O2− manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa)

PubMed Central

Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

2018-01-01

In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the senescing leaves of the esl mutant. Conversely, OsNox1, OsNox3, and OsFR07 were not associated with ABA-induced O2- generation during leaf senescence. PMID:29309410

Involvement of NADPH oxidase isoforms in the production of O2- manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa).

PubMed

Li, Zhaowei; Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

2018-01-01

In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the senescing leaves of the esl mutant. Conversely, OsNox1, OsNox3, and OsFR07 were not associated with ABA-induced O2- generation during leaf senescence.

A phase II study of axitinib (AG-013736) in patients with incurable adenoid cystic carcinoma.

PubMed

Ho, A L; Dunn, L; Sherman, E J; Fury, M G; Baxi, S S; Chandramohan, R; Dogan, S; Morris, L G T; Cullen, G D; Haque, S; Sima, C S; Ni, A; Antonescu, C R; Katabi, N; Pfister, D G

2016-10-01

Recurrent/metastatic adenoid cystic carcinoma (ACC) is an incurable disease with no standard treatments. The majority of ACCs express the oncogenic transcription factor MYB (also c-myb), often in the context of a MYB gene rearrangement. This phase II trial of the tyrosine kinase inhibitor (TKI) axitinib (Pfizer) tested the hypothesis that targeting pathways activated by MYB can be therapeutically effective for ACC. This is a minimax two-stage, phase II trial that enrolled patients with incurable ACC of any primary site. Progressive or symptomatic disease was required. Patients were treated with axitinib 5 mg oral twice daily; dose escalation was allowed. The primary end point was best overall response (BOR). An exploratory analysis correlating biomarkers to drug benefit was conducted, including next-generation sequencing (NGS) in 11 patients. Thirty-three patients were registered and evaluable for response. Fifteen patients had the axitinib dose increased. Tumor shrinkage was achieved in 22 (66.7%); 3 (9.1%) had confirmed partial responses. Twenty-five (75.8%) patients had stable disease, 10 of whom had disease stability for >6 months. The median progression-free survival (PFS) was 5.7 months (range 0.92-21.8 months). Grade 3 axitinib-related toxicities included hypertension, oral pain and fatigue. A trend toward superior PFS was noted with the MYB/NFIB rearrangement, although this was not statistically significant. NGS revealed three tumors with 4q12 amplification, producing increased copies of axitinib-targeted genes PDGFR/KDR/KIT. Two 4q12 amplified patients achieved stable disease for >6 months, including one with significant tumor reduction and the longest PFS on study (21.8 months). Although the primary end point was not met, axitinib exhibited clinical activity with tumor shrinkage achieved in the majority of patients with progressive disease before trial enrollment. Analysis of MYB biomarkers and genomic profiling suggests the hypothesis that 4q12 amplified ACCs are a disease subset that benefit from TKI therapy. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Molecular Characterization of Lactobacillus plantarum Genes for β-Ketoacyl-Acyl Carrier Protein Synthase III (fabH) and Acetyl Coenzyme A Carboxylase (accBCDA), Which Are Essential for Fatty Acid Biosynthesis

PubMed Central

Kiatpapan, Pornpimon; Kobayashi, Hajime; Sakaguchi, Maki; Ono, Hisayo; Yamashita, Mitsuo; Kaneko, Yoshinobu; Murooka, Yoshikatsu

2001-01-01

Genes for subunits of acetyl coenzyme A carboxylase (ACC), which is the enzyme that catalyzes the first step in the synthesis of fatty acids in Lactobacillus plantarum L137, were cloned and characterized. We identified six potential open reading frames, namely, manB, fabH, accB, accC, accD, and accA, in that order. Nucleotide sequence analysis suggested that fabH encoded β-ketoacyl-acyl carrier protein synthase III, that the accB, accC, accD, and accA genes encoded biotin carboxyl carrier protein, biotin carboxylase, and the β and α subunits of carboxyltransferase, respectively, and that these genes were clustered. The organization of acc genes was different from that reported for Escherichia coli, for Bacillus subtilis, and for Pseudomonas aeruginosa. E. coli accB and accD mutations were complemented by the L. plantarum accB and accD genes, respectively. The predicted products of all five genes were confirmed by using the T7 expression system in E. coli. The gene product of accB was biotinylated in E. coli. Northern and primer extension analyses demonstrated that the five genes in L. plantarum were regulated polycistronically in an acc operon. PMID:11133475

Genetic Profile of Adenoid Cystic Carcinomas (ACC) with High-Grade Transformation versus Solid Type

PubMed Central

Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

2010-01-01

Background: ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. Methods: Genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. Results: ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. Conclusion: ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC. PMID:20978318

Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

PubMed

Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

2010-01-01

ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

PubMed

Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

2011-08-01

ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features, and to compare results to solid ACC. Genome wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, four with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), and five solid ACC. In addition, Ki67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

Gibberellin Biosynthesis in Developing Pumpkin Seedlings12

PubMed Central

Lange, Theo; Kappler, Jeannette; Fischer, Andreas; Frisse, Andrea; Padeffke, Tania; Schmidtke, Sabine; Lange, Maria João Pimenta

2005-01-01

A gibberellin (GA) biosynthetic pathway was discovered operating in root tips of 7-d-old pumpkin (Cucurbita maxima) seedlings. Stepwise analysis of GA metabolism in cell-free systems revealed the conversion of GA12-aldehyde to bioactive GA4 and inactive GA34. Highest levels of endogenous GA4 and GA34 were found in hypocotyls and root tips of 3-d-old seedlings. cDNA molecules encoding two GA oxidases, CmGA20ox3 and CmGA3ox3, were isolated from root tips of 7-d-old LAB150978-treated seedlings. Recombinant CmGA20ox3 fusion protein converted GA12 to GA9, GA24 to GA9, GA14 to GA4, and, less efficiently, GA53 to GA20, and recombinant CmGA3ox3 protein oxidized GA9 to GA4. Transcript profiles were determined for four GA oxidase genes from pumpkin revealing relatively high transcript levels for CmGA7ox in shoot tips and cotyledons, for CmGA20ox3 in shoot tips and hypocotyls, and for CmGA3ox3 in hypocotyls and roots of 3-d-old seedlings. Transcripts of CmGA2ox1 were mainly found in roots of 7-d-old seedlings. In roots of 7-d-old seedlings, transcripts of CmGA7ox, CmGA20ox3, and CmGA3ox3 were localized in the cap and the rhizodermis by in situ hybridization. We conclude that hypocotyls and root tips are important sites of GA biosynthesis in the developing pumpkin seedling. PMID:16126862

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

NASA Astrophysics Data System (ADS)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Small molecule inhibition of FOXM1: How to bring a novel compound into genomic context.

PubMed

Marsico, Giovanni; Gormally, Michael V

2015-03-01

Deregulation of transcription factor (TF) networks is emerging as a major pathogenic event in many human cancers (Darnell, 2002 [1]; Libermann and Zerbini, 2006 [2]; Laoukili et al., 2007 [3]). Small molecule intervention is an attractive avenue to understand TF regulatory mechanisms in healthy and disease state, as well as for exploiting these targets therapeutically (Koehler et al., 2003 [4]; Berg, 2008 [5]; Koehler, 2010 [6]). However, because of their physico-chemical properties, TF targeting has been proven to be difficult (Verdine and Walensky, 2007 [7]). The TF FOXM1 is an important mitotic player (Wonsey and Follettie, 2005 [8]; Laoukili et al., 2005 [9]; McDonald, 2005 [10]) also implicated in cancer progression (Laoukili et al., 2007 [3]; Teh, 2011 [11]; Koo, 2012 [12]) and drug resistance development (Kwok et al., 2010 [13]; Carr et al., [14]). Therefore, its inhibition is an attractive goal for cancer therapy. Here, we describe a computational biology approach, by giving detailed insights into methodologies and technical results, which was used to analyze the transcriptional RNA-Seq data presented in our previous work (Gormally et al., 2014 [20]). Our Bioinformatics analysis shed light on the cellular effect of a novel FOXM1 inhibitor (FDI-6) newly identified through a biophysical screen. The data for this report is available at the public GEO repository (accession number http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE58626).

Endothelial Antioxidant-1: A key mediator of Copper-dependent wound healing in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, Archita; Sudhahar, Varadarajan; Chen, Gin -Fu

Here, Copper (Cu), an essential nutrient, promotes wound healing, however, target of Cu action and underlying mechanisms remains elusive. Cu chaperone Antioxidant-1 (Atox1) in the cytosol supplies Cu to the secretory enzymes such as lysyl oxidase (LOX) while Atox1 in the nucleus functions as a Cu-dependent transcription factor. Using cutaneous wound healing model, here we show that Cu content (by X-ray Fluorescence Microscopy) and nuclear Atox1 are increased after wounding, and that wound healing with and without Cu treatment is impaired in Atox1 -/ - mice. Experiments using endothelial cell (EC)-specific Atox1 -/ - mice and gene transfer of nuclear-targetmore » Atox1 in Atox1 -/ - mice reveal that Atox1 in ECs as well as transcription factor function of Atox1 are required for wound healing. Mechanistically, Atox1 -/ - mice show reduced Atox1 target proteins such as p47phox NADPH oxidase and cyclin D1 as well as extracellular matrix Cu enzyme LOX activity in wound tissues. This in turn results in reducing O 2 - production in ECs, NFkB activity, cell proliferation and collagen formation, thereby inhibiting angiogenesis, macrophage recruitment and extracellular matrix maturation. Our findings suggest that Cu-dependent transcription factor/Cu chaperone Atox1 in ECs plays an essential role to sense Cu to accelerate wound angiogenesis and healing.« less

Impact of SO(2) on Arabidopsis thaliana transcriptome in wildtype and sulfite oxidase knockout plants analyzed by RNA deep sequencing.

PubMed

Hamisch, Domenica; Randewig, Dörte; Schliesky, Simon; Bräutigam, Andrea; Weber, Andreas P M; Geffers, Robert; Herschbach, Cornelia; Rennenberg, Heinz; Mendel, Ralf R; Hänsch, Robert

2012-12-01

High concentrations of sulfur dioxide (SO(2) ) as an air pollutant, and its derivative sulfite, cause abiotic stress that can lead to cell death. It is currently unknown to what extent plant fumigation triggers specific transcriptional responses. To address this question, and to test the hypothesis that sulfite oxidase (SO) is acting in SO(2) detoxification, we compared Arabidopsis wildtype (WT) and SO knockout lines (SO-KO) facing the impact of 600 nl l(-1) SO(2) , using RNAseq to quantify absolute transcript abundances. These transcriptome data were correlated to sulfur metabolism-related enzyme activities and metabolites obtained from identical samples in a previous study. SO-KO plants exhibited remarkable and broad regulative responses at the mRNA level, especially in transcripts related to sulfur metabolism enzymes, but also in those related to stress response and senescence. Focusing on SO regulation, no alterations were detectable in the WT, whereas in SO-KO plants we found up-regulation of two splice variants of the SO gene, although this gene is not functional in this line. Our data provide evidence for the highly specific coregulation between SO and sulfur-related enzymes like APS reductase, and suggest two novel candidates for involvement in SO(2) detoxification: an apoplastic peroxidase, and defensins as putative cysteine mass storages. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Endothelial Antioxidant-1: A key mediator of Copper-dependent wound healing in vivo

DOE PAGES

Das, Archita; Sudhahar, Varadarajan; Chen, Gin -Fu; ...

2016-09-26

Here, Copper (Cu), an essential nutrient, promotes wound healing, however, target of Cu action and underlying mechanisms remains elusive. Cu chaperone Antioxidant-1 (Atox1) in the cytosol supplies Cu to the secretory enzymes such as lysyl oxidase (LOX) while Atox1 in the nucleus functions as a Cu-dependent transcription factor. Using cutaneous wound healing model, here we show that Cu content (by X-ray Fluorescence Microscopy) and nuclear Atox1 are increased after wounding, and that wound healing with and without Cu treatment is impaired in Atox1 -/ - mice. Experiments using endothelial cell (EC)-specific Atox1 -/ - mice and gene transfer of nuclear-targetmore » Atox1 in Atox1 -/ - mice reveal that Atox1 in ECs as well as transcription factor function of Atox1 are required for wound healing. Mechanistically, Atox1 -/ - mice show reduced Atox1 target proteins such as p47phox NADPH oxidase and cyclin D1 as well as extracellular matrix Cu enzyme LOX activity in wound tissues. This in turn results in reducing O 2 - production in ECs, NFkB activity, cell proliferation and collagen formation, thereby inhibiting angiogenesis, macrophage recruitment and extracellular matrix maturation. Our findings suggest that Cu-dependent transcription factor/Cu chaperone Atox1 in ECs plays an essential role to sense Cu to accelerate wound angiogenesis and healing.« less

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

PubMed

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-03-18

The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Regulatory role of glycogen synthase kinase 3 for transcriptional activity of ADD1/SREBP1c.

PubMed

Kim, Kang Ho; Song, Min Jeong; Yoo, Eung Jae; Choe, Sung Sik; Park, Sang Dai; Kim, Jae Bum

2004-12-10

Adipocyte determination- and differentiation-dependent factor 1 (ADD1) plays important roles in lipid metabolism and insulin-dependent gene expression. Because insulin stimulates carbohydrate and lipid synthesis, it would be important to decipher how the transcriptional activity of ADD1/SREBP1c is regulated in the insulin signaling pathway. In this study, we demonstrated that glycogen synthase kinase (GSK)-3 negatively regulates the transcriptional activity of ADD1/SREBP1c. GSK3 inhibitors enhanced a transcriptional activity of ADD1/SREBP1c and expression of ADD1/SREBP1c target genes including fatty acid synthase (FAS), acetyl-CoA carboxylase 1 (ACC1), and steroyl-CoA desaturase 1 (SCD1) in adipocytes and hepatocytes. In contrast, overexpression of GSK3beta down-regulated the transcriptional activity of ADD1/SREBP1c. GSK3 inhibitor-mediated ADD1/SREBP1c target gene activation did not require de novo protein synthesis, implying that GSK3 might affect transcriptional activity of ADD1/SREBP1c at the level of post-translational modification. Additionally, we demonstrated that GSK3 efficiently phosphorylated ADD1/SREBP1c in vitro and in vivo. Therefore, these data suggest that GSK3 inactivation is crucial to confer stimulated transcriptional activity of ADD1/SREBP1c for insulin-dependent gene expression, which would coordinate lipid and glucose metabolism.

Fish oil improves lipid profile in juvenile rats with intrauterine growth retardation by altering the transcriptional expression of lipid-related hepatic genes.

PubMed

Chen, Lian-Hui; Liang, Li; Fang, Yan-Lan; Wang, Ying-Min; Zhu, Wei-Fen

2016-10-01

To determine whether maternal intrauterine undernutrition and post-weaning fish oil intake influence lipid profile in juvenile offspring, and explore the possible mechanisms at transcriptional levels. After weaning, 32 control offspring and 24 intrauterine growth retardation (IUGR) offspring were randomly allocated to standard chow or fish oil diet. At 10 weeks, fasting plasma glucose, triglycerides, total cholesterol and expressions of related hepatic genes were examined. IUGR offspring without catch-up growth tended to develop hyperglycemia, dyslipidemia and hepatic steatosis. Down-regulation of CPT-1 and LDLR at transcriptional levels were found in IUGR offspring. Early short-term fish oil intervention reversed these unfavorable changes in juvenile rats with IUGR. The mechanisms might be mediated by decreased expression of ACC-1, increased expression of CPT-1, LDLR and ABCG5. These data suggest that IUGR offspring already present lipid abnormality in juvenile stage, and early short-term fish oil consumption is beneficial to prevent these unfavorable changes.

A colorimetric assay of 1-aminocyclopropane-1-carboxylate (ACC) based on ninhydrin reaction for rapid screening of bacteria containing ACC deaminase.

PubMed

Li, Z; Chang, S; Lin, L; Li, Y; An, Q

2011-08-01

1-Aminocyclopropane-1-carboxylate (ACC) deaminase activity is an efficient marker for bacteria to promote plant growth by lowering ethylene levels in plants. We aim to develop a method for rapidly screening bacteria containing ACC deaminase, based on a colorimetric ninhydrin assay of ACC. A reliable colorimetric ninhydrin assay was developed to quantify ACC using heat-resistant polypropylene chimney-top 96-well PCR plates, having the wells evenly heated in boiling water, preventing accidental contamination from boiling water and limiting evaporation. With this method to measure bacterial consumption of ACC, 44 ACC-utilizing bacterial isolates were rapidly screened out from 311 bacterial isolates that were able to grow on minimal media containing ACC as the sole nitrogen source. The 44 ACC-utilizing bacterial isolates showed ACC deaminase activities and belonged to the genus Burkholderia, Pseudomonas or Herbaspirillum. Determination of bacterial ACC consumption by the PCR-plate ninhydrin-ACC assay is a rapid and efficient method for screening bacteria containing ACC deaminase from a large number of bacterial isolates. The PCR-plate ninhydrin-ACC assay extends the utility of the ninhydrin reaction and enables a rapid screening of bacteria containing ACC deaminase from large numbers of bacterial isolates. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.

PubMed

Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong

2016-06-01

Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation of their down regulation or target may be essential. Additionally, if more sex determination genes controlled by plant hormones are identified, it may possible to reveal a crosstalk of sex determination genes with hormones and environment factors.

Skeletal muscle ACC2 S212 phosphorylation is not required for the control of fatty acid oxidation during exercise.

PubMed

O'Neill, Hayley M; Lally, James S; Galic, Sandra; Pulinilkunnil, Thomas; Ford, Rebecca J; Dyck, Jason R B; van Denderen, Bryce J; Kemp, Bruce E; Steinberg, Gregory R

2015-07-01

During submaximal exercise fatty acids are a predominant energy source for muscle contractions. An important regulator of fatty acid oxidation is acetyl-CoA carboxylase (ACC), which exists as two isoforms (ACC1 and ACC2) with ACC2 predominating in skeletal muscle. Both ACC isoforms regulate malonyl-CoA production, an allosteric inhibitor of carnitine palmitoyltransferase 1 (CPT-1); the primary enzyme controlling fatty acyl-CoA flux into mitochondria for oxidation. AMP-activated protein kinase (AMPK) is a sensor of cellular energy status that is activated during exercise or by pharmacological agents such as metformin and AICAR. In resting muscle the activation of AMPK with AICAR leads to increased phosphorylation of ACC (S79 on ACC1 and S221 on ACC2), which reduces ACC activity and malonyl-CoA; effects associated with increased fatty acid oxidation. However, whether this pathway is vital for regulating skeletal muscle fatty acid oxidation during conditions of increased metabolic flux such as exercise/muscle contractions remains unknown. To examine this we characterized mice lacking AMPK phosphorylation sites on ACC2 (S212 in mice/S221 in humans-ACC2-knock-in [ACC2-KI]) or both ACC1 (S79) and ACC2 (S212) (ACC double knock-in [ACCD-KI]) during submaximal treadmill exercise and/or ex vivo muscle contractions. We find that surprisingly, ACC2-KI mice had normal exercise capacity and whole-body fatty acid oxidation during treadmill running despite elevated muscle ACC2 activity and malonyl-CoA. Similar results were observed in ACCD-KI mice. Fatty acid oxidation was also maintained in muscles from ACC2-KI mice contracted ex vivo. These findings indicate that pathways independent of ACC phosphorylation are important for regulating skeletal muscle fatty acid oxidation during exercise/muscle contractions. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Functional Connectivity of Multiple Brain Regions Required for the Consolidation of Social Recognition Memory.

PubMed

Tanimizu, Toshiyuki; Kenney, Justin W; Okano, Emiko; Kadoma, Kazune; Frankland, Paul W; Kida, Satoshi

2017-04-12

Social recognition memory is an essential and basic component of social behavior that is used to discriminate familiar and novel animals/humans. Previous studies have shown the importance of several brain regions for social recognition memories; however, the mechanisms underlying the consolidation of social recognition memory at the molecular and anatomic levels remain unknown. Here, we show a brain network necessary for the generation of social recognition memory in mice. A mouse genetic study showed that cAMP-responsive element-binding protein (CREB)-mediated transcription is required for the formation of social recognition memory. Importantly, significant inductions of the CREB target immediate-early genes c-fos and Arc were observed in the hippocampus (CA1 and CA3 regions), medial prefrontal cortex (mPFC), anterior cingulate cortex (ACC), and amygdala (basolateral region) when social recognition memory was generated. Pharmacological experiments using a microinfusion of the protein synthesis inhibitor anisomycin showed that protein synthesis in these brain regions is required for the consolidation of social recognition memory. These findings suggested that social recognition memory is consolidated through the activation of CREB-mediated gene expression in the hippocampus/mPFC/ACC/amygdala. Network analyses suggested that these four brain regions show functional connectivity with other brain regions and, more importantly, that the hippocampus functions as a hub to integrate brain networks and generate social recognition memory, whereas the ACC and amygdala are important for coordinating brain activity when social interaction is initiated by connecting with other brain regions. We have found that a brain network composed of the hippocampus/mPFC/ACC/amygdala is required for the consolidation of social recognition memory. SIGNIFICANCE STATEMENT Here, we identify brain networks composed of multiple brain regions for the consolidation of social recognition memory. We found that social recognition memory is consolidated through CREB-meditated gene expression in the hippocampus, medial prefrontal cortex, anterior cingulate cortex (ACC), and amygdala. Importantly, network analyses based on c-fos expression suggest that functional connectivity of these four brain regions with other brain regions is increased with time spent in social investigation toward the generation of brain networks to consolidate social recognition memory. Furthermore, our findings suggest that hippocampus functions as a hub to integrate brain networks and generate social recognition memory, whereas ACC and amygdala are important for coordinating brain activity when social interaction is initiated by connecting with other brain regions. Copyright © 2017 the authors 0270-6474/17/374103-14$15.00/0.

A functional dissociation of conflict processing within anterior cingulate cortex.

PubMed

Kim, Chobok; Kroger, James K; Kim, Jeounghoon

2011-02-01

Goal-directed behavior requires cognitive control to regulate the occurrence of conflict. The dorsal anterior cingulate cortex (dACC) has been suggested in detecting response conflict during various conflict tasks. Recent findings, however, have indicated not only that two distinct subregions of dACC are involved in conflict processing but also that the conflict occurs at both perceptual and response levels. In this study, we sought to examine whether perceptual and response conflicts are functionally dissociated in dACC. Thirteen healthy subjects performed a version of the Stroop task during functional magnetic resonance imaging (fMRI) scanning. We identified a functional dissociation of the caudal dACC (cdACC) and the rostral dACC (rdACC) in their responses to different sources of conflict. The cdACC was selectively engaged in perceptual conflict whereas the rdACC was more active in response conflict. Further, the dorsolateral prefrontal cortex (DLPFC) was coactivated not with cdACC but with rdACC. We suggest that cdACC plays an important role in regulative processing of perceptual conflict whereas rdACC is involved in detecting response conflict. Copyright © 2010 Wiley-Liss, Inc.

Long non-coding RNA CCAT1 modulates neuropathic pain progression through sponging miR-155.

PubMed

Dou, Lidong; Lin, Hongqi; Wang, Kaiwei; Zhu, Guosong; Zou, Xuli; Chang, Enqiang; Zhu, Yongfeng

2017-10-27

Neuropathic pain is caused by dysfunction or primary injury of the somatosensory nervous system. Long noncoding RNAs (lncRNAs) play important roles in the development of neuropathic pain. However, the effects of lncRNA colon cancer associated transcript-1 (CCAT1) in neuropathic pain have not been reported. The model of bilateral sciatic nerve chronic constriction injuries (bCCI) is regarded as long-lasting mechanical hypersensitivity and cold allodynia, which is the representative symptom in the human subjects suffering from the neuropathic pain. In this study, we found that CCAT1 expression was decreased in the spinal dorsal horn, dorsal root ganglion (DRG), hippocampus, and anterior cingulate cortex (ACC) of rats with bCCI. The rats of bCCI presented the cold allodynia after the 14 th day of postoperation. We furtherly showed that lncRNA CCAT1 decreased miR-155 expression and enhanced Serum and glucocorticoid regulated protein kinase 3 (SGK3) expression in the NGF-differentiated PC12 cell. We found that miR-155 expression was increased in the spinal dorsal horn, DRG, hippocampus, and ACC of rats with bCCI injuries. However, SGK3 expression was downregulated in the spinal dorsal horn, DRG, hippocampus, and ACC of rats with bCCI injuries. Moreover, lncRNA CCAT1 overexpression could alleviate the pain thresholds and inhibited expression of SGK3 could rescue this effect. In conclusion, these results suggested the crucial roles of CCAT1 and SGK3 in the neuropathic pain.

Long non-coding RNA CCAT1 modulates neuropathic pain progression through sponging miR-155

PubMed Central

Dou, Lidong; Lin, Hongqi; Wang, Kaiwei; Zhu, Guosong; Zou, Xuli; Chang, Enqiang; Zhu, Yongfeng

2017-01-01

Neuropathic pain is caused by dysfunction or primary injury of the somatosensory nervous system. Long noncoding RNAs (lncRNAs) play important roles in the development of neuropathic pain. However, the effects of lncRNA colon cancer associated transcript-1 (CCAT1) in neuropathic pain have not been reported. The model of bilateral sciatic nerve chronic constriction injuries (bCCI) is regarded as long-lasting mechanical hypersensitivity and cold allodynia, which is the representative symptom in the human subjects suffering from the neuropathic pain. In this study, we found that CCAT1 expression was decreased in the spinal dorsal horn, dorsal root ganglion (DRG), hippocampus, and anterior cingulate cortex (ACC) of rats with bCCI. The rats of bCCI presented the cold allodynia after the 14th day of postoperation. We furtherly showed that lncRNA CCAT1 decreased miR-155 expression and enhanced Serum and glucocorticoid regulated protein kinase 3 (SGK3) expression in the NGF-differentiated PC12 cell. We found that miR-155 expression was increased in the spinal dorsal horn, DRG, hippocampus, and ACC of rats with bCCI injuries. However, SGK3 expression was downregulated in the spinal dorsal horn, DRG, hippocampus, and ACC of rats with bCCI injuries. Moreover, lncRNA CCAT1 overexpression could alleviate the pain thresholds and inhibited expression of SGK3 could rescue this effect. In conclusion, these results suggested the crucial roles of CCAT1 and SGK3 in the neuropathic pain. PMID:29163801

The Phytotoxin Coronatine Induces Abscission-Related Gene Expression and Boll Ripening during Defoliation of Cotton

PubMed Central

Tian, Xiaoli; Duan, Liusheng; Zhang, Mingcai; Tan, Weiming; Xu, Dongyong; Li, Zhaohu

2014-01-01

Defoliants can increase machine harvest efficiency of cotton (Gossypium hirusutum L.), prevent lodging and reduce the time from defoliation to harvest. Coronatine (COR) is a chlorosis-inducing non-host-specific phytotoxin that induces leaf and/or fruit abscission in some crops. The present study investigates how COR might induce cotton leaf abscission by modulating genes involved in cell wall hydrolases and ACC (ethylene precursor) in various cotton tissues. The effects of COR on cotton boll ripening, seedcotton yield, and seed development were also studied. After 14 d of treatment with COR, cells within the leaf abscission zone (AZ) showed marked differentiation. Elevated transcripts of GhCEL1, GhPG and GhACS were observed in the AZs treated with COR and Thidiazuron (TDZ). The relative expression of GhCEL1 and GhACS in TDZ treated plants was approximately twice that in plants treated with COR for 12 h. However, only GhACS expression increased in leaf blade and petiole. There was a continuous increase in the activity of hydrolytic enzymes such as cellulase (CEL) and polygalacturonase (PG), and ACC accumulation in AZs following COR and TDZ treatments, but there was greater increase in ACC activity of COR treated boll crust, indicating that COR had greater ripening effect than TDZ. Coronatine significantly enhanced boll opening without affecting boll weight, lint percentage and seed quality. Therefore, COR can be a potential cotton defoliant with different physiological mechanism of action from the currently used TDZ. PMID:24845465

Pivotal Advance: Eosinophilia in the MES rat strain is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba).

PubMed

Mori, Masayuki; Li, Guixin; Hashimoto, Maiko; Nishio, Ayako; Tomozawa, Hiroshi; Suzuki, Nobuyoshi; Usami, Shin-ichi; Higuchi, Keiichi; Matsumoto, Kiyoshi

2009-09-01

MES is a rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. Herein, we report that eosinophilia in MES rats is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba; also known as p22(phox)), which is an essential component of the superoxide-generating NADPH oxidase complex. The MES rat has a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. As a consequence of the deletion, a 51-nucleotide sequence of intron 4 is incorporated into the Cyba transcripts. Leukocytes from the MES strain lack both CYBA protein and NADPH oxidase activity. Nevertheless, unlike patients with chronic granulomatous disease, who suffer from infections with pathogens due to similar genetic defects in NADPH oxidase, MES rats retain normal innate immune defense against Staphylococcus aureus infection. This is due to large quantities of peritoneal eosinophils in MES rats, which phagocytose and kill the bacteria. MES rat has a balance defect due to impaired formation of otoconia in the utricles and saccules. Eosinophilia of the MES rat was normalized by introduction of a normal Cyba transgene. The mechanisms by which impairment of NADPH oxidase leads to eosinophilia in the MES rat are elusive. However, our study highlights the essential role of NADPH oxidase in homeostatic regulation of innate immunity beyond conventional microbicidial functions.

Cytochrome c oxidase rather than cytochrome c is a major determinant of mitochondrial respiratory capacity in skeletal muscle of aged rats: role of carnitine and lipoic acid.

PubMed

Tamilselvan, Jayavelu; Sivarajan, Kumarasamy; Anusuyadevi, Muthuswamy; Panneerselvam, Chinnakkannu

2007-09-01

The release of mitochondrial cytochrome c followed by activation of caspase cascade has been reported with aging in various tissues, whereas little is known about the caspase-independent pathway involved in mitochondrial dysfunction. To determine the functional impact of cytochrome c loss on mitochondrial respiratory capacity, we monitored NADH redox transitions and oxygen consumption in isolated skeletal muscle mitochondria of 4- and 24-month-old rats in the presence and absence of exogenous cytochrome c; and assessed the efficacy of cosupplementation of carnitine and lipoic acid on age-related alteration in mitochondrial respiration. The loss of mitochondrial cytochrome c with age was accompanied with alteration in respiratory transition, which in turn was not rescued by exogenous addition of cytochrome c to isolated mitochondria. The analysis of mitochondrial and nuclear-encoded cytochrome c oxidase subunits suggests that the decreased levels of cytochrome c oxidase may be attributed for the irresponsiveness to exogenously added cytochrome c on mitochondrial respiratory transitions, possibly through reduction of upstream electron carriers. Oral supplementation of carnitine and lipoic acid to aged rats help to maintaining the mitochondrial oxidative capacity by regulating the release of cytochrome c and improves cytochrome c oxidase transcript levels. Thus, carnitine and lipoic acid supplementation prevents the loss of cytochrome c and their associated decline in cytochrome c oxidase activity; thereby, effectively attenuating any putative decrease in cellular energy and redox status with age.

Role of an Essential Acyl Coenzyme A Carboxylase in the Primary and Secondary Metabolism of Streptomyces coelicolor A3(2)

PubMed Central

Rodríguez, E.; Banchio, C.; Diacovich, L.; Bibb, M. J.; Gramajo, H.

2001-01-01

Two genes, accB and accE, that form part of the same operon, were cloned from Streptomyces coelicolor A3(2). AccB is homologous to the carboxyl transferase domain of several propionyl coezyme A (CoA) carboxylases and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE shows no significant homology to any known protein. Expression of accB and accE in Escherichia coli and subsequent in vitro reconstitution of enzyme activity in the presence of the biotinylated protein AccA1 or AccA2 confirmed that AccB was the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex, suggesting that this small polypeptide is a functional component of the ACCase. The impossibility of obtaining an accB null mutant and the thiostrepton growth dependency of a tipAp accB conditional mutant confirmed that AccB is essential for S. coelicolor viability. Normal growth phenotype in the absence of the inducer was restored in the conditional mutant by the addition of exogenous long-chain fatty acids in the medium, indicating that the inducer-dependent phenotype was specifically related to a conditional block in fatty acid biosynthesis. Thus, AccB, together with AccA2, which is also an essential protein (E. Rodriguez and H. Gramajo, Microbiology 143:3109–3119, 1999), are the most likely components of an ACCase whose main physiological role is the synthesis of malonyl-CoA, the first committed step of fatty acid synthesis. Although normal growth of the conditional mutant was restored by fatty acids, the cultures did not produce actinorhodin or undecylprodigiosin, suggesting a direct participation of this enzyme complex in the supply of malonyl-CoA for the synthesis of these secondary metabolites. PMID:11526020

Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications

PubMed Central

Vanderstraeten, Lisa; Van Der Straeten, Dominique

2017-01-01

1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy. PMID:28174583

Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications.

PubMed

Vanderstraeten, Lisa; Van Der Straeten, Dominique

2017-01-01

1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy.

Increased nuclear Olig1-expression in the pregenual anterior cingulate white matter of patients with major depression: a regenerative attempt to compensate oligodendrocyte loss?

PubMed

Mosebach, Jennifer; Keilhoff, Gerburg; Gos, Tomasz; Schiltz, Kolja; Schoeneck, Linda; Dobrowolny, Henrik; Mawrin, Christian; Müller, Susan; Schroeter, Matthias L; Bernstein, Hans-Gert; Bogerts, Bernhard; Steiner, Johann

2013-08-01

Structural and functional oligodendrocyte deficits as well as impaired myelin integrity have been described in affective disorders and schizophrenia, and may disturb the connectivity between disease-relevant brain regions. Olig1, an oligodendroglial transcription factor, might be important in this context, but has not been systematically studied so far. Nissl- and Olig1-stained oligodendrocytes were quantified in the pregenual anterior cingulate (pACC)/dorsolateral prefrontal cortex (DLPFC), and adjacent white matter of patients with major depressive disorder (MDD, n = 9), bipolar disorder (BD, n = 8), schizophrenia (SZ, n = 13), and matched controls (n = 16). Potential downstream effects of increased Olig1-expression were analyzed. Antidepressant drug effects on Olig1-expression were further explored in OLN-93 oligodendrocyte cultures. Nissl-stainings of both white matter regions showed a 19-27% reduction of total oligodendrocyte densities in MDD and BD, but not in SZ. In contrast, nuclear Olig1-immunoreactivity was elevated in MDD in the pACC-adjacent white matter (left: p = 0.008; right: p = 0.018); this effect tended to increase with antidepressant dosage (r = 0.631, p = 0.069). This reactive increase of Olig1 was confirmed by partly dose-dependent effects of imipramine and amitriptyline in oligodendrocyte cultures. Correspondingly, MBP expression in the pACC-adjacent white matter tended to increase with antidepressant dosage (r = 0.637, p = 0.065). Other tested brain regions showed no diagnosis-dependent differences regarding Olig1-immunoreactivity. Since nuclear Olig1-expression marks oligodendrocyte precursor cells, its increased expression along with reduced total oligodendrocyte densities (Nissl-stained) in the pACC-adjacent white matter of MDD patients might indicate a (putatively medication-boosted) regenerative attempt to compensate oligodendrocyte loss. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

PubMed

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

Characterization of Plasmodium falciparum Choline Transporters

DTIC Science & Technology

2005-04-01

ElO PfCTL v.1 transcript El IE2E31E41 E5 E6EE EJ PfCTL v.2 transcript B 1/1 31/11 61/21 91/31 ATG AAT TAC ATC GAG ATG GAA GA CGT GAA TAT AAA CCA CTT...ATA GA GAA GTGBGAT AAT GGA AC AT ATT ATA ATA MT MC MG GM TAT TAT AAC ATG TAT GA AAC AT MT ATA M N Y I E M4 E E R E Y K P L I EK E V D N G N N I B I N N...GGT ATA AAT TAC MT GGG AM ATA TGT GGA AAG GAT CTA CAT AA TAT CCA TAT TTA TAC TTC CCT CTT ACT CCT MA MT CCT MA CCT GA ATA TTA AGT ACC TAT GCT MA TGC YO G

Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity.

PubMed

Finley, Lydia W S; Vardhana, Santosha A; Carey, Bryce W; Alonso-Curbelo, Direna; Koche, Richard; Chen, Yanyang; Wen, Duancheng; King, Bryan; Radler, Megan R; Rafii, Shahin; Lowe, Scott W; Allis, C David; Thompson, Craig B

2018-05-01

A robust network of transcription factors and an open chromatin landscape are hallmarks of the naive pluripotent state. Recently, the acetyllysine reader Brd4 has been implicated in stem cell maintenance, but the relative contribution of Brd4 to pluripotency remains unclear. Here, we show that Brd4 is dispensable for self-renewal and pluripotency of embryonic stem cells (ESCs). When maintained in their ground state, ESCs retain transcription factor binding and chromatin accessibility independent of Brd4 function or expression. In metastable ESCs, Brd4 independence can be achieved by increased expression of pluripotency transcription factors, including STAT3, Nanog or Klf4, so long as the DNA methylcytosine oxidases Tet1 and Tet2 are present. These data reveal that Brd4 is not essential for ESC self-renewal. Rather, the levels of pluripotency transcription factor abundance and Tet1/2 function determine the extent to which bromodomain recognition of protein acetylation contributes to the maintenance of gene expression and cell identity.

The Mediator Complex Subunits MED14, MED15, and MED16 Are Involved in Defense Signaling Crosstalk in Arabidopsis.

PubMed

Wang, Chenggang; Du, Xuezhu; Mou, Zhonglin

2016-01-01

Mediator is a highly conserved protein complex that functions as a transcriptional coactivator in RNA polymerase II (RNAPII)-mediated transcription. The Arabidopsis Mediator complex has recently been implicated in plant immune responses. Here, we compared salicylic acid (SA)-, methyl jasmonate (MeJA)-, and the ethylene (ET) precursor 1-aminocyclopropane-1-carboxylic acid (ACC)-induced defense and/or wound-responsive gene expression in 14 Arabidopsis Mediator subunit mutants. Our results show that MED14, MED15, and MED16 are required for SA-activated expression of the defense marker gene PATHOEGNESIS-RELATED GENE1 , MED25 is required for MeJA-induced expression of the wound-responsive marker gene VEGATATIVE STORAGE PROTEIN1 ( VSP1 ), MED8, MED14, MED15, MED16, MED18, MED20a, MED25, MED31, and MED33A/B (MED33a and MED33B) are required for MeJA-induced expression of the defense maker gene PLANT DEFENSIN1.2 ( PDF1.2 ), and MED8, MED14, MED15, MED16, MED25, and MED33A/B are also required for ACC-triggered expression of PDF1.2 . Furthermore, we investigated the involvement of MED14, MED15, and MED16 in plant defense signaling crosstalk and found that MED14, MED15, and MED16 are required for SA- and ET-mediated suppression of MeJA-induced VSP1 expression. This result suggests that MED14, MED15, and MED16 not only relay defense signaling from the SA and JA/ET defense pathways to the RNAPII transcription machinery, but also fine-tune defense signaling crosstalk. Finally, we show that MED33A/B contributes to the necrotrophic fungal pathogen Botrytis cinerea- induced expression of the defense genes PDF1.2, HEVEIN-LIKE , and BASIC CHITINASE and is required for full-scale basal resistance to B. cinerea , demonstrating a positive role for MED33 in plant immunity against necrotrophic fungal pathogens.

Acute Respiratory Distress Syndrome Neutrophils Have a Distinct Phenotype and Are Resistant to Phosphoinositide 3-Kinase Inhibition

PubMed Central

Juss, Jatinder K.; House, David; Amour, Augustin; Begg, Malcolm; Herre, Jurgen; Storisteanu, Daniel M. L.; Hoenderdos, Kim; Bradley, Glyn; Lennon, Mark; Summers, Charlotte; Hessel, Edith M.; Condliffe, Alison

2016-01-01

Rationale: Acute respiratory distress syndrome is refractory to pharmacological intervention. Inappropriate activation of alveolar neutrophils is believed to underpin this disease’s complex pathophysiology, yet these cells have been little studied. Objectives: To examine the functional and transcriptional profiles of patient blood and alveolar neutrophils compared with healthy volunteer cells, and to define their sensitivity to phosphoinositide 3-kinase inhibition. Methods: Twenty-three ventilated patients underwent bronchoalveolar lavage. Alveolar and blood neutrophil apoptosis, phagocytosis, and adhesion molecules were quantified by flow cytometry, and oxidase responses were quantified by chemiluminescence. Cytokine and transcriptional profiling were used in multiplex and GeneChip arrays. Measurements and Main Results: Patient blood and alveolar neutrophils were distinct from healthy circulating cells, with increased CD11b and reduced CD62L expression, delayed constitutive apoptosis, and primed oxidase responses. Incubating control cells with disease bronchoalveolar lavage recapitulated the aberrant functional phenotype, and this could be reversed by phosphoinositide 3-kinase inhibitors. In contrast, the prosurvival phenotype of patient cells was resistant to phosphoinositide 3-kinase inhibition. RNA transcriptomic analysis revealed modified immune, cytoskeletal, and cell death pathways in patient cells, aligning closely to sepsis and burns datasets but not to phosphoinositide 3-kinase signatures. Conclusions: Acute respiratory distress syndrome blood and alveolar neutrophils display a distinct primed prosurvival profile and transcriptional signature. The enhanced respiratory burst was phosphoinositide 3-kinase–dependent but delayed apoptosis and the altered transcriptional profile were not. These unexpected findings cast doubt over the utility of phosphoinositide 3-kinase inhibition in acute respiratory distress syndrome and highlight the importance of evaluating novel therapeutic strategies in patient-derived cells. PMID:27064380

Gibberellin Regulation of Fruit Set and Growth in Tomato1[W

PubMed Central

Serrani, Juan Carlos; Sanjuán, Rafael; Ruiz-Rivero, Omar; Fos, Mariano; García-Martínez, José Luis

2007-01-01

The role of gibberellins (GAs) in tomato (Solanum lycopersicum) fruit development was investigated. Two different inhibitors of GA biosynthesis (LAB 198999 and paclobutrazol) decreased fruit growth and fruit set, an effect reversed by GA3 application. LAB 198999 reduced GA1 and GA8 content, but increased that of their precursors GA53, GA44, GA19, and GA20 in pollinated fruits. This supports the hypothesis that GA1 is the active GA for tomato fruit growth. Unpollinated ovaries developed parthenocarpically in response to GA3 > GA1 = GA4 > GA20, but not to GA19, suggesting that GA 20-oxidase activity was limiting in unpollinated ovaries. This was confirmed by analyzing the effect of pollination on transcript levels of SlCPS, SlGA20ox1, -2, and -3, and SlGA3ox1 and -2, encoding enzymes of GA biosynthesis. Pollination increased transcript content of SlGA20ox1, -2, and -3, and SlCPS, but not of SlGA3ox1 and -2. To investigate whether pollination also altered GA inactivation, full-length cDNA clones of genes encoding enzymes catalyzing GA 2-oxidases (SlGA2ox1, -2, -3, -4, and -5) were isolated and characterized. Transcript levels of these genes did not decrease early after pollination (5-d-old fruits), but transcript content reduction of all of them, mainly of SlGA2ox2, was found later (from 10 d after anthesis). We conclude that pollination mediates fruit set by activating GA biosynthesis mainly through up-regulation of GA20ox. Finally, the phylogenetic reconstruction of the GA2ox family clearly showed the existence of three gene subfamilies, and the phylogenetic position of SlGA2ox1, -2, -3, -4, and -5 was established. PMID:17660355

Regulation of Wheat Seed Dormancy by After-Ripening Is Mediated by Specific Transcriptional Switches That Induce Changes in Seed Hormone Metabolism and Signaling

PubMed Central

Kanno, Yuri; Jordan, Mark C.; Kamiya, Yuji; Seo, Mitsunori; Ayele, Belay T.

2013-01-01

Treatments that promote dormancy release are often correlated with changes in seed hormone content and/or sensitivity. To understand the molecular mechanisms underlying the role of after-ripening (seed dry storage) in triggering hormone related changes and dormancy decay in wheat (Triticum aestivum), temporal expression patterns of genes related to abscisic acid (ABA), gibberellin (GA), jasmonate and indole acetic acid (IAA) metabolism and signaling, and levels of the respective hormones were examined in dormant and after-ripened seeds in both dry and imbibed states. After-ripening mediated developmental switch from dormancy to germination appears to be associated with declines in seed sensitivity to ABA and IAA, which are mediated by transcriptional repressions of PROTEIN PHOSPHATASE 2C, SNF1-RELATED PROTEIN KINASE2, ABA INSENSITIVE5 and LIPID PHOSPHATE PHOSPHTASE2, and AUXIN RESPONSE FACTOR and RELATED TO UBIQUITIN1 genes. Transcriptomic analysis of wheat seed responsiveness to ABA suggests that ABA inhibits the germination of wheat seeds partly by repressing the transcription of genes related to chromatin assembly and cell wall modification, and activating that of GA catabolic genes. After-ripening induced seed dormancy decay in wheat is also associated with the modulation of seed IAA and jasmonate contents. Transcriptional control of members of the ALLENE OXIDE SYNTHASE, 3-KETOACYL COENZYME A THIOLASE, LIPOXYGENASE and 12-OXOPHYTODIENOATE REDUCTASE gene families appears to regulate seed jasmonate levels. Changes in the expression of GA biosynthesis genes, GA 20-OXIDASE and GA 3-OXIDASE, in response to after-ripening implicate this hormone in enhancing dormancy release and germination. These findings have important implications in the dissection of molecular mechanisms underlying regulation of seed dormancy in cereals. PMID:23437172

Prenatal iron deficiency and monoamine oxidase A (MAOA) polymorphisms: combined risk for later cognitive performance in rhesus monkeys.

PubMed

Golub, Mari; Hogrefe, Casey

2014-03-01

Monoamine oxidase A (MAOA) gene polymorphisms resulting in high and low transcription rates are associated with individual differences in reward efficacy and response inhibition. Iron deficiency (ID) is the most frequent single-nutrient deficiency worldwide, and prenatal ID has recently been shown to carry a risk for lower mental development scores in infants. In this study, a potential interaction of MAOA genotype and prenatal ID was studied in young male rhesus monkeys. Cognitive tasks, including problem solving, responsiveness to reward and attention, were used to characterize the potential interaction of these two fetal risks. ID was induced by feeding rhesus monkey dams an iron-deficient (10 ppm, ID) or an iron-sufficient (100 ppm, IS) diet during gestation (n = 10/group). Subgroups of the ID and IS diet offspring had low-MAOA or high-MAOA transcription rate polymorphisms. ID combined with low-MAOA genotype showed distinctive effects on reward preference and problem solving while ID in hi-MAOA juveniles modified response inhibition. Given the incidence of ID and MAOA polymorphisms in humans, this interaction could be a significant determinant of cognitive performance.

Functional mechanism of neuroprotection by inhibitors of type B monoamine oxidase in Parkinson's disease.

PubMed

Naoi, Makoto; Maruyama, Wakako

2009-08-01

Neuroprotective therapy has been proposed for age-related neurodegenerative disorders, including Parkinson's disease. Inhibitors of type B monoamine oxidase (MAOB-Is), rasagiline and (-)deprenyl, are the most promising candidate neuroprotective drugs. Clinical trials of rasagiline in patients with Parkinson's disease suggest that rasagiline may have some disease-modifying effects. Results using animal and cellular models have proved that the MAOB-Is protect neurons by the intervention of 'intrinsic' mitochondrial apoptotic cascade and the induction of prosurvival antiapoptotic Bcl-2 and neurotrophic factors. Rasagiline-related MAOB-Is prevent mitochondrial permeability transition induced by various insults and activation of subsequent apoptotic cascades: cytochrome c release, casapase activation, and condensation and fragmentation of nuclear DNA. MAOB-Is increase transcription of prosurvival genes through activating the nuclear transcription factor-(NF) system. Rasagiline increases the protein and mRNA levels of GDNF in dopaminergic SH-SY5Y cells, whereas (-)deprenyl increases those of BDNF. Systemic administration of (-)deprenyl and rasagiline increases these neurotrophic factors in the cerebrospinal fluid from patients with Parkinson's disease and nonhuman primates. This review presents recent advances in our understanding of the neuroprotection offered by MAOB-Is and possible evaluation of neuroprotective efficacy in clinical samples is discussed.

Small GTPases and Stress Responses of vvran1 in the Straw Mushroom Volvariella volvacea

PubMed Central

Yan, Jun-Jie; Xie, Bin; Zhang, Lei; Li, Shao-Jie; van Peer, Arend F.; Wu, Ta-Ju; Chen, Bing-Zhi; Xie, Bao-Gui

2016-01-01

Small GTPases play important roles in the growth, development and environmental responses of eukaryotes. Based on the genomic sequence of the straw mushroom Volvariella volvacea, 44 small GTPases were identified. A clustering analysis using human small GTPases as the references revealed that V. volvacea small GTPases can be grouped into five families: nine are in the Ras family, 10 are in the Rho family, 15 are in the Rab family, one is in the Ran family and nine are in the Arf family. The transcription of vvran1 was up-regulated upon hydrogen peroxide (H2O2) stress, and could be repressed by diphenyleneiodonium chloride (DPI), a NADPH oxidase-specific inhibitor. The number of vvran1 transcripts also increased upon cold stress. Diphenyleneiodonium chloride, but not the superoxide dismutase (SOD) inhibitor diethy dithiocarbamate (DDC), could suppress the up-regulation of vvran1 gene expression to cold stress. These results combined with the high correlations between gene expression and superoxide anion (O2−) generation indicated that vvran1 could be one of the candidate genes in the downstream of O2− mediated pathways that are generated by NADPH oxidase under low temperature and oxidative stresses. PMID:27626406

Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid

PubMed Central

Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R.; Masliah, Eliezer; Lipton, Stuart A.

2015-01-01

Cyanide is a life threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species (ROS). This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain-barrier to upregulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human induced pluripotent stem cell (hiPSC)-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino (NSA) mouse model of cyanide poisoning that simulates damage observed in the human brain. PMID:25692407

Examining the Effectiveness of Climate Change Frames in the Face of a Climate Change Denial Counter-Frame.

PubMed

McCright, Aaron M; Charters, Meghan; Dentzman, Katherine; Dietz, Thomas

2016-01-01

Prior research on the influence of various ways of framing anthropogenic climate change (ACC) do not account for the organized ACC denial in the U.S. media and popular culture, and thus may overestimate these frames' influence in the general public. We conducted an experiment to examine how Americans' ACC views are influenced by four promising frames for urging action on ACC (economic opportunity, national security, Christian stewardship, and public health)-when these frames appear with an ACC denial counter-frame. This is the first direct test of how exposure to an ACC denial message influences Americans' ACC views. Overall, these four positive frames have little to no effect on ACC beliefs. But exposure to an ACC denial counter-frame does significantly reduce respondents' belief in the reality of ACC, belief about the veracity of climate science, awareness of the consequences of ACC, and support for aggressively attempting to reduce our nation's GHG emissions in the near future. Furthermore, as expected by the Anti-Reflexivity Thesis, exposure to the ACC denial counter-frame has a disproportionate influence on the ACC views of conservatives (than on those of moderates and liberals), effectively activating conservatives' underlying propensity for anti-reflexivity. Copyright © 2015 Cognitive Science Society, Inc.

Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

PubMed

Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

2018-05-01

Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

Molecular cloning and characterisation of banana fruit polyphenol oxidase.

PubMed

Gooding, P S; Bird, C; Robinson, S P

2001-09-01

Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

Transcriptome Sequencing Identifies SPL7-Regulated Copper Acquisition Genes FRO4/FRO5 and the Copper Dependence of Iron Homeostasis in Arabidopsis[C][W

PubMed Central

Bernal, María; Casero, David; Singh, Vasantika; Wilson, Grandon T.; Grande, Arne; Yang, Huijun; Dodani, Sheel C.; Pellegrini, Matteo; Huijser, Peter; Connolly, Erin L.; Merchant, Sabeeha S.; Krämer, Ute

2012-01-01

The transition metal copper (Cu) is essential for all living organisms but is toxic when present in excess. To identify Cu deficiency responses comprehensively, we conducted genome-wide sequencing-based transcript profiling of Arabidopsis thaliana wild-type plants and of a mutant defective in the gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7), which acts as a transcriptional regulator of Cu deficiency responses. In response to Cu deficiency, FERRIC REDUCTASE OXIDASE5 (FRO5) and FRO4 transcript levels increased strongly, in an SPL7-dependent manner. Biochemical assays and confocal imaging of a Cu-specific fluorophore showed that high-affinity root Cu uptake requires prior FRO5/FRO4-dependent Cu(II)-specific reduction to Cu(I) and SPL7 function. Plant iron (Fe) deficiency markers were activated in Cu-deficient media, in which reduced growth of the spl7 mutant was partially rescued by Fe supplementation. Cultivation in Cu-deficient media caused a defect in root-to-shoot Fe translocation, which was exacerbated in spl7 and associated with a lack of ferroxidase activity. This is consistent with a possible role for a multicopper oxidase in Arabidopsis Fe homeostasis, as previously described in yeast, humans, and green algae. These insights into root Cu uptake and the interaction between Cu and Fe homeostasis will advance plant nutrition, crop breeding, and biogeochemical research. PMID:22374396

[A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

PubMed

Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

2013-08-04

Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to NaCl and alkali stresses.

Transformation and crystallization energetics of synthetic and biogenic amorphous calcium carbonate.

PubMed

Radha, A V; Forbes, Tori Z; Killian, Christopher E; Gilbert, P U P A; Navrotsky, Alexandra

2010-09-21

Amorphous calcium carbonate (ACC) is a metastable phase often observed during low temperature inorganic synthesis and biomineralization. ACC transforms with aging or heating into a less hydrated form, and with time crystallizes to calcite or aragonite. The energetics of transformation and crystallization of synthetic and biogenic (extracted from California purple sea urchin larval spicules, Strongylocentrotus purpuratus) ACC were studied using isothermal acid solution calorimetry and differential scanning calorimetry. Transformation and crystallization of ACC can follow an energetically downhill sequence: more metastable hydrated ACC → less metastable hydrated ACC ⇒ anhydrous ACC ∼ biogenic anhydrous ACC ⇒ vaterite → aragonite → calcite. In a given reaction sequence, not all these phases need to occur. The transformations involve a series of ordering, dehydration, and crystallization processes, each lowering the enthalpy (and free energy) of the system, with crystallization of the dehydrated amorphous material lowering the enthalpy the most. ACC is much more metastable with respect to calcite than the crystalline polymorphs vaterite or aragonite. The anhydrous ACC is less metastable than the hydrated, implying that the structural reorganization during dehydration is exothermic and irreversible. Dehydrated synthetic and anhydrous biogenic ACC are similar in enthalpy. The transformation sequence observed in biomineralization could be mainly energetically driven; the first phase deposited is hydrated ACC, which then converts to anhydrous ACC, and finally crystallizes to calcite. The initial formation of ACC may be a first step in the precipitation of calcite under a wide variety of conditions, including geological CO(2) sequestration.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Solubility and bioavailability of stabilized amorphous calcium carbonate.

PubMed

Meiron, Oren E; Bar-David, Elad; Aflalo, Eliahu D; Shechter, Assaf; Stepensky, David; Berman, Amir; Sagi, Amir

2011-02-01

Since its role in the prevention of osteoporosis in humans was proven some 30 years ago, calcium bioavailability has been the subject of numerous scientific studies. Recent technology allowing the production of a stable amorphous calcium carbonate (ACC) now enables a bioavailability analysis of this unique form of calcium. This study thus compares the solubility and fractional absorption of ACC, ACC with chitosan (ACC-C), and crystalline calcium carbonate (CCC). Solubility was evaluated by dissolving these preparations in dilute phosphoric acid. The results demonstrated that both ACC and ACC-C are more soluble than CCC. Fractional absorption was evaluated by intrinsically labeling calcium carbonate preparations with (45)Ca, orally administrated to rats using gelatin capsules. Fractional absorption was determined by evaluating the percentage of the administrated radioactive dose per milliliter that was measured in the serum, calcium absorption in the femur, and whole-body retention over a 34-hour period. Calcium serum analysis revealed that calcium absorption from ACC and ACC-C preparations was up to 40% higher than from CCC, whereas retention of ACC and ACC-C was up to 26.5% higher than CCC. Absorbed calcium in the femurs of ACC-administrated rats was 30% higher than in CCC-treated animals, whereas 15% more calcium was absorbed following ACC-C treatment than following CCC treatment. This study demonstrates the enhanced solubility and bioavailability of ACC over CCC. The use of stable ACC as a highly bioavailable dietary source for calcium is proposed based on the findings of this study. Copyright © 2011 American Society for Bone and Mineral Research.

Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

PubMed

Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

2011-04-01

Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Genotype-specific enrichment of ACC deaminase-positive bacteria in winter wheat rhizospheres

USDA-ARS?s Scientific Manuscript database

Bacteria that produce ACC deaminase promote plant growth and development by lowering levels of the stress hormone ethylene through deamination of 1-aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Therefore, it is hypothesized that ACC deaminase positive (ACC+) bacteri...

24 CFR 982.151 - Annual contributions contract.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Contract and PHA Administration of Program § 982.151 Annual contributions contract. (a) Nature of ACC. (1) An annual contributions contract (ACC) is a written contract between HUD and a PHA. Under the ACC... owners and for the PHA administrative fee. The ACC specifies the maximum payment over the ACC term. The...

24 CFR 982.151 - Annual contributions contract.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Contract and PHA Administration of Program § 982.151 Annual contributions contract. (a) Nature of ACC. (1) An annual contributions contract (ACC) is a written contract between HUD and a PHA. Under the ACC... owners and for the PHA administrative fee. The ACC specifies the maximum payment over the ACC term. The...

Pleasure in using adaptive cruise control: A questionnaire study in The Netherlands.

PubMed

de Winter, J C F; Gorter, C M; Schakel, W J; van Arem, B

2017-02-17

Adaptive cruise control (ACC), a technology that allows for automated car following, is becoming increasingly prevalent. Previous surveys have shown that drivers generally regard ACC as pleasant but that they have to intervene when the ACC reaches its operational limits. The former research has been mostly concerned with specific car brands and does not fully reflect the diversity of ACC types in traffic today. The objective of the present research was to establish the determinants of pleasure in using ACC. A 55-item online questionnaire was completed by Dutch users of diverse ACC systems. Respondents (N = 182) rated their ACC highly, with a mean score of 8.0 on a scale from 1 (extraordinarily negative) to 10 (extraordinarily positive) and were most pleased with ACC on high-speed roads and in low-density traffic. Moreover, the findings point to specific operational limits such as associated with cut-in situations. Pleasure was greater for the types of ACC that are able to decelerate to a full stop, according to 48% of our sample. An analysis of the free-response items indicated that respondents who were displeased with ACC mentioned its occasional clumsiness and the dangerous situations it may evoke, whereas those who were pleased with ACC valued the complementarity of human and machine and emphasized the roles of responsibility and experience in using ACC. Pleasure in using ACC is a function of both technological advances and human factors.

Activation of AMP-activated Protein Kinase by Metformin Induces Protein Acetylation in Prostate and Ovarian Cancer Cells*

PubMed Central

Galdieri, Luciano; Gatla, Himavanth; Vancurova, Ivana; Vancura, Ales

2016-01-01

AMP-activated protein kinase (AMPK) is an energy sensor and master regulator of metabolism. AMPK functions as a fuel gauge monitoring systemic and cellular energy status. Activation of AMPK occurs when the intracellular AMP/ATP ratio increases and leads to a metabolic switch from anabolism to catabolism. AMPK phosphorylates and inhibits acetyl-CoA carboxylase (ACC), which catalyzes carboxylation of acetyl-CoA to malonyl-CoA, the first and rate-limiting reaction in de novo synthesis of fatty acids. AMPK thus regulates homeostasis of acetyl-CoA, a key metabolite at the crossroads of metabolism, signaling, chromatin structure, and transcription. Nucleocytosolic concentration of acetyl-CoA affects histone acetylation and links metabolism and chromatin structure. Here we show that activation of AMPK with the widely used antidiabetic drug metformin or with the AMP mimetic 5-aminoimidazole-4-carboxamide ribonucleotide increases the inhibitory phosphorylation of ACC and decreases the conversion of acetyl-CoA to malonyl-CoA, leading to increased protein acetylation and altered gene expression in prostate and ovarian cancer cells. Direct inhibition of ACC with allosteric inhibitor 5-(tetradecyloxy)-2-furoic acid also increases acetylation of histones and non-histone proteins. Because AMPK activation requires liver kinase B1, metformin does not induce protein acetylation in liver kinase B1-deficient cells. Together, our data indicate that AMPK regulates the availability of nucleocytosolic acetyl-CoA for protein acetylation and that AMPK activators, such as metformin, have the capacity to increase protein acetylation and alter patterns of gene expression, further expanding the plethora of metformin's physiological effects. PMID:27733682

Biochemical specificity of von Economo neurons in hominoids

PubMed Central

Stimpson, Cheryl D.; Tetreault, Nicole A.; Allman, John M.; Jacobs, Bob; Butti, Camilla; Hof, Patrick R.; Sherwood, Chet C.

2010-01-01

Von Economo neurons (VENs) are defined by their thin, elongated cell body and long dendrites projecting from apical and basal ends. These distinctive neurons are mostly present in anterior cingulate (ACC) and fronto-insular (FI) cortex, with particularly high densities in cetaceans, elephants, and hominoid primates (i.e., humans and apes). This distribution suggests that VENs contribute to specializations of neural circuits in species that share both large brain size and complex social cognition, possibly representing an adaptation to rapidly relay socially-relevant information over long distances across the brain. Recent evidence indicates that unique patterns of protein expression may also characterize VENs, particularly involving molecules that are known to regulate gut and immune function. In this study, we used quantitative stereologic methods to examine the expression of three such proteins that are localized in VENs – activating-transcription factor 3 (ATF3), interleukin 4 receptor (IL4Rα) and neuromedin B (NMB). We quantified immunoreactivity against these proteins in different morphological classes of ACC layer V neurons of hominoids. Among the different neuron types analyzed (pyramidal, VEN, fork, enveloping, and other multipolar), VENs showed the greatest percentage that displayed immunostaining. Additionally, a higher proportion of VENs in humans were immunoreactive to ATF3, IL4Rα, and NMB than in other apes. No other ACC layer V neuron type displayed a significant species difference in the percentage of immunoreactive neurons. These findings demonstrate that phylogenetic variation exists in the protein expression profile of VENs, suggesting that humans might have evolved biochemical specializations for enhanced interoceptive sensitivity. PMID:21140465

Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-{kappa}B in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manea, Adrian, E-mail: adrian.manea@icbp.ro; Tanase, Laurentia I.; Raicu, Monica

Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysismore » showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.« less

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Anterior cingulate cortex surface area relates to behavioral inhibition in adolescents with and without heavy prenatal alcohol exposure

PubMed Central

Migliorini, Robyn; Moore, Eileen M.; Glass, Leila; Infante, M. Alejandra; Tapert, Susan F.; Jones, Kenneth Lyons; Mattson, Sarah N.; Riley, Edward P.

2015-01-01

Prenatal alcohol exposure is associated with behavioral disinhibition, yet the brain structure correlates of this deficit have not been determined with sufficient detail. We examined the hypothesis that the structure of the anterior cingulate cortex (ACC) relates to inhibition performance in youth with histories of heavy prenatal alcohol exposure (AE, n = 32) and non-exposed controls (CON, n = 21). Adolescents (12–17 years) underwent structural magnetic resonance imaging yielding measures of gray matter volume, surface area, and thickness across four ACC subregions. A subset of subjects were administered the NEPSY-II Inhibition subtest. MANCOVA was utilized to test for group differences in ACC and inhibition performance and multiple linear regression was used to probe ACC-inhibition relationships. ACC surface area was significantly smaller in AE, though this effect was primarily driven by reduced right caudal ACC (rcACC). AE also performed significantly worse on inhibition speed but not on inhibition accuracy. Regression analyses with the rcACC revealed a significant group × ACC interaction. A smaller rcACC surface area was associated with slower inhibition completion time for AE but was not significantly associated with inhibition in CON. After accounting for processing speed, smaller rcACC surface area was associated with worse (i.e., slower) inhibition regardless of group. Examining processing speed independently, a decrease in rcACC surface area was associated with faster processing speed for CON but not significantly associated with processing speed in AE. Results support the theory that caudal ACC may monitor reaction time in addition to inhibition and highlight the possibility of delayed ACC neurodevelopment in prenatal alcohol exposure. PMID:26025509

Anterior cingulate cortex surface area relates to behavioral inhibition in adolescents with and without heavy prenatal alcohol exposure.

PubMed

Migliorini, Robyn; Moore, Eileen M; Glass, Leila; Infante, M Alejandra; Tapert, Susan F; Jones, Kenneth Lyons; Mattson, Sarah N; Riley, Edward P

2015-10-01

Prenatal alcohol exposure is associated with behavioral disinhibition, yet the brain structure correlates of this deficit have not been determined with sufficient detail. We examined the hypothesis that the structure of the anterior cingulate cortex (ACC) relates to inhibition performance in youth with histories of heavy prenatal alcohol exposure (AE, n = 32) and non-exposed controls (CON, n = 21). Adolescents (12-17 years) underwent structural magnetic resonance imaging yielding measures of gray matter volume, surface area, and thickness across four ACC subregions. A subset of subjects were administered the NEPSY-II Inhibition subtest. MANCOVA was utilized to test for group differences in ACC and inhibition performance and multiple linear regression was used to probe ACC-inhibition relationships. ACC surface area was significantly smaller in AE, though this effect was primarily driven by reduced right caudal ACC (rcACC). AE also performed significantly worse on inhibition speed but not on inhibition accuracy. Regression analyses with the rcACC revealed a significant group × ACC interaction. A smaller rcACC surface area was associated with slower inhibition completion time for AE but was not significantly associated with inhibition in CON. After accounting for processing speed, smaller rcACC surface area was associated with worse (i.e., slower) inhibition regardless of group. Examining processing speed independently, a decrease in rcACC surface area was associated with faster processing speed for CON but not significantly associated with processing speed in AE. Results support the theory that caudal ACC may monitor reaction time in addition to inhibition and highlight the possibility of delayed ACC neurodevelopment in prenatal alcohol exposure. Copyright © 2015 Elsevier B.V. All rights reserved.

Enhanced responses of the anterior cingulate cortex neurones to colonic distension in viscerally hypersensitive rats

PubMed Central

Gao, Jun; Wu, Xiaoyin; Owyang, Chung; Li, Ying

2006-01-01

The anterior cingulate cortex (ACC) is critically involved in processing the affective component of pain sensation. Visceral hypersensitivity is a characteristic of irritable bowel syndrome. Electrophysiological activity of the ACC with regard to visceral sensitization has not been characterized. Single ACC neuronal activities in response to colorectal distension (CRD) were recorded in control, sham-treated rats and viscerally hypersensitive (EA) rats (induced by chicken egg albumin injection, i.p). The ACC neurones of controls failed to respond to 10 or 30 mmHg CRD; only 22% were activated by 50 mmHg CRD. Among the latter, 16.4% exhibited an excitatory response to CRD and were labelled ‘CRD-excited’ neurones. In contrast, CRD (10, 30 and 50 mmHg) markedly increased ACC neuronal responses of EA rats (10%, 28% and 47%, respectively). CRD produced greater pressure-dependent increases in ACC spike firing rates in EA rats compared with controls. Splanchnicectomy combined with pelvic nerve section abolished ACC responses to CRD in EA rats. Spontaneous activity in CRD-excited ACC neurones was significantly higher in EA rats than in controls. CRD-excited ACC neurones in control and EA rats (7 of 16 (42%) and 8 of 20 (40%), respectively) were activated by transcutaneous electrical and thermal stimuli. However, ACC neuronal activity evoked by noxious cutaneous stimuli did not change significantly in EA rats. This study identifies CRD-responsive neurones in the ACC and establishes for the first time that persistence of a heightened visceral afferent nociceptive input to the ACC induces ACC sensitization, characterized by increased spontaneous activity of CRD-excited neurones, decreased CRD pressure threshold, and increased response magnitude. Enhanced ACC nociceptive transmission in viscerally hypersensitive rats is restricted to visceral afferent input. PMID:16239277

Genetic Profiling Reveals Cross-Contamination and Misidentification of 6 Adenoid Cystic Carcinoma Cell Lines: ACC2, ACC3, ACCM, ACCNS, ACCS and CAC2

PubMed Central

Phuchareon, Janyaporn; Ohta, Yoshihito; Woo, Jonathan M.; Eisele, David W.; Tetsu, Osamu

2009-01-01

Adenoid cystic carcinoma (ACC) is the second most common malignant neoplasm of the salivary glands. Most patients survive more than 5 years after surgery and postoperative radiation therapy. The 10 year survival rate, however, drops to 40%, due to locoregional recurrences and distant metastases. Improving long-term survival in ACC requires the development of more effective systemic therapies based on a better understanding of the biologic behavior of ACC. Much preclinical research in this field involves the use of cultured cells and, to date, several ACC cell lines have been established. Authentication of these cell lines, however, has not been reported. We performed DNA fingerprint analysis on six ACC cell lines using short tandem repeat (STR) examinations and found that all six cell lines had been contaminated with other cells. ACC2, ACC3, and ACCM were determined to be cervical cancer cells (HeLa cells), whereas the ACCS cell line was composed of T24 urinary bladder cancer cells. ACCNS and CAC2 cells were contaminated with cells derived from non-human mammalian species: the cells labeled ACCNS were mouse cells and the CAC2 cells were rat cells. These observations suggest that future studies using ACC cell lines should include cell line authentication to avoid the use of contaminated or non-human cells. PMID:19557180

Reward salience and risk aversion underlie differential ACC activity in substance dependence

PubMed Central

Alexander, William H.; Fukunaga, Rena; Finn, Peter; Brown, Joshua W.

2015-01-01

The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed. PMID:26106528

Reward salience and risk aversion underlie differential ACC activity in substance dependence.

PubMed

Alexander, William H; Fukunaga, Rena; Finn, Peter; Brown, Joshua W

2015-01-01

The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed.

24 CFR 941.302 - Annual contributions contract; drawdowns and advances.

Code of Federal Regulations, 2010 CFR

2010-04-01

... execute an ACC or ACC amendment covering the entire amount of reserved development funds or the amount of... part. This ACC or ACC amendment must be executed by both the PHA and HUD before funds can be provided... the ACC for pre-development costs for materials and services related to proposal preparation and...

24 CFR 941.302 - Annual contributions contract; drawdowns and advances.

Code of Federal Regulations, 2011 CFR

2011-04-01

... execute an ACC or ACC amendment covering the entire amount of reserved development funds or the amount of... part. This ACC or ACC amendment must be executed by both the PHA and HUD before funds can be provided... the ACC for pre-development costs for materials and services related to proposal preparation and...

Dehydration-induced amorphous phases of calcium carbonate.

PubMed

Saharay, Moumita; Yazaydin, A Ozgur; Kirkpatrick, R James

2013-03-28

Amorphous calcium carbonate (ACC) is a critical transient phase in the inorganic precipitation of CaCO3 and in biomineralization. The calcium carbonate crystallization pathway is thought to involve dehydration of more hydrated ACC to less hydrated ACC followed by the formation of anhydrous ACC. We present here computational studies of the transition of a hydrated ACC with a H2O/CaCO3 ratio of 1.0 to anhydrous ACC. During dehydration, ACC undergoes reorganization to a more ordered structure with a significant increase in density. The computed density of anhydrous ACC is similar to that of calcite, the stable crystalline phase. Compared to the crystalline CaCO3 phases, calcite, vaterite, and aragonite, the computed local structure of anhydrous ACC is most-similar to those of calcite and vaterite, but the overall structure is not well described by either. The strong hydrogen bond interaction between the carbonate ions and water molecules plays a crucial role in stabilizing the less hydrated ACC compositions compared to the more hydrated ones, leading to a progressively increasing hydration energy with decreasing water content.

Recombinant yeast screen for new inhibitors of human acetyl-CoA carboxylase 2 identifies potential drugs to treat obesity

PubMed Central

Marjanovic, Jasmina; Chalupska, Dominika; Patenode, Caroline; Coster, Adam; Arnold, Evan; Ye, Alice; Anesi, George; Lu, Ying; Okun, Ilya; Tkachenko, Sergey; Haselkorn, Robert; Gornicki, Piotr

2010-01-01

Acetyl-CoA carboxylase (ACC) is a key enzyme of fatty acid metabolism with multiple isozymes often expressed in different eukaryotic cellular compartments. ACC-made malonyl-CoA serves as a precursor for fatty acids; it also regulates fatty acid oxidation and feeding behavior in animals. ACC provides an important target for new drugs to treat human diseases. We have developed an inexpensive nonradioactive high-throughput screening system to identify new ACC inhibitors. The screen uses yeast gene-replacement strains depending for growth on cloned human ACC1 and ACC2. In “proof of concept” experiments, growth of such strains was inhibited by compounds known to target human ACCs. The screen is sensitive and robust. Medium-size chemical libraries yielded new specific inhibitors of human ACC2. The target of the best of these inhibitors was confirmed with in vitro enzymatic assays. This compound is a new drug chemotype inhibiting human ACC2 with 2.8 μM IC50 and having no effect on human ACC1 at 100 μM. PMID:20439761

Implications of terminal oxidase function in regulation of salicylic acid on soybean seedling photosynthetic performance under water stress.

PubMed

Tang, Yanping; Sun, Xin; Wen, Tao; Liu, Mingjie; Yang, Mingyan; Chen, Xuefei

2017-03-01

The aim of this study is to investigate whether exogenous application of salicylic acid (SA) could modulate the photosynthetic capacity of soybean seedlings in water stress tolerance, and to clarify the potential functions of terminal oxidase (plastid terminal oxidase (PTOX) and alternative oxidase (AOX)) in SA' s regulation on photosynthesis. The effects of SA and water stress on gas exchange, pigment contents, chlorophyll fluorescence, enzymes (guaiacol peroxidase (POD; EC 1.11.1.7), superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), ascorbate peroxidase (APX; EC 1.11.1.11) and NADP-malate dehydrogenase (NADP-MDH; EC1.1.1.82)) activity and transcript levels of PTOX, AOX1, AOX2a, AOX2b were examined in a hydroponic cultivation system. Results indicate that water stress significantly decreased the photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (E), pigment contents (Chla + b, Chla/b, Car), maximum quantum yield of PSⅡphotochemistry (Fv/Fm), efficiency of excitation capture of open PSⅡcenter (Fv'/Fm'), quantum efficiency of PSⅡphotochemistry (ΦPSⅡ), photochemical quenching (qP), and increased malondialdehyde (MDA) content and the activity of all the enzymes. SA pretreatment led to significant decreases in Ci and MDA content, and increases in Pn, Gs, E, pigment contents, Fv/Fm, Fv'/Fm', ΦPSⅡ, qP, and the activity of all the enzymes. SA treatment and water stress alone significantly up-regulated the expression of PTOX, AOX1 and AOX2b. SA pretreatment further increased the transcript levels of PTOX and AOX2b of soybean seedling under water stress. These results indicate that SA application alleviates the water stress-induced decrease in photosynthesis may mainly through maintaining a lower reactive oxygen species (ROS) level, a greater PSⅡefficiency, and an enhanced alternative respiration and chlororespiration. PTOX and AOX may play important roles in SA-mediated resistance to water stress. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Activation of acetyl-coenzyme A carboxylase is involved in Taxol-induced ovarian cancer cell death

PubMed Central

WU, JIANG; JI, FANG; DI, WEN; CHEN, HONGDUO; WAN, YINSHENG

2011-01-01

Acetyl-coenzyme A carboxylase (ACC) is an attractive target for research into the treatment of a variety of human diseases, including diabetes, obesity and cancer. Mounting evidence suggests that the inhibition of ACC induced of cancer cell apoptosis. However, whether the inhibition of ACC regulates apoptosis in CaOV3 cancer cells has yet to be addressed. This study investigated the cytotoxic mechanism of action of ACC inhibition. Results showed that 5-(tetradecyloxy)-2-furoic acid (TOFA), an ACC inhibitor, enhanced Taxol-induced CaOV3 human ovarian cancer cell apoptosis. Notably, when TOFA was administered as a monotherapy, it induced CaOV3 cell apoptosis. Pre-treatment with the EGFR inhibitor PD153035 was found to markedly enhance ACC phosphorylation, whereas AMP-activated protein kinase (AMPK) activator AICAR was found to marginally enhance ACC phosphorylation. Taken together, the data showed ACC is a potential novel molecular target of Taxol. Additionally, ACC inhibition partially contributed to the cytotoxic effect of Taxol in ovarian cancer cells. PMID:22866118

Activation of acetyl-coenzyme A carboxylase is involved in Taxol-induced ovarian cancer cell death.

PubMed

Wu, Jiang; Ji, Fang; DI, Wen; Chen, Hongduo; Wan, Yinsheng

2011-05-01

Acetyl-coenzyme A carboxylase (ACC) is an attractive target for research into the treatment of a variety of human diseases, including diabetes, obesity and cancer. Mounting evidence suggests that the inhibition of ACC induced of cancer cell apoptosis. However, whether the inhibition of ACC regulates apoptosis in CaOV3 cancer cells has yet to be addressed. This study investigated the cytotoxic mechanism of action of ACC inhibition. Results showed that 5-(tetradecyloxy)-2-furoic acid (TOFA), an ACC inhibitor, enhanced Taxol-induced CaOV3 human ovarian cancer cell apoptosis. Notably, when TOFA was administered as a monotherapy, it induced CaOV3 cell apoptosis. Pre-treatment with the EGFR inhibitor PD153035 was found to markedly enhance ACC phosphorylation, whereas AMP-activated protein kinase (AMPK) activator AICAR was found to marginally enhance ACC phosphorylation. Taken together, the data showed ACC is a potential novel molecular target of Taxol. Additionally, ACC inhibition partially contributed to the cytotoxic effect of Taxol in ovarian cancer cells.

Nonsense mutation in the phosphofructokinase muscle subunit gene associated with retention of intron 10 in one of the isolated transcripts in Ashkenazi Jewish patients with Tarui disease.

PubMed Central

Vasconcelos, O; Sivakumar, K; Dalakas, M C; Quezado, M; Nagle, J; Leon-Monzon, M; Dubnick, M; Gajdusek, D C; Goldfarb, L G

1995-01-01

Mutations in the human phosphofructokinase muscle subunit gene (PFKM) are known to cause myopathy classified as glycogenosis type VII (Tarui disease). Previously described molecular defects include base substitutions altering encoded amino acids or resulting in abnormal splicing. We report a mutation resulting in phosphofructokinase deficiency in three patients from an Ashkenazi Jewish family. Using a reverse transcription PCR assay, PFKM subunit transcripts differing by length were detected in skeletal muscle tissue of all three affected subjects. In the longer transcript, an insertion of 252 nucleotides totally homologous to the structure of the 10th intron of the PFKM gene was found separating exon 10 from exon 11. In addition, two single base transitions were identified by direct sequencing: [exon 6; codon 95; CGA (Arg) to TGA (stop)] and [exon 7; codon 172; ACC (Thr) to ACT (Thr)] in either transcript. Single-stranded conformational polymorphism and restriction enzyme analyses confirmed the presence of these point substitutions in genomic DNA and strongly suggested homozygosity for the pathogenic allele. The nonsense mutation at codon 95 appeared solely responsible for the phenotype in these patients, further expanding genetic heterogeneity of Tarui disease. Transcripts with and without intron 10 arising from identical mutant alleles probably resulted from differential pre-mRNA processing and may represent a novel message from the PFKM gene. Images Fig. 2 Fig. 4 Fig. 5 PMID:7479776

Cryptochrome and Period Proteins Are Regulated by the CLOCK/BMAL1 Gene: Crosstalk between the PPARs/RXRα-Regulated and CLOCK/BMAL1-Regulated Systems

PubMed Central

Nakamura, Koh-ichi; Inoue, Ikuo; Takahashi, Seiichiro; Komoda, Tsugikazu; Katayama, Shigehiro

2008-01-01

Feeding and the circadian system regulate lipid absorption and metabolism, and the expression of enzymes involved in lipid metabolism is believed to be directly controlled by the clock system. To investigate the interaction between the lipid metabolism system and the circadian system, we analyzed the effect of a CLOCK/BMAL1 heterodimer on the transcriptional regulation of PPAR-controlled genes through PPAR response elements (PPREs). Transcription of acyl-CoA oxidase, cellular retinol binding protein II (CRBPII), and 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase was altered by CLOCK/BMAL1, and transcriptional activity via PPRE by PPARs/RXRα was enhanced by CLOCK/BMAL1 and/or by PPARs ligand/activators. We also found that CLOCK/BMAL1-mediated transcription of period (PER) and cryptochrome (CRY) was modulated by PPARα/RXRα. These results suggest that there may be crosstalk between the PPARs/RXRα-regulated system and the CLOCK/BMAL1-regulated system. PMID:18317514

24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

The Repeat Sequences and Elevated Substitution Rates of the Chloroplast accD Gene in Cupressophytes

PubMed Central

Li, Jia; Su, Yingjuan; Wang, Ting

2018-01-01

The plastid accD gene encodes a subunit of the acetyl-CoA carboxylase (ACCase) enzyme. The length of accD gene has been supposed to expand in Cryptomeria japonica, Taiwania cryptomerioides, Cephalotaxus, Taxus chinensis, and Podocarpus lambertii, and the main reason for this phenomenon was the existence of tandemly repeated sequences. However, it is still unknown whether the accD gene length in other cupressophytes has expanded. Here, in order to investigate how widespread this phenomenon was, 18 accD sequences and its surrounding regions of cupressophyte were sequenced and analyzed. Together with 39 GenBank sequence data, our taxon sampling covered all the extant gymnosperm orders. The repetitive elements and substitution rates of accD among 57 gymnosperm species were analyzed, the results show: (1) Reading frame length of accD gene in 18 cupressophytes species has also expanded. (2) Many repetitive elements were identified in accD gene of cupressophyte lineages. (3) The synonymous and non-synonymous substitution rates of accD were accelerated in cupressophytes. (4) accD was located in rearrangement endpoints. These results suggested that repetitive elements may mediate the chloroplast genome rearrangement and accelerated the substitution rates. PMID:29731764

Stevioside improves pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA carboxylase.

PubMed

Chen, Jianguo; Jeppesen, Per Bendix; Nordentoft, Iver; Hermansen, Kjeld

2007-06-01

Chronic hyperglycemia is detrimental to pancreatic beta-cells, causing impaired insulin secretion and beta-cell turnover. The characteristic secretory defects are increased basal insulin secretion (BIS) and a selective loss of glucose-stimulated insulin secretion (GSIS). Several recent studies support the view that the acetyl-CoA carboxylase (ACC) plays a pivotal role for GSIS. We have shown that stevioside (SVS) enhances insulin secretion and ACC gene expression. Whether glucotoxicity influences ACC and whether this action can be counteracted by SVS are not known. To investigate this, we exposed isolated mouse islets as well as clonal INS-1E beta-cells for 48 h to 27 or 16.7 mM glucose, respectively. We found that 48-h exposure to high glucose impairs GSIS from mouse islets and INS-1E cells, an effect that is partly counteracted by SVS. The ACC dephosphorylation inhibitor okadaic acid (OKA, 10(-8) M), and 5-aminoimidazole-4-carboxamide-1-beta-d-ribofuranoside (AICAR, 10(-4) M), an activator of 5'-AMP protein kinase that phosphorylates ACC, eliminated the beneficial effect of SVS. 5-Tetrade-cyloxy-2-furancarboxylic acid (TOFA), the specific ACC inhibitor, blocked the effect of SVS as well. During glucotoxity, ACC gene expression, ACC protein, and phosphorylated ACC protein were increased in INS-1E beta-cells. SVS pretreatment further increased ACC gene expression with strikingly elevated ACC activity and increased glucose uptake accompanied by enhanced GSIS. Our studies show that glucose is a potent stimulator of ACC and that SVS to some extent counteracts glucotoxicity via increased ACC activity. SVS possesses the potential to alleviate negative effects of glucotoxicity in beta-cells via a unique mechanism of action.

Rostral anterior cingulate cortex morphology predicts treatment response to internet-based CBT for depression

PubMed Central

Webb, Christian A.; Olson, Elizabeth A.; Killgore, William D.S.; Pizzagalli, Diego A.; Rauch, Scott L.; Rosso, Isabelle M.

2018-01-01

Background Rostral and subgenual anterior cingulate cortex (rACC and sgACC) activity and, to a lesser extent, volume have been shown to predict depressive symptom improvement across different antidepressant treatments. This study extends prior work by examining whether rACC and/or sgACC morphology predicts treatment response to internet-based cognitive behavioral therapy (iCBT) for major depressive disorder (MDD). This is the first study to examine neural predictors of response to iCBT. Methods Hierarchical linear modeling tested whether pre-treatment rACC and sgACC volumes predicted depressive symptom improvement during a 6-session (10-week) randomized clinical trial of iCBT (n = 35) vs. a monitored attention control (MAC; n = 38). Analyses also tested whether pre-treatment rACC and sgACC volumes differed between patients who achieved depression remission versus those who did not remit. Results Larger pre-treatment right rACC volume was a significant predictor of greater depressive symptom improvement in iCBT, even when controlling for demographic (age, gender, race) and clinical (baseline depression, anhedonia and anxiety) variables previously linked to treatment response. In addition, pre-treatment right rACC volume was larger among iCBT patients whose depression eventually remitted relative to those who did not remit. Corresponding analyses in the MAC group and for the sgACC were not significant. Conclusions rACC volume prior to iCBT demonstrated incremental predictive validity beyond clinical and demographic variables previously found to predict symptom improvement. Such findings may help inform our understanding of the mediating anatomy of iCBT and, if replicated, may suggest neural targets to augment treatment response (e.g., via modulation of rACC function). ClinicalTrials.gov Identifier NCT01598922 PMID:29486867

Ferric reductase genes involved in high-affinity iron uptake are differentially regulated in yeast and hyphae of Candida albicans.

PubMed

Jeeves, Rose E; Mason, Robert P; Woodacre, Alexandra; Cashmore, Annette M

2011-09-01

The pathogenic yeast Candida albicans possesses a reductive iron uptake system which is active in iron-restricted conditions. The sequestration of iron by this mechanism initially requires the reduction of free iron to the soluble ferrous form, which is catalysed by ferric reductase proteins. Reduced iron is then taken up into the cell by a complex of a multicopper oxidase protein and an iron transport protein. Multicopper oxidase proteins require copper to function and so reductive iron and copper uptake are inextricably linked. It has previously been established that Fre10 is the major cell surface ferric reductase in C. albicans and that transcription of FRE10 is regulated in response to iron levels. We demonstrate here that Fre10 is also a cupric reductase and that Fre7 also makes a significant contribution to cell surface ferric and cupric reductase activity. It is also shown, for the first time, that transcription of FRE10 and FRE7 is lower in hyphae compared to yeast and that this leads to a corresponding decrease in cell surface ferric, but not cupric, reductase activity. This demonstrates that the regulation of two virulence determinants, the reductive iron uptake system and the morphological form of C. albicans, are linked. Copyright © 2011 John Wiley & Sons, Ltd.

Chemotherapy-Induced Monoamine Oxidase Expression in Prostate Carcinoma Functions as a Cytoprotective Resistance Enzyme and Associates with Clinical Outcomes

PubMed Central

Huang, Chung-Ying; Harris, William P.; Sim, Hong Gee; Lucas, Jared M.; Coleman, Ilsa; Higano, Celestia S.; Gulati, Roman; True, Lawrence D.; Vessella, Robert; Lange, Paul H.; Garzotto, Mark; Beer, Tomasz M.; Nelson, Peter S.

2014-01-01

To identify molecular alterations in prostate cancers associating with relapse following neoadjuvant chemotherapy and radical prostatectomy patients with high-risk localized prostate cancer were enrolled into a phase I-II clinical trial of neoadjuvant chemotherapy with docetaxel and mitoxantrone followed by prostatectomy. Pre-treatment prostate tissue was acquired by needle biopsy and post-treatment tissue was acquired by prostatectomy. Prostate cancer gene expression measurements were determined in 31 patients who completed 4 cycles of neoadjuvant chemotherapy. We identified 141 genes with significant transcript level alterations following chemotherapy that associated with subsequent biochemical relapse. This group included the transcript encoding monoamine oxidase A (MAOA). In vitro, cytotoxic chemotherapy induced the expression of MAOA and elevated MAOA levels enhanced cell survival following docetaxel exposure. MAOA activity increased the levels of reactive oxygen species and increased the expression and nuclear translocation of HIF1α. The suppression of MAOA activity using the irreversible inhibitor clorgyline augmented the apoptotic responses induced by docetaxel. In summary, we determined that the expression of MAOA is induced by exposure to cytotoxic chemotherapy, increases HIF1α, and contributes to docetaxel resistance. As MAOA inhibitors have been approved for human use, regimens combining MAOA inhibitors with docetaxel may improve clinical outcomes. PMID:25198178

Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

PubMed

Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

2008-02-01

The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.

Redox Control of Aphid Resistance through Altered Cell Wall Composition and Nutritional Quality1[OPEN

PubMed Central

Rasool, Brwa; Marcus, Sue E.

2017-01-01

The mechanisms underpinning plant perception of phloem-feeding insects, particularly aphids, remain poorly characterized. Therefore, the role of apoplastic redox state in controlling aphid infestation was explored using transgenic tobacco (Nicotiana tabacum) plants that have either high (PAO) or low (TAO) ascorbate oxidase (AO) activities relative to the wild type. Only a small number of leaf transcripts and metabolites were changed in response to genotype, and cell wall composition was largely unaffected. Aphid fecundity was decreased significantly in TAO plants compared with other lines. Leaf sugar levels were increased and maximum extractable AO activities were decreased in response to aphids in all genotypes. Transcripts encoding the Respiratory Burst Oxidase Homolog F, signaling components involved in ethylene and other hormone-mediated pathways, photosynthetic electron transport components, sugar, amino acid, and cell wall metabolism, were increased significantly in the TAO plants in response to aphid perception relative to other lines. The levels of galactosylated xyloglucan were decreased significantly in response to aphid feeding in all the lines, the effect being the least in the TAO plants. Similarly, all lines exhibited increases in tightly bound (1→4)-β-galactan. Taken together, these findings identify AO-dependent mechanisms that limit aphid infestation. PMID:28743764

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

PubMed

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Chemotherapy-induced monoamine oxidase expression in prostate carcinoma functions as a cytoprotective resistance enzyme and associates with clinical outcomes.

PubMed

Gordon, Ryan R; Wu, Mengchu; Huang, Chung-Ying; Harris, William P; Sim, Hong Gee; Lucas, Jared M; Coleman, Ilsa; Higano, Celestia S; Gulati, Roman; True, Lawrence D; Vessella, Robert; Lange, Paul H; Garzotto, Mark; Beer, Tomasz M; Nelson, Peter S

2014-01-01

To identify molecular alterations in prostate cancers associating with relapse following neoadjuvant chemotherapy and radical prostatectomy patients with high-risk localized prostate cancer were enrolled into a phase I-II clinical trial of neoadjuvant chemotherapy with docetaxel and mitoxantrone followed by prostatectomy. Pre-treatment prostate tissue was acquired by needle biopsy and post-treatment tissue was acquired by prostatectomy. Prostate cancer gene expression measurements were determined in 31 patients who completed 4 cycles of neoadjuvant chemotherapy. We identified 141 genes with significant transcript level alterations following chemotherapy that associated with subsequent biochemical relapse. This group included the transcript encoding monoamine oxidase A (MAOA). In vitro, cytotoxic chemotherapy induced the expression of MAOA and elevated MAOA levels enhanced cell survival following docetaxel exposure. MAOA activity increased the levels of reactive oxygen species and increased the expression and nuclear translocation of HIF1α. The suppression of MAOA activity using the irreversible inhibitor clorgyline augmented the apoptotic responses induced by docetaxel. In summary, we determined that the expression of MAOA is induced by exposure to cytotoxic chemotherapy, increases HIF1α, and contributes to docetaxel resistance. As MAOA inhibitors have been approved for human use, regimens combining MAOA inhibitors with docetaxel may improve clinical outcomes.

Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

PubMed

Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

2000-10-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

An Examination of Rostral Anterior Cingulate Cortex Function and Neurochemistry in Obsessive–Compulsive Disorder

PubMed Central

Brennan, Brian P; Tkachenko, Olga; Schwab, Zachary J; Juelich, Richard J; Ryan, Erin M; Athey, Alison J; Pope, Harrison G; Jenike, Michael A; Baker, Justin T; Killgore, William DS; Hudson, James I; Jensen, J Eric; Rauch, Scott L

2015-01-01

The anterior cingulate cortex is implicated in the neurobiology of obsessive–compulsive disorder (OCD). However, few studies have examined functional and neurochemical abnormalities specifically in the rostral subdivision of the ACC (rACC) in OCD patients. We used functional magnetic resonance imaging (fMRI) during an emotional counting Stroop task and single-voxel J-resolved proton magnetic resonance spectroscopy (1H-MRS) in the rACC to examine the function and neurochemistry of the rACC in individuals with OCD and comparison individuals without OCD. Between-group differences in rACC activation and glutamine/glutamate ratio (Gln/Glu), Glu, and Gln levels, as well as associations between rACC activation, Gln/Glu, Glu, Gln, behavioral, and clinical measures were examined using linear regression. In a sample of 30 participants with OCD and 29 age- and sex-matched participants without OCD, participants with OCD displayed significantly reduced rACC deactivation compared with those without OCD in response to OCD-specific words versus neutral words on the emotional counting Stroop task. However, Gln/Glu, Glu, and Gln in the rACC did not differ between groups nor was there an association between reduced rACC deactivation and Gln/Glu, Glu, or Gln in the OCD group. Taken together, these findings strengthen the evidence for rACC dysfunction in OCD, but weigh against an underlying association with abnormal rACC glutamatergic neurotransmission. PMID:25662837

24 CFR 941.305 - Technical processing and approval.

Code of Federal Regulations, 2011 CFR

2011-04-01

... shall notify the PHA in writing and shall forward to it for execution an ACC (or ACC amendment). If the PHA already has executed an ACC (or ACC amendment) for the entire reserved amount, HUD shall notify...

24 CFR 941.305 - Technical processing and approval.

Code of Federal Regulations, 2010 CFR

2010-04-01

... shall notify the PHA in writing and shall forward to it for execution an ACC (or ACC amendment). If the PHA already has executed an ACC (or ACC amendment) for the entire reserved amount, HUD shall notify...

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

PubMed

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Early Mitochondrial Adaptations in Skeletal Muscle to Obesity and Obesity Resistance Differentially Regulated by High-Fat Diet.

PubMed

Sun, Jingyu; Huang, Tao; Qi, Zhengtang; You, Songhui; Dong, Jingmei; Zhang, Chen; Qin, Lili; Zhou, Yunhe; Ding, Shuzhe

2017-09-01

The mechanism for different susceptibilities to obesity after short-term high-fat diet (HFD) feeding is largely unknown. Given the close association between obesity occurrence and mitochondrial dysfunction, the early events in skeletal muscle mitochondrial adaptations between HFD-induced obesity (DIO) and HFD-induced obesity resistant (DIO-R) lean phenotype under excess nutritional environment were explored.ICR/JCL male mice were randomly divided into 2 groups, as follows: low-fat diet (LFD) and HFD groups. After 6 weeks on HFD, HFD-fed mice were classified as DIO or DIO-R according to their body weight gain. Serum parameters, oxidative stress biomarkers, the activation of AMPK/ACC axis, and the expression profiles of mitochondrial biogenesis were measured by using corresponding methods among the LFD control, DIO, and DIO-R groups. Serum glucose, total cholesterol, low-density lipoprotein, and high-density lipoprotein levels were significantly increased in DIO and DIO-R mice compared with LFD controls. However, DIO-R mice had significantly higher MDA levels and exhibited a significantly higher level of AMP-activated protein kinase (AMPK) activation and acetyl-CoA carboxylase (ACC) inactivation than DIO mice. Furthermore, the transcript and protein levels of transcriptional coactivator peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1α (PGC-1α) and estrogen-related receptor-α (ERRα) in DIO-R mice were significantly up-regulated compared with the DIO mice. Although the body weight gain differed, the DIO and DIO-R mice had similar metabolic disturbance of glucose and lipids after short-term HFD consumption. The diverse alterations on fatty acid oxidation and mitochondrial biogenesis pathway induced by AMPK activation might be involved in different susceptibilities to obesity when consuming HFD. © Georg Thieme Verlag KG Stuttgart · New York.

Oral solution of fructose promotes SREBP-1c high-expression in the hypothalamus of Wistar rats.

PubMed

Batista, Leandro Oliveira; Ramos, Viviane Wagner; Rosas Fernández, Mariana Alejandra; Concha Vilca, Carlos Marcelo; Albuquerque, Kelse Tibau de

2018-01-25

We evaluate whether the consumption of fructose for 8 weeks affects enzymes and transcription factors of the lipogenic and inflammatory pathways in the hypothalamus of Wistar rats. At 30 days, the animals were divided into groups: Control (C) and Fructose (F) and maintained with free access to feed and filtered water (C) or aqueous solution of purified fructose at 20% (F). RT-PCR and Western blotting were performed for the target genes and proteins. In F group, results showed a lower feed intake, an increase in glycemia (146.20 ± 6.09 vs. 102.32 ± 4.58; n: 9) and triacylglycerol (F: 191.65 ± 13.51 vs. C: 131.69 ± 6.49; n: 9) and there was no difference in water and energy consumption. We identified a higher content of acetyl-CoA carboxylase (ACC) (F: 133.93 ± 5.58 vs. C: 100 ± 0.0; n: 9-10) and NFκB (F: 125.5 ± 8.85 vs. C: 100 ± 0; n: 14) in group F, whereas fatty acid synthase (FAS) was lower (F: 85.90 ± 4.81 vs. C: 100 ± 0.0; n: 4-6). SREBP-1c gene expression was higher in F vs. C group (F: 4.08 ± 0.44 vs. C: 1.13 ± 0.15; n: 5-6), although we did not found difference between groups in the gene expression for ACC, SREBP-2, and NFκB. Dietary fructose can change important lipogenic and inflammatory factors in the hypothalamus of rats and it leads to regulation of transcription factors before changes in body mass are evident.

Anticipatory activity in anterior cingulate cortex can be independent of conflict and error likelihood.

PubMed

Aarts, Esther; Roelofs, Ardi; van Turennout, Miranda

2008-04-30

Previous studies have found no agreement on whether anticipatory activity in the anterior cingulate cortex (ACC) reflects upcoming conflict, error likelihood, or actual control adjustments. Using event-related functional magnetic resonance imaging, we investigated the nature of preparatory activity in the ACC. Informative cues told the participants whether an upcoming target would or would not involve conflict in a Stroop-like task. Uninformative cues provided no such information. Behavioral responses were faster after informative than after uninformative cues, indicating cue-based adjustments in control. ACC activity was larger after informative than uninformative cues, as would be expected if the ACC is involved in anticipatory control. Importantly, this activation in the ACC was observed for informative cues even when the information conveyed by the cue was that the upcoming target evokes no response conflict and has low error likelihood. This finding demonstrates that the ACC is involved in anticipatory control processes independent of upcoming response conflict or error likelihood. Moreover, the response of the ACC to the target stimuli was critically dependent on whether the cue was informative or not. ACC activity differed among target conditions after uninformative cues only, indicating ACC involvement in actual control adjustments. Together, these findings argue strongly for a role of the ACC in anticipatory control independent of anticipated conflict and error likelihood, and also show that such control can eliminate conflict-related ACC activity during target processing. Models of frontal cortex conflict-detection and conflict-resolution mechanisms require modification to include consideration of these anticipatory control properties of the ACC.

Biomineralisation by earthworms - an investigation into the stability and distribution of amorphous calcium carbonate.

PubMed

Hodson, Mark E; Benning, Liane G; Demarchi, Bea; Penkman, Kirsty E H; Rodriguez-Blanco, Juan D; Schofield, Paul F; Versteegh, Emma A A

Many biominerals form from amorphous calcium carbonate (ACC), but this phase is highly unstable when synthesised in its pure form inorganically. Several species of earthworm secrete calcium carbonate granules which contain highly stable ACC. We analysed the milky fluid from which granules form and solid granules for amino acid (by liquid chromatography) and functional group (by Fourier transform infrared (FTIR) spectroscopy) compositions. Granule elemental composition was determined using inductively coupled plasma-optical emission spectroscopy (ICP-OES) and electron microprobe analysis (EMPA). Mass of ACC present in solid granules was quantified using FTIR and compared to granule elemental and amino acid compositions. Bulk analysis of granules was of powdered bulk material. Spatially resolved analysis was of thin sections of granules using synchrotron-based μ-FTIR and EMPA electron microprobe analysis. The milky fluid from which granules form is amino acid-rich (≤ 136 ± 3 nmol mg -1 (n = 3; ± std dev) per individual amino acid); the CaCO 3 phase present is ACC. Even four years after production, granules contain ACC. No correlation exists between mass of ACC present and granule elemental composition. Granule amino acid concentrations correlate well with ACC content (r ≥ 0.7, p ≤ 0.05) consistent with a role for amino acids (or the proteins they make up) in ACC stabilisation. Intra-granule variation in ACC (RSD = 16%) and amino acid concentration (RSD = 22-35%) was high for granules produced by the same earthworm. Maps of ACC distribution produced using synchrotron-based μ-FTIR mapping of granule thin sections and the relative intensity of the ν 2 : ν 4 peak ratio, cluster analysis and component regression using ACC and calcite standards showed similar spatial distributions of likely ACC-rich and calcite-rich areas. We could not identify organic peaks in the μ-FTIR spectra and thus could not determine whether ACC-rich domains also had relatively high amino acid concentrations. No correlation exists between ACC distribution and elemental concentrations determined by EMPA. ACC present in earthworm CaCO 3 granules is highly stable. Our results suggest a role for amino acids (or proteins) in this stability. We see no evidence for stabilisation of ACC by incorporation of inorganic components. Graphical abstractSynchrotron-based μ-FTIR mapping was used to determine the spatial distribution of amorphous calcium carbonate in earthworm-produced CaCO 3 granules.

Identification of candidate genes and molecular markers for heat-induced brown discoloration of seed coats in cowpea [Vigna unguiculata (L.) Walp].

PubMed

Pottorff, Marti; Roberts, Philip A; Close, Timothy J; Lonardi, Stefano; Wanamaker, Steve; Ehlers, Jeffrey D

2014-05-01

Heat-induced browning (Hbs) of seed coats is caused by high temperatures which discolors the seed coats of many legumes, affecting the visual appearance and quality of seeds. The genetic determinants underlying Hbs in cowpea are unknown. We identified three QTL associated with the heat-induced browning of seed coats trait, Hbs-1, Hbs-2 and Hbs-3, using cowpea RIL populations IT93K-503-1 (Hbs positive) x CB46 (hbs negative) and IT84S-2246 (Hbs positive) x TVu14676 (hbs negative). Hbs-1 was identified in both populations, accounting for 28.3% -77.3% of the phenotypic variation. SNP markers 1_0032 and 1_1128 co-segregated with the trait. Within the syntenic regions of Hbs-1 in soybean, Medicago and common bean, several ethylene forming enzymes, ethylene responsive element binding factors and an ACC oxidase 2 were observed. Hbs-1 was identified in a BAC clone in contig 217 of the cowpea physical map, where ethylene forming enzymes were present. Hbs-2 was identified in the IT93K-503-1 x CB46 population and accounted for of 9.5 to 12.3% of the phenotypic variance. Hbs-3 was identified in the IT84S-2246 x TVu14676 population and accounted for 6.2 to 6.8% of the phenotypic variance. SNP marker 1_0640 co-segregated with the heat-induced browning phenotype. Hbs-3 was positioned on BAC clones in contig512 of the cowpea physical map, where several ACC synthase 1 genes were present. The identification of loci determining heat-induced browning of seed coats and co-segregating molecular markers will enable transfer of hbs alleles into cowpea varieties, contributing to higher quality seeds.

Silibinin inhibits hypoxia-induced HIF-1α-mediated signaling, angiogenesis and lipogenesis in prostate cancer cells: In vitro evidence and in vivo functional imaging and metabolomics

PubMed Central

Deep, Gagan; Kumar, Rahul; Nambiar, Dhanya K.; Jain, Anil K.; Ramteke, Anand M.; Serkova, Natalie J.; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Hypoxia is associated with aggressive phenotype and poor prognosis in prostate cancer (PCa) patients suggesting that PCa growth and progression could be controlled via targeting hypoxia-induced signaling and biological effects. Here, we analyzed silibinin (a natural flavonoid) efficacy to target cell growth, angiogenesis and metabolic changes in human PCa, LNCaP and 22Rv1 cells under hypoxic condition. Silibinin treatment inhibited the proliferation, clonogenicity and endothelial cells tube formation by hypoxic (1% O2) PCa cells. Interestingly, hypoxia promoted a lipogenic phenotype in PCa cells via activating acetyl-Co A carboxylase (ACC) and fatty acid synthase (FASN) that was inhibited by silibinin treatment. Importantly, silibinin treatment strongly decreased hypoxia-induced HIF-1α expression in PCa cells together with a strong reduction in hypoxia-induced NADPH oxidase (NOX) activity. HIF-1α overexpression in LNCaP cells significantly increased the lipid accumulation and NOX activity; however, silibinin treatment reduced HIF-1α expression, lipid levels, clonogenicity and NOX activity even in HIF-1α overexpressing LNCaP cells. In vivo, silibinin feeding (200 mg/kg body weight) to male nude mice with 22Rv1 tumors, specifically inhibited tumor vascularity (measured by dynamic contrast-enhanced MRI) resulting in tumor growth inhibition without directly inducing necrosis (as revealed by diffusion-weighted MRI). Silibinin feeding did not significantly affect tumor glucose uptake measured by FDG-PET; however, reduced the lipid synthesis measured by quantitative 1H-NMR metabolomics. IHC analyses of tumor tissues confirmed that silibinin feeding decreased proliferation and angiogenesis as well as reduced HIF-1α, FASN and ACC levels. Together, these findings further support silibinin usefulness against PCa through inhibiting hypoxia-induced signaling. PMID:27533043

The role of the embryo and ethylene in avocado fruit mesocarp discoloration

PubMed Central

Hershkovitz, Vera; Friedman, Haya; Goldschmidt, Eliezer E.; Pesis, Edna

2009-01-01

Chilling injury (CI) symptoms in avocado (Persea americana Mill.) fruit, expressed as mesocarp discoloration, were found to be associated with embryo growth and ethylene production during cold storage. In cvs Ettinger and Arad most mesocarp discoloration was located close to the base of the seed and was induced by ethylene treatment in seeded avocado fruit. However, ethylene did not increase mesocarp discoloration in seedless fruit stored at 5 °C. Application of ethylene to whole fruit induced embryo development inside the seed. It also induced seedling elongation when seeds were imbibed separately. Persea americana ethylene receptor (PaETR) gene expression and polyphenol oxidase activity were highest close to the base of the seed and decreased gradually toward the blossom end. By contrast, expressions of PaETR transcript and polyphenol oxidase activity in seedless avocado fruit were similar throughout the pulp at the base of the fruit. Application of the ethylene inhibitor, 1-methylcyclopropene, decreased mesocarp browning, embryo development, seedling growth, and ion leakage, and down-regulated polyphenol oxidase activity. The results demonstrate that ethylene-mediated embryo growth in whole fruit is involved in the mesocarp response to ethylene perception and the development of CI disorders. PMID:19196750

The role of the embryo and ethylene in avocado fruit mesocarp discoloration.

PubMed

Hershkovitz, Vera; Friedman, Haya; Goldschmidt, Eliezer E; Pesis, Edna

2009-01-01

Chilling injury (CI) symptoms in avocado (Persea americana Mill.) fruit, expressed as mesocarp discoloration, were found to be associated with embryo growth and ethylene production during cold storage. In cvs Ettinger and Arad most mesocarp discoloration was located close to the base of the seed and was induced by ethylene treatment in seeded avocado fruit. However, ethylene did not increase mesocarp discoloration in seedless fruit stored at 5 degrees C. Application of ethylene to whole fruit induced embryo development inside the seed. It also induced seedling elongation when seeds were imbibed separately. Persea americana ethylene receptor (PaETR) gene expression and polyphenol oxidase activity were highest close to the base of the seed and decreased gradually toward the blossom end. By contrast, expressions of PaETR transcript and polyphenol oxidase activity in seedless avocado fruit were similar throughout the pulp at the base of the fruit. Application of the ethylene inhibitor, 1-methylcyclopropene, decreased mesocarp browning, embryo development, seedling growth, and ion leakage, and down-regulated polyphenol oxidase activity. The results demonstrate that ethylene-mediated embryo growth in whole fruit is involved in the mesocarp response to ethylene perception and the development of CI disorders.

Inventory of File gfs.t06z.smartguam06.tm00.grib2

Science.gov Websites

(0=sea, 1=land) [Proportion] 009 surface APCP 3-6 hour acc Total Precipitation [kg/m^2] 010 surface ] 020 surface TMAX 3-6 hour acc Maximum Temperature [K] 021 surface TMIN 3-6 hour acc Minimum Temperature [K] 022 surface MAXRH 3-6 hour acc Maximum Relative Humidity [%] 023 surface MINRH 3-6 hour acc

Effects of Low O2 Root Stress on Ethylene Biosynthesis in Tomato Plants (Lycopersicon esculentum Mill cv Heinz 1350) 1

PubMed Central

Wang, Tzann-Wei; Arteca, Richard N.

1992-01-01

Low O2 conditions were obtained by flowing N2 through the solution in which the tomato plants (Lycopersicon esculentum Mill cv Heinz 1350) were growing. Time course experiments revealed that low O2 treatments stimulated 1-aminocyclopropane-1-carboxylate (ACC) synthase production in the roots and leaves. After the initiation of low O2 conditions, ACC synthase activity and ACC content in the roots increased and reached a peak after 12 and 20 hours, respectively. The conversion of ACC to ethylene in the roots was inhibited by low levels of O2, and ACC was apparently transported to the leaves where it was converted to ethylene. ACC synthase activity in the leaves was also stimulated by low O2 treatment to the roots, reaching a peak after 24 hours. ACC synthase levels were enhanced by cobalt chloride and aminooxyacetic acid (AOA), although they inhibited ethylene production. Cobalt chloride enhanced ACC synthase only in combination with low O2 conditions in the roots. Under aeration, AOA stimulated ACC synthase activity in both the roots and leaves. However, in combination with low O2 conditions, AOA caused a stimulation in ACC synthase activity in the leaves and no effect in the roots. PMID:16668654

Nationwide analysis of adrenocortical carcinoma reveals higher perioperative morbidity in functional tumors.

PubMed

Parikh, Punam P; Rubio, Gustavo A; Farra, Josefina C; Lew, John I

2017-08-25

Current adrenalectomy outcomes for functional adrenocortical carcinoma (ACC) remain unclear. This study examines nationwide in-hospital post-adrenalectomy outcomes for ACC. A retrospective analysis of the Nationwide Inpatient Sample database (2006-2011) to identify unilateral adrenalectomy patients for functional or nonfunctional ACC was performed. Patient demographics, comorbidities and postoperative outcomes were evaluated by t-test, Chi-square and multivariate regression. Of 2199 patients who underwent adrenalectomy, 87% had nonfunctional and 13% had functional ACC (86% hypercortisolism, 16% hyperaldosteronism, 4% hyperandrogenism). Functional ACC patients had significantly more comorbidities, and experienced certain postoperative complications more frequently including wound issues, adrenocortical insufficiency and acute kidney injury with longer hospital stay compared to nonfunctional ACC (P < 0.01). On multivariate analysis, functional ACC was an independent prognosticator for wound complications (28.1, 95%CI 4.59-176.6). Patients with functional ACC manifest significant comorbidities with certain in-hospital complications. Such high-risk patients require appropriate preoperative medical optimization prior to adrenalectomy. Patients with functional adrenocortical carcinoma (ACC) have significant preoperative comorbidities and experience higher rates of certain postoperative complications including wound complications, hematoma formation, adrenal insufficiency, pulmonary embolism and acute kidney injury. Functional ACC patients also necessitate longer hospitalizations. These patients should undergo appropriate preoperative counseling in preparation for adrenalectomy. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana

PubMed Central

2012-01-01

Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone). Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC) is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream signaling cascade, these are converged to a ’common pathway’. Furthermore, several potential keyplayers, such as transcription factors and auxin-responsive genes, were identified by the microarray analysis. They await further analysis to reveal their exact role in the control of cell elongation. PMID:23134674

Liver resection for metastases of tracheal adenoid cystic carcinoma: Report of two cases.

PubMed

Hashimoto, Shintaro; Sumida, Yorihisa; Tobinaga, Shuichi; Wada, Hideo; Wakata, Kouki; Nonaka, Takashi; Kunizaki, Masaki; Hidaka, Shigekazu; Kinoshita, Naoe; Sawai, Terumitsu; Nagayasu, Takeshi

2018-05-16

Tracheal adenoid cystic carcinoma (ACC) is rare and accounts for <1% of all lung cancers. Although ACC is classified as a low-grade tumor, metastases are frequently identified in the late period. Extrapulmonary metastases are rare, and their resection has rarely been reported. Case 1: A 77-year-old man underwent tracheal resection for ACC with postoperative radiation (60 Gy) 14 years before　(at the age of 63). He underwent two subsequent pulmonary resections for metastases. Fourteen years after the first operation, he underwent extended right posterior segmentectomy with resection of segment IV and radiofrequency ablation for metastases of ACC to the liver. He was diagnosed with metastases to the kidney with peritoneal dissemination 4 years after the liver resection and died of pneumonia 2 years later. Case 2: A 53-year-old woman underwent a two-stage operation involving tracheal resection for ACC and partial resection of liver segments II and V for metastases of ACC to the liver. The tracheal margin was histopathologically positive. Postoperative radiation was performed, and she was tumor-free for 10 months after the liver resection. Complete resection of tracheal ACC provides better survival. Radiotherapy is also recommended. However, the optimal treatment for metastases of ACC is unclear, especially because liver resection for metastases of tracheal ACC is rarely reported. Our two cases of metastases of tracheal ACC were surgically managed with good outcomes. Liver resection for metastases of tracheal ACC may contribute to long survival. Copyright © 2018. Published by Elsevier Ltd.

24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

Code of Federal Regulations, 2010 CFR

2010-04-01

... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development Regulations Relating... before ACC expiration. This part is not intended to preclude or restrict the demolition or disposition of... before the ACC Expiration Date. ...

Prostate-Specific Membrane Antigen Is a Potential Antiangiogenic Target in Adrenocortical Carcinoma.

PubMed

Crowley, Michael J P; Scognamiglio, Theresa; Liu, Yi-Fang; Kleiman, David A; Beninato, Toni; Aronova, Anna; Liu, He; Jhanwar, Yuliya S; Molina, Ana; Tagawa, Scott T; Bander, Neil H; Zarnegar, Rasa; Elemento, Olivier; Fahey, Thomas J

2016-03-01

Adrenocortical carcinoma (ACC) is a rare tumor type with a poor prognosis and few therapeutic options. Assess prostate-specific membrane antigen (PSMA) expression as a potential novel therapeutic target for ACC. Expression of PSMA was evaluated in benign and malignant adrenal tumors and 1 patient with metastatic ACC. This study took place at a tertiary referral center. Fifty adrenal samples were evaluated, including 16 normal adrenal glands, 16 adrenocortical adenomas, 15 primary ACC, and 3 ACC metastases. Demographics, PSMA expression levels via real-time quantitative polymerase chain reaction and immunohistochemistry and whole-body positron emission tomography-computed tomography standardized uptake values for 1 patient. qPCR demonstrated an elevated level of PSMA in ACC relative to all benign tissues (P < .05). Immunohistochemistry localized PSMA expression to the neovasculature of ACC and confirmed overexpression of PSMA in ACC relative to benign tissues both in intensity and percentage of vessels stained (78% of ACC, 0% of normal adrenal, and 3.27% of adenoma-associated neovasculature; P < .001). Those with more than 25% PSMA-positive vessels were 33 times more likely to be malignant than benign (odds ratio, P < .001). Whole-body positron emission tomography-computed tomography imaging showed targeting of anti-PSMA Zr89-J591 to 5/5 of the patient's multiple lung masses with an average measurement of 3.49 ± 1.86 cm and a standardized uptake value of 1.4 ± 0.65 relative to blood pool at 0.8 standardized uptake value. PSMA is significantly overexpressed in ACC neovasculature when compared with normal and benign adrenal tumors. PSMA expression can be used to image ACC metastases in vivo and may be considered as a potential diagnostic and therapeutic target in ACC.

Medial frontal white and gray matter contributions to general intelligence.

PubMed

Ohtani, Toshiyuki; Nestor, Paul G; Bouix, Sylvain; Saito, Yukiko; Hosokawa, Taiga; Kubicki, Marek

2014-01-01

The medial orbitofrontal cortex (mOFC) and rostral anterior cingulate cortex (rACC) are part of a wider neural network that plays an important role in general intelligence and executive function. We used structural brain imaging to quantify magnetic resonance gray matter volume and diffusion tensor white matter integrity of the mOFC-rACC network in 26 healthy participants who also completed neuropsychological tests of intellectual abilities and executive function. Stochastic tractography, the most effective Diffusion Tensor Imaging method for examining white matter connections between adjacent gray matter regions, was employed to assess the integrity of mOFC-rACC pathways. Fractional anisotropy (FA), which reflects the integrity of white matter connections, was calculated. Results indicated that higher intelligence correlated with greater gray matter volumes for both mOFC and rACC, as well as with increased FA for left posterior mOFC-rACC connectivity. Hierarchical regression analyses revealed that DTI-derived FA of left posterior mOFC-rACC uniquely accounted for 29%-34% of the variance in IQ, in comparison to 11%-16% uniquely explained by gray matter volume of the left rACC. Together, left rACC gray matter volume and white matter connectivity between left posterior mOFC and rACC accounted for up to 50% of the variance in general intelligence. This study is to our knowledge the first to examine white matter connectivity between OFC and ACC, two gray matter regions of interests that are very close in physical proximity, and underscores the important independent contributions of variations in rACC gray matter volume and mOFC-rACC white matter connectivity to individual differences in general intelligence.

Proteomic analysis shows that stress response proteins are significantly up-regulated in resistant diploid wheat (Triticum monococcum) in response to attack by the grain aphid (Sitobion avenae).

PubMed

Guan, Wenzhu; Ferry, Natalie; Edwards, Martin G; Bell, Howard A; Othman, Hamizah; Gatehouse, John A; Gatehouse, Angharad M R

2015-01-01

The grain aphid Sitobion avenae (F.) is a major pest of wheat, acting as a virus vector as well as causing direct plant damage. Commonly grown wheat varieties in the UK have only limited resistance to this pest. The present study was carried out to investigate the potential of a diploid wheat line (ACC20 PGR1755), reported as exhibiting resistance to S. avenae, to serve as a source of resistance genes. The diploid wheat line was confirmed as partially resistant, substantially reducing the fecundity, longevity and growth rate of the aphid. Proteomic analysis showed that approximately 200 protein spots were reproducibly detected in leaf extracts from both the resistant line and a comparable susceptible line (ACC5 PGR1735) using two-dimensional gel electrophoresis and image comparison software. Twenty-four spots were significantly up-regulated (>2-fold) in the resistant line after 24 h of aphid feeding (13 and 11 involved in local and systemic responses, respectively). Approximately 50 % of all differentially expressed protein spots were identified by a combination of database searching with MS and MS/MS data, revealing that the majority of proteins up-regulated by aphid infestation were involved in metabolic processes (including photosynthesis) and transcriptional regulation. However, in the resistant line only, several stress response proteins (including NBS-LRR-like proteins) and oxidative stress response proteins were identified as up-regulated in response to aphid feeding, as well as proteins involved in DNA synthesis/replication/repair. This study indicates that the resistant diploid line ACC20 PGR1755 may provide a valuable resource in breeding wheat for resistance to aphids.

Effects of abscisic acid on ethylene biosynthesis and perception in Hibiscus rosa-sinensis L. flower development

PubMed Central

Trivellini, Alice; Ferrante, Antonio; Vernieri, Paolo; Serra, Giovanni

2011-01-01

The effect of the complex relationship between ethylene and abscisic acid (ABA) on flower development and senescence in Hibiscus rosa-sinensis L. was investigated. Ethylene biosynthetic (HrsACS and HrsACO) and receptor (HrsETR and HrsERS) genes were isolated and their expression evaluated in three different floral tissues (petals, style–stigma plus stamens, and ovaries) of detached buds and open flowers. This was achieved through treatment with 0.1 mM 1-aminocyclopropane-1-carboxylic acid (ACC) solution, 500 nl l−1 methylcyclopropene (1-MCP), and 0.1 mM ABA solution. Treatment with ACC and 1-MCP confirmed that flower senescence in hibiscus is ethylene dependent, and treatment with exogenous ABA suggested that ABA may play a role in this process. The 1-MCP impeded petal in-rolling and decreased ABA content in detached open flowers after 9 h. This was preceded by an earlier and sequential increase in ABA content in 1-MCP-treated petals and style–stigma plus stamens between 1 h and 6 h. ACC treatment markedly accelerated flower senescence and increased ethylene production after 6 h and 9 h, particularly in style–stigma plus stamens. Ethylene evolution was positively correlated in these floral tissues with the induction of the gene expression of ethylene biosynthetic and receptor genes. Finally, ABA negatively affected the ethylene biosynthetic pathway and tissue sensitivity in all flower tissues. Transcript abundance of HrsACS, HrsACO, HrsETR, and HrsERS was reduced by exogenous ABA treatment. This research underlines the regulatory effect of ABA on the ethylene biosynthetic and perception machinery at a physiological and molecular level when inhibitors or promoters of senescence are exogenously applied. PMID:21841180

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Chronic Suppression of Acetyl-CoA Carboxylase 1 in β-Cells Impairs Insulin Secretion via Inhibition of Glucose Rather Than Lipid Metabolism*

PubMed Central

Ronnebaum, Sarah M.; Joseph, Jamie W.; Ilkayeva, Olga; Burgess, Shawn C.; Lu, Danhong; Becker, Thomas C.; Sherry, A. Dean; Newgard, Christopher B.

2008-01-01

Acetyl-CoA carboxylase 1 (ACC1) currently is being investigated as a target for treatment of obesity-associated dyslipidemia and insulin resistance. To investigate the effects of ACC1 inhibition on insulin secretion, three small interfering RNA (siRNA) duplexes targeting ACC1 (siACC1) were transfected into the INS-1-derived cell line, 832/13; the most efficacious duplex was also cloned into an adenovirus and used to transduce isolated rat islets. Delivery of the siACC1 duplexes decreased ACC1 mRNA by 60–80% in 832/13 cells and islets and enzyme activity by 46% compared with cells treated with a non-targeted siRNA. Delivery of siACC1 decreased glucose-stimulated insulin secretion (GSIS) by 70% in 832/13 cells and by 33% in islets. Surprisingly, siACC1 treatment decreased glucose oxidation by 49%, and the ATP:ADP ratio by 52%, accompanied by clear decreases in pyruvate cycling activity and tricarboxylic acid cycle intermediates. Exposure of siACC1-treated cells to the pyruvate cycling substrate dimethylmalate restored GSIS to normal without recovery of the depressed ATP:ADP ratio. In siACC1-treated cells, glucokinase protein levels were decreased by 25%, which correlated with a 36% decrease in glycogen synthesis and a 33% decrease in glycolytic flux. Furthermore, acute addition of the ACC1 inhibitor 5-(tetradecyloxy)-2-furoic acid (TOFA) to β-cells suppressed [14C]glucose incorporation into lipids but had no effect on GSIS, whereas chronic TOFA administration suppressed GSIS and glucose metabolism. In sum, chronic, but not acute, suppression of ACC1 activity impairs GSIS via inhibition of glucose rather than lipid metabolism. These findings raise concerns about the use of ACC inhibitors for diabetes therapy. PMID:18381287

Chronic suppression of acetyl-CoA carboxylase 1 in beta-cells impairs insulin secretion via inhibition of glucose rather than lipid metabolism.

PubMed

Ronnebaum, Sarah M; Joseph, Jamie W; Ilkayeva, Olga; Burgess, Shawn C; Lu, Danhong; Becker, Thomas C; Sherry, A Dean; Newgard, Christopher B

2008-05-23

Acetyl-CoA carboxylase 1 (ACC1) currently is being investigated as a target for treatment of obesity-associated dyslipidemia and insulin resistance. To investigate the effects of ACC1 inhibition on insulin secretion, three small interfering RNA (siRNA) duplexes targeting ACC1 (siACC1) were transfected into the INS-1-derived cell line, 832/13; the most efficacious duplex was also cloned into an adenovirus and used to transduce isolated rat islets. Delivery of the siACC1 duplexes decreased ACC1 mRNA by 60-80% in 832/13 cells and islets and enzyme activity by 46% compared with cells treated with a non-targeted siRNA. Delivery of siACC1 decreased glucose-stimulated insulin secretion (GSIS) by 70% in 832/13 cells and by 33% in islets. Surprisingly, siACC1 treatment decreased glucose oxidation by 49%, and the ATP:ADP ratio by 52%, accompanied by clear decreases in pyruvate cycling activity and tricarboxylic acid cycle intermediates. Exposure of siACC1-treated cells to the pyruvate cycling substrate dimethylmalate restored GSIS to normal without recovery of the depressed ATP:ADP ratio. In siACC1-treated cells, glucokinase protein levels were decreased by 25%, which correlated with a 36% decrease in glycogen synthesis and a 33% decrease in glycolytic flux. Furthermore, acute addition of the ACC1 inhibitor 5-(tetradecyloxy)-2-furoic acid (TOFA) to beta-cells suppressed [(14)C]glucose incorporation into lipids but had no effect on GSIS, whereas chronic TOFA administration suppressed GSIS and glucose metabolism. In sum, chronic, but not acute, suppression of ACC1 activity impairs GSIS via inhibition of glucose rather than lipid metabolism. These findings raise concerns about the use of ACC inhibitors for diabetes therapy.

Driver's behavioral adaptation to adaptive cruise control (ACC): the case of speed and time headway.

PubMed

Bianchi Piccinini, Giulio Francesco; Rodrigues, Carlos Manuel; Leitão, Miguel; Simões, Anabela

2014-06-01

The Adaptive Cruise Control is an Advanced Driver Assistance System (ADAS) that allows maintaining given headway and speed, according to settings pre-defined by the users. Despite the potential benefits associated to the utilization of ACC, previous studies warned against negative behavioral adaptations that might occur while driving with the system activated. Unfortunately, up to now, there are no unanimous results about the effects induced by the usage of ACC on speed and time headway to the vehicle in front. Also, few studies were performed including actual users of ACC among the subjects. This research aimed to investigate the effect of the experience gained with ACC on speed and time headway for a group of users of the system. In addition, it explored the impact of ACC usage on speed and time headway for ACC users and regular drivers. A matched sample driving simulator study was planned as a two-way (2×2) repeated measures mixed design, with the experience with ACC as between-subjects factor and the driving condition (with ACC and manually) as within-subjects factor. The results show that the usage of ACC brought a small but not significant reduction of speed and, especially, the maintenance of safer time headways, being the latter result greater for ACC users, probably as a consequence of their experience in using the system. The usage of ACC did not cause any negative behavioral adaptations to the system regarding speed and time headway. Based on this research work, the Adaptive Cruise Control showed the potential to improve road safety for what concerns the speed and the time headway maintained by the drivers. The speed of the surrounding traffic and the minimum time headway settable through the ACC seem to have an important effect on the road safety improvement achievable with the system. Copyright © 2014 Elsevier Ltd. All rights reserved.

24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

Code of Federal Regulations, 2011 CFR

2011-04-01

... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development REGULATIONS RELATING TO... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

Code of Federal Regulations, 2010 CFR

2010-04-01

... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development Regulations Relating to... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

Understanding Portability of a High-Level Programming Model on Contemporary Heterogeneous Architectures

DOE PAGES

Sabne, Amit J.; Sakdhnagool, Putt; Lee, Seyong; ...

2015-07-13

Accelerator-based heterogeneous computing is gaining momentum in the high-performance computing arena. However, the increased complexity of heterogeneous architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle this problem. Although the abstraction provided by OpenACC offers productivity, it raises questions concerning both functional and performance portability. In this article, the authors propose HeteroIR, a high-level, architecture-independent intermediate representation, to map high-level programming models, such as OpenACC, to heterogeneous architectures. They present a compiler approach that translates OpenACC programs into HeteroIR and accelerator kernels to obtain OpenACC functional portability. They then evaluate the performance portability obtained bymore » OpenACC with their approach on 12 OpenACC programs on Nvidia CUDA, AMD GCN, and Intel Xeon Phi architectures. They study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.« less

The relationship between the plant-encoded RNA-dependent RNA polymerase 1 and alternative oxidase in tomato basal defense against Tobacco mosaic virus.

PubMed

Liao, Yang-Wen-Ke; Liu, Ya-Ru; Liang, Jia-Yang; Wang, Wen-Ping; Zhou, Jie; Xia, Xiao-Jian; Zhou, Yan-Hong; Yu, Jing-Quan; Shi, Kai

2015-03-01

Salicylic acid (SA) plays a critical role in plant defense against pathogen attack. The SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense, which is pathogenesis-related protein-independent but involves an RNA-dependent RNA polymerase 1 (RDR1)-mediated RNA silencing mechanism and/or an alternative oxidase (AOX)-associated defense pathway. However, the relationship between these two viral defense-related pathways remains unclear. In this study, Tobacco mosaic virus (TMV) inoculation onto Solanum lycopersicum (tomato) leaves induced a rapid induction of the SlAOX1a transcript level as well as the total and CN-resistant respiration at 0.5 dpi, followed by an increase in SlRDR1 gene expression at 1 dpi in the upper uninoculated leaves. Silencing SlRDR1 using virus-induced gene silencing system significantly reduced SlRDR1 expression and tomato defense against TMV but had no evident effect on SlAOX1a transcription. Conversely, silencing SlAOX1a not only effectively reduced the AOX1a transcript level, but also blocked the TMV-induced SlRDR1 expression and decreased the basal defense against TMV. Furthermore, the application of an exogenous AOX activator on empty vector-silenced control plants greatly induced the accumulation of SlRDR1 and SlAOX1a transcript and reduced TMV viral RNA accumulation, but failed to have such effects on SlRDR1-silenced plants. Moreover, RDR1-overexpressed transgenic Nicotiana benthamiana plants enhanced defense against TMV than the empty vector-transformed plants, but these effects were not affected by the exogenous AOX activator or inhibitor. These results indicate that RDR1 is involved in the AOX-mediated defense pathway against TMV infection and plays a crucial role in enhancing RNA silencing to limit virus systemic spread.

Insights into the role of differential gene expression on the ecological adaptation of the snail Littorina saxatilis

PubMed Central

2010-01-01

Background In the past 40 years, there has been increasing acceptance that variation in levels of gene expression represents a major source of evolutionary novelty. Gene expression divergence is therefore likely to be involved in the emergence of incipient species, namely, in a context of adaptive radiation. In this study, a genome-wide expression profiling approach (cDNA-AFLP), validated by quantitative real-time polymerase chain reaction (qPCR) were used to get insights into the role of differential gene expression on the ecological adaptation of the marine snail Littorina saxatilis. This gastropod displays two sympatric ecotypes (RB and SU) which are becoming one of the best studied systems for ecological speciation. Results Among the 99 transcripts shared between ecotypes, 12.12% showed significant differential expression. At least 4% of these transcripts still displayed significant differences after correction for multiple tests, highlighting that gene expression can differ considerably between subpopulations adapted to alternative habitats in the face of gene flow. One of the transcripts identified was Cytochrome c Oxidase subunit I (COI). In addition, 6 possible reference genes were validated to normalize and confirm this result using qPCR. α-Tubulin and histone H3.3 showed the more stable expression levels, being therefore chosen as the best option for normalization. The qPCR analysis confirmed a higher COI expression in SU individuals. Conclusions At least 4% of the transcriptome studied is being differentially expressed between ecotypes living in alternative habitats, even when gene flow is still substantial between ecotypes. We could identify a candidate transcript of such ecotype differentiation: Cytochrome c Oxidase Subunit I (COI), a mitochondrial gene involved in energy metabolism. Quantitative PCR was used to confirm the differences found in COI and its over-expression in the SU ecotype. Interestingly, COI is involved in the oxidative phosphorylation, suggesting an enhanced mitochondrial gene expression (or increased number of mitochondria) to improve energy supply in the ecotype subjected to the strongest wave action. PMID:21087461

Interaction of plant growth regulators and reactive oxygen species to regulate petal senescence in wallflowers (Erysimum linifolium).

PubMed

Salleh, Faezah Mohd; Mariotti, Lorenzo; Spadafora, Natasha D; Price, Anna M; Picciarelli, Piero; Wagstaff, Carol; Lombardi, Lara; Rogers, Hilary

2016-04-02

In many species floral senescence is coordinated by ethylene. Endogenous levels rise, and exogenous application accelerates senescence. Furthermore, floral senescence is often associated with increased reactive oxygen species, and is delayed by exogenously applied cytokinin. However, how these processes are linked remains largely unresolved. Erysimum linifolium (wallflower) provides an excellent model for understanding these interactions due to its easily staged flowers and close taxonomic relationship to Arabidopsis. This has facilitated microarray analysis of gene expression during petal senescence and provided gene markers for following the effects of treatments on different regulatory pathways. In detached Erysimum linifolium (wallflower) flowers ethylene production peaks in open flowers. Furthermore senescence is delayed by treatments with the ethylene signalling inhibitor silver thiosulphate, and accelerated with ethylene released by 2-chloroethylphosphonic acid. Both treatments with exogenous cytokinin, or 6-methyl purine (which is an inhibitor of cytokinin oxidase), delay petal senescence. However, treatment with cytokinin also increases ethylene biosynthesis. Despite the similar effects on senescence, transcript abundance of gene markers is affected differentially by the treatments. A significant rise in transcript abundance of WLS73 (a putative aminocyclopropanecarboxylate oxidase) was abolished by cytokinin or 6-methyl purine treatments. In contrast, WFSAG12 transcript (a senescence marker) continued to accumulate significantly, albeit at a reduced rate. Silver thiosulphate suppressed the increase in transcript abundance both of WFSAG12 and WLS73. Activity of reactive oxygen species scavenging enzymes changed during senescence. Treatments that increased cytokinin levels, or inhibited ethylene action, reduced accumulation of hydrogen peroxide. Furthermore, although auxin levels rose with senescence, treatments that delayed early senescence did not affect transcript abundance of WPS46, an auxin-induced gene. A model for the interaction between cytokinins, ethylene, reactive oxygen species and auxin in the regulation of floral senescence in wallflowers is proposed. The combined increase in ethylene and reduction in cytokinin triggers the initiation of senescence and these two plant growth regulators directly or indirectly result in increased reactive oxygen species levels. A fall in conjugated auxin and/or the total auxin pool eventually triggers abscission.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Multiple cognitive control mechanisms associated with the nature of conflict.

PubMed

Kim, Chobok; Chung, Chongwook; Kim, Jeounghoon

2010-06-07

Cognitive control is required to regulate conflict. The conflict monitoring theory suggests that the dorsal anterior cingulate cortex (dACC) is involved in detecting response conflict and the dorsolateral prefrontal cortex (DLPFC) plays a critical role in regulating conflict. Recent studies, however, have suggested that rostral dACC (rdACC) responds to response conflict whereas caudal dACC (cdACC) is associated with perceptual conflict. Moreover, DLPFC has been engaged only in regulation of response conflict. A neural network involved in perceptual conflict, however, remains unclear. In this study, we used functional magnetic resonance imaging (fMRI) in an attempt to reveal monitor-controller networks corresponding to either perceptual conflict or response conflict. A version of the Stroop color matching task was used to manipulate perceptual conflict, response conflict was manipulated by an arrow. The results demonstrated that rdACC and DLPFC were engaged in response conflict whereas cdACC and the dorsal portion of premotor cortex (pre-PMd) were involved in perceptual conflict. Interestingly, the posterior parietal cortex (PPC) was activated by both types of conflict. Correlation analyses between behavioral conflict effects and neural responses demonstrated that rdACC and DLPFC were associated with response conflict whereas cdACC and pre-PMd were associated with perceptual conflict. PPC was not correlated with either perceptual conflict or response conflict. We suggest that cdACC and pre-PMd play critical roles in perceptual conflict processing, and this network is independent from the rdACC/DLPFC network for response conflict processing. We also discussed the function of PPC in conflict processing. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

24 CFR 882.403 - ACC, housing assistance payments contract, and lease.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC, housing assistance payments... Procedures for Moderate Rehabilitation-Basic Policies § 882.403 ACC, housing assistance payments contract, and lease. (a) Maximum Total ACC Commitments. The maximum total annual contribution that may be...

24 CFR 880.208 - Financing.

Code of Federal Regulations, 2011 CFR

2011-04-01

... give greater rights or funds to any party than are provided under the Agreement, Contract, and/or ACC..., Contract or ACC entered into pursuant to this part: Provided, however, That such financing is in connection..., Contract, or ACC, or payments thereunder, will be limited to the amounts payable under the Contract or ACC...

24 CFR 902.5 - Applicability.

Code of Federal Regulations, 2011 CFR

2011-04-01

...(s) for which they assumed management responsibilities. (2) ACC. The ACC makes a PHA legally... the PHA and not the RMC or AME is ultimately responsible to HUD under the ACC, the PHAS score of a PHA will be based on all of the projects covered by the ACC, including those with management operations...

24 CFR 982.154 - ACC reserve account.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

24 CFR 982.154 - ACC reserve account.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

Lattice QCD simulations using the OpenACC platform

NASA Astrophysics Data System (ADS)

Majumdar, Pushan

2016-10-01

In this article we will explore the OpenACC platform for programming Graphics Processing Units (GPUs). The OpenACC platform offers a directive based programming model for GPUs which avoids the detailed data flow control and memory management necessary in a CUDA programming environment. In the OpenACC model, programs can be written in high level languages with OpenMP like directives. We present some examples of QCD simulation codes using OpenACC and discuss their performance on the Fermi and Kepler GPUs.

Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

PubMed

El Houmami, Nawal; Seligmann, Hervé

2017-01-01

We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

24 CFR 883.607 - Default by owner and/or agency.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Agency defaults under Agreement or Contract. The ACC, the Agreement and the Contract will provide that... enter into the Contract. (b) Rights of HUD if Agency defaults under ACC. The ACC will provide that, if...; however, HUD will continue to pay annual contributions in accordance with the terms of the ACC and the...

24 CFR 969.104 - Continuing eligibility for operating subsidy.

Code of Federal Regulations, 2010 CFR

2010-04-01

... in accordance with an ACC amendment providing for extension of the term of the ACC provisions related to project operation, pursuant to § 969.105 or § 969.106. The ACC amendment shall be in the form prescribed by HUD and shall specify the particular provisions of the ACC which relate to continued project...

24 CFR 969.103 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-04-01

....103 Definitions. (a) “ACC expiration date” means the last day of the term during which a particular public housing project is subject to all or any of the provisions of the ACC. The ACC term for a... Contribution Date for the project, as determined under the ACC (e.g., if the last debt service Annual...

24 CFR 882.805 - HA application process, ACC execution, and pre-rehabilitation activities.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false HA application process, ACC... § 882.805 HA application process, ACC execution, and pre-rehabilitation activities. (a) Review. When... applications in accordance with the guidelines, rating criteria, and procedures published in the NOFA. (b) ACC...

24 CFR 969.103 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-04-01

....103 Definitions. (a) “ACC expiration date” means the last day of the term during which a particular public housing project is subject to all or any of the provisions of the ACC. The ACC term for a... Contribution Date for the project, as determined under the ACC (e.g., if the last debt service Annual...

24 CFR 883.607 - Default by owner and/or agency.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Agency defaults under Agreement or Contract. The ACC, the Agreement and the Contract will provide that... enter into the Contract. (b) Rights of HUD if Agency defaults under ACC. The ACC will provide that, if...; however, HUD will continue to pay annual contributions in accordance with the terms of the ACC and the...

24 CFR 969.104 - Continuing eligibility for operating subsidy.

Code of Federal Regulations, 2011 CFR

2011-04-01

... in accordance with an ACC amendment providing for extension of the term of the ACC provisions related to project operation, pursuant to § 969.105 or § 969.106. The ACC amendment shall be in the form prescribed by HUD and shall specify the particular provisions of the ACC which relate to continued project...

Histopathology of acute acalculous cholecystitis in critically ill patients.

PubMed

Laurila, J J; Ala-Kokko, T I; Laurila, P A; Saarnio, J; Koivukangas, V; Syrjälä, H; Karttunen, T J

2005-11-01

To illustrate the histopathological features of acute acalculous cholecystitis (AAC) of critically ill patients and to compare them with those of acute calculous cholecystitis (ACC) and normal gallbladders. We studied 34 gallbladders with AAC and compared them with 28 cases of ACC and 14 normal gallbladders. Histological features were systematically evaluated. Typical features in AAC were bile infiltration, leucocyte margination of blood vessels and lymphatic dilation. Bile infiltration in the gallbladder wall was more common and extended wider and deeper into the muscle layer in AAC compared with ACC. Epithelial degeneration and defects and widespread occurrence of inflammatory cells were typical features in ACC. Necrosis in the muscle layer was also more common and extended wider and deeper in ACC. There were no differences in the occurrence of capillary thromboses, lymphatic follicles or Rokitansky-Aschoff sinuses between the AAC and ACC samples. There are characteristic differences in histopathology between AAC and ACC, although due to overlap, none appeared to be specific as such for either condition. These results suggest that AAC is largely a manifestation of systemic critical illness, whereas ACC is a local disease of the gallbladder.

OpenARC: Extensible OpenACC Compiler Framework for Directive-Based Accelerator Programming Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Seyong; Vetter, Jeffrey S

2014-01-01

Directive-based, accelerator programming models such as OpenACC have arisen as an alternative solution to program emerging Scalable Heterogeneous Computing (SHC) platforms. However, the increased complexity in the SHC systems incurs several challenges in terms of portability and productivity. This paper presents an open-sourced OpenACC compiler, called OpenARC, which serves as an extensible research framework to address those issues in the directive-based accelerator programming. This paper explains important design strategies and key compiler transformation techniques needed to implement the reference OpenACC compiler. Moreover, this paper demonstrates the efficacy of OpenARC as a research framework for directive-based programming study, by proposing andmore » implementing OpenACC extensions in the OpenARC framework to 1) support hybrid programming of the unified memory and separate memory and 2) exploit architecture-specific features in an abstract manner. Porting thirteen standard OpenACC programs and three extended OpenACC programs to CUDA GPUs shows that OpenARC performs similarly to a commercial OpenACC compiler, while it serves as a high-level research framework.« less

A role for NADPH oxidase 4 in the activation of vascular endothelial cells by oxidized phospholipids

PubMed Central

Lee, Sangderk; Gharavi, Nima M.; Honda, Henry; Chang, Irene; Kim, Brandon; Jen, Nelson; Li, Rongsong; Zimman, Alejandro; Berliner, Judith A.

2009-01-01

Previous studies from our group have demonstrated that oxidized 1-palmitoyl-2-arachidonyl-sn-glycerol-3-phosphocholine (Ox-PAPC) activates over 1000 genes in human aortic endothelial cell (HAEC). Prominent among these are genes regulating inflammation, cholesterol homeostasis, antioxidant enzymes, and the unfolded protein response. Previous studies from our lab and others suggested that transcriptional regulation by Ox-PAPC may be controlled, at least in part, by reactive oxygen species (ROS). We now present evidence that Ox-PAPC activation of NADPH oxidase 4 (NOX4) is responsible for the regulation of two of these important groups of genes: those controlling inflammation and sterol regulation. Our data demonstrate that Ox-PAPC increases reactive oxygen species formation in HAEC as seen by DCF fluorescence. NOX4 is the major molecule responsible for this increase since downregulation of NOX4 and its components (p22phox and rac1) blocked the Ox-PAPC effect. Our data show that Ox-PAPC did not change NOX4 transcription levels but did induce recruitment of rac1 to the membrane for NOX4 activation. We present evidence that vascular endothelial growth factor receptor 2 (VEGFR2) activation is responsible for rac1 recruitment to the membrane. Finally, we demonstrate that knockdown of NOX4 and its components rac1 and p22phox decrease Ox-PAPC induction of inflammatory and sterol regulatory genes, but do not affect Ox-PAPC transcriptional regulation of other gene of antioxidant and unfolded protein response. In summary, we have identified a VEGFR2/NOX4 regulatory pathway by which Ox-PAPC controls important endothelial functions. PMID:19375500

Involvement of alternative oxidase (AOX) in adventitious rooting of Olea europaea L. microshoots is linked to adaptive phenylpropanoid and lignin metabolism.

PubMed

Santos Macedo, E; Sircar, D; Cardoso, H G; Peixe, A; Arnholdt-Schmitt, B

2012-09-01

Alternative oxidase (AOX) has been proposed as a functional marker candidate in a number of events involving cell differentiation, including rooting efficiency in semi-hardwood shoot cuttings of olive (Olea europaea L.). To ascertain the general importance of AOX in olive rooting, the auxin-induced rooting process was studied in an in vitro system for microshoot propagation. Inhibition of AOX by salicylhydroxamic acid (SHAM) significantly reduced rooting efficiency. However, the inhibitor failed to exhibit any effect on the preceding calli stage. This makes the system appropriate for distinguishing dedifferentiation and de novo differentiation during root induction. Metabolite analyses of microshoots showed that total phenolics, total flavonoids and lignin contents were significantly reduced upon SHAM treatment. It was concluded that the influence of alternative respiration on root formation was associated to adaptive phenylpropanoid and lignin metabolism. Transcript profiles of two olive AOX genes (OeAOX1a and OeAOX2) were examined during the process of auxin-induced root induction. Both genes displayed stable transcript accumulation in semi-quantitative RT-PCR analysis during all experimental stages. In contrary, when the reverse primer for OeAOX2 was designed from the 3'-UTR instead of the ORF, differential transcript accumulation was observed suggesting posttranscriptional regulation of OeAOX2 during metabolic acclimation. This result confirms former observations in olive semi-hardwood shoot cuttings on differential OeAOX2 expression during root induction. It further points to the importance of future studies on the functional role of sequence and length polymorphisms in the 3'-UTR of this gene. The manuscript reports the general importance of AOX in olive adventitious rooting and the association of alternative respiration to adaptive phenylpropanoid and lignin metabolism.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

PubMed

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.

PubMed

Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A

2015-06-01

Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

Acetyl-CoA carboxylase rewires cancer metabolism to allow cancer cells to survive inhibition of the Warburg effect by cetuximab

PubMed Central

Luo, Jingtao; Hong, Yun; Lu, Yang; Qiu, Songbo; Chaganty, Bharat K. R.; Zhang, Lun; Wang, Xudong; Li, Qiang; Fan, Zhen

2016-01-01

Cetuximab inhibits HIF-1-regulated glycolysis in cancer cells, thereby reversing the Warburg effect and leading to inhibition of cancer cell metabolism. AMP-activated protein kinase (AMPK) is activated after cetuximab treatment, and a sustained AMPK activity is a mechanism contributing to cetuximab resistance. Here, we investigated how acetyl-CoA carboxylase (ACC), a downstream target of AMPK, rewires cancer metabolism in response to cetuximab treatment. We found that introduction of experimental ACC mutants lacking the AMPK phosphorylation sites (ACC1_S79A and ACC2_S212A) into head and neck squamous cell carcinoma (HNSCC) cells protected HNSCC cells from cetuximab-induced growth inhibition. HNSCC cells with acquired cetuximab resistance contained not only high levels of T172-phosphorylated AMPK and S79-phosphorylated ACC1 but also an increased level of total ACC. These findings were corroborated in tumor specimens of HNSCC patients treated with cetuximab. Cetuximab plus TOFA (an allosteric inhibitor of ACC) achieved remarkable growth inhibition of cetuximab-resistant HNSCC xenografts. Our data suggest a novel paradigm in which cetuximab-mediated activation of AMPK and subsequent phosphorylation and inhibition of ACC is followed by a compensatory increase in total ACC, which rewires cancer metabolism from glycolysis-dependent to lipogenesis-dependent. PMID:27693630

Performance, throughput, and cost of in-home training for the Army Reserve: Using asynchronous computer conferencing as an alternative to resident training

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hahn, H.A.; Ashworth, R.L. Jr.; Phelps, R.H.

1990-01-01

Asynchronous computer conferencing (ACC) was investigated as an alternative to resident training for the Army Reserve Component (RC). Specifically, the goals were to (1) evaluate the performance and throughput of ACC as compared with traditional Resident School instruction and (2) determine the cost-effectiveness of developing and implementing ACC. Fourteen RC students took a module of the Army Engineer Officer Advanced Course (EOAC) via ACC. Course topics included Army doctrine, technical engineering subjects, leadership, and presentation skills. Resident content was adapted for presentation via ACC. The programs of instruction for ACC and the equivalent resident course were identical; only the mediamore » used for presentation were changed. Performance on tests, homework, and practical exercises; self-assessments of learning; throughput; and cost data wee the measures of interest. Comparison data were collected on RC students taking the course in residence. Results indicated that there were no performance differences between the two groups. Students taking the course via ACC perceived greater learning benefit than did students taking the course in residence. Resident throughput was superior to ACC throughput, both in terms of numbers of students completing and time to complete the course. In spite of this fact, however, ACC was more cost-effective than resident training.« less

Phase transitions in biogenic amorphous calcium carbonate

NASA Astrophysics Data System (ADS)

Gong, Yutao

Geological calcium carbonate exists in both crystalline phases and amorphous phases. Compared with crystalline calcium carbonate, such as calcite, aragonite and vaterite, the amorphous calcium carbonate (ACC) is unstable. Unlike geological calcium carbonate crystals, crystalline sea urchin spicules (99.9 wt % calcium carbonate and 0.1 wt % proteins) do not present facets. To explain this property, crystal formation via amorphous precursors was proposed in theory. And previous research reported experimental evidence of ACC on the surface of forming sea urchin spicules. By using X-ray absorption near-edge structure (XANES) spectroscopy and photoelectron emission microscopy (PEEM), we studied cross-sections of fresh sea urchin spicules at different stages (36h, 48h and 72h after fertilization) and observed the transition sequence of three mineral phases: hydrated ACC → dehydrated ACC → biogenic calcite. In addition, we unexpectedly found hydrated ACC nanoparticles that are surrounded by biogenic calcite. This observation indicates the dehydration from hydrated ACC to dehydrated ACC is inhibited, resulting in stabilization of hydrated ACC nanoparticles. We thought that the dehydration was inhibited by protein matrix components occluded within the biomineral, and we designed an in vitro assay to test the hypothesis. By utilizing XANES-PEEM, we found that SM50, the most abundant occluded matrix protein in sea urchin spicules, has the function to stabilize hydrated ACC in vitro.

Evaluating the safety impact of adaptive cruise control in traffic oscillations on freeways.

PubMed

Li, Ye; Li, Zhibin; Wang, Hao; Wang, Wei; Xing, Lu

2017-07-01

Adaptive cruise control (ACC) has been considered one of the critical components of automated driving. ACC adjusts vehicle speeds automatically by measuring the status of the ego-vehicle and leading vehicle. Current commercial ACCs are designed to be comfortable and convenient driving systems. Little attention is paid to the safety impacts of ACC, especially in traffic oscillations when crash risks are the highest. The primary objective of this study was to evaluate the impacts of ACC parameter settings on rear-end collisions on freeways. First, the occurrence of a rear-end collision in a stop-and-go wave was analyzed. A car-following model in an integrated ACC was developed for a simulation analysis. The time-to-collision based factors were calculated as surrogate safety measures of the collision risk. We also evaluated different market penetration rates considering that the application of ACC will be a gradual process. The results showed that the safety impacts of ACC were largely affected by the parameters. Smaller time delays and larger time gaps improved safety performance, but inappropriate parameter settings increased the collision risks and caused traffic disturbances. A higher reduction of the collision risk was achieved as the ACC vehicle penetration rate increased, especially in the initial stage with penetration rates of less than 30%. This study also showed that in the initial stage, the combination of ACC and a variable speed limit achieved better safety improvements on congested freeways than each single technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

Abnormal Resting-State Functional Connectivity of the Anterior Cingulate Cortex in Unilateral Chronic Tinnitus Patients

PubMed Central

Chen, Yu-Chen; Liu, Shenghua; Lv, Han; Bo, Fan; Feng, Yuan; Chen, Huiyou; Xu, Jin-Jing; Yin, Xindao; Wang, Shukui; Gu, Jian-Ping

2018-01-01

Purpose: The anterior cingulate cortex (ACC) has been suggested to be involved in chronic subjective tinnitus. Tinnitus may arise from aberrant functional coupling between the ACC and cerebral cortex. To explore this hypothesis, we used resting-state functional magnetic resonance imaging (fMRI) to illuminate the functional connectivity (FC) network of the ACC subregions in chronic tinnitus patients. Methods: Resting-state fMRI scans were obtained from 31 chronic right-sided tinnitus patients and 40 healthy controls (age, sex, and education well-matched) in this study. Rostral ACC and dorsal ACC were selected as seed regions to investigate the intrinsic FC with the whole brain. The resulting FC patterns were correlated with clinical tinnitus characteristics including the tinnitus duration and tinnitus distress. Results: Compared with healthy controls, chronic tinnitus patients showed disrupted FC patterns of ACC within several brain networks, including the auditory cortex, prefrontal cortex, visual cortex, and default mode network (DMN). The Tinnitus Handicap Questionnaires (THQ) scores showed positive correlations with increased FC between the rostral ACC and left precuneus (r = 0.507, p = 0.008) as well as the dorsal ACC and right inferior parietal lobe (r = 0.447, p = 0.022). Conclusions: Chronic tinnitus patients have abnormal FC networks originating from ACC to other selected brain regions that are associated with specific tinnitus characteristics. Resting-state ACC-cortical FC disturbances may play an important role in neuropathological features underlying chronic tinnitus. PMID:29410609

Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.

PubMed

Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J

2016-03-01

An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action. © 2016 Society for Endocrinology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brewer, M; Gordon, C; Tien, C

Purpose: To follow the Integrating Healthcare Enterprise - Radiation Oncology (IHE-RO) initiative of proper cross-vendor technology integration, an automated chart checker (ACC) was developed. ACC compares extracted data from an approved patient plan in the Eclipse treatment planning system (TPS) against data existing in the Mosaiq treatment management system (TMS). ACC automatically analyzes these parameters using built-in quality checklists to provide further aid in chart review. Methods: Eclipse TPS data are obtained using Eclipse scripting API (ESAPI) while Mosaiq TMS data are obtained from a radiotherapy-treatment-planning (RTP) file. Using this information, ACC identifies TPS-TMS discrepancies in 18 primary beam parametersmore » including MU, energy, jaw positions, gantry angle, table angle, accessories, and bolus for up to 31 beams. Next, approximately 40 items from traditional quality checklists are evaluated such as prescription consistency, DRR graticule placement, plan approval status, global max dose, and dose tracking coefficients. Parameters were artificially modified to determine if ACC would detect an error in data transfer and to test each component of quality checklists. Results: Using ESAPI scripting and RTP file-processing, ACC was able to properly aggregate data from TPS and TMS for up to 31 beams. Errors were artificially introduced into each plan parameter, and ACC was able to successfully detect all of them within seconds. Next, ACC was able to successfully detect mistakes in the chart by identifying deviations with its quality checklists, within seconds. Conclusion: ACC effectively addresses the potential issue of faulty cross-vendor data transfer, as described by IHE-RO. In addition, ACC was also able to detect deviations from its built-in quality checklists. ACC is already an invaluable tool for efficient and standardized chart review and will continue to improve as its incorporated checklists become more comprehensive.« less

Antidepressant Effects of Electroconvulsive Therapy Correlate With Subgenual Anterior Cingulate Activity and Connectivity in Depression

PubMed Central

Liu, Yi; Du, Lian; Li, Yongmei; Liu, Haixia; Zhao, Wenjing; Liu, Dan; Zeng, Jinkun; Li, Xingbao; Fu, Yixiao; Qiu, Haitang; Li, Xirong; Qiu, Tian; Hu, Hua; Meng, Huaqing; Luo, Qinghua

2015-01-01

Abstract The mechanisms underlying the effects of electroconvulsive therapy (ECT) in major depressive disorder (MDD) are not fully understood. Resting-state functional magnetic resonance imaging (rs-fMRI) is a new tool to study the effects of brain stimulation interventions, particularly ECT. The authors aim to investigate the mechanisms of ECT in MDD by rs-fMRI. They used rs-fMRI to measure functional changes in the brain of first-episode, treatment-naive MDD patients (n = 23) immediately before and then following 8 ECT sessions (brief-pulse square-wave apparatus, bitemporal). They also computed voxel-wise amplitude of low-frequency fluctuation (ALFF) as a measure of regional brain activity and selected the left subgenual anterior cingulate cortex (sgACC) to evaluate functional connectivity between the sgACC and other brain regions. Increased regional brain activity measured by ALFF mainly in the left sgACC following ECT. Functional connectivity of the left sgACC increased in the ipsilateral parahippocampal gyrus, pregenual ACC, contralateral middle temporal pole, and orbitofrontal cortex. Importantly, reduction in depressive symptoms were negatively correlated with increased ALFF in the left sgACC and left hippocampus, and with distant functional connectivity between the left sgACC and contralateral middle temporal pole. That is, across subjects, as depression improved, regional brain activity in sgACC and its functional connectivity increased in the brain. Eight ECT sessions in MDD patients modulated activity in the sgACC and its networks. The antidepressant effects of ECT were negatively correlated with sgACC brain activity and connectivity. These findings suggest that sgACC-associated prefrontal-limbic structures are associated with the therapeutic effects of ECT in MDD. PMID:26559309

Morphological heterogeneity of oral salivary gland carcinomas: A clinicopathologic study of 41 cases with long term follow-up emphasizing the overlapping spectrum of adenoid cystic carcinoma and polymorphous low-grade adenocarcinoma

PubMed Central

Schwarz, Stephan; Müller, Maximilian; Ettl, Tobias; Stockmann, Philipp; Zenk, Johannes; Agaimy, Abbas

2011-01-01

We analyzed 41 oral salivary gland carcinomas from consecutive 290 salivary gland carcinoma database (14%) with emphasis on the histological spectrum and clinical outcome of adenoid cystic carcinoma (ACC) and polymorphous low-grade adenocarcinoma (PLGA). The cohort included 14 ACCs, 14 mucoepidermoid carcinomas (MECs), 8 PLGAs, 3 adenocarcinomas, not otherwise specified and 2 acinic cell carcinomas. Mean age was 48, 58 and 61 yrs for ACC, MEC and PLGA, respectively. Eight patients (19.5%) died of tumor at a mean interval of 66.5 months. ACC and PLGA showed similar mean age, gender distribution, predominant palatal localization, nodal metastasis, perineural invasion and MIB-1 index. However, ACC tended to show higher tumor stage and residual tumor (R1/R2) more frequently than PLGA, but this was statistically not significant. ACC and PLGA showed overlapping architectural patterns. However, ACCs displayed well organized basal-luminal differentiation, highlighted by CK5/CK7 immunostaining. In contrast, PLGA showed a disorganized histological and immunohistological pattern. C-Kit expression (CD117) was common in ACC, generally mirroring that of CK7 and virtually lacking in PLGA. Kaplan-Meier analysis demonstrated a similar clinical course for ACC and PLGA with 5 years survivals of 87% and 80%, respectively. Fluorescence in situ hybridization (FISH) performed on all 290 salivary carcinomas confirmed the specificity of the translocation t (11; 19) for MEC and its absence in all other carcinomas including ACC and PLGA. Our results emphasize the diversity of oral salivary gland carcinomas and the overlapping clinicopathological features of ACC and PLGA. PMID:21577319

Similar outcomes between adenoid cystic carcinoma of the breast and invasive ductal carcinoma: a population-based study from the SEER 18 database.

PubMed

Chen, Qing-Xia; Li, Jun-Jing; Wang, Xiao-Xiao; Lin, Pei-Yang; Zhang, Jie; Song, Chuan-Gui; Shao, Zhi-Ming

2017-01-24

Adenoid cystic carcinoma of the breast (breast-ACC) is a rare and indolent tumor with a good prognosis despite its triple-negative status. However, we observed different outcomes in the present study. Utilizing the Surveillance, Epidemiology, and End Results (SEER) database, we enrolled a total of 89,937 eligible patients with an estimated 86 breast-ACC cases and 89,851 invasive ductal carcinoma (IDC) patients. In our study, breast-ACC among women presented with a higher proportion of triple-negative breast cancer (TNBC), which was more likely to feature well-differentiated tumors, rare regional lymph node involvement and greater application of breast-conserving surgery (BCS). Kaplan-Meier analysis revealed that patients with breast-ACC and breast-IDC patients had similar breast cancer-specific survival (BCSS) and overall survival (OS). Moreover, using the propensity score matching method, no significant difference in survival was observed in matched pairs of breast-ACC and breast-IDC patients. Additionally, BCSS and OS did not differ significantly between TNBC-ACC and TNBC-IDC after matching patients for age, tumor size, and nodal status. Further subgroup analysis of molecular subtype indicated improved survival in breast-ACC patients with hormone receptor-positive and human epidermal growth factor receptor 2-negative (HR+/Her2-) tumors compared to IDC patients with HR+/Her2- tumors. However, the survival of ACC-TNBC and IDC-TNBC patients was similar. In conclusion, ACCs have an indolent clinical course and result in similar outcomes compared to IDC. Understanding these clinical characteristics and outcomes will endow doctors with evidence to provide the same intensive treatment for ACC-TNBC as for IDC-TNBC and lead to more individualized and tailored therapies for breast-ACC patients.

Influence of Magnesium Content on the Local Structure of Amorphous Calcium Carbonate (ACC): Real Time Determination by In Situ PDF Analysis

NASA Astrophysics Data System (ADS)

Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

2016-12-01

Calcium carbonate minerals are an essential component in the exoskeletons of crustaceans and mollusks. The onset of exoskeleton mineralization includes the precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that later transforms to produce diverse structures. Despite the importance of ACC as a critical phase during skeleton formation, the chemical and physical properties are not well characterized at conditions that approximate biological environments. Of particular interest are the solubility of ACC, the short-range structure at the time of formation, and the evolution of ACC structure to final products. Recent advances showing the widespread occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015) underline the importance of understanding amorphous intermediates. Using quantitative laboratory techniques developed by our research group (Blue et al., 2013; Blue and Dove, 2015; Blue et al., in press), this experimental study quantifies the solubility of ACC in parallel with the physical characterization of the corresponding structure. We measured ACC solubility at specific time points during the precipitation and during its subsequent evolution under the mild pH conditions that approximate biological and environmental conditions. In parallel experiments, structural data were collected from in situ pair distribution function (PDF) analyses were conducted to follow the evolution of individual samples from initial precipitation to final product. The measurements are leading to a quantitative solubility function for ACC with variable Mg contents and an x-ray based understanding of ACC structure in the same particles. We are also finding temporal changes in the short-range order of ACC after precipitation and this order is dependent upon Mg content. Moreover, the data show Mg distribution through the ACC particles is dependent upon total alkalinity. Insights from this study hold promise for better understanding the nature of the initial ACC that forms and factors that influence its structural evolution to final products.

Identification of methylated genes in salivary gland adenoid cystic carcinoma xenografts using global demethylation and methylation microarray screening

PubMed Central

LING, SHIZHANG; RETTIG, ELENI M.; TAN, MARIETTA; CHANG, XIAOFEI; WANG, ZHIMING; BRAIT, MARIANA; BISHOP, JUSTIN A.; FERTIG, ELANA J.; CONSIDINE, MICHAEL; WICK, MICHAEL J.; HA, PATRICK K.

2016-01-01

Salivary gland adenoid cystic carcinoma (ACC) is a rare head and neck malignancy without molecular biomarkers that can be used to predict the chemotherapeutic response or prognosis of ACC. The regulation of gene expression of oncogenes and tumor suppressor genes (TSGs) through DNA promoter methylation may play a role in the carcinogenesis of ACC. To identify differentially methylated genes in ACC, a global demethylating agent, 5-aza-2′-deoxycytidine (5-AZA) was utilized to unmask putative TSG silencing in ACC xenograft models in mice. Fresh xenografts were passaged, implanted in triplicate in mice that were treated with 5-AZA daily for 28 days. These xenografts were then evaluated for genome-wide DNA methylation patterns using the Illumina Infinium HumanMethylation27 BeadChip array. Validation of the 32 candidate genes was performed by bisulfite sequencing (BS-seq) in a separate cohort of 6 ACC primary tumors and 6 normal control salivary gland tissues. Hypermethylation was identified in the HCN2 gene promoter in all 6 control tissues, but hypomethylation was found in all 6 ACC tumor tissues. Quantitative validation of HCN2 promoter methylation level in the region detected by BS-seq was performed in a larger cohort of primary tumors (n=32) confirming significant HCN2 hypomethylation in ACCs compared with normal samples (n=10; P=0.04). HCN2 immunohistochemical staining was performed on an ACC tissue microarray. HCN2 staining intensity and H-score, but not percentage of the positively stained cells, were significantly stronger in normal tissues than those of ACC tissues. With our novel screening and sequencing methods, we identified several gene candidates that were methylated. The most significant of these genes, HCN2, was actually hypomethylated in tumors. However, promoter methylation status does not appear to be a major determinant of HCN2 expression in normal and ACC tissues. HCN2 hypomethylation is a biomarker of ACC and may play an important role in the carcinogenesis of ACC. PMID:27212063

Coordinated Interaction between Hippocampal Sharp-Wave Ripples and Anterior Cingulate Unit Activity

PubMed Central

2016-01-01

Hippocampal–cortical interaction during sleep promotes transformation of memory for long-term storage in the cortex. In particular, hippocampal sharp-wave ripple-associated neural activation is important for this transformation during slow-wave sleep. The anterior cingulate cortex (ACC) has been shown to be crucial for expression and likely storage of long-term memory. However, little is known about how ACC activity is influenced by hippocampal ripple activity during sleep. We report here about coordinated interactions between hippocampal ripple activity and ACC neural firings. By recording from the ACC and hippocampal CA1 simultaneously in mice, we found that almost all ACC neurons showed increased activity before hippocampal ripple activity; moreover, a subpopulation (17%) displayed a further activation immediately after ripple activity. This postripple activation of ACC neurons correlated positively with ripple amplitude, and the same neurons were excited upon electrical stimulation of the CA1. Interestingly, the preripple activation of ACC neurons was present during the sleep state, but not during the awake state. These results suggest intimate interactions between hippocampal sharp-wave ripples and ACC neurons in a state-dependent manner. Importantly, sharp-wave ripples and associated activation appear to regulate activity of a small population of ACC neurons, a process that may play a critical role in memory consolidation. SIGNIFICANCE STATEMENT The hippocampus communicates with the cortex for memory transformation. Memories of previous experiences become less dependent on the hippocampus and increasingly dependent on cortical areas, such as the anterior cingulate cortex (ACC). However, little evidence is available to directly support this hippocampus-to-cortex information transduction hypothesis of memory consolidation. Here we show that a subpopulation of ACC neurons becomes active just after hippocampal ripple activity, and that electrical stimulation of the hippocampus excites the same ACC neurons. In addition, the majority of ACC neurons are activated just before ripple activity during the sleep state, but not during the awake state. These results provide evidence supporting the hypothesis of hippocampus-to-cortex information flow for memory consolidation as well as reciprocal interaction between the hippocampus and the cortex. PMID:27733616

Contraction-induced changes in acetyl-CoA carboxylase and 5'-AMP-activated kinase in skeletal muscle.

PubMed

Vavvas, D; Apazidis, A; Saha, A K; Gamble, J; Patel, A; Kemp, B E; Witters, L A; Ruderman, N B

1997-05-16

The concentration of malonyl-CoA, a negative regulator of fatty acid oxidation, diminishes acutely in contracting skeletal muscle. To determine how this occurs, the activity and properties of acetyl-CoA carboxylase beta (ACC-beta), the skeletal muscle isozyme that catalyzes malonyl-CoA formation, were examined in rat gastrocnemius-soleus muscles at rest and during contractions induced by electrical stimulation of the sciatic nerve. To avoid the problem of contamination of the muscle extract by mitochondrial carboxylases, an assay was developed in which ACC-beta was first purified by immunoprecipitation with a monoclonal antibody. ACC-beta was quantitatively recovered in the immunopellet and exhibited a high sensitivity to citrate (12-fold activation) and a Km for acetyl-CoA (120 microM) similar to that reported for ACC-beta purified by other means. After 5 min of contraction, ACC-beta activity was decreased by 90% despite an apparent increase in the cytosolic concentration of citrate, a positive regulator of ACC. SDS-polyacrylamide gel electrophoresis of both homogenates and immunopellets from these muscles showed a decrease in the electrophoretic mobility of ACC, suggesting that phosphorylation could account for the decrease in ACC activity. In keeping with this notion, citrate activation of ACC purified from contracting muscle was markedly depressed. In addition, homogenization of the muscles in a buffer free of phosphatase inhibitors and containing the phosphatase activators glutamate and MgCl2 or treatment of immunoprecipitated ACC-beta with purified protein phosphatase 2A abolished the decreases in both ACC-beta activity and electrophoretic mobility caused by contraction. The rapid decrease in ACC-beta activity after the onset of contractions (50% by 20 s) and its slow restoration to initial values during recovery (60-90 min) were paralleled temporally by reciprocal changes in the activity of the alpha2 but not the alpha1 isoform of 5'-AMP-activated protein kinase (AMPK). In conclusion, the results suggest that the decrease in ACC activity during muscle contraction is caused by an increase in its phosphorylation, most probably due, at least in part, to activation of the alpha2 isoform of AMPK. They also suggest a dual mechanism for ACC regulation in muscle in which inhibition by phosphorylation takes precedence over activation by citrate. These alterations in ACC and AMPK activity, by diminishing the concentration of malonyl-CoA, could be responsible for the increase in fatty acid oxidation observed in skeletal muscle during exercise.

Transcriptome analysis of thermogenic Arum concinnatum reveals the molecular components of floral scent production

PubMed Central

Onda, Yoshihiko; Mochida, Keiichi; Yoshida, Takuhiro; Sakurai, Tetsuya; Seymour, Roger S.; Umekawa, Yui; Pirintsos, Stergios Arg; Shinozaki, Kazuo; Ito, Kikukatsu

2015-01-01

Several plant species can generate enough heat to increase their internal floral temperature above ambient temperature. Among thermogenic plants, Arum concinnatum shows the highest respiration activity during thermogenesis. However, an overall understanding of the genes related to plant thermogenesis has not yet been achieved. In this study, we performed de novo transcriptome analysis of flower organs in A. concinnatum. The de novo transcriptome assembly represented, in total, 158,490 non-redundant transcripts, and 53,315 of those showed significant homology with known genes. To explore genes associated with thermogenesis, we filtered 1266 transcripts that showed a significant correlation between expression pattern and the temperature trend of each sample. We confirmed five putative alternative oxidase transcripts were included in filtered transcripts as expected. An enrichment analysis of the Gene Ontology terms for the filtered transcripts suggested over-representation of genes involved in 1-deoxy-d-xylulose-5-phosphate synthase (DXS) activity. The expression profiles of DXS transcripts in the methyl-d-erythritol 4-phosphate (MEP) pathway were significantly correlated with thermogenic levels. Our results suggest that the MEP pathway is the main biosynthesis route for producing scent monoterpenes. To our knowledge, this is the first report describing the candidate pathway and the key enzyme for floral scent production in thermogenic plants. PMID:25736477

In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan

2012-02-07

We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

24 CFR 906.9 - Title restrictions and encumbrances on properties sold under a homeownership program.

Code of Federal Regulations, 2011 CFR

2011-04-01

... program. (a) If the property is subject to indebtedness under the Annual Contributions Contract (ACC), HUD will continue to make any debt service contributions for which it is obligated under the ACC, and the... title restrictions prescribed by the ACC. Because the property will no longer be subject to the ACC...

24 CFR 969.106 - ACC extension in absence of current operating subsidy.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

Code of Federal Regulations, 2011 CFR

2011-04-01

... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS RELATING... HOUSING AFTER COMPLETION OF DEBT SERVICE § 969.107 HUD approval of demolition or disposition before ACC..., HUD may authorize a PHA to demolish or dispose of public housing at any time before the ACC Expiration...

24 CFR 969.106 - ACC extension in absence of current operating subsidy.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

24 CFR 906.9 - Title restrictions and encumbrances on properties sold under a homeownership program.

Code of Federal Regulations, 2010 CFR

2010-04-01

... program. (a) If the property is subject to indebtedness under the Annual Contributions Contract (ACC), HUD will continue to make any debt service contributions for which it is obligated under the ACC, and the... title restrictions prescribed by the ACC. Because the property will no longer be subject to the ACC...

Human molybdopterin synthase gene: identification of a bicistronic transcript with overlapping reading frames.

PubMed Central

Stallmeyer, B; Drugeon, G; Reiss, J; Haenni, A L; Mendel, R R

1999-01-01

A universal molybdenum-containing cofactor (MoCo) is essential for the activity of all human molybdoenzymes, including sulphite oxidase. The free cofactor is highly unstable, and all organisms share a similar biosynthetic pathway. The involved enzymes exhibit homologies, even between bacteria and humans. We have exploited these homologies to isolate a cDNA for the heterodimeric molybdopterin (MPT)-synthase. This enzyme is necessary for the conversion of an unstable precursor into molybdopterin, the organic moiety of MoCo. The corresponding transcript shows a bicistronic structure, encoding the small and large subunits of the MPT-synthase in two different open reading frames (ORFs) that overlap by 77 nucleotides. In various human tissues, only one size of mRNA coinciding with the bicistronic transcript was detected. In vitro translation and mutagenesis experiments demonstrated that each ORF is translated independently, leading to the synthesis of a 10-kDa protein and a 21-kDa protein for the small and large subunits, respectively, and indicated that the 3'-proximal ORF of the bicistronic transcript is translated by leaky scanning. PMID:10053003

A plant spermine oxidase/dehydrogenase regulated by the proteasome and polyamines.

PubMed

Ahou, Abdellah; Martignago, Damiano; Alabdallah, Osama; Tavazza, Raffaela; Stano, Pasquale; Macone, Alberto; Pivato, Micaela; Masi, Antonio; Rambla, Jose L; Vera-Sirera, Francisco; Angelini, Riccardo; Federico, Rodolfo; Tavladoraki, Paraskevi

2014-04-01

Polyamine oxidases (PAOs) are flavin-dependent enzymes involved in polyamine catabolism. In Arabidopsis five PAO genes (AtPAO1-AtPAO5) have been identified which present some common characteristics, but also important differences in primary structure, substrate specificity, subcellular localization, and tissue-specific expression pattern, differences which may suggest distinct physiological roles. In the present work, AtPAO5, the only so far uncharacterized AtPAO which is specifically expressed in the vascular system, was partially purified from 35S::AtPAO5-6His Arabidopsis transgenic plants and biochemically characterized. Data presented here allow AtPAO5 to be classified as a spermine dehydrogenase. It is also shown that AtPAO5 oxidizes the polyamines spermine, thermospermine, and N(1)-acetylspermine, the latter being the best in vitro substrate of the recombinant enzyme. AtPAO5 also oxidizes these polyamines in vivo, as was evidenced by analysis of polyamine levels in the 35S::AtPAO5-6His Arabidopsis transgenic plants, as well as in a loss-of-function atpao5 mutant. Furthermore, subcellular localization studies indicate that AtPAO5 is a cytosolic protein undergoing proteasomal control. Positive regulation of AtPAO5 expression by polyamines at the transcriptional and post-transcriptional level is also shown. These data provide new insights into the catalytic properties of the PAO gene family and the complex regulatory network controlling polyamine metabolism.

Streptococcus mutans NADH oxidase lies at the intersection of overlapping regulons controlled by oxygen and NAD+ levels.

PubMed

Baker, J L; Derr, A M; Karuppaiah, K; MacGilvray, M E; Kajfasz, J K; Faustoferri, R C; Rivera-Ramos, I; Bitoun, J P; Lemos, J A; Wen, Z T; Quivey, R G

2014-06-01

NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD(+). The critical nature of Nox is 2-fold: it serves to regenerate NAD(+), a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD(+) have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD(+) affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

NASA Astrophysics Data System (ADS)

Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

2003-06-01

Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

Partial kinetoplast-mitochondrial gene organization and expression in the respiratory deficient plant trypanosomatid Phytomonas serpens.

PubMed

Maslov, D A; Nawathean, P; Scheel, J

1999-04-30

In plant-dwelling trypanosomatids from the genus Phytomonas, mitochondrial functions, such as cytochrome mediated respiration, ATP production and Krebs cycle, are missing, and cell energetics is based on the glycolysis. Using Blue Native/Tricine-SDS two-dimensional gel electrophoretic analysis, we observed that mitochondrial respiratory Complexes III (cytochrome bc1) and IV (cytochrome c oxidase) were absent in Phytomonas serpens; however, Complex V (ATPase) was present. A deletion of the genes for cytochrome c oxidase subunit III (COIII) and apocytochrome b (Cyb) was identified within the 6234 bp sequenced region of the 31 kb maxicircle kinetoplast DNA. Genes, found in this region, include 12S and 9S ribosomal RNAs, subunits 7, 8 and 9 of NADH dehydrogenase (ND7, ND8 and ND9) and subunit 6 of ATPase (A6 or MURF4), as well as the genes (MURF1, MURF5 and G3) with unknown function. Most genes are actively transcribed and some mRNAs are edited. Fully edited mRNAs for A6 and G3 were abundant, while edited ND7 transcripts were rare, and only partially edited and pre-edited transcripts for ND8 were detected. The data show that the mitochondrial genome of P. serpens is functional, although its functions may be limited to expressing the ATPase and, possibly, NADH dehydrogenase complexes.

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

PubMed

Zhou, Yuchan; Underhill, Steven J R

2016-01-01

Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Gene Expression Patterns during Light and Dark Infection of Prochlorococcus by Cyanophage

PubMed Central

Chisholm, Sallie W.

2016-01-01

Cyanophage infecting the marine cyanobacteria Prochlorococcus and Synechococcus require light and host photosystem activity for optimal reproduction. Many cyanophages encode multiple photosynthetic electron transport (PET) proteins, which are presumed to maintain electron flow and produce ATP and NADPH for nucleotide biosynthesis and phage genome replication. However, evidence suggests phage augment NADPH production via the pentose phosphate pathway (PPP), thus calling into question the need for NADPH production by PET. Genes implicated in cyclic PET have since been identified in cyanophage genomes. It remains an open question which mode of PET, cyclic or linear, predominates in infected cyanobacteria, and thus whether the balance is towards producing ATP or NADPH. We sequenced transcriptomes of a cyanophage (P-HM2) and its host (Prochlorococcus MED4) throughout infection in the light or in the dark, and analyzed these data in the context of phage replication and metabolite measurements. Infection was robust in the light, but phage were not produced in the dark. Host gene transcripts encoding high-light inducible proteins and two terminal oxidases (plastoquinol terminal oxidase and cytochrome c oxidase)—implicated in protecting the photosynthetic membrane from light stress—were the most enriched in light but not dark infection. Among the most diminished transcripts in both light and dark infection was ferredoxin–NADP+ reductase (FNR), which uses the electron acceptor NADP+ to generate NADPH in linear photosynthesis. The phage gene for CP12, which putatively inhibits the Calvin cycle enzyme that receives NADPH from FNR, was highly expressed in light infection. Therefore, both PET production of NADPH and its consumption by carbon fixation are putatively repressed during phage infection in light. Transcriptomic evidence is thus consistent with cyclic photophosphorylation using oxygen as the terminal electron acceptor as the dominant mode of PET under infection, with ATP from PET and NADPH from the PPP producing the energy and reducing equivalents for phage nucleotide biosynthesis and replication. PMID:27788196

Andrographolide Antagonizes TNF-α-Induced IL-8 via Inhibition of NADPH Oxidase/ROS/NF-κB and Src/MAPKs/AP-1 Axis in Human Colorectal Cancer HCT116 Cells.

PubMed

Yuan, Miaomiao; Meng, Wei; Liao, Wenzhen; Lian, Sen

2018-05-14

Andrographis paniculata Nees is used as a functional food in Japan, Korea, India, and China. Andrographolide, a naturally occurring phytochemical identified in Andrographis paniculata, has been discovered to present anti-inflammatory and anticancer activities. Highly expressed interleukin (IL-8) has been detected in colorectal cancer and is implicated in angiogenesis. However, the effect and molecular mechanisms of IL-8 expression by andrographolide remain obscure in human colorectal cancer cells. The present study was aimed to investigate the effects of andrographolide on TNF-α-induced IL-8 expression and its underlying mechanisms. We found that andrographolide concentration-dependently inhibited TNF-α-induced IL-8 mRNA (2.23 ± 0.15 fold at 20 μM) and protein expression (4.78 ± 0.31 fold at 20 μM) and reduced the IL-8 transcriptional activity (2.59 ± 0.25 fold at 20 μM). TNF-α stimulated the membrane translocation of p47 phox to activate reactive oxygen species (ROS)-producing NADPH oxidase (NOX). Furthermore, TNF-α induced Src and MAPKs (Erk1/2, p38 MAPK) phosphorylation, as well as NF-κB and AP-1 binding activities. We found that NF-κB and AP-1 were the critical transcription factors for TNF-α-induced IL-8 expression. Specific inhibitors and mutagenesis studies indicated that Src, Erk1/2, and p38 MAPK are related to TNF-α-induced IL-8. NOX-derived ROS and Src/MAPKs (Erk1/2 and p38 MAPK) functioned as upstream activators of NF-κB and AP-1, respectively. Taken together, andrographolide antagonizes TNF-α-induced IL-8 via inhibition of NADPH oxidase/ROS/NF-κB and Src/MAPKs/AP-1 signaling pathways in HCT116 colorectal cancer cells and then suppresses angiogenesis in the tumor microenvironment.

Acetyl-CoA carboxylase in Reuber hepatoma cells: variation in enzyme activity, insulin regulation, and cellular lipid content.

PubMed

Bianchi, A; Evans, J L; Nordlund, A C; Watts, T D; Witters, L A

1992-01-01

Reuber hepatoma cells are useful cultured lines for the study of insulin action, lipid and lipoprotein metabolism, and the regulation of acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid biosynthesis. During investigations in different clonal lines of these cells, we have uncovered marked intercellular variability in the activity, enzyme content, and insulin regulation of ACC paralleled by differences in cellular neutral lipid (triglyceride) content. Two contrasting clonal lines, Fao and H356A-1, have been studied in detail. Several features distinguish these two lines, including differences in ACC activity and enzyme kinetics, the content of the two major hepatic ACC isozymes (Mr 280,000 and 265,000 Da) and their heteroisozymic complex, the extent of ACC phosphorylation, and the ability of ACC to be activated on stimulation by insulin and insulinomimetic agonists. As studied by Nile Red staining and fluorescence-activated cell sorting, these two lines also display marked differences in neutral lipid content, which correlates with both basal levels of ACC activity and inhibition of ACC by the fatty acid analog, 5-(tetradecyloxy)-2-furoic acid (TOFA). These results emphasize the importance of characterization of any particular clonal line of Reuber cells for studies of enzyme regulation, substrate metabolism, and hormone action. With respect to ACC, studies in contrasting clonal lines of Reuber cells could provide valuable clues to understanding both the complex mechanisms of intracellular ACC regulation in the absence and presence of hormones and its regulatory role(s) in overall hepatic lipid metabolism.

Advanced MR Imaging of the Human Nucleus Accumbens--Additional Guiding Tool for Deep Brain Stimulation.

PubMed

Lucas-Neto, Lia; Reimão, Sofia; Oliveira, Edson; Rainha-Campos, Alexandre; Sousa, João; Nunes, Rita G; Gonçalves-Ferreira, António; Campos, Jorge G

2015-07-01

The human nucleus accumbens (Acc) has become a target for deep brain stimulation (DBS) in some neuropsychiatric disorders. Nonetheless, even with the most recent advances in neuroimaging it remains difficult to accurately delineate the Acc and closely related subcortical structures, by conventional MRI sequences. It is our purpose to perform a MRI study of the human Acc and to determine whether there are reliable anatomical landmarks that enable the precise location and identification of the nucleus and its core/shell division. For the Acc identification and delineation, based on anatomical landmarks, T1WI, T1IR and STIR 3T-MR images were acquired in 10 healthy volunteers. Additionally, 32-direction DTI was obtained for Acc segmentation. Seed masks for the Acc were generated with FreeSurfer and probabilistic tractography was performed using FSL. The probability of connectivity between the seed voxels and distinct brain areas was determined and subjected to k-means clustering analysis, defining 2 different regions. With conventional T1WI, the Acc borders are better defined through its surrounding anatomical structures. The DTI color-coded vector maps and IR sequences add further detail in the Acc identification and delineation. Additionally, using probabilistic tractography it is possible to segment the Acc into a core and shell division and establish its structural connectivity with different brain areas. Advanced MRI techniques allow in vivo delineation and segmentation of the human Acc and represent an additional guiding tool in the precise and safe target definition for DBS. © 2015 International Neuromodulation Society.

Transformation and crystallization energetics of synthetic and biogenic amorphous calcium carbonate

PubMed Central

Radha, A. V.; Forbes, Tori Z.; Killian, Christopher E.; Gilbert, P. U. P. A.; Navrotsky, Alexandra

2010-01-01

Amorphous calcium carbonate (ACC) is a metastable phase often observed during low temperature inorganic synthesis and biomineralization. ACC transforms with aging or heating into a less hydrated form, and with time crystallizes to calcite or aragonite. The energetics of transformation and crystallization of synthetic and biogenic (extracted from California purple sea urchin larval spicules, Strongylocentrotus purpuratus) ACC were studied using isothermal acid solution calorimetry and differential scanning calorimetry. Transformation and crystallization of ACC can follow an energetically downhill sequence: more metastable hydrated ACC → less metastable hydrated ACC⇒anhydrous ACC ∼ biogenic anhydrous ACC⇒vaterite → aragonite → calcite. In a given reaction sequence, not all these phases need to occur. The transformations involve a series of ordering, dehydration, and crystallization processes, each lowering the enthalpy (and free energy) of the system, with crystallization of the dehydrated amorphous material lowering the enthalpy the most. ACC is much more metastable with respect to calcite than the crystalline polymorphs vaterite or aragonite. The anhydrous ACC is less metastable than the hydrated, implying that the structural reorganization during dehydration is exothermic and irreversible. Dehydrated synthetic and anhydrous biogenic ACC are similar in enthalpy. The transformation sequence observed in biomineralization could be mainly energetically driven; the first phase deposited is hydrated ACC, which then converts to anhydrous ACC, and finally crystallizes to calcite. The initial formation of ACC may be a first step in the precipitation of calcite under a wide variety of conditions, including geological CO2 sequestration. PMID:20810918

Overexpression of a cotton gene that encodes a putative transcription factor of AP2/EREBP family in Arabidopsis affects growth and development of transgenic plants.

PubMed

Zhou, Ying; Xia, Hui; Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

2013-01-01

In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling.

Overexpression of a Cotton Gene That Encodes a Putative Transcription Factor of AP2/EREBP Family in Arabidopsis Affects Growth and Development of Transgenic Plants

PubMed Central

Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

2013-01-01

In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling. PMID:24194949

Anterior cingulate cortex activity can be independent of response conflict in Stroop-like tasks.

PubMed

Roelofs, Ardi; van Turennout, Miranda; Coles, Michael G H

2006-09-12

Cognitive control includes the ability to formulate goals and plans of action and to follow these while facing distraction. Previous neuroimaging studies have shown that the presence of conflicting response alternatives in Stroop-like tasks increases activity in dorsal anterior cingulate cortex (ACC), suggesting that the ACC is involved in cognitive control. However, the exact nature of ACC function is still under debate. The prevailing conflict detection hypothesis maintains that the ACC is involved in performance monitoring. According to this view, ACC activity reflects the detection of response conflict and acts as a signal that engages regulative processes subserved by lateral prefrontal brain regions. Here, we provide evidence from functional MRI that challenges this view and favors an alternative view, according to which the ACC has a role in regulation itself. Using an arrow-word Stroop task, subjects responded to incongruent, congruent, and neutral stimuli. A critical prediction made by the conflict detection hypothesis is that ACC activity should be increased only when conflicting response alternatives are present. Our data show that ACC responses are larger for neutral than for congruent stimuli, in the absence of response conflict. This result demonstrates the engagement of the ACC in regulation itself. A computational model of Stroop-like performance instantiating a version of the regulative hypothesis is shown to account for our findings.

Use patterns among early adopters of adaptive cruise control.

PubMed

Xiong, Huimin; Boyle, Linda Ng; Moeckli, Jane; Dow, Benjamin R; Brown, Timothy L

2012-10-01

The objective of this study was to investigate use patterns among early adopters of adaptive cruise control (ACC). Extended use ofACC may influence a driver's behavior in the long-term, which can have unintended safety consequences. The authors examined the use of a motion-based simulator by 24 participants (15 males and 9 females). Cluster analysis was performed on drivers' use of ACC and was based on their gap settings, speed settings, number of warnings issued, and ACC disengaged. The data were then examined on the basis of driving performance measures and drivers' subjective responses to trust in ACC, understanding of system operations, and driving styles. Driving performance measures included minimum time headway, adjusted minimum time to collision, and drivers' reaction time to critical events. Three groups of drivers were observed on the basis of risky behavior, moderately risky behavior, and conservative behavior. Drivers in the conservative group stayed farther behind the lead vehicle than did drivers in the other two groups. Risky drivers responded later to critical events and had more ACC warnings issued. Safety consequences with ACC may be more prevalent in some driver groups than others. The findings suggest that these safety implications are related to trust in automation, driving styles, understanding of system operations, and personalities. Potential applications of this research include enhanced design for next-generation ACC systems and countermeasures to improve safe driving with ACC.

Biotin augments acetyl CoA carboxylase 2 gene expression in the hypothalamus, leading to the suppression of food intake in mice.

PubMed

Sone, Hideyuki; Kamiyama, Shin; Higuchi, Mutsumi; Fujino, Kaho; Kubo, Shizuka; Miyazawa, Masami; Shirato, Saya; Hiroi, Yuka; Shiozawa, Kota

2016-07-29

It is known that biotin prevents the development of diabetes by increasing the functions of pancreatic beta-cells and improving insulin sensitivity in the periphery. However, its anti-obesity effects such as anorectic effects remain to be clarified. Acetyl CoA carboxylase (ACC), a biotin-dependent enzyme, has two isoforms (ACC1 and ACC2) and serves to catalyze the reaction of acetyl CoA to malonyl CoA. In the hypothalamus, ACC2 increases the production of malonyl CoA, which acts as a satiety signal. In this study, we investigated whether biotin increases the gene expression of ACC2 in the hypothalamus and suppresses food intake in mice administered excessive biotin. Food intake was significantly decreased by biotin, but plasma regulators of appetite, including glucose, ghrelin, and leptin, were not affected. On the other hand, biotin notably accumulated in the hypothalamus and enhanced ACC2 gene expression there, but it did not change the gene expression of ACC1, malonyl CoA decarboxylase (a malonyl CoA-degrading enzyme), and AMP-activated protein kinase α-2 (an ACC-inhibitory enzyme). These findings strongly suggest that biotin potentiates the suppression of appetite by upregulating ACC2 gene expression in the hypothalamus. This effect of biotin may contribute to the prevention of diabetes by biotin treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

Acetyl-CoA carboxylase rewires cancer metabolism to allow cancer cells to survive inhibition of the Warburg effect by cetuximab.

PubMed

Luo, Jingtao; Hong, Yun; Lu, Yang; Qiu, Songbo; Chaganty, Bharat K R; Zhang, Lun; Wang, Xudong; Li, Qiang; Fan, Zhen

2017-01-01

Cetuximab inhibits HIF-1-regulated glycolysis in cancer cells, thereby reversing the Warburg effect and leading to inhibition of cancer cell metabolism. AMP-activated protein kinase (AMPK) is activated after cetuximab treatment, and a sustained AMPK activity is a mechanism contributing to cetuximab resistance. Here, we investigated how acetyl-CoA carboxylase (ACC), a downstream target of AMPK, rewires cancer metabolism in response to cetuximab treatment. We found that introduction of experimental ACC mutants lacking the AMPK phosphorylation sites (ACC1_S79A and ACC2_S212A) into head and neck squamous cell carcinoma (HNSCC) cells protected HNSCC cells from cetuximab-induced growth inhibition. HNSCC cells with acquired cetuximab resistance contained not only high levels of T172-phosphorylated AMPK and S79-phosphorylated ACC1 but also an increased level of total ACC. These findings were corroborated in tumor specimens of HNSCC patients treated with cetuximab. Cetuximab plus TOFA (an allosteric inhibitor of ACC) achieved remarkable growth inhibition of cetuximab-resistant HNSCC xenografts. Our data suggest a novel paradigm in which cetuximab-mediated activation of AMPK and subsequent phosphorylation and inhibition of ACC is followed by a compensatory increase in total ACC, which rewires cancer metabolism from glycolysis-dependent to lipogenesis-dependent. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Dissociating prefrontal circuitry in intelligence and memory: neuropsychological correlates of magnetic resonance and diffusion tensor imaging.

PubMed

Nestor, Paul G; Ohtani, Toshiyuki; Bouix, Sylvain; Hosokawa, Taiga; Saito, Yukiko; Newell, Dominick T; Kubicki, Marek

2015-12-01

We examined intelligence and memory in 25 healthy participants who had both prior magnetic resonance imaging (MRI) of gray matter volumes of medial orbital frontal cortex (mOFC) and rostral anterior cingulate cortex (rACC), along with diffusion tensor imaging (DTI) of posterior and anterior mOFC-rACC white matter microstructure, as assessed by fractional anisotropy (FA). Results showed distinct relationships between these basic structural brain parameters and higher cognition, highlighted by a highly significant correlation of left rACC gray matter volume with memory, and to a lesser extent, though still statistically significant, correlation of left posterior mOFC-rACC FA with intelligence. Regression analyses showed that left posterior mOFC-rACC connections and left rACC gray matter volume each contributed to intelligence, with left posterior mOFC-rACC FA uniquely accounting for between 20.43 and 24.99% of the variance in intelligence, in comparison to 13.54 to 17.98% uniquely explained by left rACC gray matter volume. For memory, only left rACC gray matter volume explained neuropsychological performance, uniquely accounting for a remarkably high portion of individual variation, ranging from 73.61 to 79.21%. These results pointed to differential contributions of white mater microstructure connections and gray matter volumes to individual differences in intelligence and memory, respectively.

Activity and structure of human acetyl-CoA carboxylase targeted by a specific inhibitor.

PubMed

Jang, SoRi; Gornicki, Piotr; Marjanovic, Jasmina; Bass, Ethan; Lurcotta, Toni; Rodriguez, Pedro; Austin, Jotham; Haselkorn, Robert

2018-05-17

We have studied a series of human acetyl CoA-carboxylase (ACC) 1 and ACC2 proteins with deletions and/or Ser to Ala substitutions of the known phosphorylation sites. In vitro dephosphorylation/phosphorylation experiments reveal a substantial level of phosphorylation of human ACCs produced in insect cells. Our results are consistent with AMPK phosphorylation of Ser 29, Ser 80 , Ser 1,201 and Ser 1,216 . Phosphorylation of the N-terminal regulatory domain decreases ACC1 activity, while phosphorylation of residues in the ACC central domain has no effect. Inhibition of the activity by phosphorylation is significantly more profound at citrate concentrations below 2 mM. Furthermore, deletion of the N-terminal domain facilitates structural changes induced by citrate, including conversion of ACC dimers to linear polymers. We have also identified ACC2 amino acid mutations affecting specific inhibition of the isozyme by compound CD-017-0191. They form two clusters separated by 60-90 Å: one located in the vicinity of the BC active site and the other one in the vicinity of the ACC1 phosphorylation sites in the central domain, suggesting a contribution of the interface of two ACC dimers in the polymer to the inhibitor binding site. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

24 CFR 880.507 - Default by PHA and/or owner (private-owner/PHA projects).

Code of Federal Regulations, 2011 CFR

2011-04-01

... projects). (a) Rights of Owner if PHA defaults under Agreement or Contract. The ACC, the Agreement and the... obligations to enter into the Contract. (b) Rights of HUD if PHA defaults under ACC. The ACC will provide that..., HUD will continue to pay annual contributions in accordance with the terms of the ACC and the Contract...

24 CFR 968.210 - Procedures for obtaining approval of a modernization program.

Code of Federal Regulations, 2011 CFR

2011-04-01

... of Modernization capability as defined at § 968.205. (c) ACC amendment. HUD and the PHA shall enter into an ACC amendment in order for the PHA to draw down modernization funds. The ACC amendment shall require low-income use of the housing for not less than 20 years from the date of the ACC amendment...

24 CFR 880.507 - Default by PHA and/or owner (private-owner/PHA projects).

Code of Federal Regulations, 2010 CFR

2010-04-01

... projects). (a) Rights of Owner if PHA defaults under Agreement or Contract. The ACC, the Agreement and the... obligations to enter into the Contract. (b) Rights of HUD if PHA defaults under ACC. The ACC will provide that..., HUD will continue to pay annual contributions in accordance with the terms of the ACC and the Contract...

24 CFR 968.210 - Procedures for obtaining approval of a modernization program.

Code of Federal Regulations, 2010 CFR

2010-04-01

... of Modernization capability as defined at § 968.205. (c) ACC amendment. HUD and the PHA shall enter into an ACC amendment in order for the PHA to draw down modernization funds. The ACC amendment shall require low-income use of the housing for not less than 20 years from the date of the ACC amendment...

Microwave hydrothermal transformation of amorphous calcium carbonate nanospheres and application in protein adsorption.

PubMed

Qi, Chao; Zhu, Ying-Jie; Chen, Feng

2014-03-26

Calcium carbonate and calcium phosphate are the main components of biominerals. Among all of the forms of biominerals, amorphous calcium carbonate (ACC) and amorphous calcium phosphate (ACP) are the most important forms because they play a pivotal role in the process of biomineralization and are the precursors to the crystalline polymorphs. In this work, we first synthesized ACC in vitro using adenosine 5'-triphosphate disodium salt (ATP) as the stabilizer and investigated the transformation of the ACC under microwave hydrothermal conditions, and ACC/ACP composite nanospheres and carbonated hydroxyapatite (CHA) nanospheres were successfully prepared. In this novel strategy, ATP has two main functions: it serves as the stabilizer for ACC and the phosphorus source for ACP and CHA. Most importantly, the morphology and the size of the ACC precursor can be well-preserved after microwave heating, so it provides a new method for the preparation of calcium phosphate nanostructured materials using phosphorus-containing biomolecule-stabilized ACC as the precursor. Furthermore, the as-prepared ACC/ACP composite nanospheres have excellent biocompatibility and high protein adsorption capacity, indicating that they are promising for applications in biomedical fields such as drug delivery and protein adsorption.

Autoinhibition of Ethylene Production in Citrus Peel Discs 1

PubMed Central

Riov, Joseph; Yang, Shang Fa

1982-01-01

Wound ethylene formation induced in flavede tissue of citrus fruit (Citrus paradisi MacFad. cv. Ruby Red) by slicing was almost completely inhibited by exogenous ethylene. The inhibition lasted for at least 6 hours after removal of exogenous ethylene and was then gradually relieved. The extent of inhibition was dependent upon the concentration of ethylene (1 to 10 microliters/liter) and the duration of treatment. The increase in wound ethylene production in control discs was paralleled by an increase in 1-aminocyclopropane-1-carboxylic acid (AAC) content, whereas in ethylene-treated discs there was little increase in ACC content. Application of ACC completely restored ethylene production in ethylene-pretreated discs, indicating that the conversion of ACC to ethylene is not impaired by the presence of ethylene. Thus, autoinhibition of ethylene synthesis was exerted by reducing the availability of ACC. Ethylene treatment resulted in a decrease in extractable ACC synthase activity, but this decrease was too small to account for the marked inhibition of ACC formation. The data indicate that autoinhibition of ethylene production in citrus flavede discs results from suppression of ACC formation through repression of the synthesis of ACC synthase and inhibition of its activity. PMID:16662276

Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

PubMed

Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

2016-06-01

The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

Antibody-containing cell response in lymph of sheep after intra-intestinal infusion of ovalbumin with and without DEAE-dextran.

PubMed Central

Beh, K J

1979-01-01

The output of antibody-containing cells (ACC) was monitored in efferent ileal lymph after continuous infusion of ovalbumin into the ileum of sheep with and without the adjuvant DEAE-dextran. When ovalbumin was infused at the slow rate of 5 ml/h, maximum outputs of 2.9 x 10(5) and 2.4 x 10(5 ACC/h were observed on days 9 and 16 respectively. When infused at the faster rate of 15 ml/h, peak levels of 6.9 x 10(5) and 11.7 x 10(5) ACC/h were recorded on days 10 and 16 respectively. The maximum response was substantially enhanced when ovalbumin was infused simultaneously with DEAE-dextran when a mean output of 51.7 x 10(5) ACC/h occurred on day 10. With all treatments the distribution of ACC amongst various immunoglobulin classes was similar. During the first few days of the response IgM-specific ACC predominated and later IgG1-specific ACC were most abundant. Throughout the response a substantial proportion (10-81%) of ACC in efferent ileal lymph were IgA-specific. PMID:572818

Implications of Starvation-Induced Change in Right Dorsal Anterior Cingulate Volume in Anorexia Nervosa

PubMed Central

McCormick, Laurie M.; Keel, Pamela K.; Brumm, Michael C.; Bowers, Wayne; Swayze, Victor; Andersen, Arnold; Andreasen, Nancy

2013-01-01

Objective Converging evidence suggests a role for the anterior cingulate cortex (ACC) in the pathophysiology of anorexia nervosa (AN). This study sought to determine whether ACC volume was affected by starvation in active AN and, if so, whether this had any clinical significance. Method Eighteen patients with active AN and age- and gender-matched normal controls underwent magnetic resonance imaging (MRI). Sixteen patients (89%) with AN had intelligence quotients (IQ) testing at intake, 14 (78%) had repeat MRIs after weight normalization, and 10 (56%) had outcome data at 1-year post-hospitalization. Results Right dorsal ACC volume was significantly reduced in active AN patients versus controls and was correlated with lower performance IQ. While ACC normalization occurred with weight restoration, smaller change in right dorsal ACC volume prospectively predicted relapse after treatment. Conclusion Reduced right dorsal ACC volume during active AN relates to deficits in perceptual organization and conceptual reasoning. The degree of right dorsal ACC normalization during treatment is related to outcome. PMID:18473337

Implications of starvation-induced change in right dorsal anterior cingulate volume in anorexia nervosa.

PubMed

McCormick, Laurie M; Keel, Pamela K; Brumm, Michael C; Bowers, Wayne; Swayze, Victor; Andersen, Arnold; Andreasen, Nancy

2008-11-01

Converging evidence suggests a role for the anterior cingulate cortex (ACC) in the pathophysiology of anorexia nervosa (AN). This study sought to determine whether ACC volume was affected by starvation in active AN and, if so, whether this had any clinical significance. Eighteen patients with active AN and age- and gender-matched normal controls underwent magnetic resonance imaging (MRI). Sixteen patients (89%) with AN had intelligence quotients (IQ) testing at intake, 14 (78%) had repeat MRIs after weight normalization, and 10 (56%) had outcome data at 1-year posthospitalization. Right dorsal ACC volume was significantly reduced in active AN patients versus controls and was correlated with lower performance IQ. While ACC normalization occurred with weight restoration, smaller change in right dorsal ACC volume prospectively predicted relapse after treatment. Reduced right dorsal ACC volume during active AN relates to deficits in perceptual organization and conceptual reasoning. The degree of right dorsal ACC normalization during treatment is related to outcome.

Determination of 1-aminocyclopropane-1-carboxylic acid in apple extracts by capillary electrophoresis with laser-induced fluorescence detection.

PubMed

Liu, Xin; Li, Dian-Fan; Wang, Yun; Lu, Ying-Tang

2004-12-17

A rapid and sensitive method for the determination of 1-aminocyclopropane-1-carboxylic acid (ACC) in apple tissues has been described. This method is based on the derivatization of ACC with 3-(2-furoyl)quinoline-2-carboxaldehyde (FQ), and separation and quantification of the resulting FQ-ACC derivative by capillary electrophoresis coupled to laser-induced fluorescence detection (CE-LIF). Our results indicated that ACC derivatized with FQ could be well separated from other interfering amino acids using 20 mM borate buffer (pH 9.35) containing 40 mM sodium dodecyl sulfate and 10 mM Brij 35. The linearity of ACC was determined in the range from 0.05 to 5 microM with a correlation of 0.9967. The concentration detection limit for ACC was 10 nM (signal-to-noise = 3). The sensitivity and selectivity of this described method allows the analysis of ACC in crude apple extracts without extra purification and enrichment procedure.

The dynamic organization of fungal acetyl-CoA carboxylase

NASA Astrophysics Data System (ADS)

Hunkeler, Moritz; Stuttfeld, Edward; Hagmann, Anna; Imseng, Stefan; Maier, Timm

2016-04-01

Acetyl-CoA carboxylases (ACCs) catalyse the committed step in fatty-acid biosynthesis: the ATP-dependent carboxylation of acetyl-CoA to malonyl-CoA. They are important regulatory hubs for metabolic control and relevant drug targets for the treatment of the metabolic syndrome and cancer. Eukaryotic ACCs are single-chain multienzymes characterized by a large, non-catalytic central domain (CD), whose role in ACC regulation remains poorly characterized. Here we report the crystal structure of the yeast ACC CD, revealing a unique four-domain organization. A regulatory loop, which is phosphorylated at the key functional phosphorylation site of fungal ACC, wedges into a crevice between two domains of CD. Combining the yeast CD structure with intermediate and low-resolution data of larger fragments up to intact ACCs provides a comprehensive characterization of the dynamic fungal ACC architecture. In contrast to related carboxylases, large-scale conformational changes are required for substrate turnover, and are mediated by the CD under phosphorylation control.

Neuropathic Pain Causes Pyramidal Neuronal Hyperactivity in the Anterior Cingulate Cortex.

PubMed

Zhao, Ruohe; Zhou, Hang; Huang, Lianyan; Xie, Zhongcong; Wang, Jing; Gan, Wen-Biao; Yang, Guang

2018-01-01

The anterior cingulate cortex (ACC) is thought to be important for acute pain perception as well as the development of chronic pain after peripheral nerve injury. Nevertheless, how ACC neurons respond to sensory stimulation under chronic pain states is not well understood. Here, we used an in vivo two-photon imaging technique to monitor the activity of individual neurons in the ACC of awake, head restrained mice. Calcium imaging in the dorsal ACC revealed robust somatic activity in layer 5 (L5) pyramidal neurons in response to peripheral noxious stimuli, and the degree of evoked activity was correlated with the intensity of noxious stimulation. Furthermore, the activation of ACC neurons occurred bilaterally upon noxious stimulation to either contralateral or ipsilateral hind paws. Notably, with nerve injury-induced neuropathic pain in one limb, L5 pyramidal neurons in both sides of the ACC showed enhanced activity in the absence or presence of pain stimuli. These results reveal hyperactivity of L5 pyramidal neurons in the bilateral ACC during the development of neuropathic pain.

Root respiratory burst oxidase homologue-dependent H2O2 production confers salt tolerance on a grafted cucumber by controlling Na+ exclusion and stomatal closure

PubMed Central

Niu, Mengliang; Huang, Yuan; Sun, Shitao; Sun, Jingyu; Cao, Haishun; Shabala, Sergey

2018-01-01

Abstract Plant salt tolerance can be improved by grafting onto salt-tolerant rootstocks. However, the underlying signaling mechanisms behind this phenomenon remain largely unknown. To address this issue, we used a range of physiological and molecular techniques to study responses of self-grafted and pumpkin-grafted cucumber plants exposed to 75 mM NaCl stress. Pumpkin grafting significantly increased the salt tolerance of cucumber plants, as revealed by higher plant dry weight, chlorophyll content and photochemical efficiency (Fv/Fm), and lower leaf Na+ content. Salinity stress resulted in a sharp increase in H2O2 production, reaching a peak 3 h after salt treatment in the pumpkin-grafted cucumber. This enhancement was accompanied by elevated relative expression of respiratory burst oxidase homologue (RBOH) genes RbohD and RbohF and a higher NADPH oxidase activity. However, this increase was much delayed in the self-grafted plants, and the difference between the two grafting combinations disappeared after 24 h. The decreased leaf Na+ content of pumpkin-grafted plants was achieved by higher Na+ exclusion in roots, which was driven by the Na+/H+ antiporter energized by the plasma membrane H+-ATPase, as evidenced by the higher plasma membrane H+-ATPase activity and higher transcript levels for PMA and SOS1. In addition, early stomatal closure was also observed in the pumpkin-grafted cucumber plants, reducing water loss and maintaining the plant’s hydration status. When pumpkin-grafted plants were pretreated with an NADPH oxidase inhibitor, diphenylene iodonium (DPI), the H2O2 level decreased significantly, to the level found in self-grafted plants, resulting in the loss of the salt tolerance. Inhibition of the NADPH oxidase-mediated H2O2 signaling in the root also abolished a rapid stomatal closure in the pumpkin-grafted plants. We concluded that the pumpkin-grafted cucumber plants increase their salt tolerance via a mechanism involving the root-sourced respiratory burst oxidase homologue-dependent H2O2 production, which enhances Na+ exclusion from the root and promotes an early stomatal closure. PMID:29145593

A germin-like protein with superoxide dismutase activity in pea nodules with high protein sequence identity to a putative rhicadhesin receptor.

PubMed

Gucciardo, Sébastian; Wisniewski, Jean-Pierre; Brewin, Nicholas J; Bornemann, Stephen

2007-01-01

The cDNAs encoding three germin-like proteins (PsGER1, PsGER2a, and PsGER2b) were isolated from Pisum sativum. The coding sequence of PsGER1 transiently expressed in tobacco leaves gave a protein with superoxide dismutase activity but no detectable oxalate oxidase activity according to in-gel activity stains. The transient expression of wheat germin gf-2.8 oxalate oxidase showed oxalate oxidase but no superoxide dismutase activity under the same conditions. The superoxide dismutase activity of PsGER1 was resistant to high temperature, denaturation by detergent, and high concentrations of hydrogen peroxide. In salt-stressed pea roots, a heat-resistant superoxide dismutase activity was observed with an electrophoretic mobility similar to that of the PsGER1 protein, but this activity was below the detection limit in non-stressed or H(2)O(2)-stressed pea roots. Oxalate oxidase activity was not detected in either pea roots or nodules. Following in situ hybridization in developing pea nodules, PsGER1 transcript was detected in expanding cells just proximal to the meristematic zone and also in the epidermis, but to a lesser extent. PsGER1 is the first known germin-like protein with superoxide dismutase activity to be associated with nodules. It shared protein sequence identity with the N-terminal sequence of a putative plant receptor for rhicadhesin, a bacterial attachment protein. However, its primary location in nodules suggests functional roles other than as a rhicadhesin receptor required for the first stage of bacterial attachment to root hairs.

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

A Systems Biology Study in Tomato Fruit Reveals Correlations between the Ascorbate Pool and Genes Involved in Ribosome Biogenesis, Translation, and the Heat-Shock Response

PubMed Central

Stevens, Rebecca G.; Baldet, Pierre; Bouchet, Jean-Paul; Causse, Mathilde; Deborde, Catherine; Deschodt, Claire; Faurobert, Mireille; Garchery, Cécile; Garcia, Virginie; Gautier, Hélène; Gouble, Barbara; Maucourt, Mickaël; Moing, Annick; Page, David; Petit, Johann; Poëssel, Jean-Luc; Truffault, Vincent; Rothan, Christophe

2018-01-01

Changing the balance between ascorbate, monodehydroascorbate, and dehydroascorbate in plant cells by manipulating the activity of enzymes involved in ascorbate synthesis or recycling of oxidized and reduced forms leads to multiple phenotypes. A systems biology approach including network analysis of the transcriptome, proteome and metabolites of RNAi lines for ascorbate oxidase, monodehydroascorbate reductase and galactonolactone dehydrogenase has been carried out in orange fruit pericarp of tomato (Solanum lycopersicum). The transcriptome of the RNAi ascorbate oxidase lines is inversed compared to the monodehydroascorbate reductase and galactonolactone dehydrogenase lines. Differentially expressed genes are involved in ribosome biogenesis and translation. This transcriptome inversion is also seen in response to different stresses in Arabidopsis. The transcriptome response is not well correlated with the proteome which, with the metabolites, are correlated to the activity of the ascorbate redox enzymes—ascorbate oxidase and monodehydroascorbate reductase. Differentially accumulated proteins include metacaspase, protein disulphide isomerase, chaperone DnaK and carbonic anhydrase and the metabolites chlorogenic acid, dehydroascorbate and alanine. The hub genes identified from the network analysis are involved in signaling, the heat-shock response and ribosome biogenesis. The results from this study therefore reveal one or several putative signals from the ascorbate pool which modify the transcriptional response and elements downstream. PMID:29491875

The hemibiotrophic cacao pathogen Moniliophthora perniciosa depends on a mitochondrial alternative oxidase for biotrophic development

PubMed Central

Thomazella, Daniela P T; Teixeira, Paulo José P L; Oliveira, Halley C; Saviani, Elzira E; Rincones, Johana; Toni, Isabella M; Reis, Osvaldo; Garcia, Odalys; Meinhardt, Lyndel W; Salgado, Ione; Pereira, Gonçalo A G

2012-01-01

The tropical pathogen Moniliophthora perniciosa causes witches’ broom disease in cacao. As a hemibiotrophic fungus, it initially colonizes the living host tissues (biotrophic phase), and later grows over the dead plant (necrotrophic phase). Little is known about the mechanisms that promote these distinct fungal phases or mediate the transition between them. An alternative oxidase gene (Mp-aox) was identified in the M. perniciosa genome and its expression was analyzed througout the fungal life cycle. In addition, the effects of inhibitors of the cytochrome-dependent respiratory chain (CRC) and alternative oxidase (AOX) were evaluated on the in vitro development of M. perniciosa. Larger numbers of Mp-aox transcripts were observed in the biotrophic hyphae, which accordingly showed elevated sensitivity to AOX inhibitors. More importantly, the inhibition of CRC prevented the transition from the biotrophic to the necrotrophic phase, and the combined use of a CRC and AOX inhibitor completely halted fungal growth. On the basis of these results, a novel mechanism is presented in which AOX plays a role in the biotrophic development of M. perniciosa and regulates the transition to its necrotrophic stage. Strikingly, this model correlates well with the infection strategy of animal pathogens, particularly Trypanosoma brucei, which uses AOX as a strategy for pathogenicity. PMID:22443281

An Adaptive Cross-Correlation Algorithm for Extended-Scene Shack-Hartmann Wavefront Sensing

NASA Technical Reports Server (NTRS)

Sidick, Erkin; Green, Joseph J.; Ohara, Catherine M.; Redding, David C.

2007-01-01

This viewgraph presentation reviews the Adaptive Cross-Correlation (ACC) Algorithm for extended scene-Shack Hartmann wavefront (WF) sensing. A Shack-Hartmann sensor places a lenslet array at a plane conjugate to the WF error source. Each sub-aperture lenslet samples the WF in the corresponding patch of the WF. A description of the ACC algorithm is included. The ACC has several benefits; amongst them are: ACC requires only about 4 image-shifting iterations to achieve 0.01 pixel accuracy and ACC is insensitive to both background light and noise much more robust than centroiding,

Effects of dynamic controlled atmosphere by respiratory quotient on some quality parameters and volatile profile of 'Royal Gala' apple after long-term storage.

PubMed

Both, Vanderlei; Thewes, Fabio Rodrigo; Brackmann, Auri; de Oliveira Anese, Rogerio; de Freitas Ferreira, Daniele; Wagner, Roger

2017-01-15

The effects of dynamic controlled atmosphere (DCA) storage based on chlorophyll fluorescence (DCA-CF) and respiratory quotient (DCA-RQ) on the quality and volatile profile of 'Royal Gala' apple were evaluated. DCA storage reduces ACC (1-aminocyclopropane-1-carboxylate) oxidase activity, ethylene production and respiration rate of apples stored for 9months at 1.0°C plus 7days at 20°C, resulting in higher flesh firmness, titratable acidity and lesser physiological disorders, and provided a higher proportion of healthy fruit. Storage in a regular controlled atmosphere gave higher levels of key volatiles (butyl acetate, 2-methylbutyl acetate and hexyl acetate), as compared to fruit stored under DCA-CF, but fruit stored under DCA-RQ 1.5 and RQ 2.0 also showed higher amounts of key volatile compounds, with increment in ethanol and ethyl acetate, but far below the odour threshold. Storage in DCA-CF reduces fruit ester production, especially 2-methylbutyl acetate, which is the most important component of 'Royal Gala' apple flavour. Copyright © 2016 Elsevier Ltd. All rights reserved.

miRNA regulation in the early development of barley seed

PubMed Central

2012-01-01

Background During the early stages of seed development many genes are under dynamic regulation to ensure the proper differentiation and establishment of the tissue that will constitute the mature grain. To investigate how miRNA regulation contributes to this process in barley, a combination of small RNA and mRNA degradome analyses were used to identify miRNAs and their targets. Results Our analysis identified 84 known miRNAs and 7 new miRNAs together with 96 putative miRNA target genes regulated through a slicing mechanism in grain tissues during the first 15 days post anthesis. We also identified many potential miRNAs including several belonging to known miRNA families. Our data gave us evidence for an increase in miRNA-mediated regulation during the transition between pre-storage and storage phases. Potential miRNA targets were found in various signalling pathways including components of four phytohormone pathways (ABA, GA, auxin, ethylene) and the defence response to powdery mildew infection. Among the putative miRNA targets we identified were two essential genes controlling the GA response, a GA3oxidase1 and a homolog of the receptor GID1, and a homolog of the ACC oxidase which catalyses the last step of ethylene biosynthesis. We found that two MLA genes are potentially miRNA regulated, establishing a direct link between miRNAs and the R gene response. Conclusion Our dataset provides a useful source of information on miRNA regulation during the early development of cereal grains and our analysis suggests that miRNAs contribute to the control of development of the cereal grain, notably through the regulation of phytohormone response pathways. PMID:22838835

Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

PubMed Central

My, L.; Ghandour Achkar, N.; Viala, J. P.

2015-01-01

ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator of the two opposite pathways of FA degradation and synthesis. Our results show that there are still discoveries waiting to be made in the understanding of the genetic regulation of FA synthesis, even in the very well-known bacterium E. coli. PMID:25802297

GRACE Accelerometer data transplant

NASA Astrophysics Data System (ADS)

Bandikova, T.; McCullough, C. M.; Kruizinga, G. L. H.

2017-12-01

The Gravity Recovery and Climate Experiment (GRACE) has recently celebrated its 15th anniversary. The aging of the satellites brings along new challenges for both mission operation and science data delivery. Since September 2016, the accelerometer (ACC) onboard GRACE-B has been permanently turned off in order to reduce the battery load. The absence of the information about the non-gravitational forces acting on the spacecraft dramatically decreases the accuracy of the monthly gravity field solutions. The missing GRACE-B accelerometer data, however, can be recovered from the GRACE-A accelerometer measurement with satisfactory accuracy. In the current GRACE data processing, simple ACC data transplant is used which includes only attitude and time correction. The full ACC data transplant, however, requires not only the attitude and time correction, but also modeling of the residual accelerations due to thruster firings, which is the most challenging part. The residual linear accelerations ("thruster spikes") are caused by thruster imperfections such as misalignment of thruster pair, force imbalance or differences in reaction time. The thruster spikes are one of the most dominant high-frequency signals in the ACC measurement. The shape and amplitude of the thruster spikes are unique for each thruster pair, for each firing duration (30 ms - 1000 ms), for each x,y,z component of the ACC linear acceleration, and for each spacecraft. In our approach, the thruster spike model is an analytical function obtained by inverse Laplace transform of the ACC transfer function. The model shape parameters (amplitude, width and time delay) are estimated using Least squares method. The ACC data transplant is validated for days when ACC data from both satellites were available. The fully transplanted data fits the original GRACE-B measurement very well. The full ACC data transplant results in significantly reduced high frequency noise compared to the simple ACC transplant (i.e. without thruster spike modeling). The full ACC data transplant is a promising solution, which will allow GRACE to deliver high quality science data despite the serious problems related to satellite aging.

Translational control of human acetyl-CoA carboxylase 1 mRNA is mediated by an internal ribosome entry site in response to ER stress, serum deprivation or hypoxia mimetic CoCl2.

PubMed

Damiano, Fabrizio; Testini, Mariangela; Tocci, Romina; Gnoni, Gabriele V; Siculella, Luisa

2018-04-01

Acetyl-CoA carboxylase 1 (ACC1) is a cytosolic enzyme catalyzing the rate limiting step in de novo fatty acid biosynthesis. There is mounting evidence showing that ACC1 is susceptible to dysregulation and that it is over-expressed in liver diseases associated with lipid accumulation and in several cancers. In the present study, ACC1 regulation at the translational level is reported. Using several experimental approaches, the presence of an internal ribosome entry site (IRES) has been established in the 5' untranslated region (5' UTR) of the ACC1 mRNA. Transfection experiments with the ACC1 5' UTR inserted in a dicistronic reporter vector show a remarkable increase in the downstream cistron translation, through a cap-independent mechanism. The endoplasmic reticulum (ER) stress condition and the related unfolded protein response (UPR), triggered by treatment with thapsigargin and tunicamycin, cause an increase of the cap-independent translation of ACC1 mRNA in HepG2 cells, despite the overall reduction in global protein synthesis. Other stress conditions, such as serum starvation and incubation with hypoxia mimetic agent CoCl 2 , up-regulate ACC1 expression in HepG2 cells at the translational level. Overall, these findings indicate that the presence of an IRES in the ACC1 5' UTR allows ACC1 mRNA translation in conditions that are inhibitory to cap-dependent translation. A potential involvement of the cap-independent translation of ACC1 in several pathologies, such as obesity and cancer, has been discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

Posttraumatic stress and alcohol use among veterans: Amygdala and anterior cingulate activation to emotional cues.

PubMed

Simons, Raluca M; Simons, Jeffrey S; Olson, Dawne; Baugh, Lee; Magnotta, Vincent; Forster, Gina

2016-11-01

This fMRI study tested a model of combat trauma, posttraumatic stress symptoms (PTSS), alcohol use, and behavioral and neural responses to emotional cues in 100 OIF/OEF/OND veterans. Multilevel structural equation models were tested for left and right dorsal ACC (dACC), rostral ACC (rACC), and amygdala blood-oxygen- level dependent responses during the emotional counting Stroop test and masked faces task. In the Stroop task, combat exposure moderated the effect of combat stimuli resulting in hyperactivation in the rACC and dACC. Activation in the left amygdala also increased in response to combat stimuli, but effects did not vary as a function of combat severity. In the masked faces task, activation patterns did not vary as a function of stimulus. However, at the between-person level, amygdala activation during the masked faces task was inversely associated with PTSS. In respect to behavioral outcomes, higher PTSS were associated with a stronger Stroop effect, suggesting greater interference associated with combat words. Results are consistent with the premise that combat trauma results in hyperactivation in the ACC in response to combat stimuli, and, via its effect on PTSS, is associated with deficits in cognitive performance in the presence of combat stimuli. Across tasks, predeployment drinking was inversely associated with activation in the dACC but not the rACC or amygdala. Drinking may be a buffering factor, or negatively reinforcing in part because of its effects on normalizing brain response following trauma exposure. Alternatively, drinking may undermine adaptive functioning of the dACC when responding to traumatic stress cues. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts

PubMed Central

de las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine

2016-01-01

Background The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. Methods We studied 5,238 participants from the KORA surveys S3 (1994–1995) and S4 (1999–2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000–2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. Results The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. Conclusions The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany. PMID:27732641

Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts.

PubMed

de Las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine; Mahabadi, Amir Abbas; Koenig, Wolfgang

2016-01-01

The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. We studied 5,238 participants from the KORA surveys S3 (1994-1995) and S4 (1999-2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000-2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany.

Comprehensive analysis of the MYB-NFIB gene fusion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance.

PubMed

Mitani, Yoshitsugu; Li, Jie; Rao, Pulivarthi H; Zhao, Yi-Jue; Bell, Diana; Lippman, Scott M; Weber, Randal S; Caulin, Carlos; El-Naggar, Adel K

2010-10-01

The objectives of this study were to determine the incidence of the MYB-NFIB fusion in salivary adenoid cystic carcinoma (ACC), to establish the clinicopathologic significance of the fusion, and to analyze the expression of MYB in ACCs in the context of the MYB-NFIB fusion. We did an extensive analysis involving 123 cancers of the salivary gland, including primary and metastatic ACCs, and non-ACC salivary carcinomas. MYB-NFIB fusions were identified by reverse transcriptase-PCR (RT-PCR) and sequencing of the RT-PCR products, and confirmed by fluorescence in situ hybridization. MYB RNA expression was determined by quantitative RT-PCR and protein expression was analyzed by immunohistochemistry. The MYB-NFIB fusion was detected in 28% primary and 35% metastatic ACCs, but not in any of the non-ACC salivary carcinomas analyzed. Different exons in both the MYB and NFIB genes were involved in the fusions, resulting in expression of multiple chimeric variants. Notably, MYB was overexpressed in the vast majority of the ACCs, although MYB expression was significantly higher in tumors carrying the MYB-NFIB fusion. The presence of the MYB-NFIB fusion was significantly associated (P = 0.03) with patients older than 50 years of age. No correlation with other clinicopathologic markers, factors, and survival was found. We conclude that the MYB-NFIB fusion characterizes a subset of ACCs and contributes to MYB overexpression. Additional mechanisms may be involved in MYB overexpression in ACCs lacking the MYB-NFIB fusion. These findings suggest that MYB may be a specific novel target for tumor intervention in patients with ACC. ©2010 AACR.

Inflexible Functional Connectivity of the Dorsal Anterior Cingulate Cortex in Adolescent Major Depressive Disorder.

PubMed

Ho, Tiffany C; Sacchet, Matthew D; Connolly, Colm G; Margulies, Daniel S; Tymofiyeva, Olga; Paulus, Martin P; Simmons, Alan N; Gotlib, Ian H; Yang, Tony T

2017-11-01

Recent evidence suggests that anterior cingulate cortex (ACC) maturation during adolescence contributes to or underlies the development of major depressive disorder (MDD) during this sensitive period. The ACC is a structure that sits at the intersection of several task-positive networks (eg, central executive network, CEN), which are still developing during adolescence. While recent work using seed-based approaches indicate that depressed adolescents show limited task-evoked vs resting-state connectivity (termed 'inflexibility') between the ACC and task-negative networks, no study has used network-based approaches to investigate inflexibility of the ACC in task-positive networks to understand adolescent MDD. Here, we used graph theory to compare flexibility of network-level topology in eight subregions of the ACC (spanning three task-positive networks) in 42 unmedicated adolescents with MDD and 53 well-matched healthy controls. All participants underwent fMRI scanning during resting state and a response inhibition task that robustly engages task-positive networks. Relative to controls, depressed adolescents were characterized by inflexibility in local efficiency of a key ACC node in the CEN: right dorsal anterior cingulate cortex/medial frontal gyrus (R dACC/MFG). Furthermore, individual differences in flexibility of local efficiency of R dACC/MFG significantly predicted inhibition performance, consistent with current literature demonstrating that flexible network organization affords successful cognitive control. Finally, reduced local efficiency of dACC/MFG during the task was significantly associated with an earlier age of depression onset, consistent with prior work suggesting that MDD may alter functional network development. Our results support a neurodevelopmental hypothesis of MDD wherein dysfunctional self-regulation is potentially reflected by altered ACC maturation.

Sensitivity and specificity of univariate MRI analysis of experimentally degraded cartilage under clinical imaging conditions.

PubMed

Lukas, Vanessa A; Fishbein, Kenneth W; Reiter, David A; Lin, Ping-Chang; Schneider, Erika; Spencer, Richard G

2015-07-01

To evaluate the sensitivity and specificity of classification of pathomimetically degraded bovine nasal cartilage at 3 Tesla and 37°C using univariate MRI measurements of both pure parameter values and intensities of parameter-weighted images. Pre- and posttrypsin degradation values of T1 , T2 , T2 *, magnetization transfer ratio (MTR), and apparent diffusion coefficient (ADC), and corresponding weighted images, were analyzed. Classification based on the Euclidean distance was performed and the quality of classification was assessed through sensitivity, specificity and accuracy (ACC). The classifiers with the highest accuracy values were ADC (ACC = 0.82 ± 0.06), MTR (ACC = 0.78 ± 0.06), T1 (ACC = 0.99 ± 0.01), T2 derived from a three-dimensional (3D) spin-echo sequence (ACC = 0.74 ± 0.05), and T2 derived from a 2D spin-echo sequence (ACC = 0.77 ± 0.06), along with two of the diffusion-weighted signal intensities (b = 333 s/mm(2) : ACC = 0.80 ± 0.05; b = 666 s/mm(2) : ACC = 0.85 ± 0.04). In particular, T1 values differed substantially between the groups, resulting in atypically high classification accuracy. The second-best classifier, diffusion weighting with b = 666 s/mm(2) , as well as all other parameters evaluated, exhibited substantial overlap between pre- and postdegradation groups, resulting in decreased accuracies. Classification according to T1 values showed excellent test characteristics (ACC = 0.99), with several other parameters also showing reasonable performance (ACC > 0.70). Of these, diffusion weighting is particularly promising as a potentially practical clinical modality. As in previous work, we again find that highly statistically significant group mean differences do not necessarily translate into accurate clinical classification rules. © 2014 Wiley Periodicals, Inc.

Constraints on Biogenic Emplacement of Crystalline Calcium Carbonate and Dolomite

NASA Astrophysics Data System (ADS)

Colas, B.; Clark, S. M.; Jacob, D. E.

2015-12-01

Amorphous calcium carbonate (ACC) is a biogenic precursor of calcium carbonates forming shells and skeletons of marine organisms, which are key components of the whole marine environment. Understanding carbonate formation is an essential prerequisite to quantify the effect climate change and pollution have on marine population. Water is a critical component of the structure of ACC and the key component controlling the stability of the amorphous state. Addition of small amounts of magnesium (1-5% of the calcium content) is known to promote the stability of ACC presumably through stabilization of the hydrogen bonding network. Understanding the hydrogen bonding network in ACC is fundamental to understand the stability of ACC. Our approach is to use Monte-Carlo simulations constrained by X-ray and neutron scattering data to determine hydrogen bonding networks in ACC as a function of magnesium doping. We have already successfully developed a synthesis protocol to make ACC, and have collected X-ray data, which is suitable for determining Ca, Mg and O correlations, and have collected neutron data, which gives information on the hydrogen/deuterium (as the interaction of X-rays with hydrogen is too low for us to be able to constrain hydrogen atom positions with only X-rays). The X-ray and neutron data are used to constrain reverse Monte-Carlo modelling of the ACC structure using the Empirical Potential Structure Refinement program, in order to yield a complete structural model for ACC including water molecule positions. We will present details of our sample synthesis and characterization methods, X-ray and neutron scattering data, and reverse Monte-Carlo simulations results, together with a discussion of the role of hydrogen bonding in ACC stability.

Activation of Extracellular Signal-Regulated Kinase in the Anterior Cingulate Cortex Contributes to the Induction and Expression of Affective Pain

PubMed Central

Cao, Hong; Gao, Yong-Jing; Ren, Wen-Hua; Li, Ting-Ting; Duan, Kai-Zheng; Cui, Yi-Hui; Cao, Xiao-Hua; Zhao, Zhi-Qi; Ji, Ru-Rong; Zhang, Yu-Qiu

2009-01-01

The anterior cingulate cortex (ACC) is implicated in the affective response to noxious stimuli. However, little is known about the molecular mechanisms involved. The present study demonstrated that extracellular signal-regulated kinase (ERK) activation in the ACC plays a crucial role in pain-related negative emotion. Intraplantar formalin injection produced a transient ERK activation in laminae V–VI and a persistent ERK activation in laminae II–III of the rostral ACC (rACC) bilaterally. Using formalin-induced conditioned place avoidance (F-CPA) in rats, which is believed to reflect the pain-related negative emotion, we found that blockade of ERK activation in the rACC with MEK inhibitors prevented the induction of F-CPA. Interestingly, this blockade did not affect formalin-induced two-phase spontaneous nociceptive responses and CPA acquisition induced by electric foot-shock or U69,593, an innocuous aversive agent. Upstream, NMDA receptor, adenylyl cyclase (AC) and PKA activators activated ERK in rACC slices. Consistently, intra-rACC microinjection of AC or PKA inhibitors prevented F-CPA induction. Downstream, phosphorylation of cAMP response element binding protein (CREB) was induced in the rACC by formalin injection and by NMDA, AC and PKA activators in brain slices, which was suppressed by MEK inhibitors. Furthermore, ERK also contributed to the expression of pain-related negative emotion. Thus, when rats were re-exposed to the conditioning context for retrieval of pain experience, ERK and CREB were re-activated in the rACC, and inhibiting ERK activation blocked the expression of F-CPA. All together, our results demonstrate that ERK activation in the rACC is required for the induction and expression of pain-related negative affect. PMID:19279268

Pitfalls in the diagnosis of adrenocortical tumors: a lesson from 300 consultation cases.

PubMed

Duregon, Eleonora; Volante, Marco; Bollito, Enrico; Goia, Margherita; Buttigliero, Consuelo; Zaggia, Barbara; Berruti, Alfredo; Scagliotti, Giorgio Vittorio; Papotti, Mauro

2015-12-01

The correct pathologic classification of adrenocortical carcinoma (ACC) is relevant to establish an early therapeutic strategy of this rare malignancy. The aim of the study was to assess the most frequent pitfalls in ACC diagnosis reviewing a large consecutive series of 300 cases with an original diagnosis or a clinical suspect of ACC, which were sent in consultation to our institution between 2004 and 2014. A major disagreement that significantly modified the clinical management of patients was recorded in 26 cases (9%). The most common pitfall (10 cases) was to distinguish ACC from pheochromocytoma and vice versa. Seven other cases diagnosed as ACC were reclassified as metastases from other primaries and primary adrenal soft tissue tumors (including 3 angiosarcomas). Finally, 5 adrenocortical adenomas were reclassified into carcinomas, and 4 ACCs were converted into adenomas. Minor disagreements were mostly related to the identification of ACC variants (up to 32% of cases of adrenocortical tumors in the present series). Moreover, more than 50% of ACC cases lacked Ki-67. In conclusion, our results indicate that, in the presence of a histologically suspected ACC, a special attention should be devoted to exclude metastatic and soft tissue tumors and pheochromocytoma (in this latter case with special reference to the oncocytic variant of adrenocortical tumors). Moreover, pathologists should be aware of the major role of Ki-67 in determining prognosis and in selecting patients to the most appropriate treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Dissociating response conflict and error likelihood in anterior cingulate cortex.

PubMed

Yeung, Nick; Nieuwenhuis, Sander

2009-11-18

Neuroimaging studies consistently report activity in anterior cingulate cortex (ACC) in conditions of high cognitive demand, leading to the view that ACC plays a crucial role in the control of cognitive processes. According to one prominent theory, the sensitivity of ACC to task difficulty reflects its role in monitoring for the occurrence of competition, or "conflict," between responses to signal the need for increased cognitive control. However, a contrasting theory proposes that ACC is the recipient rather than source of monitoring signals, and that ACC activity observed in relation to task demand reflects the role of this region in learning about the likelihood of errors. Response conflict and error likelihood are typically confounded, making the theories difficult to distinguish empirically. The present research therefore used detailed computational simulations to derive contrasting predictions regarding ACC activity and error rate as a function of response speed. The simulations demonstrated a clear dissociation between conflict and error likelihood: fast response trials are associated with low conflict but high error likelihood, whereas slow response trials show the opposite pattern. Using the N2 component as an index of ACC activity, an EEG study demonstrated that when conflict and error likelihood are dissociated in this way, ACC activity tracks conflict and is negatively correlated with error likelihood. These findings support the conflict-monitoring theory and suggest that, in speeded decision tasks, ACC activity reflects current task demands rather than the retrospective coding of past performance.

Insight into the molecular mechanism of yeast acetyl-coenzyme A carboxylase mutants F510I, N485G, I69E, E477R, and K73R resistant to soraphen A

NASA Astrophysics Data System (ADS)

Gao, Jian; Liang, Li; Chen, Qingqing; Zhang, Ling; Huang, Tonghui

2018-02-01

Acetyl-coenzyme A carboxylases (ACCs) is the first committed enzyme of fatty acid synthesis pathway. The inhibition of ACC is thought to be beneficial not only for diseases related to metabolism, such as type-2 diabetes, but also for infectious disease like bacterial infection disease. Soraphen A, a potent allosteric inhibitor of BC domain of yeast ACC, exhibit lower binding affinities to several yeast ACC mutants and the corresponding drug resistance mechanisms are still unknown. We report here a theoretical study of binding of soraphen A to wild type and yeast ACC mutants (including F510I, N485G, I69E, E477R, and K73R) via molecular dynamic simulation and molecular mechanics/generalized Born surface area free energy calculations methods. The calculated binding free energies of soraphen A to yeast ACC mutants are weaker than to wild type, which is highly consistent with the experimental results. The mutant F510I weakens the binding affinity of soraphen A to yeast ACC mainly by decreasing the van der Waals contributions, while the weaker binding affinities of Soraphen A to other yeast ACC mutants including N485G, I69E, E477R, and K73R are largely attributed to the decreased net electrostatic (ΔE ele + ΔG GB) interactions. Our simulation results could provide important insights for the development of more potent ACC inhibitors.

Genetic analysis of the agrocinopine catabolic region of Agrobacterium tumefaciens Ti plasmid pTiC58, which encodes genes required for opine and agrocin 84 transport.

PubMed Central

Hayman, G T; Beck von Bodman, S; Kim, H; Jiang, P; Farrand, S K

1993-01-01

The acc region, subcloned from pTiC58 of classical nopaline and agrocinopine A and B Agrobacterium tumefaciens C58, allowed agrobacteria to grow using agrocinopine B as the sole source of carbon and energy. acc is approximately 6 kb in size. It consists of at least five genes, accA through accE, as defined by complementation analysis using subcloned fragments and transposon insertion mutations of acc carried on different plasmids within the same cell. All five regions are required for agrocin 84 sensitivity, and at least four are required for agrocinopine and agrocin 84 uptake. The complementation results are consistent with the hypothesis that each of the five regions is separately transcribed. Maxicell experiments showed that the first of these genes, accA, encodes a 60-kDa protein. Analysis of osmotic shock fractions showed this protein to be located in the periplasm. The DNA sequence of the accA region revealed an open reading frame encoding a predicted polypeptide of 59,147 Da. The amino acid sequence encoded by this open reading frame is similar to the periplasmic binding proteins OppA and DppA of Escherichia coli and Salmonella typhimurium and OppA of Bacillus subtilis. Images PMID:8366042

Differential expression of ethylene biosynthesis genes in drupelets and receptacle of raspberry (Rubus idaeus).

PubMed

Fuentes, Lida; Monsalve, Liliam; Morales-Quintana, Luis; Valdenegro, Mónika; Martínez, Juan-Pablo; Defilippi, Bruno G; González-Agüero, Mauricio

2015-05-01

Red Raspberry (Rubus idaeus) is traditionally classified as non-climacteric, and the role of ethylene in fruit ripening is not clear. The available information indicates that the receptacle, a modified stem that supports the drupelets, is involved in ethylene production of ripe fruits. In this study, we report receptacle-related ethylene biosynthesis during the ripening of fruits of cv. Heritage. In addition, the expression pattern of ethylene biosynthesis transcripts was evaluated during the ripening process. The major transcript levels of 1-aminocyclopropane-1-carboxylic acid synthase (RiACS1) and 1-aminocyclopropane-1-carboxylic acid oxidase (RiACO1) were concomitant with ethylene production, increased total soluble solids (TSS) and decreased titratable acidity (TA) and fruit firmness. Moreover, ethylene biosynthesis and transcript levels of RiACS1 and RiACO1 were higher in the receptacle, sustaining the receptacle's role as a source of ethylene in regulating the ripening of raspberry. Copyright © 2015 Elsevier GmbH. All rights reserved.

Acetyl-L-carnitine supplementation to old rats partially reverts the age-related mitochondrial decay of soleus muscle by activating peroxisome proliferator-activated receptor gamma coactivator-1alpha-dependent mitochondrial biogenesis.

PubMed

Pesce, Vito; Fracasso, Flavio; Cassano, Pierluigi; Lezza, Angela Maria Serena; Cantatore, Palmiro; Gadaleta, Maria Nicola

2010-01-01

The age-related decay of mitochondrial function is a major contributor to the aging process. We tested the effects of 2-month-daily acetyl-L-carnitine (ALCAR) supplementation on mitochondrial biogenesis in the soleus muscle of aged rats. This muscle is heavily dependent on oxidative metabolism. Mitochondrial (mt) DNA content, citrate synthase activity, transcript levels of some nuclear- and mitochondrial-coded genes (cytochrome c oxidase subunit IV [COX-IV], 16S rRNA, COX-I) and of some factors involved in the mitochondrial biogenesis signaling pathway (peroxisome proliferator-activated receptor gamma [PPARgamma] coactivator-1alpha [PGC-1alpha], mitochondrial transcription factor A mitochondrial [TFAM], mitochondrial transcription factor 2B [TFB2]), as well as the protein content of PGC-1alpha were determined. The results suggest that the ALCAR treatment in old rats activates PGC-1alpha-dependent mitochondrial biogenesis, thus partially reverting the age-related mitochondrial decay.

Adrenocortical neoplasia: evolving concepts in tumorigenesis with an emphasis on adrenal cortical carcinoma variants.

PubMed

de Krijger, Ronald R; Papathomas, Thomas G

2012-01-01

Adrenocortical carcinoma (ACC) is a rare, heterogeneous malignancy with a poor prognosis. According to WHO classification 2004, ACC variants include oncocytic ACCs, myxoid ACCs and ACCs with sarcomatous areas. Herein, we provide a comprehensive review of these rare subtypes of adrenocortical malignancy and emphasize their clinicopathological features with the aim of elucidating aspects of diagnostic categorization, differential diagnostics and biological behavior. The issue of current terminology, applied to biphasic tumors with pleomorphic, sarcomatous or sarcomatoid elements arising in adrenal cortex, is also discussed. We additionally present emerging evidence concerning the adrenal cortical tumorigenesis and the putative adenoma-carcinoma sequence as well.

Age-Related DNA Methylation Changes and Neoplastic Transformation of the Human Prostate

DTIC Science & Technology

2011-07-01

Vol. 4 Issue 1 Figure 4. Methylation and expression analysis of the Sprouty1. (A) Representative program traces for Sprouty1. Gray colums represents...5’-ggt acc CCC TCC TGA GCT CAT GGT AAC CT-3’ Fwd 6 (-509) 5’-ggt acc CTT CTG GTT TGG AGC ACA GTG CAA AG-3’ Fwd 5 (-1318) 5’ggt acc AGA AGA CCT...CCC GAG GTG GAT GTT A-3’ Fwd3 (-2025) 5’-ggt acc CTG TCA ATC ACC GGG AGC-3’ Reverse (+8) 5’-gct agc AAT CCG CAC TGA ATA AAT AGT TGA C-3’. For

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Agreement between activity-monitoring devices during home rehabilitation: a substudy of the AAA STOP trial.

PubMed

Myers, Jonathan; Dupain, Mandi; Vu, Andrew; Jaffe, Alyssa; Smith, Kimberly; Fonda, Holly; Dalman, Ronald

2014-01-01

As part of a home-based rehabilitation program, 24 older adult patients (71 ± 3 years) with abdominal aortic aneurysm (AAA) disease underwent 3 days (12 awake hr/day) of activity monitoring using an accelerometer (ACC), a pedometer, and a heart rate (HR) monitor, and recorded hourly activity logs. Subjects then underwent an interview to complete a 3-day activity recall questionnaire (3-DR). Mean energy expenditure (EE) in kcals/ day for HR, ACC, and 3-DR were 1,687 ± 458, 2,068 ± 529, and 1,974 ± 491, respectively. Differences in EE were not significant between 3-DR and ACC, but HR differed from both ACC (p < .001) and 3-DR (p < .01). ACC and 3-DR had the highest agreement, with a coefficient of variation of 7.9% and r = .86. Thus, ACC provided a reasonably accurate reflection of EE based the criterion measure, an activity recall questionnaire. ACC can be effectively used to monitor EE to achieve an appropriate training stimulus during home-based cardiac rehabilitation.

Disordered amorphous calcium carbonate from direct precipitation

DOE PAGES

Farhadi Khouzani, Masoud; Chevrier, Daniel M.; Güttlein, Patricia; ...

2015-06-01

Amorphous calcium carbonate (ACC) is known to play a prominent role in biomineralization. Different studies on the structure of biogenic ACCs have illustrated that they can have distinct short-range orders. However, the origin of so-called proto-structures in synthetic and additive-free ACCs is not well understood. In the current work, ACC has been synthesised in iso-propanolic media by direct precipitation from ionic precursors, and analysed utilising a range of different techniques. The data suggest that this additive-free type of ACC does not resemble clear proto-structural motifs relating to any crystalline polymorph. This can be explained by the undefined pH value inmore » iso-propanolic media, and the virtually instantaneous precipitation. Altogether, this work suggests that aqueous systems and pathways involving pre-nucleation clusters are required for the generation of clear proto-structural features in ACC. Experiments on the ACC-to-crystalline transformation in solution with and without ethanol highlight that polymorph selection is under kinetic control, while the presence of ethanol can control dissolution re-crystallisation pathways.« less

Bronchoscopic intervention as a main treatment for tracheobronchial adenoid cystic carcinoma.

PubMed

Wang, Hongwu; Zhang, Jieli; Zhang, Nan; Li, Dongmei; Zou, Heng; Zhou, Yunzhi; Liang, Sujuan; Mao, Jiangfeng; Li, Jing

2015-06-01

Bronchial adenoid cystic carcinoma (ACC) is a rare disease with low malignancy and indolent progression. Airway obstruction caused by ACC can be resolved by endoscopic procedures. The efficacy of different techniques of bronchoscopic interventions for ACC has not been determined. From November 2004 to March 2012, ACC patients, mainly treated with different techniques of bronchoscopic interventions in our hospital, were reviewed. The study included 37 ACC patients. Five patients (13.5%) with intra-luminal type underwent bronchoscopic therapies for a median of three times (range 1-6 times). Thirty-two patients (86.5%) with mixed type underwent bronchoscopic interventions for a median of 14 times (range 4-20 times). The dyspnea index was significantly improved after the first endoscopic procedure. The overall five- and ten-year survival rate was 85.9% and 45.9%, respectively, similar to surgery-dominant treatments. The present study demonstrates that different procedures of bronchoscopic interventions, as main treatments for ACC, are as effective as surgery-dominant treatment. More prospective and multicentric studies are required to confirm these favorable results, which may influence the therapeutic strategy for ACC in the future.

AtomicChargeCalculator: interactive web-based calculation of atomic charges in large biomolecular complexes and drug-like molecules.

PubMed

Ionescu, Crina-Maria; Sehnal, David; Falginella, Francesco L; Pant, Purbaj; Pravda, Lukáš; Bouchal, Tomáš; Svobodová Vařeková, Radka; Geidl, Stanislav; Koča, Jaroslav

2015-01-01

Partial atomic charges are a well-established concept, useful in understanding and modeling the chemical behavior of molecules, from simple compounds, to large biomolecular complexes with many reactive sites. This paper introduces AtomicChargeCalculator (ACC), a web-based application for the calculation and analysis of atomic charges which respond to changes in molecular conformation and chemical environment. ACC relies on an empirical method to rapidly compute atomic charges with accuracy comparable to quantum mechanical approaches. Due to its efficient implementation, ACC can handle any type of molecular system, regardless of size and chemical complexity, from drug-like molecules to biomacromolecular complexes with hundreds of thousands of atoms. ACC writes out atomic charges into common molecular structure files, and offers interactive facilities for statistical analysis and comparison of the results, in both tabular and graphical form. Due to high customizability and speed, easy streamlining and the unified platform for calculation and analysis, ACC caters to all fields of life sciences, from drug design to nanocarriers. ACC is freely available via the Internet at http://ncbr.muni.cz/ACC.

CFD study on the effects of boundary conditions on air flow through an air-cooled condenser

NASA Astrophysics Data System (ADS)

Sumara, Zdeněk; Šochman, Michal

2018-06-01

This study focuses on the effects of boundary conditions on effectiveness of an air-cooled condenser (ACC). Heat duty of ACC is very often calculated for ideal uniform velocity field which does not correspond to reality. Therefore, this study studies the effect of wind and different landscapes on air flow through ACC. For this study software OpenFOAM was used and the flow was simulated with the use of RANS equations. For verification of numerical setup a model of one ACC cell with dimensions of platform 1.5×1.5 [m] was used. In this experiment static pressures behind fan and air flows through a model of surface of condenser for different rpm of fan were measured. In OpenFOAM software a virtual clone of this experiment was built and different meshes, turbulent models and numerical schemes were tested. After tuning up numerical setup virtual model of real ACC system was built. Influence of wind, landscape and height of ACC on air flow through ACC has been investigated.

KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.

PubMed

Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao

2015-06-15

Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.

24 CFR 941.608 - Technical processing and approval.

Code of Federal Regulations, 2011 CFR

2011-04-01

... execution an ACC amendment and/or a grant agreement. If the PHA has already executed a front-end ACC amendment, HUD will send to the PHA for execution a special ACC amendment for the mixed-finance development...

24 CFR 884.122 - Separate project requirement.

Code of Federal Regulations, 2010 CFR

2010-04-01

... separate ACC List and ACC Part I and shall be assigned a separate project number. All new construction... construction projects where: (1) The units are placed under ACC on the same date; and (2) Such consolidation is...

24 CFR 941.608 - Technical processing and approval.

Code of Federal Regulations, 2010 CFR

2010-04-01

... execution an ACC amendment and/or a grant agreement. If the PHA has already executed a front-end ACC amendment, HUD will send to the PHA for execution a special ACC amendment for the mixed-finance development...

24 CFR 884.122 - Separate project requirement.

Code of Federal Regulations, 2011 CFR

2011-04-01

... separate ACC List and ACC Part I and shall be assigned a separate project number. All new construction... construction projects where: (1) The units are placed under ACC on the same date; and (2) Such consolidation is...

Metastatic adrenal cortical carcinoma to T12 vertebrae.

PubMed

Lee, Daniel; Yanamadala, Vijay; Shankar, Ganesh M; Shin, John H

2016-05-01

We report spinal metastasis of adrenal cortical carcinoma (ACC) to the T12 vertebrae with epidural extension. ACC is a rare malignancy with poor prognosis and high rates of metastasis. However, spinal lesions of ACC are rare, and few have been reported in the literature. We discuss our management of this lesion and review the current understanding and treatment of ACC and spinal metastasis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of acid-sensing ion channels in adenoid cystic carcinomas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye Jinhai; Department of Oral and Maxillofacial Surgery, School of Stomatology, Nanjing Medical University, Research Institute of Stomatology, Nanjing 210029; Gao Jun

2007-04-20

Tissue acidosis is an important feature of tumor. The response of adenoid cystic carcinoma (ACC) cells to acidic solution was studied using whole-cell patch-clamp recording in the current study. An inward, amiloride-sensitive Na{sup +} current was identified in cultured ACC-2 cells while not in normal human salivary gland epithelial cells. Electrophysiological and pharmacological properties of the currents suggest that heteromeric acid-sensing ion channels (ASICs) containing 2a and 3 may be responsible for the proton-induced currents in the majority of ACC-2 cells. Consistent with it, analyses of RT-PCR and Western blotting demonstrated the presences of ASIC2a and 3 in ACC-2 cells.more » Furthermore, we observed the enhanced expression of ASIC2a and 3 in the sample of ACC tissues. These results indicate that the functional expression of ASICs is characteristic feature of ACC cells.« less

Expression of an estrogen-regulated variant transcript of the peroxisomal branched chain fatty acid oxidase ACOX2 in breast carcinomas.

PubMed

Bjørklund, Sunniva Stordal; Kristensen, Vessela N; Seiler, Michael; Kumar, Surendra; Alnæs, Grethe I Grenaker; Ming, Yao; Kerrigan, John; Naume, Bjørn; Sachidanandam, Ravi; Bhanot, Gyan; Børresen-Dale, Anne-Lise; Ganesan, Shridar

2015-07-17

Alternate transcripts from a single gene locus greatly enhance the combinatorial flexibility of the human transcriptome. Different patterns of exon usage have been observed when comparing normal tissue to cancers, suggesting that variant transcripts may play a role in the tumor phenotype. Ribonucleic acid-sequencing (RNA-seq) data from breast cancer samples was used to identify an intronic start variant transcript of Acyl-CoA oxidase 2, ACOX2 (ACOX2-i9). Difference in expression between Estrogen Receptor (ER) positive and ER negative patients was assessed by the Wilcoxon rank sum test, and the findings validated in The Cancer Genome Atlas (TCGA) breast cancer dataset (BRCA). ACOX2-i9 expression was also assessed in cell lines using both quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and Western blot analysis. Knock down by short hairpin RNA (shRNA) and colony formation assays were used to determine whether ACOX2-i9 expression would influence cellular fitness. The effect of ACOX2-i9 expression on patient survival was assessed by the Kaplan-Meier survival function, and association to clinical parameters was analyzed using a Fisher exact test. The expression and translation of ACOX2-i9 into a 25 kDa protein was demonstrated in HepG2 cells as well as in several breast cancer cell lines. shRNA knock down of the ACOX2-i9 variant resulted in decreased cell viability of T47D and MDA-MB 436 cells. Moreover, expression of ACOX2-i9 was shown to be estrogen regulated, being induced by propyl pyrazoletriol and inhibited by tamoxifen and fulvestrant in ER+ T47D and Mcf-7 cells, but not in the ER- MDA-MB 436 cell line. This variant transcript showed expression predominantly in ER-positive breast tumors as assessed in our initial set of 53 breast cancers and further validated in 87 tumor/normal pairs from the TCGA breast cancer dataset, and expression was associated with better outcome in ER positive patients. ACOX2-i9 is specifically enriched in ER+ breast cancers where expression of the variant is associated with improved outcome. These data identify variant ACOX2 as a potential novel therapeutic biomarker in ER+ breast tumors.

Analysis of Arabidopsis Accessions Hypersensitive to a Loss of Chloroplast Translation1[OPEN

PubMed Central

Parker, Nicole; Wang, Yixing; Meinke, David

2016-01-01

Natural accessions of Arabidopsis (Arabidopsis thaliana) differ in their ability to tolerate a loss of chloroplast translation. These differences can be attributed in part to variation in a duplicated nuclear gene (ACC2) that targets homomeric acetyl-coenzyme A carboxylase (ACCase) to plastids. This functional redundancy allows limited fatty acid biosynthesis to occur in the absence of heteromeric ACCase, which is encoded in part by the plastid genome. In the presence of functional ACC2, tolerant alleles of several nuclear genes, not yet identified, enhance the growth of seedlings and embryos disrupted in chloroplast translation. ACC2 knockout mutants, by contrast, are hypersensitive. Here we describe an expanded search for hypersensitive accessions of Arabidopsis, evaluate whether all of these accessions are defective in ACC2, and characterize genotype-to-phenotype relationships for homomeric ACCase variants identified among 855 accessions with sequenced genomes. Null alleles with ACC2 nonsense mutations, frameshift mutations, small deletions, genomic rearrangements, and defects in RNA splicing are included among the most sensitive accessions examined. By contrast, most missense mutations affecting highly conserved residues failed to eliminate ACC2 function. Several accessions were identified where sensitivity could not be attributed to a defect in either ACC2 or Tic20-IV, the chloroplast membrane channel required for ACC2 uptake. Overall, these results underscore the central role of ACC2 in mediating Arabidopsis response to a loss of chloroplast translation, highlight future applications of this system to analyzing chloroplast protein import, and provide valuable insights into the mutational landscape of an important metabolic enzyme that is highly conserved throughout eukaryotes. PMID:27707889

Leptin activates hypothalamic acetyl-CoA carboxylase to inhibit food intake

PubMed Central

Gao, Su; Kinzig, Kimberly P.; Aja, Susan; Scott, Karen A.; Keung, Wendy; Kelly, Sandra; Strynadka, Ken; Chohnan, Shigeru; Smith, Wanli W.; Tamashiro, Kellie L. K.; Ladenheim, Ellen E.; Ronnett, Gabriele V.; Tu, Yajun; Birnbaum, Morris J.; Lopaschuk, Gary D.; Moran, Timothy H.

2007-01-01

Hypothalamic fatty acid metabolism has recently been implicated in the controls of food intake and energy homeostasis. We report that intracerebroventricular (ICV) injection of leptin, concomitant with inhibiting AMP-activated kinase (AMPK), activates acetyl-CoA carboxylase (ACC), the key regulatory enzyme in fatty acid biosynthesis, in the arcuate nucleus (Arc) and paraventricular nucleus (PVN) in the hypothalamus. Arc overexpression of constitutively active AMPK prevents the Arc ACC activation in response to ICV leptin, supporting the hypothesis that AMPK lies upstream of ACC in leptin's Arc intracellular signaling pathway. Inhibiting hypothalamic ACC with 5-tetradecyloxy-2-furoic acid, a specific ACC inhibitor, blocks leptin-mediated decreases in food intake, body weight, and mRNA level of the orexigenic neuropeptide NPY. These results show that hypothalamic ACC activation makes an important contribution to leptin's anorectic effects. Furthermore, we find that ICV leptin up-regulates the level of malonyl-CoA (the intermediate of fatty acid biosynthesis) specifically in the Arc and increases the level of palmitoyl-CoA (a major product of fatty acid biosynthesis) specifically in the PVN. The rises of both levels are blocked by 5-tetradecyloxy-2-furoic acid along with the blockade of leptin-mediated hypophagia. These data suggest malonyl-CoA as a downstream mediator of ACC in leptin's signaling pathway in the Arc and imply that palmitoyl-CoA, instead of malonyl-CoA, could be an effector in relaying ACC signaling in the PVN. Together, these findings highlight site-specific impacts of hypothalamic ACC activation in leptin's anorectic signaling cascade. PMID:17956983

Theta-frequency phase-locking of single anterior cingulate cortex neurons and synchronization with the medial thalamus are modulated by visceral noxious stimulation in rats.

PubMed

Wang, J; Cao, B; Yu, T R; Jelfs, B; Yan, J; Chan, R H M; Li, Y

2015-07-09

The rodent anterior cingulate cortex (ACC) is critical for visceral pain and pain-related aversive response in chronic visceral hypersensitive (VH) state. Long-term potentiation (LTP), induced by theta burst stimulation (TBS) in the medial thalamus (MT)-ACC pathway, is blocked in VH rats. However, the neuronal intrinsic firing characteristics and the MT-ACC connectivity have not been investigated in visceral pain. Using repetitive distension of the colon and rectum (rCRD) as a sensitization paradigm, we have identified that the spontaneous firing rates of ACC neurons and the CRD-stimulated neuronal firings were increased after repetitive visceral noxious stimulation. This correlates with increases in visceral pain responses (visceromotor responses, VMRs). Two multichannel arrays of electrodes were implanted in the MT and ACC. Recordings were performed in free-moving rats before and after repeated CRD treatment. Power spectral density analysis showed that the local field potential (LFP) recorded in the ACC displayed increases in theta band power (4-10 Hz) that were modulated by rCRD. Neural spike activity in the ACC becomes synchronized with ongoing theta oscillations of LFP. Furthermore, cross correlation analysis showed augmented synchronization of thalamo-ACC theta band LFPs, which was consistent with an increase of neuronal communication between the two regions. In conclusion, these results reveal theta oscillations and theta-frequency phase-locking as prominent features of neural activity in the ACC and a candidate neural mechanism underlying acute visceral pain. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Acute Radiation Hypotension in the Rabbit: a Model for the Human Radiation Shock Syndrome.

NASA Astrophysics Data System (ADS)

Makale, Milan Theodore

This study has shown that total body irradiation (TBI) of immature (40 to 100 day old) rabbits leads to an acute fall in mean arterial pressure (MAP) 30 to 90 minutes after exposure, which takes no more than about three minutes, and often results in pressures which are less than 50% of the lowest pre-exposure MAP. This is termed acute cardiovascular collapse (ACC). ACC is often accompanied by ECG T-wave elevation, a sharp rise in ear temperature, labored breathing, pupillary constriction, bladder emptying, and loss of abdominal muscle tone. About 73% of 40 to 100 day rabbits exhibit ACC; the others and most older rabbits display gradual pressure reductions (deliberate hypotension) which may be profound, and which may be accompanied by the same changes associated with ACC. ACC and deliberate hypotension occurred in rabbits cannulated in the dorsal aorta, and in non-operated animals. The decline in MAP for all 40 to 100 day cannulated rabbits (deliberate and ACC responders) is 55.4%. The experiments described below only involved 40 to 100 day cannulated TBI rabbits. Heart region irradiation resulted in an average MAP decline of 29.1%, with 1/15 rabbits showing ACC. Heart shielding during TBI reduced the decline in MAP to 19%, with 1/10 rabbits experiencing ACC. These results imply that the heart region, which includes the heart, part of the lungs, neural receptors, roots of the systemic vessels, and the blood, is a sensitive target. Bilateral vagotomy reduced the decline in MAP to 24.9%, and abolished ACC. Atropine (6 mg/kg) reduced the frequency of ACC to 26%, and the decline in MAP to 41.4%. In 11/13 rabbits the voltage generated by left vagal transmission rose after TBI. The vagi appear to participate in radiation hypotension. Heart shielding together with bilateral vagotomy reduced the decline in MAP to only 9.9%, with no ACC responders. The mean right ventricular pressure (MRVP) rose after TBI in 8/10 rabbits. In animals which displayed either ACC or steep deliberate hypotension, the MRVP rose sharply prior to the rapid decline in MAP. This suggests that the pulmonary blood flow was impeded, possibly causing right heart failure (cor pulmonale), and consequent cardiovascular collapse.

Comparison of the Surgical Outcomes of Dorsal Augmentation Using Expanded Polytetrafluoroethylene or Autologous Costal Cartilage.

PubMed

Joo, Yeon Hee; Jang, Yong Ju

2016-09-01

Dorsal augmentation material includes alloplastic implants and autologous tissues. However, there has been no comparison to date of dorsal augmentation using different materials performed by the same surgeon. To compare the aesthetic outcomes and complications of dorsal augmentation using expanded polytetrafluoroethylene (ePTFE) and autologous costal cartilage (ACC) in rhinoplasty. A retrospective review of the medical records of 244 patients who underwent dorsal augmentation performed by the same surgeon at the Asan Medical Center using ePTFE or ACC from March 1, 2003, through September 31, 2015. Patient demographics and surgical procedures were analyzed. The aesthetic outcomes were scored from 1 (worst) to 4 (best) by 3 otolaryngologists. Changes in dorsal height and radix height were measured by comparing preoperative and postoperative profile views. Postoperative complications were also evaluated. A total of 244 patients who underwent augmentation rhinoplasty were reviewed in this study, including 141 men (57.8%) and 103 women (42.2%). The ePTFE group included 176 patients, and the ACC group comprised 68 patients. In the ePTFE and ACC groups, 96 patients (54.5%) and 45 patients (66.2%) were male, respectively. The patient ages ranged from 11 to 69 years, with a mean (SD) age of 30.3 (11.49) years in the ePTFE group and 36.04 (12.65) years in the ACC group. The mean (SD) aesthetic outcome scores were comparable between the 2 groups: 2.99 (0.05) in the ePTFE group and 2.99 (0.06) in the ACC group (P = .93). The change of dorsal (2.64% in ePTFE group and 5.82% in ACC group) and radix (3.62% in ePTFE group and 3.77% in ACC group) heights were significantly increased after augmentation in both groups (P < .001) even though the dorsal height of the ACC group after augmentation showed a significantly greater increase compared to the ePTFE group (P < .001). However, the complication rate was significantly higher in the ACC group: 4.0% in ePTFE group and 11.8% in ACC group (P = .02). Dorsal augmentation with ACC produces similar aesthetic outcomes but a higher complication rate than dorsal augmentation with ePTFE. This higher complication rate may justify the use of ePTFE implants for dorsal augmentation in Asian patients undergoing rhinoplasty. 3.

Mechanism of retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops.

PubMed

Zuchegna, Candida; Aceto, Fabiana; Bertoni, Alessandra; Romano, Antonella; Perillo, Bruno; Laccetti, Paolo; Gottesman, Max E; Avvedimento, Enrico V; Porcellini, Antonio

2014-01-01

Histone methylation changes and formation of chromatin loops involving enhancers, promoters and 3' end regions of genes have been variously associated with active transcription in eukaryotes. We have studied the effect of activation of the retinoic A receptor, at the RARE-promoter chromatin of CASP9 and CYP26A1 genes, 15 and 45 min following RA exposure, and we found that histone H3 lysines 4 and 9 are demethylated by the lysine-specific demethylase, LSD1 and by the JMJ-domain containing demethylase, D2A. The action of the oxidase (LSD1) and a dioxygenase (JMJD2A) in the presence of Fe++ elicits an oxidation wave that locally modifies the DNA and recruits the enzymes involved in base and nucleotide excision repair (BER and NER). These events are essential for the formation of chromatin loop(s) that juxtapose the RARE element with the 5' transcription start site and the 3' end of the genes. The RARE bound-receptor governs the 5' and 3' end selection and directs the productive transcription cycle of RNA polymerase. These data mechanistically link chromatin loops, histone methylation changes and localized DNA repair with transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals.

PubMed Central

Breitenberger, C A; Browning, K S; Alzner-DeWeerd, B; RajBhandary, U L

1985-01-01

We have used RNA gel transfer hybridization, S1 nuclease mapping and primer extension to analyze transcripts derived from several genes in Neurospora crassa mitochondria. The transcripts studied include those for cytochrome oxidase subunit III, 17S rRNA and an unidentified open reading frame. In all three cases, initial transcripts are long, include tRNA sequences, and are subsequently processed to generate the mature RNAs. We find that endpoints of the most abundant transcripts generally coincide with those of tRNA sequences. We therefore conclude that tRNA sequences in long transcripts act as primary signals for RNA processing in N. crassa mitochondria. The situation is somewhat analogous to that observed in mammalian mitochondrial systems. The difference, however, is that in mammalian mitochondria, noncoding spacers between tRNA, rRNA and protein genes are very short and in many cases non-existent, allowing no room for intergenic RNA processing signals whereas, in N. crassa mtDNA, intergenic non-coding sequences are usually several hundred nucleotides long and contain highly conserved GC-rich palindromic sequences. Since these GC-rich palindromic sequences are retained in the processed mature RNAs, we conclude that they do not serve as signals for RNA processing. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2990893

Further studies of auxin and ACC induced feminization in the cucumber plant using ethylene inhibitors

NASA Technical Reports Server (NTRS)

Takahashi, H.; Jaffe, M. J.

1984-01-01

The present study was designed to establish the role of an essential hormone controlling sex expression in cucumber. A potent anti-ethylene agent, AgNO3, completely inhibited pistillate flower formation caused by IAA, ACC or ethephon. Inhibitors of ethylene biosynthesis, AVG and CoCl2 also suppressed feminization due to exogenous IAA or ACC. Though AVG also suppressed ethephon-induced feminization, this may be due to the second effect of AVG rather than the effect on ACC biosynthesis. These results confirm that ethylene is a major factor regulating feminization and that exogenous auxin induces pistillate flower formation through its stimulation of ethylene production, rather than ACC production.

Glycolytic intermediates induce amorphous calcium carbonate formation in crustaceans.

PubMed

Sato, Ai; Nagasaka, Seiji; Furihata, Kazuo; Nagata, Shinji; Arai, Isao; Saruwatari, Kazuko; Kogure, Toshihiro; Sakuda, Shohei; Nagasawa, Hiromichi

2011-04-01

It has been thought that phosphorus in biominerals made of amorphous calcium carbonate (ACC) might be related to ACC formation, but no such phosphorus-containing compounds have ever been identified. Crustaceans use ACC biominerals in exoskeleton and gastroliths so that they will have easy access to calcium carbonate inside the body before and after molting. We have identified phosphoenolpyruvate and 3-phosphoglycerate, intermediates of the glycolytic pathway, in exoskeleton and gastroliths and found them important for stabilizing ACC.

Air Force Institute of Technology Research Report 2006

DTIC Science & Technology

2006-09-30

Mitigation by Considering the Effects of Coatings , Nonequilibrium Thermodynamics and Material Failure.” Sponsor: AFRL/AFOSR/NM. Funding: $102,953...April 2005. Martinez, S.A., Sathish, S., and Mall, S., and Blodgett, M.P., " Effects of Fretting Fatigue on the Residual Stress of Shot-Peened Ti-6Al...Sponsor: ACC/OL- 0011 E8SG JTF/EN, ACC/E8SG/NG, and ACC/330 CTS. LEE, SANG H. Investigation of the Effects of Target Feature Variations

Absence of cytotoxic antibody to human immunodeficiency virus-infected cells in humans and its induction in animals after infection or immunization with purified envelope glycoprotein gp120

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nara, P.L.; Robey, W.G.; Gonda, M.A.

1987-06-01

The presence of antibody-dependent complement-mediated cytotoxicity (ACC) was assessed in humans and chimpanzees, which are capable of infection with human immunodeficiency virus isolate HTLV-IIIb, and examined in the goat after immunization with the major viral glycoprotein (gp120) of HTLV-IIIb. In infected humans no antibody mediating ACC was observed regardless of the status of disease. Even healthy individuals with high-titer, broadly reactive, neutralizing antibodies has no ACC. In contrast, chimpanzees infected with HTLV-IIIb, from whom virus could be isolated, not only had neutralizing antibody but also antibodies broadly reactive in ACC, even against distantly related human immunodeficiency virus isolates, as wellmore » as against their own reisolated virus. In the goat, the gp120 of HTLV-IIIb induced a highly type-specific response as measured by both ACC and flow cytofluorometry of live infected H9 cells. Normal human cells were not subject to ACC by animal anti-HTLV-III gp120-specific sera. Induction of ACC and neutralizing antibody were closely correlated in the animal experimental models but not in humans. The presence of ACC in gp120-inoculated goats and HTLV-III-infected chimpanzees represent a qualitative difference that may be important in the quest for the elicitation of a protective immunity in humans.« less

TP53 alterations in pancreatic acinar cell carcinoma: new insights into the molecular pathology of this rare cancer.

PubMed

La Rosa, Stefano; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Furlan, Daniela; Sahnane, Nora; Vanoli, Alessandro; Albarello, Luca; Zhang, Lizhi; Notohara, Kenji; Casnedi, Selenia; Chenard, Marie-Pierre; Adsay, Volkan; Asioli, Sofia; Capella, Carlo; Sessa, Fausto

2016-03-01

The molecular alterations of pancreatic acinar cell carcinomas (ACCs) are poorly understood and have been reported as being different from those in ductal adenocarcinomas. Loss of TP53 gene function in the pathogenesis of ACCs is controversial since contradictory findings have been published. A comprehensive analysis of the different possible genetic and epigenetic mechanisms leading to TP53 alteration in ACC has never been reported and hence the role of TP53 in the pathogenesis and/or progression of ACC remains unclear. We investigated TP53 alterations in 54 tumor samples from 44 patients, including primary and metastatic ACC, using sequencing analysis, methylation-specific multiplex ligation probe amplification, fluorescence in situ hybridization, and immunohistochemistry. TP53 mutations were found in 13 % of primary ACCs and in 31 % of metastases. Primary ACCs and metastases showed the same mutational profile, with the exception of one case, characterized by a wild-type sequence in the primary carcinoma and a mutation in the corresponding metastasis. FISH analysis revealed deletion of the TP53 region in 53 % of primary ACCs and in 50 % of metastases. Promoter hypermethylation was found in one case. The molecular alterations correlated well with the immunohistochemical findings. A statistically significant association was found between the combination of mutation of one allele and loss of the other allele of TP53 and worse survival.

Trichoderma-Plant Root Colonization: Escaping Early Plant Defense Responses and Activation of the Antioxidant Machinery for Saline Stress Tolerance

PubMed Central

Brotman, Yariv; Landau, Udi; Cuadros-Inostroza, Álvaro; Takayuki, Tohge; Fernie, Alisdair R.; Chet, Ilan; Viterbo, Ada; Willmitzer, Lothar

2013-01-01

Trichoderma spp. are versatile opportunistic plant symbionts which can colonize the apoplast of plant roots. Microarrays analysis of Arabidopsis thaliana roots inoculated with Trichoderma asperelloides T203, coupled with qPCR analysis of 137 stress responsive genes and transcription factors, revealed wide gene transcript reprogramming, proceeded by a transient repression of the plant immune responses supposedly to allow root colonization. Enhancement in the expression of WRKY18 and WRKY40, which stimulate JA-signaling via suppression of JAZ repressors and negatively regulate the expression of the defense genes FMO1, PAD3 and CYP71A13, was detected in Arabidopsis roots upon Trichoderma colonization. Reduced root colonization was observed in the wrky18/wrky40 double mutant line, while partial phenotypic complementation was achieved by over-expressing WRKY40 in the wrky18 wrky40 background. On the other hand increased colonization rate was found in roots of the FMO1 knockout mutant. Trichoderma spp. stimulate plant growth and resistance to a wide range of adverse environmental conditions. Arabidopsis and cucumber (Cucumis sativus L.) plants treated with Trichoderma prior to salt stress imposition show significantly improved seed germination. In addition, Trichoderma treatment affects the expression of several genes related to osmo-protection and general oxidative stress in roots of both plants. The MDAR gene coding for monodehydroascorbate reductase is significantly up-regulated and, accordingly, the pool of reduced ascorbic acid was found to be increased in Trichoderma treated plants. 1-Aminocyclopropane-1-carboxylate (ACC)-deaminase silenced Trichoderma mutants were less effective in providing tolerance to salt stress, suggesting that Trichoderma, similarly to ACC deaminase producing bacteria, can ameliorate plant growth under conditions of abiotic stress, by lowering ameliorating increases in ethylene levels as well as promoting an elevated antioxidative capacity. PMID:23516362

Expression and methylation of microsomal triglyceride transfer protein and acetyl-CoA carboxylase are associated with fatty liver syndrome in chicken.

PubMed

Liu, Zhen; Li, Qinghe; Liu, Ranran; Zhao, Guiping; Zhang, Yonghong; Zheng, Maiqing; Cui, Huanxian; Li, Peng; Cui, Xiaoyan; Liu, Jie; Wen, Jie

2016-06-01

The typical characteristic of fatty liver syndrome (FLS) is an increased hepatic triacylglycerol content, and a sudden decline in egg production often occurs. FLS may develop into fatty liver hemorrhagic syndrome (FLHS), characterized by sudden death from hepatic rupture and hemorrhage. DNA methylation is associated with transcriptional silencing, leading to the etiology and pathogenesis of some animal diseases. The roles of DNA methylation in the genesis of FLS, however, are largely unknown. The lipogenic methyl-deficient diet (MDD) caused FLS similar to human nonalcoholic steatohepatitis (NASH). After 16 Jingxing-Huang (JXH) hens were fed MDD for 10 wk, eight exhibited FLS (designated as FLS-susceptible birds); the remainder, without FLS, served as controls (NFLS). Physiological and biochemical variables, gene expression levels, and DNA methylation were determined in the liver. The development of FLS in JXH hens was accompanied by abnormal lipid accumulation. Relative expression of acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), and microsomal triglyceride transfer protein (MTTP) were significantly up-regulated in the FLS group in comparison with the NFLS group. The transcript abundance of sterol regulatory element binding protein 1 (SREBP-1c), stearoyl-CoA desaturase (SCD), liver X receptor alpha (LXRα), peroxisome proliferator-activated receptor alpha (PPARα), and peroxisome proliferator-activated receptor gamma (PPARγ) did not differ between the two groups. Interestingly, MTTP and ACC mRNA abundance were negatively correlated with the level of promoter methylation. The extent of DNA methylation of the cytosine-guanine (CpG) sites in the SREBP-1c, FAS, PPARα, and LXRα promoter regions was also analyzed by direct sequencing but none differed between FLS and NFLS birds. Taken together, these results specify link DNA methylation to the pathogenesis of FLS in chickens. © 2016 Poultry Science Association Inc.

Reducing the risk of rear-end collisions with infrastructure-to-vehicle (I2V) integration of variable speed limit control and adaptive cruise control system.

PubMed

Li, Ye; Wang, Hao; Wang, Wei; Liu, Shanwen; Xiang, Yun

2016-08-17

Adaptive cruise control (ACC) has been investigated recently to explore ways to increase traffic capacity, stabilize traffic flow, and improve traffic safety. However, researchers seldom have studied the integration of ACC and roadside control methods such as the variable speed limit (VSL) to improve safety. The primary objective of this study was to develop an infrastructure-to-vehicle (I2V) integrated system that incorporated both ACC and VSL to reduce rear-end collision risks on freeways. The intelligent driver model was firstly modified to simulate ACC behavior and then the VSL strategy used in this article was introduced. Next, the I2V system was proposed to integrate the 2 advanced techniques, ACC and VSL. Four scenarios of no control, VSL only, ACC only, and the I2V system were tested in simulation experiments. Time exposed time to collision (TET) and time integrated time to collision (TIT), 2 surrogate safety measures derived from time to collision (TTC), were used to evaluate safety issues associated with rear-end collisions. The total travel times of each scenario were also compared. The simulation results indicated that both the VSL-only and ACC-only methods had a positive impact on reducing the TET and TIT values (reduced by 53.0 and 58.6% and 59.0 and 65.3%, respectively). The I2V system combined the advantages of both ACC and VSL to achieve the most safety benefits (reduced by 71.5 and 77.3%, respectively). Sensitivity analysis of the TTC threshold also showed that the I2V system obtained the largest safety benefits with all of the TTC threshold values. The impact of different market penetration rates of ACC vehicles in I2V system indicated that safety benefits increase with an increase in ACC proportions. Compared to VSL-only and ACC-only scenarios, this integrated I2V system is more effective in reducing rear-end collision risks. The findings of this study provide useful information for traffic agencies to implement novel techniques to improve safety on freeways.

Regulation of Na(+)/K(+)-ATPase by nuclear respiratory factor 1: implication in the tight coupling of neuronal activity, energy generation, and energy consumption.

PubMed

Johar, Kaid; Priya, Anusha; Wong-Riley, Margaret T T

2012-11-23

NRF-1 regulates mediators of neuronal activity and energy generation. NRF-1 transcriptionally regulates Na(+)/K(+)-ATPase subunits α1 and β1. NRF-1 functionally regulates mediators of energy consumption in neurons. NRF-1 mediates the tight coupling of neuronal activity, energy generation, and energy consumption at the molecular level. Energy generation and energy consumption are tightly coupled to neuronal activity at the cellular level. Na(+)/K(+)-ATPase, a major energy-consuming enzyme, is well expressed in neurons rich in cytochrome c oxidase, an important enzyme of the energy-generating machinery, and glutamatergic receptors that are mediators of neuronal activity. The present study sought to test our hypothesis that the coupling extends to the molecular level, whereby Na(+)/K(+)-ATPase subunits are regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), found recently by our laboratory to regulate all cytochrome c oxidase subunit genes and some NMDA and AMPA receptor subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutational analysis, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Atp1a1 and Atp1b1 genes but not of the Atp1a3 gene in neurons. The transcripts of Atp1a1 and Atp1b1 subunit genes were up-regulated by KCl and down-regulated by tetrodotoxin. Atp1b1 is positively regulated by NRF-1, and silencing of NRF-1 with small interference RNA blocked the up-regulation of Atp1b1 induced by KCl, whereas overexpression of NRF-1 rescued these transcripts from being suppressed by tetrodotoxin. On the other hand, Atp1a1 is negatively regulated by NRF-1. The binding sites of NRF-1 on Atp1a1 and Atp1b1 are conserved among mice, rats, and humans. Thus, NRF-1 regulates key Na(+)/K(+)-ATPase subunits and plays an important role in mediating the tight coupling between energy consumption, energy generation, and neuronal activity at the molecular level.

Perspectives on the Role and Relevance of Copper in Cardiac Disease.

PubMed

Medeiros, Denis M

2017-03-01

Cardiac hypertrophy as a result of dietary copper deficiency has been studied for 40 plus years and is the subject of this review. While connective tissue anomalies occur, a hallmark pathology is cardiac hypertrophy, increased mitochondrial biogenesis, with disruptive cristae, vacuolization of mitochondria, and deposition of lipid droplets. Electrocardiogram abnormalities have been demonstrated along with biochemical changes especially as it relates to the copper-containing enzyme cytochrome c oxidase. The master controller of mitochondrial biogenesis, PGC1-α expression and protein, along with other proteins and transcriptional factors that play a role are upregulated. Nitric oxide, vascular endothelial growth factor, and cytochrome c oxidase all may enhance the upregulation of mitochondrial biogenesis. Marginal copper intakes reveal similar pathologies in the absence of cardiac hypertrophy. Reversibility of the copper-deficient rat heart with a copper-replete diet has resulted in mixed results, depending on both the animal model used and temporal relationships. New information has revealed that copper supplementation may rescue cardiac hypertrophy induced by pressure overload.

ACC Effectiveness Review, 1999-2002.

ERIC Educational Resources Information Center

Wallace, Roslyn, Ed.

2002-01-01

These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills…

Serotonin2C receptors in the nucleus accumbens are involved in enhanced alcohol-drinking behavior

PubMed Central

Yoshimoto, Kanji; Watanabe, Yoshihisa; Tanaka, Masaki; Kimura, Minoru

2012-01-01

Dopamine and serotonin (5-HT) in the nucleus accumbens (ACC) and ventral tegmental area of the mesoaccumbens reward pathways have been implicated in the mechanisms underlying development of alcohol dependence. We used a C57BL/6J mouse model with increased voluntary alcohol-drinking behavior by exposing the mice to alcohol vapor for 20 consecutive days. In the alcohol-exposed mice, the expression of 5-HT2C receptor mRNA increased in the ACC, caudate nucleus and putamen, dorsal raphe nucleus (DRN), hippocampus and lateral hypothalamus, while the protein level of 5-HT2C receptor significantly increased in the ACC. The expression of 5-HT7 receptor mRNA increased in the ACC and DRN. Contents of 5-HT decreased in the ACC shell (ACCS) and DRN of the alcohol-exposed mice. The basal extracellular releases of dopamine (DA) and 5-HT in the ACCS increased more in the alcohol-exposed mice than in alcohol-naïve mice. The magnitude of the alcohol-induced ACCS DA and 5-HT release in the alcohol-exposed mice was increased compared with the control mice. Intraperitoneal (i.p.) administration or local injection into ACCS of the 5-HT2C receptor antagonist, SB-242084, suppressed voluntary alcohol-drinking behavior in the alcohol-exposed mice. But the i.p. administration of the 5-HT7 receptor antagonist, SB-258719, did not have significant effects on alcohol-drinking behavior in the alcohol-exposed mice. The effects of the 5-HT2C receptor antagonist were not observed in the air-exposed control mice. These results suggest that adaptations of the 5-HT system, especially the upregulation of 5-HT2C receptors in the ACCS, are involved in the development of enhanced voluntary alcohol-drinking behavior. PMID:22512261

Startup of air-cooled condensers and dry cooling towers at low temperatures of the cooling air

NASA Astrophysics Data System (ADS)

Milman, O. O.; Ptakhin, A. V.; Kondratev, A. V.; Shifrin, B. A.; Yankov, G. G.

2016-05-01

The problems of startup and performance of air-cooled condensers (ACC) and dry cooling towers (DCT) at low cooling air temperatures are considered. Effects of the startup of the ACC at sub-zero temperatures are described. Different options of the ACC heating up are analyzed, and examples of existing technologies are presented (electric heating, heating up with hot air or steam, and internal and external heating). The use of additional heat exchanging sections, steam tracers, in the DCT design is described. The need for high power in cases of electric heating and heating up with hot air is noted. An experimental stand for research and testing of the ACC startup at low temperatures is described. The design of the three-pass ACC unit is given, and its advantages over classical single-pass design at low temperatures are listed. The formation of ice plugs inside the heat exchanging tubes during the start-up of ACC and DCT at low cooling air temperatures is analyzed. Experimental data on the effect of the steam flow rate, steam nozzle distance from the heat-exchange surface, and their orientation in space on the metal temperature were collected, and test results are analyzed. It is noted that the surface temperature at the end of the heat up is almost independent from its initial temperature. Recommendations for the safe start-up of ACCs and DCTs are given. The heating flow necessary to sufficiently heat up heat-exchange surfaces of ACCs and DCTs for the safe startup is estimated. The technology and the process of the heat up of the ACC with the heating steam external supply are described by the example of the startup of the full-scale section of the ACC at sub-zero temperatures of the cooling air, and the advantages of the proposed start-up technology are confirmed.

Tone-Evoked Acoustic Change Complex (ACC) Recorded in a Sedated Animal Model.

PubMed

Presacco, Alessandro; Middlebrooks, John C

2018-05-10

The acoustic change complex (ACC) is a scalp-recorded cortical evoked potential complex generated in response to changes (e.g., frequency, amplitude) in an auditory stimulus. The ACC has been well studied in humans, but to our knowledge, no animal model has been evaluated. In particular, it was not known whether the ACC could be recorded under the conditions of sedation that likely would be necessary for recordings from animals. For that reason, we tested the feasibility of recording ACC from sedated cats in response to changes of frequency and amplitude of pure-tone stimuli. Cats were sedated with ketamine and acepromazine, and subdermal needle electrodes were used to record electroencephalographic (EEG) activity. Tones were presented from a small loudspeaker located near the right ear. Continuous tones alternated at 500-ms intervals between two frequencies or two levels. Neurometric functions were created by recording neural response amplitudes while systematically varying the magnitude of steps in frequency centered in octave frequency around 2, 4, 8, and 16 kHz, all at 75 dB SPL, or in decibel level around 75 dB SPL tested at 4 and 8 kHz. The ACC could be recorded readily under this ketamine/azepromazine sedation. In contrast, ACC could not be recorded reliably under any level of isoflurane anesthesia that was tested. The minimum frequency (expressed as Weber fractions (df/f)) or level steps (expressed in dB) needed to elicit ACC fell in the range of previous thresholds reported in animal psychophysical tests of discrimination. The success in recording ACC in sedated animals suggests that the ACC will be a useful tool for evaluation of other aspects of auditory acuity in normal hearing and, presumably, in electrical cochlear stimulation, especially for novel stimulation modes that are not yet feasible in humans.

WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana[OPEN

PubMed Central

Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi

2015-01-01

Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

Low-intensity laser irradiation at 660 nm stimulates transcription of genes involved in the electron transport chain.

PubMed

Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi

2013-02-01

Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.

Periodic variation in bile acids controls circadian changes in uric acid via regulation of xanthine oxidase by the orphan nuclear receptor PPARα.

PubMed

Kanemitsu, Takumi; Tsurudome, Yuya; Kusunose, Naoki; Oda, Masayuki; Matsunaga, Naoya; Koyanagi, Satoru; Ohdo, Shigehiro

2017-12-29

Xanthine oxidase (XOD), also known as xanthine dehydrogenase, is a rate-limiting enzyme in purine nucleotide degradation, which produces uric acid. Uric acid concentrations in the blood and liver exhibit circadian oscillations in both humans and rodents; however, the underlying mechanisms remain unclear. Here, we demonstrate that XOD expression and enzymatic activity exhibit circadian oscillations in the mouse liver. We found that the orphan nuclear receptor peroxisome proliferator-activated receptor-α (PPARα) transcriptionally activated the mouse XOD gene and that bile acids suppressed XOD transactivation. The synthesis of bile acids is known to be under the control of the circadian clock, and we observed that the time-dependent accumulation of bile acids in hepatic cells interfered with the recruitment of the co-transcriptional activator p300 to PPARα, thereby repressing XOD expression. This time-dependent suppression of PPARα-mediated transactivation by bile acids caused an oscillation in the hepatic expression of XOD, which, in turn, led to circadian alterations in uric acid production. Finally, we also demonstrated that the anti-hyperuricemic effect of the XOD inhibitor febuxostat was enhanced by administering it at the time of day before hepatic XOD activity increased. These results suggest an underlying mechanism for the circadian alterations in uric acid production and also underscore the importance of selecting an appropriate time of day for administering XOD inhibitors. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Transcriptome analyses provide insights into the difference of alkaloids biosynthesis in the Chinese goldthread (Coptis chinensis Franch.) from different biotopes.

PubMed

Chen, Hanting; Deng, Cao; Nie, Hu; Fan, Gang; He, Yang

2017-01-01

Coptis chinensis Franch., the Chinese goldthread ('Weilian' in Chinese), one of the most important medicinal plants from the family Ranunculaceae, and its rhizome has been widely used in Traditional Chinese Medicine for centuries. Here, we analyzed the chemical components and the transcriptome of the Chinese goldthread from three biotopes, including Zhenping, Zunyi and Shizhu. We built comprehensive, high-quality de novo transcriptome assemblies of the Chinese goldthread from short-read RNA-Sequencing data, obtaining 155,710 transcripts and 56,071 unigenes. More than 98.39% and 95.97% of core eukaryotic genes were found in the transcripts and unigenes respectively, indicating that this unigene set capture the majority of the coding genes. A total of 520,462, 493,718, and 507,247 heterozygous SNPs were identified in the three accessions from Zhenping, Zunyi, and Shizhu respectively, indicating high polymorphism in coding regions of the Chinese goldthread (∼1%). Chemical analyses of the rhizome identified six major components, including berberine, palmatine, coptisine, epiberberine, columbamine, and jatrorrhizine. Berberine has the highest concentrations, followed by coptisine, palmatine, and epiberberine sequentially for all the three accessions. The drug quality of the accession from Shizhu may be the highest among these accessions. Differential analyses of the transcriptome identified four pivotal candidate enzymes, including aspartate aminotransferaseprotein, polyphenol oxidase, primary-amine oxidase, and tyrosine decarboxylase, were significantly differentially expressed and may be responsible for the difference of alkaloids contents in the accessions from different biotopes.

NADPH oxidase 2-derived reactive oxygen species signal contributes to bradykinin-induced matrix metalloproteinase-9 expression and cell migration in brain astrocytes

PubMed Central

2012-01-01

Background Matrix metalloproteinase-9 (MMP-9) plays a crucial role in pathological processes of brain inflammation, injury, and neurodegeneration. Moreover, bradykinin (BK) induces the expression of several inflammatory proteins in brain astrocytes. Recent studies have suggested that increased oxidative stress is implicated in the brain inflammation and injury. However, whether BK induced MMP-9 expression mediated through oxidative stress remains virtually unknown. Herein we investigated the role of redox signals in BK-induced MMP-9 expression in rat brain astrocytes (RBA-1 cells). Results In the study, we first demonstrated that reactive oxygen species (ROS) plays a crucial role in BK-induced MMP-9 expression in cultured brain astrocytes (in vitro) and animal brain tissue (in vivo) models. Next, BK-induced MMP-9 expression is mediated through a Ca2+-mediated PKC-α linking to p47phox/NADPH oxidase 2 (Nox2)/ROS signaling pathway. Nox2-dependent ROS generation led to activation and up-regulation of the downstream transcriptional factor AP-1 (i.e. c-Fos and c-Jun), which bound to MMP-9 promoter region, and thereby turned on transcription of MMP-9 gene. Functionally, BK-induced MMP-9 expression enhanced astrocytic migration. Conclusions These results demonstrated that in RBA-1 cells, activation of AP-1 (c-Fos/c-Jun) by the PKC-α-mediated Nox2/ROS signals is essential for up-regulation of MMP-9 and cell migration enhanced by BK. PMID:23176293

Job satisfaction among academic coordinators of clinical education in physical therapy.

PubMed

Harris, M J; Fogel, M; Blacconiere, M

1987-06-01

The Academic Coordinator of Clinical Education is the physical therapy faculty member who is responsible for the clinical component of the curriculum. The responsibilities involved in the ACCE's job are such that ACCEs seem to be at risk for job dissatisfaction and burnout. The purpose of this descriptive study was to investigate the levels and patterns of job satisfaction among ACCEs in physical therapy. A questionnaire, including a 32-item job satisfaction inventory, was sent to the ACCE at each accredited entry-level education program for physical therapists and physical therapist assistants (N = 169). One hundred twelve (66.3%) responses were received and analyzed. Demographic characteristics of the respondents are reported. The results of the study showed that ACCEs, in general, expressed low levels of occupational dissatisfaction and burnout. Satisfaction with the aspects of the job involving self-esteem, achievement, and creativity seems to outweight dissatisfaction with the time available, the work load, and organizational efficiency. Those ACCEs with doctoral degrees expressed the highest levels of dissatisfaction and burnout. Those ACCEs working in entry-level master's degree programs expressed the lowest level of dissatisfaction; those in tenure-track positions expressed the lowest level of burnout. Factors contributing to job satisfaction and dissatisfaction are discussed.

Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI

PubMed Central

Zweerings, Jana; Pflieger, Eliza M.; Mathiak, Krystyna A.; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

2018-01-01

Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD. PMID:29899712

[The anaesthesia and critical care specialty and new hospital management in France: an inquiry in university and general hospitals].

PubMed

Fusciardi, J; Remérand, F; Landais, A; Brodeur, J; Journois, D; Laffon, M

2010-03-01

To know: (1) how French public services of anaesthesia and critical care (ACC) have applied the new principles of hospital management and (2) whether or not it has impacted the different components of ACC. National questionnaire at the end of 2008, i.e., after 2 years of new hospital management. Heads of ACC services in general (GH) and university hospitals (UH). Eighteen closed questions and open opinions analyzed. Comparisons of percentages (Chi(2) - Yates): linear correlation. Percentages of responses were 70% (n=51) for UH and 37% (n=146) for GH. The new management principles were mainly applied. The different clinical and academic components of the ACC specialty (ACC, emergency medicine, pain management) mainly remained associated in UH. In GH, the new management induced constant and various changes. They were mainly judged as defeating the object of the ACC speciality in GH, especially in those of lower and mild sizes. The general tendency is that the ACC specialty was able to maintain the family ties of its different components in the UH. However, this principle was not a cornerstone of the new management in the GH. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

Acetyl CoA Carboxylase Inhibition Reduces Hepatic Steatosis but Elevates Plasma Triglycerides in Mice and Humans: A Bedside to Bench Investigation.

PubMed

Kim, Chai-Wan; Addy, Carol; Kusunoki, Jun; Anderson, Norma N; Deja, Stanislaw; Fu, Xiaorong; Burgess, Shawn C; Li, Cai; Ruddy, Marcie; Chakravarthy, Manu; Previs, Steve; Milstein, Stuart; Fitzgerald, Kevin; Kelley, David E; Horton, Jay D

2017-08-01

Inhibiting lipogenesis prevents hepatic steatosis in rodents with insulin resistance. To determine if reducing lipogenesis functions similarly in humans, we developed MK-4074, a liver-specific inhibitor of acetyl-CoA carboxylase (ACC1) and (ACC2), enzymes that produce malonyl-CoA for fatty acid synthesis. MK-4074 administered to subjects with hepatic steatosis for 1 month lowered lipogenesis, increased ketones, and reduced liver triglycerides by 36%. Unexpectedly, MK-4074 increased plasma triglycerides by 200%. To further investigate, mice that lack ACC1 and ACC2 in hepatocytes (ACC dLKO) were generated. Deletion of ACCs decreased polyunsaturated fatty acid (PUFA) concentrations in liver due to reduced malonyl-CoA, which is required for elongation of essential fatty acids. PUFA deficiency induced SREBP-1c, which increased GPAT1 expression and VLDL secretion. PUFA supplementation or siRNA-mediated knockdown of GPAT1 normalized plasma triglycerides. Thus, inhibiting lipogenesis in humans reduced hepatic steatosis, but inhibiting ACC resulted in hypertriglyceridemia due to activation of SREBP-1c and increased VLDL secretion. Copyright © 2017 Elsevier Inc. All rights reserved.

Effect of adaptive cruise control systems on mixed traffic flow near an on-ramp

NASA Astrophysics Data System (ADS)

Davis, L. C.

2007-06-01

Mixed traffic flow consisting of vehicles equipped with adaptive cruise control (ACC) and manually driven vehicles is analyzed using car-following simulations. Simulations of merging from an on-ramp onto a freeway reported in the literature have not thus far demonstrated a substantial positive impact of ACC. In this paper cooperative merging for ACC vehicles is proposed to improve throughput and increase distance traveled in a fixed time. In such a system an ACC vehicle senses not only the preceding vehicle in the same lane but also the vehicle immediately in front in the other lane. Prior to reaching the merge region, the ACC vehicle adjusts its velocity to ensure that a safe gap for merging is obtained. If on-ramp demand is moderate, cooperative merging produces significant improvement in throughput (20%) and increases up to 3.6 km in distance traveled in 600 s for 50% ACC mixed flow relative to the flow of all-manual vehicles. For large demand, it is shown that autonomous merging with cooperation in the flow of all ACC vehicles leads to throughput limited only by the downstream capacity, which is determined by speed limit and headway time.

Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI.

PubMed

Zweerings, Jana; Pflieger, Eliza M; Mathiak, Krystyna A; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

2018-01-01

Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD.

HIF1α in Tumorigenesis of Adenoid Cystic Carcinoma.

PubMed

Lim, Yun-Sung; Cha, Wonjae; Park, Min-Woo; Jeong, Woo-Jin; Ahn, Soon-Hyun

2017-02-01

Tumor hypoxia induces hypoxia-inducible factor-1α (HIF1α), which can influence tumorigenesis and metastasis. We evaluated the expression of HIF1α and the effect of HIF1α inhibitors in adenoid cystic carcinoma (ACC). HIF1α expression was demonstrated in ACC cell lines (ACC2 and ACCM). The effect of HIF1α inhibitors was evaluated. A systemic metastasis model was developed. The number of metastatic pulmonary nodules were analyzed. The ACCM cell line demonstrated greater HIF1α expression and invasion than ACC2. The expression of HIF1α and invasion of ACC cells were blocked by HIF1α siRNA. HIF1α inhibitors 17-N-allylamino-17-demethoxygeldanamycin (17AAG) and echinomycin inhibited cell invasion. 17AAG inhibited metastasis in the animal model, although not statistically significantly. HIF1α siRNA and 17AAG and echinomycin blocked invasion by ACC2 and ACCM cells. 17AAG exhibited therapeutic potential for inhibition of metastasis. Our results provide positive evidence that HIF1α is a promising research pathway for therapy of ACC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Acetyl-CoA carboxylase-a as a novel target for cancer therapy.

PubMed

Wang, Chun; Rajput, Sandeep; Watabe, Kounosuke; Liao, Duan-Fang; Cao, Deliang

2010-01-01

Acetyl-CoA carboxylases (ACC) are rate-limiting enzymes in de novo fatty acid synthesis, catalyzing ATP-dependent carboxylation of acetyl-CoA to form malonyl-CoA. Malonyl-CoA is a critical bi-functional molecule, i.e., a substrate of fatty acid synthase (FAS) for acyl chain elongation (fatty acid synthesis) and an inhibitor of carnitine palmitoyltransferase I (CPT-I) for fatty acid beta-oxidation. Two ACC isoforms have been identified in mammals, i.e. ACC-alpha (ACCA, also termed ACC1) and ACC-beta (ACCB, also designated ACC2). ACC has long been used as a target for the management of metabolic diseases, such as obesity and metabolic syndrome, and various inhibitors have been developed in clinical trials. Recently, ACCA up-regulation has been recognized in multiple human cancers, promoting lipogenesis to meet the need of cancer cells for rapid growth and proliferation. Therefore, ACCA might be effective as a potent target for cancer intervention, and the inhibitors developed for the treatment of metabolic diseases would be potential therapeutic agents for cancer therapy. This review summarizes our recent findings and updates the current understanding of the ACCA with focus on cancer research.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

75 FR 39034 - Public Housing Annual Contributions Contract

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-07

... Contributions Contract (ACC) with certain requirements applicable to all project and other requirements... (General Depository Agreements); 52190-A and B (Declaration of Trust); and 52840-A (Capital Fund ACC... terms and conditions contained in an Annual Contributions Contract (ACC) with certain requirements...

U.S. DOE Office of Science Success Stories (2011)

Science.gov Websites

; Gibson, Kerry; ACC0400 2011-04-01; Thin Sheet of Diamond Has Worlds of Uses; Sagoff, Jared; ACC0399 Top -03-28; Firm Uses DOE's Fastest Supercomputer to Streamline Long-Haul Trucks; ACC0391 2011-03-28

Effect of 1-aminocyclopropane-1-carboxylic acid on the production of ethylene in senescing flowers of Ipomoea tricolor Cav

DOE Office of Scientific and Technical Information (OSTI.GOV)

Konze, J.R.; Jones, J.F.; Boller, T.

1980-10-01

Application of 1-aminocyclopropane-1-carboxylic acid (ACC) to rib segments excised from flowers of Ipomoea tricolor Cav. resulted in the formation of C/sub 2/H/sub 4/ in greater quantities than produced under natural conditions. The ability of ACC to enhance C/sub 2/H/sub 4/ production was independent of the physiological age of the tissue and its capacity to synthesize C/sub 2/H/sub 4/ without applied ACC. When ACC was fed to rib segments that had been treated with (/sup 14/C)methionine, incorporation of radioactivity into C/sub 2/H/sub 4/ was reduced by 80%. Aminoethoxyvinylglycine and aminooxyacetic acid inhibited C/sub 2/H/sub 4/ production in rib segments of I.more » tricolor but had no effect on ACC-enhanced C/sub 2/H/sub 4/ production. Protoplasts obtained from flower tissue of I. tricolor did not form C/sub 2/H/sub 4/, even when incubated with methionine or selenomethionine. They produced C/sub 2/H/sub 4/ upon incubation with ACC, however. ACC-dependent C/sub 2/H/sub 4/ production in protoplasts was inhibited by n-propyl gallate, AgCl, CoCl/sub 2/, KCN, Na/sub 2/S, and NaN/sub 3/. ACC-dependent C/sub 2/H/sub 4/ synthesis in rib segments and protoplasts was dependent on O/sub 2/, the K/sub m/ for O/sub 2/ being 1.0 to 1.4% (v/v). These results confirm the following pathway for C/sub 2/H/sub 4/ biosynthesis in I. tricolor: methionine (selenomethionine) ..-->..S-adenosylmethionine (selenoadenosylmethionine) ..-->.. ACC ..-->.. C/sub 2/H/sub 4/.« less

Development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS): An observation-based tool for assessing cognitive behavioral therapy competence.

PubMed

Muse, Kate; McManus, Freda; Rakovshik, Sarah; Thwaites, Richard

2017-05-01

This article outlines the development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS) rating scale. The ACCS aims to provide a novel assessment framework to deliver formative and summative feedback regarding therapists' performance within observed cognitive-behavioral treatment sessions, and for therapists to rate and reflect on their own performance. Findings from 3 studies are outlined: (a) a feedback study (n = 66) examining content validity, face validity and usability; (b) a focus group (n = 9) evaluating usability and utility; and (c) an evaluation of the psychometric properties of the ACCS in real world cognitive behavioral therapy (CBT) training and routine clinical practice contexts. Results suggest that the ACCS has good face validity, content validity, and usability and provides a user-friendly tool that is useful for promoting self-reflection and providing formative feedback. Scores on both the self and assessor-rated versions of the ACCS demonstrate good internal consistency, interrater reliability, and discriminant validity. In addition, ACCS scores were found to be correlated with, but distinct from, the Revised Cognitive Therapy Scale (CTS-R) and were comparable to CTS-R scores in terms of internal consistency and discriminant validity. In addition, the ACCS may have advantages over the CTS-R in terms of interrater reliability of scores. The studies also provided insight into areas for refinement and a number of modifications were undertaken to improve the scale. In summary, the ACCS is an appropriate and useful measure of CBT competence that can be used to promote self-reflection and provide therapists with formative and summative feedback. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Conflict-related anterior cingulate functional connectivity is associated with past suicidal ideation and behavior in recent-onset schizophrenia.

PubMed

Minzenberg, Michael J; Lesh, Tyler; Niendam, Tara; Yoon, Jong H; Cheng, Yaoan; Rhoades, Remy; Carter, Cameron S

2015-06-01

Suicide is highly prevalent in schizophrenia (SZ), yet it remains unclear how suicide risk factors such as past suicidal ideation or behavior relate to brain function. Circuits modulated by the prefrontal cortex (PFC) are altered in SZ, including in dorsal anterior cingulate cortex (dACC) during conflict-monitoring (an important component of cognitive control), and dACC changes are observed in post-mortem studies of heterogeneous suicide victims. We tested whether conflict-related dACC functional connectivity is associated with past suicidal ideation and behavior in SZ. 32 patients with recent-onset of DSM-IV-TR-defined SZ were evaluated with the Columbia Suicide Severity Rating Scale and functional MRI during cognitive control (AX-CPT) task performance. Group-level regression models relating past history of suicidal ideation or behavior to dACC-seeded functional connectivity during conflict-monitoring controlled for severity of depression, psychosis and impulsivity. Past suicidal ideation was associated with relatively higher functional connectivity of the dACC with the precuneus during conflict-monitoring. Intensity of worst-point past suicidal ideation was associated with relatively higher dACC functional connectivity in medial parietal lobe and striato-thalamic nuclei. In contrast, among those with past suicidal ideation (n = 17), past suicidal behavior was associated with lower conflict-related dACC connectivity with multiple lateral and medial PFC regions, parietal and temporal cortical regions. This study provides unique evidence that recent-onset schizophrenia patients with past suicidal ideation or behavior show altered dACC-based circuit function during conflict-monitoring. Suicidal ideation and suicidal behavior have divergent patterns of associated dACC functional connectivity, suggesting a differing pattern of conflict-related brain dysfunction with these two distinct features of suicide phenomenology. Published by Elsevier Ltd.

MYB Labeling by Immunohistochemistry Is More Sensitive and Specific for Breast Adenoid Cystic Carcinoma than MYB Labeling by FISH.

PubMed

Poling, Justin S; Yonescu, Raluca; Subhawong, Andrea P; Sharma, Rajni; Argani, Pedram; Ning, Yi; Cimino-Mathews, Ashley

2017-07-01

Breast adenoid cystic carcinoma (ACC) is a primary breast carcinoma that, like salivary gland ACC, displays the t(6;9) translocation resulting in the MYB-NFIB gene fusion and immunopositivity for MYB by immunohistochemistry (IHC). However, it is not well established whether MYB immunoreactivity or rearrangement can be used to support a diagnosis of ACC in a malignant basaloid or benign cribriform breast lesion. Whole sections of primary breast ACC (n=11), collagenous spherulosis (CS; n=7), and microglandular adenosis (MGA; n=5) and tissue microarrays containing 16 basal-like, triple-negative breast carcinomas (TNBC) were labeled for MYB by IHC and underwent MYB fluorescence in situ hybridization using a break-apart probe. Strong, diffuse nuclear MYB labeling was seen in 100% ACC compared with no cases of basal-like TNBC, CS, or MGA (P=0.0001). Any degree of nuclear MYB labeling was seen in 100% ACC compared with 54% of all other cases (P=0.007), with any labeling seen in 71% CS, 63% basal-like TNBC, and 0% MGA. MYB rearrangement was detected in 89% (8/9) of evaluable ACC compared with 4% (1/26) of all other evaluable cases (P=0.0001), with a rearrangement detected in 1 (7%; n=1/15) evaluable basal-like TNBC. Strong, diffuse nuclear labeling for MYB is more sensitive than MYB fluorescence in situ hybridization for breast ACC and can be used to support a diagnosis of ACC in a cribriform or basaloid lesion in the breast. However, weak and focal labeling should be interpreted with caution as it can be seen in other benign cribriform and malignant basaloid lesions.

Therapeutic inhibition of the MDM2-p53 interaction prevents recurrence of adenoid cystic carcinomas

PubMed Central

Nör, Felipe; Warner, Kristy A.; Zhang, Zhaocheng; Acasigua, Gerson A.; Pearson, Alexander T.; Kerk, Samuel A.; Helman, Joseph; Filho, Manoel Sant’Ana; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose Conventional chemotherapy has modest efficacy in advanced adenoid cystic carcinomas (ACC). Tumor recurrence is a major challenge in the management of ACC patients. Here, we evaluated the anti-tumor effect of a novel small molecule inhibitor of the MDM2-p53 interaction (MI-773) combined with Cisplatin in patient-derived xenograft (PDX) ACC tumors. Experimental design Therapeutic strategies with MI-773 and/or Cisplatin were evaluated in SCID mice harboring PDX ACC tumors (UM-PDX-HACC-5) and in low passage primary human ACC cells (UM-HACC-2A, -2B, -5, -6) in vitro. The effect of therapy on the fraction of cancer stem cells was determined by flow cytometry for ALDH activity and CD44 expression. Results Combined therapy with MI-773 with Cisplatin caused p53 activation, induction of apoptosis, and regression of ACC PDX tumors. Western blots revealed induction of MDM2, p53 and downstream p21 expression, and regulation of apoptosis-related proteins PUMA, BAX, Bcl-2, Bcl-xL and active Caspase-9 upon MI-773 treatment. Both, single-agent MI-773, and MI-773 combined with Cisplatin, decreased the fraction of cancer stem cells in PDX ACC tumors. Notably, neoadjuvant MI-773 and surgery eliminated tumor recurrences during a post-surgical follow-up of more than 300 days. In contrast, 62.5% of mice that received vehicle control presented with palpable tumor recurrences within this time period (p=0.0097). Conclusions Collectively, these data demonstrate that therapeutic inhibition of MDM2-p53 interaction by MI-773 decreased the cancer stem cell fraction, sensitized ACC xenograft tumors to Cisplatin, and eliminated tumor recurrence. These results suggest that patients with ACC might benefit from the therapeutic inhibition of the MDM2-p53 interaction. PMID:27550999

Diffuse Staining for Activated NOTCH1 Correlates With NOTCH1 Mutation Status and Is Associated With Worse Outcome in Adenoid Cystic Carcinoma.

PubMed

Sajed, Dipti P; Faquin, William C; Carey, Chris; Severson, Eric A; H Afrogheh, Amir; A Johnson, Carl; Blacklow, Stephen C; Chau, Nicole G; Lin, Derrick T; Krane, Jeffrey F; Jo, Vickie Y; Garcia, Joaquín J; Sholl, Lynette M; Aster, Jon C

2017-11-01

NOTCH1 is frequently mutated in adenoid cystic carcinoma (ACC). To test the idea that immunohistochemical (IHC) staining can identify ACCs with NOTCH1 mutations, we performed IHC for activated NOTCH1 (NICD1) in 197 cases diagnosed as ACC from 173 patients. NICD1 staining was positive in 194 cases (98%) in 2 major patterns: subset positivity, which correlated with tubular/cribriform histology; and diffuse positivity, which correlated with a solid histology. To determine the relationship between NICD1 staining and NOTCH1 mutational status, targeted exome sequencing data were obtained on 14 diffusely NICD1-positive ACC specimens from 11 patients and 15 subset NICD1-positive ACC specimens from 15 patients. This revealed NOTCH1 gain-of-function mutations in 11 of 14 diffusely NICD1-positive ACC specimens, whereas all subset-positive tumors had wild-type NOTCH1 alleles. Notably, tumors with diffuse NICD1 positivity were associated with significantly worse outcomes (P=0.003). To determine whether NOTCH1 activation is unique among tumors included in the differential diagnosis with ACC, we performed NICD1 IHC on a cohort of diverse salivary gland and head and neck tumors. High fractions of each of these tumor types were positive for NICD1 in a subset of cells, particularly in basaloid squamous cell carcinomas; however, sequencing of basaloid squamous cell carcinomas failed to identify NOTCH1 mutations. These findings indicate that diffuse NICD1 positivity in ACC correlates with solid growth pattern, the presence of NOTCH1 gain-of-function mutations, and unfavorable outcome, and suggest that staining for NICD1 can be helpful in distinguishing ACC with solid growth patterns from other salivary gland and head and neck tumors.

Measuring Zonal Transport Variability of the Antarctic Circumpolar Current Using GRACE Ocean Bottom Pressure

NASA Astrophysics Data System (ADS)

Makowski, J.; Chambers, D. P.; Bonin, J. A.

2012-12-01

Previous studies have suggested that ocean bottom pressure (OBP) can be used to measure the transport variability of the Antarctic Circumpolar Current (ACC). Using OBP data from the JPL ECCO model and the Gravity Recovery and Climate Experiment (GRACE), we examine the zonal transport variability of the ACC integrated between the major fronts between 2003-2010. The JPL ECCO data are used to determine average front positions for the time period studies, as well as where transport is mainly zonal. Statistical analysis will be conducted to determine the uncertainty of the GRACE observations using a simulated data set. We will also begin looking at low frequency changes and how coherent transport variability is from region to region of the ACC. Correlations with bottom pressure south of the ACC and the average basin transports will also be calculated to determine the probability of using bottom pressure south of the ACC as a means for describing the ACC dynamics and transport.

Ethylene and 1-Aminocyclopropane-1-carboxylate (ACC) in Plant–Bacterial Interactions

PubMed Central

Nascimento, Francisco X.; Rossi, Márcio J.; Glick, Bernard R.

2018-01-01

Ethylene and its precursor 1-aminocyclopropane-1-carboxylate (ACC) actively participate in plant developmental, defense and symbiotic programs. In this sense, ethylene and ACC play a central role in the regulation of bacterial colonization (rhizospheric, endophytic, and phyllospheric) by the modulation of plant immune responses and symbiotic programs, as well as by modulating several developmental processes, such as root elongation. Plant-associated bacterial communities impact plant growth and development, both negatively (pathogens) and positively (plant-growth promoting and symbiotic bacteria). Some members of the plant-associated bacterial community possess the ability to modulate plant ACC and ethylene levels and, subsequently, modify plant defense responses, symbiotic programs and overall plant development. In this work, we review and discuss the role of ethylene and ACC in several aspects of plant-bacterial interactions. Understanding the impact of ethylene and ACC in both the plant host and its associated bacterial community is key to the development of new strategies aimed at increased plant growth and protection. PMID:29520283

Driver behaviour with adaptive cruise control.

PubMed

Stanton, Neville A; Young, Mark S

2005-08-15

This paper reports on the evaluation of adaptive cruise control (ACC) from a psychological perspective. It was anticipated that ACC would have an effect upon the psychology of driving, i.e. make the driver feel like they have less control, reduce the level of trust in the vehicle, make drivers less situationally aware, but workload might be reduced and driving might be less stressful. Drivers were asked to drive in a driving simulator under manual and ACC conditions. Analysis of variance techniques were used to determine the effects of workload (i.e. amount of traffic) and feedback (i.e. degree of information from the ACC system) on the psychological variables measured (i.e. locus of control, trust, workload, stress, mental models and situation awareness). The results showed that: locus of control and trust were unaffected by ACC, whereas situation awareness, workload and stress were reduced by ACC. Ways of improving situation awareness could include cues to help the driver predict vehicle trajectory and identify conflicts.

Engineered ACC deaminase-expressing free-living cells of Mesorhizobium loti show increased nodulation efficiency and competitiveness on Lotus spp.

PubMed

Conforte, Valeria P; Echeverria, Mariela; Sánchez, Cintia; Ugalde, Rodolfo A; Menéndez, Ana B; Lepek, Viviana C

2010-08-01

Ethylene inhibits the establishment of symbiosis between rhizobia and legumes. Several rhizobia species express the enzyme ACC deaminase, which degrades the ethylene precursor 1-cyclopropane-1-carboxilate (ACC), leading to reductions in the amount of ethylene evolved by the plant. M. loti has a gene encoding ACC deaminase, but this gene is under the activity of the NifA-RpoN-dependent promoter; thus, it is only expressed inside the nodule. The M. loti structural gene ACC deaminase (acdS) was integrated into the M. loti chromosome under a constitutive promoter activity. The resulting strain induced the formation of a higher number of nodules and was more competitive than the wild-type strain on Lotus japonicus and L. tenuis. These results suggest that the introduction of the ACC deaminase activity within M. loti in a constitutive way could be a novel strategy to increase nodulation competitiveness of the bacteria, which could be useful for the forage inoculants industry.

Adenoid cystic carcinoma: current therapy and potential therapeutic advances based on genomic profiling

PubMed Central

Chae, Young Kwang; Chung, Su Yun; Davis, Andrew A.; Carneiro, Benedito A.; Chandra, Sunandana; Kaplan, Jason; Kalyan, Aparna; Giles, Francis J.

2015-01-01

Adenoid cystic carcinoma (ACC) is a rare cancer with high potential for recurrence and metastasis. Efficacy of current treatment options, particularly for advanced disease, is very limited. Recent whole genome and exome sequencing has dramatically improved our understanding of ACC pathogenesis. A balanced translocation resulting in the MYB-NFIB fusion gene appears to be a fundamental signature of ACC. In addition, sequencing has identified a number of other driver genes mutated in downstream pathways common to other well-studied cancers. Overexpression of oncogenic proteins involved in cell growth, adhesion, cell cycle regulation, and angiogenesis are also present in ACC. Collectively, studies have identified genes and proteins for targeted, mechanism-based, therapies based on tumor phenotypes, as opposed to nonspecific cytotoxic agents. In addition, although few studies in ACC currently exist, immunotherapy may also hold promise. Better genetic understanding will enable treatment with novel targeted agents and initial exploration of immune-based therapies with the goal of improving outcomes for patients with ACC. PMID:26359351

Localized microstimulation of primate pregenual cingulate cortex induces negative decision-making.

PubMed

Amemori, Ken-ichi; Graybiel, Ann M

2012-05-01

The pregenual anterior cingulate cortex (pACC) has been implicated in human anxiety disorders and depression, but the circuit-level mechanisms underlying these disorders are unclear. In healthy individuals, the pACC is involved in cost-benefit evaluation. We developed a macaque version of an approach-avoidance decision task used to evaluate anxiety and depression in humans and, with multi-electrode recording and cortical microstimulation, we probed pACC function as monkeys performed this task. We found that the macaque pACC has an opponent process-like organization of neurons representing motivationally positive and negative subjective value. Spatial distribution of these two neuronal populations overlapped in the pACC, except in one subzone, where neurons with negative coding were more numerous. Notably, microstimulation in this subzone, but not elsewhere in the pACC, increased negative decision-making, and this negative biasing was blocked by anti-anxiety drug treatment. This cortical zone could be critical for regulating negative emotional valence and anxiety in decision-making.

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

PubMed

Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

1995-07-01

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

PubMed

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Copper economy in Chlamydomonas: Prioritized allocation and reallocation of copper to respiration vs. photosynthesis

PubMed Central

Kropat, Janette; Gallaher, Sean D.; Urzica, Eugen I.; Nakamoto, Stacie S.; Strenkert, Daniela; Tottey, Stephen; Mason, Andrew Z.; Merchant, Sabeeha S.

2015-01-01

Inorganic elements, although required only in trace amounts, permit life and primary productivity because of their functions in catalysis. Every organism has a minimal requirement of each metal based on the intracellular abundance of proteins that use inorganic cofactors, but elemental sparing mechanisms can reduce this quota. A well-studied copper-sparing mechanism that operates in microalgae faced with copper deficiency is the replacement of the abundant copper protein plastocyanin with a heme-containing substitute, cytochrome (Cyt) c6. This switch, which is dependent on a copper-sensing transcription factor, copper response regulator 1 (CRR1), dramatically reduces the copper quota. We show here that in a situation of marginal copper availability, copper is preferentially allocated from plastocyanin, whose function is dispensable, to other more critical copper-dependent enzymes like Cyt oxidase and a ferroxidase. In the absence of an extracellular source, copper allocation to Cyt oxidase includes CRR1-dependent proteolysis of plastocyanin and quantitative recycling of the copper cofactor from plastocyanin to Cyt oxidase. Transcriptome profiling identifies a gene encoding a Zn-metalloprotease, as a candidate effecting copper recycling. One reason for the retention of genes encoding both plastocyanin and Cyt c6 in algal and cyanobacterial genomes might be because plastocyanin provides a competitive advantage in copper-depleted environments as a ready source of copper. PMID:25646490

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riganti, Chiara; Costamagna, Costanzo; Doublier, Sophie

We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to thosemore » observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.« less

Acute catecholamine cardiomyopathy in patients with phaeochromocytoma or functional paraganglioma.

PubMed

Giavarini, Alessandra; Chedid, Antoine; Bobrie, Guillaume; Plouin, Pierre-François; Hagège, Albert; Amar, Laurence

2013-10-01

Phaeochromocytomas and paragangliomas (PPGL) can cause acute catecholamine cardiomyopathy (ACC). We assessed the prevalence of ACC and compared the presentation of cases with and without ACC in a large series of PPGL. Single centre retrospective study. Hypertension Unit, University Hospital, Paris. 140 consecutive patients with PPGL, referred from January 2003 to September 2012. Left ventricular ejection fraction (LVEF), perioperative mortality. Fifteen patients (11%) had suffered an ACC, occurring in 14 cases before the diagnosis of PPGL. Precipitating factors were identified in 11 cases. Twelve patients presented with acute pulmonary oedema, including 10 with cardiogenic shock, requiring life support in eight cases. Seven patients (five with pulmonary oedema) presented with acute chest pain and cardiac dysfunction. Electrocardiographic abnormalities were present in 14 cases: ST segment elevation or pathological Q waves, ST segment depression, and/or diffuse T wave inversion. Six patients displayed classical (apical ballooning) or inverted (basal/mid ventricular stunning) takotsubo-like cardiomyopathy. Coronary arteries were always normal on angiography. In patients with ACC, median LVEF rose from 30% (IQR 23-33%) during ACC to 71% (50-72%) before surgery (n=11, p<0.001). Median LVEF before PPGL surgery was 65% (51-72%) and 65% (60-70%) in patients with and without a history of ACC, respectively (not significant). PPGL may present as ACC in 11% of cases, excluding patients dying from undiagnosed tumours. Left ventricular dysfunction is usually reversible before surgery. PPGL should be suspected in patients with acute heart failure without evidence of valvular or coronary artery disease.

Neural representation of cost-benefit selections in rat anterior cingulate cortex in self-paced decision making.

PubMed

Wang, Shuai; Shi, Yi; Li, Bao-Ming

2017-03-01

The anterior cingulate cortex (ACC) is crucial for decision making which involves the processing of cost-benefit information. Our previous study has shown that ACC is essential for self-paced decision making. However, it is unclear how ACC neurons represent cost-benefit selections during the decision-making process. In the present study, we trained rats on the same "Do More Get More" (DMGM) task as in our previous work. In each trial, the animals stand upright and perform a sustained nosepoke of their own will to earn a water reward, with the amount of reward positively correlated to the duration of the nosepoke (i.e., longer nosepokes earn larger rewards). We then recorded ACC neuronal activity on well-trained rats while they were performing the DMGM task. Our results show that (1) approximately 3/5 ACC neurons (296/496, 59.7%) exhibited changes in firing frequency that were temporally locked with the main events of the DMGM task; (2) about 1/5 ACC neurons (101/496, 20.4%) or 1/3 of the event-modulated neurons (101/296, 34.1%) showed differential firing rate changes for different cost-benefit selections; and (3) many ACC neurons exhibited linear encoding of the cost-benefit selections in the DMGM task events. These results suggest that ACC neurons are engaged in encoding cost-benefit information, thus represent the selections in self-paced decision making. Copyright © 2016 Elsevier Inc. All rights reserved.

Report of a case of acinic cell carcinoma of the upper lip and review of Japanese cases of acinic cell carcinoma of the minor salivary glands

PubMed Central

Ishikawa, Hitoshi; Fuyama, Shigemi; Kobayashi, Takehito; Waki, Takayoshi; Taira, Yukio; Iino, Mitsuyoshi

2016-01-01

Acinic cell carcinoma (ACC) is a malignant tumor of the salivary glands. The majority of ACCs occur in the parotid gland, and ACCs of the minor salivary glands (MSGs) are relatively infrequent. We describe here a patient with ACC of the upper lip. The patient was a 31-year-old male who presented with a nodular mass on the left upper lip. The preoperative diagnosis was benign tumor or cyst, and the lesion was surgically excised. The histological diagnosis was ACC. The postoperative course was uneventful. No recurrence or metastasis was detected at 13 months postoperatively. In addition, we retrospectively reviewed 21 reported Japanese patients with ACC of the MSGs. In 7 of the 21 patients, the preoperative diagnosis was benign tumor, and the tumors were resected without preoperative biopsy. Kaplan–Meier analysis showed that disease-free survival was worse in patients who underwent resection with a preoperative diagnosis of benign tumor than in patients who underwent resection with a preoperative diagnosis of malignant tumor. The rate of recurrence was higher for ACCs assumed to be benign lesions on a purely clinical basis, or without an accurate preoperative biopsy. ACCs of the MSGs are easy to be misdiagnosed for benign lesions such as mucous cysts or hemangiomas. Correct preoperative diagnosis and initial therapy may therefore be the most important prognostic factors. Key words:Acinic cell carcinoma, Kaplan-Meier analysis, minor salivary glands, prognosis, upper lip. PMID:27957284

Amino acid N-malonyltransferases from mung beans. Action on 1-aminocyclopropane-1-carboxylic acid and D-phenylalanine.

PubMed

Guo, L; Phillips, A T; Arteca, R N

1993-12-05

1-Aminocyclopropane-1-carboxylate (ACC) N-malonyltransferase from etiolated mung bean hypocotyls was examined for its relationship to D-phenylalanine N-malonyltransferase and other enzymes which transfer malonyl groups from malonyl-CoA to D-amino acids. Throughout a 3600-fold purification the ratio of D-phenylalanine N-malonyltransferase activity to ACC N-malonyltransferase activity was unchanged. Antibodies raised against purified ACC N-malonyltransferase 55-kDa protein were also able to precipitate all D-phenylalanine-directed activity from partially purified mung bean extracts. The irreversible inhibitors phenylglyoxal and tetranitromethane reduced malonyltransferase activity towards D-phenylalanine to the same extent as that for ACC. In addition, several other D-amino acids, particularly D-tryptophan and D-tyrosine, were able to inhibit action towards both ACC and D-phenylalanine. These lines of evidence suggest that a single enzyme is capable of promoting malonylation of both ACC and D-phenylalanine. Km values for D-phenylalanine and malonyl-CoA were found to be 48 and 43 microM, respectively; these values are 10-fold lower than the corresponding values when ACC was substrate. Coenzyme A was a noncompetitive (mixed type) product inhibitor towards malonyl-CoA at both unsaturated and saturated ACC concentrations. The enzyme was also inhibited uncompetitively at high concentrations of malonyl-CoA. We propose that the enzyme follows an Ordered Bi-Bi reaction pathway, with the amino acid substrate being bound initially.

Leaf Abscission Induced by Ethylene in Water-Stressed Intact Seedlings of Cleopatra Mandarin Requires Previous Abscisic Acid Accumulation in Roots.

PubMed Central

Gomez-Cadenas, A.; Tadeo, F. R.; Talon, M.; Primo-Millo, E.

1996-01-01

The involvement of abscisic acid (ABA) in the process of leaf abscission induced by 1-aminocyclopropane-1-carboxylic acid (ACC) transported from roots to shoots in Cleopatra mandarin (Citrus reshni Hort. ex Tan.) seedlings grown under water stress was studied using norflurazon (NF). Water stress induced both ABA (24-fold) and ACC (16-fold) accumulation in roots and arrested xylem flow. Leaf bulk ABA also increased (8-fold), although leaf abscission did not occur. Shortly after rehydration, root ABA and ACC returned to their prestress levels, whereas sharp and transitory increases of ACC (17-fold) and ethylene (10-fold) in leaves and high percentages of abscission (up to 47%) were observed. NF suppressed the ABA and ACC accumulation induced by water stress in roots and the sharp increases of ACC and ethylene observed after rewatering in leaves. NF also reduced leaf abscission (7-10%). These results indicate that water stress induces root ABA accumulation and that this is required for the process of leaf abscission to occur. It was also shown that exogenous ABA increases ACC levels in roots but not in leaves. Collectively, the data suggest that ABA, the primary sensitive signal to water stress, modulates the levels of ethylene, which is the hormonal activator of leaf abscission. This assumption implies that root ACC levels are correlated with root ABA amounts in a dependent way, which eventually links water status to an adequate, protective response such as leaf abscission. PMID:12226398

Identification of arsenic resistant endophytic bacteria from Pteris vittata roots and characterization for arsenic remediation application.

PubMed

Tiwari, Sarita; Sarangi, Bijaya Ketan; Thul, Sanjog T

2016-09-15

Mitigation of arsenic (As) pollution is a topical environmental issue of high R&D priority. The present investigation was carried out to isolate As resistant endophytes from the roots of Indian ecotype Pteris vittata and characterize their As transformation and tolerance ability, plant growth promoting characteristics and their role to facilitate As uptake by the plant. A total of 8 root endophytes were isolated from plants grown in As amended soil (25 mg As kg(-1)). These isolates were studied for minimum inhibitory concentration (MIC), arsenite As(III) - arsenate As(V) transformation ability, plant growth promoting (PGP) characteristics through siderophore, indole acetic acid (IAA) production, phosphatase, ACC deaminase activity, and presence of arsenite oxidase (aox) and arsenite transporter (arsB) genes. On the basis of 16S rDNA sequence analysis, these isolates belong to Proteobacteria, Firmicutes and Bacteroidetes families under the genera Bacillus, Enterobacter, Stenotrophomonas and Rhizobium. All isolates were found As tolerant, of which one isolates showed highest tolerance up to 1000 mg L(-1) concentration in SLP medium. Five isolates were IAA positive with highest IAA production up to 60 mg/L and two isolates exhibited siderophore activity. Phosphatase activity was shown by only one isolate while ACC deaminase activity was absent in all the isolates. The As transformation study by silver nitrate test showed that only two strains had dual characteristics of As(III) oxidation and As (V) reduction, four strains exhibited either of the characteristics while other two didn't confirmed any of the two characteristics. Presence of aox gene was detected in two strains and arsB gene in six isolates. The strain with highest As tolerance also showed highest IAA production and occurrence of arsB gene. Present investigation may open up further scope of utilizing these endophytes for up gradation of phytoextraction process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Silibinin inhibits hypoxia-induced HIF-1α-mediated signaling, angiogenesis and lipogenesis in prostate cancer cells: In vitro evidence and in vivo functional imaging and metabolomics.

PubMed

Deep, Gagan; Kumar, Rahul; Nambiar, Dhanya K; Jain, Anil K; Ramteke, Anand M; Serkova, Natalie J; Agarwal, Chapla; Agarwal, Rajesh

2017-03-01

Hypoxia is associated with aggressive phenotype and poor prognosis in prostate cancer (PCa) patients suggesting that PCa growth and progression could be controlled via targeting hypoxia-induced signaling and biological effects. Here, we analyzed silibinin (a natural flavonoid) efficacy to target cell growth, angiogenesis, and metabolic changes in human PCa, LNCaP, and 22Rv1 cells under hypoxic condition. Silibinin treatment inhibited the proliferation, clonogenicity, and endothelial cells tube formation by hypoxic (1% O 2 ) PCa cells. Interestingly, hypoxia promoted a lipogenic phenotype in PCa cells via activating acetyl-Co A carboxylase (ACC) and fatty acid synthase (FASN) that was inhibited by silibinin treatment. Importantly, silibinin treatment strongly decreased hypoxia-induced HIF-1α expression in PCa cells together with a strong reduction in hypoxia-induced NADPH oxidase (NOX) activity. HIF-1α overexpression in LNCaP cells significantly increased the lipid accumulation and NOX activity; however, silibinin treatment reduced HIF-1α expression, lipid levels, clonogenicity, and NOX activity even in HIF-1α overexpressing LNCaP cells. In vivo, silibinin feeding (200 mg/kg body weight) to male nude mice with 22Rv1 tumors, specifically inhibited tumor vascularity (measured by dynamic contrast-enhanced MRI) resulting in tumor growth inhibition without directly inducing necrosis (as revealed by diffusion-weighted MRI). Silibinin feeding did not significantly affect tumor glucose uptake measured by FDG-PET; however, reduced the lipid synthesis measured by quantitative 1 H-NMR metabolomics. IHC analyses of tumor tissues confirmed that silibinin feeding decreased proliferation and angiogenesis as well as reduced HIF-1α, FASN, and ACC levels. Together, these findings further support silibinin usefulness against PCa through inhibiting hypoxia-induced signaling. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Evidence of MAOA genotype involvement in spatial ability in males

PubMed Central

Mueller, Sven C.; Cornwell, Brian R.; Grillon, Christian; MacIntyre, Jessica; Gorodetsky, Elena; Goldman, David; Pine, Daniel S.; Ernst, Monique

2014-01-01

Although the Monoamine Oxidase-A (MAOA) gene has been linked to spatial learning and memory in animal models, convincing evidence in humans is lacking. Performance on an ecologically-valid, virtual computer-based equivalent of the Morris Water Maze task was compared between 28 healthy males with the low MAOA transcriptional activity and 41 healthy age- and IQ-matched males with the high MAOA transcriptional activity. The results revealed consistently better performance (reduced heading error, shorter path length, and reduced failed trials) for the high MAOA activity individuals relative to the low activity individuals. By comparison, groups did not differ on pre-task variables or strategic measures such as first-move latency. The results provide novel evidence of MAOA gene involvement in human spatial navigation using a virtual analogue of the Morris Water Maze task. PMID:24671068

Neuropsychological correlates of transcription factor AP-2Beta, and its interaction with COMT and MAOA in healthy females.

PubMed

Schabram, Ina; Eggermann, Thomas; Siegel, Steven J; Gründer, Gerhard; Zerres, Klaus; Vernaleken, Ingo

2013-01-01

The transcription factor AP-2β has been shown to impact clinical and neuropsychological properties. Apparently, it regulates the transcription of genes that code for molecules which are part of the catecholaminergic transmission system. This investigation focuses on possible effects of the transcription factor AP-2β intron 2 polymorphism on cognitive performance parameters. This hypothesis-driven investigation examined the effects and interactions of the transcription factor AP-2β intron 2 polymorphism, the Val158Met catechol-O-methyltransferase (COMT) polymorphism, and the variable number of tandem repeat polymorphism of monoamine oxidase A (MAOA) on cognitive performance parameters within a group of 200 healthy women (age: mean ± SD, 23.93 ± 3.33 years). The AP-2β polymorphism significantly influenced cognitive performance (in particular, the Trail Making Test part B), whereas the MAOA and COMT polymorphisms did not. However, there was an interaction effect of the AP-2β × MAOA × COMT genotypes on the decision bias β of the degraded-stimulus version of the continuous performance task. Only the Val158Met COMT polymorphism showed an influence on personality questionnaires (openness and self-transcendence; NEO Five-Factor Inventory, Temperament and Character Inventory). The transcription factor AP-2β intron 2 polymorphism had more influence on cognition than the MAOA and COMT polymorphisms. Possibly, the AP-2β genotype might influence cognition through pathways other than those that regulate MAOA and COMT transcription. Interactions of transcription factor AP-2β, COMT, and MAOA polymorphisms suggest higher leverage effects of transcription factor AP-2β in subjects with high dopamine availability. Copyright © 2013 S. Karger AG, Basel.

The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation.

PubMed

Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A

2015-05-19

The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. © 2015 Authors.

enDNA-Prot: identification of DNA-binding proteins by applying ensemble learning.

PubMed

Xu, Ruifeng; Zhou, Jiyun; Liu, Bin; Yao, Lin; He, Yulan; Zou, Quan; Wang, Xiaolong

2014-01-01

DNA-binding proteins are crucial for various cellular processes, such as recognition of specific nucleotide, regulation of transcription, and regulation of gene expression. Developing an effective model for identifying DNA-binding proteins is an urgent research problem. Up to now, many methods have been proposed, but most of them focus on only one classifier and cannot make full use of the large number of negative samples to improve predicting performance. This study proposed a predictor called enDNA-Prot for DNA-binding protein identification by employing the ensemble learning technique. Experiential results showed that enDNA-Prot was comparable with DNA-Prot and outperformed DNAbinder and iDNA-Prot with performance improvement in the range of 3.97-9.52% in ACC and 0.08-0.19 in MCC. Furthermore, when the benchmark dataset was expanded with negative samples, the performance of enDNA-Prot outperformed the three existing methods by 2.83-16.63% in terms of ACC and 0.02-0.16 in terms of MCC. It indicated that enDNA-Prot is an effective method for DNA-binding protein identification and expanding training dataset with negative samples can improve its performance. For the convenience of the vast majority of experimental scientists, we developed a user-friendly web-server for enDNA-Prot which is freely accessible to the public.

The flower of Edgeworthia gardneri (wall.) Meisn. suppresses adipogenesis through modulation of the AMPK pathway in 3T3-L1 adipocytes.

PubMed

Gao, Die; Zhang, Yong-Lan; Yang, Feng-Qing; Li, Fan; Zhang, Qi-Hui; Xia, Zhi-Ning

2016-09-15

The flower of Edgeworthia gardneri (Wall.) Meisn., locally named "Lvluohua, ", has been widely used as Tibetan folk medicine for the treatment of metabolic diseases for a long time. To evaluate the anti-adipogenesis effect of ethyl acetate extract of the flower of E. gardneri (EEG extract) in 3T3-L1 adipocytes. Obesity-related parameters such as lipid accumulation and TG content were determined by Oil red O staining and enzymatic kit, respectively. Western blotting was used to determine the expressions of peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhancer-binding protein-α (C/EBPα), phosphorylated adenosine 5'-monophosphate (AMP)-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC). Moreover, main constituents of EEG extract were analyzed by high performance liquid chromatography (HPLC). EEG extract decreased the lipid and triglyceride (TG) accumulations during the differentiation process and down-regulated the adipogenesis-related transcriptional factors PPARγ and C/EBPα. EEG extract treatment increased AMPK and ACC phosphorylation. In addition, pretreatment with AMPK inhibitor, weakened the inhibitory effects of EEG extract on the expressions of PPARγand C/EBPα. HPLC analysis indicated that tiliroside was the main constituent in EEG extract. These results suggest that EEG extract may exert anti-adipogenic effects through modulation of the AMPK signaling pathway. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

24 CFR 964.7 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Contributions Contract (ACC). A contract (in the form prescribed by HUD) under which HUD agrees to provide... activities for which the HA is responsible to HUD under the ACC, within the definition of “operation” under the Act and the ACC, including the development of resident programs and services. Management contract...

24 CFR 881.208 - Financing.

Code of Federal Regulations, 2011 CFR

2011-04-01

... any party than are provided under the Agreement, Contract, and/or ACC. Where the project is financed... pledge, or offer as security for any loan or obligation, an Agreement, Contract or ACC entered into... pursuant to this part and approved by HUD. Any pledge of the Agreement, Contract, or ACC, or payments...

24 CFR 970.3 - Applicability.

Code of Federal Regulations, 2010 CFR

2010-04-01

... subject to annual contributions contracts (ACCs) under the Act. (b) This part does not apply to the... dwelling units under ACC); (3) The conveyance of public housing for the purpose of providing homeownership... incidental to the normal operation of the project for public housing purposes, as permitted by the ACC; (5...

24 CFR 904.101 - Introduction.

Code of Federal Regulations, 2011 CFR

2011-04-01

... operated as Turnkey III, the Annual Contributions Contract (ACC) shall contain the “Special Provisions for... III developments pursuant to an executed ACC where no Agreements with Homebuyers have been signed, the ACC shall be amended (i) to include the “Special Provisions” set forth in Appendix I, (ii) to extend...

24 CFR 970.3 - Applicability.

Code of Federal Regulations, 2011 CFR

2011-04-01

... subject to annual contributions contracts (ACCs) under the Act. (b) This part does not apply to the... dwelling units under ACC); (3) The conveyance of public housing for the purpose of providing homeownership... incidental to the normal operation of the project for public housing purposes, as permitted by the ACC; (5...

Motivation of extended behaviors by anterior cingulate cortex.

PubMed

Holroyd, Clay B; Yeung, Nick

2012-02-01

Intense research interest over the past decade has yielded diverse and often discrepant theories about the function of anterior cingulate cortex (ACC). In particular, a dichotomy has emerged between neuropsychological theories suggesting a primary role for ACC in motivating or 'energizing' behavior, and neuroimaging-inspired theories emphasizing its contribution to cognitive control and reinforcement learning. To reconcile these views, we propose that ACC supports the selection and maintenance of 'options' - extended, context-specific sequences of behavior directed toward particular goals - that are learned through a process of hierarchical reinforcement learning. This theory accounts for ACC activity in relation to learning and control while simultaneously explaining the effects of ACC damage as disrupting the motivational context supporting the production of goal-directed action sequences. Copyright © 2011 Elsevier Ltd. All rights reserved.

Surgical management and clinical prognosis of adrenocortical carcinoma.

PubMed

Dong, Dexin; Li, Hanzhong; Yan, Weigang; Ji, Zhigang; Mao, Quanzong

2012-01-01

To study the relationship between surgical management and prognosis of adrenocortical carcinoma (ACC) in order to guide the surgical management of ACC. Clinical data of 45 cases of ACC treated in our hospital were retrospectively analyzed. The 45 cases included 3 cases in stage I, 12 cases in stage II, 7 cases in stage III, and 23 cases in stage IV. 17 cases underwent complete excision, 14 cases underwent palliative excision, 8 cases had non-operative treatment and 6 cases gave up treatment. All patients were followed up from 2 to 141 months. The average survival time of 31 patients with surgery was 32.46 months, and the average survival time of 14 patients without surgery was 4.75 months. There were statistically significant differences between the two groups (p < 0.01). There were no statistically significant differences between the two groups in survival time in stage III and stage IV (p > 0.05). Surgery is considered to be the only method to cure ACC. For ACC in stage I and II, tumor resection is the most effective treatment, and second surgical operation is recommended for local recurrence. For ACC in stage III, extensive surgical operation is recommended, and for ACC in stage IV, surgical operation has no effect on the prognosis. Copyright © 2012 S. Karger AG, Basel.

A meta-analysis of the anterior cingulate contribution to social pain

PubMed Central

Lemogne, Cedric; Hinfray, Sophie; Huguet, Pascal; Grynszpan, Ouriel; Tartour, Eric; George, Nathalie; Fossati, Philippe

2015-01-01

Many functional magnetic resonance imaging studies have explored the neural correlates of social pain that results from social threat, exclusion, rejection, loss or negative evaluation. Although activations have consistently been reported within the anterior cingulate cortex (ACC), it remains unclear which ACC subdivision is particularly involved. To provide a quantitative estimation of the specific involvement of ACC subdivisions in social pain, we conducted a voxel-based meta-analysis. The literature search identified 46 articles that included 940 subjects, the majority of which used the cyberball task. Significant likelihoods of activation were found in both the ventral and dorsal ACC for both social pain elicitation and self-reported distress during social pain. Self-reported distress involved more specifically the subgenual and pregenual ACC than social pain-related contrasts. The cyberball task involved the anterior midcingulate cortex to a lesser extent than other experimental tasks. During social pain, children exhibited subgenual activations to a greater extent than adults. Finally, the ventro-dorsal gradient of ACC activations in cyberball studies was related to the length of exclusion phases. The present meta-analysis contributes to a better understanding of the role of ACC subdivisions in social pain, and it could be of particular importance for guiding future studies of social pain and its neural underpinnings. PMID:25140048

ATP-stabilized amorphous calcium carbonate nanospheres and their application in protein adsorption.

PubMed

Qi, Chao; Zhu, Ying-Jie; Lu, Bing-Qiang; Zhao, Xin-Yu; Zhao, Jing; Chen, Feng; Wu, Jin

2014-05-28

Calcium carbonate is a common substance found in rocks worldwide, and is the main biomineral formed in shells of marine organisms and snails, pearls and eggshells. Amorphous calcium carbonate (ACC) is the least stable polymorph of calcium carbonate, which is so unstable under normal conditions that it is difficult to be prepared in vitro because it rapidly crystallizes to form one of the more stable polymorphs in aqueous solution. Herein, we report the successful synthesis of highly stable ACC nanospheres in vitro using adenosine 5'-triphosphate disodium salt (ATP) as a stabilizer. The effect of ATP on the stability of ACC nanospheres is investigated. Our experiments show that ATP plays an unique role in the stabilization of ACC nanospheres in aqueous solution. Moreover, the as-prepared ACC nanospheres are highly stable in phosphate buffered saline for a relatively long period of time (12 days) even under relatively high concentrations of calcium and phosphate ions. The cytotoxicity tests show that the as-prepared highly stable ACC nanospheres have excellent biocompatibility. The highly stable ACC nanospheres have high protein adsorption capacity, implying that they are promising for applications in biomedical fields such as drug delivery and protein adsorption. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Depression in chronic ketamine users: Sex differences and neural bases.

PubMed

Li, Chiang-Shan R; Zhang, Sheng; Hung, Chia-Chun; Chen, Chun-Ming; Duann, Jeng-Ren; Lin, Ching-Po; Lee, Tony Szu-Hsien

2017-11-30

Chronic ketamine use leads to cognitive and affective deficits including depression. Here, we examined sex differences and neural bases of depression in chronic ketamine users. Compared to non-drug using healthy controls (HC), ketamine-using females but not males showed increased depression score as assessed by the Center of Epidemiological Studies Depression Scale (CES-D). We evaluated resting state functional connectivity (rsFC) of the subgenual anterior cingulate cortex (sgACC), a prefrontal structure consistently implicated in the pathogenesis of depression. Compared to HC, ketamine users (KU) did not demonstrate significant changes in sgACC connectivities at a corrected threshold. However, in KU, a linear regression against CES-D score showed less sgACC connectivity to the orbitofrontal cortex (OFC) with increasing depression severity. Examined separately, male and female KU showed higher sgACC connectivity to bilateral superior temporal gyrus and dorsomedial prefrontal cortex (dmPFC), respectively, in correlation with depression. The linear correlation of sgACC-OFC and sgACC-dmPFC connectivity with depression was significantly different in slope between KU and HC. These findings highlighted changes in rsFC of the sgACC as associated with depression and sex differences in these changes in chronic ketamine users. Copyright © 2017 Elsevier B.V. All rights reserved.

Asian Care Certificate (ACC): a care quality assurance framework.

PubMed

Talaie, Tony

2018-04-16

Purpose Quality assuring elderly care through a viable and feasible standard framework is a major challenge for Asian governments. Although several attempts have been made to tackle foreign care worker (FCW) shortage, assuring the quality of the care they provide has been overlooked. The original framework allowed a better control over service quality to assure the elderly about their care according to the agreed standards. The paper aims to discuss these issues. Design/methodology/approach Through several Japanese Governmental meetings, a new Asian Care Certificate (ACC) program is discussed based on the Japanese Care Certificate (JCC). The governments' representatives adopted the JCC to form the ACC, which enables the ACC board to evaluate care workers and to intervene whenever the desired quality level is not achieved. Findings The author describes a new program. The findings of this paper will be confirmed when the ACC is implemented. Practical implications Using the ACC framework, the challenge in providing a high-quality care service using FCWs across Asia would be partly resolved. FCWs' quality of life might also gradually improve especially regarding to their human rights. Originality/value The ACC provides a new framework. Its value is recognized if one considers that many Asian populations are rapidly aging and many governments compromise quality by employing overseas workers to solve care worker shortages.

Competition between learned reward and error outcome predictions in anterior cingulate cortex.

PubMed

Alexander, William H; Brown, Joshua W

2010-02-15

The anterior cingulate cortex (ACC) is implicated in performance monitoring and cognitive control. Non-human primate studies of ACC show prominent reward signals, but these are elusive in human studies, which instead show mainly conflict and error effects. Here we demonstrate distinct appetitive and aversive activity in human ACC. The error likelihood hypothesis suggests that ACC activity increases in proportion to the likelihood of an error, and ACC is also sensitive to the consequence magnitude of the predicted error. Previous work further showed that error likelihood effects reach a ceiling as the potential consequences of an error increase, possibly due to reductions in the average reward. We explored this issue by independently manipulating reward magnitude of task responses and error likelihood while controlling for potential error consequences in an Incentive Change Signal Task. The fMRI results ruled out a modulatory effect of expected reward on error likelihood effects in favor of a competition effect between expected reward and error likelihood. Dynamic causal modeling showed that error likelihood and expected reward signals are intrinsic to the ACC rather than received from elsewhere. These findings agree with interpretations of ACC activity as signaling both perceptions of risk and predicted reward. Copyright 2009 Elsevier Inc. All rights reserved.

Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

PubMed

Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

2013-09-01

It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

Involvement of NADPH oxidases in alkali burn-induced corneal injury.

PubMed

Gu, Xue-Jun; Liu, Xian; Chen, Ying-Ying; Zhao, Yao; Xu, Man; Han, Xiao-Jian; Liu, Qiu-Ping; Yi, Jing-Lin; Li, Jing-Ming

2016-07-01

Chemical burns are a major cause of corneal injury. Oxidative stress, inflammatory responses and neovascularization after the chemical burn aggravate corneal damage, and lead to loss of vision. Although NADPH oxidases (Noxs) play a crucial role in the production of reactive oxygen species (ROS), the role of Noxs in chemical burn-induced corneal injury remains to be elucidated. In the present study, the transcription and expression of Noxs in corneas were examined by RT-qPCR, western blot analysis and immunofluorescence staining. It was found that alkali burns markedly upregulated the transcription and expression of Nox2 and Nox4 in human or mouse corneas. The inhibition of Noxs by diphenyleneiodonium (DPI) or apocynin (Apo) effectively attenuated alkali burn-induced ROS production and decreased 3-nitrotyrosine (3-NT) protein levels in the corneas. In addition, Noxs/CD11b double‑immunofluorescence staining indicated that Nox2 and Nox4 were partially co-localized with CD11b. DPI or Apo prevented the infiltration of CD11b-positive inflammatory cells, and inhibited the transcription of inflammatory cytokines following alkali burn-induced corneal injury. In our mouse model of alkali burn-induced corneal injury, corneal neovascularization (CNV) occurred on day 3, and it affected 50% of the whole area of the cornea on day 7, and on day 14, CNV coverage of the cornea reached maximum levels. DPI or Apo effectively attenuated alkali burn‑induced CNV and decreased the mRNA levels of angiogenic factors, including vascular endothelial growth factor (VEGF), VEGF receptors and matrix metalloproteinases (MMPs). Taken together, our data indicate that Noxs play a role in alkali burn-induced corneal injury by regulating oxidative stress, inflammatory responses and CNV, and we thus suggest that Noxs are a potential therapeutic target in the future treatment of chemical-induced corneal injury.

In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

PubMed

Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

2013-12-01

The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

Applicability of the 2013 ACC/AHA Risk Assessment and Cholesterol Treatment Guidelines in the real world: results from a multiethnic case-control study.

PubMed

Magnoni, Marco; Berteotti, Martina; Norata, Giuseppe Danilo; Limite, Luca Rosario; Peretto, Giovanni; Cristell, Nicole; Maseri, Attilio; Cianflone, Domenico

2016-01-01

The 2013 ACC/AHA cholesterol treatment guidelines have introduced a new cardiovascular risk assessment approach (PCE) and have revisited the threshold for prescribing statins. This study aims to compare the ex ante application of the ACC/AHA and the ATP-III guideline models by using a multiethnic case-control study. ATP-III-FRS and PCE were assessed in 739 patients with first STEMI and 739 age- and gender-matched controls; the proportion of cases and controls that would have been eligible for statin as primary prevention therapy and the discriminatory ability of both models were evaluated. The application of the ACC/AHA compared to the ATP-III model, resulted in an increase in sensitivity [94% (95%CI: 91%-95%) vs. 65% (61%-68%), p< 0.0001], a reduction in specificity [19% (15%-22%) vs. 55% (51%-59%), p< 0.0001] with similar global accuracy [0.56 (0.53-0.59) vs.0.59 (0.57-0.63), p ns]. When stratifying for ethnicity, the accuracy of the ACC/AHA model was higher in Europeans than in Chinese (p = 0.003) and to identified premature STEMI patients within Europeans much better compared to the ATP-III model (p = 0.0289). The application of the ACC/AHA model resulted in a significant reduction of first STEMI patients who would have escaped from preventive treatment. Age and ethnicity affected the accuracy of the ACC/AHA model improving the identification of premature STEMI among Europeans only. Key messages According to the ATP-III guideline model, about one-third of patients with STEMI would not be eligible for primary preventive treatment before STEMI. The application of the new ACC/AHA cholesterol treatment guideline model leads to a significant reduction of the percentage of patients with STEMI who would have been considered at lower risk before the STEMI. The global accuracy of the new ACC/AHA model is higher in the Europeans than in the Chinese and, moreover, among the Europeans, the application of the new ACC/AHA guideline model also improved identification of premature STEMI patients.

Trust in smart systems: sharing driving goals and giving information to increase trustworthiness and acceptability of smart systems in cars.

PubMed

Verberne, Frank M F; Ham, Jaap; Midden, Cees J H

2012-10-01

We examine whether trust in smart systems is generated analogously to trust in humans and whether the automation level of smart systems affects trustworthiness and acceptability of those systems. Trust is an important factor when considering acceptability of automation technology. As shared goals lead to social trust, and intelligent machines tend to be treated like humans, the authors expected that shared driving goals would also lead to increased trustworthiness and acceptability of adaptive cruise control (ACC) systems. In an experiment, participants (N = 57) were presented with descriptions of three ACCs with different automation levels that were described as systems that either shared their driving goals or did not. Trustworthiness and acceptability of all the ACCs were measured. ACCs sharing the driving goals of the user were more trustworthy and acceptable than were ACCs not sharing the driving goals of the user. Furthermore, ACCs that took over driving tasks while providing information were more trustworthy and acceptable than were ACCs that took over driving tasks without providing information. Trustworthiness mediated the effects of both driving goals and automation level on acceptability of ACCs. As when trusting other humans, trusting smart systems depends on those systems sharing the user's goals. Furthermore, based on their description, smart systems that take over tasks are judged more trustworthy and acceptable when they also provide information. For optimal acceptability of smart systems, goals of the user should be shared by the smart systems, and smart systems should provide information to their user.

Amorphous calcium carbonate associated with biofilms in hot spring deposits

NASA Astrophysics Data System (ADS)

Jones, Brian; Peng, Xiaotong

2012-08-01

Calcium carbonate nanoparticles are intimately associated with crystalline calcite and aragonite in the Eryuan, Gongxiaoshe, and Zhuyuan hot springs (water temperature > 75 °C), which are located in Yunnan Province, China. The nanoparticles, < 1 μm long, are spherical to disc-shaped and commonly fuse together into small clusters. Their general appearance and lack of crystal faces or edges indicate that they are noncrystalline. Morphologically, these nanoparticles are similar to calcified nannobacteria or the constituent grains in amorphous calcium carbonate (ACC), which can be formed by various biogenic and abiogenic processes. In the Chinese hot springs, the ACC is always found under, in, or on top of biofilms, commonly in close proximity to crystalline calcite and/or aragonite. Textural evidence indicates that the ACC probably developed in microdomains that develop in the complex biofilm hydrogels. Critically, there is no evidence to support the notion that the nanoparticles are calcified nannobacteria. In the Chinese springs, ACC appears to play a formative role in the development of wheat-sheaf arrays of aragonite crystals and some of the calcite crystals. Hollow cores in some of the aragonite bundles probably formed as ACC was dissolved and many of the aragonite crystals appear to have developed as ACC recrystallized. Similarly, layers of ACC that coat the surfaces of some calcite crystals could be diagenetically transformed into calcite. The development of ACC in hot spring systems may be widespread and may play a critical but transitory role in the development of crystalline CaCO3 in these high temperature environments.

Frontal Hyperconnectivity Related to Discounting and Reversal Learning in Cocaine Subjects

PubMed Central

Camchong, Jazmin; MacDonald, Angus W; Nelson, Brent; Bell, Christopher; Mueller, Bryon A; Specker, Sheila; Lim, Kelvin O

2011-01-01

BACKGROUND Functional neuroimaging studies suggest that chronic cocaine use is associated with frontal lobe abnormalities. Functional connectivity (FC) alterations of cocaine dependent individuals (CD), however, are not yet clear. This is the first study to our knowledge that examines resting FC of anterior cingulate cortex (ACC) in CD. Because ACC is known to integrate inputs from different brain regions to regulate behavior, we hypothesize that CD will have connectivity abnormalities in ACC networks. In addition, we hypothesized that abnormalities would be associated with poor performance in delayed discounting and reversal learning tasks. METHODS Resting functional magnetic resonance imaging data were collected to look for FC differences between twenty-seven cocaine dependent individuals (CD) (5 females, age: M=39.73, SD=6.14) and twenty-four controls (5 females, age: M=39.76, SD = 7.09). Participants were assessed with delayed discounting and reversal learning tasks. Using seed-based FC measures, we examined FC in CD and controls within five ACC connectivity networks with seeds in subgenual, caudal, dorsal, rostral, and perigenual ACC. RESULTS CD showed increased FC within the perigenual ACC network in left middle frontal gyrus, ACC and middle temporal gyrus when compared to controls. FC abnormalities were significantly positively correlated with task performance in delayed discounting and reversal learning tasks in CD. CONCLUSIONS The present study shows that participants with chronic cocaine-dependency have hyperconnectivity within an ACC network known to be involved in social processing and mentalizing. In addition, FC abnormalities found in CD were associated with difficulties with delay rewards and slower adaptive learning. PMID:21371689

Anterior cingulate cortex supports effort allocation towards a qualitatively preferred option.

PubMed

Hart, Evan E; Gerson, Julian O; Zoken, Yael; Garcia, Marisella; Izquierdo, Alicia

2017-07-01

The anterior cingulate cortex (ACC) is known to be involved in effortful choice, yet its role in cost-benefit evaluation of qualitatively different rewards (more/less preferred), beyond magnitude differences (larger/smaller), is poorly understood. Selecting between qualitatively different options is a decision type commonly faced by humans. Here, we assessed the role of ACC on a task that has primarily been used to probe striatal function in motivation. Rats were trained to stable performance on a progressive ratio schedule for sucrose pellets and were then given sham surgeries (control) or excitotoxic NMDA lesions of ACC. Subsequently, a choice was introduced: chow was concurrently available while animals could work for the preferred sucrose pellets. ACC lesions produced a significant decrease in lever presses for sucrose pellets compared to control, whereas chow consumption was unaffected. Lesions had no effect on sucrose pellet preference when both options were freely available. When laboratory chow was not concurrently available, ACC-lesioned rats exhibited similar lever pressing as controls. During a test under specific satiety for sucrose pellets, ACC-lesioned rats also showed intact devaluation effects. The effects of ACC lesions in our task are not mediated by decreased appetite, a change in food preference, a failure to update value or a learning deficit. Taken together, we found that ACC lesions decreased effort for a qualitatively preferred option. These results are discussed with reference to effects of striatal manipulations and our recent report of a role for basolateral amygdala in effortful choice. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Alleviating neuropathic pain mechanical allodynia by increasing Cdh1 in the anterior cingulate cortex.

PubMed

Tan, Wei; Yao, Wen-Long; Hu, Rong; Lv, You-You; Wan, Li; Zhang, Chuan-Han; Zhu, Chang

2015-09-12

Plastic changes in the anterior cingulate cortex (ACC) are critical in the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Cdh1, a co-activator subunit of anaphase-promoting complex/cyclosome (APC/C) regulates synaptic differentiation and transmission. Based on this, we hypothesised that the APC/C-Cdh1 played an important role in long-term plastic changes induced by neuropathic pain in ACC. We employed spared nerve injury (SNI) model in rat and found Cdh1 protein level in the ACC was down-regulated 3, 7 and 14 days after SNI surgery. We detected increase in c-Fos expression, numerical increase of organelles, swollen myelinated fibre and axon collapse of neuronal cells in the ACC of SNI rat. Additionally, AMPA receptor GluR1 subunit protein level was up-regulated on the membrane through a pathway that involves EphA4 mediated by APC/C-Cdh1, 3 and 7 days after SNI surgery. To confirm the effect of Cdh1 in neuropathic pain, Cdh1-expressing lentivirus was injected into the ACC of SNI rat. Intra-ACC treatment with Cdh1-expressing lentivirus vectors elevated Cdh1 levels, erased synaptic strengthening, as well as alleviating established mechanical allodynia in SNI rats. We also found Cdh1-expressing lentivirus normalised SNI-induced redistribution of AMPA receptor GluR1 subunit in ACC by regulating AMPA receptor trafficking. These results provide evidence that Cdh1 in ACC synapses may offer a novel therapeutic strategy for treating chronic neuropathic pain.

Are general practice characteristics predictors of good glycaemic control in patients with diabetes? A cross-sectional study.

PubMed

Esterman, Adrian J; Fountaine, Tim; McDermott, Robyn

2016-01-18

To determine whether certain characteristics of general practices are associated with good glycaemic control in patients with diabetes and with completing an annual cycle of care (ACC). Our cross-sectional analysis used baseline data from the Australian Diabetes Care Project conducted between 2011 and 2014. Practice characteristics were self-reported. Characteristics of the patients that were assessed included glycaemic control (HbA1c level ≤ 53 mmol/mol), age, sex, duration of diabetes, socio-economic disadvantage (SEIFA) score, the complexity of the patient's condition, and whether the patient had completed an ACC for diabetes in the past 18 months. Clustered logistic regression was used to establish predictors of glycaemic control and a completed ACC. Data were available from 147 general practices and 5455 patients with established type 1 or type 2 diabetes in three Australian states. After adjustment for other patient characteristics, only the patient completing an ACC was statistically significant as a predictor of glycaemic control (P = 0.011). In a multivariate model, the practice having a chronic disease-focused practice nurse (P = 0.036) and running educational events for patients with diabetes (P = 0.004) were statistically significant predictors of the patient having complete an ACC. Patient characteristics are moderately good predictors of whether the patient is in glycaemic control, whereas practice characteristics appear to predict only the likelihood of patients completing an ACC. The ACC is an established indicator of good diabetes management. This is the first study to report a positive association between having completed an ACC and the patient being in glycaemic control.

Rostral anterior cingulate cortex volume correlates with depressed mood in normal healthy children

PubMed Central

Boes, Aaron D.; McCormick, Laurie M.; Coryell, William H.; Nopoulos, Peg

2008-01-01

BACKGROUND The rostral anterior cingulate cortex (rACC) has been implicated as a structural neural correlate of familial major depressive disorder, raising the possibility that the structure of this region may act as a biologic marker of depression vulnerability. The aim of the current study was to determine whether children and adolescents with depressive symptoms have lower rACC volume relative to those without symptoms and examine how a positive family history of depression affects this relationship. METHODS 112 normal healthy children (59 boys, 53 girls), age 7–17, without a current diagnosis or history of depression or other psychiatric illness, were recruited from the community. Mood symptoms were collected using the Pediatric Behavior Scale, a parent- and teacher-reported questionnaire. Volumetric measures of the rACC were generated using structural MRI. The relationship of depressive symptoms and rACC volume was examined. RESULTS 1) The rACC volume was significantly lower in boys with subclinical depressive symptoms compared to boys with no depressive symptoms, particularly on the left side (14.6% reduction; F = 8.90, p = .005). 2) In comparing the correlation of depressive symptoms and rACC volume in boys with a positive family history of depression to those with no family history there was a more robust negative correlation in subjects with a positive family history. 3) In girls there was not a significant association of depressive symptoms and rACC volume. CONCLUSIONS These findings lend further support to the notion that rACC structure may act as a biologic marker of vulnerability or trait-marker of depression. PMID:17916329

Neural Processing of Emotional Musical and Nonmusical Stimuli in Depression

PubMed Central

Atchley, Ruth Ann; Chrysikou, Evangelia; Martin, Laura E.; Clair, Alicia A.; Ingram, Rick E.; Simmons, W. Kyle; Savage, Cary R.

2016-01-01

Background Anterior cingulate cortex (ACC) and striatum are part of the emotional neural circuitry implicated in major depressive disorder (MDD). Music is often used for emotion regulation, and pleasurable music listening activates the dopaminergic system in the brain, including the ACC. The present study uses functional MRI (fMRI) and an emotional nonmusical and musical stimuli paradigm to examine how neural processing of emotionally provocative auditory stimuli is altered within the ACC and striatum in depression. Method Nineteen MDD and 20 never-depressed (ND) control participants listened to standardized positive and negative emotional musical and nonmusical stimuli during fMRI scanning and gave subjective ratings of valence and arousal following scanning. Results ND participants exhibited greater activation to positive versus negative stimuli in ventral ACC. When compared with ND participants, MDD participants showed a different pattern of activation in ACC. In the rostral part of the ACC, ND participants showed greater activation for positive information, while MDD participants showed greater activation to negative information. In dorsal ACC, the pattern of activation distinguished between the types of stimuli, with ND participants showing greater activation to music compared to nonmusical stimuli, while MDD participants showed greater activation to nonmusical stimuli, with the greatest response to negative nonmusical stimuli. No group differences were found in striatum. Conclusions These results suggest that people with depression may process emotional auditory stimuli differently based on both the type of stimulation and the emotional content of that stimulation. This raises the possibility that music may be useful in retraining ACC function, potentially leading to more effective and targeted treatments. PMID:27284693

Clinical and molecular insights into adenoid cystic carcinoma: Neural crest‐like stemness as a target

PubMed Central

Panaccione, Alexander; Chang, Michael T.; Ivanov, Sergey V.

2016-01-01

Objectives This review surveys trialed therapies and molecular defects in adenoid cystic carcinoma (ACC), with an emphasis on neural crest‐like stemness characteristics of newly discovered cancer stem cells (CSCs) and therapies that may target these CSCs. Data Sources Articles available on Pubmed or OVID MEDLINE databases and unpublished data. Review Methods Systematic review of articles pertaining to ACC and neural crest‐like stem cells. Results Adenoid cystic carcinoma of the salivary gland is a slowly growing but relentless cancer that is prone to nerve invasion and metastases. A lack of understanding of molecular etiology and absence of targetable drivers has limited therapy for patients with ACC to surgery and radiation. Currently, no curative treatments are available for patients with metastatic disease, which highlights the need for effective new therapies. Research in this area has been inhibited by the lack of validated cell lines and a paucity of clinically useful markers. The ACC research environment has recently improved, thanks to the introduction of novel tools, technologies, approaches, and models. Improved understanding of ACC suggests that neural crest‐like stemness is a major target in this rare tumor. New cell culture techniques and patient‐derived xenografts provide tools for preclinical testing. Conclusion Preclinical research has not identified effective targets in ACC, as confirmed by the large number of failed clinical trials. New molecular data suggest that drivers of neural crest‐like stemness may be required for maintenance of ACC; as such, CSCs are a target for therapy of ACC. PMID:28894804

Evidence against translational repression by the carboxyltransferase component of Escherichia coli acetyl coenzyme A carboxylase.

PubMed

Smith, Alexander C; Cronan, John E

2014-11-01

In Escherichia coli, synthesis of the malonyl coenzyme A (malonyl-CoA) required for membrane lipid synthesis is catalyzed by acetyl-CoA carboxylase, a large complex composed of four subunits. The subunit proteins are needed in a defined stoichiometry, and it remains unclear how such production is achieved since the proteins are encoded at three different loci. Meades and coworkers (G. Meades, Jr., B. K. Benson, A. Grove, and G. L. Waldrop, Nucleic Acids Res. 38:1217-1227, 2010, doi:http://dx.doi.org/10.1093/nar/gkp1079) reported that coordinated production of the AccA and AccD subunits is due to a translational repression mechanism exerted by the proteins themselves. The AccA and AccD subunits form the carboxyltransferase (CT) heterotetramer that catalyzes the second partial reaction of acetyl-CoA carboxylase. Meades et al. reported that CT tetramers bind the central portions of the accA and accD mRNAs and block their translation in vitro. However, long mRNA molecules (500 to 600 bases) were required for CT binding, but such long mRNA molecules devoid of ribosomes seemed unlikely to exist in vivo. This, plus problematical aspects of the data reported by Meades and coworkers, led us to perform in vivo experiments to test CT tetramer-mediated translational repression of the accA and accD mRNAs. We report that increased levels of CT tetramer have no detectable effect on translation of the CT subunit mRNAs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Evidence against Translational Repression by the Carboxyltransferase Component of Escherichia coli Acetyl Coenzyme A Carboxylase

PubMed Central

Smith, Alexander C.

2014-01-01

In Escherichia coli, synthesis of the malonyl coenzyme A (malonyl-CoA) required for membrane lipid synthesis is catalyzed by acetyl-CoA carboxylase, a large complex composed of four subunits. The subunit proteins are needed in a defined stoichiometry, and it remains unclear how such production is achieved since the proteins are encoded at three different loci. Meades and coworkers (G. Meades, Jr., B. K. Benson, A. Grove, and G. L. Waldrop, Nucleic Acids Res. 38:1217–1227, 2010, doi:http://dx.doi.org/10.1093/nar/gkp1079) reported that coordinated production of the AccA and AccD subunits is due to a translational repression mechanism exerted by the proteins themselves. The AccA and AccD subunits form the carboxyltransferase (CT) heterotetramer that catalyzes the second partial reaction of acetyl-CoA carboxylase. Meades et al. reported that CT tetramers bind the central portions of the accA and accD mRNAs and block their translation in vitro. However, long mRNA molecules (500 to 600 bases) were required for CT binding, but such long mRNA molecules devoid of ribosomes seemed unlikely to exist in vivo. This, plus problematical aspects of the data reported by Meades and coworkers, led us to perform in vivo experiments to test CT tetramer-mediated translational repression of the accA and accD mRNAs. We report that increased levels of CT tetramer have no detectable effect on translation of the CT subunit mRNAs. PMID:25157077